Therapeutic constructs for the co-delivery of mitotic kinase inhibitors and immune checkpoint inhibitors
Patent Information
- Application Number
- JP2026091722
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-07-12
- Filing Date
- 2026-06-01
- Publication Date
- 2026-09-08
Smart Images

Figure 2026143527000001_ABST
Abstract
Description
[Technical Field]
[0001] Description of research and development funded by the federal government. This invention was developed with government support under grant R44CA217534, awarded by the National Institutes of Health. The government has certain rights to this invention.
[0002] Areas of this disclosure This disclosure relates to compositions and methods for immunotherapeutic treatment. Therapeutic constructs are described based on the co-delivery of a mitotic kinase inhibitor and an immune checkpoint inhibitor. These therapeutic constructs have a greater therapeutic index than free drug counterparts for broad-spectrum cancer treatment and / or induce superior adaptive anti-cancer immunity. [Background technology]
[0003] Background of this disclosure Immune checkpoint inhibitors, such as antibodies against PD-L1, PD-1, and CTLA-4, have shown promising results in clinical settings and have received FDA fast-track approval to treat many cancer types. However, while patients who respond to immune checkpoint blockade may show a robust and sustained response, this represents only a small fraction of the total patient population, and even in patients with high PD-L1 expression, the response rate remains below 50% (Reck et al., NEJM 375(19):1823-1833, 2016 (Non-Patent Literature 1)). Furthermore, many early responders develop resistance and eventually relapse (Jenkins et al., Brit J Canc. 118:9, 2018 (Non-Patent Literature 2)).
[0004] Generally, immune checkpoint blockade is less severe and has different toxicity than chemotherapy, but there are concerns about autoimmune disorders caused by immunotherapy (Tocut et al., Autoimmunity Rev 17(6):610-616, 2018 (Non-Patent Literature 3)). The systemic distribution of these antibodies can trigger abnormal and uncontrolled immune responses, leading to immune-related adverse events (irAEs) (Reynolds et al., J Clin Oncol. 36(16_suppl):3096, 2018 (Non-Patent Literature 4)). Although generally manageable, treatment interruptions have occurred due to irAEs, and in some cases, irAEs can be fatal.
[0005] To improve cancer treatment outcomes, trials are exploring the use of chemotherapy in combination with immune checkpoint inhibitors. For example, one clinical trial is investigating the combination of nab-paclitaxel (Abraxane) and a PD-L1 antibody (atezolizumab) administered as a free agent for metastatic TNBC (Schmid et al., N Engl J Med 379(22):2108-2021, 2018 (Non-Patent Literature 5)). Preclinical studies have reported nanoparticles for co-delivery of docetaxel and PD-L1 antibody (Xu et al., Inter J Nanomed. 14:17-32, 2018 (Non-Patent Literature 6)) or doxorubicin and PD-L1 antibody (Emami et al., Mol Pharm 16(3):1184-1199, 2019 (Non-Patent Literature 7)). However, co-delivery of mitotic kinase inhibitors and immune checkpoint inhibitors has not been reported as free agents, nor has it been reported as co-delivery on particles or with chemical linkers.
[0006] Mitotic kinase inhibitors have monotherapy efficacy in killing cancer cells by inducing cell cycle arrest and apoptosis. Unlike chemotherapeutic drugs that kill rapidly dividing cells, mitotic kinase inhibitors are considered targeted therapies and should be more specific to cancer cells than chemotherapeutic drugs.
[0007] Nevertheless, the main limitations of current mitotic kinase inhibitors, such as PLK1 small molecule inhibitors, include low solid tumor bioavailability and toxic side effects on other rapidly dividing cells, particularly hematopoietic progenitor cells (Gjertsen & Schoffski, Leukemia 29(1):11-19, 2015 (Non-Patent Literature 8)). PLK1 inhibitors need to have a long half-life to achieve sufficient tumor bioavailability. This prolongs exposure time to hematopoietic progenitor cells in the blood and bone marrow, leading to dose-limiting toxicities such as neutropenia (low neutrophils) and thrombocytopenia (low platelets) (de Braud et al., Annals of Oncol. / EMSO 26(11):2341-2346, 2015 (Non-Patent Literature 9); Schoffski et al., Euro J Canc.48(2):179-186, 2012 (Non-Patent Literature 10); Lin et al., Brit J Canc.110(10):2434-2440, 2014 (Non-Patent Literature 11); Frost et al., Curr Oncol.19(1):e28-35, 2012 (Non-Patent Literature 12)). This highlights the need for targeted delivery of mitotic kinase inhibitors to cancer cells beyond non-target cells.
[0008] Furthermore, PLK1 inhibitors may also inhibit other PLK family members, PLK2 and PLK3, potentially leading to further toxic side effects (Raab et al., Nat.Comm.2:395, 2011 (Non-Patent Literature 13)). Of all the PLK1 inhibitors, volasertib (Boehringer Ingelheim) has reached Phase III clinical trials and shown the most promising results, albeit only for acute myeloid leukemia (hematological malignancy) (Gjertsen & Schoffski, Leukemia 29(1):11-19, 2015 (Non-Patent Literature 14)), but the results of the Phase III trials were not promising, possibly due to insufficient dosage (e.g., limited by toxicity). Inhibition of PLK1 for cancer treatment remains a clinical challenge.
[0009] Furthermore, previous studies have revealed extensive interactions between PLK1 and many genes that regulate cancer progression and immune evasion (Zitouni et al., Nat Rev Mol Cell Biol 15(7):433-452, 2014 (Non-Patent Document 15); Zhang et al., BMC Cancer 17(1):861, 2017 (Non-Patent Document 16); Liu et al., Translational Oncol. 10(1):22-23, 2016 (Non-Patent Document 17); Fu & Wen, Cancers 9(10), 2017 (Non-Patent Document 18)), which highlights that monotherapy using a PLK1 inhibitor alone may not be effective in some cases. Mitotic kinase inhibitors used alone are also extremely toxic, as shown in clinical trials of various PLK1 inhibitors. [Prior Art Documents] [Non-Patent Literature]
[0010] [Non-Patent Document 1] Reck et al., NEJM 375(19):1823-1833, 2016 [Non-Patent Document 2] Jenkins et al., Brit J Canc. 118:9, 2018 [Non-Patent Document 3] Tocut et al., Autoimmunity Rev 17(6):610-616, 2018 [Non-Patent Document 4] Reynolds et al., J Clin Oncol. 36(16_suppl):3096, 2018 [Non-Patent Document 5] Schmid et al., N Engl J Med 379(22):2108-2021, 2018 [Non-Patent Document 6] Xu et al., Inter J Nanomed. 14:17-32, 2018 [Non-Patent Document 7] Emami et al., Mol Pharm 16(3):1184-1199, 2019 [Non-Patent Document 8] Gjertsen & Schoffski, Leukemia 29(1):11-19, 2015 [Non-Patent Document 9] de Braud et al., Annals of Oncol. / EMSO 26(11):2341-2346, 2015 [Non-Patent Document 10] Schoffski et al., Euro J Canc. 48(2):179-186, 2012 [Non-Patent Document 11] Lin et al., Brit J Canc. 110(10):2434-2440, 2014 [Non-Patent Document 12] Frost et al., Curr Oncol. 19(1):e28-35, 2012 [Non-Patent Document 13] Raab et al., Nat. Comm. 2:395, 2011 [Non-Patent Document 14] Gjertsen & Schoffski, Leukemia 29(1):11-19, 2015 [Non-Patent Document 15] Zitouni et al., Nat Rev Mol Cell Biol 15(7):433-452, 2014 [Non-Patent Document 16] Zhang et al., BMC Cancer 17(1):861, 2017 [Non-Patent Document 17] Liu et al., Translational Oncol. 10(1):22-23, 2016 [Non-Patent Document 18] Fu & Wen, Cancers 9(10), 2017 [Summary of the Invention]
[0011] Summary of the Present Disclosure The development of novel therapeutic constructs based on the co-delivery of mitotic kinase inhibitors (or mitotic inhibitors) and checkpoint inhibitors is described herein. These therapeutic constructs have a greater therapeutic index than free drug counterparts and are useful for a wide range of cancer treatments.
[0012] To treat cancer, strategies are desperately needed to improve response, enhance therapeutic efficacy, and manage the toxicity of immune checkpoint blockade and mitotic kinase inhibitors. Single-agent (i.e., therapeutic construct) delivery of immune checkpoint inhibitors and mitotic kinase inhibitors achieves synergistic effects by co-localizing therapeutic efficacy while reducing systemic toxicity of the drugs.
[0013] Mitosis inhibitors and mitotic kinase inhibitors have monotherapy efficacy in killing cancer cells by inducing cell cycle arrest and apoptosis.
[0014] The mechanism by which cancer cells avoid death by mitosis inhibition is to upregulate immune checkpoints to evade immune-mediated cell death, thereby remaining immunologically invisible (Figure 1A). Therefore, by combining mitosis inhibitors with immune checkpoint inhibitors, it is possible to induce an immune response by having immune cells (i.e., cytotoxic CD8+ T cells) attack cells that survive the mitosis inhibitor (Figure 1B).
[0015] Engineered particles (therapeutic constructs) for the co-delivery of at least one mitotic inhibitor or mitotic kinase inhibitor and at least one immune checkpoint inhibitor are described herein. The data provided herein demonstrate a method by which the delivery of a mitotic kinase inhibitor together with an immune checkpoint inhibitor on a therapeutic construct can improve efficacy and reduce toxicity (by reducing the dose to one-fifth in an exemplary lung metastasis model).
[0016] The manipulated particles containing immune checkpoint inhibitors not only enable T cells to attack cancer cells, but also function as homing targets for surviving cancer cells.
[0017] The data also shows that the therapeutic constructs offered can not only kill cancer cells but also induce adaptive antitumor responses that delay the development of distal tumors (e.g., metastasis).
[0018] Mitotic kinase inhibitors can be small molecule inhibitors, antibody-based drugs, or oligonucleotides (e.g., siRNA, miRNA, antisense oligonucleotides).
[0019] The therapeutic construct may be administered locally or intratumorally to easily accessible tumors, such as melanoma, head and neck cancer, breast cancer, and lymphoma, or systemically to other cancers, such as lung cancer, liver cancer, pancreatic cancer, prostate cancer, brain cancer, kidney cancer, hematological cancer, gastric cancer, colon cancer, rare cancers, and metastatic cancers.
[0020] The manipulated therapeutic constructs may have diameters in the nanometer or micrometer range and can be fabricated from any material (e.g., lipids, organic materials, inorganic materials, polymers and hybrids or combinations thereof) that can be loaded with therapeutic agents / adjuvant cargoes and delivered to target sites (cancer cells, immune cells, extracellular matrix, etc.) to enable them to perform the desired function.
[0021] To enhance the therapeutic effect by augmenting the antitumor T cell repertoire, adjuvants can optionally be co-delivered on the same therapeutic construct. Mitotic kinase inhibitors kill cancer cells and induce antigen release, adjuvants mimic danger signals that stimulate immune cells by activating pattern recognition receptors, and immune checkpoint inhibitors release the brakes that tumor cells have put on immune cells. In this way, monotherapies can overcome the various strategies cancer cells use to evade the immune response and provide a sustained cancer cell-killing effect.
[0022] Optionally, exemplary therapeutic constructs may also contain one or more homing agents (such as antibodies, aptamers, ligands, peptides, etc.) that enable them to be preferentially delivered to and / or taken up by target cancer cells or various immune cell types (e.g., DCs, macrophages, monocytes, T cells).
[0023] The therapeutic constructs provided herein may be used alone or, without limitation, in combination with standard treatments including chemotherapy, surgery, targeted therapy, and radiotherapy.
[0024] Alternatively, other targeted therapeutic agents (e.g., small molecule inhibitors or antibodies targeting other tumor proteins, or medical radioisotopes) can be directly loaded onto or within the therapeutic construct as therapeutic activators.
[0025] The therapeutic construct can optionally be formulated into a topical formulation or a microneedle formulation for local delivery.
[0026] A therapeutic construct comprising a delivery system, at least one mitotic inhibitor or mitotic kinase inhibitor conjugated to or contained within the delivery system, and at least one immune checkpoint inhibitor conjugated to or contained within the delivery system is provided herein. In this embodiment of the therapeutic construct, the delivery system comprises liposomes, lipid particles, polymer particles, inorganic nanoparticles or organic nanoparticles, inorganic microparticles or organic microparticles, or hybrids thereof. In certain embodiments of the therapeutic construct provided, nanoparticles having a hydrodynamic size of 5 nm to 999 nm (e.g., about 80 nm to about 200 nm, about 90 nm to about 130 nm, or less than 150 nm) when measured in an aqueous solution (PBS, Tris buffer, water, etc.) are used. In yet another embodiment, the therapeutic construct is a microparticle having a hydrodynamic size of 1 micron to 1000 microns. In some embodiments, the delivery system has a size of approximately 5 nm to approximately 200 nm, approximately 5 nm to approximately 90 nm, approximately 5 nm to approximately 20 nm, approximately 30 nm to approximately 100 nm, approximately 30 nm to approximately 80 nm, approximately 30 nm to approximately 60 nm, approximately 40 nm to approximately 80 nm, approximately 70 nm to approximately 90 nm, or approximately 5 nm, approximately 10 nm, approximately 20 nm, approximately 30 nm, approximately 40 nm, approximately 50 nm, approximately 60 nm, approximately 70 nm, approximately 80 nm, approximately 90 nm, or approximately 100 nm.
[0027] In some embodiments, the therapeutic construct further comprises an adjuvant. In some embodiments, the therapeutic construct does not contain a tumor-specific antigen.
[0028] Therapeutic constructs comprising immune checkpoint inhibitors, mitotic kinase inhibitors, and chemical linkers linking the immune checkpoint inhibitor and the mitotic kinase inhibitor are also provided herein. In some embodiments, the immune checkpoint inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody. In some embodiments, the mitotic kinase inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody. In some embodiments, the therapeutic construct is an antibody-oligonucleotide conjugate, a small molecule-oligonucleotide conjugate, or a small molecule-small molecule conjugate. In some embodiments, the immune checkpoint inhibitor is an antibody (e.g., against PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4). In some embodiments, mitotic kinase inhibitors are small molecule inhibitors, e.g., inhibitors of PLK1 (e.g., GSK461364, BI2536, Tak960, NMS-P937, borasertib), Chk 1 kinase (e.g., LY2603618, prexasertib, or AZD7762), RHA helicase A (e.g., YK-4-279), cyclin-dependent kinase 1 / 2 (e.g., AZ703), or aurora kinase A (e.g., alicertib). In some embodiments, mitotic kinase inhibitors are oligonucleotides, e.g., siRNA or antisense oligonucleotides against mitotic kinase genes (e.g., siRNA against PLK1, e.g., siPLK1).
[0029] Compositions comprising at least one therapeutic construct described herein are also provided. Optionally, such compositions further comprise at least one pharmaceutically acceptable carrier, excipient, or diluent.
[0030] Another embodiment is a method for treating cancer, comprising the step of administering to a subject having cancer (such as a human subject) an effective amount of a provided therapeutic construct, or a composition containing such therapeutic construct, in order to reduce one or more symptoms of cancer.
[0031] A method for treating cells exhibiting symptoms of cancer is also provided, comprising the step of bringing the cells into contact with a therapeutically effective amount of a provided therapeutic agent.
[0032] A method for treating cells obtained from a subject exhibiting symptoms of cancer is also provided, comprising the step of contacting the cells with a therapeutically effective amount of a provided therapeutic construct or a composition containing such therapeutic construct.
[0033] A method for treating cells obtained from a subject exhibiting symptoms of cancer is also provided, comprising the step of ex vivo contacting the cells with a therapeutically effective amount of a provided therapeutic construct or a composition containing such therapeutic construct.
[0034] In any of the cell-based embodiments, the cells are intended to be cancer cells, in some cases. In other embodiments, the cells are not cancer cells. In various embodiments, the cells are immune cells. Optionally, in any of the cell-based embodiments, the cells may be derived from a human subject or from another mammalian subject.
[0035] Another embodiment is a method for treating a subject diagnosed with a hyperproliferative disease or hyperproliferative condition, comprising the step of administering an effective amount of a composition comprising at least one of the therapeutic constructs provided to the subject.
[0036] A method for enhancing the effect of anticancer therapy in a subject requiring it (such as a human subject) is also provided, comprising the step of administering to the subject requiring it an effective amount of a provided therapeutic construct or a composition containing such therapeutic construct and at least one anticancer agent (e.g., a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor). Optionally, the therapeutic construct or composition and the anticancer therapy may be administered sequentially or simultaneously.
[0037] Another aspect is a method for enhancing the effect of radiotherapy in a subject diagnosed with a neoplasm (such as a human subject), comprising the steps of administering to the subject in need an effective amount of a provided therapeutic construct or a composition containing such therapeutic construct, and at least one radiotherapy. Optionally, the therapeutic construct or composition and the radiotherapy may be administered sequentially or simultaneously.
[0038] As used herein, in the context of the therapeutic effect of anticancer therapy, the term “enhancing” refers to an increase in the therapeutic effect of anticancer therapy (e.g., treatment with anticancer drugs, radiotherapy, or checkpoint immunotherapy) that exceeds the therapeutic effect normally obtained when the anticancer therapy is administered without the therapeutic construct of the present invention. “Enhancing therapeutic effect” occurs when there is an acceleration and / or increase in intensity and / or degree of the therapeutic effect obtained by the anticancer therapy. “Enhancing therapeutic effect” also includes an extension of the useful duration of the therapeutic benefit. “Enhancing therapeutic effect” may also occur when, when administered concurrently with the therapeutic construct provided by the present invention, a relatively low dose of anticancer therapy is required to obtain the same benefit and / or effect as when a relatively high dose of anticancer therapy is administered alone. The enhancing effect preferably results in the treatment of acute symptoms that are ineffective or poorly therapeutically effective with anticancer therapy alone, though not necessarily so. When the therapeutic construct of the present invention is administered concurrently with anticancer therapy, enhancement is achieved if the therapeutic effect increases by at least 10% compared to administration of anticancer therapy alone (for example, at least 25%, at least 50%, at least 75%, or at least 100%). [Brief explanation of the drawing]
[0039] [Figure 1]The central hypothesis regarding the activity of therapeutic constructs. (Figure 1A) Mitotic inhibition (e.g., by PLK1 inhibitors or siRNA) kills cancer cells and releases antigens, but also increases checkpoint (e.g., PD-L1) expression in surviving cells, thereby inhibiting the anti-cancer immune response against the surviving cells. (Figure 1B) Combining mitotic inhibitors with immune checkpoint inhibitors (e.g., on therapeutic constructs) results in synergistic treatment of cancer. [Figure 2A] Effect of siRNA (siPLK1) on the mitotic regulator PLK1 in non-small cell lung cancer (NSCLC) cell lines (A549 and H460). (Figure 2A) 48-hour PLK1 mRNA knockdown (HPRT used as a housekeeping gene) and (Figure 2B) 72-hour PLK1 protein reduction at a 50 nM siRNA dose. (Figure 2C) 4-day cell viability at a 30 nM siRNA dose. (Figure 2D) Increased G2 / M phase cell cycle arrest in A549 72 hours after treatment. siPLK1 (C-siPLK1-NP) or scrambled siRNA control (C-siSCR-NP) was delivered with 50 nM siRNA using an antibody (cetuximab) conjugated NP. BI 2536 (PLK1 inhibitor) was used as a drug benchmark at 10 nM. Data presented as mean ±SD from two independent pairs (10,000 events / sample); ****P<0.0001 vs. untreated control. Unless otherwise specified, "NP" refers to mesoporous silica nanoparticles coated with crosslinked PEI and PEG, as described in Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-2659, 2015 and U.S. Patent Application Publication No. 2017 / 0173169. [Figure 2B] See the explanation in Figure 2A. [Figure 2C] See the explanation in Figure 2A. [Figure 2D] See the explanation in Figure 2A. [Figure 3A]siRNA-mediated PLK1 knockdown induces PD-L1 expression. (Figure 3A) mRNA expression of PLK1 and PD-L1 in A549 (human NSCLC) 48 hours after treatment with PLK1 siRNA (siPLK1) or scrambled siRNA (siSCR) normalized to HPRT housekeeping genes. Data shown as mean ± SD from triplicates; ****P<0.0001. (Figure 3B) PD-L1 surface expression (10,000 events / sample) in A549 (Figure 2B) and LLC-JSP (mouse NSCLC, Figure 3C) 72 hours after treatment, evaluated by flow cytometry. Mouse siPLK1 sequence: GUGGGCGUGGUACCAUCUGUU (SEQ ID NO: 1); Human siPLK1 sequence: UAUUCAUUCUUCUUGAUCCGG (SEQ ID NO: 2). [Figure 3B] See the explanation in Figure 3A. [Figure 3C] See the explanation in Figure 3A. [Figure 4A] (A) 3-day survival rate of LLC-JSP cells, (B) PD-L1 expression levels of surviving cells after treatment with 500 ng / ml volasertib, alicertib, or AZD7762, as determined by flow cytometry, and (C) therapeutic effect of mitotic kinase inhibitors on their quantification. [Figure 4B] See the explanation in Figure 4A. [Figure 4C] See the explanation in Figure 4A. [Figure 5]Enhancement of cancer treatment with PD-L1 and PLK1 inhibitors administered as free drugs. (Figure 5A) 200K LLC-JSP cells were injected into the right flank of C57BL / 6 mice. Eight days after tumor inoculation, mice were divided into groups (n=7-8) and administered either a control vehicle (PBS and HCl / saline), the PLK1 inhibitor volasertib (20 mg / kg), mouse PD-L1 antibody (200 μg / mouse, BioXCell), or a combination of PLK1 inhibitor and PD-L1 antibody via ip administration. Three doses were administered every five days. (Figure 5B) Tumor growth in mice. (Figure 5C) Kaplan-Meier survival curves. Data shown as mean ± SEM; ***P<0.001, ****P<0.0001. [Figure 6A] Nanoparticle delivery of the PLK1 inhibitor boracertib (iPLK1-NP) to mouse NSCLC cells. (Figure 6A) Schematic diagram of iPLK1-NP synthesis. (Figure 6B) Hydrodynamic size of NP (without inhibitor) and iPLK1-NP as measured using Zetasizer. (Figure 6C) Viability of LLC-JSP cells treated for 4 days with boracertib (in 1% DMSO / PBS), iPLK1-NP (in PBS), or 1% DMSO / PBS. Data shown as mean ± SD from four independent samples; ****P<0.0001. (Figure 6D) PD-L1 surface expression of LLC-JSP cells treated for 3 days with PBS or iPLK1-NP (42 μg / ml NP, 210 ng / ml boracertib). [Figure 6B] See the explanation in Figure 6A. [Figure 6C] See the explanation in Figure 6A. [Figure 6D] See the explanation in Figure 6A. [Figure 7A]Nanoparticles (p-iPLK1-NP) for the co-delivery of PLK1 inhibitor (iPLK1) and PD-L1 antibody. (Figure 7A) Schematic diagram of p-iPLK1-NP containing 4 wt% PD-L1 antibody and 0.5 wt% PLK1 inhibitor, and (Figure 7B) hydrodynamic size. (Figure 7C) 5-day cell viability of LLC-JSP cells treated with iPLK1-NP or p-iPLK1-NP. Data shown as mean ± SD from four independent samples; ns - not significant. (Figure 7D) PD-L1 surface expression assessed by flow cytometry after incubating LLC-JSP cells with various specified treatments for 2 hours and (Figure 7E) 2 days. Dosage: Free PD-L1 antibody (50 μg / ml), iPLK1-NP (NP containing 50 μg / ml volacertib), and p-iPLK1-NP (NP containing 50 μg / ml volacertib and 2 μg / ml PD-L1 antibody). Figures 7D and 7E: Left: Representative histogram, Right: Median intensity (RFU). Data shown as mean ± SD from two independent sequences (10,000 events / sample); *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Unless otherwise specified, loading rates are by nanoparticle weight throughout this application. [Figure 7B] See the explanation in Figure 7A. [Figure 7C] See the explanation in Figure 7A. [Figure 7D] See the explanation in Figure 7A. [Figure 7E] See the explanation in Figure 7A. [Figure 8A]p-iPLK1-NP induces antitumor immunotherapy. (Figure 8A) 100K LLC-JSP cells were injected into the right flank of C57BL / 6 mice, and 40K cells were injected into the left flank. Twelve days after tumor inoculation, the right (local) tumors of the mice were treated with saline, p-NP, iPLK1-NP, or p-iPLK1-NP. For a total of three doses, each dose contained 0.5 mg of NP with 4 wt% PD-L1 antibody and 0.5 wt% PLK1 inhibitor in 50 μl. (Figure 8B) Local tumor growth. (Figure 8C) Distal (untreated) tumor growth of individual mice. (Figure 8D) Kaplan-Meier survival curves. (Figure 8E) Mice were injected with tumors as shown in (Figure 8A) and treated with saline or p-iPLK1-NP. Tumors were collected one day after the last procedure, and tumor-infiltrating lymphocytes (TILs) were evaluated using flow analysis (50,000 events / sample). Data are presented as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 8B] See the explanation in Figure 8A. [Figure 8C] See the explanation in Figure 8A. [Figure 8D] See the explanation in Figure 8A. [Figure 8E] See the explanation in Figure 8A. [Figure 9] p-iPLK1-NP improves the survival of mice carrying metastatic lung tumors. (Figure 9A) Tumors were induced in the lungs of C57BL / 6 mice by intravenous injection of 200K LLC-JSP cells. Three days later, mice were randomly assigned to receive a total of four doses: saline, free drug (12.5 μg volasertib and 100 μg PD-L1 antibody), or p-iPLK1-NP (containing 2.5 μg volasertib and 20 μg PD-L1). (Figure 9B) Kaplan-Meier survival curves. *P<0.05, **P<0.01 (Log-rank Mantel-Cox test). (Figure 9C) Change in body weight of mice after the first treatment. [Figure 10]The effect of p-iPLK1-NP is dependent on CD8+ T cells. 200K LLC-JSP cells were intravenously injected into C57BL / 6 mice. Three days later, the mice were treated with saline, p-iPLK1-NP (iv, containing 2.5 μg volasertib and 20 μg PD-L1), or p-iPLK1-NP + anti-CD8 (200 μg, twice weekly). (A) Kaplan-Meier survival curves. *P<0.05, **P<0.01, ***P<0.001 (Log-rank Mantel-Cox test). [Figure 11A] Targeting and treatment specificity of p-iPLK1-NP. (A) PD-L1 expression in 4T1 cells 4 days after treatment with p-iPLK1-NP. Cells (control and p-iPLK1-NP treated) were harvested and incubated with p-iPLK1-NP tagged with dye-siRNA for 1 hour. (B) Cell uptake of p-iPLK1-NP. (C) Cell viability of mouse cancer cells (LLC-JSP, 4T1, B16-F10) and mouse bone marrow-derived dendritic cells (BMDC) treated with p-iPLK1-NP. [Figure 11B] See the explanation in Figure 11A. [Figure 11C] See the explanation in Figure 11A. [Figure 12A] Inhibition of PLK1 reduces STAT3 phosphorylation. Western blots show the protein expression of PLK1, PI3Ka, phosphorylated STAT3 (Tyr705), phosphorylated AKT (Ser473), and β-actin 3 days after treatment (50 nM siRNA) in A549 and H460 NSCLC cell lines. Figure 12B shows that NPs can also deliver siRNA against PD-L1 (siPDL1) and result in effective knockdown of PD-L1 protein expression (measured by flow cytometry) in LLC-JSP cells. Cells were treated with NPs containing 2 wt% siRNA with either 30 nM siRNA against PD-L1 (siPDL1) or 30 nM scrambled siRNA (siSCR). 72 hours after treatment, cells were harvested and PD-L1 protein expression was evaluated by flow cytometry. RFU = relative fluorescence units. [Figure 12B]See the explanation in Figure 12A. [Figure 13] Adding CpG to p-iPLK1-NP increases the therapeutic benefit, as shown by the Kaplan-Meier survival curve. 100K LLC-JSP cells were injected into the right flank of C57BL / 6 mice, and 40K cells were injected into the left flank. Twelve days after tumor inoculation, the right (local) tumors of the mice were treated intratumorally with saline, p-NP, iPLK1-NP, p-iPLK1-NP, or p-iPLK1-NP-CpG. 0.5 mg of NP (iPLK1 2.5 μg, PD-L1 antibody 20 μg, CpG 20 μg) in 50 μl was administered every three days for a total of three doses. [Figure 14A] Antibody-drug conjugate (ADC) of aricertib (Aurora kinase A inhibitor) and PD-L1 antibody. (A) Synthesis scheme of PD-L1-antibody aricertib conjugate (ADC). (B) Therapeutic effect of equivalent doses of ADC versus free aricertib on LLC-JSP cell viability (2 days). Free aricertib was dissolved in DMSO before use. (C) Effect of PD-L1 on LLC-JSP cell viability. [Figure 14B] See the explanation in Figure 14A. [Figure 14C] See the explanation in Figure 14A. [Figure 15] Localized siRNA-NPs in porcine skin with and without microneedle roller pretreatment. Fluorescence images of porcine skin treated for 1 hour with a single local application of Dy677-siSCR-NP in Aquaphor, with and without pretreatment using a microneedle roller. siRNA signals are indicated by arrows. Tissue nuclei were also stained using Hoechst 33342. [Figure 16]Localized siRNA-NP / Tween-Aquaphor in mice with and without microneedle roller pretreatment. Fluorescence images of mouse skin treated for 1.5 hours with a single local application of Dy677-siSCR-NP in Tween / Aquaphor, with and without microneedle roller pretreatment. siRNA signals are indicated by arrows. Tissue nuclei were also stained using Hoechst 33342. [Figure 17] EGFR knockdown effect of localized siRNA-NPs using a microneedle roller versus injected siRNA-NPs. Mouse skin was collected 3 days after a single local treatment with siEGFR-NPs or siSCR-NPs in Tween / Aquaphor using a microneedle roller (A), or 3 days after a single injection of siEGFR-NPs or siSCR-NPs in physiological saline (B). Skin tissue was fixed and stained with a fluorescently labeled EGFR antibody for EGFR signal quantification. 4-8 images (20x magnification) were taken per condition, and 3 animals were processed per group. [Figure 18] Dextran-based microneedles containing NPs loaded with Dy677-siRNA. [Modes for carrying out the invention]
[0040] Reference to sequence list Nucleic acid sequences described herein are shown using standard abbreviations for nucleotide bases, as defined in 37 CFR §1.822. Only one strand of each nucleic acid sequence is shown, but complementary strands are understood to be included in the embodiment, where appropriate. A computer-readable text file titled "51127-005WO2_Sequence_Listing_07.13.20_ST25.txt", created on or around July 13, 2020, with a file size of 1 KB, contains the sequence listing of this application, and is incorporated herein by reference in its entirety.
[0041] SEQ ID NO:1 is the mouse siPLK1 sequence: TIFF2026143527000002.tif3128
[0042] SEQ ID NO:2 is a human siPLK1 sequence: TIFF2026143527000003.tif3128
[0043] SEQ ID NO:3 is a scrambled siSCR sequence: TIFF2026143527000004.tif3128
[0044] Detailed explanation Therapies for cancer treatment described herein utilize engineered particles or chemical linkers for the co-delivery of mitotic kinase inhibitors and immune checkpoint inhibitors to create therapeutic constructs that localize both classes of drugs within the same cell for cancer treatment.
[0045] When the provided therapeutic construct is administered intratumorally or systemically to cancer cells, the mitotic kinase inhibitor causes the cancer to undergo cell cycle arrest, leading to programmed cell death and increasing immune checkpoint expression (e.g., PD-L1) in the surviving cancer cells. Therefore, immune checkpoint inhibitors (e.g., antibodies against PD-L1) enhance the targeted delivery of the construct to the surviving cells and enable cytotoxic T cells to attack the cancer.
[0046] Because mitotic kinase inhibitors can upregulate the PD-L1 receptor, this strategy can treat a wide range of cancer types and is particularly useful for cancers that lack obvious receptors for targeted delivery of mitotic kinase inhibitors, which would normally be toxic treatments.
[0047] Furthermore, the death of cancer cells releases tumor antigens, which, along with checkpoint inhibition, can trigger adaptive immunity to attack cancer or prevent its spread or recurrence. Optionally, adjuvants can be added to therapeutic constructs to enhance the anti-tumor immune response.
[0048] This invention utilizes novel discoveries in cancer biology and immunology, along with engineered particles for creating novel drug candidates that enhance efficacy while reducing toxicity compared to free drug counterparts.
[0049] In certain embodiments, the delivery vehicle comprises an MSNP core for drug loading (e.g., about 50 nm) coated with an in vivo reducing crosslinked cationic polymer, such as polyethyleneimine (PEI), for oligo loading and endosomal extrusion, and a stabilizer, such as polyethylene glycol (PEG), which prevents nanoparticle aggregation, protects the oligo cargo from degradation by blood enzymes (Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-2659, 2015), shields the charge of PEI, and enhances safety. The oligo (siRNA and / or CpG) is loaded into the construct last and mixed in PBS at room temperature for several minutes (e.g., 5 minutes). The oligonucleotides (siRNA and / or CpG) are electrostatically bound to PEI in an oligo-sequence-independent manner and protected from enzymatic degradation under the PEG layer (Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-2659, 2015). The resulting nanoparticles (NPs) are highly optimized for siRNA delivery efficacy with respect to MSNP size, molecular weight and composition of PEI and PEG, PEI crosslinking conditions (to enhance buffering capacity and reduce charge), and oligonucleotide and (optionally) antibody loading (Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-2659, 2015). This embodiment of siRNA-NPs has a rigid MSNP core size of 50 nm (by TEM) and a hydrodynamic size of 100 nm with a narrow size distribution (NPs with polymer coating). This embodiment of siRNA-NP consists of 13.5 wt% PEI and 18.2 wt% PEG, and can be loaded with 2–4 wt% siRNA or up to 10 wt% CpG oligo. The drug (e.g., taxane) may be loaded in 0.5–3 wt% within the MSNP core or on the polymer. All values in this paragraph are by weight of nanoparticles. See also U.S. Patent Application Publication No. 2017 / 0173169.
