A method for using Japanese knotweed leaf extract as an active ingredient in a moisturizing and / or barrier function improving agent, a β-glucocerebrosidase expression promoter, a sphingoemilase expression promoter, a filaggrin expression promoter, a transglutaminase-1 expression promoter, an epidermal hyaluronic acid synthase expression promoter, a composition for improving moisturizing and / or barrier function, and a method for using Japanese knotweed leaf extract as an active ingredient.

Abstract

This invention provides novel moisturizing and / or barrier function improving agents, β-glucocerebrosidase expression promoters, sphingoeminase expression promoters, filaggrin expression promoters, transglutaminase-1 expression promoters, epidermal hyaluronic acid synthase expression promoters, and compositions for improving moisturizing and / or barrier function, all of which contain Japanese knotweed leaf extract as an active ingredient, as well as methods for using Japanese knotweed leaf extract as an active ingredient to improve the moisturizing and / or barrier function of the skin. [Solution] The moisturizing and / or barrier function improving agent contains knotweed leaf extract as an active ingredient.

Description

[Technical Field]

[0001] The present invention relates to a moisturizing function and / or barrier function improving agent, a β-glucocerebrosidase expression promoter, a sphingomyelinase expression promoter, a filaggrin expression promoter, a transglutaminase-1 expression promoter, an epidermal hyaluronic acid synthase expression promoter, a composition for improving moisturizing function and / or barrier function, and a method of using a Japanese knotweed leaf extract as an active ingredient. [Background Art]

[0002] Giant knotweed (Reynoutria sachalinense) is a dioecious plant of the genus Reynoutria in the Polygonaceae family that grows wild from central Honshu northward to Hokkaido, Japan. Since ancient times, the rhizome of giant knotweed has been used as the crude drug "Ko-jō-kon" (Hu Zhang Root) which exhibits analgesic effects, and in recent years, whitening cosmetics containing an extract component from the root, leaf, or whole plant of giant knotweed (Patent Document 1) and agents for preventing and improving skin aging symptoms (Patent Document 2) have been reported. In addition, an external skin composition containing a Japanese knotweed leaf extract, which is useful for atopic dermatitis and the like, has been reported (Patent Document 3).

[0003] The stratum corneum of the skin suppresses the transpiration of water from the body and has a barrier function that prevents irritation from the external environment. It is known that when the skin barrier function is impaired by ultraviolet rays, surfactants, dryness, mechanical irritation, reactive oxygen species, residual chlorine in tap water, etc., it induces dry skin, atopic dermatitis, rough skin and the like. [Prior Art Literature] [Patent Literature]

[0004] [Patent Document 1] Japanese Unexamined Patent Publication No. 10-120546 [Patent Document 2] Japanese Unexamined Patent Publication No. 2000-319189 [Patent Document 3] Japanese Unexamined Patent Publication No. 2012-97049 [Summary of the Invention] [Problems that the invention aims to solve]

[0005] The number of patients with atopic dermatitis is increasing year by year, and since skin disorders such as dry skin and rough skin can be triggered at any age, there has been a need for the development of new skin moisturizing and barrier function improving agents.

[0006] The present invention has been made in view of the above circumstances, and aims to provide a novel moisturizing and / or barrier function improving agent, β-glucocerebrosidase expression promoter, sphingoemilase expression promoter, filaggrin expression promoter, transglutaminase-1 expression promoter, epidermal hyaluronic acid synthase expression promoter, and composition for improving moisturizing and / or barrier function, all of which contain Japanese knotweed leaf extract as an active ingredient, as well as a method for using Japanese knotweed leaf extract as an active ingredient to improve the moisturizing and / or barrier function of the skin. [Means for solving the problem]

[0007] To achieve the above objectives, the moisturizing and / or barrier function improving agent according to the first aspect of the present invention is: It contains knotweed leaf extract as its active ingredient.

[0008] For example, it improves the moisturizing and / or barrier function of the scalp.

