Zinc finger protein transcription factors for suppressing α-synuclein expression

Abstract

This invention provides a zinc finger fusion protein that inhibits α-synuclein expression in the nervous system, and a method for using the same. [Solution] A nucleic acid construct is provided comprising a coding sequence of a fusion protein including a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain is bound to a target region in the human α-synuclein gene (SNCA gene), the ZFP domain comprises a specific amino acid sequence, and the coding sequence is operably linked to a transcriptional regulatory element.

Description

TECHNICAL FIELD

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority based on U.S. Provisional Application 62 / 909,496 filed on October 2, 2019, and U.S. Provisional Application 62 / 959,153 filed on January 9, 2020. The content of the aforementioned provisional application is incorporated herein by reference in its entirety.

[0002] SEQUENCE LISTING This application contains a Sequence Listing which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The above-mentioned ASCII copy was created on October 1, 2020, is named 025297_WO011_SL.txt, and has a size of 121,468 bytes. BACKGROUND ART

[0003] BACKGROUND OF THE INVENTION Parkinson's disease (PD) is a neurodegenerative disease characterized by movement disorders. Approximately 50% of PD patients eventually develop dementia. PD is the second most common neurodegenerative disease after Alzheimer's disease. In the United States, there are about 1 million PD patients, with 50,000 to 60,000 new cases every year. Sporadic forms of PD typically have an onset age of 60 to 70 years. Generally, the period from initial diagnosis to death due to PD complications is 15 to 20 years.

[0004] Patients with Parkinson's disease exhibit various motor symptoms, including bradykinesia, rigidity, forward bending posture, masked facies, forward tilt of the trunk, decreased arm swing, flexion of the elbows, wrists, hips and knees, postural instability, resting tremor of the extremities, and short shuffling gait. Patients also often present non-motor symptoms including anosmia, sleep disorders, decreased intestinal motility, neuropathic pain, and dementia. See, for example, Jeanjean and Aubert, Lancet (2011) 378(9805):1773-4; Kalia and Lang, Lancet (2015) 386(9996):896-912.

[0005] The brains of Parkinson's disease (PD) patients are characterized by the loss of dopamine-producing (dopaminergic) neurons in a region called the substantia nigra. The brains of PD patients are also characterized by the presence of Lewy bodies, which are protein aggregates or clumps formed within neurons, and Lewy neurites, which are neurites (neuronal projections) containing protein aggregates similar to those of Lewy bodies. Lewy bodies were first discovered in the brains of PD patients by Friedrich Lewy in 1912 and were subsequently found to contain fibrils, which are aggregated, insoluble forms of α-synuclein (Goedert and Spillantini, MolPsychiatry (1998)3(6):462-5; Spillantini et al., NeurosciLett.(1998)251(3):205-8; Spillantini et al., Nature(1997)388(6645):839-40). Mutations in the alpha-synuclein gene (SNCA) were identified in families affected by Parkinson's disease (PD) in 1997 (see, e.g., Polymeropoulos et al., Science (1997) 276(5321):2045-7). Subsequently, duplication and triplication of the SNCA gene, as well as further point mutations in alpha-synuclein, have been shown to correlate with the genetic or familial morphology of PD. Furthermore, partial genomic changes that control alpha-synuclein expression levels have been shown to be associated with an increased risk of PD in large, unbiased population studies (genome-wide association studies, GWAS).

[0006] Alpha-synuclein is a membrane-bound protein involved in vesicle release at the presynaptic terminals of neurons. It may also be important in DNA repair. Mature alpha-synuclein is a small 14kD protein with a central core region (residues 61-95) containing hydrophobic amino acids known as the NAC (non-A-beta component of Alzheimer's disease amyloid) region. The NAC is a contributor to protein aggregation. Misfolded alpha-synuclein polypeptides aggregate into oligomers and protofibrils, which then combine to form large, insoluble aggregates similar to those found in Lewy bodies. Accumulated evidence indicates that alpha-synuclein misfolding and aggregation play a central role in cell damage occurring in PD, ultimately leading to neuronal death in the substantia nigra. Furthermore, smaller aggregates of alpha-synuclein have been shown to migrate from cell to cell and spread throughout the brain, similar to those seen in prion diseases. Inhibiting alpha-synuclein aggregation reduces neuronal damage and can slow or even halt the progression of Parkinson's disease.

[0007] Current approaches to lowering α-synuclein levels include the use of antisense oligonucleotides (ASOs) that target α-synuclein at the RNA level, and monoclonal antibodies (mAbs) that target specific 3D morphologies or conformations of extracellular α-synuclein. However, there is an urgent need for clinically effective methods to treat PD by targeting α-synuclein. [Overview of the initiative]

[0008] This disclosure provides zinc finger protein (ZFP) domains that target the human SNCA gene or a region near it. The ZFP domains of this disclosure can specifically inhibit the expression of the human SNCA gene at the DNA level when fused to a transcription factor. These fusion proteins include (i) a ZFP domain that specifically binds to a target region in the SNCA gene and (ii) a transcriptional repressor domain that reduces the transcription of the gene.

[0009] In one embodiment, the disclosure provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region of the human α-synuclein gene (SNCA gene). In one embodiment, the target region (i.e., the target site) is within approximately 1 kb of the transcription start site (TSS, e.g., TSS1, 2a, or 2b) in the SNCA gene. In a further embodiment, the target region is within approximately 500 bp upstream of TSS2a, within approximately 500 bp downstream of TSS2b, and / or within approximately 500 bp upstream or downstream of TSS1, as shown in Figures 2B and / or 4. Non-limiting examples of target regions are shown in Table 1.

[0010] In one embodiment, the fusion protein contains one or more (e.g., two, three, four, five, or six) zinc fingers. It suppresses the expression of the SNCA gene by at least about 40%, 75%, 90%, 95%, or 99%, preferably with no or minimal detectable off-target binding or activity (e.g., binding to genes other than the SNCA gene). Non-limiting examples of zinc finger domains are shown in Table 1. In one embodiment, the fusion protein contains one or more recognition helix sequences shown in Table 1. In a further embodiment, the fusion protein contains some or all of the recognition helix sequences from one row of the table, with or without the main mutations shown. In a particular embodiment, the fusion protein contains the amino acid sequences shown in Table 2.

[0011] In one embodiment, the transcriptional repressor domain of the fusion protein is derived from the KRAB domain of the KOX1 protein. The zinc finger domain may be bound to the transcriptional repressor domain via a peptide linker. In another embodiment, the disclosure provides a nucleic acid construct comprising the coding sequence of the fusion protein, wherein the coding sequence is operably linked to a transcriptional regulatory element, such as a mammalian promoter that is constitutively active or inducible in brain cells, and the promoter is optionally a human synapsin I promoter. The disclosure also provides a host cell comprising the nucleic acid construct, the host cell being a human cell, such as a brain cell or a pluripotent stem cell, the stem cell being optionally an embryonic stem cell or an induced pluripotent stem cell (iPSC).

[0012] In another embodiment, the present disclosure provides a method for inhibiting the expression of α-synuclein in human brain cells, comprising introducing the fusion protein into the cells (for example, by introducing a nucleic acid construct or recombinant virus, e.g., AAV (e.g., AAV2, AAV6, AAV9, or a hybrid thereof)) thereby inhibiting the expression of α-synuclein in the cells. The brain cells may be neurons, glial cells, ependymal cells, or neuroepithelial cells. The cells may be present in the brains of patients who have or are at risk of developing Parkinson's disease, Lewy body dementia, Alzheimer's disease, multiple system atrophy, or other synuclein diseases.

[0013] The Disclosure also provides a method for treating (e.g., slowing the progression of) synuclein disease in a patient, comprising administering a recombinant AAV encoding the fusion protein of the Disclosure to the patient. In one embodiment, the AAV is introduced into the patient via intravenous, intrathecal, intraventricular, intracisional, intrastriatal, or intrasubstantia nigra injection, or injection into any of the brain regions. The patient may have Parkinson's disease, Lewy body dementia, Alzheimer's disease, or multiple system atrophy.

[0014] This disclosure also provides a fusion protein for use in the above-described method, and the use of this fusion protein in the manufacture of a drug for use in the above-described method.