[0050] In certain embodiments, immune checkpoint inhibitors are oligonucleotides, polynucleotides, small molecule inhibitors, or antibodies. In some embodiments, mitotic kinase inhibitors are oligonucleotides, polynucleotides, small molecule inhibitors, or antibodies. In some embodiments, therapeutic constructs are antibody-oligonucleotide conjugates (Wiener, J. et al. Scientific Reports, 10, 1457, 2020), small molecule-oligonucleotide conjugates (Winkler J., Therapeutic delivery, 4(7), 791-809, 2013), or small molecule-small molecule conjugates.
[0051] A therapeutic construct comprising a delivery system, at least one mitotic inhibitor or mitotic kinase inhibitor conjugated to or contained within the delivery system, and at least one immune checkpoint inhibitor conjugated to or contained within the delivery system is provided herein. In this embodiment of the therapeutic construct, the delivery system comprises liposomes, lipid particles, polymer particles, inorganic nanoparticles or organic nanoparticles, inorganic microparticles or organic microparticles, or hybrids thereof. For example, in various examples, the delivery vehicle includes one or more of the following: fullerenes, endohedral metal fullerenes, trimetal nitride-templated endohedral metal fullerenes, single-walled carbon nanotubes and multi-walled carbon nanotubes, branched carbon nanotubes and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled boron / nitrate nanotubes and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, calcium phosphate, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, silicon, silica microspheres and silica nanospheres, polymer microspheres and polymer nanospheres, silica shells, biodegradable PLGA microspheres and biodegradable PLGA nanospheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.
[0052] Examples of the therapeutic constructs provided include mitotic kinase inhibitors and / or immune checkpoint inhibitors, which include oligonucleotides (e.g., siRNA or antisense oligonucleotides), polynucleotides, small molecule inhibitors, or antibodies.
[0053] In examples of therapeutic constructs, the mitotic kinase inhibitor includes at least one inhibitor of polo-like kinase (PLK), aurora kinase, cyclin-dependent kinase (CDK) 1, CDK2, HASPIN, monopolar spindle 1 kinase (Mps1), or NimA-related kinase (NEK). In various embodiments, the mitotic kinase inhibitor includes one or more of GSK461364, BI2536, Tak960, NMS-P937, BI6727 (voracertib), Chk 1 kinase inhibitor LY2603618, prexacertib, AZD7762, AU14022, YK-4-279, or AZ703.
[0054] In various embodiments, mitotic inhibitors include one or more of etoposide, vinorelbine, mitoxantrone, doxorubicin, estramustine, carboplatin, vinblastine, docetaxel, paclitaxel, and cabazitaxel.
[0055] In various embodiments, immune checkpoint inhibitors include siRNAs, inhibitors, or antibodies against one or more of PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4. For example, the therapeutic agent is an immune checkpoint inhibitor selected from antibodies against PD-L1, PD-1, or CTLA-4. In many more examples, the immune checkpoint inhibitor includes at least one of nivolumab, pembrolizumab, ipilimumab, tremelimumab, atezolizumab, avelumab, durvalumab, semiprimab, pidilizumab, or spartalizumab (PDR001).
[0056] The therapeutic constructs provided herein may optionally further include adjuvants. Exemplary adjuvants used with the provided therapeutic constructs are particularly intended to exhibit immunostimulatory activity. For example, adjuvants useful in embodiments of the provided therapeutic constructs include one or more of the following: CpG oligonucleotides, DNA TLR agonists containing CpG sequences, non-CpG DNA TLR agonists, RNA TLR agonists, aluminum salts, anti-CD40 antibodies, fusion proteins, cytokines, small molecule TLR agonists, oil-based or surfactant-based adjuvants, lipopolysaccharides, plant extracts, or derivatives thereof. Specific examples of adjuvant compounds include CpG oligonucleotides, imiquimod, reximod, gardikimod, polyIC, polyICLC, dSLIM, or EnanDIM.
[0057] In some embodiments, the therapeutic construct does not contain tumor-specific antigens.
[0058] Compositions comprising at least one therapeutic construct described herein are also provided. Optionally, such compositions further comprise at least one pharmaceutically acceptable carrier, excipient, or diluent.
[0059] Another embodiment is a method for treating cancer, comprising the step of administering to a subject having cancer (such as a human subject) an effective amount of a provided therapeutic construct, or a composition containing such therapeutic construct, in order to reduce one or more symptoms of cancer.
[0060] A method for treating cells exhibiting symptoms of cancer is also provided, comprising the step of bringing the cells into contact with a therapeutically effective amount of a provided therapeutic agent.
[0061] A method for treating cells obtained from a subject exhibiting symptoms of cancer is also provided, comprising the step of contacting the cells with a therapeutically effective amount of a provided therapeutic construct or a composition containing such therapeutic construct.
[0062] A method is also provided which includes the step of ex vivo contacting cells with a therapeutically effective amount of a provided therapeutic construct, or a composition containing such therapeutic construct.
[0063] In any of the cell-based embodiments, the cells are intended to be cancer cells, in some cases. In other embodiments, the cells are not cancer cells. In various embodiments, the cells are immune cells. Optionally, in any of the cell-based embodiments, the cells may be derived from a human subject or from another mammalian subject.
[0064] Another embodiment is a method for treating a subject diagnosed with a hyperproliferative disorder or hyperproliferative condition, comprising the step of administering to the subject an effective amount of a composition comprising at least one of the therapeutic constructs provided. In various examples of this embodiment, the hyperproliferative disorder includes one or more of cancers, precancerous conditions, or cancerous metastases. In examples of these methods, the hyperproliferative disorder includes one or more of melanoma, lung cancer, breast cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, lymphoma, colon cancer, or liver cancer.
[0065] In any of the methods provided for treating a subject, administration is intended to be carried out in a variety of ways. For example, in the example of a therapeutic method, the administration step may include one or more of the following: injection into or at the tumor of the subject, local infusion into or at the tumor of the subject, systemic injection at the subject, systemic infusion at the subject, or local application to the subject. In other examples, the administration step may include microneedle application.
[0066] A method for enhancing the effect of anticancer therapy in a subject requiring it (such as a human subject) is also provided, comprising the step of administering to the subject requiring it an effective amount of a provided therapeutic construct or a composition containing such therapeutic construct and at least one anticancer agent (e.g., a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor). Optionally, the therapeutic construct or composition and the anticancer therapy may be administered sequentially or simultaneously.
[0067] Another aspect is a method for enhancing the effect of radiotherapy in a subject diagnosed with a neoplasm (such as a human subject), comprising the steps of administering to the subject in need an effective amount of a provided therapeutic construct or a composition containing such therapeutic construct, and at least one radiotherapy. Optionally, the therapeutic construct or composition and the radiotherapy may be administered sequentially or simultaneously.
[0068] Kits comprising the therapeutic constructs described herein and at least one anticancer agent are also provided herein. In some embodiments, the anticancer agent is a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor.
[0069] To support the teachings of this disclosure, aspects of this disclosure are described below with additional details and options: (I) therapeutic constructs; (II) mitotic kinases and their inhibitors; (III) immune checkpoint inhibitors; (IV) any additional components; (V) delivery systems; (VI) antibodies; (VII) pharmaceutical compositions and dosage formulations; (VIII) exemplary uses; (IX) kits; (X) exemplary embodiments; and (XI) examples.
[0070] (I) Therapeutic constructs A novel class of therapeutic agents (generally, “therapeutic constructs”) comprising engineered particles that simultaneously deliver at least two activators, including at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor, to cancer cells is described herein. Also disclosed herein are therapeutic constructs comprising an immune checkpoint inhibitor, a mitotic kinase inhibitor, and a chemical linker (antibody-drug conjugate) connecting the two, for example, any of those described herein. The ratio of activators (e.g., mitotic kinase inhibitor to immune checkpoint inhibitor, or immune checkpoint inhibitor to mitotic kinase inhibitor) may be, for example, about 1 to about 20 (e.g., about 2 to about 8, about 4 to about 6, about 2, about 4, or about 6). Mitotic kinase inhibitors can be present in therapeutic constructs at concentrations of 0.01% to 99.9% by weight (e.g., 0.01-1%, 1-5%, 1-10%, 1-20%, 10-30%, 10-40%, 10-50%, 25-75%, 40-60%, 50-75%, 50-80%, 75-90%, 75-95%, or 75-99.9%). Immune checkpoint inhibitors can be present in concentrations of 0.01% to 99.9% by weight (e.g., 0.01–1%, 1–5%, 1–10%, 1–20%, 10–30%, 10–40%, 10–50%, 25–75%, 40–60%, 50–75%, 50–80%, 75–90%, 75–95%, or 75–99.9%). These therapeutic constructs allow for the co-administration of drugs without reducing the dose required to achieve the effect to, for example, about one-fifth, and without reaching dose-limiting toxicity. They induce adaptive immunity that enhances tumor inhibition and development at local (treated) and distal (untreated) sites (e.g., metastases), as well as the survival of the treated subject. When treated with the therapeutic construct, cancer cells undergo programmed cell death, but the surviving cells overexpress immune checkpoint molecules such as PD-L1. This allows for highly targeted delivery of the construct via feedforward to the remaining cancer cells, which may not normally have significant expression of the receptors necessary for target delivery.Furthermore, since mitotic kinases are found in all cancers that overexpress immune checkpoint molecules such as PD-L1 when mitotic kinases are inhibited, therapeutic constructs can be applied to a wide range of cancer types.
[0071] In some examples, the chemical linker is one or more hydrazines; disulfides; N-succinimidyl-4-(2-pyridyldithio)butanoates; N-succinimidyl-4-(2-pyridyldithio)-2-sulfobutanoates; perfluorophenyl-3-(pyridine-2-yldisulfanyl)propanoates; 2,5-dioxopyrrolidine-1-yl-3-methyl-3-(pyridine-2-yldisulfanyl)butanoates; Gly-Phe-Leu-Gly; Ala-Leu-Ala-Leu; Val-Cit; Phe-Lys; Val-Ala; Ala-Phe-Lys; Phe-Lys; n is 1-20 (Gly) nβ-glucuronide linker; maleimidocaproyl; N-(maleimidomethyl)cyclohexane-1-carboxylate; 4-(4-acetylphenoxy)butanoic acid; dibromomaleimide; para-aminobenzoic acid; 4-nitrophenol; acetic acid; formic acid; 4-maleimidobutyrate N-succinimidyl ester; N-(4-maleimidobutyryloxy)succinimidide; N-(6-maleimidocaproyloxy)succinimidide; 3-maleimidopropionic acid N-succinimidyl ester; N-(3-maleimidopropionyloxy)succinimidide; 5-maleimidovaleric acid-NHS; 100~10000 The chemical linker may include linear, branched, or multi-armed polyethylene glycol having a molecular weight of Da; propargyl-N-hydroxysuccinimidyl ester; pyrophosphate; succinimidyl-4-azidobutyrate; 4-azidobenzoic acid N-hydroxysuccinimide ester; tert-butyl 1-(4-formylphenyl)-1-oxo-5,8,11-trioxa-2-azatridecane-13-oate; or residues thereof. In some embodiments, the chemical linker includes N-(maleimidomethyl)cyclohexane-1-carboxylate or a residue thereof (e.g., sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate). In some embodiments, the chemical linker includes polyethylene glycol having a molecular weight of 100 to 10000 Da (e.g., linear polyethylene glycol) or a residue thereof.
[0072] This strategy has many important features. They train and utilize the body's immune cells to attack cancer using the memory effect, are applicable to many types of cancer, can be administered locally to easily accessible tumors and systemically to deeper tumors and metastatic tumors, are effective, are safe because the required dose is low (compared to free drug counterparts), and are sustained.
[0073] It will be understood that the amounts of each component in the therapeutic construct (e.g., mitotic inhibitors, mitotic kinase inhibitors, immune checkpoint inhibitors, delivery vehicles, or any component of the delivery vehicle) may vary depending on the embodiment. For example, any individual component may constitute 0.001% to 80% by weight, 0.01% to 75% by weight, 0.5% to 50% by weight, 0.5% to 10% by weight, 0.5% to 5% by weight, 1% to 10% by weight, or 2% to 4% by weight of the therapeutic construct.
[0074] (II) Mitotic kinases and their inhibitors Cancer is characterized by uncontrolled cell regeneration. Mitosis is a cell cycle phase in which a series of complex events ensure fidelity to chromosome segregation into two daughter cells. Several current cancer treatments, including taxanes and vinca alkaloids, act to inhibit the mitotic mechanism. Mitotic progression is primarily regulated by proteolysis and phosphorylation events mediated by mitotic kinases. Members of the Aurora kinase family (e.g., Aurora A, Aurora B, Aurora C) regulate mitotic progression through the regulation of centrosome segregation, spindle dynamics, spindle formation checkpoints, chromosome alignment, and cytokinesis (Dutertre et al. Oncogene 21:6175, 2002; Berdnik et al. Curr. Biol. 12:640, 2002). Overexpression and / or amplification of aurora kinase has been associated with carcinogenesis in several tumor types, including colon and breast tumors (Warner et al. Mol. Cancer Ther. 2:589, 2003; Bischoff et al. EMBO 17:3062, 1998; Sen et al. Cancer Res. 94:1320, 2002). Furthermore, inhibition of aurora kinase in tumor cells leads to mitotic arrest and apoptosis, suggesting that these kinases are important targets for cancer therapy (Ditchfield, J. Cell Biol. 161:267, 2003; Harrington et al. Nat Med 10(3):262-267, 2004).
[0075] Mitotic kinases: In certain aspects, mitotic kinases include the Aurora family of serine / threonine kinases, which are essential for cell proliferation (Bischoff & Plowman, Trends in Cell Biology 9:454-459, 1999; Giet & Prigent, J Cell Science 112:3591-3601, 1999; Nigg, Nat. Rev. Mol. Cell Biol. 2:21-32, 2001; Adams et al., Trends in Cell Biology 11:49-54, 2001). Since their discovery in 1997, the mammalian Aurora kinase family has been closely associated with tumorigenesis. The most compelling evidence for this is that overexpression of Aurora A transforms rodent fibroblasts (Bischoff et al., EMBO J. 17:3052-3065, 1998). Therefore, inhibitors of the Aurora kinase family have the potential to inhibit the growth of all tumor types.
[0076] The three known mammalian family members, Aurora A("1"), B("2"), and C("3"), are highly homologous proteins responsible for chromosome segregation, mitotic spindle function, and cytokinesis. They are highly conserved in the C-terminal region where the kinase domain is located, and exhibit sequence differences in the N-terminal domain (Nat. Rev. Cancer, 5:42-49, 2005). Aurora expression is low or undetectable in resting cells, and expression and activity peak during G2 and mitotic phases in dividing cells. In mammalian cells, proposed substrates for Aurora include histone H3, a protein involved in chromosome condensation, as well as CENP-A, myosin II regulatory light chain, protein phosphatase 1, and TPX2, all of which are required for cell division.
[0077] Aurora B is expressed between late G2 phase and telophase. It is located in the inner centromere region and the spindle intermediate zone. Aurora B regulates chromosome orientation in the metaphase plate and corrects erroneous kinetochore-microtubule interactions. Aurora B phosphorylates histone H3, thereby enabling this histone to interact with DNA, which is crucial for subsequent chromosome condensation. Aurora C shows high sequence homology to Aurora B and has a function in meiosis.
[0078] As used herein, the term “Aurora A kinase” refers to a serine / threonine kinase involved in mitotic progression. Aurora A kinase is also known as AIK, ARK1, AURA, BTAK, STK6, STK7, STK15, AURORA2, MGC34538, and AURKA. Various cellular proteins that play some role in cell division, including TPX-2, XIEg5 (Xenopus), and D-TACC (Drosophila), are substrates for phosphorylation by the Aurora A kinase enzyme. The Aurora A kinase enzyme is also a substrate for autophosphorylation, for example, at Thr288. In some cases, Aurora A kinase is human Aurora A kinase.
[0079] In certain embodiments, mitotic kinases include polo-like kinases ("PLK"). PLK, including polo-like kinase 1 ("PLK1"), polo-like kinase 2 ("PLK2"), polo-like kinase 3 ("PLK3"), and polo-like kinase 4 ("PLK4"), are involved in the formation and alteration of the mitotic spindle, as well as the activation of the CDK / cyclin complex during mitosis (Strebhardt & Ullrich, Nature Reviews Cancer 6(4):321, 2006). PLK is overexpressed in tumors, and its overexpression is associated with poor prognosis and reduced overall survival. Therefore, PLK inhibitors have been developed as cancer drug therapies.
[0080] In certain aspects, mitotic kinases include cyclin-dependent protein kinases (CDKs). CDKs are regulators of the timing and coordination of eukaryotic cell cycle events (Norbury & Nurse, Annu. Rev. Biochem. 61:441-470, 1992; Sher, Science 274:1672-1677, 1996). Therefore, CDKs, their regulators, and their substrates are targets of gene mutations in many human cancers (Kamb et al., Science 264:436-440, 1994; Nobori et al., Nature 368:753-756, 1994; Spruck et al., Nature 370:183-184, 1994; Hunter & Pines, Cell 66:1071-1074, 1991; Keyomarsi & Pardee, Proc. Natl. Acad. Sci. USA 90:1112-1116, 1993; Wang, Nature 369:669-671, 1994). Members of the cyclin-dependent kinase family include Cdk2 and Cdk4. Both are active in the G1 phase of the cell cycle and regulate entry into the G1 / S phase. In one pathway, these kinases regulate the phosphorylation of retinoblastoma proteins. Substrate phosphorylation releases the E2F transcription factor, which in turn regulates the expression of genes necessary for S-phase entry. Therefore, inhibition of these kinases blocks cell entry into S-phase and subsequent proliferation events.
[0081] In certain aspects, mitotic kinases include unipolar spindle 1 (MPS1) kinase. Also known as TTK, MPS1 kinase is a dual serine / threonine kinase that controls chromosome alignment and influences the stability of kinetochore-microtubule interactions as a key regulator of spindle formation checkpoints (SACs). SACs are essential for proper chromosome alignment and segregation. MPS1 is expressed only in proliferating cells and is activated when phosphorylated during mitosis, in which case it is required for proper kinetochore recruitment of essential SAC proteins, such as Mad1 (mitotic arrest deficient protein) 1 and Mad2 (mitotic arrest deficient protein) 2. MPS1 is also overexpressed in a wide range of human tumors and is required for tumor cell proliferation.
[0082] In certain embodiments, mitotic kinases include Nek2 (never-in-mitosis gene a-related kinase). Nek2 is a serine / threonine kinase localized to the centrosome, regulating spindle pole formation and separation through phosphorylation of substrates including C-Nap1 (nucleosome assembly protein-1), rutretin, and Nlp (nineine-like protein). In addition to its role in the centrosome, Nek2 is also involved in chromatin condensation and spindle checkpoint control. Nek2 expression and activity are tightly regulated in a cell cycle-dependent manner. Expression levels are low in G1 and increased in S / G2. Nek2 is abnormally expressed in cancer cells.
[0083] In certain aspects, mitotic kinases include Wee1 kinase. Wee1 kinase is a mitotic inhibitor that maintains G2 cell cycle checkpoint arrest for premitotic DNA repair. Wee1 is overexpressed in cancers such as advanced hepatocellular carcinoma, breast cancer, colon cancer, lung cancer, seminoma, and glioblastoma, and its expression is correlated with patient survival in mantle cell lymphoma.
[0084] Those skilled in the art will understand how to utilize representative sequences of mitotic kinases readily available in public sequence databases. The following table provides sample sequence information: TIFF2026143527000005.tif177158
[0085] Mitotic kinase inhibitors: Examples of mitotic kinase inhibitors include inhibitors against PLK1 (e.g., GSK461364, BI2536, Tak960, NMS-P937, BI6727, or volasertib), PLK2, PLK3, PLK4, Aurora kinase 1 / 2 (e.g., alicertib), CDK1 / 2, CHK1 / 2 (e.g., AZD7762, prexasertib), BUB1, BUBR1, MPS1, NEK2, and HASPIN (Schmit et al., Mol Cancer Ther. 6(7):1920-31, 2007). These mitotic kinases can be targeted using small molecule inhibitors, oligonucleotides (e.g., siRNA, miRNA, antisense oligonucleotides), and / or antibodies, all of which are intended in this application.
[0086] Nonspecific Aurora A inhibitors include MLN8054 (Millennium Pharmaceuticals, Cambridge, MA; Jones et al., Proc Am Soc Clin Oncol Annu Meet 25:3577, 2007); MK-0457 (VX-680; Harrington et al., Nat Med 10(3):262-267, 2004); SU6668 (Sugen; Lapenna & Giordano, Nature Rev Drug Discovery 8:547-566, 2009, and supplemental information); and the quinazoline-based inhibitor ZM447439 (Girdler et al., J. Cell Sci., 119, 3664-3675, 2006).
[0087] In certain embodiments, selective inhibitors of Aurora A kinase include, for example, U.S. Publication No. 2008 / 0045501, U.S. Publication No. 7,572,784, International Publication No. 2005 / 111039, International Publication No. 2008 / 021038, U.S. Publication No. 7,718,648, International Publication No. 2008 / 063525, U.S. Publication No. 2008 / 0167292, U.S. Publication No. 8,026,246, and International Publication No. 2010 / 134. Compounds disclosed in U.S. Publication No. 965, U.S. Publication No. 2010 / 0310651, International Publication No. 2011 / 014248, U.S. Publication No. 2011 / 0039826 and U.S. Publication No. 2011 / 0245234; include sodium 4-{[9-chloro-7-(2-fluoro-6-methoxyphenyl)-5H-pyrimido[5,4-(i][2]benzazepine-2-yl]amino}-2-methoxybenzoate; KW-2449 (Kyowa Hakko), ENMD-2076 (ENMD-981693; EntreMed); and MK-5108 (Vertex / Merck).
[0088] Other aurora kinase inhibitors include Hesperadin (Hauf et al., J Cell Biol 161(2):281-294, 2003), AZD1152 (quinazoline prodrug, active metabolite is AZD-1152-HQPA; AstraZeneca, Cambridge, UK; Schellens et al., J Clin Oncol 24:122s, 2006; Yang et al., Blood 110(6):2034-2040, 2007), and MLN8237 (aricertib, a selective, competitive, and reversible small molecule inhibitor of aurora A kinase; Millennium Pharmaceuticals, Cambridge, MA; Gorgun et al., Blood 115(25):5202-5213, 2010; Friedberg et al., J Clin Oncol 32(1):44-50,2014);CYC-116(Cyclapolin 1;Cyclacel Ltd., Cambridge,UK;Taylor&Peters,Curr Opin Cell Biol 20:77-84,2008);AS-703569(R-763;Rigel Pharmaceuticals,San Francisco,CA);AT9283(Astex;Howard et al.,J Med Clin Cancer Res This includes 12(13):4080-4089,2006);SNS-314 (Sunesis Pharmaceuticals, San Francisco, CA; Lapenna & Giordano, Nature Reviews Drug Discovery 8:547-566,2009, and supplemental information); and PF-3814735 (Bhattacharya et al., Am Assoc Canc Res 68(9) Supplement LB-147,2008).An overview is provided in Gautschi et al., Clin. Cancer Res. 14(6):1639-48, 2008. International Publication No. 01 / 21596 describes quinazoline derivatives that inhibit aurora 2 kinase. More than 30 small molecule aurora kinase inhibitors are in various stages of preclinical and clinical development (Lapenna & Giordano Nature Reviews Drug Discovery 8:547-566, 2009, and supplementary information; Kollareddy et al., Invest New Drugs 30(6):2411-2432, 2012).
[0089] The cell cycle inhibitor JNJ-7706621 exhibits potent inhibition of several cyclin-dependent kinases (CDKs) and aurora kinases, selectively inhibiting the proliferation of tumor cells of various origins. At low concentrations, JNJ-7706621 slows cell proliferation, while at high concentrations, it induces cytotoxicity. Cell therapy with JNJ-7706621 showed delayed progression through the G1 phase of the cell cycle and cell cycle arrest in the G2-M phase (Emanuel et al., Cancer Res. 65:9038-9046, 2005).
[0090] CDK inhibitors are described, for example, in EP1244668, EP1507780, EP153976, EP1590341, EP1615926, International Publication No. 03 / 63764, U.S. Publication No. 6,107,305, U.S. Publication No. 6,413,974, International Publication No. 1999 / 02162, International Publication No. 2000 / 12486, International Publication No. 2000 / 39101, International Publication No. 2001 / 14375, International Publication No. 2002 / 10162, International Publication No. 2002 / 04429, International Publication No. 2002 / 096888, and International Publication No. 2003 / 7076437. Several adenosine δ'-triphosphate (ATP) competitive organic small molecules and peptides have been reported in the literature as CDK inhibitors for potential cancer treatments.
[0091] Furthermore, small molecule cyclin-dependent kinase inhibitors are described in Grab et al., FEBS Lett. 353:207-211, 1994; Kitagawa et al., Oncogene 8:2425-2432, 1993; Losiewicz et al., Biochem. Biophys. Res. Commun. 201:589-595, 1994; Carlson et al., Cancer Res. 56:2973-2978, 1996; Kelland, Expert Opin. Invest. Drugs 9:2903-2911, 2000; Senderowicz, Invest. New Drugs 17:313-320, 1999; and Vassilev et al., PNAS 103(28):10660-10665, 2006.In certain aspects, CDK inhibitors include flavopyridol (Senderowicz Invest New Drugs 17(3):313-320, 1999); oromoucin (Vesely et al., Eur.J. Biochem. 224:771-786, 1994); roscovitine (Meijer et al., Eur.J. Biochem. 243:527-536, 1997); CDKi-277 (Amgen, Thousand Oaks, CA; Payton et al., Cancer Res. 66:4299-4308, 2006); RO-3306 (Vassilev et al., PNAS 103(28):10660-10665, 2006); and pervalanol A (Villerbu et al., Int.J. Cancer 97:761-769,2002);NU6140(Pennati et al.,Mol.Cancer Ther.4:1328-1337,2005);s-CR8(Bettayeb et al.,Oncogene 27:5797-5807,2008);N-&-N1(GP0210;Greenpharma SAS, Orleans,France;Bettayeb et al.,Mol.Cancer Ther.7:2713-2724,2008);AZ703(AstraZeneca, Cambridge,UK;Byth et al.,Mol.Cancer Ther.5:655-664,2006);JNJ-7706621(Johnson&Johnson, New Brunswick,NJ;Emanuel et al. al.,Cancer Res. 65:9038-9046, 2005); RGB-286199 (GPC Biotech AG, Planegg, Germany; Wang et al., Proc. Amer. Assoc. Cancer Res. 46, Abstr. 4428, 2005); and SNS-032 (Sunesis Pharmaceuticals, San Francisco, CA; Choong et al. al.,Bioorg.Med.Chem.Lett.18:5763-5765,2008;Fan et al.,Bioorg.Med.Chem.Lett.18:6236-6239,2008).
[0092] Polo-like kinase inhibitors include Scytonemin (Stevenson et al., Inflamm Res 51:112-114, 2002); Wortmannin (Liu et al., Chem Biol 12:99-107, 2005); ON-01910 (or ON 01910.Na; multi-target intravenous cell cycle inhibitor; Onconova Therapeutics Inc., Newtown, PA; Gumireddy et al., Cancer Cell 7:275-286, 2005); BI-2536 (ATP competitive inhibitor of PLK1; Boehringer Ingelheim, Ingelheim, Germany; Steegmaier et al., Current Biology 17:316-322, 2007); BI-6727 (dihydropteridinone derivative inhibitor of PLK; Boehringer Ingelheim, Ingelheim, Germany; Rudolph et al.) al., Clin Cancer Res 15(9):3094-3102, 2009; GSK-61364 (or GSK-461364A; selective intravenous thiophenamide inhibitor of PLK1; Laquerre et al. A potent and selective Polo-like kinase 1 (Plk1) inhibitor (GSK461364) induces cell cycle arrest and growth inhibition of cancer cell. Presented at the 98th American Association for Cancer Research Annual Meeting, Los Angeles, CA, April 14-18, 2007); HMN-214 (oral stilbene derivative inhibitor of PLK1; prodrug of the activator HMN-176; Nippon Shinyaku Co. Ltd, Kyoto, Japan; Garland et al., Clin Can Res 12:5182-5189, 2006); ZK-thiazolidinone (TAL; ATP competitive inhibitor of PLK1; Bayer Schering Pharma AG, Berlin, Germany; Santamaria et al.,Mol Biol Cell 18:4024-4036,2007);NMS-1 (Selective PLK1 inhibitor available orally; Nerviano Medical Sciences, Milano, Italy; Beria et al. Antitumoral activity of pyrazoloquinazoline derivatives as potent oral Plk-1 specific inhibitors. Presented at the 20th European Organization for Research and Treatment of Cancer-National Cancer Institute-American Association for Cancer Research Symposium on Molecular Targets and Cancer Therapeutics, Geneva, Switzerland, October 21-24, 2008);CYC-800 (Selective PLK1 inhibitor derived from benzthiazole-3-oxide; Cyclacel Ltd., Cambridge, UK; McInnes et al., Curr Top Med Chem 5:181-197, 2005); DAP-81 (a diaminopyrimidine derivative targeting PLK; Rockefeller University, New York; Peters et al., Nat Chem Biol 2:618-626, 2006); LC-445 (a specific nonATP competitive allosteric inhibitor of PLK3; Avalon Pharmaceuticals, Germantown, MD; Horrigan et al. A small molecule allosteric inhibitor of Polo-like kinase 3 induces apoptosis and disrupts the integrity of the mitotic spindle apparatus in cancer cells.This was presented at the 20th European Organization for Research and Treatment of Cancer-National Cancer Institute-American Association for Cancer Research Symposium on Molecular Targets and Cancer Therapeutics, Geneva, Switzerland, October 21-24, 2008. This includes centrinone (LCR-263) and centrinone-B (LCR-323) (PLK4 inhibitors; Wong et al., Science 348(6239):1155-1160, 2015). PLK inhibitors are described in Schoffski The Oncologist 14:559-570, 2009.
[0093] Inhibitors of MPS1 kinase include NMS-P715 (pyrazoloquinazoline; Colombo et al., Cancer Res 70(24):10255-10264, 2010); Mps-1-IN-1 and Mps1-IN-2 (Kwiatkowski et al., Nat Chem Biol 6(5):359-368 2010); Mps-1-IN-3 (Bakhos et al., JNCI: Journal of the National Cancer Institute 105(17):1322-1331, 2013); and MPI-0479605 (Tardif et al., Mol Cancer Ther 10(12):2267-2275, 2011).
[0094] In certain embodiments, mitotic kinase inhibitors include Nek2 aminopyrazine inhibitors (Whelligan et al., J Med Chem 53:7682-7698, 2010).
[0095] Wee1 kinase inhibitors include PD0166285 (a pyridopyrimidine derivative that is a non-selective inhibitor of Wee1); PD0407824 (a pyrrolocarbazole derivative that is a highly selective inhibitor of Wee1); Wee1 Inhibitor II (a pyrrolocarbazole derivative); and 4-(2-phenyl)-9-hydroxypyrrolo[3,4-c]-carbazole-1,3-(2H,6H)-dione (PHCD). De Witt Hamer et al. (2011) Clin Cancer Res;17(13):4200-4207; Palmer et al. (2006) J Med Chem 49:4896-4911.
[0096] The term "[target protein] inhibitor" or "[target protein] inhibitor" is used to describe a compound that can interact with a target protein and inhibit its activity, such as enzyme activity. For example, inhibiting target kinase enzyme activity means reducing the target kinase's ability to phosphorylate a substrate peptide or substrate protein. In various embodiments, such a reduction in kinase activity is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In various embodiments, the concentration of kinase inhibitor (or another inhibitor) required to reduce the kinase enzyme activity of a target kinase (or the activity of another target) is less than about 1 μM, less than about 500 nM, less than about 100 nM, or less than about 50 nM. In embodiments, the concentration required to inhibit the enzyme activity of a target (such as a target kinase) is lower than the concentration of inhibitor required to inhibit the enzyme activity of other kinases, or other proteins of the same family, or other proteins that share activity. In various embodiments, the concentration of the inhibitor required to reduce the enzymatic activity of a target protein is at least about half, at least about one-fifth, at least about one-tenth, at least about one-twentieth, at least about one-fiftieth, at least about one-hundredth, at least about one-fiftyth, at least about one-fiftyth, at least about one-fiftyth, at least about one-fiftyth, or at least about one-thousandth of the concentration of the inhibitor required to reduce the enzymatic activity of other proteins, particularly other similar proteins (such as other kinases). Inhibitors can also be used with oligonucleotides (e.g., siRNA, antisense) to induce a reduction in the target protein, or the mRNA encoding the target protein, by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the original mRNA and / or protein levels.
[0097] In certain embodiments, inhibition of mitotic kinases such as PLK1 can modulate the immunosuppressive tumor microenvironment, for example, through a reduction in phosphorylated STAT3 or other immunosuppressive pathways, thereby benefiting the antitumor immune response.
