Zinc finger protein transcription factors for tau expression repression

JP2026143516APending Publication Date: 2026-09-08SANGAMO THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026090463
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-01-22
Filing Date
2026-05-29
Publication Date
2026-09-08

Smart Images

  • Figure 2026143516000004
    Figure 2026143516000004
  • Figure 2026143516000005
    Figure 2026143516000005
  • Figure 2026143516000006
    Figure 2026143516000006
Patent Text Reader

Abstract

The present invention provides a zinc finger fusion protein that inhibits tau expression in the nervous system, and a method for using the protein to treat neurodegenerative diseases such as Alzheimer's disease, frontotemporal dementia, and other tauopathies. [Solution] The present invention provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repression domain, wherein the ZFP domain binds to the target region of the human microtubule-associated protein tau (MAPT) gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross-Reference to Related Applications This application claims the priority benefit of U.S. Provisional Application 62 / 964,501, filed on January 22, 2020.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted electronically in ASCII format, and is hereby incorporated by reference into this specification in its entirety. This ASCII copy, created on January 19, 2021, is named 025297_WO016_SL.txt and is 304,337 bytes in size. Background Art

[0003] Background of the Invention Microtubule-associated protein tau (MAPT), also known simply as tau, plays an important role in certain brain pathologies. Aggregation of misfolded tau into neurofibrillary tangles (NFTs) and other pathological tau inclusions has been implicated in numerous neurodegenerative conditions collectively referred to as tauopathies. These include Alzheimer's disease (AD), frontotemporal dementia (FTD), progressive supranuclear palsy (PSP), intractable genetic epilepsy (e.g., Dravet syndrome), traumatic brain injury (TBI), corticobasal degeneration (CBD), and chronic traumatic encephalopathy (CTE). See, e.g., Benussi et al., Front Aging Neurosci. (2015) 7:171; Gheyara et al., Ann Neurol. (2014) 76:443-56; Scholz and Bras, Int J Mol Sci. (2015) 16(10):24629-55; and McKee et al., Brain Pathol. (2015) 25(3):350-64.

[0004] Tau has been suggested to possess prion-like properties. Several studies have shown that hyperphosphorylation of tau may cause tau misfolding. Misfolded tau aggregates can spread throughout the brain (Takeda et al., Nat Comm. (2015) 6:8490; Hyman, Neuron (2014) 82:1189; de Calignon et al., Neuron (2012) 73:685-97). These aggregates may be the initial step in the formation of NFTs found in tauopathy. While NFTs are confined to the entorhinal cortex and medial temporal lobe in the early stages of AD, by the time severe clinical symptoms appear, NFTs have spread throughout the brain. Both NFTs and amyloid-beta plaques have been found in patients with AD, and amyloid deposition has been shown to increase tau pathology and deposition in the distal brain region (Bennett et al., Am J Pathol. (2017) 187(7):1601-12). Localized tau accumulation and diffusion are closely associated with neuronal loss in rodent models and human diseases (Pooler et al., Acta Neuropathol Commun. (2015) 3:14; La Joie et al., Sci Transl Med. (2020) 12:524). In addition to the neurotoxicity exerted by aggregated tau accumulation, the soluble oligomeric form of tau also appears to be similarly toxic (Guerrero-Munoz et al., Front Cell Neurosci. (2015) 9:464). Soluble, misfolded endogenous tau appears to play a role as a mediator of neurotoxicity in various neurological stress conditions.

[0005] Reduced endogenous tau levels have been shown to be beneficial for AD-like pathology in different genetic mouse models (Roberson et al., Science (2007) 316:750-4; DeVos et al., Sci Transl Med. (2017) 9(374):eaag0481; Wegmann et al., EMBO J. (2015) 1-14). Reduced tau levels in the brain also appear to protect against stress-induced and seizure-induced neuronal damage, as well as learning and memory impairments resulting from traumatic brain injury (Lopes et al., PNAS (2016) 113:e3755-63; Gheyara, supra; DeVos et al., J Neurosci. (2013) 33(31):12887-97; Cheng et al., PLoS One (2014) 9(12):e115765). However, there is no effective treatment for tauopathy. In vivo tau knockdown has been achieved by administering antisense oligonucleotides (ASOs) that bind to tau mRNA and prevent its translation (DeVos (2017) ibid; DeVos et al., Neurotherapeutics (2013) 10(3):486-97), or by intravenous injection of anti-tau antibodies (Asuni et al., J Neurosci. (2007) 27:9115-29; Ittner et al., J Neurochem. (2015) 132:135-45; Herrmann et al., J Neurochem. (2015) 132:1-4; Yanamandra et al., Neuron (2013) 80(2):402-14). Both approaches may promote a reduction in tau protein in the brain, but require chronic administration throughout the patient's life. Antibodies have poor blood-brain barrier and cell membrane permeability, which can limit both their diffusion within the central nervous system and their ability to bind to intraneuronal tau. Furthermore, the identity and number of pathogenic tau species are currently unknown and may differ among tauopathies, making the development of anti-tau antibody therapies challenging.

[0006] Given the crucial role of tau in brain pathologies and the lack of effective treatments, there is an urgent need to develop therapies targeting this protein for the prevention and treatment of tauopathies, including Alzheimer's disease (AD). [Overview of the project]

[0007] This disclosure provides zinc finger proteins (ZFPs) that target a site within or near the human MAPT gene. The ZFPs of this disclosure may be fused to a transcription factor to specifically inhibit the expression of the microtubule-associated protein tau (MAPT) gene at the DNA level. These fusion proteins contain (i) a ZFP domain that specifically binds to a target region of the MAPT gene, and (ii) at least one transcriptional repression domain that reduces the transcription of the gene.

[0008] In one embodiment, the disclosure provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repression domain, wherein the ZFP domain binds to a target region of a human MAPT gene. In some embodiments, the target region is located within 1.5 kb of the transcription start site (TSS) of the MAPT gene, for example, within 1000 bps upstream of the TSS and / or within 500 bps downstream of the TSS of the MAPT gene.

[0009] In some embodiments, the ZFP domain comprises one or more (e.g., one, two, three, four, five, six, or more) zinc fingers, and optionally the fusion protein suppresses MAPT gene expression by at least about 40%, 75%, 90%, 95%, or 99%, with preferably no or minimal off-target binding or activity (e.g., binding to genes other than the MAPT gene) detectable by known methods. Non-limiting examples of DNA-binding recognition helix amino acid sequences of this ZFP are shown in Figure 14 or 16. In some embodiments, the fusion protein comprises one or more recognition helix sequences shown in Figure 14 or 16. In further embodiments, the fusion protein comprises some or all of the recognition helix sequences shown in a single row in Figure 14 or 16, with or without the indicated backbone mutation shown in Figure 16. In certain embodiments, the fusion protein comprises the amino acid sequence shown in Figure 15 or 17.

[0010] In some embodiments, the transcriptional repressor domain of the fusion protein comprises a KRAB domain, which optionally is derived from the human KOX1 protein. In some embodiments, the ZFP domain is linked to a transcriptional repressor via a peptide linker. In some embodiments, the fusion protein includes a nuclear localization signal.

[0011] In some embodiments, the ZFP domain of the fusion protein comprises four, five, or six zinc finger recognition helix sequences shown in a single row in Figure 14 or 16; binds to a target sequence shown in Figure 14 or 16; comprises a zinc finger recognition helix sequence of a ZFP transcription factor shown in Figure 15 or 17 (e.g., FP-TF71377, 71385, 73034, 73122, 73131, or 73133); and / or comprises a zinc finger recognition helix sequence ligated as shown in Figures 14, 15, 16, or 17 (e.g., ZFP-TF71377, 71385, 73034, 73122, 73131, or 73133).

[0012] In certain embodiments, the fusion protein comprises amino acid sequences selected from SEQ ID NOs: 89-196, 197-248, and 267-307.

[0013] In another embodiment, the disclosure provides a nucleic acid construct comprising the coding sequence of the fusion protein, wherein the coding sequence is operably linked to a transcriptional regulatory element. In some embodiments, the transcriptional regulatory element is a mammalian promoter that can be constitutively activated or inducible in brain cells. In certain embodiments, the construct is a recombinant viral construct, such as a recombinant adeno-associated virus (AAV) construct.

[0014] In another embodiment, the Disclosure provides a host cell comprising the nucleic acid construct. The host cell may be a human cell such as a human brain cell or a pluripotent stem cell (e.g., an embryonic stem cell or an inducible pluripotent stem cell (iPSC)).

[0015] In another aspect, the Disclosure provides a method for inhibiting tau expression in human brain cells (e.g., neurons, glial cells, ependymal cells, neuroepithelial cells, endothelial cells, or oligodendrocytes), which includes introducing the fusion protein specified herein into cells, optionally through the introduction of the nucleic acid constructs herein, thereby inhibiting tau expression in the cells. In some embodiments, the cells are located in the brains of patients who have or are at risk of developing Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, traumatic brain injury (TBI), paroxysmal disorder, corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), or another tauopathy. In certain embodiments, the method includes introducing a recombinant virus expressing the fusion protein into the cells (e.g., a pseudotype of recombinant AAV such as neurotrophic serotype or AAV9).

[0016] In a relevant embodiment, this disclosure provides a method for treating a patient's tauopathy (e.g., slowing its progression), comprising administering a recombinant AAV encoding the fusion protein of this specification to the patient. In some embodiments, the AAV is introduced into the patient via an intravenous, intrasacral, intracerebral, intraventricular, intracisional, intrahippocampal, intrathalamic, or intraparenchymal pathway. In some embodiments, the tauopathy is Alzheimer's disease, or frontotemporal dementia, progressive supranuclear palsy, traumatic brain injury (TBI), paroxysmal disorder, corticobasal degeneration (CBD), or chronic traumatic encephalopathy (CTE).

[0017] Furthermore, this specification also provides fusion proteins for use in the treatment methods described herein, and the use of fusion proteins herein for the manufacture of pharmaceuticals in said treatment methods.