[0015] Other features, purposes, and advantages of the present invention will become apparent in the detailed description below. However, it should be understood that the detailed description illustrates, but is not limiting, embodiments and aspects of the present invention. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Brief explanation of the drawing]

[0016] [Figure 1] Figure 1 shows the specific targeting of the SNCA gene by a modified six-finger zinc finger protein transcription factor (ZFP-TF) that recognizes 18 base pairs in the gene. When ZFP-TF binds to the gene, SNCA transcription is reduced, and levels of SNCA mRNA and α-synuclein protein decrease. This figure discloses Sequence ID No. 20. [Figure 2A] Figure 2A shows the genomic structure of the human SNCA gene. The gene has seven exons (two non-protein coding and five protein coding), and each transcript contains five introns. There are three transcription start sites (TSSs) called TSS1, TSS2a, and TSS2b, which produce transcripts that begin from non-coding exons 1, 2a, and 2b, respectively. In all transcripts, the first protein-coding exon is exon 3. [Figure 2B]Figure 2B shows the upstream genomic region of the human SNCA gene. The mRNA sequence of SNCA is shown as a red bar. Small triangles in the cluster below the gene indicate regions in the SNCA gene targeted by 416 representative ZFP-TFs exemplified herein. The figure also shows the effect of each ZFP-TF on the decrease in human SNCA mRNA expression in SK-N-MC human neuroblastoma cells collected 24 hours after transfection with ZFP-TF mRNA. Messenger RNA levels were measured by RT-qPCR. Normalized SNCA expression levels are shown by the gradient bar "SNCA mRNA". The deepest (red) color indicates a 100% decrease. The lightest (white) color indicates a 0% decrease. RT-qPCR data were normalized to the mean of mRNA levels of two housekeeping genes (ATP5B and EIF4A2). Right-pointing triangles indicate that ZFP-TFs bind to the sense strand of the gene. The left-pointing triangle indicates that ZFP-TF binds to the antisense strand of the gene. [Figure 3-1] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-2]Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-3] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-4] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-5]Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-6] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-7] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-8]Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-9] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-10] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-11]Figures 3A-3E show the screening results from 416 ZFP-TF libraries described herein. The screening was performed on the SK-N-MC human neuroepithelial cell line. The y-axis in each panel represents α-synuclein mRNA expression normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B), measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the average of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are internal reference numbers for the ZFP-TFs. [Figure 3-12] Figures 3A-3E show the screening results from 416 ZFP-TF libraries described herein. The screening was performed on the SK-N-MC human neuroepithelial cell line. The y-axis in each panel represents α-synuclein mRNA expression normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B), measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the average of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are internal reference numbers for the ZFP-TFs. [Figure 3-13] Figures 3A-3E show the screening results from 416 ZFP-TF libraries described herein. The screening was performed on the SK-N-MC human neuroepithelial cell line. The y-axis in each panel represents α-synuclein mRNA expression normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B), measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the average of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are internal reference numbers for the ZFP-TFs. [Figure 3-14]Figures 3A to 3E show the results of screening from a library of 416 ZFP-TFs described herein. The screening was performed using the SK-N-MC human neuroepithelial cell line. In each panel, the y-axis represents α-synuclein mRNA expression, which was normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below each panel are the internal reference numbers of the ZFP-TFs. [Figure 3-15] Figures 3A to 3E show the results of screening from a library of 416 ZFP-TFs described herein. The screening was performed using the SK-N-MC human neuroepithelial cell line. In each panel, the y-axis represents α-synuclein mRNA expression, which was normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below each panel are the internal reference numbers of the ZFP-TFs. [Figure 3-16] Figures 3A to 3E show the results of screening from a library of 416 ZFP-TFs described herein. The screening was performed using the SK-N-MC human neuroepithelial cell line. In each panel, the y-axis represents α-synuclein mRNA expression, which was normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and measured 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below each panel are the internal reference numbers of the ZFP-TFs. [Figure 3-17]Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 3-18] Figures 3A–3E show the screening results from the 416 ZFP-TF libraries described herein. The screening was performed in the SK-N-MC human neuroepithelial cell line. In each figure, the y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and evaluated 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 4]Figure 4 shows the upstream genomic region of the human SNCA gene. The mRNA sequence of SNCA is shown as a red bar. The small triangles in the cluster below the gene represent regions of the SNCA gene targeted by 50 representative ZFP-TFs with 1, 2, or 3 phosphate contact mutations. The figure also shows the effect of each ZFP-TF on the decrease in human SNCA mRNA expression in SK-N-MC human neuroblastoma cells collected 24 hours after transfection with ZFP-TF mRNA. Messenger RNA levels were measured by RT-qPCR. Normalized SNCA expression levels are shown as a gradient bar "SNCA mRNA". The deepest (red) color indicates a 100% decrease. The lightest (white) color indicates a 0% decrease. RT-qPCR data were normalized to the mean mRNA levels of two housekeeping genes (ATP5B and EIF4A2). Right-pointing triangles indicate that ZFP-TFs bind to the sense strand of the gene. The left-pointing triangle indicates that ZFP-TF binds to the antisense strand of the gene. [Figure 5-1] Figure 5 shows exemplary screening results from 50 representative ZFP-TF libraries with one, two, or three phosphate contact mutations. The screening was performed in the SK-N-MC human neuroepithelial cell line. The y-axis in each figure represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and assessed 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 5-2]Figure 5 shows exemplary screening results from 50 representative ZFP-TF libraries with one, two, or three phosphate contact mutations. The screening was performed in the SK-N-MC human neuroepithelial cell line. The y-axis in each figure represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and assessed 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 5-3] Figure 5 shows exemplary screening results from 50 representative ZFP-TF libraries with one, two, or three phosphate contact mutations. The screening was performed in the SK-N-MC human neuroepithelial cell line. The y-axis in each figure represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (EIF4A2 and ATP5B) and assessed 24 hours after transfection with RNA encoding different ZFP-TFs. RNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the figures are the internal reference numbers of the ZFP-TFs. [Figure 6-1]Figures 6A and 6B are a group of figures showing that 40 α-synuclein ZFP-TFs exhibited a range of α-synuclein inhibitory activity in SK-N-MC human neuroblastoma cells and human iPSC-derived neurons. Panel A shows 20 exemplary ZFP-TFs listed in Tables 1 and 2. Panel B shows exemplary ZFP-TFs not listed in Tables 1 and 2 but characterized by Figures 3A–3E. The y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (ATP5B and EIF4A2), evaluated 24 hours after transfection of SK-N-MC cells with RNA encoding a different ZFP-TF, or 28 days after transduction of iPSC-derived neurons with AAV6 encoding a different ZFP-TF. The x-axis shows the amount of RNA or AAV6 used, with RNA (3, 10, 30, 100, 300, and 1,000 ng) or AAV6 (1E3, 3E3, 1E4, 3E4, 1E5, and 3E5) doses increasing from left to right. The blue and orange bars represent the mean of four technical replicates, and the error bars represent the standard deviation. A larger version of the dose scale is shown at the bottom of the figure. [Figure 6-2]Figures 6A and 6B are a group of figures showing that 40 α-synuclein ZFP-TFs exhibited a range of α-synuclein inhibitory activity in SK-N-MC human neuroblastoma cells and human iPSC-derived neurons. Panel A shows 20 exemplary ZFP-TFs listed in Tables 1 and 2. Panel B shows exemplary ZFP-TFs not listed in Tables 1 and 2 but characterized by Figures 3A–3E. The y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (ATP5B and EIF4A2), evaluated 24 hours after transfection of SK-N-MC cells with RNA encoding a different ZFP-TF, or 28 days after transduction of iPSC-derived neurons with AAV6 encoding a different ZFP-TF. The x-axis shows the amount of RNA or AAV6 used, with RNA (3, 10, 30, 100, 300, and 1,000 ng) or AAV6 (1E3, 3E3, 1E4, 3E4, 1E5, and 3E5) doses increasing from left to right. The blue and orange bars represent the mean of four technical replicates, and the error bars represent the standard deviation. A larger version of the dose scale is shown at the bottom of the figure. [Figure 6-3]Figures 6A and 6B are a group of figures showing that 40 α-synuclein ZFP-TFs exhibited a range of α-synuclein inhibitory activity in SK-N-MC human neuroblastoma cells and human iPSC-derived neurons. Panel A shows 20 exemplary ZFP-TFs listed in Tables 1 and 2. Panel B shows exemplary ZFP-TFs not listed in Tables 1 and 2 but characterized by Figures 3A–3E. The y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (ATP5B and EIF4A2), evaluated 24 hours after transfection of SK-N-MC cells with RNA encoding a different ZFP-TF, or 28 days after transduction of iPSC-derived neurons with AAV6 encoding a different ZFP-TF. The x-axis shows the amount of RNA or AAV6 used, with RNA (3, 10, 30, 100, 300, and 1,000 ng) or AAV6 (1E3, 3E3, 1E4, 3E4, 1E5, and 3E5) doses increasing from left to right. The blue and orange bars represent the mean of four technical replicates, and the error bars represent the standard deviation. A larger version of the dose scale is shown at the bottom of the figure. [Figure 6-4]Figures 6A and 6B are a group of figures showing that 40 α-synuclein ZFP-TFs exhibited a range of α-synuclein inhibitory activity in SK-N-MC human neuroblastoma cells and human iPSC-derived neurons. Panel A shows 20 exemplary ZFP-TFs listed in Tables 1 and 2. Panel B shows exemplary ZFP-TFs not listed in Tables 1 and 2 but characterized by Figures 3A–3E. The y-axis represents α-synuclein mRNA expression, normalized to the geometric mean of two housekeeping genes (ATP5B and EIF4A2), evaluated 24 hours after transfection of SK-N-MC cells with RNA encoding a different ZFP-TF, or 28 days after transduction of iPSC-derived neurons with AAV6 encoding a different ZFP-TF. The x-axis shows the amount of RNA or AAV6 used, with RNA (3, 10, 30, 100, 300, and 1,000 ng) or AAV6 (1E3, 3E3, 1E4, 3E4, 1E5, and 3E5) doses increasing from left to right. The blue and orange bars represent the mean of four technical replicates, and the error bars represent the standard deviation. A larger version of the dose scale is shown at the bottom of the figure. [Figure 7-1]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-2] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-3]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-4] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-5]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-6] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-7]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-8] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-9]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-10] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-11]Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 7-12] Figures 7A–7D are a group of volcano plots showing the off-target activity of 40 α-synuclein ZFP-TFs in mouse primary neurons (A and B) and human iPSC-derived neurons (C and D). Refer to the bar graphs in Figures 1 and 2 for easy reference. Figures 6A–6B, showing the inhibitory activity of ZFP-TFs in human iPSC-derived neurons, are shown next to the corresponding ZFP-TF volcano plots. These volcano plots summarize microarray data showing transcriptome changes in mouse primary neurons (A and B) 7 days after transduction or human iPSC-derived neurons (C and D) 19 days after transduction. In the volcano plots, the numbers in red and green indicate the number of downregulated and upregulated off-target genes, respectively. Yellow circles represent human α-synuclein. Green circles (to the right of each volcano plot) represent genes that were significantly upregulated by more than twofold. The red circles represent genes that have been downregulated by more than twofold. [Figure 8-1]Figures 8A and 8B are a group of figures showing (A) mRNA expression levels of ZFP-TF and α-synuclein, or (B) mRNA expression levels of glial fibrillary acidic protein (GFAP), ionized calcium-binding adapter molecule 1 (IBA1), and NeuN in different brain regions of female PAC synuclein mice (Kuo et al., HumMolGenet. (2010) 19(9):1633-50). The animals were administered bilaterally to two sites in the striatum with AAV9 encoding the shown test substance or vehicle. All gene expression data are normalized to the geometric mean of three housekeeping genes (ATP5B, EIF4A2, and GAPDH). The y-axis represents the mRNA expression level of the shown gene, and the x-axis represents the brain region. The red squares show the mean expression data for n=3 animals treated with ZFP-TF82195, and the green triangles show the mean expression data for n=3 animals treated with ZFP-TF82264. Panel A provides α-synuclein mRNA expression normalized to the mean of animals treated with 3 vehicles, and ZFP-TF expression on a logarithmic scale as copies per 1 ng of introduced RNA. Panel B provides all expression data normalized to the mean of animals treated with 3 vehicles. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ***p<0.0001. [Figure 8-2]Figures 8A and 8B are a group of figures showing (A) mRNA expression levels of ZFP-TF and α-synuclein, or (B) mRNA expression levels of glial fibrillary acidic protein (GFAP), ionized calcium-binding adapter molecule 1 (IBA1), and NeuN in different brain regions of female PAC synuclein mice (Kuo et al., HumMolGenet. (2010) 19(9):1633-50). The animals were administered bilaterally to two sites in the striatum with AAV9 encoding the shown test substance or vehicle. All gene expression data are normalized to the geometric mean of three housekeeping genes (ATP5B, EIF4A2, and GAPDH). The y-axis represents the mRNA expression level of the shown gene, and the x-axis represents the brain region. The red squares show the mean expression data for n=3 animals treated with ZFP-TF82195, and the green triangles show the mean expression data for n=3 animals treated with ZFP-TF82264. Panel A provides α-synuclein mRNA expression normalized to the mean of animals treated with 3 vehicles, and ZFP-TF expression on a logarithmic scale as copies per 1 ng of introduced RNA. Panel B provides all expression data normalized to the mean of animals treated with 3 vehicles. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ***p<0.0001. [Modes for carrying out the invention]