[0009] A β-glucocerebrosidase expression promoter according to a second aspect of the present invention is: It contains knotweed leaf extract as its active ingredient.

[0010] For example, it promotes β-glucocerebrosidase expression in skin keratinocytes.

[0011] A sphingoeminase expression promoter according to the third aspect of the present invention is: It contains knotweed leaf extract as its active ingredient.

[0012] For example, it promotes sphingoeminase expression in skin keratinocytes.

[0013] A filaggrin expression promoter according to a fourth aspect of the present invention is comprising a Japanese knotweed leaf extract as an active ingredient.

[0014] For example, it promotes filaggrin expression in skin keratinocytes.

[0015] A transglutaminase-1 expression promoter according to a fifth aspect of the present invention is comprising a Japanese knotweed leaf extract as an active ingredient.

[0016] For example, it promotes transglutaminase-1 expression in skin keratinocytes.

[0017] An epidermal hyaluronan synthase expression promoter according to a sixth aspect of the present invention is comprising a Japanese knotweed leaf extract as an active ingredient.

[0018] For example, it promotes epidermal hyaluronan synthase expression in skin keratinocytes.

[0019] A composition for improving a moisturizing function and / or barrier function according to a seventh aspect of the present invention is for promoting expression of at least one selected from the group consisting of β-glucocerebrosidase, sphingomyelinase, filaggrin, transglutaminase-1, and epidermal hyaluronan synthase in skin keratinocytes, comprising a Japanese knotweed leaf extract as an active ingredient.

[0020] A method of use as an active ingredient of a Japanese knotweed leaf extract according to an eighth aspect of the present invention is a method for improving the moisturizing function and / or barrier function of the skin.

[0021] For example, applying the Japanese knotweed leaf extract to the scalp improves the moisturizing function and / or barrier function of the scalp. Effects of the Invention

[0022] According to the present invention, there can be provided a novel moisturizing function and / or barrier function improving agent comprising a Japanese knotweed leaf extract as an active ingredient, a β-glucocerebrosidase expression promoter, a sphingomyelinase expression promoter, a filaggrin expression promoter, a transglutaminase-1 expression promoter, an epidermal hyaluronic acid synthase expression promoter, a composition for improving moisturizing function and / or barrier function, and a method of use of Japanese knotweed leaf extract as an active ingredient for improving skin moisturizing function and / or barrier function. MODE FOR CARRYING OUT THE INVENTION

[0023] (1. Japanese knotweed leaf extract) The Japanese knotweed leaf extract used in the present invention refers to an extract obtained from leaf tissue of giant knotweed (*Follopia sachalinensis*, *Polygonum sachalinense*, *Reynoutria sachalinense*) or Japanese knotweed (*Follopia japonica*). The extract can be produced by immersing leaves of giant knotweed or Japanese knotweed in a solvent and eluting components contained in the leaves into the solvent. Here, the solvent and extraction method can be appropriately selected and used depending on desired functionality and the like. As the Japanese knotweed leaf extract, an extract obtained from leaf tissue of giant knotweed can be preferably used.

[0024] To illustrate the method for preparing knotweed leaf extract in more detail, the leaves of Japanese knotweed or Japanese knotweed are immersed in a solvent for a certain period of time to prepare an extract. Here, the leaves of Japanese knotweed or Japanese knotweed may be used as is, or they may be dried or pulverized. Examples of solvents include water, lower alcohols (ethanol, propanol, etc.), glycols (glycerin, 1,3-butylene glycol, propylene glycol, 1,3-propanediol, etc.), and mixtures of water, lower alcohols and / or glycols, but there are no particular restrictions as long as the solvent can extract the components contained in the leaves of Japanese knotweed or Japanese knotweed. The amount of solvent can be exemplified by 5 to 20 parts by weight of solvent per 1 part by weight of Japanese knotweed or Japanese knotweed leaves. The extraction temperature can be exemplified by 4 to 90°C, and the extraction time can be exemplified by 1 hour to 2 weeks.