[0018] Other features, purposes, and advantages of the present invention will become apparent in the following detailed description. However, it should be understood that the detailed description illustrates embodiments and aspects of the present invention, but is given only as examples and not as a limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Brief explanation of the drawing]

[0019] [Figure 1] Figure 1 illustrates the specific targeting of the MAPT gene by a modified six-finger zinc finger protein transcription factor (ZFP-TF) that recognizes 18 base pairs in the gene. When ZFP-TF binds to the gene, MAPT transcription is reduced, which in turn reduces MAPT mRNA and tau protein levels. The figure discloses Sequence ID No. 308.

[0020] [Figure 2]Figure 2 illustrates the targeting of the MAPT gene by anti-tau ZFP-TF. Primary MAPT mRNA is shown in the top bar, and exon 1 is represented by a thick arrow. Small pentagons (370; orange and blue) in the clusters below the gene and mRNA indicate regions within the MAPT gene targeted by representative ZFP-TFs illustrated herein. Blue pentagons represent ZFP-TFs that specifically target the human MAPT gene, while orange pentagons target both human and non-human primate (NHP) MAPT genes. Right-pointing pentagons indicate that the ZFP-TF binds to the sense strand of the gene. Left-pointing pentagons indicate that the ZFP-TF binds to the antisense strand of the gene.

[0021] [Figure 3-1] Figure 3 is a group of graphs showing the tau repressive activity of 48 ZFP-TFs selected from a library of 370 ZFP-TFs (Figure 14). The y-axis of each graph represents tau mRNA expression normalized to the geometric mean of two housekeeping genes (Atp5b and Eif4a2), assessed 20 hours after transfection with mRNA encoding different ZFP-TFs in SK-N-MC cells. mRNA doses increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the graphs are the internal reference numbers of the ZFP-TFs. A larger version of the titration scale is shown in the lower right of the figure. [Figure 3-2] Same as above. [Figure 3-3] Same as above.

[0022] [Figure 4]Figure 4 demonstrates an optimization strategy for improving the target specificity of a parental ZFP-TF. This comprises mutating arginine (R) residues to glutamine (Q) at positions (-4), (-5), (-9), and / or (-14) of up to three zinc finger modules of the parental ZFP-TF. The mutations affect conserved non-specific contacts between the zinc fingers and the phosphate backbone of target DNA.

[0023] [Figure 5-1] Figures 5A and 5B demonstrate the target regions of mutated anti-tau ZFP-TFs in the MAPT gene. MAPT mRNA is shown as a red bar. In Figure 5A, small pentagons (red and white) within the first cluster under the gene represent regions in the MAPT gene targeted by the parental ZFP-TF. Small red pentagons of the second cluster under the gene indicate regions in the MAPT gene targeted by the R→Q variants of the parental ZFP-TF. Figure 5B shows an enlarged view of the target regions of a representative parental and mutated ZFP-TF in the MAPT gene. Orange pentagons represent the parental ZFP-TF, and red pentagons represent their R→Q variants. Right-facing pentagons indicate that the ZFP-TF binds to the sense strand of the gene. Left-facing pentagons indicate that the ZFP-TF binds to the antisense strand of the gene. The parental ZFP-TF is numbered 71, and the mutated ZFP-TF is numbered 73. Figure 5B respectively discloses SEQ ID NOs: 309 to 311 in order of appearance. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 5-5] Same as above. [Figure 5-6] Same as above.

[0024] [Figure 6-1]Figure 6 shows a group of graphs illustrating the tau repressive activity of representative R→Q mutant ZFP-TFs (Figure 16) from a library of ~340 mutants. The y-axis of each graph represents tau mRNA expression normalized to the geometric mean of two housekeeping genes (Atp5b and Eif4a2), assessed 20 hours after transfection with different ZFP-TF encoding mRNAs in SK-N-MC cells. mRNA levels increase from left to right (3, 10, 30, 100, 300, and 1,000 ng). Up to seven R→Q mutants are shown for each parent ZFP-TF. Bars represent the mean of four technical replicates, and error bars represent the standard deviation. The numbers below the graphs are the internal reference numbers of the ZFP-TFs. A larger version of the titration scale is shown in the lower right of the figure. [Figure 6-2] Same as above.

[0025] [Figure 7-1] Figure 7A shows a group of graphs illustrating the tau-repressive activity of representative ZFP-TFs in human iPSC-derived neurons. The y-axis represents tau mRNA expression normalized to the geometric mean of three housekeeping genes (ATP5B, EIF4A2, and GAPDH), and was evaluated for different ZFP-TFs in human iPSC-derived neurons 32 days after transduction with AAV6. The amount of AAV6 used is shown in the legend at the bottom right, along with the increasing AAV6 doses from left to right (MOI of 1E3, 3E3, 1E4, 3E4, 1E5, and 3E5). Neurons treated with formulation buffer (Mock) were used as negative controls. Bars represent the mean of four technical replicates, and error bars represent the standard deviation. [Figure 7-2] Same as above.

[0026] [Figure 7-3]Figure 7B is a group of graphs comparing the human tau inhibitory activity of representative R→Q mutant ZFP-TFs in human iPSC-derived neurons, human SK-N-MC cells, and primary mouse neurons. The y-axis represents tau mRNA expression normalized to the geometric mean of housekeeping genes ATP5B, EIF4A2, and optionally GAPDH, and is evaluated for each different ZFP-TF in human iPSC-derived neurons and primary mouse neurons at 32 and 7 days after AAV6 transduction, or 20 hours after transfection with mRNA encoding a different ZFP-TF in SK-N-MC cells. The amount of AAV6 or mRNA used is shown below the x-axis, increasing from left to right, along with the doses of AAV6 (MOI of 1E3, 3E3, 1E4, 3E4, 1E5, and 3E5) and mRNA (3, 10, 30, 100, 300, and 1,000 ng). The bars represent the mean of four technical iterations, and the error bars represent the standard deviation. A larger version of the titration scale is shown below the figure. The number of discrepancies between the target sequence of human MAPT and the orthologous target site of mouse MAPT is shown above the bar for each ZFP tested in primary mouse neurons. [Figure 7-4] Same as above.

[0027] [Figure 8-1]Figure 8 is a panel of Affymetrix / microarray data volcano / scatter plots showing changes in the transcriptome of human iPSC-derived neurons and primary mouse neurons 19 days or 7 days after treatment with representative R→Q mutant ZFP-TFs, respectively. Blue rectangles indicate the level of human tau suppression achieved with each representative ZFP-TF at the highest dose tested in neurons. The numbers shown in red and green indicate the number of downregulated and upregulated off-target genes, respectively; yellow circles represent different transcripts within the tau locus; red circles represent downregulated off-target genes; and green circles represent upregulated off-target genes. Human and mouse microarray data were obtained from at least two independent experiments and 5–8 biological replicates per experiment. CPNE6 was excluded from the off-target count as it was shown to be an artifact of the reference ZFP. [Figure 8-2] Same as above.

[0028] [Figure 9-1] Figure 9 shows a group of graphs illustrating the effects of representative R→Q mutant ZFP-TFs on the expression levels of transcripts within tau loci (human tau and STH) and off-target genes (CPNE6 and IGF2). Mock treatments and ZFP-TFs that do not bind to tau loci were used as negative controls. The y-axis represents mRNA expression normalized to the geometric mean of three housekeeping genes (ATP5B, EIF4A2, and GAPDH), assessed 32 days after transfection with mRNA encoding different ZFP-TFs in human iPSC-derived neurons. The amount of AAV6 used is shown in the legend in the lower right, with AAV6 doses increasing from left to right (MOI of 1E3, 3E3, 1E4, 3E4, 1E5, and 3E5). The blue rectangles indicate the level of human tau suppression achieved with each representative ZFP-TF at the maximum dose tested in neurons. Bars represent the mean of four technical replicates, and error bars represent the standard deviation. [Figure 9-2] Same as above.

[0029] [Figure 10] Figure 10 shows a group of graphs illustrating the mRNA expression levels of ZFP-TF, mouse Mapt, NeuN, and neuroinflammatory markers after intraparenchymal (IPa) delivery of AAV9 encoding a representative R→Q mutant ZFP-TF in C57BL / 6 mice. The y-axis in each graph represents the absolute or normalized mRNA expression levels of ZFP-TF, Mapt, Gfap, Iba1, and NeuN in hippocampal tissue obtained from the right hemisphere of adult mouse brains 4 weeks after treatment with AAV9 encoding ZFP-TF (dose - 3E10VG per hemisphere) under the human synapsin 1 promoter. Vehicle treatment (VEH) and treatment with ZFP-TF encoding GFP were used as negative controls. The ZFP-TF used is indicated on the x-axis. Colored bars represent the mean of the values ​​from four mice, and error bars represent the standard deviation. Arrows in each figure indicate the group to which the values ​​of other groups are normalized.

[0030] [Figure 11-1] Figure 11 shows a group of graphs showing the mRNA expression levels of ZFP-TF, human MAPT, mouse Mapt, human STH, GFP, NeuN, and neuroinflammatory markers after intraparenchymal (IPa) delivery of AAV9 encoding a representative R→Q mutant ZFP-TF or a positive control ZFP-TF construct (57890-T2A-65918) in htau mice. The y-axis in each graph represents the absolute or normalized mRNA expression levels of ZFP-TF, human MAPT, mouse Mapt, human STH, GFP, GFAP, IBA1, and NeuN in hippocampal tissue obtained from the right hemisphere of adult mouse brains 3 or 6 months after treatment with AAV9 encoding ZFP-TF under the human synapsin 1 promoter (dose - 3E9, 1E10, or 3E10VG per hemisphere). Vehicle treatment (VEH) was used as a negative control. The evaluated ZFP-TF, dose, and time point are shown on the x-axis. The colored bars represent the average value for 5-8 mice per group, and the error bars represent the standard deviation. [Figure 11-2] Same as above.