[0098] (III) Immune checkpoint inhibitors Checkpoint inhibitor therapy is a form of cancer immunotherapy developed in recent years. This therapy targets immune checkpoints, which are important regulators of the immune system that tumors may use to stimulate or inhibit the action of the immune system and prevent immune system attacks. Checkpoint therapy can block inhibitory checkpoints and restore immune system function (Pardoll, Nature Revs. Cancer 12(4):252-264, 2012). The first anticancer drug targeting immune checkpoints was the CTLA-4 blocker ipilimumab, approved in the United States in 2011 (Cameron et al., Drugs 71(8):1093-1104, 2011). See also Wieder et al., J Allergy Clin Immunol. 142(5):1403-1414, 2018.
[0099] Immune checkpoint inhibitors treat cancer indirectly by manipulating the immune system. Immune checkpoint inhibitors disrupt the normal immunosuppressive function of immune checkpoint molecules, for example, by downregulating their expression or by binding to them and blocking normal receptor / ligand interactions. Because immune checkpoint molecules act as a brake on the immune system's response to antigens, inhibitors of immune checkpoint molecules reduce this immunosuppressive effect and enhance the immune response. Molecules that play some role in immune checkpoints include cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed cell death 1 T cell receptor (PD-1).
[0100] CTLA-4, PD-1, and their ligands are members of the CD28-B7 family of co-signaling molecules that play crucial roles at every stage of T cell and other cell function. The PD-1 receptor is expressed on the surface of activated T cells (and B cells) and, under normal circumstances, binds to its ligands (PD-L1 and PD-L2) expressed on the surface of antigen-presenting cells such as dendritic cells or macrophages. This interaction signals T cells, effectively switching them off or inhibiting them. Cancer cells exploit this system by promoting high levels of PD-L1 expression on their surface. This allows cancer cells to gain control of the PD-1 pathway and switch off PD-1-expressing T cells, which can enter the tumor microenvironment, thus suppressing the anti-cancer immune response. The immunotherapy ipilimumab, a monoclonal antibody that targets CTLA-4 on the surface of T cells, is approved for the treatment of melanoma. Various novel targeted immunotherapies targeting programmed cell death-1 (PD-1) T cell receptors or their ligands (PD-L1 or PD-L2) may also prove effective. Additional immune checkpoint targets, such as T cell immunoglobulin domain and mucin domain 3 (TIM-3), lymphocyte activator gene 3 (LAG-3), various B7 ligands, BTLA, and adenosine A2A receptor (A2AR), may also prove effective.
[0101] Currently approved immune checkpoint inhibitors target CTLA-4, PD-1, and PD-L1. PD-1 is a transmembrane programmed cell death 1 protein (also known as PDCD1 and CD279) that interacts with PD-L1 (PD-1 ligand 1 or CD274). PD-L1 on the cell surface binds to PD-1 on the surface of immune cells, inhibiting immune cell activity. A key function of PD-L1 is the regulation of T cell activity (Butte et al., Immunity 27(11);111-122, 2007; Karwacz et al., EMBO Mol.Med.3(10:581-592, 2011). Cancer-mediated upregulation of PD-L1 on the cell surface may inhibit T cells that would normally be able to attack cancer cells. Antibodies that bind to either PD-1 or PD-L1 and thus block their interaction may allow T cells to attack tumors (Syn et al., The Lancet Oncology 18(12):e731-e741, 2017).
[0102] In the immune system, a critical balance between rejection and self-tolerance is maintained by a finely tuned set of coregulatory receptor-ligand interactions. Recently, the programmed cell death (PD)-1 / PD-1 ligand (PD-L1, B7-H1) pathway has attracted attention as a key mediator of tumor immune tolerance. Under physiological conditions, inhibitory PD-1 receptors are expressed on activated immune effector cells, including T cells, B cells, and NK cells. Through interaction with its ligands PD-L1 and PD-L2, normally expressed on antigen-presenting cells (APCs), immune effector activity is self-restricted within peripheral tissues during inflammatory processes. This inhibitory system is fundamental to protecting healthy tissues and uninfected cells during the elimination of intracellular viral and bacterial infections. However, many human cancers have been shown to express PD-1 ligands, thereby locally inducing immune tolerance within the tumor microenvironment (TME) and promoting the escape of tumor cells from immune attack. Two common mechanisms that promote PD-L1 expression on tumor cells have been hypothesized. In some tumors, abnormal signaling pathways can constitutively upregulate PD-L1 expression, a phenomenon known as "innate immune resistance." On the other hand, PD-L1 expression is an adaptive mechanism arising in response to inflammatory cytokines produced within the tumor mesenter during the antitumor immune response ("adaptive immune resistance"). These mechanisms of PD-L1 expression are not mutually exclusive; that is, constitutive PD-L1 expression on tumor cells can be further upregulated by cytokines such as interferon-gamma (IFN-γ).
[0103] PD-L1 expression by tumor cells before treatment is reduced with anti-PD-1 monotherapy (e.g., nivolumab (Bristol-Myers)). It correlates highly with responses to Squibb (OPDIVO®), pembrolizumab (Merck; KEYTRUDA®), and anti-PD-L1 therapies (e.g., MPDL3280A (Genentech / Roche)). Additional checkpoint inhibitors include ipilimumab and tremelimumab (targeting CTLA-4); atezolizumab (Genentech / Roche; Tecentriq), avelumab (Merck; Bavencio), and durvalumab (Medimmune / Strazeneca; Imfinzi) (targeting PD-L1); as well as semiprimab (REGN-2810), nivolumab, pembrolizumab, and pidilizumab (targeting PD-1). Spartalizumab (PDR001; Novartis) is also under development as a PD-1 inhibitor.
[0104] Methods of PD-1 blockade therapy, including cancer treatment, are well known in the art. See, for example, International Publication No. 2016 / 201425, U.S. Patent No. 2019 / 0275705, Kvistborg et al. (Science Transl Med. 6(254):254ra128, 2014), Zou et al. (Science Transl Med. 8(328):328rv4, 2016), and Sakuishi et al. J Exp Med. 207(10):2187-2194, 2010.
[0105] PD-1 blockers include those used to treat cancer (i.e., to inhibit the growth or survival of tumor cells). Cancers whose growth can be inhibited using antibodies or anti-PD-1 agents or other checkpoint inhibitors typically include cancers that are responsive to immunotherapy, but also cancers that have not previously been associated with immunotherapy. Examples of cancers for treatment include melanoma (e.g., metastatic melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone-refractory adenocarcinoma of the prostate), pancreatic adenocarcinoma, breast cancer, colon cancer, lung cancer (e.g., non-small cell lung cancer), esophageal cancer, squamous cell carcinoma of the head and neck, liver cancer, ovarian cancer, cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma, and other neoplastic malignancies. The procedures described herein are applicable to malignancies that show improved disease-free survival and overall survival in association with the presence of tumor-infiltrating lymphocytes in biopsy or surgical material, such as melanoma, colorectal cancer, liver cancer, kidney cancer, gastric / esophageal cancer, breast cancer, pancreatic cancer, and ovarian cancer. Such cancer subtypes are known to be susceptible to immunomodulation by T lymphocytes. Furthermore, the techniques provided are useful for treating refractory or recurrent malignancies whose growth can be inhibited using PD-1 or other checkpoint blocker therapies. In particular, cancers characterized by elevated expression of PD-1 and / or its ligands PD-L1 and / or PD-L2 in the tissue samples tested include, for example, ovarian cancer, kidney cancer, colorectal cancer, pancreatic cancer, breast cancer, liver cancer, glioblastoma, non-small cell lung cancer, gastric cancer, esophageal cancer, and melanoma. Cancers also include those associated with persistent infections caused by viruses such as human immunodeficiency virus, hepatitis viruses classes A, B, and C, Epstein-Barr virus, and human papillomavirus, which are known to be causally linked to Kaposi's sarcoma, liver cancer, nasopharyngeal cancer, lymphoma, cervical cancer, vulvar cancer, anal cancer, penile cancer, and oral cancer.
[0106] The PD-1 / PD-L1 pathway is a well-validated target for the development of antibody therapies for cancer treatment. Anti-PD-1 antibodies may also be useful against chronic viral infections. Memory CD8+ T cells, generated after acute viral infection, are highly functional and constitute a crucial component of protective immunity. In contrast, chronic infections are often characterized by varying degrees of dysfunction (exhaustion) of the virus-specific T cell response, a defect that is the main reason why the host is unable to eliminate persistent pathogens. Functional effector T cells are initially generated in the early stages of infection but gradually lose function throughout the course of chronic infection. Barber et al. (Nature 439:682-687, 2006) showed that mice infected with an experimental strain of LCMV developed chronic infections resulting in high levels of virus in the blood and other tissues. These mice initially expressed a robust T cell response but eventually succumbed to the infection when T cell exhaustion occurred. The authors found that in chronically infected mice, the decline in the number and function of effector T cells could be reversed by injecting antibodies that block the interaction between PD-1 and PD-L1.
[0107] In certain embodiments, immune checkpoint molecules include CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, TIM-3, killer cell immunoglobulin-like receptor (KIR), CD160, B7-H3 (CD276), BTLA (CD272), IDO (indoleamine 2,3-dioxygenase), adenosine A2A receptor (A2AR), and C10ORF54.
[0108] The term "immune checkpoint protein" or "immune checkpoint molecule" refers to a molecule expressed by T cells that either enhances signaling (stimulatory checkpoint molecules) or weakens signaling (inhibitory checkpoint molecules). It is recognized in the art that immune checkpoint molecules constitute immune checkpoint pathways similar to the CTLA-4-dependent and PD-1-dependent pathways (see, e.g., Pardoll, Nature Rev Cancer 12:252-264, 2012; Mellman et al., Nature 480:480-489, 2011). Examples of inhibitory checkpoint molecules include A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, LAG-3, TIM-3, and VISTA. The adenosine A2A receptor (A2AR) is considered an important checkpoint in cancer treatment because the tumor microenvironment has relatively high levels of adenosine, which leads to a negative immune feedback loop through A2AR activation. B7-H3, also known as CD276, was initially understood to be a co-stimulatory molecule, but is now considered to be a co-inhibitor. B7-H4, also known as VTCN1, is expressed by tumor cells and tumor-associated macrophages and plays some role in tumor escape. B and T lymphocyte attenuators (BTLA), also known as CD272, are ligands for HVEM (herpesvirus entry mediator). Cell surface expression of BTLA is gradually downregulated during the differentiation of human CD8+ T cells from naive cell phenotype to effector cell phenotype, but tumor-specific human CD8+ T cells express high levels of BTLA. CTLA-4, also known as CD152, is overexpressed on regulatory T (Treg) cells and functions to regulate T cell proliferation. IDO is a tryptophan-degrading enzyme in the tryptophan-to-kynurenine metabolic pathway that modulates innate and adaptive immunity. IDO is known to suppress T cells and natural killer (NK) cells, generate and activate Treg and myeloid suppressor cells, and promote tumor angiogenesis.Another important molecule is TDO, tryptophan 2,3-dioxygenase, a key enzyme in the metabolic pathway from tryptophan to kynurenine (Platten et al., Front Immunol. 5:673, 2014). KIR is a receptor for MHC class I molecules on NK cells. LAG-3 functions to suppress the immune response through its action on Tregs and its direct action on CD8+ T cells. PD-1, the programmed cell death 1 (PD-1) receptor, has two ligands, PD-L1 and PD-L2. This checkpoint is the target of the melanoma drug Keytruda® (pembrolizumab, Merck & Co., Kenilworth, NJ), which received FDA approval in September 2014. The advantage of targeting PD-1 is that it can restore immune function within the tumor microenvironment. TIM-3 is expressed on activated human CD4+ T cells and modulates Th1 and Th17 cytokines. TIM-3 acts as a negative regulator of Th1 / Tel function by inducing cell death when it interacts with its ligand, galectin-9. Since the V-domain Ig inhibitor of T cell activation (VISTA) is primarily expressed on hematopoietic cells, consistent expression of VISTA on leukocytes within tumors may make VISTA blockade effective across a wide range of solid tumors.
[0109] The term "immune checkpoint inhibitor" refers to any compound that inhibits the function of an immunosuppressive checkpoint protein. Inhibition includes reduced function and complete blockade. In certain embodiments, an immune checkpoint inhibitor is an antibody that specifically recognizes an immune checkpoint protein. In certain embodiments, immune checkpoint inhibitors include peptides, antibodies, nucleic acid molecules, and small molecules. In certain embodiments, immune checkpoint inhibitors are administered to enhance the proliferation, migration, persistence, and / or cytotoxic activity of target CD8+ T cells, particularly target tumor-infiltrating CD8+ T cells.
[0110] Immune checkpoint inhibitors include drugs that inhibit at least one of the following (directly or indirectly): CTLA-4, PD-1, PD-L1, etc. Suitable anti-CTLA-4 therapeutic agents for use in the methods of this disclosure include anti-CTLA-4 antibodies, human anti-CTLA-4 antibodies, mouse anti-CTLA-4 antibodies, mammalian anti-CTLA-4 antibodies, humanized anti-CTLA-4 antibodies, monoclonal anti-CTLA-4 antibodies, polyclonal anti-CTLA-4 antibodies, chimeric anti-CTLA-4 antibodies, ipilimumab, tremelimumab, anti-CD28 antibodies, anti-CTLA-4 adnectin, anti-CTLA-4 domain antibodies, single-chain anti-CTLA-4 fragments, heavy-chain anti-CTLA-4 fragments, light-chain anti-CTLA-4 fragments, CTLA-4 inhibitors that stimulate the costimulatory pathway, antibodies disclosed in International Publication No. 2001 / 014424, antibodies disclosed in International Publication No. 2004 / 035607, antibodies disclosed in U.S. Patent No. 2005 / 0201994, and antibodies disclosed in EP1212422. Additional anti-CTLA-4 antibodies are described in U.S. Publication Nos. 5,811,097, 5,855,887, 6,051,227, 6,984,720, International Publication Nos. 01 / 14424, 00 / 37504, 2002 / 0039581, and 2002 / 086014. Other anti-CTLA-4 antibodies that may be used in the methods of this disclosure include, for example, those disclosed in International Publication No. 98 / 42752; U.S. Patent No. 6,682,736; U.S. Patent No. 6,207,156; Hurwitz et al., Proc. Natl. Acad. Sci. USA, 95(17):10067-10071, 1998; Camacho et al., J. Clin. Oncology, 22(145): Abstract No. 2505, 2004 (Antibody CP-675206); Mokyr et al., Cancer Res 58:5301-5304, 1998; U.S. Patent No. 5,977,318; U.S. Patent No. 6,682,736; U.S. Patent No. 7,109,003; and U.S. Patent No. 7,132,281.
[0111] Suitable anti-PD-1 and anti-PD-L1 therapies for use in the methods of this disclosure include anti-PD-1 antibodies and anti-PD-L1 antibodies, human anti-PD-1 antibodies and anti-PD-L1 antibodies, mouse anti-PD-1 antibodies and anti-PD-L1 antibodies, mammalian anti-PD-1 antibodies and anti-PD-L1 antibodies, humanized anti-PD-1 antibodies and anti-PD-L1 antibodies, monoclonal anti-PD-1 antibodies and anti-PD-L1 antibodies, polyclonal anti-PD-1 antibodies and anti-PD-L1 antibodies, chimeric anti-PD-1 antibodies and anti-PD-L1 antibodies. In certain embodiments, anti-PD-1 therapies include nivolumab, pembrolizumab, pidilizumab, MEDI0680 (AstraZeneca, Cambridge, UK) and combinations thereof. In certain embodiments, anti-PD-L1 therapies include atezolizumab, BMS-936559 (Bristol-Myers Squibb, New York, NY), durvalumab (MEDI4736), avelumab (MSB0010718C), and combinations thereof.
[0112] Suitable anti-PD-1 and anti-PD-L1 antibodies are described in Topalian et al. (Cancer Cell 27:450-461, 2015).
[0113] In certain embodiments, immune checkpoint inhibitors may include modified ligands or antisense nucleic acid molecules, such as siRNA, designed to inhibit specific immune checkpoint molecules. In certain embodiments, siRNA prevents the translation of an immune checkpoint molecule and, consequently, prevents the expression of the protein. Given that the genomic sequences of many immune checkpoint molecules are publicly known, those skilled in the art could use common methods to design suitable inhibitory antisense nucleic acid molecules.
[0114] In certain embodiments, checkpoint inhibitors may be siRNAs, small molecule inhibitors, or antibodies (specific to immune checkpoint molecules) against immune checkpoint molecules that are beneficial for cancer treatment. Such targets include PD-L1, PD-1, CTLA-4, LAG-3, TIM-3, B7-H3, VISTA, A2AR, and IDO (Khair et al., Frontiers Immunology, 10:453, 2019).
[0115] Those skilled in the art will understand how to utilize representative sequences of such targets, which are readily available in public sequence databases. The following table provides sample sequence information: TIFF2026143527000006.tif93158
[0116] (IV) Any additional components The therapeutic constructs provided herein may optionally contain, or be administered with, one or more optional components in addition to mitotic kinase inhibitors and immune checkpoint inhibitors. These optional components include adjuvants, therapeutic oligonucleotides, additional anticancer agents, and targeted moieties.
[0117] Adjuvant The therapeutic constructs provided herein may optionally include at least one adjuvant component contained within or otherwise bound to the delivery vehicle. The embodiments of the therapeutic constructs are not limited to any particular type of adjuvant, but specific examples are provided herein.
[0118] Generally, an adjuvant is any substance that, when mixed with a vaccine composition, increases or otherwise modifies the immune response to a (cancer) antigen. The ability of an adjuvant to increase the immune response to an antigen is typically manifested by a significant increase in the immune-mediated response or a reduction in disease symptoms. For example, an increase in humoral immunity typically manifests as a significant increase in the titer of antibodies induced against the antigen, and an increase in T cell activity typically manifests as an increase in antigen-specific T cell proliferation, target cell death, or cytokine secretion. Adjuvants can also alter the immune response, for example, by changing a primarily humoral or Th2 response to a primarily cellular or Th1 response.
[0119] Suitable adjuvants include TLR-binding DNA substituents, such as CpG oligonucleotides (e.g., ISS1018; Amplivax; CpG ODN 7909, CpG ODN 1826, CpG ODN D19, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395, ODN M362, and SD-101), DNA TLR agonists containing CpG sequences (e.g., dSLIM), non-CpG DNA TLR agonists (e.g., EnanDIM), and cationic peptide conjugate CpG oligonucleotides (e.g., IC30, IC31); RNA TLR agonists (e.g., poly-I:C and poly-ICLC); aluminum salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum chloride, and potassium aluminum sulfate); anti-CD40 antibodies (e.g., CP-870, 893); cytokines (e.g., granulocyte-macrophage colony-stimulating factor (GM-CSF)); small molecule TLR agonists (e.g., imiquimod, reximod, gardikimod, and 3M-052); fusion proteins (e.g., ImuFact IMP321, CyaA, and ONTAK); oil-based or surfactant-based adjuvants (e.g., MF59, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, and Montanide ISA-51); plant extracts (e.g., QS21 stimulon derived from saponins (Aquila) Biotech, Worcester, Mass., USA); Mycobacterial extracts and synthetic bacterial cell wall mimics, e.g., lipopolysaccharides (e.g., monophosphoryl lipid A, OM-174, OM-197-MP-EC, and Pam3Cys); xanthenon derivatives (e.g., badi mezan); mixtures thereof (e.g., AS-15); and other proprietary adjuvants, e.g., Ribi's Detox, Quil, or Superfos, are included but not limited to these.Several immunological adjuvants (e.g., dendritic cell-specific MF59 and their preparations) have been previously described (Dupuis et al., Cell Immunol. 186(1):18-27, 1998; Allison, Dev Biol Stand.; 92:3-11, 1998). Cytokines may also be used as adjuvants. Some cytokines affect dendritic cell migration to lymphoid tissues (e.g., TNF-α), promote the maturation of dendritic cells into efficient antigen-presenting cells for T lymphocytes (e.g., GM-CSF, IL-1 and IL-4) (US Patent No. 5,849,589), and function as immunoadjuvants (e.g., IL-12) (Gabrilovich et al., J Immunother Emphasis Tumor). This is directly related to Immunol. (6):414-418, 1996). Additionally, Toll-like receptors (TLRs), or drugs that activate TLRs, may be used as adjuvants and are important members of the family of pattern recognition receptors (PRRs) that recognize conserved motifs shared by many microorganisms, known as "pathogen-associated molecular patterns" (PAMPS).
[0120] In some embodiments, adjuvants include CpG oligonucleotides. CpG immunostimulatory oligonucleotides have also been reported to enhance the effects of adjuvants in vaccine settings. While not bound by any specifically mechanistic theory, CpG oligonucleotides function at least partially by activating the innate (maladaptive) immune system via Toll-like receptors (TLRs), primarily TLR9. CpG-induced TLR9 activation enhances antigen-specific humoral and cellular responses to a wide variety of antigens, including peptide or protein antigens, live or dead viruses, dendritic cell vaccines, autologous cell vaccines, and polysaccharide conjugates, in both prophylactic and therapeutic vaccines. More importantly, CpG-induced TLR9 activation promotes dendritic cell maturation and differentiation, even without the help of CD4 T cells. HIt enhances the activation of single cells and generates potent cytotoxic T lymphocytes (CTLs). TLR9 stimulation induces T H 1 bias is usually T H 2. Bias is maintained even in the presence of vaccine adjuvants such as alum or incomplete Freund's adjuvant (IFA). CpG oligonucleotides exhibit even greater adjuvant activity when formulated, administered co-administered with other adjuvants, or in formulations such as microparticles, nanoparticles, lipid emulsions, or similar formulations, which are particularly necessary to induce a strong response when the antigen is relatively weak. They also accelerate the immune response and, in some experiments, have allowed for an antigen dose reduction of approximately two orders of magnitude while obtaining an antibody response comparable to a full-dose vaccine without CpG (Krieg, Nature Reviews, Drug Discovery, 5:471-484, 2006). U.S. Patent No. 6,406,705 describes the combined use of CpG oligonucleotides, non-nucleoside adjuvants, and antigens to induce an antigen-specific immune response. A commercially available CpG TLR9 agonist is dSLIM (double Stem Loop Immunomodulator) manufactured by Mologen (Berlin, Germany). Other TLR-binding molecules, such as RNA-binding TLR 7, RNA-binding TLR 8, and / or RNA-binding TLR 9, may also be used.
[0121] For example, xanthenone derivatives such as badimezan or AsA404 (also known as 5,6-dimethylxanthenone-4-acetic acid (DMXAA)) may also be used as adjuvants according to embodiments of the present invention. Alternatively, such derivatives may also be administered in parallel with the vaccine of the present invention, for example, via systemic delivery or intratumoral delivery, to stimulate immunity at the tumor site. Although not bound by theory, such xanthenone derivatives are thought to function by stimulating interferon (IFN) production via stimulators of the IFN gene receptor (see, e.g., Conlon et al., J Immunology, 190:5216-5225, 2013; and Kim et al., ACS Chem Biol, 8:1396-1401, 2013). Other examples of useful adjuvants include, but are not limited to, chemically modified CpG (e.g., CpR, Idera), poly(I:C) (e.g., polyi:CI2U), non-CpG bacterial DNA or non-CpG bacterial RNA, as well as immunoactive small molecules and antibodies that can function therapeutically and / or as adjuvants, such as cyclophosphamide, sunitinib, bevacizumab, Celebrex®, NCX-4016, sildenafil, tadalafil, vardenafil, sorafinib, XL-999, CP-547632, pazopanib, AZD2171, ipilimumab, tremelimumab, and SC58175. In the context of the present invention, the amounts and concentrations of useful adjuvants and additives can be readily determined by those skilled in the art without the use of excessive experimentation. Additional adjuvants include colony-stimulating factors, such as granulocyte-macrophage colony-stimulating factor (GM-CSF, salglamostim).
[0122] Poly-ICLC is a synthetically prepared double-stranded RNA consisting of a poly-I chain and a poly-C chain with an average length of approximately 5000 nucleotides, stabilized against thermal denaturation and hydrolysis by serum nucleases by the addition of polylysine and carboxymethylcellulose. This compound activates the RNA helicase domains of TLR3 and MDA5, both members of the PAMP family, resulting in the activation of DCs and natural killer (NK) cells, as well as the production of a “natural mixture” of type I interferons, cytokines, and chemokines. Furthermore, poly-ICLC exerts more direct, broad-spectrum host-targeting anti-infective and possibly antitumor effects mediated by two IFN-inducible nuclear enzyme systems, namely 2'5'-OAS and Pl / eIF2a kinase, also known as PKR(4-6), as well as RIG-I helicase and MDA5.
[0123] Examples of immunological adjuvants that can be conjugated to therapeutic constructs include TLR ligands, type C lectin receptor ligands, NOD-like receptor ligands, RLR ligands, and RAGE ligands. TLR ligands may include lipopolysaccharide (LPS) and its derivatives, as well as lipid A and its derivatives, including but not limited to monophosphoryl lipid A (MPL), glycopyranosyl lipid A, PET-lipid A, and 3-O-desacyl-4'-monophosphoryl lipid A. In a specific embodiment, the immunological adjuvant is MPL. In another embodiment, the immunological adjuvant is LPS. TLR ligands may also include, but are not limited to, TLR3 ligands (e.g., polyinosine-polycytidic acid (Poly(I:C))), TLR7 ligands (e.g., imiquimod and reciquimod), and TLR9 ligands.
[0124] As used herein, the term “TLR-binding DNA substituent” refers to a substituent or moiety that can bind to a Toll-like receptor (“TLR”) and comprises at least one deoxyribonucleic acid. In some embodiments, the TLR-binding DNA substituent is a nucleic acid. In some embodiments, the TLR-binding DNA substituent comprises at least one nucleic acid analog. In some embodiments, the TLR-binding DNA substituent comprises at least one nucleic acid analog having an alternative skeleton (e.g., phosphodiester derivatives (e.g., phosphoramidate, phosphorodiamidate, phosphorothioate, phosphorodithioate, phosphonocarboxylic acid, phosphonocarboxylate, phosphonoacetic acid, phosphonoformic acid, methylphosphonate, boronphosphonate, or O-methylphosphoramidite), peptide nucleic acid skeleton, LNA, or binding). In some embodiments, the TLR-binding DNA substituent comprises DNA. In some embodiments, any nucleotide sugar in the TLR-binding DNA substituent is deoxyribose (e.g., any nucleotide is DNA). In some embodiments, the TLR-binding DNA substituent consists of DNA. In one embodiment, the TLR-binding DNA substituent includes or is DNA having internucleotide bonds selected from phosphodiesters and phosphodiester derivatives (e.g., phosphoramides, phosphorodiamidates, phosphorothioates, phosphorodithioates, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methylphosphonates, boronphosphonates, O-methylphosphoramidites, or combinations thereof). In another embodiment, the TLR-binding DNA substituent consists of DNA having internucleotide bonds selected from phosphodiesters and phosphorothioates. In yet another embodiment, the TLR-binding DNA substituent includes or is DNA having skeletal bonds selected from phosphodiesters and phosphorodithioates. In yet another embodiment, the TLR-binding DNA substituent includes or is DNA containing a phosphodiester skeletal bond. In yet another embodiment, the TLR-binding DNA substituent includes or is DNA containing a phosphorothioate skeletal bond. In one embodiment, the TLR-binding DNA substituent includes or is DNA containing a phosphorodithioate backbone.In one embodiment, the TLR-binding DNA substituent preferentially binds to TLR9 over other TLRs. In another embodiment, the TLR-binding DNA substituent specifically binds to TLR9. In another embodiment, the TLR-binding DNA substituent specifically binds to TLR3. In another embodiment, the TLR-binding DNA substituent specifically binds to TLR7. In another embodiment, the TLR-binding DNA substituent specifically binds to TLR8. In another embodiment, the TLR-binding DNA substituent specifically binds to a cell subcompartment (e.g., endosome) associated TLR (e.g., TLR3, TLR7, TLR8, or TLR9). In another embodiment, the TLR-binding DNA substituent contains or is a G-rich oligonucleotide. In another embodiment, the TLR-binding DNA substituent contains a CpG motif, where C and G are nucleotides and p is a phosphate linking C and G. In another embodiment, the CpG motif is unmethylated. In another embodiment, the TLR-binding DNA substituent is a class A CpG oligodeoxynucleotide (ODN). In one embodiment, the TLR-binding DNA substituent is a class B CpG oligodeoxynucleotide (ODN). In another embodiment, the TLR-binding DNA substituent is a class C CpG oligodeoxynucleotide (ODN). In another embodiment, the TLR-binding DNA substituent (e.g., TLR9-binding DNA substituent) consists of a deoxyribonucleic acid having an A base, a G base, a C base, or a T base and a phosphodiester bond and / or a phosphodiester derivative bond (e.g., a phosphorothioate bond).
[0125] The term "CpG motif" refers to a 5'C nucleotide linked to a 3'G nucleotide via a phosphodiester nucleotide bond or a phosphodiester derivative nucleotide bond. In some embodiments, the CpG motif includes a phosphodiester nucleotide bond. In some embodiments, the CpG motif includes a phosphodiester derivative nucleotide bond.
[0126] As used herein, the terms “Class A CpG ODN,” “Class A CpG ODN,” “Type D CpG ODN,” or “Class A CpG DNA sequence” are used in accordance with their general meanings in biological and chemical sciences and refer to a CpG motif containing an oligodeoxynucleotide, which includes a poly-G sequence at the 5', 3', or both ends; an internal palindromic sequence containing a CpG motif; or one or more phosphodiester derivatives that conjugate a deoxynucleotide. In some embodiments, a Class A CpG ODN comprises a poly-G sequence at the 5', 3', or both ends; an internal palindromic sequence containing a CpG motif; and one or more phosphodiester derivatives that conjugate a deoxynucleotide. In some embodiments, the phosphodiester derivative is a phosphorothioate. Examples of Class A CpG ODNs include ODN D19, ODN 1585, ODN 2216, and ODN 2336.
[0127] The terms “Class B CpG ODN,” “Class B CpG ODN,” “Type K CpG ODN,” or “Class B CpG DNA sequence” are used according to their general meanings in biological and chemical sciences and refer to a CpG motif containing a hexameric motif containing a CpG motif; and a CpG motif containing an oligodeoxynucleotide containing one or more phosphodiester derivatives that bind any deoxynucleotide. In aspects, a Class B CpG ODN comprises a hexameric motif containing a CpG motif and one or more copies of a phosphodiester derivative that binds any deoxynucleotide. In aspects, the phosphodiester derivative is a phosphorothioate. In aspects, a Class B CpG ODN comprises one hexameric motif containing a CpG motif. In aspects, a Class B CpG ODN comprises two copies of a hexameric motif containing a CpG motif. In aspects, a Class B CpG ODN comprises three copies of a hexameric motif containing a CpG motif. In some embodiments, a class B CpG ODN contains four copies of a hexamer motif that includes a CpG motif. Examples of class B CpG ODNs include ODN 1668, ODN 1826, ODN 2006, and ODN 2007.
[0128] The terms "Class C CpG ODN," "Class C CpG ODN," or "Type C CpG DNA sequence" are used according to their general meanings in biological and chemical sciences and refer to oligodeoxynucleotides containing a palindromic sequence with a CpG motif and a phosphodiester derivative (phosphorothioate) that binds any deoxynucleotide. Examples of Class C CpG ODNs include ODN 2395 and ODN M362.
[0129] Therapeutic oligonucleotides Optionally, the therapeutic construct provided may contain one or more therapeutic oligonucleotides. Various types of therapeutic oligonucleotides can be used, and these may include, but are not exhaustive, siRNA, miRNA, antisense oligonucleotides, ribozymes, aptamers, DNA, mRNA, sgRNA (for CRISPR), and CRISPR-Cas9 elements. In other words, any chain of nucleotides can be utilized as long as it can specifically regulate (interfere with or enhance) the action or synthesis of specific genes and proteins. Each particular oligonucleotide may have one or more targets. Examples of gene / protein targets of interest to the present invention include immune checkpoints (described elsewhere herein), transcription factors, phosphatases, kinases, and the like. Specific targets are not limited to STAT3, TGF-β, CD47, NOX1-5, HSP47, XBP1, BCL2, BCL-XL, AKT1, AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1, RRM2, PKN3, EGFR, IRE1-α, VEGF-R1, RTP801, proNGF, Keratin K6A, LMP2, LMP7, MECL1, HIF1α, Furin, KSP, ei These include F-4E, p53, β-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1, MTDH, Twist, Lcn2, IL-6, IL-10, p65, and the aforementioned mitotic kinases (e.g., PLK1, PLK2, PLK3, PLK4, CDK1, CDK2, CHK1, CHK2, BUB1, BUBR1, MPS1, NEK2, HASPIN, Aurora A). Therapeutic oligonucleotides can also contain two strands targeting two genes (e.g., siRNA against BCL2 and AKT1, siRNA against AR and MYC). They can also contain immunostimulatory sequences / elements that can simultaneously enhance the immune response and modulate the expression of target genes. They can also be designed to target the aforementioned genes with mutations.
[0130] In certain embodiments, therapeutic constructs contain, as activators, oligonucleotides that mediate RNA interference. RNA interference is a highly conserved mechanism caused by double-stranded RNA (dsRNA) that can downregulate the transcript of a gene homologous to the dsRNA. dsRNA is initially processed by a dicer into short double-stranded molecules of 21-23 nucleotides called small interfering RNA (siRNA). Once incorporated into the RNA-induced silencing complex (RISC), dsRNA can mediate gene silencing by cleaving target mRNA. "siRNA," or "small interfering ribonucleic acid," refers to two strands of ribonucleotides that hybridize along complementary regions under physiological conditions. The siRNA molecule contains a double-stranded region substantially identical to the region of the target gene's mRNA. A region with 100% identity to the corresponding sequence of the target gene is suitable. This state is called "perfectly complementary." However, this region may also contain one, two, or three mismatches compared to the corresponding region of the target gene, depending on the length of the targeted mRNA region, and therefore may not be perfectly complementary. Methods for analyzing and identifying siRNAs with sufficient sequence identity to effectively inhibit the expression of a specific target sequence are known in the art. The coding region is considered a suitable mRNA target region. Untranslated regions, such as the 5'-UTR, 3'-UTR, and splice junctions, are also suitable, provided that these regions are specific to the mRNA target and do not target the mRNA polyA tail.