[0017] Detailed description of the invention This disclosure provides ZFP domains that target a site (i.e., sequence) within or near the human SNCA gene. The ZFP domains described herein may bind to or fusion with another functional molecule or domain. The ZFP domains of this disclosure may be fused to a transcription factor to repress the transcription of the human SNCA gene to RNA. The fusion protein is referred to as a zinc finger protein transcription factor (ZFP-TF). These ZFP-TFs comprise a zinc finger protein (ZFP) domain that specifically binds to a target region within or near the SNCA gene and a transcriptional repressor domain that reduces the transcription of the gene. By introducing ZFP-TFs into a patient's brain, it is expected that the levels of α-synuclein in neurons will be reduced, thereby inhibiting (e.g., decreasing or halting) the aggregation of α-synuclein into oligomer (smaller soluble aggregates) or fibril (larger insoluble) forms. Reduced α-synuclein aggregation allows brain cells to use their cellular quality control mechanisms to remove misfallen, toxic forms of α-synuclein in a timely manner. As a result, α-synuclein aggregation and intercellular proliferation are reduced or inhibited.

[0018] Our ZFP-TF approach to α-synuclein inhibition offers several advantages over current approaches being tested by others. ZFP-TF can achieve higher levels of α-synuclein repression than those reported with antisense oligonucleotides (ASOs) (see, e.g., Luna et al., ActaNeuropathol. (2018) 135(6):855-75 (showing less than 75% SNCA inhibition by ASO)). Furthermore, ZFP-TF may require only a single administration (by introducing a ZFP-TF expression construct into the patient), while ASO requires repeated administrations. Additionally, only the ZFP-TF approach requires the use of two alleles of the SNCA gene in each cell's genome. In contrast, ASO requires the use of multiple copies of SNCA mRNA in each cell.

[0019] Our ZFP-TF approach is more beneficial than the aforementioned antibody approach because antibodies can only bind to a subset of the morphology or conformation of α-synuclein. This is insufficient for potent therapeutic effects. In contrast, ZFP-TFs suppress α-synuclein expression at the DNA level, reducing the levels of all forms of α-synuclein. Therefore, unlike antibodies, ZFP-TFs are not morphologically dependent on the toxic species. Furthermore, while antibodies are thought to act primarily on α-synuclein on or outside the cell, ZFP-TFs can directly reduce intracellular α-synuclein and indirectly reduce extracellular α-synuclein levels. Thus, since α-synuclein is primarily an intracellular protein, the ZFP-TF approach is expected to be more effective. In addition, antibodies require repeated administration, while ZFP-TFs require only a single delivery of their expression constructs.

[0020] I.ZFP domain targets The ZFP domain of the fusion protein of the present invention specifically binds to a target region within or near the human SNCA gene. Figure 1 shows the binding of the ZFP domain to the target SNCA gene sequence. The ZFP domain in the figure has six zinc fingers, but ZFP domains with fewer or more zinc fingers can be used, as will be further described below.