[0025] Japanese knotweed leaf extract may be purified before use. Purification methods include removing plant residue by filtration or decantation, followed by heat sterilization. Heat sterilization can be performed by heating at 80-120°C, preferably 90-105°C, for approximately 30-60 minutes. Residue can be removed by filtration using a filter large enough to filter the used plant residue, or by centrifugation to settle the residue and collecting the supernatant.

[0026] Japanese knotweed leaf extract can be prepared using the procedure described above, or a commercially available product can be used. The Japanese knotweed leaf extract can be used as is, but it may be diluted or concentrated as needed. The extract may be in liquid form, or in solid form such as powder, granules, or solid matter.

[0027] The various agents or compositions according to the present invention may be used as is as cosmetics, pharmaceuticals, quasi-drugs, etc., or they may be used as raw materials for cosmetics, pharmaceuticals, quasi-drugs, etc., in combination with other ingredients. "Application" of the various agents or compositions according to the present invention means, for example, applying the Japanese knotweed leaf extract according to the present invention to the target skin or outer layer as a cosmetic, pharmaceutical, or quasi-drug.

[0028] (2. Moisturizing and / or barrier function improving agent) The moisturizing and / or barrier function improving agent of the present invention contains Japanese knotweed leaf extract as an active ingredient.

[0029] In this specification, "moisturizing function" means the ability to retain moisture in the stratum corneum, and "improvement of moisturizing function" means increasing or retaining moisture in the stratum corneum when various agents or compositions according to the present invention are applied to the skin. Moisture in the stratum corneum can be measured using known methods.

[0030] In this specification, "barrier function" means the function of suppressing transepidermal water loss and the function of suppressing the intrusion of foreign substances (allergens, viruses, bacteria, etc.) from the outside world, and "improvement of barrier function" means that when the various agents or compositions according to the present invention are applied to the skin, transepidermal water loss is suppressed and the intrusion of foreign substances from the outside world is suppressed. The degree of transepidermal water loss and the degree of intrusion of foreign substances from the outside world can be measured using known methods.

[0031] The moisturizing and / or barrier function improving agent of the present invention can preferably improve moisturizing and / or barrier function in the scalp.

[0032] (3. β-glucocerebrosidase expression promoter) The β-glucocerebrosidase expression promoter of the present invention contains Japanese knotweed leaf extract as an active ingredient.

[0033] In this specification, with respect to biomolecules such as β-glucocerebrosidase, sphingoemilinase (described later), filaggrin, transglutaminase-1, and epidermal hyaluronic acid synthase, "expression promotion" and "promotion of expression" mean increasing the transcription level of the gene encoding all or part of the biomolecule in any cell, tissue, or organ of a living organism, increasing the amount of the biomolecule, or increasing the activity of the biomolecule.

[0034] β-glucocerebrosidase is a hydrolytic enzyme localized in the intracellular lysosomes of eukaryotic cells. It catalyzes the hydrolysis of the sugar-lipid dehydration condensation site of Glc-Cer (glucocerebroside), a type of glycolipid. β-glucocerebrosidase is involved in ceramide production. Ceramide is the main component of the stratum corneum, which forms the surface of the epidermis of human skin. It prevents excessive water loss due to dryness and forms a barrier function that prevents the invasion of microorganisms. β-glucocerebrosidase plays a role in the production of acylceramide during ceramide biosynthesis and is therefore an important enzyme in ceramide production. In fact, it has been reported that in transgenic mice genetically lacking β-glucocerebrosidase activity, an incomplete lamellar structure of intercellular lipids in the stratum corneum is observed, and transepidermal water loss is significantly increased (WM Holleran et al, J Clin Invest. 93(4):1756-64 (1994)). Therefore, the β-glucocerebrosidase expression promoter of the present invention promotes the expression of β-glucocerebrosidase, thereby promoting ceramide production in the skin, for example, and improving moisturizing and / or barrier functions. It is also known that Gaucher's disease develops when β-glucocerebrosidase is congenitally deficient due to genetic factors. In Gaucher's disease, a decrease or deficiency in glucocerebrosidase activity leads to the accumulation of its substrate, the glycolipid glucocerebroside, in tissues, causing hepatosplenomegaly, bone pain and pathological fractures, and central nervous system disorders. Therefore, the β-glucocerebrosidase expression promoter of the present invention is considered useful, for example, in Gaucher disease. The β-glucocerebrosidase expression promoter of the present invention can be used in all applications where promoting the production of β-glucocerebrosidase is significant.