[0131] In some embodiments, siRNA encapsulated within or bound to a therapeutic construct is utilized in methods and systems involving RNA interference. Such embodiments are not limited to a specific size or type of siRNA molecule. The length of the siRNA region complementary to the target may be, for example, 15–100 nucleotides, 18–25 nucleotides, 20–23 nucleotides, or greater than 15, 16, 17, or 18 nucleotides. If there is a mismatch with the corresponding target region, the length of the complementary region generally needs to be somewhat longer.
[0132] In certain embodiments, it is intended that the development of any gene of interest can be inhibited using an siRNA delivery method (e.g., by loading siRNA onto the therapeutic construct) that uses the therapeutic constructs disclosed herein. Specific targets include, but are not limited to, genes known as drivers in cancer and other diseases, such as STAT3, TGF-β, CD47, NOX1-5, HSP47, XBP1, BCL2, BCL-XL, AKT1, AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1, RRM2, PKN3, EGFR, IRE1-α, VEGF-R1, RTP801, proNGF, keratin K6A, LMP2, LMP7, MECL1, HIF1α, furin, KSP, eiF-4E, p53, β-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1, MTDH, Twist, Lcn2, IL-6, IL-10, p65, and the aforementioned mitotic kinases. Furthermore, siRNA is specifically intended to target mutant or mutated genes rather than wild-type genes.
[0133] Those skilled in the art will understand how to utilize representative sequences of these targets, which are readily available in public sequence databases. The following table provides sample sequence information: TIFF2026143527000007.tif171158TIFF2026143527000008.tif241158TIFF2026143527000009.tif215158TIFF2026143527000010.tif109158
[0134] Such embodiments are not limited to specific methods for evaluating the delivery profile of siRNA in vitro and / or in vivo. In some embodiments, labeling the siRNA molecule with imaging agents (e.g., fluorescent dyes FITC, RITC, Cy® dyes, Dylight® dyes, Alexa Fluor® dyes, or lantanide probes) or radiotraceers allows for visualization of the in vivo distribution and intracellular delivery profile of siRNA molecules at the organ level. In some embodiments, RT-PCR and Western blotting are used to analyze target proteins at the mRNA level and protein level, respectively.
[0135] In certain embodiments, the present invention provides a method for inhibiting a target gene within a cell, comprising the step of introducing an siRNA capable of inhibiting the target gene by RNA interference into a cell (bound to a therapeutic construct), wherein the siRNA comprises two complementary RNA strands, and the siRNA is loaded onto a therapeutic construct. In some embodiments, the siRNA is modified with cholesterol at its 3' sense strand. In some embodiments, the cells are located within a human or animal subject (e.g., a horse, dog, cat, or other domesticated animal, livestock, or other animal with cancer).
[0136] MicroRNAs (miRNAs), or miRNA mimes, are short non-coding RNAs that can target and effectively silence protein-coding genes via their 3'-UTR elements. While the crucial roles of miRNAs in numerous biological processes are well-established, a comprehensive analysis of miRNA function in complex diseases is lacking. miRNAs are initially transcribed as primary miRNAs (pri-miRNAs), which are then cleaved by nuclear RNAse Drosha and Pasha to yield precursor miRNAs (pre-miRNAs). These precursors are further processed by cytoplasmic RNAse III dicers to form short double-stranded miR-miR* double helices, one of which (miR) is then incorporated into an RNA-induced silencing complex (RISC) containing the enzyme dicer and Argonaut (Ago). Mature miRNAs (approximately 17–24 nt) direct the RISC to a specific target site located within the 3'UTR of the target gene. Upon binding to a target site, miRNAs repress translation through mRNA degradation, translation inhibition, and / or sequestering to a processing body (P body) (Eulalio et al., Cell, 132:9-14, 2008; Behm-Ansmant et al., Cold Spring Harb. Symp. Quant. Biol., 71:523-530, 2006; Chu and Rana, Plos. Biology., 4:e210, 2006). Recent estimates suggest that over 60% of protein-coding genes have 3'-UTR miRNA target sites (Friedman et al., Genome Res., 19:92-105, 2009).In this regard, miRNAs act as important regulators of diverse processes, such as early development (Reinhart et al., Nature, 403:901-906, 2000), cell proliferation and cell death (Brennecke et al., Cell, 113(1):25-36, 2003), apoptosis and adipogenesis (Xu et al., Curr. Biol., 13(9):790-795, 2003), and cell differentiation (Chen et al., Mol. Microbiol., 53843-856, 2004; Dostie et al., RNA-A Publication of the RNA Society, 9:180-186, 2003). Furthermore, studies of miRNA expression in chronic lymphocytic leukemia (Calin et al., Proc. Natl. Acad. Sci. USA, 105:5166-5171, 2008), colonic adenocarcinoma (Michael et al., Mol. Cancer Res., 1:882-891, 2003), Burkitt lymphoma (Metzler et al., Genes Chromosomes Cancer, 39:167-169, 2004), heart disease (Zhao et al., Cell, 129:303-317, 2007), and viral infections (Pfeffer et al., Science, 304:734-736, 2004) suggest important associations between miRNAs and numerous diseases.
[0137] miRNAs observed to date are approximately 21–22 nucleotides long and arise from longer precursors transcribed from non-protein-coding genes, as outlined in Carrington and Ambros (Science, 301(5631):336–338, 2003). The precursors form structures that fold over each other within self-complementary regions. They are then processed by nuclease dicers in animals (or DCL1 in plants). miRNA molecules interrupt translation through accurate or inaccurate base pairing with their targets. In some embodiments, miRNAs can be used as components of therapeutic constructs that are therapeutically provided or administered to subjects, e.g., human patients, to treat diseases, e.g., cancer. Alternatively, in some embodiments, a nucleic acid complementary to miRNA may be therapeutically administered to a subject in vivo or used in vitro to produce the desired therapeutic miRNA (e.g., miRNA-142-3p, miRNA-142-3p, miRNA-124, or miRNA-138). Thus, the desired therapeutic miRNA (e.g., miRNA-142-3p, miRNA-142-3p, miRNA-124, or miRNA-138) may be produced using a complementary nucleic acid as a template.
[0138] Additional anticancer drugs The term "anticancer agent" is used according to its simple, ordinary meaning and refers to a composition (e.g., compound, drug, antagonist, inhibitor, modulator) that has antineoplastic properties or the ability to inhibit cell growth or proliferation. In some embodiments, an anticancer agent is a chemotherapeutic agent. In some embodiments, an anticancer agent is a targeted therapy agent. In some embodiments, an anticancer agent is an immune checkpoint inhibitor. In some embodiments, an anticancer agent is a drug identified herein that is useful in a method of treating cancer. In some embodiments, an anticancer agent is a drug approved by the FDA or a similar regulatory authority in a country other than the United States for the treatment of cancer.
[0139] Examples of anticancer drugs include, but are not limited to, MEK (e.g., MEK1, MEK2, or MEK1 and MEK2) inhibitors (e.g., XL518, CI-1040, PD035901, selumetinib / AZD6244, GSK1120212 / trametinib, GDC-0973, ARRY-162, ARRY-300, AZD8330, PD0325901, U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766, PD184352, SB239063, BAY 43-9006); alkylating agents, e.g., nitrogen mustard (e.g., mechloretamine, cyclophosphamide, uramustine, chlorambucil, melphalan, ifosfamide), ethyleneimine and methylmelamine (e.g., hexamethylmelamine and thiotepa), alkyl sulfonates (e.g., busulfan and hepsulfam), nitrosourea (e.g., carmustine, lomusitine, semustine and streptozocin), and triazenes (e.g., decarbazine); antimetabolites, e.g., folic acid analogs (e.g., methotrexate, leucovorin, larcitrexed and pemetrexed), pyr Midine analogs (e.g., fluorouracil, floxouridine, cytarabine, capecitabine, and gemcitabine) and purine analogs (e.g., mercaptopurine, thioguanine, pentostatin, fludarabine, and 5-azathiopurine); plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, and homohalintinine); topoisomerase inhibitors, e.g., camptothecin derivatives (e.g., irinotecan and topotecan), amsacrin, and epipodophyllotoxin (e.g., etoposide (VP16), etoposide phosphate, and teniposide);Antibiotics, such as anthracendions (e.g., mitoxantrone), anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, and fluorodaunorunicin hydrochloride), (e.g., hydrochloride), Streptomyces-derived antibiotics or their derivatives (e.g., dactinomycin, bleomycin, mitomycin, geldanamycin, plicamycin and 17-N-allylamino-17-demethoxygeldanamycin (17-AAG; tanespimycin), clofazimine and β-lactam derivatives; platinum compounds (e.g., cisplatin, oxaliplatin, carboplatin); substituted ureas (e.g., hydroxyurea); methylhydrazine derivatives (e.g., procarbazine); adrenal cortical inhibitors (e.g., mitotane and aminoglutethimide); angiogenesis inhibitors (e.g., L-asparaginase and arginine deiminase); PI3K inhibitors (e.g., wartmannin and LY294002); mTOR inhibitors (e.g., sertraline); DNA methyltransferase inhibitors (e.g., 5-aza-2'-deoxycytidine); antisense oligonucleotides; apoptosis gene modulators; apoptosis Sulfate regulators (e.g., deoxyadenosine and tryptride); BCR / ABL antagonists; bFGF inhibitors; casein kinase inhibitors (ICOS); gallium nitrate; gelatinase inhibitors; glutathione inhibitors (e.g., etanidazole); immunostimulant peptides; insulin-like growth factor 1 receptor inhibitors; leukemia inhibitors; matrilysin inhibitors; matrix metalloproteinase inhibitors; MIF inhibitors; mismatch double-stranded RNA; mycobacterial cell wall extracts; nitric oxide modulators; phosphatase inhibitors; plasminogen activator inhibitors; proteasome inhibitors (e.g., bortezomib); protein A system immunomodulators; protein kinase C modulators; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitors; ribozymes; signaling inhibitors / modulators (e.g., itraconazole); single-stranded antigen-binding proteins;Stem cell inhibitors; stem cell division inhibitors; stromelysin inhibitors; synthetic glycosaminoglycans; telomerase inhibitors; thyroid-stimulating hormone; translation inhibitors; urokinase receptor antagonists; gonadotropin-releasing hormone agonists (GnRH), e.g., goserelin and leuprolide (leuprorelin); steroids, e.g., corticosteroids (e.g., prednisone and dexamethasone); progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate); antiprogestrogens (e.g., mifepristone); estrogens (e.g., diethylstilbestrol and ethinylestradiol); antiestrogenic drugs, e.g., aromatase inhibitors (e.g., exemestane, fadrozol, letrozole, pentrozole and anastrozole); selective estrogen receptor modulators (e.g., tamoxifen analogs, tamoxifen analogs, tamoxifen Cyfenmethiozide analogs, panomiphene analogs, and clomiphene analogs; androgens (e.g., testosterone propionate and fluoxymesterone); antiandrogenic drugs (e.g., flutamide, finasteride, and bicalutamide); immunostimulants, e.g., levamisol, interleukins (e.g., interleukin-2), and interferon / interferon agonists (e.g., α-interferon); monoclonal antibodies, e.g., anti-CD20 Monoclonal antibodies (e.g., rituximab), anti-HER2 monoclonal antibodies (e.g., trastuzumab), anti-CD52 monoclonal antibodies, anti-CD25 monoclonal antibodies (e.g., daclizumab), anti-HLA-DR monoclonal antibodies and anti-VEGF monoclonal antibodies); immunotoxins (e.g., anti-CD33 monoclonal antibody-calitiamicin conjugate, anti-CD22 monoclonal antibody-Pseudomonas aeruginosa exotoxin conjugate, etc.); radioimmunotherapy agents (e.g., 111 In, 90 Y or 131 Anti-CD20 monoclonal antibodies conjugated to I; statins (e.g., cerivastatin and pitavastatin); 5-T1 BReceptor agonists (e.g., 5-nonyloxytryptamine); BRAF kinase inhibitors (e.g., vemurafenib and dabrafenib); tyrosine kinase inhibitors, e.g., inhibitors of one or more of EGFR, HER2, KDR, FLT4, EphB4, and Src (e.g., gefitinib (Iressa®), erlotinib (Tarceva®), cetuximab (Erbitux®), lapatinib (Tykerb®), panitumumab (Vectibix®), vandetanib (Caprelsa®), afatinib / BIBW2992, CI-1033 / canertinib, neratinib / HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, AG-1478, Dacomitinib / PF299804, OSI-420 / Desmethylerlotinib, AZD8931, ARRY-380, AEE788, Peritinib / EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626, Sorafenib, Imatinib (Gleevec (Registered) Examples include registered trademarks, sunitinib and dasatinib; immune checkpoint inhibitors (e.g., anti-CTLA-4 antibody, anti-PD1 / L1 antibody); PLK1 inhibitors (GSK461364, BI2536, Tak960, NMS-P937, BI6727); mitotic kinase inhibitors, etc., or mixtures thereof (e.g., leuprolide + estrogen + progesterone).
[0140] Furthermore, the therapeutic constructs described herein can be co-administered with conventional immunotherapeutic agents including, but not limited to, immunostimulants (e.g., Bacille Calmette-Guerin (BCG), levamisole, interleukin-2, α-interferon, etc.), therapeutic monoclonal antibodies (e.g., anti-CD20 monoclonal antibodies, anti-HER2 monoclonal antibodies, anti-CD52 monoclonal antibodies, anti-HLA-DR monoclonal antibodies and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugates, anti-CD22 monoclonal antibody-Pseudomonas aeruginosa exotoxin conjugates, etc.), immune checkpoint inhibitors (e.g., anti-CTLA4 antibodies, anti-PD-1 antibodies, anti-PD-L1 antibodies) and radioimmunotherapy (e.g., 111 In, 90 Y or 131 anti-CD20 monoclonal antibodies conjugated to I, etc.). These immunotherapeutic agents can also be directly loaded onto the therapeutic constructs to enhance their therapeutic efficacy, reduce toxicity, and shorten administration time.
[0141] In a further aspect, the therapeutic constructs described herein can be co-administered with conventional radiotherapeutic agents including, but not limited to, radionuclides such as 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 87 Y, 90 Y, 105 Rh, 111 Ag, 111 In, 117 mSn, 149 Pm, 153 Sm, 166 Ho, 177 Lu, 186 Re, 188 Re, 211 At and 212 Bi. These radiotherapeutic agents can also be directly loaded onto the therapeutic constructs to enhance therapeutic efficacy, reduce toxicity, and shorten administration time.
[0142] targeting part One or more targeting moieties (also known as targeting molecules) may be loaded into a delivery vehicle, attached to the surface of a delivery vehicle, and / or encapsulated within a delivery vehicle. In some embodiments, the targeting moieties are presented on the outer surface of the delivery vehicle. Such targeting moieties may be particularly beneficial for systemic delivery.
[0143] Exemplary target molecules include proteins, peptides, ligands, nucleic acids, lipids, sugars, or polysaccharides that bind to one or more targets associated with organs, tissues, cells, or extracellular matrix, or specific types of tumors or infected cells. The degree of specificity to which the delivery vehicle is targeted can be modulated by selecting targeting molecules with appropriate affinity and specificity. Antibodies, for example, are highly specific. They can be polyclonal, monoclonal, fragmentary, recombinant, or single-stranded, many of which are commercially available or readily obtainable using standard techniques. T cell-specific molecules, antigens, and tumor targeting molecules can be conjugated to the surface of therapeutic constructs. Targeting molecules can be conjugated to the ends of one or more PEG chains present on the particle surface.
[0144] In some embodiments, the targeting portion is an antibody or its antigen-binding fragment (e.g., a single-strand variable fragment) that specifically recognizes cells or tumor markers that are exclusively or in high concentrations on target cells, such as malignant cells (e.g., tumor antigens). Suitable targeting molecules that can be used to direct therapeutic constructs to cells and tissues of interest, as well as methods for conjugating target molecules into nanoparticles, are known in the art. For example,
[0145] See Ruoslahti et al. (Nat. Rev. Cancer, 2:83-90, 2002). In certain cases, therapeutic agents may be toxic to both cancer cells and immune cells, resulting in suboptimal effects. Therefore, in certain embodiments, therapeutic constructs can be conjugated with targeting moieties to enrich the delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to cancer cells only. Examples include antibodies against HER2, EGFR, PD-L1, etc., which are non-exclusively overexpressed on cancer cells. In some embodiments, therapeutic constructs can be conjugated with targeting moieties to enrich the delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to immune cells only.
[0146] Targeting molecules may include neuropilins and endothelial targeting molecules, integrins, selectins, adhesion molecules, bone targeting molecules such as zoledronic acid and alendronate (for example, to target cancer that has metastasized to the bone), stroma, and fibroblast targeting molecules.
[0147] In some embodiments, the targeting portion targets the therapeutic construct to antigen-presenting cells (APCs), particularly a subclass of APCs known as dendritic cells. Dendritic cells express several cell surface receptors that can mediate endocytosis. In some embodiments, the therapeutic construct enhances the activity of DCs that process tumor antigens. Targeted delivery to DCs may be performed. Targeting exogenous antigens to internalized surface molecules on antigen-presenting cells distributed throughout the body facilitates particle uptake and can overcome the major rate-limiting step in therapy.
[0148] Dendritic cell targeting molecules include monoclonal or polyclonal antibodies or fragments thereof that recognize and bind to epitopes presented on the surface of dendritic cells. Dendritic cell targeting molecules also include ligands that bind to cell surface receptors on dendritic cells. One such receptor, the lectin DEC-205, has been used in vitro and in mice to enhance both humoral (antibody-based) and cellular (CD8 T cell) responses by 2 to 4 orders of magnitude (Hawiger et al., J.Exp.Med., 194(6):769-79, 2001; Bonifaz et al., J.Exp.Med., 196(12):1627-38, 2002; Bonifaz et al., J.Exp.Med., 199(6):815-24, 2004). In these reports, the antigen was fused to the anti-DEC205 heavy chain, and recombinant antibody molecules were used for immunization.
[0149] Various other endocytosis receptors, including mannose-specific lectins (mannose receptors) and IgG Fc receptors, have also been targeted in this manner, resulting in similarly improved antigen presentation efficiency. Other suitable receptors that may be targeted include, but are not limited to, DC-SIGN, 33D1, SIGLEC-H, DCIR, CD11c, heat shock protein receptors, and scavenger receptors. For preferential uptake by immune cells expressing these receptors, targeting moies to these receptors can be attached to therapeutic constructs. An example is mannose attached to a therapeutic construct for targeted delivery to macrophages and DCs with high levels of mannose receptors.
[0150] Other receptors that can be targeted include Toll-like receptors (TLRs). TLRs recognize and bind to pathogen-associated molecular patterns (PAMPs). PAMPs target TLRs on the surface of dendritic cells, signaling internally and thereby potentially increasing DC antigen uptake, maturation, and T cell stimulation capabilities. PAMPs that can be conjugated or co-encapsulated on the particle surface include unmethylated CpG DNA (bacterial), double-stranded RNA (viral), lipopolysaccharide (bacterial), peptidoglycan (bacterial), lipoarabinomannin (bacterial), zymosan (yeast), mycoplasma lipoproteins such as MALP-2 (bacterial), flagellin (bacterial), poly(inosine-cytidylic acid) (bacterial), lipoteichoic acid (bacterial), or imidazoquinoline (synthetic).
[0151] The targeted molecule can be covalently bonded to the delivery vehicle using various methods known in the art. In a preferred embodiment, the targeted moiety is attached to the delivery vehicle by PEGylation or biotin-avidin crosslinking.
[0152] CD40 agonist. In certain embodiments, the targeting moiety targets CD40. This moiety may be a CD40 agonist. The cell surface molecule CD40 is a member of the tumor necrosis factor receptor superfamily and is widely expressed by immune cells, hematopoietic cells, vascular cells, epithelial cells, and other cells, including a wide range of tumor cells. As a potential target for cancer therapy, CD40 may mediate tumor regression through both indirect immune activation effects and direct cytotoxic effects on tumors, resulting in a "2:1" mechanism of action for CD40 agonists. CD40 agonists are known in the art and are outlined in Vonderheide (Clin Cancer Res, 13(4):1083-1088, 2007). Exemplary agonists include recombinant CD40L (recombinant human trimer), CD-870, 893 (full human IgG2 mAb), SGN-40 (humanized IgG1), and HCD 122 (full human IgG1 mAb). Soluble agonist CD40 antibodies have been shown to replace T cell support provided by CD4+ lymphocytes in mouse models of T cell-mediated immunity (Khalil et al., Update Cancer Ther., 2:61-65, 2007).
[0153] Integrin ligand. In another embodiment, the targeting moiety is a ligand for integrins. Studies have shown that integrins can function as markers to distinguish tumor cells from normal cells because they are overexpressed on the surface of tumor cells. Certain integrins also activate TGF-β via extracellular pathways. Latent TGF-β, after being released from tumor cells, binds to integrins on the surface of tumor cells, resulting in the activation of latent TGF-β. Increased TGF-β concentration within the tumor microenvironment supports immunosuppression and mobilizes regulatory T cells into the tumor environment.
[0154] RGD peptides can perform a dual function. Not only are RGD peptides typical integrin-targeting ligands (Ruoslahti et al., Annu. Rev. Cell Dev. Biol., 12:697-715, 1996), but they also function as immune danger signals that activate APCs (Altincicek et al., Biol Chem., 390, 1303-11, 2009). Therefore, in a preferred embodiment, RGD peptides are loaded into a delivery vehicle, attached to the surface of a delivery vehicle, and / or encapsulated within a delivery vehicle.
[0155] A T cell receptor that recognizes the p53 antigen. In certain embodiments, the targeting portion is a T cell receptor (TCR) that recognizes the p53 antigen in relation to human MHC. A T cell receptor recombinant protein derived from bacterial, eukaryotic, or yeast cells, containing a T cell receptor (α / β TCR or γ / Δ TCR) composed of an alpha, beta, or gamma / delta chain.
[0156] IL-15 / IL-15Rα. In another embodiment, the targeting moiety is the IL-15 / IL-15Rα complex. Interleukin-15 (IL-15) is a cytokine that shares a specific receptor subunit with IL-2 and therefore has several overlapping mechanisms of action. IL-15 is expressed by dendritic cells and provides an important signal for the proliferation and priming of natural killer (NK) cells. Therefore, the IL-15 / IL-15Rα complex can be used to target, for example, natural killer (NK) cells with nanoparticle compositions.
[0157] (V) Delivery System The embodiments of the therapeutic constructs provided herein are independent of the delivery system used for the co-delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor. Therefore, in various embodiments, the delivery system may use or be based on any known or planned particulate delivery vehicle. These include nanoparticles, fullerenes, endohedral metal fullerenes, trimetal nitride-templated endohedral metal fullerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, calcium phosphate particles, aluminum salt particles, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, lipid nanoparticles, lipoplexes, polymer nanoparticles, polyplexes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass microspheres and glass nanospheres, and polymer microspheres and polymer nanospheres, biodegradable PLGA microspheres and biodegradable PLGA nanospheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, porous silica nanoparticles and non-porous silica nanoparticles, and modified micelles. Hybrid particles consisting of several classes of materials can also be used. Nanometer and micron-sized particles can be used. Therapeutic agents, adjuvants, and any additional compounds may be included together with the delivery agent by any preferred means, for example, loaded into the delivery system, attached to the surface of the delivery system, bound to the delivery system, encapsulated within the delivery system, or contained within the delivery system. Such agents may be encapsulated, covalently bonded, or non-covalently bonded (e.g., by electrostatic interactions, hydrophobic interactions, van der Waals interactions, or compound-specific interactions (such as nucleic acid base pairing, ligand-receptor, antibody-antigen, biotin-avidin, etc.)).
[0158] In some embodiments, the delivery system includes mesoporous silica nanoparticles (MSNPs), such as those described in U.S. Patent Application Publication US2017 / 0172923 and U.S. Patent Application Publication 2017 / 0173169, which are incorporated herein by reference.
[0159] In some embodiments, the average particle size of the mesoporous nanoparticles (or different nanoparticles) is approximately 5 nm to 200 nm, approximately 5 nm to 90 nm, approximately 5 nm to 20 nm, approximately 30 nm to 100 nm, approximately 30 nm to 80 nm, approximately 30 nm to 60 nm, approximately 40 nm to 80 nm, approximately 70 nm to 90 nm, or approximately 5 nm, approximately 10 nm, approximately 20 nm, approximately 30 nm, approximately 40 nm, approximately 50 nm, approximately 60 nm, approximately 70 nm, approximately 80 nm, approximately 90 nm, or approximately 100 nm. In some embodiments, the mesoporous silica nanoparticles are coated with a cationic polymer or other compound. The cationic polymer can be bonded to the surface of the nanoparticles using any suitable means. In some embodiments, the cationic polymer is bonded to the nanoparticles via electrostatic interactions. Cationic polymers are any positively charged polymers, for example, without limit, PEI, polyamidoamine, poly(allylamine), poly(diallyldimethylammonium chloride), chitosan, poly(N-isopropylacrylamide-co-acrylamide), poly(N-isopropylacrylamide-co-acrylic acid), poly(L-lysine), diethylaminoethyl-dextran, poly(N-ethyl-vinylpyridinium bromide), poly(dimethylamino)ethyl methacrylate, or poly(ethylene glycol)-co-poly(trimethylaminoethyl methacrylate chloride). Other cationic polymers are obvious to those skilled in the art and can be found, for example, in Polymer Handbook, 4th Edition, Edited by Brandrup, E. H. Immergut, and E. A. Grukle; John Wiley & Sons, 2003).
[0160] Cationic polymers can be linear or branched. In some embodiments, cationic polymers can be in the size range of about 500 Da to about 25 kDa and can be branched or linear. For example, branched PEI having an average size of 1.8 kDa to 10 kDa may be loaded onto the nanoparticle core. The ratio of cationic polymer to nanoparticles can vary depending on the desired result. Cationic polymers can be present in 1 to 50 wt% of the nanoconstruction, e.g., 5 to 40 wt%, 10 to 30 wt%, 20 to 30 wt%, 5 to 15 wt%, 5 to 20 wt%, 5 to 25 wt%, 5 to 30 wt%, 10 to 20 wt%, 10 to 25 wt%, or 25 to 40 wt%, e.g., about 5, about 10, about 15, about 20, about 25, about 30, or about 35 wt%. In some embodiments, cationic polymers are present in 10 to 20 wt%.
[0161] In some embodiments, the cationic polymer is crosslinked, for example, by cleavable disulfide bonds, before or after coating onto the nanoparticles. In some embodiments, the attached cationic polymer is crosslinked after being bonded to nanoparticles, e.g., MSNPs, using, for example, DSP(dithiobis[succinimidylpropionate]), DTSSP(3,3'-dithiobis(sulfosuccinimidylpropionate)), and DTBP(dimethyl 3,3'-dithiobispropionimidate). Crosslinking may occur in the absence or presence of free cationic polymer in solution. In other embodiments, the cationic polymer is not crosslinked.
[0162] The stabilizer may be conjugated to MSNPs (or different nanoparticles) and / or cationic polymers by any suitable means, for example. In some embodiments, the stabilizer is conjugated to amine groups or other reactive groups of a crosslinked cationic polymer coated on nanoparticles (e.g., MSNPs). Exemplary stabilizers include, but are not limited to, PEG, dextran, polysialic acid, hyaluronic acid, polyvinylpyrrolidone, polyvinyl alcohol, and polyacrylamide or combinations thereof.
[0163] Stabilizers may have multiple chemically reactive groups for attachment to, for example, nanoparticles, cationic polymers, and / or other components. For example, reactive stabilizers, such as PEG derivatives, may have maleimide-PEG-N-hydroxysuccinimidyl ester (Mal-PEG-NHS) containing both two electrophilic moieties, e.g., a Michael acceptor and an activating ester. Stabilizers used in conjunction with the compositions and methods of the present invention, such as PEG, generally have molecular weights in the range of 500 Da to 40 kDa, for example, 2 to 10 kDa. Stabilizers may be present in 1 to 50% by weight of the nanoconstruction, for example, 5 to 30% by weight, 10 to 20% by weight, 10 to 25% by weight, 5 to 15% by weight, 5 to 20% by weight, 5 to 25% by weight, or 1 to 10% by weight, for example, about 5, about 10, about 15, about 20, about 25, about 35, about 40, or about 45% by weight.
[0164] As used herein, “average particle size” generally refers to the statistically average particle size (diameter) of particles within a particle population. For essentially spherical particles, the diameter may refer to either the physical diameter or the hydrodynamic diameter. For non-spherical particles, the diameter may preferentially refer to the hydrodynamic diameter. As used herein, the diameter of non-spherical particles may refer to the maximum straight-line distance between two points on the particle's surface. The average hydrodynamic particle size can be measured using methods known in the art, such as dynamic light scattering.
[0165] "Monodisperse" and "uniform size distribution" are used without distinction herein and refer to a collection of nanoparticles or microparticles in which all particles are the same or nearly the same size. As used herein, monodisperse distribution refers to a particle distribution in which 90% of the distribution is within 15% of the median particle size, more preferably within 10% of the median particle size, and most preferably within 5% of the median particle size.
[0166] As used herein, “nanoparticles” generally refer to particles having a diameter of about 5 nm to less than about 1 micron, preferably 20 nm to about 1 micron. The particles may have any shape. Nanoparticles having a spherical shape are generally referred to as “nanospheres.” The present invention is not limited to any particular type or category of nanoparticles for forming complexes with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor configured to treat or prevent cancer and associated hyperproliferative disorders.
[0167] Examples of nanoparticles include fullerenes (also known as C 60 , C 70 , C 76 , C 80 , C 84 Examples include endohedral metallic fullerenes (EMIs) containing additional atoms, ions, or clusters inside their fullerene cages, trimetallic nitride template endohedral metallic fullerenes (TNT EMEs, which are highly symmetrical tetraatomic molecular cluster endohedrals formed within a trimetallic nitride template in a carbon cage), single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled boron / nitrate nanotubes and multi-walled boron / nitrate nanotubes, carbon nanotube peapods (nanotubes with internal metallic fullerenes and / or other internal chemical structures), carbon nanohorns, carbon nanohorn peapods, lipid particle liposomes, lipoplexes, polymer nanoparticles, polyplexes, nanoshells, dendrimers, quantum dots, superparamagnetic nanoparticles, nanorods, and cellulose nanoparticles. Other exemplary nanoparticles include glass microspheres and glass nanospheres, polymer microspheres and polymer nanospheres, biodegradable PLGA microspheres and biodegradable PLGA nanospheres, gold nanoparticles, silver nanoparticles, platinum nanoparticles, carbon nanoparticles, and iron nanoparticles.
[0168] In some embodiments, the nanoparticles are modified micelles. In these embodiments, the modified micelles comprise a polyol polymer modified to include a hydrophobic polymer block. As used herein, the term “hydrophobic polymer block” refers to a segment of a polymer that is hydrophobic in itself. As used herein, the term “micelle” refers to an aggregate of molecules dispersed in a liquid. A typical micelle in an aqueous solution forms an aggregate with a hydrophilic “head” region in contact with the surrounding solvent, isolating a hydrophobic single tail region at the center of the micelle. In some embodiments, the head region may be, for example, a surface region of the polyol polymer, and the tail region may be, for example, a hydrophobic polymer block region of the polyol polymer.
[0169] The present invention further encompasses the use of micrometer-scale particles in addition to nanometer-scale particles. When microparticles are used, they are relatively small, preferably about 1 to 50 micrometers in size. For ease of explanation, the use of “nanoparticles” as used herein encompasses true nanoparticles (sizes about 1 nm to about 1000 nm), microparticles (e.g., about 1 micrometer to about 50 micrometers), or both.
[0170] Examples of nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metallic nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers, dendrimers having covalently bonded metal chelates, nanofibers, nanohorns, nanoonions, nanorods, nanoropes, and quantum dots. In some embodiments, the nanoparticles are metallic nanoparticles (e.g., nanoparticles of gold, palladium, platinum, silver, copper, nickel, cobalt, iridium, or alloys of two or more of these). Nanoparticles may include a core, or a core and a shell, such as core-shell nanoparticles. Hybrid particles consisting of several classes of materials can also be used.
[0171] Disclosed are therapeutic construct-containing compositions comprising at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor, each loaded within a delivery vehicle, attached to the surface of a delivery vehicle, and / or encapsulated within a delivery vehicle. Nanoparticle compositions offer several advantages beyond delivering one or more activators to target cells in solution. For example, nanoparticle compositions present one or more activators at local concentrations on or within nanoparticles, increasing binding activity when the nanoparticles encounter target cells. Nanoparticle compositions can also function as depots for activators with tunable release kinetics that can be extended over several days to extend the effective systemic half-life and efficacy of one or more drugs.
[0172] Typically, two or more activators (including at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor) are loaded into a delivery vehicle, attached to the surface of the delivery vehicle, and / or encapsulated within the delivery vehicle. The relative concentrations of each of the two or more activators and their positions on or within the delivery vehicle can be manipulated during the composition's preparation to adapt to the preferred dosage and presentation received by target cells. Loading two or more activators into or on the same delivery vehicle makes it possible to present two or more activators simultaneously to target cells or the same tumor microenvironment, or to present them to target cells in other predetermined orders.