[0021] The human SNCA gene is approximately 117 kb long and is mapped to chr4:89,724,099-89,838,315 (GRCh38 / hg38). Its nucleotide sequence is available in GenBank acceptance number NC_000004 version 000004.12. The gene has seven exons (two non-protein coding and five protein coding), and each transcript has five introns (Figure 2A). The gene has three transcription start sites (TSS), one at the beginning of exon 1 and two at exon 2, thereby expressing exons 2a and 2b. The first protein-coding exon is exon 3. See also Touchman et al., GenomeRes. (2001) 11:78-86. The full-length isoform 1 of human α-synuclein is shown below. MDVFMKGLSK AKEGVVAAAE KTKQGVAEAA GKTKEGVLYV GSKTKEGVVH GVATVAEKTK EQVTNVGGAV VTGVTAVAQK TVEGAGSIAA ATGFVKKDQL GKNEEGAPQE GILEDMPVDP DNEAYEMPSE EGYQDYEPEA (Sequence ID 1; P37840-1)

[0022] Isoforms 2-4 differ from isoform 1 in that amino acid residues 103-130 are missing. Isoforms 2-5 differ from isoform 1 in that amino acid residues 41-54 are missing. Genetic analysis of α-synuclein reveals gene copy amplification (e.g., Brueggemann et al., Neurology (2008) 71:1294; Troiano et al., Neurology (2008) 71:1295; Uchiyama et al., Neurology (2008) 71:1289-90) and specific point mutations as potential causes of synuclein diseases such as PD and Lewy body dementia. For example, the following α-synuclein point mutations have been identified in some PD patients: A30P (Kruger et al., NatureGenet. (1998) 18:106-8); E46K (Zarranz et al., AnnNeurol. (2004) 55:164-73; Choi et al., FEBSLett. (2004) 576:363-8); H50Q (Khalaf et al., J Biol Chem. (2014) 289:21856-76); G51D (Lesage et al., AnnNeurol. (2013) 73:459-71); and A53T (Polymeropoulos et al., Science (1997) 276:2045-7).

[0023] The DNA-binding ZFP domain of the ZFP-TF directs the fusion protein to the target region of the SNCA gene, bringing the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then represses the transcription of the SNCA gene by RNA polymerase. The target region of the ZFP-TF can be any suitable site within or near the SNCA gene that enables the repression of gene expression. For example, the target region may contain (either downstream or upstream) or be adjacent to an SNCA TSS or SNCA transcriptional regulatory element (e.g., promoter, enhancer, RNA polymerase arrest site).

[0024] As described above, the human SNCA gene has three transcription start sites (TSSs). These are TSS1, TSS2a, and TSS2b, located 5' to 3', at the 5' end of exon 1 (TSS1), exon 2a, and exon 2b (TSS2a and 2b) (Figure 2B). Transcription at the three TSSs generates RNA isoforms of different lengths. However, because α-synuclein translation begins at exon 3, the RNAs produced from different TSSs form the same protein. In one embodiment, the genomic target region of this ZFP-TF extends to or near TSS1 (e.g., base pairs 529–1529) or TSS2a and 2b (e.g., base pairs 1613–2949). In a particular embodiment, the target region is within approximately 500 bp upstream or downstream of TSS1, and / or within approximately 500 bp upstream or downstream of TSS2a, and / or within approximately 500 bp upstream or downstream of TSS2b.

[0025] In one embodiment, the genomic target region is at least 8 bp long. For example, the target region may be between 8 bp and 40 bp long, e.g., 12, 15, 18, 21, 24, 27, 30, 33, or 36 bp long. The target sequence may be on the sense strand or antisense strand of a gene. To ensure targeting accuracy and reduce off-target binding or activity by the ZFP-TF, the selected SNCA target region sequence preferably has less than 75% homology (e.g., less than 70%, less than 65%, 60%, or less than 50%) to the sequence of another gene. In a particular embodiment, the target region of the ZFP-TF of the present invention is 15–18 bp long and located within 500 bp of TSS1, 2a, or 2b. Examples of target regions are shown in Figure 2B and Table 1.

[0026] In one embodiment, the manipulated ZFP of the present invention preferably binds to the target site (i.e., binding sequence) shown in a row of Table 1 with little or no detectable off-target binding or activity.

[0027] Other criteria for further evaluating target segments include the historical availability of ZFPs that bind to such segments or related segments, the ease of configuring novel ZFPs that bind to a given target segment, and the risk of off-target binding.

[0028] II. ZFP Domain A "zinc finger protein" or "ZFP" refers to a protein that has a DNA-binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Each DNA-binding unit of a ZFP is called a zinc "finger." Each finger typically consists of seven amino acid residues and contains a DNA-binding "recognition helix" that determines the specificity of DNA binding. A ZFP domain has at least one finger, and each finger binds to 2-4 base pairs of DNA, typically 3 or 4 base pairs. Each zinc finger typically consists of about 30 amino acids and chelated zinc. Manipulated ZFPs can have novel binding specificities compared to naturally occurring ZFPs. Manipulation methods include, but are not limited to, reasonable design and various types of selection. A rational design would involve, for example, the use of a database containing triplet (or quadruplet) nucleotide sequences and each zinc finger amino acid sequence, where each triplet or quadruplet nucleotide sequence is related to one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. For example, U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,140,081; 6,200,759; 6,453,242; 6,534,261; 6,979,539; and 8,586,526; and International Patent Publication WO95 / 19431; WO96 See the ZFP design methods described in detail in / 06166;WO98 / 53057;WO98 / 53058;WO98 / 53059;WO98 / 53060;WO98 / 54311;WO00 / 27878;WO01 / 60970;WO01 / 88197;WO02 / 016536;WO02 / 099084; and WO03 / 016496. The ZFP domains described herein may be bound to or fused with another molecule, such as a protein.Such ZFP fusions may contain domains that enable gene activation (e.g., activation domain), gene repression (e.g., repression domain), ligand binding (e.g., ligand binding domain), high-throughput screening (e.g., ligand binding domain), hypermutation localization (e.g., activation-induced cytidine deaminase domain), chromatin modification (e.g., histone deacetylase domain), recombination (e.g., recombinase domain), targeted integration (e.g., integrase domain), DNA modification (e.g., DNA methyltransferase domain), base editing (e.g., base editor domain), or targeted DNA cleavage (e.g., nuclease domain). Examples of manipulated ZFP domains are shown in Table 1.

[0029] The ZFP domain of the manipulated ZFP fusion protein of the present invention may contain at least one zinc finger (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or more). A ZFP domain with one finger typically recognizes a target site containing three or four nucleotides. A ZFP domain with two fingers typically recognizes a target site containing six or eight nucleotides. A ZFP domain with three fingers typically recognizes a target site containing nine or twelve nucleotides. A ZFP domain with four fingers typically recognizes a target site containing twelve to fifteen nucleotides. A ZFP domain with five fingers typically recognizes a target site containing fifteen to eighteen nucleotides. A ZFP domain with six fingers can recognize a target site containing eighteen to twenty-one nucleotides.

[0030] In one embodiment, the manipulated ZFP of the present invention comprises the DNA-binding recognition helix sequences shown in Table 1. For example, the manipulated ZFP may comprise the sequences F1, F2, F3, F4, F5, or F6, as shown in Table 1.

[0031] In one embodiment, the manipulated ZFP of the present invention comprises two adjacent DNA-binding recognition helix sequences shown in a row in Table 1. For example, the manipulated ZFP may comprise the sequences F1-F2, F2-F3, F3-F4, F4-F5, or F5-F6 shown in a row in Table 1.

[0032] In one embodiment, the manipulated ZFP of the present invention includes a DNA-binding recognition helix sequence shown in a row in Table 1. For example, the manipulated ZFP may include sequences F1, F2, F3, F4, F5, and F6 (e.g., F1-F6) shown in a row in Table 1.

[0033] The target specificity of a ZFP domain can be improved, for example, by mutations in the ZFP backbone sequence as described in U.S. Patent No. 2018 / 0087072. Such mutations include mutations made to residues of the ZFP backbone that can interact nonspecifically with phosphates on the DNA backbone but are not related to nucleotide target specificity. In some embodiments, these mutations include changing cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, these mutations include changing polar amino acid residues to neutral or nonpolar amino acid residues. In further embodiments, mutations are made at positions (-5), (-9), and / or (-14) relative to the DNA binding helix. In some embodiments, a zinc finger may contain one or more mutations at positions (-5), (-9), and / or (-14). In further embodiments, one or more zinc fingers in a multifinger ZFP domain may contain mutations at positions (-5), (-9), and / or (-14). In one embodiment, the amino acids at positions (-5), (-9), and / or (-14) (e.g., arginine (R) or lysine (K)) have mutations in alanine (A), leucine (L), serine (S), aspartic acid (N), glutamic acid (E), tyrosine (Y), and / or glutamine (Q). Examples of manipulated ZFPs with one, two, or three skeletal mutations are shown in Figures 4 and 5 and Tables 1 and 2. The symbol "^" in Table 1 indicates that the arginine (R) residue upstream of the first amino acid at position 4 of the indicated recognition helix has been changed to glutamine (Q). In each recognition helix sequence, the positions of seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Thus, the position of the R-to-Q substitution is numbered (-5).

[0034] In one embodiment, the manipulated ZFP of the present invention comprises a DNA-binding recognition helix sequence and associated skeletal mutations, as shown in Table 1.