[0035] The β-glucocerebrosidase expression promoter can preferably promote β-glucocerebrosidase expression in skin keratinocytes, and more preferably in scalp keratinocytes.

[0036] (4. Sphingoeminase expression promoters) The sphingoeminase expression promoter of the present invention contains knotweed leaf extract as an active ingredient.

[0037] Sphingomyelinase is an enzyme that hydrolyzes sphingomyelin into phosphorylcholine and ceramide, and plays an important role in ceramide production. Therefore, the sphingomyelinase expression promoter of the present invention promotes sphingomyelinase expression, thereby promoting ceramide production in the skin, for example, and improving moisturizing and / or barrier functions. Furthermore, it is known that acid sphingomyelinase deficiency occurs when acid sphingomyelinase is congenitally deficient due to genetic factors. Acid sphingomyelinase deficiency is caused by a decrease or deficiency of acid sphingomyelinase activity, leading to the accumulation of sphingomyelin, cholesterol, glycolipids, etc., in reticuloendothelial cells and nerve cells of the liver, spleen, and bone marrow, causing hepatosplenomegaly, psychomotor disorders, etc. Therefore, the sphingomyelinase expression promoter of the present invention is considered useful, for example, for acid sphingomyelinase deficiency. The sphingoeminase expression enhancer of the present invention can be used in all applications where promoting sphingoeminase production is significant.

[0038] The sphingoeminase expression promoter can preferably promote sphingoeminase expression in skin keratinocytes, and more preferably in scalp keratinocytes.

[0039] (5. Filaggrin expression promoters) The filaggrin expression promoter of the present invention contains knotweed leaf extract as an active ingredient.

[0040] Filaggrin is a protein of approximately 40 kDa that is a major component of the stratum corneum and is known as a building block for natural moisturizing factors (NMF), which will be discussed later. Filaggrin is first produced as profilaggrin in the granular layer of the epidermis. Profilaggrin is a high molecular weight protein of approximately 400 kDa, consisting of 10 to 12 filaggrin units arranged in a sequence, and is broken down into filaggrin within the stratum corneum. Filaggrin within the stratum corneum aggregates keratin fibers, which form the skeleton of keratinocytes, and works to maintain the physical strength and elasticity of keratinocytes and the stratum corneum. Furthermore, filaggrin is broken down into amino acids and urocanic acid in the upper layer of the stratum corneum. These are called natural moisturizing factors (NMF) and play a role in retaining moisture in the stratum corneum and preventing drying, deformation, atrophy, and shedding of keratinocytes. The gene encoding profilaggrin is the filaggrin gene, and mutations in the filaggrin gene are known to cause loss or thinning of the granular layer, leading to a decrease in profilaggrin production and, consequently, impaired skin barrier function (Aesthetic Dermatology 2nd Edition "Stratum Corneum and Dry Skin" pp. 8-21, Nanzando, May 2009; Allergy 64(9)1189-1195(2005) Atsushi Otsuka, Kenji Kabashima). Therefore, the filaggrin expression promoter of the present invention promotes filaggrin expression, thereby promoting the production of natural moisturizing factors (NMF) in the skin, for example, and improving moisturizing and / or barrier functions. The filaggrin expression promoter of the present invention can be used in all applications where promoting filaggrin production is significant.

[0041] The filaggrin expression promoter can preferably promote filaggrin expression in skin keratinocytes, and more preferably in scalp keratinocytes.

[0042] (6. Transglutaminase-1 expression promoters) The transglutaminase-1 expression promoter of the present invention contains Japanese knotweed leaf extract as an active ingredient.