[0173] The delivery vehicle may be, for example, a nanolipogel, polymer particles, silica particles, liposomes, or multilayer vesicles. In certain embodiments, the microparticle delivery vehicle is a nanoscale composition, e.g., 10 nm to less than about 1 micron. However, in some embodiments and applications, it will be understood that the particles may be even smaller or larger (e.g., microparticles). The exemplary therapeutic constructs disclosed herein may be called nanoparticle compositions, but in some embodiments and applications, it will be understood that the microparticle compositions may be somewhat larger than nanoparticles. For example, the microparticle compositions may be about 1 micron to about 1000 microns. Such compositions may be called fine particle compositions.
[0174] In embodiments for treating cancer, it is desirable that the particles are of a size suitable for reaching the tumor microenvironment. In certain embodiments, the particles are of a size suitable for reaching the tumor microenvironment and / or tumor cells through enhanced permeability and retention (EPR) effects. EPR refers to the property that molecules of a certain size (e.g., the particulate matter compositions described herein) tend to accumulate in tumor tissue in much greater quantities than in normal tissue. Therefore, in compositions for treating cancer, the delivery vehicle is preferably in the range of about 25 nm to about 500 nm, and more preferably in the range of about 30 nm to about 300 nm.
[0175] Nanolipogels. Nanolipogels are core-shell nanoparticles that combine the advantages of both liposomes and polymer-based particles for sustained delivery of active ingredients. In some of these embodiments and applications, nanolipogels can exhibit increased loading efficiency, enhanced sustained release, and improved therapeutic efficacy for macromolecule-molecule combinations compared to conventional nanoparticle compositions.
[0176] Typically, the outer shell of a nanolipogel protects the cargo and provides biocompatibility and a surface for functionalization by targeted molecules. The outer shell encapsulates components so they remain hidden until desired, for example, in response to environmental conditions or stimuli, creating monodisperse, reproducible particle populations and mediating internalization into desired cell types. The inner core may be a dendrimer or other polymer and has distinct, additional functions relative to the outer shell. For example, the inner shell may enable secondary deposition of drugs, vaccines, or imaging agents, increase the loading of components with different physicochemical properties into the particles, allow for controllable release of contents from the particles, and increase the cytosolic availability of DNA / RNA, drugs, and / or proteins by disrupting endosomes, any of which enhance drug efficacy, antigen presentation, and transfection / silencing.
[0177] Nanolipogels have a polymer matrix core containing one or more host molecules. The polymer matrix is preferably a crosslinked block copolymer comprising one or more poly(alkylene oxide) segments, such as polyethylene glycol, and one or more aliphatic polyester segments, such as polylactic acid. One or more cargo molecules are dispersed within the polymer matrix or covalently bonded to the polymer matrix. The hydrogel core is surrounded by a liposome shell.
[0178] Nanolipogels can be constructed to incorporate various activators that can be subsequently released in a controlled manner. Activators can be dispersed within a hydrogel matrix, dispersed within liposome shells, covalently bonded to liposome shells, and combinations thereof. Activators can be selectively incorporated into each of these locations within the nanolipogel. Furthermore, the release rate of the activator from each of these locations can be independently controlled. Because each of these locations has different properties, including size and hydrophobic / hydrophilicity, the chemical components independently incorporated into each of these locations can differ dramatically in terms of size and composition. For example, a nanolipogel can be loaded with one or more compounds dispersed within a polymer matrix, as well as at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor. Nanolipogels can result in the simultaneous and sustained release of drugs with vastly different chemical compositions and molecular weights.
[0179] Nanolipogels are typically spherical, with an average particle size in the range of about 50 nm to about 1000 nm, more preferably about 75 nm to about 300 nm, and most preferably about 90 nm to about 200 nm. In certain embodiments, nanolipogels have an average particle size of about 100 nm to about 140 nm. The particles may be non-spherical.
[0180] Depending on the properties of the lipids present within the liposome shell of the nanolipogel, nanolipogels having a positive, negative, or nearly neutral surface charge may be prepared. In certain embodiments, the nanolipogel has a nearly neutral surface charge. In certain embodiments, the nanolipogel has a zeta potential of about 10 mV to about -10 mV, more preferably about 5 mV to about -5 mV, even more preferably about 3 mV to about -3 mV, and most preferably about 2 mV to about -2 mV.
[0181] Hydrophobic surfactants, such as proteins, may be covalently bonded to the surface of the nanolipogel, while hydrophilic surfactants may be covalently bonded to the surface of the nanolipogel or dispersed within the liposome shell. In certain embodiments, the liposome shell contains one or more PEGylated lipids. In these cases, one or more surfactants may be conjugated to the ends of one or more PEG chains present on the surface of the liposome shell.
[0182] In another embodiment, the lipid is modified to include an avidin moiety, which, if desired, allows for the attachment of a biotinylated targeting moiety, a detectable label, or other activator.
[0183] In certain embodiments, one or more activators are covalently bonded to the surface of a nanolipogel via binding groups that are cleaved in response to external chemical or physical stimuli, such as changes in ambient pH, to trigger the release of the activators at a desired physiological site.
[0184] Core. The nanolipogel core is formed from a polymer matrix. The matrix may contain one or more host molecules, as will be described in more detail below. The nanolipogel core may further contain one or more activators. The activators may be complexed with the host molecules, dispersed in the polymer matrix, or in combination thereof.
[0185] The polymer matrix of the nanolipogel can be formed from one or more polymers or copolymers. By varying the composition and morphology of the polymer matrix, various controlled release properties can be achieved, enabling the delivery of one or more moderate, constant doses of activators over extended periods.
[0186] The polymer matrix may be formed from a non-biodegradable polymer or a biodegradable polymer. However, the polymer matrix is preferably biodegradable. The polymer matrix may be selected to degrade over a period ranging from 1 day to 1 year, more preferably 7 days to 26 weeks, even more preferably 7 days to 20 weeks, and most preferably 7 days to 16 weeks. To increase the molecular weight of the polymer, a biodegradable crosslinking agent may be used, which can be removed from the body as small fragments after the crosslinking agent has degraded.
[0187] Generally, synthetic polymers are preferred, but natural polymers may also be used. Typical polymers include poly(hydroxy acids), e.g., poly(lactic acid), poly(glycolic acid), poly(lactic acid-coglycolic acid), polyhydroxyalkanoates, e.g., poly3-hydroxybutyrate or poly4-hydroxybutyrate; polycaprolactone; poly(orthoester); polyanhydride; poly(phosphazene); poly(lactide-co-caprolactone); poly(glycolide-co-caprolactone); polycarbonates, e.g., tyrosine polycarbonate; and polyamides (synthetic polyamides and Poly(amino acids); Polyesteramides; Other biocompatible polyesters; Poly(dioxanone); Poly(alkylene alkylate); Hydrophilic polyethers; Polyurethanes; Polyether esters; Polyacetals; Polycyanoacrylates; Polysiloxanes; Poly(oxyethylene) / Poly(oxypropylene) copolymers; Polyketals; Polyphosphates; Polyhydroxyvalerates; Polyalkylene oxalates; Polyalkylene succinates; Poly(mal) This includes poly(acrylic acid), polyvinyl alcohol, polyvinylpyrrolidone; poly(alkylene oxide), e.g., polyethylene glycol (PEG); derivatized cellulose, e.g., alkylcellulose (e.g., methylcellulose), hydroxyalkylcellulose (e.g., hydroxypropylcellulose), cellulose ethers, cellulose esters, nitrocellulose, polymers of acrylic acid, methacrylic acid, or copolymers or derivatives thereof, including esters, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate) (collectively referred to herein as "polyacrylic acid"), as well as their derivatives, copolymers, and blends.
[0188] As used herein, “derivative” includes polymers having substitutions, additions of chemical groups, and other modifications to the polymer backbone commonly performed by those skilled in the art. Natural polymers, including proteins such as albumin, collagen, gelatin, prolamin, e.g., zein, and polysaccharides such as alginates and pectin, may be incorporated into the polymer matrix. A variety of polymers may be used to form the polymer matrix, but generally the resulting polymer matrix is a hydrogel. In certain cases, if the polymer matrix contains natural polymers, the natural polymers are biopolymers that degrade by hydrolysis, e.g., polyhydroxyalkanoates.
[0189] The polymer matrix may optionally contain one or more crosslinkable polymers. Preferably, the crosslinkable polymer contains one or more photopolymerizable groups to enable crosslinking of the polymer matrix after nanolipogel formation. Examples of suitable photopolymerizable groups include vinyl groups, acrylate groups, methacrylate groups, and acrylamide groups. If present, the photopolymerizable groups may be incorporated into the backbone of the crosslinkable polymer, into one or more of the side chains of the crosslinkable polymer, into one or more of the ends of the crosslinkable polymer, or into a combination thereof.
[0190] Polymer matrices can be formed from polymers with varying molecular weights to form nanolipogels having properties, including optimal drug release rates for specific applications. Generally, the polymers constituting the polymer matrix have an average molecular weight in the range of about 500 Da to about 50 kDa. When the polymer matrix is formed from non-crosslinkable polymers, the polymers typically have an average molecular weight in the range of about 1 kDa to about 50 kDa, more preferably about 1 kDa to about 70 kDa, and most preferably about 5 kDa to about 50 kDa. When the polymer matrix is formed from crosslinkable polymers, the polymers typically have an even lower average molecular weight in the range of about 500 Da to about 25 kDa, more preferably about 1 kDa to about 10 kDa, and most preferably about 3 kDa to about 6 kDa. In certain embodiments, the polymer matrix is formed from crosslinkable polymers having an average molecular weight of about 5 kDa.
[0191] In some embodiments, the polymer matrix is formed from a poly(alkylene oxide) polymer or a block copolymer comprising one or more poly(alkylene oxide) segments. The poly(alkylene oxide) polymer or poly(alkylene oxide) polymer segment may contain 8 to 500 repeating units, more preferably 40 to 300 repeating units, and most preferably 50 to 150 repeating units. Suitable poly(alkylene oxides) include polyethylene glycol (also known as polyethylene oxide or PEG), polypropylene 1,2-glycol, poly(propylene oxide), polypropylene 1,3-glycol, and copolymers thereof.
[0192] In some embodiments, the polymer matrix is formed from an aliphatic polyester or a block copolymer comprising one or more aliphatic polyester segments. Preferably, the polyester or polyester segment is poly(lactic acid) (PLA), poly(glycolic acid) PGA, or poly(lactide-co-glycolide) (PLGA).
[0193] In some embodiments, the polymer matrix is formed from a block copolymer comprising one or more poly(alkylene oxide) segments, one or more aliphatic polyester segments, and optionally one or more photopolymerizable groups. In these cases, one or more poly(alkylene oxide) segments impart the necessary hydrophilicity to the polymer so that the resulting polymer matrix forms a suitable hydrogel, while the polyester segments provide a polymer matrix with tunable hydrophobic / hydrophilic properties and / or desired in vivo degradation properties.
[0194] The degradation rate of polyester segments, and often the corresponding drug release rate, can be varied from a few days (for pure PGA) to several months (for pure PLA), and this can be easily manipulated by changing the ratio of PLA to PGA within the polyester segment. Furthermore, poly(alkylene oxides), such as PEG, as well as aliphatic polyesters, such as PGA, PLA, and PLGA, have been established as safe for human use. These materials have been used in human clinical applications, including drug delivery systems, for over 30 years.
[0195] In certain embodiments, the polymer matrix is formed from a triblock copolymer comprising a central poly(alkylene oxide) segment, adjacent aliphatic polyester segments attached to any end of the central poly(alkylene oxide) segment, and one or more photopolymerizable groups. Preferably, the central poly(alkylene oxide) segment is PEG, and the aliphatic polyester segments are PGA, PLA, or PLGA.
[0196] Generally, the average molecular weight of the central poly(alkylene oxide) segment is greater than the average molecular weight of the adjacent polyester segments. In certain embodiments, the average molecular weight of the central poly(alkylene oxide) segment is at least three times the average molecular weight of one of the adjacent polyester segments, more preferably at least five times the average molecular weight of one of the adjacent polyester segments, and most preferably at least ten times the average molecular weight of one of the adjacent polyester segments.
[0197] In some cases, the central poly(alkylene oxide) segment has an average molecular weight in the range of about 500 Da to about 10,000 Da, more preferably about 1,000 Da to about 7,000 Da, and most preferably about 2,500 Da to about 5,000 Da. In certain embodiments, the average molecular weight of the central poly(alkylene oxide) segment is about 4,000 Da. Typically, each adjacent polyester segment has an average molecular weight in the range of about 100 Da to about 3,500 Da, more preferably about 100 Da to about 1,000 Da, and most preferably about 100 Da to about 500 Da.
[0198] Examples of natural polymers include proteins, such as albumin, collagen, gelatin, and prolamins, such as zein, as well as polysaccharides, such as alginates, cellulose derivatives, and polyhydroxyalkanoates, such as polyhydroxybutyrate. The in vivo stability of microparticles can be controlled during manufacturing by using polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the outer surface, the hydrophilicity of PEG may increase the time these materials circulate.
[0199] Examples of non-biodegradable polymers include ethylene vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers, and mixtures thereof.
[0200] The matrix can also be made from gel-type polymers such as alginates produced by conventional ion gelation techniques. The polymer is first dissolved in an aqueous solution, mixed with barium sulfate or some bioactive agent, and then extruded through a microdroplet formation device that uses a stream of nitrogen gas to potentially break up the droplets. An ion curing bath, slowly agitated (approximately 100-170 RPM), is placed below the extruder to capture the formed microdroplets. The microparticles are incubated in the bath for 20-30 minutes to allow sufficient time for gelation to occur. Microparticle size is controlled by using extruders of various sizes or by varying the flow rate of nitrogen gas or the polymer solution. Chitosan microparticles can be prepared by dissolving the polymer in an acidic solution and crosslinking it with tripolyphosphate. Carboxymethylcellulose (CMC) microparticles can be prepared by dissolving the polymer in an acidic solution and precipitating the microparticles with lead ions. In the case of negatively charged polymers (e.g., alginates, CMCs), positively charged ligands of different molecular weights (e.g., polylysine, polyethyleneimine) can be ionically bonded to them.
[0201] Perhaps the most widely used are aliphatic polyesters, particularly the hydrophobic poly(lactic acid) (PLA), the relatively hydrophilic poly(glycolic acid) (PGA), and their copolymers, poly(lactide-co-glycolide) (PLGA). The degradation rates of these polymers, and often the corresponding drug release rates, can vary from days (PGA) to months (PLA) and are easily manipulated by changing the ratio of PLA to PGA. Secondly, the physiological compatibility of PLGA and its homopolymers PGA and PLA is established for safe use in humans. These materials have a history of over 30 years in various human clinical applications, including drug delivery systems. PLGA nanoparticles can be formulated in various ways to improve pharmacokinetics and biodistribution to target tissues, either through passive or active targeting. Microparticles are designed to release encapsulated or attached molecules over a period of days to weeks. Factors influencing the release duration include the pH of the surrounding medium (relatively fast release rates at pH 5 or below due to acid-catalyzed hydrolysis of PLGA) and the polymer composition. Aliphatic polyesters exhibit different hydrophobic properties, which affects their degradation rates. Specifically, hydrophobic poly(lactic acid) (PLA), relatively hydrophilic poly(glycolic acid) (PGA), and their copolymers, poly(lactide-co-glycolide) (PLGA), have varying release rates. The degradation rates of these polymers, and often the corresponding drug release rates, can range from a few days (PGA) to several months (PLA) and can be easily manipulated by changing the ratio of PLA to PGA.
[0202] Shell components. Nanolipogels contain a liposome shell composed of one or more concentric lipid monolayers or lipid bilayers. The shell may further contain one or more activators, targeting molecules, or combinations thereof.
[0203] The nanolipogel comprises a liposome shell composed of one or more concentric lipid monolayers or lipid bilayers. The composition of the liposome shell may be modified to affect the release rate of one or more activators in vivo. Alternatively, the lipids may be covalently crosslinked to alter in vivo drug release, if desired.
[0204] A lipid shell can be formed from a single lipid bilayer (monolayer) or from several concentric lipid bilayers (multilayer). The lipid shell may also be formed from a single lipid. However, in a preferred embodiment, the lipid shell is formed from a combination of multiple lipids. Lipids can be neutral, anionic, or cationic at physiological pH.
[0205] Suitable neutral and anionic lipids include sterols and lipids, such as cholesterol, phospholipids, lysolipids, lysophospholipids, and sphingolipids. Neutral and anionic lipids include phosphatidylcholine (PC) containing 1,2-diacyl-glycero-3-phosphocholine (e.g., egg PC, soy PC); phosphatidylserine (PS), phosphatidylglycerol, phosphatidylinositol (PI); glycolipids; sphingophospholipids, such as sphingomyelin; sphingoglycolipids (also known as 1-ceramidyl glucosides), such as ceramide galactopyranoside, ganglioside, and cerebroside; fatty acids, sterols containing carboxylic acid groups, such as cholesterol, or those. Derivatives of; and 1,2-diacyl-sn-glycero-3-phosphoethanolamines, including, but not limited to, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine or 1,2-dioreollylglycerylphosphatidylethanolamine (DOPE), 1,2-dihexadecylphosphoethanolamine (DHPE), 1,2-distearoylphosphatidylcholine (DSPC), 1,2-dipalmitoylphosphatidylcholine (DPPC), and 1,2-dimiristoylphosphatidylcholine (DMPC). Natural derivatives of these lipids (e.g., tissue-derived L.-α-phosphatidyl: egg yolk, heart, brain, liver, soybean) and / or synthetic derivatives (e.g., saturated and unsaturated 1,2-diacyl-sn-glycero-3-phosphocholine, 1-acyl-2-acyl-sn-glycero-3-phosphocholine, 1,2-diheptanoyl-SN-glycero-3-phosphocholine) are also suitable.
[0206] Suitable cationic lipids include N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium salt, also known as TAP lipids, such as methyl sulfate. Suitable TAP lipids include, but are not limited to, DOTAP (dioleoyl-), DMTAP (dimyristoyl-), DPTAP (dipalmitoyl-), and DSTAP (distearoyl-). Other suitable cationic lipids include dimethyldioctadecylammonium bromide (DDAB), 1,2-diacyloxy-3-trimethylammonium propane, N-[1-(2,3-dioloyloxy)propyl]-N,N-dimethylamine (DODAP), 1,2-diacyloxy-3-dimethylammonium propane, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), and 1,2-dialkyloxy-3 -Dimethylammonium propane, dioctadecylamide glycylspermine (DOGS), 3-[N--(N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol); 2,3-Dioleoyloxy-N-(2-(sperminecarboxamide)-ethyl)-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), β-alanylcholesterol, cetyltrimethylammonium bromide (CTAB), diC 14- Amidine, N-tert-butyl-N'-tetradecyl-3-tetradecylaminopropionamidine, N-(α-trimethylammonioacetyl)didodecyl-D-glutamate chloride (TMAG), ditetradecanoyl-N-(trimethylammonioacetyl)diethanolamine chloride, 1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylamide (DOSPER), and N,N,N',N'-tetramethyl-,N'-bis(2-hydroxyethyl)-2,3-dioleoyloxy C-1,4-butanediammonium iodide, 1-[2-(acyloxy)ethyl]2-alkyl(alkenyl)-3-(2-hydroxyethyl)-imidazolinium chloride derivatives, for example, 1-[2-(9(Z)-octadecenoyloxy)ethyl]-2-(8(Z)-heptadecenyl-3-(2-hydroxyethyl)-imidazolinium chloride (DOTIM) and 1-[2-(hexadecanoyloxy)ethyl]-2-pentadecyl-3-(2-hydroxyethyl)imidazolinium chloride (DPTIM), Furthermore, 2,3-dialkyloxypropyl quaternary ammonium derivatives containing a hydroxyalkyl moiety on a quaternary amine, for example, 1,2-dioleyl-3-dimethyl-hydroxyethylammonium bromide (DORI), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 1,2-dioleyloxypropyl-3-dimethyl-hydroxypropylammonium bromide (DORIE-HP), 1,2-dioleyl-oxypropyl-3-dimethyl-hydroxypropyl This includes ammonium bromide (DORIE-HB), 1,2-dioleyloxypropyl-3-dimethyl-hydroxypentylammonium bromide (DORIE-Hpe), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DMRIE), 1,2-dipalmityloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DPRIE), and 1,2-disteryloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DSRIE).
[0207] Other suitable lipids include PEGylated derivatives of the neutral, anionic, and cationic lipids mentioned above. By incorporating one or more PEGylated lipid derivatives into a lipid shell, nanolipogels presenting polyethylene glycol chains on their surface can be obtained. The resulting nanolipogels may exhibit increased in vivo stability and circulation time compared to nanolipogels lacking PEG chains on their surface. Examples of suitable PEGylated lipids include distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG), including DSPE PEG (2000 MW) and DSPE PEG (5000 MW), dipalmitoyl-glycerosuccinate polyethylene glycol (DPGS-PEG), stearyl-polyethylene glycol, and cholesteryl-polyethylene glycol.
[0208] In certain embodiments, the lipid shell is formed from a combination of multiple lipids. In certain embodiments, the lipid shell is formed from a mixture of at least three lipids. In specific embodiments, the lipid shell is formed from a mixture of phosphatidylcholine (PC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000](DSPE-PEG), and cholesterol.
[0209] In some embodiments, the lipid shell is formed from a mixture of one or more PEGylated phospholipids and one or more additional lipids or sterols. In certain cases, the molar ratio of one or more PEGylated lipids to one or more additional lipids or sterols is in the range of about 1:1 to about 1:6, more preferably about 1:2 to about 1:6, and most preferably about 1:3 to about 1:5. In certain embodiments, the molar ratio of one or more PEGylated lipids to one or more additional lipids or sterols is about 1:4.
[0210] In some embodiments, the lipid shell is formed from a mixture of one or more phospholipids and one or more additional lipids or sterols. In certain cases, the molar ratio of one or more phospholipids to one or more additional lipids or sterols is in the range of about 1:1 to about 6:1, more preferably about 2:1 to about 6:1, and most preferably about 3:1 to about 5:1. In certain embodiments, the molar ratio of one or more phospholipids to one or more additional lipids or sterols is about 4:1.
[0211] In a preferred embodiment, the lipid shell is formed from a mixture of a phospholipid, such as phosphatidylcholine (PC), a PEGylated phospholipid, such as 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] (DSPE-PEG), and cholesterol. In a particular embodiment, the lipid shell is formed from a mixture of phosphatidylcholine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] (DSPE-PEG), and cholesterol in a 3:1:1 molar ratio.
[0212] Polymer particles. The delivery vehicle may also be polymer particles, e.g., microparticles or nanoparticles. The particles may be biodegradable or non-biodegradable. Exemplary polymers that may be used to manufacture polymer particles are described above with respect to the polymer matrix components of nanolipogels.
[0213] Examples of preferred biodegradable polymers include polymers of hydroxy acids such as lactic acid and glycolic acid, as well as copolymers with PEG, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), blends thereof, and copolymers. In a preferred embodiment, the particles consist of one or more polyesters.
[0214] For example, the particles may contain homopolymers comprising the following polyesters, namely, glycolic acid units referred to herein as "PGA," and lactic acid units such as poly-L-lactic acid, poly-D-lactic acid, poly-D,L-lactic acid, poly-L-lactide, poly-D-lactide, and poly-D,L-lactide, collectively referred herein as "PLA," and caprolactone units such as poly(ε-caprolactone), collectively referred herein as "PCL"; and copolymers comprising lactic acid units and glycolic acid units characterized by a lactic acid:glycolic acid ratio, collectively referred herein as "PLGA," such as various forms of poly(lactic acid-coglycolic acid) and poly(lactide-coglycolide); and polyacrylates, as well as one or more of their derivatives. Exemplary polymers also include copolymers of polyethylene glycol (PEG) and the aforementioned polyesters, such as various forms of PLGA-PEG copolymers or PLA-PEG copolymers, collectively referred herein as "PEGylated polymers." In certain embodiments, a "PEGylated polymer" can be obtained by covalently bonding the PEG region to a polymer and using a cleavable linker. Alginate polymers can also be used.
[0215] In some embodiments, the particles are composed of PLGA, a safe, FDA-approved polymer. PLGA particles are advantageous because they can protect the activator (i.e., act as an encapsulant), facilitate long-term release, and are suitable for adding a targeted moiety.
[0216] The particles may contain one or more polymer conjugates comprising an end-to-end bond between the polymer and a targeting moiety, a detectable label, or other activator. For example, the modified polymer may be PLGA-PEG-phosphonate. In another example, the particles may be modified to include an avidin moiety, to which a biotinylated targeting moiety, a detectable label, or other activator can be conjugated.
[0217] Examples of preferred natural polymers include proteins, such as albumin, collagen, gelatin, and prolamins, such as zein, as well as polysaccharides, such as alginates, cellulose derivatives, and polyhydroxyalkanoates, such as polyhydroxybutyrate. The in vivo stability of the particles can be adjusted during manufacturing by using polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the outer surface, the hydrophilicity of PEG may increase the time these materials circulate.
[0218] Examples of non-biodegradable polymers include ethylene vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers, and mixtures thereof.
[0219] Nanolipogels. Nanolipogels are nanoparticles that combine the advantages of both liposomes and polymer-based particles for the sustained delivery of nucleic acids, proteins, and / or small molecules. Nanolipogels can be in the form of spheres, disks, rods, or other shapes with different aspect ratios. Nanospheres can be relatively large, i.e., microparticles. Nanolipogels are typically formed from synthetic or natural polymers whose properties can be tuned to facilitate different release rates and which can encapsulate drugs by distal loading. The release rate is tuned by varying the polymer-to-lipid ratio from 0.05 to 5.0, more preferably from 0.5 to 1.5.
[0220] Nanolipogels are designed to be loaded with a drug either before, during, or after formation, and then function as a controlled-release vehicle for the drug. Multiple drugs may be loaded into the nanolipogel so that controlled release of multiple drugs is subsequently achieved.
[0221] The nanolipogel is loaded with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor by a rehydration process of the nanolipogel in the presence of the drug during and / or after formation. For example, the nanolipogel is loaded with a molecule that functions as a mitotic kinase inhibitor, and the nanolipogel then incorporates one or more immune checkpoint inhibitors after formation (or vice versa) to deliver and release both inhibitors simultaneously.
[0222] Polymer nanoparticles Emulsion method. In some embodiments, polymer nanoparticles are prepared using the emulsion solvent evaporation method. For example, the polymer material is dissolved in a water-immiscible organic solvent and mixed with a drug solution, or a combination of drug solutions. The water-immiscible organic solvent may be, but is not limited to, one or more of chloroform, dichloromethane, and acyl acetate. The drug may be, but is not limited to, one or more of acetone, ethanol, methanol, isopropyl alcohol, acetonitrile, and dimethyl sulfoxide (DMSO). An aqueous solution is then added to the resulting mixture solution to obtain an emulsion solution by emulsification. The emulsification technique may be homogenization by probe sonication or homogenizer, but is not limited to these methods. The peptide or fluorophore or drug may be bound to the surface of the polymer matrix of the particle, encapsulated within the polymer matrix of the particle, surrounded by the polymer matrix of the particle, and / or distributed throughout the polymer matrix of the particle.
[0223] Nanoprecipitation method. In another embodiment, polymer nanoparticles are prepared using a nanoprecipitation method or a microfluidic device. The polymer material is mixed with a drug, or a combination of drugs, in a water-miscible organic solvent. The resulting mixture is then added to an aqueous solution to obtain a nanoparticle solution.
[0224] Exemplary preparation methods. Particles can be produced from various polymers using various methods that can be selected based on criteria including the polymer composition of the particles, and the drug is loaded into or bound to the particles according to methods known in the art. Exemplary methods are provided below.
[0225] Solvent evaporation. In this method, the polymer is dissolved in a volatile organic solvent such as methylene chloride. The drug (dispersed soluble or as fine particles) is added to the solution, and the mixture is suspended in an aqueous solution containing a surfactant such as poly(vinyl alcohol). The resulting emulsion is stirred until most of the organic solvent has evaporated, leaving solid particles. The resulting particles are washed with water and dried overnight in a freeze-dryer. This method can yield particles of different sizes (0.5 to 1000 microns) and morphologies. This method is useful for relatively stable polymers such as polyester and polystyrene.
[0226] However, unstable polymers such as polyanhydrides may decompose during the manufacturing process due to the presence of water. For these polymers, the following two methods, carried out in a completely anhydrous organic solvent, are more useful.
[0227] Hot-melt microencapsulation. In this method, the polymer is first melted and then mixed with solid particles. The mixture is suspended in an immiscible solvent (such as silicone oil) and heated 5°C above the melting point of the polymer while continuously stirring. Once the emulsion is stabilized, it is cooled until the polymer particles solidify. The resulting particles are washed by decantation with petroleum ether to obtain a fluid powder. This method yields particles with a size of 0.5 to 1000 microns. The outer surface of spheres prepared by this technique is usually smooth and dense. This procedure is used to prepare particles made from polyesters and polyanhydrides. However, this method is limited to polymers with a molecular weight of 1,000 to 50,000.
[0228] Solvent removal. This technique is primarily designed for polyanhydrides. In this method, the drug is dispersed or dissolved in a solution of the selected polymer in a volatile organic solvent such as methylene chloride. This mixture is suspended by stirring in an organic oil (e.g., silicone oil) to form an emulsion. Unlike solvent evaporation, this method can be used to produce particles from polymers with high melting points and various molecular weights. This procedure can yield particles ranging from 1 to 300 microns. The external morphology of the spheres produced by this technique depends heavily on the type of polymer used.
[0229] Spray drying. In this method, the polymer is dissolved in an organic solvent. A known amount of active drug is suspended (insoluble drug) or co-dissolved (soluble drug) in the polymer solution. The solution or dispersion is then spray-dried. Typical process parameters for a mini spray dryer (Buchi) are as follows: polymer concentration = 0.04 g / mL, inlet temperature = -24°C, outlet temperature = 13-15°C, aspirator setting = 15, pump setting = 10 mL / min, spray flow rate = 600 Nl / hour, and nozzle diameter = 0.5 mm. Microparticles ranging from 1 to 10 microns are obtained in a form depending on the type of polymer used.
[0230] Hydrogel particles. Particles made from gel-type polymers such as alginates are produced by conventional ion gelation techniques. The polymer is first dissolved in an aqueous solution, mixed with barium sulfate or some bioactive agent, and then extruded through a microdroplet formation apparatus that uses a stream of nitrogen gas to break up droplets, if applicable. An ion curing bath, slowly agitated (approximately 100-170 RPM), is placed below the extruder to capture the formed microdroplets. The particles are incubated in the bath for 20-30 minutes to allow sufficient time for gelation to occur. Particle size is controlled by using extruders of various sizes or by varying the flow rate of nitrogen gas or polymer solution. Chitosan particles can be prepared by dissolving the polymer in an acidic solution and crosslinking it with tripolyphosphate. Carboxymethylcellulose (CMC) particles can be prepared by dissolving the polymer in an acidic solution and precipitating the particles with lead ions. In the case of negatively charged polymers (e.g., alginates, CMC), positively charged ligands of different molecular weights (e.g., polylysine, polyethyleneimine) can be ionically bonded.
[0231] Other delivery vehicles In some embodiments, the delivery vehicle is a liposome or lipid nanoparticle. Liposomes are typically spherical vesicles composed of lamellar-phase lipid bilayers. Liposomes may be, for example, multilayer vesicles (MLVs), small monolayer liposome vesicles (SUVs), large monolayer vesicles (LUVs), or spiral vesicles. Liposomes, micelles, and other lipid-based delivery vehicles useful for preparing the disclosed nanoparticle compositions are known in the art. See, for example, Torchilin et al. (Adv Drug Delivery Rev, 58(14):1532-55, 2006). A wide variety of liposomes and exosomes are expected to be used in conjunction with the present invention. Liposomes may include N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (DOTAP) or Lipofectamine®. In some embodiments, a delivery system containing chitosan may be used, for example, as described by Lu et al. (Cancer Cell, 18:185-197, 2010). In some embodiments, nanovectors may be used to deliver miRNAs to the target. Nanovectors are described, for example, by Pramanik et al. (Mol Cancer Ther, 10:1470-1480, 2011).
[0232] The delivery vehicle may be silica particles. Suitable silica particles useful for preparing the disclosed nanoparticle compositions are also known in the art. See, for example, Barbe et al. (Adv Materials, 16(21):1959-1966, 2004), Ngamcherdtrakul et al. (Adv Func Materials, 25:2646-2659, 2015) and Argyo et al. (Chem. Mater., 26(1):435-451, 2014). For example, in some embodiments, silicone nanoparticles (e.g., as described in Bharali et al. PNAS, 102(32):11539-11544, 2005) can be used to deliver at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to a cell. The solubility of silica or silicon in the body provides the particles with sustained release capability for the loaded agent. Furthermore, biodegradable polymers or in vivo reducible crosslinking agents can be used to modify silica particles or silicon particles to provide sustained release capability.
[0233] (VI) Antibodies As used herein, at least a portion of an agent (such as an agent used to induce immune checkpoint blockade) is an antibody. An antibody is a type of binding molecule, for example, a molecule that can bind to a target ligand on the surface of a cell or in a biological sample. The term antibody includes both whole antibodies and functional fragments thereof (i.e., fragments that retain significant and specific target binding). The terms "antibody" and "immunoglobulin" are used interchangeably herein and are well understood by those skilled in the art. These terms refer to a protein comprising one or more polypeptides that specifically bind to an antigen. One form of antibody comprises the basic structural unit of an antibody. This form is a tetramer and comprises two pairs of antibody chains, each pair having one light chain and one heavy chain. In each pair, the light chain variable region and the heavy chain variable region together are responsible for binding to the antigen recognized by the antibody, and the constant regions are responsible for the effector functions of the antibody.