[0035] In one embodiment, the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence shown in the row of Table 2. In one embodiment, the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence shown in the row of Table 2, since the sequence appears after post-translational modification. For example, the post-translational modification may involve removing an initiation factor methionine residue from the sequence, as shown in Table 2.

[0036] In one embodiment, the ZFP-TF of the present invention comprises one or more zinc finger domains. The domains may be linked together via an extendable flexible linker, for example, one domain comprising one or more (e.g., four, five, or six) zinc fingers, and another domain comprising one or more (e.g., four, five, or six) further zinc fingers. In one embodiment, the linker is a standard interfinger linker, such that the finger array comprises one DNA-binding domain comprising eight, nine, ten, eleven, or twelve or more fingers. In another embodiment, the linker is an atypical linker, such as a flexible linker. For example, the two ZFP domains may be linked to the transcriptional repressor TF in the structures (from N-terminus to C-terminus) ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (the two ZFP-TF fusion proteins are fused via a linker).

[0037] In one embodiment, ZFP-TFs are "two-handed," meaning they contain two zinc finger clusters (two ZFP domains) separated by an intervening amino acid, with the two ZFP domains binding to two discontinuous target sites. An example of a two-handed zinc finger-binding protein is SIP1, where a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus (Remacleetal., EMBO J.(1999)18(18):5073-84). Each zinc finger cluster in these proteins can bind to a specific target sequence, and the space between the two target sequences can contain many nucleotides.

[0038] Alternatively, the DNA-binding domain may be derived from a nuclease. For example, recognition sequences of homing endonucleases and meganucleases are known, such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII. See also U.S. Patents 5,420,032 and 6,833,252; Belfort et al., NucleicAcidsRes. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., NucleicAcidsRes. (1994) 22:1125-7; Jasin, Trends Genet (1996) 12:224-8; Gimble et al., JMolBiol. (1996) 263:163-80; Argast et al., JMolBiol. (1998) 280:345-53; and the New England Biolab catalog, among others. Furthermore, the DNA binding specificity of homing endonucleases and meganucleases can be manipulated to bind to non-natural target sites. See, for example, Chevalier et al., Mol Cell (2002) 10:895-905; Epinat et al., NucleicAcidsRes. (2003) 31:2952-62; Ashworth et al., Nature (2006) 441:656-59; Paques et al., Current Gene Therapy (2007) 7:49-66; and U.S. Patent Publication No. 2007 / 0117128.

[0039] III. Zinc Finger Protein Transcription Factors The ZFP domains described herein may be fused to a transcription factor. In one embodiment, the fusion protein of the present invention comprises a DNA-binding zinc finger protein (ZFP) domain and a transcription factor domain (i.e., ZFP-TF). In one embodiment, the transcription factor is a transcriptional repressor domain, and the ZFP and the repressor domain may be linked to each other directly by peptidyl linkage or a peptide linker, or by dimerization (e.g., via a leucine zipper, a STAT protein N-terminal domain, or an FK506-binding protein). As used herein, “fusion protein” means a complex of polypeptides having covalently linked domains and polypeptides linked to each other via non-covalent bonds. The transcriptional repressor domain can be linked to the ZFP domain at any suitable position, including the C-terminus or N-terminus of the ZFP domain.

[0040] In one embodiment, the ZFP-TFs of the present invention bind to their targets with a KD of less than approximately 25 nM and repress the transcription of the human SNCA gene by 20% or more (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% or more). In one embodiment, two or more ZFP-TFs of the present invention are used simultaneously in a patient, and the ZFP-TFs bind to different target regions of the SNCA gene to achieve optimal repression of SNCA expression.

[0041] A. Transcriptional repressor domain The ZFP-TF of the present invention comprises one or more transcriptional repressor domains that weaken the transcriptional activity of the manipulated ZFP domain and the SNCA gene as described herein. The one or more manipulated ZFP domains and the one or more transcriptional repressor domains may be linked by a flexible linker. Non-limiting examples of transcriptional repressor domains include the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGF-beta-inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, TRa, histone methyltransferase, histone deacetylase (HDAC), nuclear hormone receptors (e.g., estrogen receptor or thyroid hormone receptor), members of the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al. (1999) Cell 99:451-454; Tyler et al. (1999) Cell 99:443-446; Knoepfler et al. (1999) Cell 99:447-450; and Robertson et al. (2000) Nature Genet. 25:338-342. Further exemplary repressive domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al. (1996) Plant Cell 8:305-321; and Wu et al. (2000) Plant J. 22:19-27.

[0042] In one embodiment, the transcriptional repressor domain contains a sequence from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank number NM_015394.4). An example KRAB domain sequence is: DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPD VILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV (Sequence ID 12) That is the case. This variant of the KRAB sequence may also be used, as long as it has the same or similar transcriptional repression function.

[0043] In one embodiment, the engineered ZFP-TF described herein preferably binds to a target site shown in a row in Table 1 with little to no detectable off-target binding or activity. Off-target binding may be determined, for example, by measuring the activity of the ZFP-TF in an off-target gene. In one embodiment, the engineered ZFP-TF described herein includes a DNA binding recognition helix sequence shown in Table 1. In one embodiment, the engineered ZFP-TF described herein includes two adjacent DNA binding recognition helix sequences shown in a row in Table 1. In one embodiment, the engineered ZFP-TF described herein includes a DNA binding recognition helix sequence shown in a row in Table 1. In one embodiment, the engineered ZFP-TF described herein includes a recognition helix and a skeletal portion of the sequence shown in a row in Table 2. In one embodiment, the engineered ZFP-TF described herein includes an amino acid sequence shown in a row in Table 2. In one embodiment, the engineered ZFP-TF described herein includes a recognition helix and a skeletal portion of the sequence shown in a row in Table 2, since the sequence appears after post-translational modification. In one embodiment, the manipulated ZFP-TF described herein includes the amino acid sequence shown in a row in Table 2, since the sequence appears after post-translational modification. For example, the post-translational modification may involve the removal of an initiation factor methionine residue from the sequence shown in Table 2.

[0044] B. Peptide Linker The ZFP domain and transcriptional repressor domain of the ZFP-TF of the present invention, and / or the zinc finger within the ZFP domain, may be linked via a peptide linker, for example, an imcutable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Preferred linkers are typically flexible amino acid subsequences synthesized as recombinant fusion proteins. See, for example, the above and U.S. Patents 6,479,626; 6,903,185; 7,153,949; 8,772,453; and 9,163,245; and WO2011 / 139349. The proteins described herein may contain any combination of suitable linkers. Non-restrictive examples of linkers include DGGGS (sequence number 2), TGEKP (sequence number 3), LRQKDGERP (sequence number 4), GGRR (sequence number 5), GGRRGGGS (sequence number 6), LQRDGERP (sequence number 7), LRQKDGGGSERP (sequence number 8), LRQKD(G3S)2ERP (sequence number 9), and TGSQKP (sequence number 10).

[0045] In one embodiment, TGEKPFA (SEQ ID NO: 166) and / or TGSQKPFQ (SEQ ID NO: 167) bind a zinc finger within the ZFP domain, and / or LRQKDAARGSGG (SEQ ID NO: 168) or LRGSGG (SEQ ID NO: 169) bind the ZFP domain to the transcriptional repressor domain.

[0046] In one embodiment, the peptide linker is 3 to 20 amino acid residues long and is predominantly G and / or S. A non-limiting example of such a linker is a G4S type linker (SEQ ID NO: 16), i.e., a linker containing one or more (e.g., two, three, or four) GGGGS (SEQ ID NO: 11) motifs, or a variation of said motif (such as having one, two, or three amino acid insertions, deletions, and substitutions from said motif).

[0047] IV. Expression of ZFP-TF The ZFP-TFs of this disclosure may be introduced into a patient via a nucleic acid molecule encoding them. The nucleic acid molecule may be an RNA or cDNA molecule. The nucleic acid molecule may be introduced into the patient's brain via injection of a composition comprising a lipid:nucleic acid complex (e.g., liposome). Alternatively, the ZFP-TFs may be introduced into a patient via a nucleic acid expression vector containing a sequence encoding the ZFP-TFs. The expression vector may include expression regulatory sequences, such as a promoter, enhancer, transcription signal sequence, and transcription termination sequence, that enable the expression of the coding sequence of the ZFP-TFs in cells of the nervous system. In one embodiment, the expression vector remains present in the cell as a stable episome. In another embodiment, the expression vector is integrated into the cell's genome.