[0031] [Figure 12] Figure 12 is a graph showing human tau protein levels after intraparenchymal (IPa) delivery of AAV9 encoding a representative R→Q mutant ZFP-TF or a positive control ZFP-TF construct (57890-T2A-65918) in htau mice. The y-axis in each graph represents the absolute or normalized total tau protein levels in hippocampal tissue obtained from the right hemisphere of the brain of adult mice 3 or 6 months after treatment with AAV9 encoding ZFP-TF under the human synapsin 1 promoter (dose - 3E9, 1E10, or 3E10VG / hemisphere). Vehicle treatment (VEH) was used as a negative control. The ZFP-TF, dose, and time point evaluated are shown on the x-axis. Colored bars represent the mean values ​​of 5-8 mice per group, and error bars represent the standard deviation.

[0032] [Figure 13] Figure 13 is a panel of images from multiple in-situ hybridization / immunofluorescence staining showing human MAPT transcripts, NeuN protein, and DAPI after intraparenchymal (IPa) delivery of AAV9 encoding a representative R→Q mutant ZFP-TF in htau mice. The representative image shows the hippocampal region from the left hemisphere of the brain of adult mice 3 months after treatment with AAV9 encoding ZFP-TF under the human synapsin 1 promoter (dose - 3E9VG per hemisphere). Vehicle treatment (VEH) was used as a negative control.

[0033] [Figure 14-1]Figure 14 is a table showing exemplary ZFPs of this disclosure. For each 4, 5, or 6-finger ZFP (i.e., F1-F4, F1-F5, or F1-F6), the genomic target sequence (i.e., the linked sequence) of the DNA-binding recognition helix sequence is shown in a single row and capitalized. The figure also shows exemplary peptide linker sequences between the zinc fingers and between the ZFP domain and repressor domain (i.e., L1, L2, L3, L4, L5, or L6) of each ZFP shown in Table 1. The sequence number for each sequence is shown in parentheses. [Figure 14-2] Same as above. [Figure 14-3] Same as above.

[0034] [Figure 15-1] Figure 15 is a table showing exemplary complete protein sequences for ZFP-TF, including the ZFP shown in Figure 14. DNA-binding recognition helix sequences are shown in bold. Zinc finger linkers are underlined, while interdomain linkers are double-underlined. The sequence number for each sequence is shown in parentheses. [Figure 15-2] Same as above. [Figure 15-3] Same as above. [Figure 15-4] Same as above. [Figure 15-5] Same as above. [Figure 15-6] Same as above. [Figure 15-7] Same as above. [Figure 15-8] Same as above. [Figure 15-9] Same as above. [Figure 15-10] Same as above. [Figure 15-11] Same as above. [Figure 15-12] Same as above. [Figure 15-13] Same as above. [Figure 15-14] Same as above.

[0035] [Figure 16-1]Figure 16 is a table showing exemplary R→QZFPs of this disclosure. For each of the four, five, or six finger ZFPs shown (i.e., F1-F4, F1-F5, or F1-F6), the genomic target sequence (i.e., the linked sequence) of the DNA binding recognition helix sequence shown in a single row is indicated in capital letters. The figure also shows exemplary peptide linker sequences between the zinc fingers and between the ZFP domain and repressor domain (i.e., L1, L2, L3, L4, L5, or L6) of each ZFP shown in Table 1. The symbol "^" indicates that the arginine (R) residues from the first to the fourth amino acid upstream in the shown finger are changed to glutamine (Q). The sequence number for each sequence is shown in parentheses. [Figure 16-2] Same as above. [Figure 16-3] Same as above.

[0036] [Figure 17-1] Figure 17 is a table showing an exemplary complete protein sequence of R→QZFP-TF containing the ZFP shown in Figure 16. DNA binding recognition helix sequences are shown in bold. Zinc finger linkers are underlined, while interdomain linkers are double-underlined. The sequence number for each sequence is shown in parentheses. [Figure 17-2] Same as above. [Figure 17-3] Same as above. [Figure 17-4] Same as above. [Figure 17-5] Same as above. [Figure 17-6] Same as above. [Figure 17-7] Same as above. [Figure 17-8] Same as above. [Figure 17-9] Same as above. [Figure 17-10] Same as above. [Figure 17-11] Same as above. [Figure 17-12] Same as above.

[0037] Detailed description of the invention This disclosure provides a ZFP domain that targets (i.e., binds to a DNA sequence) within or near the human MAPT gene. The ZFP domain described herein may be bound to or fused to another functional molecule or domain. The ZFP domain of this disclosure may be fused to a transcription factor that represses the transcription of the human MAPT gene to mRNA. The fusion protein is called a zinc finger protein transcription factor (ZFP-TF) and specifically targets the human MAPT gene and represses its transcription to RNA. These ZFP-TFs include a zinc finger protein (ZFP) domain that specifically binds to a target region within or near the MAPT gene, and a transcriptional repression domain that reduces the transcription of the gene. By introducing ZFP-TFs into a patient's brain, reducing tau levels in neurons is expected to inhibit (e.g., reduce or stop) the aggregation of tau into aggregates and NFTs. Cell-to-cell propagation of tau aggregates is reduced or prevented. These ZFP-TFs can be used for the prevention and / or treatment of tauopathy.

[0038] The ZFP-TF approach to tau inhibition offers several advantages over current approaches tested by others, including (i) antisense oligonucleotides (ASOs) that bind to tau mRNA and prevent its translation, and (ii) immunotherapy with anti-tau antibodies. ZFP-TF may only require a single administration (by introducing a ZFP-TF expression construct into the patient), while ASOs require repeated administrations. Furthermore, the ZFP-TF approach requires the use of only two alleles of the MAPT gene in the genome of each cell. In contrast, ASOs require the involvement of numerous copies of MAPT mRNA in each cell. In addition, while the distribution and tropism of ASOs are fixed, the ZFP-TF approach can target different cell types and brain regions by modifying the promoter, serotype, and administration route.

[0039] Because antibodies can only bind to subsets of tau protein species or conformations, this ZFP-TF approach has advantages over the antibody approach. This may not be sufficient for potent therapeutic effects. In contrast, ZFP-TFs suppress tau expression at the DNA level, reducing levels of all forms of tau, including different tau conformational isomers and post-translational modified forms found throughout tauopathy. Therefore, unlike antibodies, ZFP-TFs are morphologically independent of toxic species. Furthermore, while antibodies are thought to act primarily on extracellular tau, ZFP-TFs can directly reduce total intracellular tau levels, thus indirectly reducing extracellular tau levels. Therefore, this ZFP-TF approach is expected to be more effective because tau exerts its pathology intracellularly and the pathogenic species is unknown. Furthermore, antibodies typically require repeated administration to the periphery, resulting in reduced efficiency in crossing the blood-brain barrier. In contrast, ZFP-TFs require only a single delivery of the expression construct and can be administered via multiple routes, including directly into the brain parenchyma, into the CSF, or intravenously.

[0040] I.ZFP domain targets The ZFP domain of this fusion protein specifically binds to target regions within or near the human MAPT gene. Figure 1 demonstrates the binding of the ZFP domain to the DNA sequence of the MAPT gene. The ZFP domain in this figure has six zinc fingers. However, as will be further discussed below, ZFP domains with fewer or more zinc fingers can also be used.

[0041] The human MAPT gene is approximately 134 kb long and maps to chr17q21.31:45,894,382~46,028,334 (GRCh38.p13). Its nucleotide sequence is available under GenBank accession number ENSG00000186868. The MAPT gene contains 13–16 exons. Exons 1, 4, 5, 7, 9, 11, and 12 are constitutively expressed, while exons 2, 3, and 10 can instead be present in tau protein species derived from spliced ​​mutants, leading to the presence of six distinct tau protein isoforms in the adult brain. The full-length human tau protein has the following sequence: [ka]

[0042] The DNA-binding ZFP domain of the ZFP-TF directs the fusion protein to the target region of the MAPT gene, bringing the transcriptional repression domain of the fusion protein to the target region. The repression domain recruits the transcriptional corepressor complex to change the chromatin to a state that does not tolerate transcription by RNA polymerase II. The target region of the ZFP-TF can be any suitable site within or near the MAPT gene that enables the repression of gene expression. For example, the target region may contain or be adjacent to (either downstream or upstream) a MAPT transcription start site (TSS) or MAPT transcriptional regulatory elements (e.g., promoter, enhancer, RNA polymerase rest site, etc.).

[0043] In some embodiments, the genomic target region is at least 8 bps long. For example, the target region may be between 8 bps and 40 bps long, such as 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bps. The target sequence may be on the sense strand or antisense strand of a gene. To ensure targeting accuracy and reduce off-target binding or activity by ZFP-TFs, preferably, the sequence of the selected MAPT target region has less than 75% homology (e.g., less than 70%, less than 65%, less than 60%, or less than 50%) to a sequence in another gene. In a particular embodiment, the target region of the ZFP-TF has a length of 12–20 (e.g., 12–18, 15–19, 15, 18, or 19) bps and is located within 1500 bps upstream to 1000 bps downstream of the TSS (e.g., -1000 bps to +1000 bps, +750, or +500 bps).

[0044] In some embodiments, the manipulated ZFPs bind to target sites (i.e., target sequences) as shown in the single row of Figure 14 or 16, preferably containing continuous or discontinuous sequences within these target sites, with no or minimal off-target binding or activity detected. In some embodiments, the target sites include and / or are located within any one of sequence numbers 37-88 and 249.

[0045] Other criteria for further evaluating target segments include the prior availability of ZFPs that bind to such segment or related segments, the ease of designing new ZFPs to bind to a given target segment, and the risk of off-target binding.