[0234] Recognized immunoglobulin polypeptides include κ and λ light chains, as well as α, γ (IgG1, IgG2, IgG3, IgG4), δ, ε, and μ heavy chains, or other equivalents. A full-length immunoglobulin "light chain" (25 kDa or 214 amino acids) contains a 110-amino acid variable region at the NH2 terminus and a κ or λ constant region at the COOH terminus. A full-length immunoglobulin "heavy chain" (50 kDa or 446 amino acids) similarly contains a 116-amino acid variable region and one of the aforementioned heavy chain constant regions, e.g., γ (330 amino acids).
[0235] Specific embodiments of antibodies and immunoglobulins include antibody or immunoglobulins of any isotype, Fab fragments, Fv fragments, scFv fragments, and Fd fragments, as well as antibody fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins containing the antigen-binding portion of an antibody and a non-antibody protein, all of which retain specific binding to an antigen. Antibodies may be labeled detectably, for example, by radioisotopes, enzymes that produce detectable products, fluorescent proteins, fluorescent molecules, or stable elemental isotopes. Antibodies may be further conjugated to other portions, such as members of specific binding pairs, for example, biotin (a member of the biotin-avidin specific binding pair). Fab', Fv, F(ab')2, and other antibody fragments that retain specific binding to their congener antigens, as well as monoclonal antibodies, are also included in this term.
[0236] Antibodies can exist in various other forms including, for example, bifunctional (i.e., bispecific) hybrid antibodies (see, for example, Lanzavecchia et al., Eur. J. Immunol. 17:105, 1987) and single chain antibodies (see, for example, Huston et al., Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883, 1988; and Bird et al., Science 242:423-426, 1988). See generally Hood et al. (1984) ''Immunology'', N.Y., 2nd ed., and Hunkapiller & Hood (Nature 323:15-16, 1986).
[0237] An immunoglobulin light chain variable region or an immunoglobulin heavy chain variable region consists of "framework" regions (FR) interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs". The ranges of framework regions and CDRs have been precisely defined (see ''Sequences of Proteins of Immunological Interest'' E. Kabat et al. (1991) US Department of Health and Human Services). In certain embodiments, the numbering of antibody amino acid sequences may follow the Kabat system. The sequences of framework regions from various light chains or heavy chains are relatively conserved within a species. The framework regions of an antibody, that is, the combined framework regions of the constituent light and heavy chains, serve to position and align the CDRs. CDRs are primarily responsible for binding to an epitope of an antigen.
[0238] A chimeric antibody is an antibody in which the light chain gene and heavy chain gene are constructed, typically by genetic engineering, from antibody variable region genes and antibody constant region genes belonging to different species. For example, the variable segment of a gene derived from a rabbit monoclonal antibody can be linked to human constant segments such as γ1 and γ3.
[0239] (VII) Pharmaceutical Compositions and Administration Formulations Compositions for use in the treatment of cancer, precancerous and other proliferative disorders are provided herein. Each composition comprises at least two active ingredients / agents, one of which is a therapeutic activator inhibiting at least one mitotic kinase inhibitor, and the other is an immune checkpoint inhibitor. As described herein, the activator may be conjugated with a delivery / delivery vehicle (construct, engineered construct) such as liposomes, organic (nano or micro) particles, or inorganic (nano or micro) particles. As described herein, the activator may be co-delivered with a chemical linker that connects the drug (e.g., antibody-drug conjugate, antibody-oligonucleotide conjugate, small molecule-oligonucleotide conjugate, or small molecule-small molecule conjugate).
[0240] The composition may be delivered to cells directly, for example, by contact with the cells, or indirectly, for example, by the action of any biological process. For example, the composition may be formulated in a physiologically acceptable carrier or vehicle and injected into the tissue or fluid surrounding the cells. The composition may pass through the cell membrane by simple diffusion, endocytosis, or by any active or passive transport mechanism.
[0241] When formulated into a pharmaceutical composition, therapeutic compounds (such as a delivery system combining at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor) can be mixed with pharmaceutically acceptable carriers or excipients. As used herein, the term "pharmaceutically acceptable" generally refers to molecular entities and compositions that are considered physiologically tolerable and do not typically cause allergic reactions or similar adverse reactions, such as stomach upset or dizziness, when administered to human or veterinary subjects.
[0242] As used herein, the term “pharmaceutically acceptable derivative” means any pharmaceutically acceptable salt, solvate, or prodrug, such as an ester, of a desired activator that, when administered to a recipient, can provide (directly or indirectly) the desired activator or its active metabolite or residue. Such derivatives are recognizable to those skilled in the art without excessive experimentation. Nevertheless, refer to the teachings in Burger's Medicinal Chemistry and Drug Discovery, 5th Edition, Vol 1: Principles and Practice. pharmaceutically acceptable derivatives include salts, solvates, esters, carbamates, and phosphate esters.
[0243] While a composition for treatment can be used as is, it may be preferable to administer it in a pharmaceutical formulation by mixing it with a suitable pharmaceutical excipient, diluent, or carrier selected, for example, in relation to the intended route of administration and standard pharmacopoeia. Thus, in one aspect, a pharmaceutical composition or pharmaceutical formulation comprises at least one active composition or a pharmaceutically acceptable derivative thereof, in combination with pharmaceutically acceptable excipients, diluents, and / or carriers. The excipients, diluents, and / or carriers are "acceptable" in the sense that they are compatible with the other components of the formulation and not significantly harmful to its recipient.
[0244] Any compositional formulation disclosed herein may favorably include any other pharmaceutically acceptable carrier, including any carrier that does not produce significantly adverse allergic reactions or other undesirable reactions that outweigh the benefits of administration, whether for research, prophylactic, and / or therapeutic purposes. Exemplary pharmaceutically acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical field and are described, for example, in Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins (AR, Gennaro edit. 2005) and Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990. Furthermore, formulations may be prepared to meet the sterility, pyrogenicity, general safety, and purity standards required by the U.S. FDA Office of Biological Standards and / or other relevant foreign regulatory authorities. Pharmaceutical excipients, pharmaceutical diluents, and pharmaceutical carriers may be selected with respect to the intended route of administration and standard pharmaceutical practices.
[0245] Such pharmaceutical formulations may be provided for use in the conventional manner with one or more suitable excipients, diluents, and carriers. Pharmaceutically acceptable excipients include diluents, binders, lubricants, flow enhancers, disintegrants, colorants, and other components that assist or enable the formation of dosage forms for bioactive materials. Preservatives, stabilizers, dyes, and even flavorings may be provided in the pharmaceutical composition. Examples of preservatives include esters of sodium benzoate, ascorbic acid, and p-hydroxybenzoic acid. Antioxidants and suspending agents may also be used. An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well-tolerated upon ingestion, and does not interfere with the absorption of the bioactive material.
[0246] Exemplary commonly used pharmaceutically acceptable carriers include all kinds of fillers or bulking agents, solvents or co-solvents, dispersions, coatings, surfactants, antioxidants (e.g., ascorbic acid, methionine, vitamin E), preservatives, isotonic agents, absorption retarders, salts, stabilizers, buffers, chelating agents (e.g., EDTA), gels, binders, disintegrants, and / or lubricants.
[0247] Examples of buffers include citrate buffers, succinate buffers, tartarate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers, and / or trimethylamine salts.
[0248] Exemplary preservatives include phenol, benzyl alcohol, meta-cresol, methylparaben, propylparaben, octadecyldimethylbenzylammonium chloride, benzalkonium halide, hexamethonium chloride, alkylparabens, such as methylparaben or propylparaben, catechol, resorcinol, cyclohexanol, and 3-pentanol.
[0249] Examples of isotonic agents include polyhydric sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol, or mannitol.
[0250] Examples of stabilizers include organic sugars, polyhydric sugar alcohols, polyethylene glycol; sulfur-containing reducing agents, amino acids, low molecular weight polypeptides, proteins, immunoglobulins, hydrophilic polymers, or polysaccharides.
[0251] The “therapeutic dose” or “therapeutic amount” means the amount of a compound sufficient to achieve a condition, disorder, or pathology when administered to a subject to treat such a condition, disorder, or pathology. The “therapeutic dose” varies depending on the compound, the disease and its severity, as well as the age, weight, physical condition, and responsiveness of the mammal being treated. The exact dose and formulation depend on the therapeutic purpose and can be determined by those skilled in the art using known techniques (see, for example, Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003); and Pickar, Dosage Calculations (1999)). In certain cases, “therapeutic dose” is used to mean the amount or dose sufficient to adjust, for example, 10%, 50%, or 90% of the desired activity, for example, by increasing or decreasing it. Generally, the therapeutically effective dose is sufficient to produce a clinically significant improvement in the host's condition after a treatment regimen containing one or more therapeutic agents. The concentration or amount of the active ingredient depends on the desired dosage and administration regimen, as described herein.
[0252] The actual dose administered to a specific subject may be determined by a physician, veterinarian, or researcher, taking into account parameters such as the target, body weight, stage of cancer, type of cancer, previous or concurrent therapeutic interventions, the subject's idiopathic disease, and physical, physiological, and psychological factors, including the route of administration.
[0253] The effective dose for this use depends on the severity and location of the disease, as well as the weight and general condition of the patient being treated, especially when metastatic sites are involved. Generally, the dose ranges from 0.01 mg / kg to 100 mg / kg of host body weight per day of the therapeutic construct, with doses of 0.1 mg / kg to 10 mg / kg per day, for example, 3 to 7 mg / kg, being more commonly used. Long-term maintenance doses may be adjusted as needed. However, the dose may vary depending on the patient's requirements, the severity of the condition being treated, and the compound used. For example, the dose may be determined empirically in a particular patient, taking into account the type and stage of cancer diagnosed. In the context of this invention, the dose administered to a patient should be sufficient to produce a beneficial therapeutic response over time. The size of the dose is also determined by the presence, nature, and extent of any adverse side effects associated with the administration of a particular vector or transduced cell type to a particular patient. Determining the appropriate dose for a particular situation is within the scope of the practitioner's skill. Generally, treatment is initiated with a relatively low dose, below the optimal dose of the compound. Subsequently, the dosage should be gradually increased until the optimal effect is achieved under the given circumstances. For convenience, if desired, the total daily dose may be divided and administered in installments throughout the day.
[0254] The selected dosage may be influenced by the desired therapeutic effect, route of administration, desired treatment duration, and the specific therapeutic complex used. Generally, therapeutic constructs may be administered in doses ranging from approximately 0.001 mg / kg to approximately 100 mg / kg (for example, daily; or two, three, four, five or more times per week; or two, three, four, five or more times per month, as will be further detailed below). The route of administration may also be considered when determining the dosage. For example, in certain embodiments, the therapeutic construct is administered via an intravenous or intraperitoneal route in doses ranging from 0.01 mg / kg to 100 mg / kg (e.g., daily; or two, three, four, five or more times per week; or two, three, four, five or more times per month, etc.), or via a subcutaneous route (e.g., local injection into the tumor or TME, or local injection adjacent to the tumor or TME) in doses ranging from 0.0001 mg / kg to 1 mg / kg (e.g., daily; or two, three, four, five or more times per week; or two, three, four, five or more times per month, etc.). Further exemplary doses are described below.
[0255] A suitable dose may range from 0.01 mg / kg to 100 mg / kg body weight per day, week, or month. An exemplary dose may include 0.05 mg / kg to 10.0 mg / kg of the active compound (therapeutic construct) disclosed herein. The total daily dose may be 0.05 mg / kg to 30.0 mg / kg of the drug administered to the subject one to three times a day, including total daily doses of 0.05 to 3.0, 0.1 to 3.0, 0.5 to 3.0, 1.0 to 3.0, 1.5 to 3.0, 2.0 to 3.0, 2.5 to 3.0 and 0.5 to 3.0 mg / kg / day of drug administration using oral, intravenous, or other administration methods over 60 minutes. In a specific example, the dose may be administered to the subject as a total daily dose of 1.5 mg / kg, 3.0 mg / kg, 4.0 mg / kg, 5.0 mg / kg, or 7.5 mg / kg of a composition containing up to 92-98% wt / v of the compounds disclosed herein, either as a QD or BID.
[0256] Additional useful dosages can often range from 0.1 to 5 μg / kg or 0.5 to 1 μg / kg. In other examples, the dosage can include 1 μg / kg, 10 μg / kg, 20 μg / kg, 40 μg / kg, 80 μg / kg, 200 μg / kg, 0.1 to 5 mg / kg or 0.5 to 1 mg / kg. In other examples, the dosage can include 1 mg / kg, 10 mg / kg, 20 mg / kg, 40 mg / kg, 80 mg / kg, 200 mg / kg, 400 mg / kg, 450 mg / kg or more.
[0257] The therapeutic materials of the present disclosure can be used in severe disease conditions, that is, life-threatening or potentially life-threatening situations. In such cases, substantially excess administration of these compositions is possible and may be deemed desirable by the treating physician.
[0258] As will be appreciated by those skilled in the art, the specific dosage is affected by the pharmacokinetics of the active compound. For administration, a therapeutically effective amount (also referred to as a dosage herein) can be initially estimated based on results obtained from in vitro assays and / or animal model studies. Such information can be used to more accurately determine a useful dosage for a subject of interest. Useful preclinical studies include pharmacodynamic analysis, toxicity analysis and the like.
[0259] A therapeutically effective amount can be achieved by administering a single dose or multiple doses over the course of a treatment regimen (e.g., every 1 hour, every 2 hours, every 3 hours, every 4 hours, every 6 hours, every 9 hours, every 12 hours, every 18 hours, every day, every other day, every 3 days, every 4 days, every 5 days, every 6 days, every week, every 2 weeks, every 3 weeks, or every month).
[0260] The effective dose of a compound containing an active agent includes the dose that partially or completely achieves the desired therapeutic, prophylactic, and / or biological effect. The actual effective dose for a particular use depends on the condition being treated and the route of administration. Effective doses for use in humans can be determined from animal models. For example, doses for humans may be formulated to achieve local (e.g., intratumoral) or circulating levels that have been found to be effective in animals.
[0261] The composition can be administered with one or more anesthetics, including ethanol, bupivacaine, chloroprocaine, levobupivacaine, lidocaine, mepivacaine, procaine, ropivacaine, tetracaine, desflurane, isoflurane, ketamine, propofol, sevoflurane, codeine, fentanyl, hydromorphone, marcaine, meperidine, methadone, morphine, oxycodone, remifentanil, sufentanil, butorphanol, nalbufine, tramadol, benzocaine, dibucaine, ethyl chloride, lidocaine, and / or phenazopyridine.
[0262] In certain embodiments, including treating or preventing cancer (e.g., cancer metastasis), the compositions disclosed herein may be used in combination with other cancer treatments such as chemotherapy, targeted therapy, radiotherapy, and / or immunotherapy. The compositions described herein may be administered concurrently with or consecutively with another treatment within a selected time frame, for example, within a time frame of 10 minutes, 1 hour, 3 hours, 10 hours, 15 hours, 24 hours, or 48 hours, or within a clinically relevant treatment frame for the complementary treatment.
[0263] The pharmaceutical composition may be formulated in a dosage form appropriate for each route of administration, and may be for parenteral administration (intramuscular injection, intraperitoneal injection, intravenous (IV) injection, or subcutaneous injection), intravenous infusion, or depot administration.
[0264] In some embodiments, the composition is administered systemically in an amount effective for delivery of the composition to target cells, for example, by intravenous or intraperitoneal administration. Other routes include intravenous infusion or mucosal administration.
[0265] In certain embodiments, the composition is administered locally, for example, by direct injection into the site to be treated. In some embodiments, the composition is injected or administered directly into one or more tumors or diseased tissues. Typically, local injection results in an increase in the local concentration of the composition that is higher than the concentration that can be achieved by systemic administration. In some embodiments, the composition is delivered locally to the appropriate cells by using a catheter or syringe. Other means of locally delivering such a composition to cells include using an infusion pump or incorporating the composition into a polymer implant that can provide a sustained release of the composition to the immediate vicinity of the implant.
[0266] For example, in certain embodiments, the therapeutic construct may be administered locally to easily accessible tumors, such as melanoma, head and neck cancer, breast cancer, and lymphoma, or systemically to other cancers, such as lung cancer, liver cancer, pancreatic cancer, prostate cancer, and metastatic cancer.
[0267] Accordingly, the therapeutic compositions described herein may be administered (alone or as part of combination therapy) by various routes, including any convenient method for use in human or veterinary medicinal products. A therapeutically effective amount of the desired active ingredient can be formulated into a pharmaceutical composition to be introduced parenterally, transmucosally (e.g., orally, nasally, or rectally), or percutaneously. In some embodiments, administration is, for example, intravenous injection, or parenterally via arteriole, intramuscular, intradermal, subcutaneous, intraperitoneal, intracerebroventricular, and intracranial administration. Administration may be as a bolus, by continuous infusion over a period of time, or by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intra-articular bursal, intrathecal, oral, topical, or inhalation routes. In certain embodiments, for example, in embodiments involved in the treatment of inflammatory conditions affecting joints, the pharmaceutical composition may be administered directly to the synovial membrane, synovial fluid, or joint capsule, preferably by injection using a syringe. Administration may be topical or systemic. The choice may be influenced by the condition being treated, as well as the active agent and composition being administered.
[0268] For injection, the composition can be prepared as an aqueous solution in a buffer solution such as Hanks' solution, Ringer's solution, or physiological saline. The solution may contain compounding agents such as suspending agents, stabilizers, and / or dispersants. Alternatively, the composition may be in lyophilized and / or powder form to be prepared using a suitable vehicle, such as sterile pyrogen-free water, before use.
[0269] Compositions containing therapeutic constructs may be administered in aqueous solution by parenteral injection. Injectable formulations may be in the form of suspensions or emulsions and may optionally include pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such injectable compositions may include diluents, e.g., sterile water, various buffer-containing substances (e.g., Tris-HCl, acetate, phosphate), buffered saline of pH and ionic strength, and optionally, additives, e.g., detergents and solubilizers (e.g., TWEEN® 20, TWEEN® 80, also known as polysorbate 20 or 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), and preservatives (e.g., thimerosal, benzyl alcohol). Examples of non-aqueous solvents or vehicles include propylene glycol, polyethylene glycol, vegetable oils, e.g., olive oil and corn oil, gelatin, and injectable organic esters, e.g., ethyl oleate. The injectable formulation may be freeze-dried and resuspended, for example, immediately before use. The injectable formulation may be sterilized, for example, by filtration through a bacterial-retaining filter, by incorporating a sterilizing agent into the composition, by irradiating the composition, or by heating the composition.
[0270] In other embodiments, the therapeutic construct-containing composition is applied topically or by intravenous infusion. Topical administration may include application to the lungs, nose, oral cavity (sublingual, buccal), vagina, or rectal mucosa. These administration methods can be carried out by formulating a shell or coating of the delivery vehicle using a mucosal transport element. When the composition is delivered as either an aerosol or spray-dried particles having an aerodynamic diameter of less than about 5 microns, it may be delivered to the lungs while traversing the pulmonary epithelium and moving into the bloodstream during inhalation.
[0271] A wide range of machinery and devices designed for the delivery of therapeutic products to the lungs may be used, including, but are not limited to, nebulizers, metered-dose inhalers, and powder inhalers, all of which are well known to those skilled in the art.
[0272] Formulations for administration to mucous membranes are typically spray-dried drug particles that can be incorporated into tablets, gels, capsules, suspensions, or emulsions. Standard pharmaceutical excipients are available from any prescriber.
[0273] Transdermal formulations may be prepared. These are typically ointments, lotions, sprays, or patches, all of which can be prepared using standard techniques. Transdermal formulations may contain penetration enhancers. In combination with this method, chemical enhancers, as well as physical methods including electroporation and microneedling, may function.
[0274] Microneedles (MNs) are micron-sized needles with a height of 10-2000 μm and a width of 10-50 μm that can penetrate directly through the epidermis to the dermis with minimal or no pain (Hao et al., J Biomed Nanotechnol, 13(12):1581-1597, 2017). Several types of microneedles can be used. In some embodiments, a metal or plastic microneedle roller can be used to physically disrupt the skin surface to facilitate the penetration of the applied topical agent (in this case, the therapeutic construct). In some embodiments, biodegradable and soluble microneedles can contain the therapeutic construct. When administered to the skin, the microneedles can dissolve and release the construct deep within the skin layers. In some embodiments, non-biodegradable microneedles may be coated with the therapeutic construct to deliver the coated construct deep into the skin layers. Microneedles can be fabricated from a wide range of materials, including, but not limited to, polymers, sugars, polysaccharides, peptides, proteins, metals, and inorganic compounds (Ye et al., Adv Drug Deliv Rev, 127:106-118, 2018). Any materials and fabrication methods known in the art for microneedle technology are applicable to enhance the delivery of this therapeutic construct.
[0275] Any device that facilitates systemic or local delivery of therapeutic agents is also applicable to the therapeutic constructs provided herein. For example, a hepatic artery infusion (HAI) pump (Cohen et al., The Oncologist, 8(6):553-566, 2003), which is an implantation chemotherapy device that delivers high concentrations of cytotoxic agents directly to liver metastases while minimizing systemic toxicity, can also be used to deliver the therapeutic constructs described herein. In some embodiments, convection-enhanced delivery (CED) (Mehta, A. et al., Neurotherapeutics: the journal of the American Society for Experimental NeuroTherapeutics, 14(2), 358-371, 2017), which includes the arrangement of a small-diameter infusion catheter for delivering therapeutic agents to brain tumors, can also be used to deliver the therapeutic constructs described herein.
[0276] (VIII) Example of use: By providing herein a therapeutic construct comprising at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor, a method for treating and / or preventing hyperproliferative disorders, hyperproliferative disorders, or hyperproliferative conditions, including cancer, cancer symptoms, cancer progression (including from precancerous to cancerous), and cancer metastasis, is made possible. Specific examples of hyperproliferative disorders, hyperproliferative disorders, or hyperproliferative conditions include cancer. In some embodiments, cancer can suppress the immune system of a subject or individual having cancer. In some embodiments, the therapeutic constructs provided herein can suppress or reverse cancer-mediated immunosuppression, enabling immune recognition and elimination of malignant tumors.
[0277] As used herein, the term “treatment” or “to treat” refers to any improvement in cancer that occurs in a treated subject compared to an untreated subject. Such improvement may be prevention of cancer progression or worsening (e.g., improvement in progression-free survival). Furthermore, such improvement may also be a reduction or cure of cancer or its associated symptoms (e.g., reduction in tumor volume, partial remission, complete remission (e.g., over 6 months, 1 year, 2 years, 3 years, 4 years or 5 years or longer), prevention of cancer recurrence or relapse, reduction of metastasis, or reduction in the number of tumors or lesions). It will be understood that treatment may not be successful in 100% of treated subjects. However, this term requires that the treatment be successful as determined by those skilled in the art (e.g., oncologists, physicians). As used herein, the term “prevent” refers to avoiding the development of cancer or its associated syndromes as used herein. Prevention will be understood to mean avoiding the development of cancer within a future timeframe. The time frame preferably begins at the time of administration of the compound in the sense of the present invention and lasts for at least one month, at least six months, at least nine months, at least one year, at least two years, at least five years, at least ten years, or even for the remainder of the subject's physiological life. It will be understood that prevention may not be successful for 100% of the subjects being treated. However, this term requires that prevention be successful as determined by those skilled in the art (e.g., oncologists, physicians). Prevention may also be related to the recurrence of cancer after remission, for example, by a reduction in the probability of recurrence within the population.
[0278] The disclosed compositions can be used to treat benign or malignant cancers and their tumors. Treatment may directly target and kill cancer cells, indirectly target cancer cells by increasing the immune response against them, or a combination of both.
[0279] In mature animals, a balance is usually maintained between cell regeneration and cell death in most organs and tissues. Various types of mature cells in the body have a given lifespan. As these cells die, new cells are generated through the proliferation and differentiation of various types of stem cells. Under normal circumstances, the generation of new cells is regulated so that the number of any particular type of cell remains constant. However, occasionally, cells arise that no longer respond to the normal proliferation control mechanisms. These cells can grow to considerable size, producing clones of cells that can give rise to tumors or neoplasms. Tumors that cannot grow uncontrollably and do not extensively invade healthy surrounding tissues are benign. Tumors that continue to grow and gradually become invasive are malignant. The term cancer specifically refers to malignant tumors. In addition to uncontrolled growth, malignant tumors exhibit metastasis. In this process, small clusters of cancerous cells detach from the tumor, invade blood vessels or lymphatic vessels, and are carried to other tissues where they continue to grow. Thus, a primary tumor in one site can give rise to secondary tumors in another site.
[0280] The disclosed compositions can delay or inhibit the growth of a target tumor, reduce the growth or size of the tumor, completely eliminate the tumor, inhibit or reduce tumor metastasis, and / or inhibit or reduce symptoms associated with the development or growth of the tumor. For example, in some embodiments, the compositions reduce the tumor burden of the target or delay or prevent tumor growth over time.
[0281] Malignant tumors can be classified according to the embryonic origin of the tissue from which the tumor originates. Carcinomas are tumors arising from endodermal or ectodermic tissue, such as skin, or the inner lining of the epithelium of viscera and glands. Sarcomas, though less frequently, originate from mesodermal connective tissue, such as bone, fat, and cartilage. Leukemia and lymphoma are malignant tumors of hematopoietic cells in the bone marrow. Leukemia grows as single cells, while lymphoma tends to grow as a tumor mass. Malignant tumors can appear in multiple organs or tissues of the body, establishing cancer.
[0282] The types of cancer that can be treated with the provided compositions and methods include, but are not limited to, vascular cancers such as multiple myeloma, as well as solid cancers including adenocarcinomas and sarcomas of the bone, bladder, brain, breast, cervix, colon, rectum, esophagus, kidney, liver, lung, nasopharynx, pancreas, prostate, skin, stomach, and uterus. In some embodiments, the disclosed compositions are used to treat multiple cancer types simultaneously. The compositions may also be used to treat metastases or tumors at multiple locations.
[0283] Administration is not limited to the treatment of existing tumors, but may also be used to prevent or reduce the risk of an individual developing such a disease, i.e., for prophylactic use, and, for example, to reduce the spread of cancer by metastasis. Potential candidates for prophylactic vaccination include individuals at high risk of developing cancer, i.e., those with a personal or family history of certain types of cancer.
[0284] As used herein, the term “cancer” refers to any type of cancer, neoplasm, or malignant tumor found in mammals, including leukemia, lymphoma, carcinoma, and sarcoma. Exemplary cancers that can be treated with the compounds, pharmaceutical compositions, or methods provided herein include lymphoma, sarcoma, bladder cancer, bone cancer, brain tumor, cervical cancer, colon cancer, esophageal cancer, gastric cancer, head and neck cancer, kidney cancer, myeloma, thyroid cancer, leukemia, prostate cancer, and breast cancer (e.g., triple-negative, ER-positive, ER-negative, chemotherapy-resistant, Herceptin®-resistant, HER2-positive, doxorubicin-resistant, tamoxifen-resistant, ductal carcinoma, lobular carcinoma, primary). This includes cancers such as ovarian cancer, pancreatic cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung cancer, adenocarcinoma, large cell lung cancer, small cell lung cancer, carcinoid, sarcoma), glioblastoma multiforme, glioma, melanoma, prostate cancer, castration-resistant prostate cancer, breast cancer, triple-negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B-cell lymphoma, or multiple myeloma. Additional examples include cancers of the thyroid, endocrine system, brain, breast, cervix, colon, head and neck, esophagus, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovarian, sarcoma, stomach, uterus, or medulloblastoma, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocythemia, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, premalignant skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, and genitourinary tract cancer. Examples include cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, neoplasms of the endocrine or exocrine parts of the pancreas, medullary thyroid carcinoma, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid carcinoma, hepatocellular carcinoma, papillary Paget's disease, phyllodes tumor, lobular carcinoma, ductal carcinoma, stellate cell carcinoma of the pancreas, stellate cell carcinoma of the hepatic thyroid, or prostate cancer. As used herein, the term "precancerous" refers to a condition or growth that precedes or progresses to cancer.As used herein, the term "cancer metastasis" refers to the spread of cancer cells or tumors from one organ or part of the body to another organ or part of the body.
[0285] The term "leukemia" broadly refers to a progressive malignant disease of the hematopoietic organs, generally characterized by abnormal proliferation and development of white blood cells and their precursors in the blood and bone marrow. Leukemia is generally clinically classified based on (1) the duration and characteristics of the acute or chronic disease; (2) the type of cells involved; myeloid, lymphoid, or monocytic; and (3) an increase or absence of the number of abnormal cells, whether hematological leukemic or aleukemic (subleukemic). Exemplary leukemias that can be treated with the compounds, pharmaceutical compositions, or methods provided herein include, for example, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, leukocythemic leukemia, basophilic leukemia, blastic leukemia, bovine leukemia, chronic myeloid leukemia, cutaneous leukemia, embryocellular leukemia, eosinophilic leukemia, Gross leukemia, hairy cell leukemia, hemoblastic leukemia, hemoblastic cell leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, and lymphocytic leukemia. Leukemia includes lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloid leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasma cell leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemia, or anaplastic cell leukemia.
[0286] The term "sarcoma" generally refers to a tumor composed of a substance such as embryonic connective tissue, and generally consisting of densely packed cells embedded in a fibrous or homogeneous material. Sarcomas that can be treated with the compounds, pharmaceutical compositions or methods provided herein include chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, liposarcoma, liposarcoma, hydatidiform soft tissue sarcoma, amelosarcoma, rhabdomyosarcoma, and green sarcoma (chloroma). This includes sarcomas, choriocarcinoma, embryonal sarcoma, Wilms tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastic sarcoma, lymphoma, T-cell immunoblastic sarcoma, Jensen's sarcoma, Kaposi's sarcoma, Kupffer's astrocytic sarcoma, angiosarcoma, leukemosarcoma, malignant mesenchymal sarcoma, paraosteal osteosarcoma, reticulocytic sarcoma, Rous sarcoma, serous cystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma.
[0287] The term “melanoma” is interpreted to mean tumors arising from the melanocyte system of the skin and other organs. Melanomas that can be treated with the compounds, pharmaceutical compositions or methods provided herein include, for example, acral lentiginous melanoma, achromosomal malignant melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passé melanoma, juvenile melanoma, lentigo malignant melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.
[0288] The term "carcinoma" refers to a malignant neoplasm composed of epithelial cells that tends to invade surrounding tissues and cause metastasis. Exemplary carcinomas that can be treated with the compounds, pharmaceutical compositions, or methods provided herein include, for example, medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, lobular carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, adenomatous carcinoma (carcinoma adenomatosum), adrenal cortical carcinoma, alveolar carcinoma, alveolar epithelial carcinoma, basal cell carcinoma, basocellular carcinoma, basosquamous cell carcinoma, bronchoalveolar carcinoma, bronchiolar carcinoma, bronchogenic lung carcinoma, cerebriform carcinoma, cholangiocarcinoma, chorionic carcinoma, gelatinous carcinoma, comedone carcinoma, corpus carcinoma, cribriform carcinoma, armory carcinoma, skin carcinoma, and cylindrical carcinoma. Carcinoma, cylindrical cell carcinoma, adenocarcinoma, ductal carcinoma, carcinoma durum, embryonic carcinoma, medullary carcinoma, epidermoid carcinoma, adenoid epithelial carcinoma (carcinoma epitheliale adenoides), exotropic carcinoma, ulcerative carcinoma, fibrous carcinoma (carcinoma fibrosum), gelatinous carcinoma (gelatiniforni carcinoma), colloidal carcinoma, giant cell carcinoma, giant cell carcinoma (carcinoma gigantocellulare), adenocarcinoma (glandular carcinoma), granulosa cell carcinoma, hair matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Haasle cell carcinoma, hyaline carcinoma, adrenal carcinoma, infant embryonic carcinoma, carcinoma in situ, carcinoma in epidermis, carcinoma in situ carcinoma, Krompecher's carcinoma, Kurticsky cell carcinoma, large cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinomaCarcinoma, lobular carcinoma, lymphoepithelial carcinoma, medullary carcinoma, medullary carcinoma, black carcinoma, molle carcinoma, mucinous carcinoma, mucinous secretory carcinoma, mucocellular carcinoma, mucoepidermoid carcinoma, mucinous carcinoma, mucinous carcinoma, myxomatous carcinoma, nasopharyngeal carcinoma, oat cell carcinoma, ossificans carcinoma, osteoid carcinoma, papillary carcinoma, periportal carcinoma, pre-invasive carcinoma, squamous cell carcinoma, pultaceous carcinoma, renal cell carcinoma of the kidney, pre-cell carcinoma, sarcomatoid carcinoma This includes sarcomatodes, Schneiderian carcinoma, scirrhous carcinoma, scrotal carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, solanoid carcinoma, spheroid cell carcinoma, spindle cell carcinoma, cavernous carcinoma, squamous cell carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, nodular carcinoma (carcinoma tuberosum), tubular carcinoma, tubeous carcinoma, verrucous carcinoma, or choriocarcinoma (carcinoma villosum).
[0289] (IX) Kit In particular, an active ingredient comprising at least one described therapeutic construct (containing at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor, or a delivery vehicle conjugated thereto) may be provided as a kit. The kit may optionally include one or more containers containing (containing) one or more compounds or complexes described herein (e.g., anticancer agents) together with one or more additional agents for use in therapy. For example, some kits may contain a certain amount of at least one additional anticancer composition, or a certain amount of at least one additional anti-inflammatory agent, or both.