[0043] Transglutaminase-1 is a calcium ion-dependent enzyme that plays a crucial role in the maturation of the cornified envelope (CE), the outer wall structure of keratinocytes. The CE is formed from various constituent proteins and is responsible for the skin's barrier function. More specifically, keratinocytes are formed when keratinocytes (basal cells) formed in the basal layer, the deepest layer of the epidermis, are pushed up by newly developing keratinocytes, transforming into spinous cells and granular cells as they migrate to the skin surface. During this process, proteins that make up the CE, such as involucrin and filaggrin, are cross-linked by the action of transglutaminase-1, forming isopeptide bonds (glutamyl-lysine bonds), and a strong, water-insoluble CE is formed. Furthermore, transglutaminase-1 also has the function of binding the proteins that make up the CE to intercellular lipids, and in the aforementioned process, it plays a role in binding intercellular lipids to the surface of the CE and forming a lamellar structure. Therefore, the transglutaminase-1 expression promoter of the present invention promotes the expression of transglutaminase-1, thereby promoting the maturation of cerebrospinal fluid (CE) and improving moisturizing and / or barrier functions. It is also known that ichthyosis follicularis develops due to abnormalities in the transglutaminase-1 gene (Jpn.J.Clin.Immunol.,40(6)416-427(2017)). Therefore, the transglutaminase-1 expression promoter of the present invention is considered useful, for example, for ichthyosis follicularis. The transglutaminase-1 expression promoter of the present invention can be used in all applications where promoting the production of transglutaminase-1 is significant.

[0044] The transglutaminase-1 expression promoter can preferably promote transglutaminase-1 expression in skin keratinocytes, and more preferably in scalp keratinocytes.

[0045] (7. Epidermal hyaluronic acid synthase expression promoter) The epidermal hyaluronic acid synthase expression promoter of the present invention contains Japanese knotweed leaf extract as an active ingredient.

[0046] Epidermal hyaluronic acid synthase is an enzyme that synthesizes hyaluronic acid. Hyaluronic acid is found in the stratum corneum, epidermis, and dermis of the skin, and it has been reported that there are three types of hyaluronic acid synthases (HAS1, HAS2, and HAS3) involved in human hyaluronic acid synthesis. High molecular weight hyaluronic acid in the dermis and epidermis is known to be mainly produced by hyaluronic acid synthase 2 (HAS2). Hyaluronic acid is a high molecular weight polysaccharide found in the skin (epidermis and dermis), cartilage, synovial fluid, etc., and has many functions, including retaining moisture in the intercellular spaces, maintaining cells based on the formation of a jelly-like matrix within tissues, maintaining tissue lubricity and flexibility, resistance to external forces such as mechanical damage, and prevention of bacterial infection. Therefore, the epidermal hyaluronic acid synthase expression promoter of the present invention promotes the expression of epidermal hyaluronic acid synthase, thereby promoting the production of hyaluronic acid in the skin, for example, and improving moisturizing and / or barrier functions. Furthermore, it is known that during the healing process after a burn injury, hyaluronic acid significantly increases in granulation tissue from the initial stages when granulation tissue proliferates from below the necrotic tissue until the entire tissue is replaced by granulation tissue ("Connective Tissue and Disease," Kodansha, p. 153, 1980). Therefore, the epidermal hyaluronic acid synthase expression promoter of the present invention is considered useful, for example, as a therapeutic agent for the initial stages of burns. The epidermal hyaluronic acid synthase expression promoter of the present invention can be used in all applications where promoting hyaluronic acid production is significant.

[0047] The epidermal hyaluronic acid synthase expression promoter can preferably promote the expression of epidermal hyaluronic acid synthase in skin keratinocytes, and more preferably can promote the expression of epidermal hyaluronic acid synthase in scalp keratinocytes.