[0046] II. Zinc finger protein domain Zinc finger proteins, or ZFPs, refer to proteins that have a DNA-binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. The individual DNA-binding units of a ZFP are called "zinc fingers." Each finger typically consists of seven amino acid residues and contains a DNA-binding "recognition helix" that determines the specificity of DNA binding. A ZFP domain has at least one finger, and each finger binds to 2-4 base pairs of nucleotides, usually 3-4 base pairs of DNA (continuous or discontinuous). Each zinc finger typically contains about 30 amino acids that chelate zinc. Manipulated ZFPs can have novel binding specificities compared to naturally occurring ZFPs. Manipulation methods include, but are not limited to, rational design and the selection of various types. Rational design includes, for example, using a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. For example, U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,140,081; 6,200,759; 6,453,242; 6,534,261; 6,979,539; and 8,586,526; and International Patent Applications WO95 / 19431; WO96 / 06166; WO9 See ZFP design methods described in detail in 8 / 53057;WO98 / 53058;WO98 / 53059;WO98 / 53060;WO98 / 54311;WO00 / 27878;WO01 / 60970;WO01 / 88197;WO02 / 016536;WO02 / 099084; and WO03 / 016496. The ZFP domains described herein may be bound to or fused to another molecule (e.g., another domain), such as a protein.Such ZFP fusions may include domains that enable gene activation (e.g., activation domain), gene repression (e.g., repression domain), ligand binding (e.g., ligand binding domain), high-throughput screening (e.g., ligand binding domain), localization hypermutation (e.g., activation-induced cytidine deaminase domain), chromatin modification (e.g., histone deacetylase domain), recombination (e.g., recombinase domain), target integration (e.g., integrase domain), DNA modification (e.g., DNA methyl-transferase domain), base editing (e.g., base editor domain), or targeted DNA cleavage (e.g., nuclease domain). Examples of manipulated ZFP domains are shown in Figures 14 and 16.

[0047] The ZFP domain of the manipulated ZFP fusion may contain at least one zinc finger (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or more). A ZFP domain with one finger typically recognizes target sites containing 3 or 4 nucleotides. A ZFP domain with two fingers typically recognizes target sites containing 6 or 8 nucleotides. A ZFP domain with three fingers typically recognizes target sites containing 9 or 12 nucleotides. A ZFP domain with four fingers typically recognizes target sites containing 12 to 15 nucleotides. A ZFP domain with five fingers typically recognizes target sites containing 15 to 18 nucleotides. A ZFP domain with six fingers can recognize target sites containing 18 to 21 nucleotides.

[0048] In some embodiments, the manipulated ZFP comprises a DNA-binding recognition helix sequence having at least four amino acids of any recognition helix, as shown in Figure 14 or 16. In other embodiments, the manipulated ZFP comprises a DNA-binding recognition helix sequence as shown in Figure 14 or 16. For example, the manipulated ZFP may comprise the sequences F1, F2, F3, F4, F5, or F6, as shown in Figure 14 or 16.

[0049] In some embodiments, the manipulated ZFP includes two adjacent DNA-binding recognition helix sequences, as shown in the single row of Figure 4 or 16. For example, the manipulated ZFP may include sequences F1-F2, F2-F3, F3-F4, F4-F5, or F5-F6 (e.g., F1-F4, F1-F5, or F1-F6), as shown in the single row of Figure 14 or 16.

[0050] In some embodiments, the manipulated ZFP includes a DNA-binding recognition helix sequence as shown in the single row of Figure 4 or 16. For example, the manipulated ZFP may include sequences F1, F2, F3, F4, F5, and F6 (e.g., F1-F4, F1-F5, or F1-F6) as shown in the single row of Figure 14 or 16.

[0051] In some embodiments, the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence shown in the single row of Figure 15. In some embodiments, the sequence shown in the single row of Figure 15 appears after post-translational modification, and therefore the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence. For example, post-translational modification can involve removing an initiator methionine residue from the sequence, as shown in Figure 15.

[0052] The target specificity of the ZFP domain may be improved by mutations in the ZFP backbone sequence, for example, as described in U.S. Patent Publication 2018 / 0087072. Mutations include those added to ZFP backbone residues that can interact nonspecifically with phosphates on the DNA backbone but are not involved in nucleotide target specificity. In some embodiments, these mutations include mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, these mutations include mutating polar amino acid residues to neutral or nonpolar amino acid residues. In further embodiments, mutations are made at positions (-4), (-5), (-9), and / or (-14) relative to the DNA binding helix. In some embodiments, the zinc finger may contain one or more mutations at positions (-4), (-5), (-9), and / or (-14). In further embodiments, one or more zinc fingers in a multifinger ZFP domain may contain mutations at positions (-4), (-5), (-9), and / or (-14). In some embodiments, the amino acids at positions (-4), (-5), (-9), and / or (-14) (e.g., arginine (R) or lysine (K)) are mutated to alanine (A), leucine (L), serine (S), aspartic acid (D), glutamic acid (E), tyrosine (Y), and / or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q. The symbol "^" in Figure 16 indicates that the arginine (R) residue fourth upstream of the first amino acid of the shown recognition helix is ​​changed to glutamine (Q). In each recognition helix sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Thus, the position for the R to Q substitution is numbered (-5).

[0053] In some embodiments, the manipulated ZFP includes a DNA-binding recognition helix sequence and associated skeletal mutations, as shown in Figure 16.

[0054] In some embodiments, the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence shown in the single row of Figure 17. In some embodiments, the sequence shown in the single row of Figure 17 appears after post-translational modification, so the manipulated ZFP described herein includes a recognition helix and a skeletal portion of the sequence. For example, the post-translational modification may involve removing an initiator methionine residue from the sequence, as shown in Figure 17.

[0055] III. Zinc Finger Protein Transcription Factors The ZFP domains described herein may be fused to transcription factors. In some embodiments, the fusion protein contains a DNA-binding zinc finger protein (ZFP) domain and a transcription factor domain (i.e., ZFP-TF). In some embodiments, the transcription factor may be a transcriptional repressor domain, where the ZFP and repressor domains may be linked to each other directly by peptidyl linkage, a peptide linker, or by dimerization (e.g., through a leucine zipper, a STAT protein N-terminal domain, or an FK506-binding protein). As used herein, “fusion protein” refers to a complex of polypeptides having covalently linked domains and polypeptides linked to each other via non-covalent bonds. The transcriptional repressor domain can be linked to the ZFP domain at any suitable position, including the C-terminus or N-terminus of the ZFP domain.

[0056] In some embodiments, the ZFP-TFs bind to their targets with a KD of less than approximately 25 nM and repress the transcription of the human MAPT gene by 20% or more (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more). In some embodiments, two or more of the ZFP-TFs are expressed intracellularly to synergistically regulate intracellular MAPT expression (see, for example, U.S. Patent Applications Publications 2020 / 0101133 and 2020 / 0109406). Such synergistic ZFPs may be linked by a 2A linker peptide, e.g., T2A GSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 19). Therefore, to achieve optimal repression of MAPT expression, two or more of the ZFP-TFs may be used simultaneously in a patient if the ZFP-TFs bind to different target regions of the MAPT gene.

[0057] In some embodiments, the ZFP-TF comprises one or more zinc finger domains. The domains may be linked together via an extensible flexible linker, for example, one domain comprising one or more (e.g., 4, 5, or 6) zinc fingers and another domain comprising an additional one or more (e.g., 4, 5, or 6) zinc fingers. In some embodiments, the linker is a standard interfinger linker, such that the finger array comprises one DNA-binding domain comprising 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a flexible linker. For example, two ZFP domains may be linked to a transcriptional repressor TF in configuration (N-terminus to C-terminus) ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins fused via a linker).

[0058] In some embodiments, ZFP-TFs are "two-handed," meaning they contain two zinc finger clusters (two ZFP domains) separated by intervening amino acids, so that the two ZFP domains bind to two discontinuous target sites. An example of a two-handed type of zinc finger-binding protein is SIP1, where a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus (see Remacle et al., EMBO J. (1999) 18(18):5073-84). Each of these zinc finger clusters can bind to a specific target sequence, and the space between the two target sequences can contain many nucleotides.

[0059] In some embodiments, the manipulated ZFP-TFs described herein bind to a target site as shown in a single row in Figure 14 or 16, along with undesirable or little detectable off-target binding or activity. Off-target binding may be determined, for example, by measuring the activity of the ZFP-TF in an off-target gene. In some embodiments, the manipulated ZFP-TFs described herein include a DNA binding recognition helix sequence shown in Figure 14 or 16. In some embodiments, the manipulated ZFP-TFs described herein include two adjacent DNA binding recognition helix sequences shown in a single row in Figure 14 or 16. In some embodiments, the manipulated ZFP-TFs described herein include a DNA binding recognition helix sequence shown in a single row in Figure 14 or 16.

[0060] A. Transcriptional repressor domain This ZFP-TF comprises the engineered ZFP domains described herein and one or more transcriptional repressor domains that weaken the transcriptional activity of MAPT genes. The one or more engineered ZFP domains and one or more transcriptional repressor domains may be linked by a flexible linker. Non-exclusive examples of transcriptional repressor domains include the KRAB domain of KOX1 or ZIM3 (or any other KRAB domain-containing protein; see, e.g., Alerasool et al., Nature Methods (2020) 17:1093-6), KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGF-beta inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, TRa, histone methyltransferase, histone deacetylase (HDAC), nuclear hormone receptors (e.g., estrogen receptor or thyroid hormone receptor), members of the DNMT family (DNMT1, DNMT3A, DNMT3B, etc.), Rb, and MeCP2. See, for example, Bird et al., Cell (1999) 99:451-4; Tyler et al., Cell (1999) 99:443-6; Knoepfler et al., Cell (1999) 99:447-50; and Robertson et al., Nature Genet. (2000) 25:338-42. Further exemplary repressive domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.

[0061] In some embodiments, the transcriptional repressor domain contains a sequence from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank number NM_015394.4). An example KRAB domain sequence is as follows: [ka] Variants of this KRAB sequence may also be used, as long as they have the same or similar transcriptional repression function.

[0062] B. Peptide Linker The ZFP domain and the transcriptional repression domain of the ZFP-TF and / or the zinc finger within the ZFP domain may be linked through a peptide linker, for example, an uncleavable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more amino acids). Typically, a preferred linker is a flexible amino acid subsequence synthesized as a recombinant fusion protein. In some embodiments, the zinc finger is linked so that there are no gaps between the linked module target subsites in the target nucleic acid molecule. In other embodiments, the zinc finger is linked by a linker designed to allow the linked modules to bind to target sites having a gap of 1, 2, or 3 base pairs between the linked module target subsites in the target nucleic acid molecule. See, for example, U.S. Patent No. 8,772,453.