[0048] In one embodiment, the promoter on the vector for directing ZFP-TF expression in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, the retroviral RSV LTR promoter (with RSV enhancer as appropriate), CMV promoter (with CMV enhancer as appropriate), CMV pre-early promoter, SV40 promoter, dihydrofolate reductase (DHFR) promoter, β-actin promoter, phosphoglycerate kinase (PGK) promoter, EF1α promoter, MoMLV LTR, CK6 promoter, trans tiretin promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter, CMV enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene (1991) 108 (2):193-9), and RU-486-responsive promoter. Neuron-specific promoters, such as the synapsin I promoter, MeCP2 promoter, CAMKII promoter, PrP promoter, GFAP promoter, or modified or native promoters that restrict expression in neurons and glial cells, may also be used.

[0049] Any method for introducing nucleotide sequences into cells may be used, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes combined with nuclear localization signals, naturally occurring liposomes (e.g., exosomes), or viral transduction.

[0050] Viral transduction may be used for in vivo delivery of the expression vector. Various viral vectors known in the art, such as vaccine vectors, adenovirus vectors, lentiviral vectors, poxyvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, and hybrid viral vectors, may be used by those skilled in the art for use in this disclosure. In one embodiment, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors infect both dividing and non-dividing cells, exist as stable episomal structures for long-term expression, and have very low immunogenicity, making them particularly suitable for CNS gene delivery (Hadaczek et al., MolTher. (2010) 18:1458-61; Zaiss, et al., GeneTher. (2008) 15:808-16). Any suitable AAV serotype may be used. For example, the AAV may be a pseudotype such as AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or AAV2 / 8, AAV2 / 5, AAV2 / 6, or AAV2 / 9, or a serotype that is a variant or derivative of one of the AAV serotypes described herein (i.e., AAVs derived from multiple serotypes; for example, rAAV containing an AAV2 reverse-terminal repeat (ITR) in its genome and AAV8, 5, 6, or 9 capsid). In one embodiment, the expression vector is an AAV virus vector, and is introduced into target human cells by a recombinant AAV virion containing a construct whose genome has AAV reverse-terminal repeat (ITR) sequences at both ends, enabling the generation of AAV virions in a production system such as an insect cell / baculovirus production system or a mammalian cell production system. The AAV may be engineered so that its capsid protein reduces immunogenicity or enhances transduction ability in humans or non-human primates. In one embodiment, AAV9 is used. The viral vectors described herein may be produced using methods known in the art.Any suitable tolerant or packaging cell may be used to generate the viral particles. For example, mammalian or insect cells may be used as packaging cell lines.

[0051] V. Pharmaceutical Uses The ZFP-TF of the present invention can be used to treat patients who require downregulation of α-synuclein expression. These patients have or are at risk of developing neurodegenerative diseases such as Parkinson's disease, Lewy body dementia, Alzheimer's disease, multiple system atrophy, or other synuclein diseases. Patients at risk include those with a genetic predisposition, those who have suffered repeated brain injuries such as concussions, and those who have been exposed to environmental neurotoxins. This disclosure provides a method for treating a neurological disorder (e.g., a neurodegenerative disorder) in a subject such as a human patient requiring treatment, comprising introducing a therapeutically effective amount (e.g., an amount that allows for sufficient suppression of SNCA expression) of ZFP-TF (e.g., an rAAV vector expressing it) into the nervous system of the subject. The term “treat” includes symptom relief, prevention of symptom onset, delay of disease progression, improvement of quality of life, and increased survival.

[0052] This disclosure provides a pharmaceutical composition comprising a viral vector, for example, a recombinant AAV (rAAV) in which the recombinant genome contains an expression cassette for ZFP-TF. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, for example, water, saline (e.g., phosphate-buffered saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. Furthermore, the composition may comprise auxiliary substances, for example, wetting or emulsifying agents, pH buffers, stabilizers, or other reagents that enhance the efficacy of the pharmaceutical composition. The pharmaceutical composition may comprise a delivery vehicle, for example, liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.

[0053] The target cells of the therapies of this disclosure include, but are not limited to, nerve cells (e.g., motor neurons, sensory neurons, dopaminergic neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons); glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglia); ependymal cells; or neuroepithelial cells. The target brain regions of the therapies may be those most significantly affected in synuclein disease, e.g., the striatum, caudate nucleus, putamen, substantia nigra, midbrain, olfactory bulb, cerebellum, locus coeruleus, pons, medulla, brainstem, globus pallidus, hippocampus, cerebral cortex, or other brain regions. These regions may be directly reached by intrastriatal injection, intrasubstantia nigra injection, intracerebral injection, intracisional cisternus (ICM) injection, more commonly, intraparenchymal injection, intraventricular (ICV) injection, intrathecal injection, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In one embodiment, the viral vector is administered directly into the cerebrospinal fluid (CSF) via, for example, intrathecal and / or intraventricular injection, or intracisional injection, and then spreads throughout the CNS tissue. In another embodiment, the viral vector crosses the blood-brain barrier and achieves extensive distribution throughout the target CNS tissue after intravenous administration. In another embodiment, the viral vector is delivered directly to the target region via intraparenchymal injection. In some cases, the viral vector may undergo retrograde or anterograde transport to other brain regions after intraparenchymal delivery. In one embodiment, the viral vector has different CNS tissue targeting capabilities (e.g., CNS tissue tropism) that achieve stable and non-toxic gene transfer with high efficiency.

[0054] As an example, a pharmaceutical composition may be delivered by intracerebroventricular administration to the ventricular region of the patient's forebrain, such as the right ventricle, left ventricle, third ventricle, or fourth ventricle. A pharmaceutical composition may also be delivered to a patient by intracerebral administration, such as by injection of the composition into or near the striatum, caudate nucleus, putamen, substantia nigra, midbrain, olfactory bulb, cerebrum, medulla, pons, cerebellum, locus coeruleus, brainstem, globus pallidus, hippocampus, cerebral cortex, intracranial cavity, meninges, dura mater, arachnoid mater, or pia mater. In some cases, intracerebral administration may involve the administration of the drug into the cerebrospinal fluid (CSF) in the subarachnoid space surrounding the brain.

[0055] In some cases, intracerebral administration relates to injection using stereotactic fixation. Stereotactic fixation is well known in the art and typically involves the use of a computer and a 3D scanning device used together to guide the injection to a specific intracerebral region, e.g., the ventricular region. A microinjection pump (e.g., World Precision Instruments) may also be used. In some cases, the microinjection pump is used to deliver a composition containing a viral vector. In some cases, the infusion rate of the composition is in the range of 0.1 μl / min to 100 μl / min. As will be understood by those skilled in the art, the infusion rate depends on various factors, including, for example, the species of the subject, the age of the subject, the weight / size of the subject, the serotype of AAV, the required dosage, and the intracerebral region targeted. Other infusion rates may be considered appropriate by those skilled in the art in particular circumstances.

[0056] rAAV may be delivered to the target population by, for example, intravenous administration. In some cases, it may be desirable to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neurons, glial cells, meninges, astrocytes, oligodendrocytes, microglia, interstitial space, etc. In some cases, recombinant AAV may be delivered to the CNS by injection into the ventricular region, as well as directly to the striatum, caudate nucleus, putamen, substantia nigra, midbrain, olfactory bulb, cerebellum, locus coeruleus, pons, medulla, brainstem, globus pallidus, hippocampus, and cerebral cortex, or other brain regions. AAV can be delivered using neurosurgical techniques known in the art, for example, by needle, catheter, or related device via stereotactic injection (see, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29).

[0057] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings generally understood by those skilled in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials may also be used in the practice or testing of this disclosure. In case of any conflict, this specification, including its definitions, shall prevail. Generally, the nomenclature and techniques used in relation to neurology, medicine, medicinal chemistry, and cell biology described herein are well known and commonly used in the art. Enzyme reactions and purification techniques are commonly practiced in the art or performed according to the manufacturer's specifications, as described herein. Furthermore, unless otherwise required by context, singular forms shall include plural forms and plural forms shall include singular forms. Throughout this specification and its embodiments, the words “have” and “comprise,” or variations thereof such as “has,” “having,” “comprises,” or “comprising,” shall be understood to mean including the integer or group of integers described, but not excluding other integers or groups of integers. All publications and other references mentioned herein are incorporated in their entirety by reference. While many references are cited herein, this citation does not imply that any of these references constitute part of the general common sense of the art. As used herein, the terms “approximately” or “about” applied to one or more target values ​​mean a value similar to the reference value described herein. In certain embodiments, such terms mean a range of values ​​that are within the range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less, in either direction (greater than or less than) the reference value described herein.