[0048] (8. Compositions for improving moisturizing and / or barrier function) The present invention provides a composition for improving moisturizing and / or barrier function, comprising Japanese knotweed leaf extract as an active ingredient, and for promoting the expression of at least one selected from the group consisting of β-glucocerebrosidase, sphingoemilinase, filaggrin, transglutaminase-1, and epidermal hyaluronic acid synthase in skin keratinocytes.

[0049] Details regarding improved moisturizing function, improved barrier function, and promotion of expression of β-glucocerebrosidase, sphingoeminase, filaggrin, transglutaminase-1, and epidermal hyaluronic acid synthase are as described above.

[0050] The present invention's composition for improving moisturizing and / or barrier function is preferably intended to promote the expression of at least one selected from the group consisting of β-glucocerebrosidase, sphingoemilase, filaggrin, transglutaminase-1, and epidermal hyaluronic acid synthase in scalp keratinocytes.

[0051] (9. How to use Japanese knotweed leaf extract as an active ingredient) The method of using the Japanese knotweed leaf extract as an active ingredient in this invention is for the purpose of improving the moisturizing function and / or barrier function of the skin.

[0052] Details regarding improvements in moisturizing function, barrier function, etc., are the same as described above.

[0053] In the method of use of the present invention, applying Japanese knotweed leaf extract to a target can improve the moisturizing and / or barrier function of the skin. The target includes primates that require improvement of the moisturizing and / or barrier function of the skin, such as humans, chimpanzees, and rhesus monkeys, but the preferred target is humans.

[0054] In the method of use of the present invention, Japanese knotweed leaf extract can preferably be applied to the scalp to improve the moisturizing and / or barrier function of the scalp.

[0055] (10. Conclusion) The present invention provides novel moisturizing and / or barrier function improving agents, β-glucocerebrosidase expression promoters, sphingoeminase expression promoters, filaggrin expression promoters, transglutaminase-1 expression promoters, epidermal hyaluronic acid synthase expression promoters, and compositions for improving moisturizing and / or barrier function, as well as methods for using Japanese knotweed leaf extract as an active ingredient to improve the moisturizing and / or barrier function of the skin. [Examples]

[0056] The present invention will be specifically described below with reference to examples. However, the present invention is not limited to these examples. In these examples, "%" represents mass % ((w / w)%) unless otherwise specified.

[0057] We investigated the moisturizing and barrier functions of Polygonum cuspidatum leaf extract. More specifically, we examined the effects of Polygonum cuspidatum leaf extract on gene expression related to moisturizing and barrier functions using gene analysis tests (mRNA expression tests) with skin keratinocytes.

[0058] Japanese knotweed leaf extract was prepared as follows: The leaves of Japanese knotweed (Polygonum sachalinense) were dried and powdered. 100g of this dried powder was immersed in 900g of a 30% by volume 1,3-butylene glycol aqueous solution and left to stand at room temperature (approximately 20°C) for one week. Subsequently, the supernatant was transferred to a separate container and stored in a refrigerator at 4°C for one week. After that, the residue was removed by filtration, and the collected filtrate was designated as "Japanese knotweed leaf extract."

[0059] First, as a preliminary test, a cytotoxicity test was conducted as follows. 1) Human dermal keratinocytes (Takara Bio Inc.) were pre-cultured at 37°C under 5% CO2 conditions. 2) Place subconfluent cells in a 96-well microplate in a 1.0 × 10⁶ well. 4The cells were seeded at a rate of 100 μL / well and pre-cultured until subconfluent. 3) A predetermined amount of Japanese knotweed leaf extract was added to each well, and the mixture was incubated at 37°C in a 5% CO2 incubator for 24 hours. 4) After 24 hours of incubation, 100 μL of culture medium without Japanese knotweed leaf extract was added to each well of each test plot, 10 μL of MTT Solution (Cosmo Bio Co., Ltd.) was added, and incubation was performed for 3 hours. 5) After incubation, 150 μL of PBS(-) was added to each well and washed twice. 6) 150 μL of isopropanol was added to each well and shaken for 10 minutes using a plate shaker at 300 rpm. 7) After shaking, the absorbance at 540 nm was measured using a plate reader.