[0063] In some embodiments, the peptide linker is 3 to 20 amino acid residues in length and is rich in G and / or S. Non-limiting examples of such linkers include the G4S type linker (SEQ ID NO: 18), i.e., a linker containing one or more (e.g., 2, 3, or 4) GGGGS (SEQ ID NO: 15) motifs, or variations of the motif (such as those having 1, 2, or 3 amino acid insertions, deletions, and substitutions from the motif).

[0064] Methods for designing linkers and exemplary linkers that may be used to ligate the ZFP domain and the transcriptional repressor domain and / or zinc fingers within the ZFP domain of this ZFP-TF are described in U.S. Patent Nos. 6,479,626; 7,851,216; 8,772,453; 9,394,531; 9,567,609; and 10,724,020; and PCT Publication Nos. WO1999 / 045132; WO2001 / 053480; WO2009 / 154686; WO2011 / 139349; WO2015 / 031619; and WO2017 / 136049. The proteins described herein may include any combination of appropriate linkers.

[0065] Non-restrictive examples of linkers include DGGGS (SEQ ID NO: 3), TGEKP (SEQ ID NO: 4), LRQKDGERP (SEQ ID NO: 5), GGRR (SEQ ID NO: 6), GGRRGGGS (SEQ ID NO: 7), LQRDGERP (SEQ ID NO: 8), LRQKDGGGSERP (SEQ ID NO: 9), LRQKD(G3S)2ERP (SEQ ID NO: 10), TGSQKP (SEQ ID NO: 11), LRQKDAARGS (SEQ ID NO: 13), and LRQKDAARGSGG (SEQ ID NO: 14). Additional exemplary linkers for linking zinc fingers and / or domains are listed in Table 1. The finger-finger linkers listed in Table 1 include a portion of the skeletal sequence, e.g., FQ or FA.

[0066] Table 1 demonstrates exemplary alternative peptide linkers that may be used to link zinc finger amino acid sequences and / or ZFPs and functional domain sequences shown in Figure 14 or 16. [Table 1]

[0067] In some embodiments, the manipulated ZFP described herein includes two adjacent DNA-binding recognition helix sequences linked together as shown in the single row of Figure 14 or 16. For example, the manipulated ZFP may include sequences F1-F2, F2-F3, F3-F4, F4-F5, or F5-F6 as shown in the single row of Figure 14 or 16. In other embodiments, different linkers from the same linker category may be used.

[0068] In some embodiments, the modified ZFPs described herein include a DNA-binding recognition helix sequence that is ligated as shown in a single row in Figure 14 or 16. For example, the manipulated ZFP may include ligated sequences of F1-F4, F1-F5, or F1-F6, as shown in a single row in Figure 14 or 16. In other embodiments, one or more different linkers from the same linker category may be used. In some embodiments, the manipulated ZFP-TFs described herein include an amino acid sequence shown in a single row in Figure 15 or 17. In some embodiments, the sequence shown in a single row in Figure 15 or 17 appears after post-translational modification, so the manipulated ZFP-TFs described herein include the recognition helix, backbone, and linker portion of the sequence. In some embodiments, the amino acid sequence shown in a single row in Figure 15 or 17 appears after post-translational modification, so the manipulated ZFP-TFs described herein include the sequence. For example, the post-translational modification may involve removing an initiator methionine residue from the sequence, as shown in Figure 15 or 17.

[0069] IV. Expression of ZFP-TF The ZFP-TFs of this disclosure may be introduced into a patient through a nucleic acid molecule encoding them. The nucleic acid molecule may be an RNA or cDNA molecule. The nucleic acid may be introduced into the patient's brain by injection of a composition comprising a lipid:nucleic acid complex (e.g., liposome). Alternatively, the ZFP-TFs may be introduced into a patient via a nucleic acid expression vector containing a sequence encoding the ZFP-TFs. The expression vector may include expression regulatory sequences such as a promoter, enhancer, transcription signal sequence, and transcription termination sequence that enable the expression of the ZFP-TF encoding sequence in cells of the nervous system. In some embodiments, the expression vector remains present in the cell as a stable episome. In other embodiments, the expression vector is integrated into the cell's genome.

[0070] In some embodiments, the promoter on the vector for directing ZFP-TF expression in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, the Roussarcoma virus (RSV) long-terminal repeat (LTR) promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer), the CMV pre-early promoter, the Simian virus 40 (SV40) promoter, the dihydrofolate reductase (DHFR) promoter, the β-actin promoter, the phosphoglycerate kinase (PGK) promoter, the EFLα promoter, and the Moloney's mouse leukemia virus (MoMLV). This includes LTR, creatine kinase-based (CK6) promoter, transthyretin promoter (TTR), thymidine kinase (TK) promoter, tetracycline-responsive promoter (TRE), hepatitis B virus (HBV) promoter, human α1-antitrypsin (hAAT) promoter, chimeric liver-specific promoter (LSP), factor E2 (E2F) promoter, human telomerase reverse transcriptase (hTERT) promoter, CMV enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene (1991) 108(2):193-9), and RU-486-responsive promoter. Neuron-specific promoters such as the synapsin I promoter, calcium / calmodulin-dependent protein kinase II (CamKII) promoter, methyl CpG-binding protein 2 (MeCP2) promoter, choline acetyltransferase (ChAT) promoter, calbindin (Calb) promoter, CAMKII promoter, PrP promoter, and GFAP promoter, or engineered or native promoters that restrict expression to neurons and glial cells may also be used. Astrocyte-specific promoters such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family, member L1 (Aldh1L1) promoter may also be used.Oligodendrocyte-specific promoters, such as the Olig2 promoter, may also be used. Furthermore, the promoter may include one or more autoregulatory elements to which ZFP-TFs can bind and suppress their own expression levels to a predetermined threshold. See U.S. Patent 9,624,498.

[0071] Any method for introducing a nucleotide sequence into a cell may be used, but is not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes combined with nuclear localization signals, native liposomes (e.g., exosomes), or viral transduction.

[0072] Viral transduction may be used for in vivo delivery of the expression vector. Various viral vectors known in the art, such as vaccinia vectors, adenovirus vectors, lentiviral vectors, poxyvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, and hybrid viral vectors, may be adapted by those skilled in the art for use in this disclosure. In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors are particularly suitable for CNS gene delivery because they infect both dividing and non-dividing cells, exist as stable episomal structures for long-term expression, and have very low immunogenicity (Hadaczek et al., Mol Ther. (2010) 18:1458-61; Zaiss, et al., Gene Ther. (2008) 15:808-16). Any suitable AAV serotype may be used. For example, AAV is a serotype or pseudotype such as AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9, or AAV2 / 6 / 9, or a serotype that is a variant or derivative of one of the AAV serotypes listed herein (i.e., AAV derived from multiple serotypes; for example, the rAAV contains an AAV2 reverse terminal repeat (ITR) and an AAV8, 5, 6, or 9 capsid in its genome). In some embodiments, the expression vector is an AAV virus vector, and the genome is introduced into target human cells by recombinant AAV virions containing a construct, the vector having ITR sequences at both ends to enable the production of AAV virions in a production system such as an insect cell / baculovirus production system or a mammalian cell production system. AAV may be engineered so that its capsid protein reduces immunogenicity or enhances its transduction ability in humans or non-human primates. In some embodiments, AAV9 is used. The viral vectors described herein may be generated using methods known in the art.Any suitable tolerant cell type or packaging cell type may be used to produce viral particles. For example, mammalian (e.g., 293) or insect (e.g., sf9) cells may be used as packaging cell lines.

[0073] V. Pharmaceutical Applications This ZFP-TF can be used to treat patients who require downregulation of tau expression. Patients have or are at risk of developing neurodegenerative diseases such as Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, traumatic brain injury, paroxysmal disorders, corticobasal degeneration, Parkinson's disease, Lewy body dementia (DLB), and / or other tauopathies. Patients at risk include those with a genetic predisposition, those who have suffered repeated brain injuries such as concussions, and those who have been exposed to environmental neurotoxins. This disclosure provides a method for treating neurological diseases (e.g., tauopathies such as neurodegenerative diseases) in subjects such as human patients requiring treatment, comprising introducing a therapeutically effective amount (e.g., an amount that allows for sufficient suppression of MAPT expression) of ZFP-TF (e.g., an rAAV vector expressing it) into the nervous system of the subject. The term "treat" includes symptom relief, prevention of symptom onset, delay of disease progression, improvement of quality of life, and improvement of survival.

[0074] This disclosure provides a pharmaceutical composition comprising a viral vector such as rAAV, in which a recombinant genome contains an expression cassette for ZFP-TF. The pharmaceutical composition (e.g., artificial cerebrospinal fluid or aCSF) may further comprise a pharmaceutically acceptable carrier such as water, saline (e.g., phosphate-buffered saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. Furthermore, the composition may comprise auxiliary substances such as wetting agents or emulsifiers, pH buffers, stabilizers, or other reagents that enhance the efficacy of the pharmaceutical composition. The pharmaceutical composition may comprise a delivery vehicle such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.

[0075] Cells targeted by the therapeutic agents of this disclosure are cells in the brain, including, but are not limited to, nerve cells (e.g., motor neurons, sensory neurons, dopaminergic neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons); glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglia); ependymal cells; or neuroepithelial cells.

[0076] The brain regions targeted by the treatment may be those most significantly affected in tauopathy, such as specific cortical regions, the entorhinal cortex, hippocampus, cerebellum, globus pallidus, thalamus, midbrain, caudate nucleus, putamen, substantia nigra, pons, and medulla oblongata. These regions can be directly reached by intrahippocampal injection, intracerebral injection, intracisional (ICM) injection, or more commonly, intraparenchymal, intrathalamic, intraventricular (ICV) injection, intrathecal, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, the viral vector spreads throughout the CNS tissue after direct administration into the cerebrospinal fluid (CSF), for example, via intrathecal and / or intracerebral injection, or intracisional or intraventricular injection. In other embodiments, the viral vector crosses the blood-brain barrier and is widely distributed throughout the target CNS tissue after intravenous administration. In other embodiments, the viral vector is delivered directly to the target region via intraparenchymal injection. In some cases, the viral vector may undergo retrograde or anterograde transport to other brain regions following intracellular delivery. In some aspects, the viral vector has a clear CNS tissue targeting capability (e.g., CNS tissue tropism) that achieves highly efficient, stable, and non-toxic gene transfer.