[0058] To better understand the present invention, the following embodiments are provided. These embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. [Examples]

[0059] Example 1: Screening of ZFP-TF To identify ZFP-TFs that suppress α-synuclein expression, a library of 416 ZFP-TFs predicted to bind to 15 or 18 bp sequences in the human SNCA gene region, ranging from 500 bp upstream to 500 bp downstream of TSS1, or from 500 bp upstream to 500 bp downstream of TSS2a to 500 bp downstream of TSS2b, was designed and screened (Figure 2B). In Figure 2B, the target region of the ZFP-TF is indicated by an arrow, and the direction of the arrow indicates the DNA strand to which the ZFP-TF binds (5' to 3'). Figure 4 shows similar data to that in Figure 2B for ZFP-TFs with one, two, or three phosphate contact changes targeting TSS2a and 2b of the SNCA gene. In this study, a KRAB domain sequence (SEQ ID NO: 12) was used as a transcriptional repressor and fused to the C-terminus of the ZFP domain. Twenty representative ZFP-TF sequences are shown in Table 2 below. Templates for in vitro transcription were prepared from pVAX-ZFP or pVAX-GFP plasmids using PCR (forward primer GCAGAGCTCTCTGGCTAACTAGAG (SEQ ID NO: 13); reverse primer T(180)CTGGCAACTAGAAGGCACAG (SEQ ID NO: 14)). Messenger RNA was synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and purified using an RNeasy96 column (Qiagen). Next, the RNA encoding each ZFP-TF was dispensed into 96-well plates at six dilutions.

[0060] Recombinant rAAV vectors containing a ZFP-TF coding sequence were prepared in HEK293 cells according to a known method. The cells were transfected with a plasmid encoding the AAV helper gene and the rAAV genome, and harvested after 3 days. The cells were then lysed by three freeze / thaw cycles, and the cell debris was removed by centrifugation. The rAAV virions were precipitated using polyethylene glycol. After resuspending, the virions were purified by overnight ultracentrifugation under a cesium chloride gradient. The virions were formulated by dialysis and subsequently filtered sterilized. The AAV was aliquoted and stored at -80°C until use. The AAV was not refrozen after thawing.

[0061] Screening was performed using the SK-N-MC human neuroepithelial cell line. SK-N-MC cells are suitable for testing ZFP-TF, which reduces α-synuclein expression, because they express high levels of human α-synuclein. SK-N-MC cells were cultured in tissue culture flasks until confluence was reached. The cells were plated in 96-well plates at a rate of 150,000 cells per well and resuspended in Amaxa® SF solution. The cells were then mixed with ZFP-TF RNA (six doses: 3, 10, 30, 100, 300, and 1000 ng) and transferred to Amaxa® shuttle plate wells. The cells were transfected using an Amaxa® Nucleofector® device (Lonza; program CM-137). Eagle MEM cell medium was added to each well of the plate. The cells were transferred to 96-well tissue culture plates and incubated at 37°C for 24 hours.

[0062] ZFP-TF was also tested in GABAergic neurons derived from human iPSCs (Cellular Dynamics International). The cells were plated at a density of 40,000 cells per well in 96-well plates coated with poly-L-ornithine and laminin and maintained according to the manufacturer's instructions. The cells were transfected 48 hours after plating with AAV6 expressing the desired ZFP-TF at six different MOIs (1E3, 3E3, 1E4, 3E4, 1E5, and 3E5). Transduced cells were maintained for up to 32 days (with 50-75% medium changes every 3-5 days). The cells were harvested 28-30 days after AAV transfection.

[0063] The harvested cells were lysed and reverse transcribed using a C2CT kit according to the manufacturer's instructions. SNCA expression levels were measured using TaqMan quantitative polymerase chain reaction (qPCR). SNCA expression levels were normalized to the geometric mean of the expression levels of the housekeeping genes EIF4A2, ATP5B, and GAPDH. Mock transfection and transfection with ZFP-TF, known not to target SNCA, were used as negative controls.

[0064] Dose-dependent inhibition of α-synuclein was demonstrated in many of the ZFP-TFs tested. The maximum inhibition achieved was over 99%, but ZFP-TFs that inhibited α-synuclein to a lower degree were identified (e.g., approximately 90%, 75%, or 40% at the highest dose). Figures 3A–E and 5 show the screening data.

[0065] The dose-dependent activity of 40 ZFP-TF samples is shown in Figures 6A and 6B. The data in these figures indicate that ZFP-TF exhibits a broad α-synuclein repressive activity profile, with α-synuclein mRNA repression ranging from approximately 40% to over 99% at the highest dose tested. For example, ZFP-TF81966, 81970, 81972, 82002, 82008, 82012, 82049, 82054, 82090, 82092, 82096, 82097, 82107, 82150, 82190, 82195, 82197, 82215, 82225, and 82294 showed 95% or more repression of the human SNCA gene. -TF81965, 81971, 82076, 82135, 82136, 82158, 82167, 82242, 82264, 82285, and 82329 showed 80-94% inhibition, while ZFP-TF82001, 82056, 82058, 82110, 82144, 82148, 82151, 82208, and 82288 showed 41-79% inhibition.

[0066] Example 2: Off-target activity of α-synuclein ZFP-TF To evaluate the off-target effects of α-synuclein ZFP-TF on overall gene expression, microarray experiments were performed using total RNA isolated from human iPSC-derived neurons and primary mouse cortical neurons treated with AAV encoding representative α-synuclein ZFP-TFs.

[0067] Human iPSC-derived neurons were processed as described in Example 1. For microarray analysis, the cells were plated at a density of 260,000 cells per well on 24-well plates coated with poly-L-ornithine and laminin, transfected with 1E5 VG / cell 48 hours after plating, and harvested 19 days after viral transfection. RNA isolated from the harvested cells was used for microarray analysis.

[0068] Primary mouse cortical neurons were purchased from Gibco. These cells were plated at 200,000 cells / well on poly-D-lysine-coated 24-well plates and maintained according to the manufacturer's instructions using Gibco Neurobasal Medium containing GlutaMAX® I supplement, B27 supplement, and penicillin / streptomycin. 48 hours after plating (using DIV2), the cells were infected with AAV6 at an MOI of 1E5 VG / cell and harvested after 7 days (using DIV9; 50% medium change every 3-4 days). RNA isolation and microarray analysis were then performed.

[0069] Off-target analysis was performed using the GeneTitan® platform (Clariom S kit) according to the manufacturer's instructions. The assay results were analyzed using TAC software. In this analysis, differentially regulated genes that were regulated by more than twofold and had an FDR-corrected p-value of 0.05 or less were collected. Known ZFP-TFs and simulated transfections exhibiting minimal off-target effects were used as negative controls.

[0070] Figures 7A–D show microarray results for 40 representative α-synuclein ZFP-TFs in human iPSC-derived neurons and primary mouse cortical neurons. A wide range of off-target activities were present, with some ZFP-TFs exhibiting very low or undetectable off-target activity.

[0071] Example 3: In vivo suppression of α-synuclein mRNA expression AAV6 constructs expressing two representative ZFP-TFs (82195, ~95%; 82264, ~80%), which have minimal to undetectable off-target activity in both human and mouse neurons and different maximal inhibitory activity in human iPSC-derived neurons, were used to demonstrate in vivo suppression of human SNCA in a PAC synuclein mouse model (Kuo et al., HumMolGenet. (2010)19(9):1633-50). This mouse model expresses the full-length human SNCA sequence along with its upstream regulatory sequence in a mouse α-synuclein null background. AAV6 vectors and vehicles expressing each ZFP-TF were bilaterally administered to two striatum sites at a rate of 0.5 μL / min in 8-week-old female PAC synuclein mice (n=3 per group) (two sites per hemisphere: 5 μL to the anterior striatum, 4 μL to the posterior striatum, totaling 9 μL / hemispheric and 18 μL / animal). After injection, the needle was left in place for 5 minutes to allow the test drug to diffuse. The needle was then slowly withdrawn over 1-2 minutes. The stereotactic coordinates of the injection were as follows (anterior striatum: AP: +1.4 mm, ML: + / -1.7 mm, DV: -3.0 mm; posterior striatum: AP: +0.2 mm, ML: + / -2.3 mm, DV: -2.7 mm). The mice were euthanized after 3 weeks, and their brains were collected for molecular analysis. During euthanasia, the animals were perfused transcardially with 0.9% saline solution, and the brains were removed and partially resected. The left hemisphere was further dissected into 12 distinct regions (olfactory bulb; rostral, medial, and caudal cortex; rostral, medial, and caudal striatum; hippocampus; thalamus; ventral midbrain; medulla oblongata; and cerebellum). The dissected tissues were placed in RNALater to maintain RNA integrity. After 24 hours, the RNALater was removed, and the tissues were rapidly frozen in liquid nitrogen and maintained on dry ice until stored at -80°C.