[0290] Any active ingredient in the kit may be provided in pre-measured doses, but this is not mandatory. A particular kit is expected to contain multiple doses.
[0291] The kit may also include a notice in the form prescribed by a government agency that regulates the manufacture, use, or sale of a pharmaceutical or biological product, which reflects approval by the agency for manufacture, use, or sale for human administration. The notice may state that the active ingredient provided may be administered to a subject. The kit may include additional instructions for using the kit, such as instructions for administration, proper disposal of associated waste, etc. Instructions may be in the form of printed instructions provided within the kit, or they may be printed as part of the kit itself. Instructions may be in the form of a sheet, pamphlet, booklet, CD-ROM, or computer-readable device, or instructions for instructions may be provided remotely, such as on a website. In certain embodiments, the kit may also include some or all of the essential medical supplies required to use the kit effectively, such as applicators, ampoules, sponges, sterile adhesive strips, Chloraprep, gloves, etc. Any of the contents of the kits described herein may be modified. The instructions for the kit shall direct the use of the active ingredient contained in the kit to achieve the clinical and / or therapeutic uses described herein.
[0292] Preferred methods, materials, and examples used for carrying out and / or testing aspects of the disclosed invention are described herein. Such methods and materials are illustrative and not intended to limit the scope. Other methods, materials, and examples similar to or equivalent to those described herein may be used.
[0293] The following exemplary embodiments and examples are included to demonstrate specific embodiments of the Disclosure. Those skilled in the art should recognize in light of the Disclosure that many modifications can be made to specific embodiments disclosed herein without departing from the spirit and scope of the Disclosure, and similar or comparable results can still be obtained.
[0294] (X) Exemplary aspects 1. Delivery system and, For example, at least one mitotic kinase inhibitor bound to or contained within a delivery system, For example, at least one immune checkpoint inhibitor bound to or contained within a delivery system and A therapeutic construct, including one. 2. A therapeutic construct according to Embodiment 1, wherein the delivery system comprises liposomes, lipid particles, polymer particles, inorganic nanoparticles or organic nanoparticles, inorganic microparticles or organic microparticles, or hybrids thereof. 3. A therapeutic construct of Embodiment 2, wherein the delivery vehicle comprises one or more of the following: fullerenes, endohedral metallofullerenes, trimetallic nitride-templated endohedral metallofullerenes, single-walled carbon nanotubes and multi-walled carbon nanotubes, branched carbon nanotubes and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled boron / nitrate nanotubes and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, calcium phosphate particles, aluminum salt particles, nanorods, cellulose nanoparticles, silicon, silica microspheres and silica nanospheres, polymer microspheres and polymer nanospheres, silica shells, biodegradable PLGA microspheres and biodegradable PLGA nanospheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles. 4. A therapeutic construct in any one of embodiments 1 to 3, wherein the delivery vehicle comprises mesoporous silica nanoparticles. 5. The therapeutic construct of embodiment 4, wherein the mesoporous silica nanoparticles have a size of approximately 5 to approximately 200 nm. 6. A therapeutic construct of embodiment 4 or 5, wherein mesoporous silica nanoparticles are coated with crosslinked polyethyleneimine and polyethylene glycol. 7. A therapeutic construct of any one of embodiments 1 to 6, comprising an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody, wherein the mitotic kinase inhibitor and / or immune checkpoint inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody. 8. A therapeutic construct in any one of embodiments 1 to 7, wherein at least one mitotic kinase inhibitor is an inhibitor of polo-like kinase (PLK), aurora kinase, cyclin-dependent kinase (CDK) 1, CDK2, HASPIN, unipolar spindle 1 kinase (Mps1), or NimA-related kinase (NEK). 9. A therapeutic construct in any one of embodiments 1 to 8, wherein the mitotic kinase inhibitor comprises one or more of the following: GSK461364, BI2536, Tak960, NMS-P937, volasertib, Chk 1 kinase inhibitors LY2603618, AU14022, YK-4-279, AZ703, aricertib, prexasertib, or AZD7762. 10. A therapeutic construct in any one of embodiments 1 to 9, wherein the mitotic kinase inhibitor is volacertib. 11. Any one of embodiments 1 to 10, comprising an immune checkpoint inhibitor, an siRNA, inhibitor, or antibody against one or more of PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4. 12. Any one of embodiments 1 to 11, wherein at least one immune checkpoint inhibitor is selected from antibodies against PD-L1, PD-1, or CTLA-4. 13. A therapeutic construct in any one of embodiments 1 to 12, wherein at least one immune checkpoint inhibitor is an antibody against PD-L1. 14. A therapeutic construct of embodiment 13, wherein the immune checkpoint inhibitor comprises at least one of nivolumab, pembrolizumab, MPDL3280A, ipilimumab, tremelimumab, atezolizumab, avelumab, durvalumab, semiprimab, pidilizumab, or spartalizumab. 15. Any one of the above embodiments of a therapeutic construct further comprising an adjuvant. 16. A therapeutic construct according to embodiment 15, wherein the adjuvant comprises one or more of the following: CpG oligonucleotides, DNA TLR agonists containing CpG sequences, non-CpG DNA TLR agonists, RNA TLR agonists, aluminum salts, anti-CD40 antibodies, fusion proteins, cytokines, small molecule TLR agonists, oil-based adjuvants or surfactant-based adjuvants, lipopolysaccharides, plant extracts, or derivatives thereof. 17. A therapeutic construct according to embodiment 15 or 16, wherein the adjuvant comprises a CpG oligonucleotide, imiquimod, reximod, gardikimod, polyI:C, polyICLC, dSLIM, or EnanDIM. 18. The therapeutic construct of embodiment 17, wherein the adjuvant comprises a CpG oligonucleotide. 19. A therapeutic construct having a hydrodynamic size of 5 to 999 nm, any one of embodiments 1 to 18. 20. A therapeutic structure having a hydrodynamic size of 1 to 1000 microns, one of any of embodiments 1 to 18. 21. Immune checkpoint inhibitors, Mitotic kinase inhibitors, and A chemical linker that connects immune checkpoint inhibitors and mitotic kinase inhibitors. A therapeutic construct, including one. 22. The therapeutic construct according to embodiment 21, wherein the mitotic kinase inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody. 23. A therapeutic construct according to embodiment 21 or 22, wherein the immune checkpoint inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody. 24. A therapeutic construct according to any one of embodiments 21 to 23, wherein the immune checkpoint inhibitor is an antibody. 25. A therapeutic construct according to any one of embodiments 21 to 24, wherein the immune checkpoint inhibitor is an antibody against PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4. 26. A therapeutic construct according to any one of embodiments 21 to 25, wherein the immune checkpoint inhibitor is an antibody against PD-L1, PD-1, or CTLA-4. 27. A therapeutic construct according to any one of embodiments 21 to 26, wherein the immune checkpoint inhibitor is an antibody against PD-L1. 28. Any one of the therapeutic constructs in any of embodiments 21 to 27, wherein the mitotic kinase inhibitor is selected from GSK461364, BI2536, Tak960, NMS-P937, volasertib, Chk 1 kinase inhibitors LY2603618, AU14022, YK-4-279, AZ703, aricertib, prexasertib, or AZD7762. 29. Any one of the therapeutic constructs described in embodiments 21 to 28, wherein the mitotic kinase inhibitor is aricertib. 30. The chemical linker is hydrazine; disulfide; N-succinimidyl-4-(2-pyridyldithio)butanoate; N-succinimidyl-4-(2-pyridyldithio)-2-sulfobutanoate; perfluorophenyl-3-(pyridine-2-yldisulfanyl)propanoate; 2,5-dioxopyrrolidine-1-yl-3-methyl-3-(pyridine-2-yldisulfanyl)butanoate; Gly-Phe-Leu-Gly; Ala-Leu-Ala-Leu; Val-Cit; Phe-Lys; Val-Ala; Ala-Phe-Lys; Phe-Lys; n is 1-20 (Gly) nβ-glucuronide linker; maleimidocaproyl; N-(maleimidomethyl)cyclohexane-1-carboxylate; 4-(4-acetylphenoxy)butanoic acid; dibromomaleimide; para-aminobenzoic acid; 4-nitrophenol; acetic acid; formic acid; 4-maleimidobutyrate N-succinimidyl ester; N-(4-maleimidobutyryloxy)succinimidide; N-(6-maleimidocaproyloxy)succinimidide; 3-maleimidopropionic acid N-succinimidyl ester; N-(3-maleimidopropionyloxy)succinimidide; 5-maleimidovaleric acid-NHS; 100~10000 A therapeutic construct comprising one or more residues from the following embodiments: linear, branched, or multi-armed polyethylene glycol having a molecular weight of Da; propargyl-N-hydroxysuccinimidyl ester; pyrophosphate; succinimidyl-4-azidobutyrate; 4-azidobenzoic acid N-hydroxysuccinimide ester; tert-butyl 1-(4-formylphenyl)-1-oxo-5,8,11-trioxa-2-azatridecane-13-oate; or any one of these residues. 31. Any one of the therapeutic constructs of embodiments 21 to 30, wherein the chemical linker comprises an N-(maleimidomethyl)cyclohexane-1-carboxylate linker or a residue thereof. 32. Any one of the therapeutic constructs of embodiments 21 to 31, wherein the chemical linker comprises sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate. 33. A therapeutic construct in any one of embodiments 21 to 32, wherein the chemical linker comprises linear polyethylene glycol or a residue thereof having a molecular weight of 100 to 10000 Da. 34. A therapeutic construct according to any one of claims 21 to 33, wherein the ratio of mitotic kinase inhibitor to immune checkpoint inhibitor is approximately 1 to approximately 20. 35. The therapeutic construct of embodiment 34, wherein the ratio of mitotic kinase inhibitors to immune checkpoint inhibitors is approximately 2 to approximately 8. 36. A therapeutic construct of embodiment 34 or 35, wherein the ratio of mitotic kinase inhibitor to immune checkpoint inhibitor is approximately 4 to approximately 6. 37. Any one of embodiments 21 to 33, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 1 to approximately 20. 38. The therapeutic construct of embodiment 37, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 2 to approximately 8. 39. A therapeutic construct according to embodiment 37 or 38, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 4 to approximately 6. 40. A composition comprising one therapeutic construct from any one of embodiments 1 to 39 and a pharmaceutically acceptable carrier, excipient, or diluent. 41. A method for treating cancer, comprising the step of administering to a subject having cancer an effective amount of one of the therapeutic constructs from embodiments 1 to 39 or the composition of embodiment 40. 42. The method of aspect 41, wherein the subject is a human being. 43. A method for treating cells exhibiting symptoms of cancer, The step of bringing the cells into contact with a therapeutically effective amount of any one of the therapeutic constructs from embodiments 1 to 39 or the composition of embodiment 40. The method, including the method described above. 44. A method for treating cells obtained from a subject exhibiting symptoms of cancer, The step of bringing the cells into contact with a therapeutically effective amount of any one of the therapeutic constructs from embodiments 1 to 39 or the composition of embodiment 40. The method, including the method described above. 45. A method for treating cells obtained from a subject exhibiting symptoms of cancer, A step of ex vivo contacting cells with a therapeutically effective amount of one of the therapeutic constructs from embodiments 1 to 39 or the composition of embodiment 40. The method, including the method described above. 46. The method according to aspect 44 or 45, wherein the cells are cancer cells. 47. The method of aspect 44 or 45, wherein the cells are not cancer cells. 48. The method of aspect 47, wherein the cells are immune cells. 49. Any one of embodiments 43 to 48, further comprising the step of administering at least one treated cell back to the target. 50. A method for treating a subject diagnosed with an overproliferative disease or overproliferative condition, A step of administering an effective amount of the composition of embodiment 40 to the subject. The method, including the method described above. 51. The method of aspect 50, wherein the hyperproliferative disorder includes one or more of cancer, precancerous conditions, or cancerous metastases. 52. The method of aspect 51 or 52, wherein the hyperproliferative disease includes one or more of melanoma, lung cancer, breast cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, lymphoma, colon cancer, or liver cancer. 53. The administration process is, Injection into or at the target tumor, Local injection into or at the target tumor, Systemic injection in the subject, Whole-body injection in the subject, Inhalation by the target, Oral administration to the target, or Local application to the target A method from any one of embodiments 50 to 52, which includes one or more of the above. 54. Any one of embodiments 50 to 53, wherein the administration step includes the application of a microneedle. 55. A method for enhancing the effect of anticancer therapy in a subject that requires it, An effective amount of any one therapeutic construct from embodiments 1 to 39 or the composition of embodiment 40, At least one anticancer drug and The process of administering it to the target that needs it. The method, including the method described above. 56. The method according to embodiment 55, wherein the anticancer agent is a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor. 57. The method according to embodiment 55 or 56, wherein a therapeutic construct or composition and an anticancer agent are administered sequentially or simultaneously. 58. A method for enhancing, increasing, or improving the effect of radiotherapy in a subject diagnosed with a neoplasm, An effective amount of any one therapeutic construct from embodiments 1 to 39 or the composition of embodiment 40, At least one radiation therapy and The process of administering it to the target that needs it. The method, including the method described above. 59. The method of aspect 58, wherein a therapeutic construct or composition and radiotherapy are administered sequentially or simultaneously. 60. Any one of the methods described in aspects 49 to 59, wherein the subject is a human being. 61. An immunotherapy construct from any one of embodiments 1 to 39, At least one anticancer drug and A kit that includes this. 62. A kit according to embodiment 61, wherein the anticancer agent is a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor. [Examples]
[0295] (XI) Examples Example 1: Combination of PLK1 inhibition and PD-L1 blockade for cancer treatment Polo-like kinase 1 (PLK1) is an important mitotic kinase that is overexpressed in various cancers and contributes to oncogenesis (Liu et al., Translational Oncology, 10(1):22-32, 2016). Previous studies have shown the potential of PLK1 inhibition as a therapeutic strategy, and several PLK1 small molecule inhibitors have reached clinical trials (Gutteridge et al., Molecular Cancer Therapeutics, 15(7):1427-35, 2016). However, PLK1 inhibitors as monotherapy have not progressed beyond clinical trials due to insufficient efficacy and dose-limiting toxicity (de Braud et al. Annals of Oncology: Official Journal of ESMO, 26(11):2341-6, 2015; Schoffski et al., European J Cancer, 48(2):179-86, 2012; Lin et al., British J Cancer, 110(10):2434-40, 2014; Frost et al., Current Oncology, 19(1):e28-35, 2012). Volasertib (BI6727), the most advanced PLK1 inhibitor, reached a Phase III clinical trial for acute myeloid leukemia (hematological malignancy) (Gjertsen et al., Leukemia, 29(1):11-9, 2015), but ultimately failed to meet the primary endpoint of objective response (Ingelheim, Results of Phase III study of volasertib for the treatment of acute myeloid leukemia, presented at the European Hematology Association Annual Meeting, Ridgefield, Conn., 2016). In lung cancer, volasertib as monotherapy was discontinued early in a Phase II clinical trial due to a lack of response with a given dose-limiting toxicity (300 mg every three weeks) (Ellis et al., Clinical lung cancer, 16(6):457-65, 2015).These results suggest that alternative therapeutic strategies are needed to unlock the full potential of inhibiting PLK1.
[0296] The recent emergence of immune checkpoint blockade targeting the PD-L1 / PD-1 axis offers promising results for NSCLC patients. PD-L1 expression on tumor cells inhibits tumor-targeted cytotoxic CD8+ T cell activity by binding to PD-1 receptors on T cells and suppressing their function (Ohaegbulam et al., Trends in Molecular Medicine, 21(1):24-33, 2015; Shrimali et al., Immunotherapy, 7(7):777-92, 2015; Zou et al., Science Translational Medicine, 8(328):328rv4-rv4, 2016). In recent years, PD-1 and PD-L1 checkpoint inhibitors (e.g., pembrolizumab, nivolumab, atezolizumab, and durvalumab) have received FDA approval for the treatment of NSCLC as first-line (pembrolizumab) or second-line therapy (Gettinger, Immunotherapy of advanced non-small cell lung cancer with immune checkpoint inhibition. (Uptodate.com, 2018)). However, while some patients may show a robust and sustained response, only a small fraction of patients respond, and many early responders eventually experience relapse (Reck et al., New England Journal of Medicine, 375(19):1823-33, 2016; Malhotra et al., Translational Lung Cancer Research, 6(2):196-211, 2017; Moya-Horno et al., Therapeutic Advances in Medical (Oncology, 10:1758834017745012, 2018). Furthermore, systemic distribution of antibodies against immune checkpoints can trigger abnormal and uncontrolled immune responses, leading to immune-related adverse events (irAEs) that damage normal tissues (Reynolds et al., Journal of Clinical Oncology, 36(15_suppl):3096, 2018).These toxicities can lead to treatment interruptions, and in some cases, irAEs can be fatal. Therefore, strategies to improve the response and therapeutic efficacy of immune checkpoint blockade are of great interest (Kanwal et al., Cureus, 10(9):e3254-e, 2018).
[0297] Recent studies have shown that in several human cancer cell lines, PD-L1 protein levels fluctuate during cell cycle progression, peaking in M phase and early G1 phase (Zhang et al., Nature, 553(7686):91-5, 2018). Therefore, increased PD-L1 protein levels were observed in several mouse tumor-derived cell lines arrested in M phase with nocodazole or taxol (Zhang et al., Nature, 553(7686):91-5, 2018). A decrease in PLK1 induced potent mitotic arrest that could persist for several days after treatment (Figures 2A-2C, and Morry et al., Mol Cancer Ther. 2017, 16(4):763-772). In summary, these observations led to the hypothesis that combining PD-L1 antibodies with mitotic kinase inhibitors such as PLK1 inhibitors can increase cancer cell death due to the apoptotic effect of PLK1 inhibitors and the antitumor immune effect induced by PD-L1 checkpoint blockade.
[0298] This specification describes the development of a PLK1 inhibitor-loaded mesoporous silica nanoparticle platform (MSNP) conjugated to a PD-L1 antibody to synergize the combined effects of targeting both PLK1 and PD-L1. By co-delivering these agents using nanoparticle constructs or antibody-drug conjugates (ADCs), therapeutic effects can be effectively co-localized to tumors, mitigating toxicity concerns associated with systemic drug administration. The constructs also induce adaptive immunization against cancer. Our studies highlight a rationale for a combination strategy to enhance existing therapies without increasing toxicity by utilizing the MSNP platform as a delivery carrier.
[0299] material and method Cell lines and reagents: A549 NSCLC was purchased from ATCC (CCL-185) and maintained in RPMI medium containing 10% fetal bovine serum (FBS). Lewis lung cancer (LLC) metastatic mutants, LLC-JSP cells, and fluorescently labeled LLC-JSP cells were donated by Dr. Don Gibbons lab (MD Anderson Cancer Center) and cultured in RPMI + 10% FBS. Antibodies used: Human PD-L1 antibody (eBioscience), mouse PD-L1 (PE, BD Biosciences), mouse CD3 (APC, eBioscience), mouse CD8a (Pacific Blue, Invitrogen), mouse CD4 (BV711, BD biosciences), mouse PD-1 (PE / Cy7, BioLegend). Alexa Fluor 488 secondary antibody was purchased from Life Technologies. The in vivo-grade mouse PD-L1 antibody was purchased from BioXcell (BE0101), and volasertib was purchased from Selleckchem. siRNA sequence: PLK1 TIFF2026143527000011.tif4128; Scramble SCR I purchased TIFF2026143527000012.tif4128 from Dharmacon.
[0300] Synthesis and Characterization of Nanoparticles: As previously reported by the inventors, naked MSNPs were synthesized (Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-59, 2015, and U.S. Patent Application Publication No. 2017 / 0173169). For loading with the PLK1 inhibitor, volasertib was dissolved in DMSO, diluted in ethanol solution, and mixed with the ethanol solution of MSNPs, and shaken overnight at room temperature (350 RPM). The following day, the nanoparticles were coated with PEI (Alfa Aesar) and mal-PEG-NHS (Jenkem) according to the inventors' previous tests (Ngamcherdtrakul et al., Advanced Functional Materials, 25(18):2646-59, 2015; Ngamcherdtrakul et al., Int J Nanomedicine, 13:4015-27, 2018). For PD-L1 antibody conjugation, in vivo-grade mouse PD-L1 antibody (BioXcell) was buffer-exchanged with PBS pH 8 (Zeba spin column, Thermo Fisher) and thiolated using Traut reagent (Thermo Fisher) according to the manufacturer's protocol. The thiolated antibody was added to NPs at 20% wt and shaken overnight at 4°C (300 RPM). Before characterization, the nanoparticles were washed with PBS pH 7.2. The nanoparticle size was 90 nm and determined using a Malvern Zetasizer. The antibody loading was 4% wt and determined by protein quantification of the NP supernatant using a BCA assay. To quantify the PLK1 inhibitor loading, the nanoparticles were shaken in DMSO solution to release the drug, and the supernatant was collected. The absorbance of the supernatant was measured using a Tecan plate reader and the loading was determined to be 0.5% wt. p-iPLK1-NP is a nanoparticle loaded with both a PLK1 inhibitor and a PD-L1 antibody, while p-NP is a nanoparticle loaded with a PD-L1 antibody, and iPLK1-NP is a nanoparticle loaded with a PLK1 inhibitor.
[0301] Flow cytometry: Cells (100K cells / well) were seeded overnight in a 6-well plate and treated the following day using the indicated treatment. After treatment, cells were harvested, aliquoted into 1 million cells / sample, washed in FACs buffer, and stained. Primary and secondary antibodies were used for staining for 30 minutes and 1 hour, respectively, while shaking on ice. After staining, cells were washed in FACs buffer and flow analysis was performed using a Guava easyCyte (Millipore Sigma) flow cytometer (10,000 events / sample). For tumors, tumor tissue was collected, finely chopped, incubated with 1 mg / ml DNAse for 30 minutes, and then lysed through a 70 μm filter to obtain a single-cell suspension. Cells were incubated with RBC lysis buffer for 5 minutes and washed with PBS. 1 million cells / sample were blocked using an Fc-shield and then stained with a dye-conjugated antibody for 30 minutes (in FACs buffer). Next, the cells were washed in FACs buffer and analyzed using Guava (50,000 events / sample).
[0302] Western blotting. Cells were seeded overnight in 6-well plates and treated using the indicated method. One day after treatment, the cell culture medium was changed. Three days after treatment, the cells were lysed in RIPA buffer (50-100 μl / well). The lysates were sonicated and centrifuged (15,000 RPM for 15 minutes), and the supernatant was collected. Total protein content was quantified using BCA. 30 μg of protein (per sample) was mixed with 4X Novex NuPAGE LDS sample buffer and β-mercaptoethanol (10% final concentration). The samples were denatured at 95°C for 5 minutes and loaded onto a gel (NuPAGE) for electrophoresis. The proteins were then transferred onto a PVDF-FL membrane and blocked with LICOR blocking buffer. The membranes were incubated overnight with primary antibodies at 4°C (PLK1, phospho-STAT3 (Tyr705), β-actin). The following day, the membrane was rinsed with TBS-T, and IRDye conjugate secondary antibody (LI-COR) was added over 1 hour while shaking at room temperature. The membrane was scanned using the LI-COR Odyssey CLx imaging system.
[0303] Cell viability after treatment: Cells (1500 cells / well) were seeded overnight in a white, flat-bottomed, 96-well plate. The following day, the cells were treated with the indicated treatment, and the culture medium was changed 24 hours after treatment. Three to five days after treatment, cell viability was evaluated using the Cell Titer Glo assay (Promega) according to the manufacturer's instructions. Luminescence was read using a Tecan plate reader.
[0304] RT-qPCR to evaluate PLK1 gene knockdown: RNA was isolated using the GeneJet RNA purification kit (Thermo Fisher Scientific) according to the manufacturer's instructions. One-step qRT-PCR was performed using the EXPRESS One-Step Superscript™ qRT-PCR Kit (Invitrogen). Cycling conditions: 40 cycles of 2 minutes at 50°C, 10 minutes at 95°C, 15 seconds at 95°C, and 1 minute at 60°C. TAQMAN gene expression primers were used: human HPRT mRNA (Hs99999909_m1), human PLK1 mRNA (Hs00983225_g1), and human PD-L1 (Hs00204257_m1). 2 -ΔΔC(t) The data was analyzed using the law.
[0305] Synergistic tumor model and treatment: For a single tumor flank model, LLC-JSP mouse lung cancer cells (200K) were inoculated into the right flank of C57BL / 6 female mice (6 weeks old) (Charles River NCI colony). Eight days after tumor inoculation, mice were treated with volasertib (20 mg / kg) and / or PD-L1 antibody (BioXcell mouse PD-L1); 10 mg / kg) in a total of three doses, administered intraperitoneally (ip) every five days. Tumors were measured using a Vernier caliper, with V = 0.5 × length × width. 2 Volume was calculated accordingly. For bilateral tumors, 100K and 40K LLC-JSP cells were inoculated into the right and left flanks, respectively, of C57BL / 6. Twelve days after inoculation, the aforementioned treatment was administered intratumorally to the right tumor every three days in a total of three doses. For both the single flank tumor model and the bilateral flank tumor model, the total tumor load was 2000 mm². 3Mice were euthanized when the threshold was exceeded. For a metastatic lung tumor model, LLC-JSP(200K) was intravenously (iv) injected into 6-week-old C57BL / 6 mice. Three days after cancer cell injection, mice were randomly divided into groups and treated every three days with a total of four doses: iv saline, p-iPLK1-NP (25 mg / kg NP), or ipPD-L1 antibody (5 mg / kg) and volasertib (1.25 mg / kg). All studies were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Oregon Health & Science University (OHSU).
[0306] Statistical Analysis: All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software Inc.). Student's t-test was used to compare the two groups. Tumor growth was analyzed using two-way repeated measures ANOVA with Tukey's correction for multiple comparisons. Kaplan-Meier survival curves were analyzed using the log-rank (Mantel-Cox) method. Significance was set at p<0.05. In vitro data are expressed as mean ± SD, and in vivo data are expressed as mean ± SEM.
[0307] result PLK1 knockdown induces PD-L1 expression in cancer cells: knocking down PLK1 (Figures 2A-2B) leads to lung cancer cell death (Figure 2C) and causes cancer cells to enter a G2 / M growth arrest state (Figure 2D) with small molecule inhibitors against PLK1 (e.g., BI2536) or mitotic kinase inhibitors such as siRNA delivered on nanoparticles (see U.S. Patent Application Publication No. 2017 / 0173169). This is consistent with previous reports that inhibition or knockdown of PLK1 leads to cell cycle arrest in G2 / M breast cancer (Morry et al., Mol Cancer Ther., 16(4):763-772, 2017).
[0308] PLK1 knockdown resulted in increased PD-L1 surface expression in both human (A549, Figures 3A-3B) and mouse (LLC-JSP, Figure 3C) lung cancer cell lines. As shown in Figure 3A, 85% knockdown of PLK1 mRNA (by siRNA against PLK1) resulted in a 2.5-fold increase in PD-L1 mRNA expression in the A549 cell line compared to control-treated cells. This was then confirmed at the surface protein level of the A549 (Figure 3B) and LLC-JSP (Figure 3C) lung cancer cell lines three days after siRNA treatment.
[0309] Mitochondrial kinase inhibitors kill cancer cells and upregulate PD-L1 expression. Following our discovery that PLK1 knockdown leads to PD-L1 upregulation, we sought to determine whether this generally applies to mitochondrial kinase inhibition. Three major mitochondrial kinase inhibitors were screened against PLK1 (borasertib), Aurora kinase A (aricertib), and CHK1 (AZD7762) in mouse lung cancer cell lines. As shown in Figure 4, treatment of LLC-JSP (mouse lung cancer cell line) with borasertib, aricertib, or AZD7762 resulted in significant cell death (Figure 4A) and upregulation of surface PD-L1 levels (Figures 4B-4C). This confirmed the association between mitochondrial kinase inhibition (regardless of kinase class) and PD-L1 upregulation. In surviving cells, levels of immune checkpoint molecules (e.g., PD-L1, Figures 3A-3C and 4B-4C) that prevent cytotoxic T cells from attacking surviving cancer cells are increased. Therefore, co-delivery of mitotic inhibitors (e.g., PLK, aurora kinase, CHK1, CDK1 / 2, HASPIN, Mps1, NEK inhibitors) and immune checkpoint inhibitors (e.g., monoclonal antibodies against PD-L1, PD-1, CTLA-4) on the same construct results in even more cancer deaths.
[0310] The combination of PLK1 inhibition and PD-L1 blockade enhances tumor control in vivo: Based on our findings that PLK1 reduction leads to PD-L1 increase, we sought to investigate whether PLK1 inhibition and PD-L1 blockade have a synergistic effect in vivo. We developed a flank tumor model in immunocompetent mice using the LLC-JSP cell line (Chen et al., Nature Communications, 5:5241, 2014). Tumors were established 8 days after tumor inoculation (>60 mm). 3 The mice were treated with ip therapy every 5 days using a total of three doses of the PLK1 inhibitor volasertib (20 mg / kg) and PD-L1 monoclonal antibody (10 mg / kg) (Figure 5A). As shown in Figure 5B, the combination treatment significantly reduced tumor growth compared to monotherapy. Furthermore, this combination significantly extended the survival time of the mice (Figure 5C), supporting our hypothesis.
[0311] Nanoparticle Delivery of the PLK1 Inhibitor Volasertib (iPLK1-NP): Despite the promising therapeutic target of mitotic kinase PLK1, clinical trials using current small molecule inhibitors have been disappointing. All six PLK1 inhibitors (GSK461364, BI2536, Tak960, NMS-P937, TKM-PLK1, and BI6727) have failed in clinical trials. To reduce the toxicity of PLK1 inhibitors and improve tumor bioavailability, we investigated whether our MSNP platform could improve the efficacy of clinically available PLK1 inhibitors. Morry et al. (Mol Cancer Ther., 16(4):763-772, 2017) demonstrated the potential of this MSNP platform for delivering siRNA to thoracic tumors, including thoracic tumors with lung metastases and orthotopic lung tumors. In this study, the inventors utilized a platform to deliver boracertib, a small molecule inhibitor and the most advanced inhibitor of PLK1. Boracertib was loaded onto mesoporous silica (Figure 6A) before surface modification with polyethyleneimine (PEI) and polyethylene glycol (PEG). The final nanoparticle size (called iPLK1-NP) was 90 nm (Figure 6B), which is within a suitable range to utilize the EPR effect, and contained 0.5 wt% of the PLK1 inhibitor boracertib. As shown in Figure 6C, treatment of LLC-JSP cells with boracertib or iPLK1-NP significantly reduced cell viability in a dose-dependent manner compared to vehicle-treated cells. Furthermore, treatment with iPLK1-NP reduced cell viability more than treatment with free PLK1 inhibitor (Figure 6C). Consistent with previous findings using PLK1 siRNA (Figures 3A-3C) and mitotic kinase inhibitors (Figures 4B-4C), treatment with iPLK1-NP resulted in a significant increase in PD-L1 cell surface expression (Figure 6D).
[0312] Nanoparticles for simultaneous delivery of iPLK1 and PD-L1 antibody (p-iPLK1-NP): Since iPLK1-NP can effectively kill cancer cells and simultaneously upregulate PD-L1 in surviving cells, we aimed to utilize this as an advantage for targeting PD-L1+ cancer cells by conjugating a PD-L1 antibody onto iPLK1-NP. In this sense, repeated administration of PD-L1 targeted iPLK1-NP (called p-iPLK1-NP) can upregulate PD-L1 expression and generate a feedforward loop that enables superior tumor targeting to induce both apoptosis (by PLK1 inhibition) and an anti-tumor immune response (by PD-L1 blockade). This is particularly advantageous for treating tumors for which there is no obvious target / receptor for nanoparticle delivery and ultimately may enable immune checkpoint blockade with even higher response rates. As shown in Figure 7A, the PD-L1 antibody was conjugated to PEG on the NP, and the antibody amount was determined to be 4% by weight by BCA assay. The hydrodynamic size of the construct is approximately 90 nm, as shown in Figure 7B. In the LLC-JSP cell line, treatment with p-iPLK1-NP significantly reduced cell viability, similar to iPLK1-NP (Figure 7C). Furthermore, LLC-JSP cells incubated with p-iPLK1-NP for 2 hours blocked PD-L1 surface receptors to the same extent as free PD-L1 antibody delivered at a 25-fold dose (Figure 7D). This may be due to the high local concentration of antibody experienced by the cells when the antibody was delivered with the nanoparticles. iPLK1-NP did not affect PD-L1 levels at this short time point (Figure 7D). Treatment of cells with iPLK1-NP for 2 days increased PD-L1 levels as predicted, and treatment with nanoparticles containing PD-L1 antibody (p-iPLK1-NP) reduced them to normal levels (see untreated cells) (Figure 7E). This demonstrates nanoparticle targeting and blockade of the PD-L1 receptor, induced by PLK1 inhibition.