[0060] Table 1 shows the results of the cytotoxicity test. In Table 1, "Average" indicates the relative value for each concentration of Japanese knotweed leaf extract, with the absorbance of the unadded test group (without Japanese knotweed leaf extract) set to 100%. Table 1, "Japanese knotweed leaf extract concentration (μg / mL)," represents the final concentration of Japanese knotweed leaf extract in the reaction system solution. No significant toxicity from Japanese knotweed leaf extract was observed in any of the concentration groups.

[0061] [Table 1]

[0062] Based on the results of these cytotoxicity tests, the following gene expression tests were conducted with a maximum concentration of Japanese knotweed leaf extract of 1000 μg / mL.

[0063] Next, gene expression tests related to moisturizing and barrier functions were performed. • β-glucocerebrosidase (ceramide-producing enzyme) (NM_00157.3) • Alkaline ceramidase-2 (ceramide-degrading enzyme) (NM_001010887.2) • Sphingomyelinase (ceramide-producing enzyme) (NM_000543.4) • Filaggrin (a component of natural moisturizing factors (NMF)) (NM_002016.1) • Transglutaminase-1 (CE maturation enzyme) NM_000359.2) • Epidermal hyaluronic acid synthase (NM_005329.2)

[0064] Gene expression tests were performed as follows: 1) Human dermal keratinocytes (Takara Bio Inc.) were pre-cultured for 18 hours at 37°C in a 5% CO2 incubator. 2) A predetermined amount of Japanese knotweed leaf extract was added, and the mixture was cultured for 24 hours. 3) After the culture was complete, the cells were thoroughly washed with PBS(-). 4) RNA was extracted using NucleoSpin® RNA (Takara Bio Inc.). 5) A portion of the obtained sample was diluted 50-fold, and the absorbance at 260 nm was measured to determine the total RNA content. (Calculation formula: OD260nm×40(factor)×50(dilution rate)=Total RNA amount(ng / μL)) 6) cDNA was prepared by performing a reverse transcription reaction by PCR using PrimeScript® RT Master Mix (Takara Bio Inc.) (15 minutes at 37°C, 5 seconds at 85°C). 7) Real-time PCR reaction was performed using SYBR® Premix Ex Taq® II (Takara Bio Inc.). 12.5 μL of SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2×), 1 μL of PCR Forward Primer (10 μM), 1 μL of PCR Reverse Primer (10 μM), and 1 μL or 2 μL of cDNA were added, and the total volume was adjusted to 25 μL using RNase Free H2O. The real-time PCR reaction consisted of initial denaturation at 95°C for 10 seconds, followed by 45 cycles of 5 seconds at 95°C and 30 seconds at 60-65°C, and one repeat of a reaction at 60-95°C for 0.2 deg / s. 8) After the PCR reaction, mRNA expression levels were compared with the control group using the △△Ct method.

[0065] The sequence information for PCR Forward Primer and PCR Reverse Primer is shown below. • β-glucocerebrosidase (GBA) Forward Primer: ACAGCCCGGAGACATCTACCA(Sequence ID 1) • β-glucocerebrosidase (GBA) Reverse Primer: TCAGCTGTCACTGCCCAGAAC (Sequence ID 2) • Alkali ceramidase-2 (ACER2) Forward Primer: GCATGGTGGGAATTATCAACCTC (Sequence ID 3) • Alkali ceramidase-2 (ACER2) Reverse Primer: TGACATGACTCCTGCCCACA(Sequence ID 4) • Sphingomyelinase (SMPD1) Forward Primer: CTCTATGAAGCGATGGCCAAG (Sequence ID 5) • Sphingomyelinase (SMPD1) Reverse Primer: TGGAGTTGATCAAGAGCCAGAA(Sequence No. 6) • Filaggrin (FLG) Forward Primer: TCACGTGGCAGTCCTCACAG (Sequence No. 7) • Filaggrin (FLG) Reverse Primer: AGTGTCTAAACCCGGATTCACCATA (Sequence ID 8) • Transglutaminase-1 (TGM1) Forward Primer: CTCAATGTCTCAGGCCATGTCAA (Sequence ID 9) • Transglutaminase-1 (TGM1) Reverse Primer: CCAACAACTGCTGCTCCCAGTA (Sequence ID 10) • Epidermal hyaluronic acid synthase (HAS3) Forward Primer: TGCGACTCTGACACTGTGCTG (Sequence ID 11) • Epidermal hyaluronic acid synthase (HAS3) reverse primer: GGAAATCCATGAGTCGTACTTGTTG(Sequence ID 12)