[0072] Brain tissue was transferred on ice to a 1.5 mL Eppendorf tube containing 0.6 mL of TRI reagent (Thermo Fisher) and two 3.2 mm steel beads (BioSpec Products). The samples were lysed using a Qiagen TissueLyser at 4°C with the following parameters: 5 cycles, 90 seconds, and 25.1 frequency. After a short spin, 70 μL of 1-bromo-3-chloropropane was added to each sample at room temperature. The samples were vortexed for 10 seconds and centrifuged at 12,000 × g at 4°C for 10 minutes. 120 μL of aqueous phase from each sample was transferred to a well in a 96-well plate.

[0073] 60 μL of isopropyl alcohol and 12 μL of MagMax magnetic beads (Thermo Scientific) were added to each well containing the aqueous phase of the tissue lysate. Ribonucleic acid (RNA) was isolated from the tissue lysate according to the manufacturer's protocol using a Kingfisher 96 robot (Thermo Scientific) and a MagMax kit (Thermo Fisher). 100 μL of eluted RNA was separated from the magnetic beads using a magnetic stand. RNA yield and quality were evaluated using a Nanodrop 8000 instrument (Thermo Scientific).

[0074] Complementary deoxyribonucleic acid (cDNA) was prepared using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) with 10 μL of RNA and 10 μL of the default RT master mix (10x RT buffer, 10x random primers, 25x dNTP mix, multiscribe enzyme, and RNAse-free water). If necessary, the volumes of RNA and RT master mix were adjusted so that the product was in the range of 100–1,000 ng. Reverse transcription was performed on a C1000 Touch Biorad thermal cycler using the following program: 10 minutes at 25°C, 120 minutes at 37°C, 5 minutes at 85°C, and held at 4°C.

[0075] cDNA was subjected to RT-qPCR using a Biorad CFX384 thermal cycler. The cDNA was diluted 10-fold with nuclease-free water, and 4 μL of diluted cDNA was added to 10 μL of PCR reaction mixture. Each sample was technically analyzed four times. 2x FastMultiplex PCR (Qiagen) master mix was used for the triplex assay, and SsoAdvanced Universal Probes Supermix (Biorad) was used for the other assays.

[0076] The following cycling conditions were used: Qiagen Fast Multiplex master mix → 5 minutes at 95°C, 45 seconds at 95°C, 45 seconds at 60°C, plate reading, 40 cycles; Biorad SsoAdvanced master mix → 90 seconds at 95°C, 12 seconds at 95°C, 40 seconds at 60°C, plate reading, 42 cycles.

[0077] RNA recovery percentage was evaluated using spikes in GFP RNA before and after the RNA isolation step. A 5-fold dilution series of four pooled RNA samples from experimental animals was used as a standard curve. Sample data were normalized to the geometric mean of three housekeeping genes: ATP5B, EIF4A2, and GAPDH.

[0078] The mRNA expression data for α-synuclein, ZFP-TF, GFAP, IBA1, and NeuN from the aforementioned experiment are shown in Figures 8A and 8B. These data indicate that α-synuclein was suppressed in brain regions showing significant ZFP-TF expression. Furthermore, the expression data for GFAP, IBA1, and NeuN demonstrate that ZFP-TF administration did not result in an increase in the expression of neuroinflammatory markers or a decrease in the expression of the neuronal marker NeuN, indicating that ZFP-TF is well-tolerated.

[0079] Sequence List Table 1 below lists 33 exemplary manipulated ZFPs of this disclosure. For each ZFP, the genomic target sequence (binding sequence) and DNA binding recognition helix sequence (i.e., F1-F6) of each zinc finger within the ZFP domain are shown in a single row. In the table below, "^" indicates that the fourth arginine (R) residue upstream of the first amino acid in the indicated helix has been changed to glutamine (Q). The sequence number (Sequence Number #) is shown in parentheses. [Table 1-1] [Table 1-2]

[0080] Table 2 below lists the complete amino acid sequences of 33 exemplary ZFP-TFs of this disclosure, where DNA-binding recognition helix sequences are shown in bold, and intramodule and intermodule linkers are shown in underline. Variations in the R(-5)Q backbone are shown in bold and underline. The sequence number (SEQ ID NO) is shown in parentheses. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

Claims

1. A fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in the human α-synuclein gene (SNCA gene).

2. The fusion protein according to claim 1, wherein the target region is within 1 kb of the transcription start site (TSS) in the SNCA gene.

3. The fusion protein according to claim 2, wherein the TSS is TSS1, 2a, or 2b.

4. The fusion protein according to claim 3, wherein the target region is within 500 bp upstream of TSS1, within 500 bp downstream of TSS1, within 500 bp upstream of TSS2a, and / or within 500 bp downstream of TSS2b of the SNCA gene.

5. The fusion protein according to any one of claims 1, wherein the ZFP domain comprises six zinc fingers, and the fusion protein optionally suppresses the expression of the SNCA gene to at least about 40%, 75%, 90%, 95%, or 99%, with no detectable off-target binding or activity, or to a minimum.

6. The fusion protein according to any one of claims 1 to 5, wherein the transcriptional repressor domain comprises a KRAB domain amino acid sequence derived from human KOX1.

7. The fusion protein according to any one of claims 1 to 6, wherein the ZFP domain is bound to a transcriptional repressor via a peptide linker.

8. The fusion protein according to any one of claims 1 to 7, wherein the ZFP domain includes the DNA binding recognition helix sequence shown in Table 1.

9. The fusion protein according to any one of claims 1 to 8, wherein the ZFP domain includes a DNA-binding recognition helix sequence shown in one row of Table 1.

10. A nucleic acid construct comprising a coding sequence of a fusion protein according to any one of claims 1 to 9, wherein the coding sequence is operably linked to a transcription regulatory element.

11. The nucleic acid construct according to claim 10, wherein the transcriptional regulatory element is a mammalian promoter that is constitutively active or inducible in brain cells, and the promoter is optionally a human synapsin I promoter.

12. A recombinant virus comprising the nucleic acid construct according to claim 10 or 11.

13. The recombinant virus according to claim 12, wherein the recombinant virus is an adeno-associated virus vector, an adenovirus vector, or a lentivirus vector.

14. A pharmaceutical composition comprising a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13, and a pharmaceutically acceptable carrier.

15. A host cell comprising the nucleic acid construct according to claim 10 or 11, or the recombinant virus according to claim 12 or 13.

16. The host cell according to claim 15, wherein the host cell is a human cell.

17. The host cell according to claim 15, wherein the host cell is a brain cell or a pluripotent stem cell, and the stem cell is, as appropriate, an embryonic stem cell or an induced pluripotent stem cell (iPSC).

18. A method for inhibiting the expression of α-synuclein in human brain cells, comprising introducing a fusion protein according to any one of claims 1 to 9 into the cells by introducing a nucleic acid construct according to claim 10 or 11 or a recombinant virus according to claim 12 or 13, as appropriate, thereby inhibiting the expression of α-synuclein in the cells.

19. The method according to claim 18, wherein the human brain cells are neurons, glial cells, ependymal cells, or neuroepithelial cells.

20. The method according to claim 18 or 19, wherein the cells are located in the brain of a patient who has or is at risk of developing Parkinson's disease, Lewy body dementia, Alzheimer's disease, multiple system atrophy, or another synuclein disease.

21. The method according to any one of claims 18 to 20, comprising introducing a recombinant virus expressing the fusion protein into the cells.

22. The method according to claim 21, wherein the recombinant virus is, as appropriate, an adeno-associated virus (AAV) of serotype 9.

23. A method for treating a patient's synuclein disease, comprising administering to the patient a recombinant AAV encoding the fusion protein described in any one of claims 1 to 9.

24. The method according to claim 23, wherein the AAV is introduced into the patient via intravenous, intrathecal, intraventricular, intracisional, intrastriatal, or intrasubstantial injection, or injection into any of the brain regions.

25. The method according to claim 23 or 24, wherein the synuclein disease is Parkinson's disease, Lewy body dementia, Alzheimer's disease, or multiple system atrophy.

26. A fusion protein according to any one of claims 1 to 9, a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13, or a pharmaceutical composition according to claim 14, for use in the method according to any one of claims 18 to 25.

27. Use of a fusion protein according to any one of claims 1 to 9, a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13 for the production of a drug according to the method of any one of claims 18 to 25.

Images