[0313] Local delivery of p-iPLK1-NP reduces the growth of local and distal tumors: To evaluate the antitumor immune response of p-iPLK1-NP, we utilized a bilateral flank tumor model. 100K and 40K LLC-JSP cells were injected into the right and left flanks, respectively, of C57BL / 6 mice. Twelve days post-injection, PBS, p-NP, iPLK1-NP, or p-iPLK1-NP (0.5 mg NP, 2.5 μg iPLK1, 20 μg PD-L1) were injected into the right flank (local) tumor for a total of three times every three days (Figure 8A). Tumor growth of local (treated) and distal (untreated) tumors was monitored. Treatment with p-iPLK1-NP significantly reduced tumor growth of local tumors compared to nanoparticles containing monotherapy (p-NP or iPLK1-NP) (Figure 8B). Importantly, delayed distal tumor development was also observed in p-iPLK1-NP-treated mice (Figure 8C), indicating that an antitumor immune response occurred. The antitumor immune effect was not solely due to PD-L1 on the nanoparticles, but was mediated by both PD-L1 inhibitors and PLK1 inhibitors on the nanoparticles (Figure 8C). Furthermore, treatment with p-iPLK1-NP significantly extended the survival time of mice compared to saline control or monotherapy with p-iPLK1-NP (Figure 8D). In addition, in another study, mice were injected with either saline or p-iPLK1-NP as shown in Figure 8A, and tumors were harvested one day after the last treatment to assess T cell infiltration. As shown in Figure 8E, tumors treated with p-iPLK1-NP had significantly higher CD3+ tumor-infiltrating lymphocytes (TILs) and CD8+ tumor-infiltrating lymphocytes (TILs), but CD4+ TILs were not enhanced compared to control tumors.
[0314] Systemic administration of p-iPLK1-NP extends the survival time of mice with experimental metastatic tumors: To demonstrate the clinical potential of p-iPLK1-NP for lung cancer, we developed an experimental metastatic lung tumor model by intravenous injection of LLC-JSP cells (200K cells). Three days after cell injection, as shown in Figure 9A, mice were randomly divided into groups and treated every three days with a total of four doses of saline, p-iPLK1-NP, or a free drug (volasertib + PD-L1 antibody). The free drug was administered at a dose five times the amount on the NP. Mice treated with p-iPLK1-NP survived significantly longer than mice treated with saline (Figure 9B). The presence of lung tumors was visually confirmed in each deceased mouse. The data show that p-iPLK1-NP was as effective as the free drug administered at five times the dose, due to the nanoparticle's ability to target tumors, co-localize therapeutic effects, and induce adaptive anti-tumor immunity. Furthermore, treatment with p-iPLK1-NP did not cause any weight loss, demonstrating the safety of the construct (Figure 9C). Systemic application of the therapeutic construct enables the treatment of other cancers that cannot be treated by topical delivery.
[0315] Systemic administration of p-iPLK1-NP is CD8+ T cell dependent: C57BL / 6 mice were intravenously injected with 200K LLC-JSP cells. Three days later, the mice were treated with saline, p-iPLK1-NP (iv, containing 2.5 μg volasertib and 20 μg PD-L1 antibody), or p-iPLK1-NP + anti-CD8 (200 μg, twice weekly). As shown in Figure 10, the effect of p-iPLK1-NP was immunomediated, as CD8 depletion negated the effect of p-iPLK1-NP and no extension of survival was observed (saline vs. p-iPLK1-NP + anti-CD8 antibody; p>0.05=ns). The immunomediated response supersedes the direct drug effect of this specific nanoconstruct.
[0316] Feedforward (positive feedback loop) delivery and specificity of anti-PD-L1 conjugate NPs. p-iPLK1-NPs initially reduce PD-L1 levels upon binding and internalization (as shown in Figures 7D-E), but in surviving cells, PD-L1 levels are upregulated due to the signaling effect of PLK1 inhibition (Figure 6D). In connection with this, using unregulated PD-L1 as a homing target for subsequent delivery of p-iPLK1-NPs results in feedforward cancer targeting (i.e., the more the dose of treatment is increased until all cancer disappears, the higher the degree of targeting). To investigate the feedforward targeting of p-iPLK1-NPs, we used 4T1 mouse cancer cells expressing low baseline PD-L1 levels. p-iPLK1-NPs resulted in upregulation of PD-L1 in 4T1 cells 4 days after treatment (Figure 11A). Next, the inventors evaluated the cellular uptake of p-iPLK1-NP in control (low PD-L1) and p-iPLK1-NP-treated 4T1 cells (PD-L1 upregulated). As shown in Figure 11B, after 1 hour of exposure, p-iPLK1-NP was preferentially taken up by PD-L1-high cells at approximately four times the rate of PD-L1-low cells, demonstrating the selectivity and feedforward targeting of p-iPLK1-NP. The inventors also evaluated the cell-killing selectivity by comparing the viability of various cancer cells (lung LLC-JSP cancer cells, thoracic 4T1 cancer cells, melanoma B16-F10 cancer cells) with bone marrow-derived dendritic cells (BMDCs) after treatment with p-iPLK1-NP. As shown in Figure 11C, p-iPLK1-NP resulted in significant cell killing in cancer cells, but minimal killing in dendritic cells necessary for antigen presentation to develop antitumor T cells. Furthermore, inhibition of mitotic kinases such as PLK1 (e.g., by siRNA, Figure 12A) reduced STAT3 phosphorylation, suggesting it may be beneficial in regulating the tumor's immunosuppressive environment.
[0317] Consideration In this example, inhibition of PLK1, as well as other mitotic kinases such as Aurora kinase A and CHK1, is shown to result in increased immune checkpoint PD-L1 expression in human and mouse NSCLC cells. This suggests that evasion of the immune response is a mechanism utilized by cancer cells that survive mitotic kinase inhibition.
[0318] Previous studies have also demonstrated the role of PLK1 in immunity. For example, PLK1 has been shown to be a regulator of STAT3 activation that promotes an immunosuppressive microenvironment (Zhang et al., Gastroenterology, 142(3):521-30.e3, 2012), and as reported herein (Figure 12A), inhibition of PLK1 resulted in loss of phosphorylated STAT3 in NSCLC cells (Yan et al., Oncology Letters, 16(5):6801-7, 2018). Furthermore, PLK1 has been found to associate with MAVS and negatively regulate its activity in type I interferon induction (Gringhuis et al., Nature Immunology, 18(2):225-35, 2017; Vitour et al., J Biological Chemistry, 284(33):21797-809, 2009). Interestingly, PLK1 inhibition has also been shown to significantly increase HLA mRNA encoding MHC class I proteins, which are antigen-presenting surface receptors (Li et al., Journal of Oncology, 2018:3979527, 2018). These studies suggest that PLK1 inhibition may be promising for enhancing immunotherapy. However, to the best of our knowledge, this is the first study to report the combined effects of PLK1 inhibition and immunotherapy.
[0319] PLK1 inhibition induces PD-L1 upregulation, and co-delivery of PD-L1 antibodies and PLK1 inhibitors significantly enhances treatment outcomes, as demonstrated for NSCLC. Other cytotoxic agents, including paclitaxel in ovarian cancer (Peng et al., Cancer Research, 75(23):5034-45, 2015), CDK4 / 6 inhibitors (Zhang et al., Nature, 553(7686):91-5, 2018), and PARP inhibitors in breast cancer (Jiao et al., Clin Cancer Res, 23(14):3711-20, 2017), have also been shown to increase PD-L1 expression. Therefore, it is reasonable that these drugs are currently in clinical study in combination with PD-L1 checkpoint blockade (Esteva et al., The Lancet Oncology, 20(3):e175-e86, 2019). Our findings also suggest that these and other cytotoxic agents, when combined with PD-L1 immune checkpoint blockade on our nanoparticles, can facilitate clinically effective treatment and reduce toxicity.
[0320] The studies presented in this embodiment focused on lung cancer, a major deadly cancer (American Cancer Society, Cancer Facts & Figures, 2018). Like melanoma, where immunotherapy is most promising, lung cancer is a highly mutagenic disease that promotes the expression of various neoepitopes that can be recognized by the host immune system (Campbell et al., Nature Genetics, 48(6):607-16, 2016; Rizvi et al., Science, 348(6230):124-8, 2015). Therefore, immunotherapy is a promising approach for treating lung cancer. However, the objective response rate in lung cancer patients is much lower than in melanoma. The studies described herein illustrate how a superior response can be achieved against lung cancer by combining PLK1 inhibition with PD-L1 blockade. Furthermore, since the increase in PD-L1 is not specific to PLK1 inhibitors, other cytotoxic agents that induce PD-L1 upregulation can be explored to synergize with current immune checkpoint blockers. In addition, by co-localizing therapeutic effects using our MSNP platform, the required drug dose can be reduced to one-fifth. This suggests that nanoparticles can improve the effects of free drugs and reduce systemic toxicity. This is key to improving outcomes, as current combination therapy strategies with immune checkpoint blockade can increase adverse event rates. Finally, due to the versatility of the MSNP platform, in addition to targeted antibodies (e.g., PD-L1) and PLK1 inhibitors, siRNA can also be loaded to target any gene identified as a regulator of cancer progression or immune evasion.
[0321] Example 2: Adjuvant oligonucleotides for enhancing the function of therapeutic constructs To enhance antitumor immunity, adjuvant oligonucleotides can also be incorporated. For example, the incorporation of CpG onto p-iPLK1-NP (called p-iPLK1-NP-CpG) significantly improved survival in 2 out of 7 mice, and one mouse was completely tumor-free (Figure 13). CpG oligodeoxynucleotides act as a damage-associated molecular pattern (DAMP) to stimulate PRRs, particularly Toll-like receptor 9 (TLR9). This functions as a danger signal for the activation of antigen-presenting cells and subsequent T-cell priming. Thus, by releasing antigens (via cancer killing with mitotic inhibitors), delivering CpG adjuvants, and blocking immune checkpoints, this therapeutic agent addresses the various strategies cancer cells employ to evade the immune response (Patel & Minn, Immunity 48(3):417-433, 2018).
[0322] Example 3: An antibody-drug conjugate (ADC) of alicertib and PD-L1 antibody enhances cell killing compared to the free drug counterpart. An immune checkpoint antibody-mitotic kinase inhibitor (ADC) consists of an immune checkpoint antibody (MKI) and a linker. The antibody acts as a carrier for the drug (MKI). The linker can be tuned to control drug release, obtaining the desired physicochemical properties and pharmacokinetics of the ADC. The drug can be released either outside or inside the target cell. When the drug is released inside the target cell, the antibody also acts as a targeting moiety to enhance intracellular drug uptake. The drug-to-antibody ratio can range from 1 to 20. An ideal ratio (e.g., approximately 2 to 8 or 4 to 6) should yield the best pharmacokinetics and tumor accumulation, as well as the highest antitumor activity.
[0323] Materials and Methods. The synthesis of PD-L1-alicertib involved three steps: (1) alicertib-PEG conjugation, (2) PD-L1 activation, and (3) PD-L1-alicertib conjugation. (1): 0.3 ml of 5 mg / ml alicertib (Selleck Chemicals, USA) in dimethyl sulfoxide (DMSO) (Fisher Scientific, USA), 50 μl of 60 mg / ml (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Thermo Scientific, USA)) in DMSO, and 60 mg / ml N-hydroxysuccinimide (Sigma 27 μl of Aldrich (USA) DMSO solution was mixed with the alicertib-PEG-SH. Then, 57.8 μl of 40 mg / ml H2N-PEG-SH (MW400) (Nanocs, USA) DMSO solution was added. The reaction mixture was purged with N2 for 1 minute and then stirred at room temperature for 12 hours. Distilled water was then added to precipitate the alicertib-PEG-SH. The alicertib-PEG-SH was recovered by centrifugation at 15,000 rpm at 4°C for 10 minutes and washed three times with distilled water. The final clean alicertib-PEG-SH was lyophilized for long-term storage (AdVantage 2.0, SP). (Thermo Fisher, USA). (2) 0.147 ml of 6.76 mg / ml PD-L1 (BioXCell, USA) was mixed with 0.9 ml of phosphate-buffered saline (PBS) (pH 7.2) and 29 μl of 5 mg / ml sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC) (Thermo Fisher, USA) aqueous solution. The reaction mixture was stirred at room temperature for 1 hour. Desalting column (Thermo Pure PD-L1-SMCC was recovered using Fisher (USA). (3): 750 μg of PD-L1-SMCC and 70 μg of alicertib-PEG-SH were dissolved in a mixture of PBS (pH 7.2) (1 ml), DMSO (50 μl), and propylene glycol (50 μl). The reaction mixture was purged with N2 for 1 minute and then stirred at room temperature for 24 hours. The PD-L1-alicertib solution was recovered by desalting column and then lyophilized.The drug-to-antibody ratio was determined by UV absorbance at 280 nm and 318 nm.
[0324] Results: The inventors prepared a PD-L1 antibody-aricertib conjugate using an N-(maleimidomethyl)cyclohexane-1-carboxylate (MCC) linker used in FDA-approved ADC drugs (Kadcyla or T-DM1). Although the MCC linker is not cleavable, aricertib was modified with a short PEG chain via an -HN-CO- bond prior to conjugation to the antibody-MCC (Figure 14A). This amide bond was hydrolyzed by acidic conditions in endosomes and lysosomes, allowing for the intact release of aricertib. A short PEG8 (MW400Da) was used to increase the solubility of aricertib and introduce a thiol group for conjugation with the antibody-MCC. A desalting column was used to remove free aricertib and thiolated aricertib. The drug-to-antibody ratio (DAR) was 6 aricertib molecules / antibody (determined by UV-Vis). ADC exhibited significantly greater cytotoxicity than free alicertib in LLC-JSP cells (Figure 14B), whereas free PD-L1 had no effect on cell viability (Figure 14C).
[0325] Example 4: Application of topical formulations and therapeutic constructs The therapeutic constructs disclosed herein can be formulated into topical formulations. Several vehicles known in the art, such as Aquaphor (ointment type) and Carbopol (gel type), can be mixed with the constructs. Heat or surfactants (e.g., polysorbate 80 (Tween 80) as an emulsifier) can be used to enable better mixing of the vehicle with the aqueous suspension of AIRISE. As an example, 10% by weight of Tween-80 was confirmed not to cause premature leakage of siRNA from nanoparticles. It was also shown that 2.5% by weight of Tween-80 was sufficient to enhance the mixing of siRNA-NPs and Aquaphor when the mixture was heated to 55°C.
[0326] Methods that simultaneously promote penetration can be used, such as ultrasound and microneedle rollers (e.g., Dermaroller® with needle heights ranging from 0.5 mm to 1.5 mm). When tested on porcine skin (Figure 15) and mice (Figure 16), applying microneedles with a short needle height of 0.5 mm can enhance the penetration of topical siRNA nanoparticle formulations.
[0327] Figure 15 shows that the microneedle roller enhances the penetration of the siRNA nanoparticle construct when tested on porcine skin, which is similar in thickness to human skin. Pig skin was incubated with the formulation (Aquaphor solution of Dy677-siSCR-NP) for 1.5 hours (37°C; 5% CO2). After 1.5 hours, skin punches were taken from the treated area and processed for fluorescence imaging using standard techniques. A significant enhancement of skin penetration with the microneedle roller was observed. When the Aquaphor solution of siRNA-NP was administered without the roller, the siRNA signal (arrow) was limited to the outer surface of the pig skin, whereas we observed the siRNA signal (arrow) extending beyond the epidermis to the dermis before the application of the microneedle roller (Figure 15).
[0328] Figure 16 shows that the microneedle roller enhances the local delivery of siRNA-NPs. First, mice were shaved one day before treatment. Dy677-siSCR-NP (0.72 nmol siRNA) was mixed with 100 μL of 2.5% Tween-Aquaphor (per application). Immediately before treatment, a dermal microroller was applied to only one side of the dorsal region in four directions, while the other side was not pretreated. For comparison, the mixture was applied to the shaved area (approximately 2 cm²) with and without microneedle pretreatment. 2 The treatment was applied to the specified application area. After 1.5 hours of processing time, the treated skin samples were collected and processed for imaging.
[0329] Figures 17A and 17B show gene knockdown obtained 3 days after application of microroller + topical siRNA nanoconstruct. Compared to the saline-treated group, a 55% EGFR knockdown (*p<0.05) was observed in the siEGFR-NP group (Figure 17A). By comparison, a single intradermal injection of siEGFR-NP (same siEGFR dose of 0.72 nmol) resulted in a 40% EGFR knockdown compared to the saline-treated group (Figure 17B). Microneedle morphology of the therapeutic construct. As shown in Figure 18, for microneedle fabrication, the use of soluble microneedles based on dextran, amylopectin, PVP, PEG, methylcellulose, chitosan, or other polymers or compounds known in the art was considered, and the use of these soluble microneedles enables painless home treatment and high needle density (100 needles / 1cm²). 2 This is highly effective in delivering AIRISE-02 due to the following. As an example (Figure 18), a dextran solution (300 mg / ml aqueous solution) containing NPs loaded with Dy677 conjugate siRNA was cast onto a microneedle mold. The solution was centrifuged or vacuumed to densely fill the mold. The microneedles were dried by air, desiccator, vacuum oven, refrigerator, or a combination thereof and removed from the mold. The needle height was varied from 300 to 800 microns depending on the mold and optimization. siRNA-NPs were successfully loaded onto these needle arrays (at approximately 0.5 nmol siRNA / array), and the needles dissolved completely within 5 minutes after application to porcine skin. Different dissolution times can be manipulated by changing the composition of the microneedles. Different shapes and forms of microneedle patches can also be manufactured using different molds.
[0330] As will be understood by those skilled in the art, each embodiment disclosed herein includes, is essentially, or may be essentially the specific described element, process, component, or constituent. Accordingly, the terms “include” or “including” should be interpreted as enumerating “comprise,” “consist of,” or “consist essentially of.” The transitional terms “comprise” or “comprises” mean including, but not limited to, an unspecified number of elements, processes, components, or constituents, and enabling their inclusion. The transitional phrase “consisting of” excludes any elements, processes, components, or constituents that are not specified. The transitional phrase “consisting essentially of” limits the scope of the embodiment to the specified elements, processes, components, or constituents, and those that do not substantially affect the embodiment. In this context, significant effect means a measurable reduction in the biological effect of a therapeutic construct (such as an anti-cancer effect).
[0331] Unless otherwise specified, all figures used in this specification and the claims, such as quantities of components, molecular weights and other properties, and reaction conditions, should be understood to be modified in all cases by the term "approximately." Therefore, unless otherwise indicated, the numerical parameters described herein and in the appended claims are approximations that may vary depending on the desired properties to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the claims, each numerical parameter should be interpreted in light of the number of significant figures reported and by applying common rounding techniques. If further clarification is needed, the term “about” has a meaning reasonably given to a person skilled in the art when used in conjunction with a stated number or range, namely, that it is somewhat greater or somewhat less than the stated value or range, and within the range of ±20%, ±19%, ±18%, ±17%, ±16%, ±15%, ±14%, ±13%, ±12%, ±11%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% of the stated value.
[0332] Even though the numerical ranges and parameters representing the broad scope of the present invention are approximations, the numerical values shown in specific embodiments are reported with a feasible degree of accuracy. However, any numerical value inherently includes certain errors that inevitably result from the standard deviation found in each test measurement.
[0333] In the context describing the present invention (particularly in the context of the appended claims), the terms “a,” “an,” “the,” and similar references should be interpreted as encompassing both singular and plural forms unless otherwise specified herein or unless clearly inconsistent with the context. The enumeration of value ranges herein is intended merely as a way of referring individually to each distinct value that falls within that range. Unless otherwise specified herein, each individual value is incorporated herein as if it were described individually. All methods described herein can be performed in any preferred order unless otherwise specified herein or unless clearly inconsistent with the context. The use of any and all examples or exemplary language provided herein (e.g., “etc.”) is intended merely to further illustrate the present invention and does not impose any limitation on the scope of the invention as otherwise claimed. Nothing in this specification should be interpreted as indicating any unclaimed element essential to the practice of the invention.
[0334] The grouping of alternative elements or embodiments of the Invention disclosed herein should not be construed as limiting. Each group component may be referenced and claimed individually or in any combination with other components of the group or other elements found herein. For convenience and / or patentability reasons, it is anticipated that one or more components of a group may be included in or removed from a group. In the event of any such inclusion or removal, this specification shall be deemed to include the modified groups and thus satisfy the described description of all Markush groups used in the appended claims.
[0335] Certain aspects of the Invention are described herein, including the best mode known to the inventors for carrying out the Invention. Needless to say, modifications of these described aspects will be apparent to those skilled in the art by reading the foregoing description. The inventors anticipate that those skilled in the art will appropriately use such modifications, and they intend that the Invention may be carried out in ways other than those specifically described herein. Accordingly, the Invention includes all modifications and equivalents of the subject matter enumerated in the claims appended herein, to the extent permitted by applicable law. Furthermore, any combination of the elements described above in all possible modifications thereof is incorporated herein unless otherwise specified herein or unless it is clearly inconsistent with the context.
[0336] Furthermore, numerous patents, printed publications, scholarly articles, and other documents (materials referenced herein) are referenced throughout this specification. Each of these referenced materials is incorporated into this specification in its entirety by reference with respect to the teachings it references.
[0337] It should be understood that the embodiments of the present invention disclosed herein are illustrative of the principles of the present invention. Other modifications that may be used are within the scope of the invention. For this reason, alternative configurations of the present invention may be used, without limitation, as examples, in accordance with the teachings herein. Accordingly, the present invention is not limited to those shown and described herein.
[0338] The details provided herein are illustrative and are intended only to illustrate preferred embodiments of the invention and are presented to provide what is considered to be the most useful and readily understandable explanation of the principles and conceptual aspects of various embodiments of the invention. In this regard, no attempt has been made to provide structural details of the invention in more detail than is necessary for a basic understanding of the invention, and the description using drawings and / or embodiments will make it clear to those skilled in the art how some embodiments of the invention can actually be embodied.
[0339] The definitions and descriptions used in this disclosure are intended to control any future configurations unless expressly and uniquely altered in the examples, or unless the application of the meaning makes any configuration meaningless or essentially meaningless. Definitions should be interpreted in accordance with Webster's Dictionary, 3rd Edition, or dictionaries known to those skilled in the art, such as the Oxford Dictionary of Biochemistry and Molecular Biology (Ed. Anthony Smith, Oxford University Press, Oxford, 2004), where the construction of the term makes it meaningless or essentially meaningless.
Claims
1. At least one mitotic kinase inhibitor, At least one immune checkpoint inhibitor and Delivery systems including A therapeutic construct, including one.
2. The therapeutic construct according to claim 1, wherein the delivery system comprises liposomes, lipid particles, polymer particles, inorganic nanoparticles or organic nanoparticles, inorganic microparticles or organic microparticles, or hybrids thereof.
3. The therapeutic construct according to claim 2, wherein the delivery vehicle comprises one or more of the following: fullerenes, endohedral metallofullerenes, trimetal nitride-templated endohedral metallofullerenes, single-walled carbon nanotubes and multi-walled carbon nanotubes, calcium phosphate particles, aluminum salt particles, branched carbon nanotubes and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled boron / nitrate nanotubes and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, silicon, silica microspheres and silica nanospheres, polymer microspheres and polymer nanospheres, silica shells, biodegradable PLGA microspheres and biodegradable PLGA nanospheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.
4. A therapeutic construct according to any one of claims 1 to 3, wherein the delivery vehicle comprises mesoporous silica nanoparticles.
5. The therapeutic construct according to claim 4, wherein the mesoporous silica nanoparticles have an average particle size of about 5 to about 200 nm.
6. The therapeutic construct according to claim 4 or 5, wherein mesoporous silica nanoparticles are coated with crosslinked polyethyleneimine and polyethylene glycol.
7. A therapeutic construct according to any one of claims 1 to 6, wherein at least one mitotic kinase inhibitor and / or immune checkpoint inhibitor comprises an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody.
8. A therapeutic construct according to any one of claims 1 to 7, wherein at least one mitotic kinase inhibitor is an inhibitor of polo-like kinase (PLK), aurora kinase, cyclin-dependent kinase (CDK) 1, CDK2, HASPIN, unipolar spindle 1 kinase (Mps1), or NimA-related kinase (NEK).
9. A therapeutic construct according to any one of claims 1 to 8, wherein at least one mitotic kinase inhibitor comprises one or more of the following: GSK461364, BI2536, Tak960, NMS-P937, volasertib, Chk 1 kinase inhibitor LY2603618, AU14022, YK-4-279, AZ703, aricertib, prexasertib, or AZD7762.
10. A therapeutic construct according to any one of claims 1 to 9, wherein at least one mitotic kinase inhibitor comprises volacertib.
11. A therapeutic construct according to any one of claims 1 to 10, wherein at least one immune checkpoint inhibitor comprises an siRNA, inhibitor, or antibody against one or more of PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4.
12. A therapeutic construct according to any one of claims 1 to 11, wherein at least one immune checkpoint inhibitor is an antibody against PD-L1, PD-1, or CTLA-4.
13. A therapeutic construct according to any one of claims 1 to 12, wherein at least one immune checkpoint inhibitor is an antibody against PD-L1.
14. The therapeutic construct according to claim 13, wherein at least one immune checkpoint inhibitor comprises at least one of nivolumab, pembrolizumab, MPDL3280A, ipilimumab, tremelimumab, atezolizumab, avelumab, durvalumab, semiprimab, pidilizumab, or spartalizumab.
15. A therapeutic construct according to any one of the claims, further comprising an adjuvant.
16. The therapeutic construct according to claim 15, wherein the adjuvant comprises one or more of the following: CpG oligonucleotides, DNA TLR agonists containing CpG sequences, non-CpG DNA TLR agonists, RNA TLR agonists, aluminum salts, anti-CD40 antibodies, fusion proteins, cytokines, small molecule TLR agonists, oil-based adjuvants or surfactant-based adjuvants, lipopolysaccharides, plant extracts, or derivatives thereof.
17. A therapeutic construct according to claim 15 or 16, wherein the adjuvant comprises a CpG oligonucleotide, imiquimod, reximod, gardiquimod, polyI:C, polyICLC, dSLIM, or EnanDIM.
18. The therapeutic construct according to claim 16, wherein the adjuvant comprises a CpG oligonucleotide.
19. A therapeutic construct according to any one of claims 1 to 18, having a hydrodynamic size of 5 to 999 nm.
20. A therapeutic structure according to any one of claims 1 to 18, having a hydrodynamic size of 1 to 1000 microns.
21. Immune checkpoint inhibitors, Mitotic kinase inhibitors, and A chemical linker that connects immune checkpoint inhibitors and mitotic kinase inhibitors. A therapeutic construct, including one.
22. The therapeutic construct according to claim 21, wherein the mitotic kinase inhibitor is an oligonucleotide, a polynucleotide, a small molecule inhibitor, or an antibody.
23. The therapeutic construct according to claim 21 or 22, wherein the immune checkpoint inhibitor is an oligonucleotide, polynucleotide, small molecule inhibitor, or antibody.
24. A therapeutic construct according to any one of claims 21 to 23, wherein the immune checkpoint inhibitor is an antibody.
25. A therapeutic construct according to any one of claims 21 to 24, wherein the immune checkpoint inhibitor is an antibody against PD-L1, PD-1, TIM-3, LAG-3, or CTLA-4.
26. A therapeutic construct according to any one of claims 21 to 25, wherein the immune checkpoint inhibitor is an antibody against PD-L1, PD-1, or CTLA-4.
27. A therapeutic construct according to any one of claims 21 to 26, wherein the immune checkpoint inhibitor is an antibody against PD-L1.
28. A therapeutic construct according to any one of claims 21 to 27, wherein the mitotic kinase inhibitor is selected from GSK461364, BI2536, Tak960, NMS-P937, voracertib, Chk 1 kinase inhibitors LY2603618, AU14022, YK-4-279, AZ703, aricertib, prexacertib, or AZD7762.
29. A therapeutic construct according to any one of claims 21 to 28, wherein the mitotic kinase inhibitor is aricertib.
30. The chemical linker is hydrazine; disulfide; N-succinimidyl-4-(2-pyridyldithio)butanoate; N-succinimidyl-4-(2-pyridyldithio)-2-sulfobutanoate; perfluorophenyl-3-(pyridine-2-yldisulfanyl)propanoate; 2,5-dioxopyrrolidine-1-yl-3-methyl-3-(pyridine-2-yldisulfanyl)butanoate; Gly-Phe-Leu-Gly; Ala-Leu-Ala-Leu; Val-Cit; Phe-Lys; Val-Ala; Ala-Phe-Lys; Phe-Lys; n is 1-20 (Gly) n β-glucuronide linker; maleimidocaproyl; N-(maleimidomethyl)cyclohexane-1-carboxylate; 4-(4-acetylphenoxy)butanoic acid; dibromomaleimide; para-aminobenzoic acid; 4-nitrophenol; acetic acid; formic acid; 4-maleimidobutyrate N-succinimidyl ester; N-(4-maleimidobutyryloxy)succinimidide; N-(6-maleimidocaproyloxy)succinimidide; 3-maleimidopropionic acid N-succinimidyl ester; N-(3-maleimidopropionyloxy)succinimidide; 5-maleimidovaleric acid-NHS; 100-10000 A therapeutic construct according to any one of claims 21 to 29, comprising: linear, branched, or multi-armed polyethylene glycol having a molecular weight of Da; propargyl-N-hydroxysuccinimidyl ester; pyrophosphate; succinimidyl-4-azidobutyrate; 4-azidobenzoic acid N-hydroxysuccinimide ester; tert-butyl 1-(4-formylphenyl)-1-oxo-5,8,11-trioxa-2-azatridecane-13-oate; or one or more of these residues.
31. A therapeutic construct according to any one of claims 21 to 30, wherein the chemical linker comprises an N-(maleimidomethyl)cyclohexane-1-carboxylate linker or a residue thereof.
32. A therapeutic construct according to any one of claims 21 to 31, wherein the chemical linker comprises sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate.
33. A therapeutic construct according to any one of claims 21 to 32, wherein the chemical linker comprises a linear polyethylene glycol or a residue thereof having a molecular weight of 100 to 10,000 Da.
34. A therapeutic construct according to any one of claims 21 to 33, wherein the ratio of mitotic kinase inhibitors to immune checkpoint inhibitors is approximately 1 to approximately 20.
35. The therapeutic construct according to claim 34, wherein the ratio of mitotic kinase inhibitors to immune checkpoint inhibitors is approximately 2 to approximately 8.
36. A therapeutic construct according to claim 34 or 35, wherein the ratio of mitotic kinase inhibitors to immune checkpoint inhibitors is approximately 4 to approximately 6.
37. A therapeutic construct according to any one of claims 21 to 33, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 1 to approximately 20.
38. The therapeutic construct according to claim 37, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 2 to approximately 8.
39. A therapeutic construct according to claim 37 or 38, wherein the ratio of immune checkpoint inhibitors to mitotic kinase inhibitors is approximately 4 to approximately 6.
40. A composition comprising a therapeutic construct according to any one of claims 1 to 39 and a pharmaceutically acceptable carrier, excipient, or diluent.
41. A method for treating cancer, comprising the step of administering an effective amount of a therapeutic construct according to any one of claims 1 to 39 or a composition according to claim 40 to a subject having cancer.
42. The method according to claim 41, wherein the subject is a human.
43. A method for treating cells that exhibit symptoms of cancer, The step of bringing the cells into contact with a therapeutically effective amount of the therapeutic construct according to any one of claims 1 to 39 or the composition according to claim 40. The method, including the method described above.
44. A method for treating cells obtained from a subject exhibiting symptoms of cancer, The step of bringing the cells into contact with a therapeutically effective amount of the therapeutic construct according to any one of claims 1 to 39 or the composition according to claim 40. The method, including the method described above.
45. A method for treating cells obtained from a subject exhibiting symptoms of cancer, A step of ex vivo contacting cells with a therapeutically effective amount of the therapeutic construct according to any one of claims 1 to 39 or the composition according to claim 40. The method, including the method described above.
46. The method according to claim 44 or 45, wherein the cells are cancer cells.
47. The method according to claim 44 or 45, wherein the cells are not cancer cells.
48. The method according to claim 47, wherein the cells are immune cells.
49. The method according to any one of claims 41 to 48, further comprising the step of administering at least one treated cell back to the target.
50. A method for treating a subject diagnosed with an overproliferative disease or overproliferative condition, A step of administering an effective amount of the composition according to claim 40 to the subject. The method, including the method described above.
51. The method according to claim 50, wherein the hyperproliferative disorder includes one or more of cancer, precancerous conditions, or cancerous metastases.
52. The method according to claim 50 or 51, wherein the hyperproliferative disease includes one or more of melanoma, lung cancer, breast cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, lymphoma, colon cancer, or liver cancer.
53. The administration process is, Injection into or at the target tumor, Local injection into or at the target tumor, Systemic injection in the subject, Whole-body injection in the subject, Inhalation by the target, Oral administration to the target, or Local application to the target The method according to any one of claims 50 to 52, comprising one or more of the above.
54. The method according to any one of claims 50 to 53, wherein the administration step includes the application of a microneedle.
55. A method for enhancing the effect of anticancer therapy in subjects that require it, An effective amount of the therapeutic construct according to any one of claims 1 to 39 or the composition according to claim 40, At least one anticancer drug and The process of administering it to the target that needs it. The method, including the method described above.
56. The method according to claim 55, wherein the anticancer agent is a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor.
57. The method according to claim 55 or 56, wherein the therapeutic construct or composition and the anticancer therapy are administered sequentially or simultaneously.
58. A method for enhancing, increasing, or improving the effect of radiotherapy in a subject diagnosed with a neoplasm, An effective amount of the therapeutic construct according to any one of claims 1 to 39 or the composition according to claim 40, At least one radiation therapy and The process of administering it to the target that needs it. The method, including the method described above.
59. The method according to claim 58, wherein the therapeutic construct or composition and radiotherapy are administered sequentially or simultaneously.
60. The method according to any one of claims 49 to 59, wherein the subject is a human.
61. A therapeutic structure according to any one of claims 1 to 39, At least one anticancer drug and A kit that includes this.
62. The kit according to claim 61, wherein the anticancer agent is a chemotherapeutic agent, a targeted therapy agent, or an immune checkpoint inhibitor.