[0066] Table 2 shows the results of the gene expression test. In Table 2, the relative expression ratio is shown for each concentration of Japanese knotweed leaf extract, with the gene expression intensity of the control group (no Japanese knotweed leaf extract) set to 1.00. Also, in Table 2, "Japanese knotweed leaf extract concentration (μg / mL)" represents the final concentration of Japanese knotweed leaf extract in the reaction system solution. An expression ratio of 1.00 or higher indicates that the gene is activated compared to the control, and an expression ratio of 1.20 or higher indicates that the activation is even stronger. Japanese knotweed leaf extract showed a significant increase in expression of β-glucocerebrosidase (ceramide-producing enzyme), sphingomyelinase (ceramide-producing enzyme), filaggrin (material for natural moisturizing factors (NMF)), transglutaminase-1 (CE maturation enzyme), and HAS-3 (epidermal hyaluronic acid synthase), which are related to moisturizing and barrier functions.

[0067] [Table 2]

[0068] Based on the above, it was shown that the knotweed leaf extract of this example promotes ceramide production by increasing the expression of β-glucocerebrosidase and sphingomyelinase, promotes the production of natural moisturizing factors (NMF) by increasing the expression of filaggrin, promotes the maturation of CE by increasing the expression of transglutaminase-1, and promotes hyaluronic acid synthesis by increasing the expression of HAS-3. Therefore, it was suggested that the knotweed leaf extract of this example has excellent moisturizing and barrier functions.

Claims

1. A moisturizing and / or barrier function improving agent containing knotweed leaf extract as an active ingredient.

2. To improve the moisturizing and / or barrier function of the scalp. The moisturizing and / or barrier function improving agent according to claim 1.

3. A β-glucocerebrosidase expression promoter containing knotweed leaf extract as its active ingredient.

4. A β-glucocerebrosidase expression promoter according to claim 3, which promotes β-glucocerebrosidase expression in skin keratinocytes.

5. A sphingoemilase expression promoter containing knotweed leaf extract as its active ingredient.

6. The sphingoeminase expression promoter according to claim 5, which promotes sphingoeminase expression in skin keratinocytes.

7. A filaggrin expression promoter containing knotweed leaf extract as its active ingredient.

8. A filaggrin expression promoter according to claim 7, which promotes filaggrin expression in skin keratinocytes.

9. A transglutaminase-1 expression promoter containing knotweed leaf extract as the active ingredient.

10. A transglutaminase-1 expression promoter according to claim 9, which promotes transglutaminase-1 expression in skin keratinocytes.

11. An epidermal hyaluronic acid synthase expression promoter containing knotweed leaf extract as an active ingredient.

12. The epidermal hyaluronic acid synthase expression promoter according to claim 11, which promotes the expression of epidermal hyaluronic acid synthase in skin keratinocytes.

13. A composition for improving moisturizing and / or barrier function, comprising Polygonum cuspidatum leaf extract as an active ingredient, for promoting the expression of at least one selected from the group consisting of β-glucocerebrosidase, sphingoemilase, filaggrin, transglutaminase-1, and epidermal hyaluronic acid synthase in skin keratinocytes.

14. Method of using Japanese knotweed leaf extract as an active ingredient to improve the moisturizing and / or barrier function of the skin.

15. Applying the aforementioned Japanese knotweed leaf extract to the scalp improves the moisturizing and / or barrier function of the scalp. The method of use described in feature 14.

Images