[0077] For example, a pharmaceutical composition may be administered to a patient via intracerebroventricular administration, for example, into the ventricular region of the patient's forebrain, such as the right ventricle, left ventricle, third ventricle, or fourth ventricle. A pharmaceutical composition may also be administered to a patient by intracerebral administration, for example, by injection of the composition into or near the cerebrum, medulla, pons, cerebellum, thalamus, striatum, caudate nucleus, putamen, substantia nigra, midbrain, caudate nucleus, putamen, olfactory bulb, locus coeruleus, brainstem, globus pallidus, hippocampus, cerebral cortex, intracranial cavity, meninges, dura mater, arachnoid mater, or pia mater of the brain. Intracerebral administration may optionally involve administration of the drug into the cerebrospinal fluid (CSF) in the subarachnoid space surrounding the brain.

[0078] In some cases, intracerebral administration includes injection using stereotactic surgery. Stereotactic fixation procedures are well known in the art and typically involve the use of a computer and a three-dimensional scanning device used together to guide injection into a specific intracerebral region, e.g., the ventricular region. Microinjection pumps (e.g., World Precision Instruments) may also be used. In some cases, microinjection pumps are used to deliver compositions containing viral vectors. In some cases, the injection rate of the composition is in the range of 0.1 μl / min to 100 μl / min. As will be understood by those skilled in the art, the injection rate depends on a variety of factors, including, for example, the species of the subject, the age of the subject, the weight / size of the subject, the serotype of AAV, the required dose, and the intracerebral region to be targeted. Other injection rates may be considered appropriate by those skilled in the art in particular in specific circumstances.

[0079] Delivery of rAAV to the target may be achieved, for example, by intravenous administration. In certain cases, rAAV (e.g., 10 10 ~10 15It may be preferable to deliver Vg) locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neurons, glial cells, meninges, astrocytes, oligodendrocytes, microglia, interstitial spaces, etc. In some cases, recombinant AAV may be delivered directly to the CNS by injection into the ventricular region or nearby, in addition to the hippocampus, cerebral cortex, cerebellar lobules, cerebellum, cerebrum, medulla, pons, thalamus, striatum, caudate nucleus, putamen, substantia nigra, midbrain, caudate nucleus, putamen, olfactory bulb, locus coeruleus, brainstem, globus pallidus, intracranial cavity, meninges, dura mater, arachnoid mater, or pia mater of the brain, or other brain regions. AAV may be delivered using needles, catheters, or related devices, employing neurosurgical techniques known in the art, such as stereotactic injection (see, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum Gene Ther. (2000) 11:2315-29).

[0080] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have meanings generally understood by those skilled in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials may also be used in the implementation or testing of this disclosure. In case of any conflict, this specification, including definitions, shall prevail. Generally, the nomenclature and techniques used in relation to neurology, medicine, biomedical and pharmaceutical chemistry, and cell biology described herein are well known and commonly used in the art. Enzyme reactions and purification techniques shall be carried out in accordance with the manufacturer's specifications, either as generally achieved in the art or as described herein. Furthermore, unless otherwise required by context, singular terms shall include plural forms, and plural terms shall include singular forms. Throughout this specification and its embodiments, the words “have” and “comprising,” or variations such as “has,” “having,” “comprises,” or “comprising,” are understood to mean including the integer or group of integers described, but not to exclude any other integer or group of integers. All publications and other references mentioned herein are incorporated in their entirety by reference. Many documents are cited herein, but this citation does not imply that any of these documents constitute common general knowledge in the art. The terms “approximately” or “about,” as used herein, refer to a value similar to the given reference value when applied to one or more target values. In particular embodiments, unless otherwise stated or evident from the context, the term refers to a range of values ​​that fall within (greater than or less than) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction of the given reference value.

[0081] To better understand the present invention, the following examples are provided. These examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention.

[0082] VI. Exemplary Embodiments Non-limiting exemplary embodiments of this disclosure are described below. 1. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 52288. 2. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 52389. 3. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 52364. 4. A ZFP-TF fusion protein that binds to a target sequence and contains a DNA-binding zinc finger recognition helix sequence corresponding to the ZFP ID shown in the single row of Figure 14, where the ZFP ID is 57890. 5. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71214. 6. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71218. 7. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71225. 8. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71227. 9. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71249. 10. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71304. 11. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71309. 12. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71310. 13. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71312. 14. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71341. 15. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71343. 16. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71345. 17. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71347. 18. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71351. 19. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71352. 20. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71357. 21. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71364. 22. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71366. 23. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71370. 24. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71373. 25. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71374. 26. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71377. 27. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71378. 28. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71385. 29. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71389. 30. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71391. 31. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71393. 32. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71395. 33. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71397. 34. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71398. 35. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71399. 36. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71400. 37. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71401. 38. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71402. 39. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71414. 40. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71420. 41. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71421. 42. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71424. 43. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71437. 44. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71447. 45. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71448. 46. ​​A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71453. 47. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71467. 48. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71468. 49. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71470. 50. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71472. 51. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71485. 52. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence that binds to a target sequence and corresponds to the ZFP ID shown in the single row of Figure 14, wherein the ZFP ID is 71503. 53. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 65918. 54. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73015. 55. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73016. 56. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to the ZFP ID shown in the single row of Figure 16, wherein ZFPI5D is 73017. 57. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73018. 58. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73019. 59. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73020. 60. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73021. 61. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73029. 62. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73030. 63. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73031. 64. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73032. 65. A ZFP-TF fusion protein that binds to a target sequence and contains a skeletal mutation corresponding to the DNA-binding zinc finger recognition helix sequence and ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73034. 66. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73035. 67. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73120. 68. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73121. 69. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73122. 70. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73123. 71. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73124. 72. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73125. 73. A ZFP-TF fusion protein that binds to a target sequence and contains a skeletal mutation corresponding to the DNA-binding zinc finger recognition helix sequence and ZFP ID shown in a row in Figure 72, wherein the ZFP ID is 73126. 74. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73127. 75. A ZFP-TF fusion protein that binds to a target sequence and contains a skeletal mutation corresponding to the DNA-binding zinc finger recognition helix sequence and ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73128. 76. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73129. 77. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73130. 78. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73131. 79. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73133. 80. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73190. 81. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations corresponding to a ZFP ID as shown in the single row of Figure 16, wherein the ZFP ID is 73191. 82. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73192. 83. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73193. 84. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73194. 85. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73195. 86. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and a skeletal mutation corresponding to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73196. 87. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73197. 88. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73198. 89. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73199. 90. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73200. 91. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73201. 92. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73202. 93. A ZFP-TF fusion protein comprising a DNA-binding zinc finger recognition helix sequence and skeletal mutations that bind to a target sequence and correspond to the ZFP ID shown in the single row of Figure 16, wherein the ZFP ID is 73203. 94. A ZFP-TF fusion protein according to any one of Embodiments 1 to 93, wherein the ZFP-TF fusion protein contains a transcriptional repressor domain. 95. A ZFP-TF fusion protein of Embodiment 94, wherein the transcriptional repressor domain includes a KRAB domain. 96. The ZFP-TF fusion protein of Embodiment 94, wherein the transcriptional repression domain includes SEQ ID NO: 2. 97. A method for inhibiting tau expression in human brain cells, comprising introducing one of the fusion proteins from Embodiments 1 to 96 into the cells. 98. A method for inhibiting tau expression in human brain cells, comprising introducing two or more different fusion proteins from any one of Embodiments 1 to 96 into cells. 99. A method for inhibiting tau expression in human brain cells, comprising introducing the fusion proteins of Embodiment 4 (ZFP ID 57890) and Embodiment 53 (ZFP ID 65918) into cells. 100. The method of Embodiment 98 or 99, wherein each of the fusion proteins comprises a transcriptional repressor domain, and optionally the transcriptional repressor domain is a KRAB domain. 101. Any one of the embodiments 98 to 100, wherein the fusion protein is co-delivered. 102. Any one of embodiments 98 to 100, wherein the fusion protein is linked by a 2A self-cleaving peptide.

[0083] Examples Example 1: Screening of anti-tau ZFP-TF To identify ZFP-TFs that suppress tau expression, a library of 370 ZFP-TFs predicted to bind to 15, 18, or 19 bp sequences in the human MAPT gene region, extending 1000 bp upstream to 500 bp downstream of the TSS, was designed and screened for tau repressive activity. The target region of the ZFP-TF is indicated by a pentagon in Figure 2. The direction of the pentagon indicates the DNA strand to which the ZFP-TF binds (5' to 3'). In this study, the KRAB domain sequence (SEQ ID NO: 2) was used as a transcriptional repressor and fused to the C-terminus of the ZFP domain. The sequences of 52 representative ZFP-TFs are shown in Figure 14 below. Templates for in vitro transcription were generated from pVAX-ZFP or pVAX-GFP plasmids using PCR (forward primer GCAGAGCTCTCTGGCTAACTAGAG (SEQ ID NO: 16); reverse primer T(180)CTGGCAACTAGAAGGCACAG (SEQ ID NO: 17)). Following the manufacturer's instructions, messenger RNA was synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Thermo Fisher Scientific) and purified using an RNeasy96 column (Qiagen). The mRNA encoding each ZFP-TF was then aliquoted into 96-well plates in six dilutions.

[0084] Screening was performed using the SK-N-MC human neuroepithelial cell line. SK-N-MC cells express high levels of human tau, making them suitable for testing ZFP-TF, which reduces tau expression. SK-N-MC cells were cultured in tissue culture flasks until confluence. Cells were seeded at 150,000 cells / well into 96-well plates and resuspended in Amaxa® SF solution. Cells were then mixed with ZFP-TF mRNA (6 doses: 3, 10, 30, 100, 300, and 1000 ng) and transferred to Amaxa® shuttle plate wells. Cells were transfected using an Amaxa® Nucleofector® instrument (Lonza; program CM-137). Eagle MEM cell medium was added to each well of the plate. Cells were transferred to 96-well tissue culture plates and incubated at 37°C for 20 hours.

[0085] Next, cells were lysed and reverse transcription was performed using a C2CT kit according to the manufacturer's instructions. MAPT expression levels, normalized to the geometric mean of the expression levels of housekeeping genes Atp5b and Eif4a2, were measured using TaqMan quantitative polymerase chain reaction (qPCR). Mock transfections and transfections using ZFP-TF, both known not to target MAPT, were used as negative controls.

[0086] Dose-dependent suppression of tau by more than 50% was found in approximately 29% of the ZFP-TFs tested. The maximum suppression achieved was 100%, but ZFP-TFs that suppressed tau to a lower degree were also identified (e.g., approximately 90%, 75%, or 50% at the highest dose). Figures 3A-D show the screening data. In addition, 52 representative ZFP-TFs were tested in human iPSC-derived neurons (data not shown).

[0087] Example 2: Optimization of target specificity of anti-tau ZFP-TF To optimize the target specificity of ZFP-TFs, up to three arginine (R) residues in the zinc fingers were mutated to glutamine (Q). These arginine residues are located at the fourth amino acid upstream of the first amino acid of the DNA-binding helix and are within the β-sheet of each zinc finger (Figures 4, 5A, and 5B). These residues are involved in conserved nonspecific contact with the phosphate backbone of the target DNA. Each parental ZFP-TF was mutated at the fourth position upstream of the first amino acid of the indicated helix to generate up to seven different R→Q mutants. The sequences of 41 representative R→Q mutant ZFP-TFs are shown in Figure 16 below. See also Miller et al., Nat Biotechnol. (2019) 37:945-52.

[0088] Example 3: Screening of R→Q mutants of parental anti-tau ZFP-TF To identify the R→Q mutant of the parental ZFP-TF that best suppresses human tau expression, a library of approximately 340 mutant ZFP-TFs was screened as described in Example 1. The →Q mutant ZFP-TFs were also tested in human iPSC-derived neurons and primary mouse cortical neurons transduced with the AAV encoding each ZFP-TF.

[0089] AAV Production Recombinant adeno-associated virus vectors (rAAV) were generated by triple transfection. Briefly, HEK293 cells were seeded in a 10-layer CellSTACK chamber (Corning, Acton, MA) and grown to 80% density for 3 days. Three plasmids—(i) an AAV helper plasmid containing the Rep and Cap genes, (ii) an adenovirus helper plasmid containing the adenovirus helper gene, and (iii) a transgene plasmid containing a sequence in which the AAV2 reverse-terminal repeat is packaged—were transfected into the cells using calcium phosphate. After 3 days, the cells were harvested. The cells were then lysed by three freeze / thaw cycles, and cell debris was removed by centrifugation. rAAV was precipitated using polyethylene glycol. After resuspending, the virus was purified by overnight ultracentrifugation on a cesium chloride gradient. The virus was formulated by dialysis and then filtered. After adjusting the titer (viral genome / ml) of all AAV batches by diluting with PBS + 0.001% Pluronic F-68, the AAV was dispensed into single-use portions and stored at -80°C until use. It was not refrozen after thawing.

[0090] Human iPSC-derived GABAergic neurons were purchased from Cellular Dynamics International and seeded at a density of 40,000 cells per well in 96-well plates coated with poly-L-ornithine and laminin, and maintained according to the manufacturer's instructions. Cells were infected with AAV expressing the desired ZFP-TF at the MOI indicated 48 hours after plating and maintained for up to 32 days (50-75% medium change every 3-5 days). Cells were harvested at the end of the experimental period, RNA was isolated, and RT-qPCR was performed for gene expression analysis. For microarray analysis, cells were transfected with 1E5VG / cell 48 hours after seeding and harvested 19 days after viral transfection.

[0091] Primary mouse neuron culture and ZFP-TFAAV infection Primary mouse cortical neurons (MCNs) were purchased from Gibco. Cells were seeded at 50,000 or 200,000 cells / well in 96-well or 24-well plates coated with poly-D-lysine, respectively, and maintained according to the manufacturer's specifications using Gibco Neurobasal Medium containing GlutaMAX® I supplement, B27 supplement, and penicillin / streptomycin. 48 hours after seeding (in DIV2), 50,000 cells / well from 96-well plates were infected with AAV-ZFP at the specified MOI, harvested after 7 days (in DIV9 with 50% medium change every 3-4 days), and subsequently subjected to RNA isolation and gene expression analysis by RT-qPCR. Alternatively, 200,000 neurons / well from 24-well plates were treated with 1E5VG / cell to ensure 100% transduction and treated similarly for microarray analysis in DIV9.

[0092] Figure 6 shows screening data for representative R→Q mutant ZFP-TFs. Figures 7A and 7B show dose-dependent activity of representative ZFP-TFs and their R→Q mutants in human iPSC-derived neurons and mouse primary neurons transduced with AAVs encoding each ZFP-TF.

[0093] The data in these figures show that the R→Q mutant ZFP-TF exhibited a broad tau inhibitory activity profile, with human tau mRNA repression in human iPSC-derived neurons ranging from approximately 45% to 100% at the highest dose tested. Since the expression of representative R→Q mutant ZFP-TF in primary cortical mouse neurons did not result in dose-dependent suppression of overall mouse MAPT after 7 days, it is also clear that the tested ZFP-TF specifically targets human MAPT.

[0094] Example 4: Off-target activity of anti-tau ZFP-TF To evaluate the off-target effects of R→Q mutants of parental ZFP-TFs on overall gene expression, microarray (Clariom S Array and Clariom D Array) experiments were performed on total RNA isolated from human iPSC-derived neurons and primary mouse cortical neurons treated with AAV encoding representative R→Q mutant ZFP-TFs. Quantitative RT-qPCR analysis was also performed to compare the effects of these ZFP-TFs on transcript expression levels within tau loci (human tau and STH) and on the expression levels of obvious off-target genes identified in microarray studies (CPNE6 and IGF2).

[0095] Microarray analysis Microarray analysis was performed according to the manufacturer's protocol (Thermo Fisher Scientific), and assay results were analyzed using TAC4 software. RT-qPCR analysis was used to further investigate apparent off-targets with FDR-corrected p-values ​​≤0.05.

[0096] Gene expression analysis using RT-qPCR Reverse transcription was performed using the C2CT kit according to the manufacturer's instructions. Transcription levels of Mapt, Sth, Cpne6, and Igf2 were measured using TaqMan quantitative polymerase chain reaction (qPCR). Gene expression levels were normalized to the geometric mean of the expression levels of housekeeping genes Atp5b, Eif4a2, and Gapdh. Mock transfections and transfections using ZFP-TF, known not to target MAPT, STH, CPNE6, and IGF2, were used as negative controls.

[0097] Figure 8 shows microarray results for six representative R→Q mutant ZFP-TFs in human iPSC-derived neurons and primary mouse cortical neurons. Figure 9 shows RT-qPCR results for Mapt, Sth, Cpne6, and Igf2 gene expression in human iPSC-derived neurons transduced with representative R→Q mutant ZFP-TFs.

[0098] We found that the R→Q mutant ZFP-TF exhibits low or no detectable off-target activity.

[0099] Example 5: In vivo resistance of representative R→Q mutants of anti-tau ZFP-TF To evaluate the potential adverse effects of ZFP-TF-mediated tau suppression after administration of stereotactic AAV9 in the hippocampus, transgene expression and neuroinflammatory marker expression levels were assessed by quantitative RT-qPCR analysis of ZFP-TF, tau, Gfap, Iba1, and NeuN expression in hippocampal tissue isolated from the brains of adult C57BL / 6 mice 4 weeks after treatment with AAVs encoding R→Q mutants of parental ZFP-TF with various human tau-suppressing activities.

[0100] To collect hippocampal tissue for subsequent analysis, mice were perfused with PBS, their brains were removed, and dissected on ice. The hippocampus was cut with a razor blade or scalpel, and the cut tissue was divided into two portions designated for RNA and DNA analysis. The finely chopped tissue was then rapidly frozen in liquid nitrogen and maintained at -80°C until analysis.

[0101] Reverse transcription was performed using the High Capacity RT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Expression levels of ZFP-TF, Mapt, Gfap, Iba1, and NeuN were measured using TaqMan quantitative polymerase chain reaction (qPCR). Gene expression levels were normalized to the geometric mean of the expression levels of housekeeping genes Atp5b, Eif4a2, and Gapdh. Vehicle treatment and treatment with AAV-expressing green fluorescent protein (GFP) were used as negative controls.

[0102] Most of the R→Q mutant ZFP-TFs tested were found to be well tolerated in vivo at maximum dose. Several candidates did not show significant changes in the expression levels of neuroinflammatory markers. Furthermore, some candidates did not cross-react to mouse tau, demonstrating high specificity. Adult mice treated with representative R→Q mutant ZFP-TFs showed stable mouse Mapt expression, indicating that these ZFP-TFs specifically target the human MAPT gene. However, one fusion protein resulted in decreased ZFP-TF expression, while another resulted in elevated expression levels of neuroinflammatory markers Gfap and Iba1. None of the tested ZFP-TFs resulted in decreased expression levels of the neuronal marker NeuN. These findings suggest that the tau ZFP-TF candidates tested in this study have desirable in vivo profiles in mice, with minimal evidence of elevated neuroinflammatory markers and neuronal loss following expression in the mouse brain (Figure 10).

[0103] Example 6: In vivo reduction of human tau mRNA and protein by representative R→Q variants of anti-tau ZFP-TF To evaluate the reduction of human tau mRNA and protein in vivo, anti-tau ZFP-TF was administered to htau mice (B6.Cg-Mapttm1(EGFP)KltTg(MAPT)8cPdav / J, JacksonLabs) as described herein. htau mice express the wild-type human MAPT gene against a background of endogenous (mouse) Mapt, which has been functionally knocked out by inserting a GFP expression construct into the first coding exon of mouse Mapt. Mice received stereotactic dual, bilateral injections into the dorsal and ventral hippocampi of an AAV9 vector encoding one of the following: vehicle, 73133, 73034, 73122, or 65918.T2A.57890 (a construct co-expressing two ZFPs designed to target a site in the mouse Mapt gene). ZFP-TF73133, 73034, and 73122 were tested at doses of 3E9, 1E0, and 3E10VG per hemisphere, while ZFP-TF65918.T2A.57890 was tested at 3E9VG per hemisphere only. Another group of mice was sacrificed at 3 or 6 months post-injection for molecular, biochemical, and immunohistological endpoints.

[0104] In hippocampal tissue isolated from the brains of htau mice, the expression levels of ZFP transgenes, human MAPT, endogenous mouse MAPT, and a GFP cassette that interferes with endogenous MAPT translation were evaluated by quantitative RT-qPCR. Neuroinflammatory and neuronal markers such as Gfap, Iba1, and NeuN were also evaluated. Furthermore, the levels of an intron transcript of an unknown function within human MAPT, named Cytohin (STH), were assessed.

[0105] For subsequent analysis, mice were perfused with PBS, their brains were removed, and dissected on ice to collect hippocampal tissue. For the right hemisphere, the hippocampus was dissected with a razor blade or scalpel, and the dissected tissue was divided into two portions designated for RNA and protein analysis. The finely chopped tissue was then rapidly frozen in liquid nitrogen and maintained at -80°C until analysis. For the left hemisphere, the hippocampus was drop-fixed in 10% NBF for 24 hours, transferred to 70% ethanol, and then embedded in paraffin blocks for insitu hybridization (ISH) analysis.

[0106] For mRNA analysis, total RNA was extracted using MagMax for the Microarray RNA Extraction Kit (Thermo Fisher Scientific), and reverse transcription was performed using the High Capacity RT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. The expression levels of target genes were measured using TaqMan® quantitative polymerase chain reaction (qPCR). ZFP transgene expression was normalized to the amount of total RNA used as input for the RT-qPCR reaction. The expression levels of all other target genes were normalized to the geometric mean of the expression levels of the housekeeping genes Atp5b, Eif4a2, and Gapdh. All treatment groups were scaled to the mean of the normalized levels observed for the vehicle group.

[0107] For protein analysis, human tau protein levels were quantified using the whole human tau ELISA (Thermo Fisher Scientific) kit according to the manufacturer's protocol. Total tau levels were normalized to total protein determined by BCA protein assay. All treatment groups were scaled to the mean of the normalized levels observed for the vehicle group.

[0108] For ISH analysis, paraffin-embedded blocks were cut according to the manufacturer's protocol (Advanced Cell Diagnostics) and treated for multiple RNAscope / immunofluorescence staining. The nuclei of the sections were stained with DAPI, human MAPT transcripts were stained with RNAscope, and NeuN protein was stained with immunofluorescence.

[0109] Each ZFP-TF was expressed at similar levels in a sustained, dose-dependent manner across all constructs tested for each corresponding dose at both 3-month and 6-month time points. Human-targeted anti-tau ZFP-TFs were able to specifically reduce human tau mRNA by up to 93% (73133) or 54–61% (73034 and 73122) at the highest doses tested at both time points. ZFP-TFs 73133 and 73034 resulted in a dose-dependent reduction of tau mRNA, while 73122 showed a plateau effect across the entire range of tested doses (approximately a 46–68% reduction). Similar results were observed for all ZFP-TFs tested and for intronic MAPT transcript STH for each time point. There was no significant reduction in endogenous mouse Mapt or GFP expression for 73133, 73034, and 73034. In heterogeneous studies targeting 65918.T2A.57890, the single dose tested (3E9VG per hemisphere) resulted in a greater than 50% reduction in tau levels in both human and mouse at both time points. No significant changes in neuroinflammation or neuronal markers such as Gfap, Iba1, or Neun were observed in the ZFP-treated groups (Figure 11).

[0110] Human-targeted anti-tau ZFP-TFs similarly reduced human tau protein levels from 97% (73133) to >64–80% (73034 and 73122) at the highest doses tested at both time points. ZFP-TFs 73133 and 73034 resulted in a dose-dependent decrease in tau protein, while 73122 produced a plateau effect across the range of doses tested (a decrease of approximately 54–80%; Figure 12).

[0111] RNAscope analysis revealed a ZFP-dependent degree of reduction in human MAPT transcripts in the hippocampus of treated htau mice. Compared to vehicle-treated mice, NeuN-positive hippocampal neurons treated with ZFP-TF73133 had minimal remaining detectable MAPT transcripts after 3 months at a 3e9 test dose. In contrast, 73122 retained intermediate levels of detectable MAPT transcripts, consistent with bulk MAPT mRNA and tau protein analysis, indicating less overall repression for this ZFP-TF (Figure 13). These single-cell data support the repression results obtained for MAPT-targeted ZFP-TFs expressed in SK-N-MC cells, cultured human iPSC-derived neurons, and bulk brain tissue from htau mice.

[0112] These findings indicate that the tau ZFP-TF candidates tested in this study exhibit a desirable tau reduction profile in vivo in mice, with minimal evidence of elevated neuroinflammatory markers and no post-expression neuronal loss in the htau mouse brain.

Claims

1. A fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repression domain, wherein the ZFP domain binds to the target region of the human microtubule-associated protein tau (MAPT) gene.

2. The fusion protein according to claim 1, wherein the target region is located within 1.5 kb of the transcription start site (TSS) of the MAPT gene.

3. The fusion protein according to claim 2, wherein the target region is located within 1000 bps upstream of the TSS of the MAPT gene and / or within 500 bps downstream of the TSS.

4. The fusion protein according to any one of claims 1 to 3, wherein the fusion protein suppresses the expression of the MAPT gene by at least about 40%, 75%, 90%, 95%, or 99%, with no or minimal detectable off-target binding or activity.

5. The fusion protein according to any one of claims 1 to 4, wherein the transcriptional repression domain comprises a KRAB domain, and optionally the KRAB domain is derived from human KOX1 protein.

6. The fusion protein according to any one of claims 1 to 5, wherein the DNA-binding domain is linked to a transcriptional repressor via a peptide linker.

7. The fusion protein according to any one of claims 1 to 6, wherein the ZFP domain comprises a DNA-binding recognition helix sequence shown in Figure 14 or 16.

8. The fusion protein according to any one of claims 1 to 7, wherein the ZFP domain comprises a DNA-binding recognition helix sequence as shown in the single row of Figure 14 or 16.

9. The ZFP domain of the fusion protein It contains four, five, or six zinc fingers; Bind to the target sequence shown in Figure 14 or 16; It includes the DNA binding recognition helix sequence of the ZFP transcription factor shown in Figure 15 or 17; It includes a DNA binding recognition helix sequence that is linked together as shown in Figures 14, 15, 16, or 17; and / or The amino acid sequence includes an amino acid sequence selected from SEQ ID NOs: 89-196, 197-248, and 267-307. A fusion protein according to any one of claims 1 to 8.

10. A nucleic acid construct comprising a coding sequence of a fusion protein according to any one of claims 1 to 9, wherein the coding sequence is operably linked to a transcriptional regulatory element.

11. A nucleic acid construct according to claim 10, wherein the transcriptional regulatory element is a mammalian promoter that can be constitutively activated or induced in brain cells, wherein the construct is optionally a recombinant viral construct.

12. A recombinant virus comprising the nucleic acid construct according to claim 10 or 11.

13. The recombinant virus according to claim 12, wherein the recombinant virus is an adeno-associated virus vector, an adenovirus vector, or a lentivirus vector.

14. A pharmaceutical composition comprising a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13, and a pharmaceutically acceptable carrier.

15. A host cell comprising the nucleic acid construct according to claim 10 or 11, or the recombinant virus according to claim 12 or 13.

16. The host cell according to claim 15, wherein the host cell is a human cell.

17. The host cell according to claim 15 or 16, wherein the host cell is a brain cell or a pluripotent stem cell, and optionally the stem cell is an embryonic stem cell or an inducible pluripotent stem cell (iPSC).

18. A method for inhibiting tau expression in human brain cells, comprising introducing a fusion protein according to any one of claims 1 to 9 into the cells, optionally through the introduction of a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13, or thereby inhibiting tau expression in the cells.

19. The method according to claim 18, wherein the human brain cells are neurons, glial cells, ependymal cells, neuroepithelial cells, endothelial cells, or oligodendrocytes.

20. The method according to claim 18 or 19, wherein the cells are located in the brain of a patient who has or is at risk of developing Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, traumatic brain injury (TBI), paroxysmal disorder, corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), or another tauopathy.

21. The method according to any one of claims 18 to 20, comprising introducing a recombinant virus expressing a fusion protein into a cell.

22. The method according to claim 21, wherein the recombinant virus is optionally a pseudotype adeno-associated virus (AAV) derived from serotype 9 or AAV9.

23. A method for treating tauopathy in a patient requiring treatment, comprising administering to the patient a recombinant AAV or nucleic acid construct encoding a fusion protein according to any one of claims 1 to 9.

24. The method according to claim 23, wherein the AAV or nucleic acid construct is introduced into the patient via an intravenous, intrasacral, intracerebral, intraventricular, intracisional, intrahippocampal, intrathalamic, or intraparenchymal pathway.

25. The method according to claim 23 or 24, wherein the tauopathy is Alzheimer's disease, or frontotemporal dementia, progressive supranuclear palsy, traumatic brain injury (TBI), paroxysmal disorder, corticobasal degeneration (CBD), or chronic traumatic encephalopathy (CTE).

26. A fusion protein according to any one of claims 1 to 9, a nucleic acid construct according to claim 10 or 11, a recombinant virus according to claim 12 or 13, or a pharmaceutical composition according to claim 14, for use in the method according to any one of claims 18 to 25.

27. Use of a fusion protein according to any one of claims 1 to 9, or a nucleic acid construct according to claim 10 or 11, or a recombinant virus according to claim 12 or 13, for the manufacture of a pharmaceutical for use in the method according to any one of claims 18 to 25.