Protein particles
Patent Information
- Application Number
- JP2026093594
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-04-22
- Filing Date
- 2026-06-03
- Publication Date
- 2026-09-08
Smart Images

Figure 2026143590000001_ABST
Abstract
Description
Detailed Description of the Invention
[0001] [Statement of Funding] The project leading to this application has received funding from the European Research Council (ERC) under the Horizon 2020 research and innovation programme of the European Union (Grant Agreement Number 670930).
[0002] [Field of the Invention] The present invention relates to proteinaceous particles, cells and compositions comprising proteinaceous particles, methods for producing cells capable of producing engineered proteinaceous particles, methods for isolating proteinaceous particles, proteinaceous particles for use as a medicament, and methods of treatment using proteinaceous particles.
[0003] [Background] Cancer immunotherapies using checkpoint blockade, tumor-infiltrating lymphocytes or CAR-T cells have great efficacy against certain subtypes of cancer; however, immunotherapy has not been successful among others for brain cancer (in particular glioblastoma), esophageal cancer, ovarian cancer and pancreatic cancer. Challenges associated with treating these and other types of cancer include the entry of effector cells into the tumor and the immunosuppressive tumor microenvironment (TME). Glioblastoma is a particularly difficult disease to treat with limited treatment options, as it is a tumor located in an immunoprivileged site that is not adequately accessed by conventional immunotherapy or cells. Accordingly, there exists a need for alternative immunotherapies that can overcome these challenges.
[0004] [Statement of the Invention] Therefore, according to a first aspect of the present invention, there is provided an isolated proteinaceous particle comprising a core of perforin and / or granzyme, wherein the core is surrounded by a glycoprotein shell comprising thrombospondin-1 (TSP-1), or a fragment, variant or ortholog thereof.
[0005] According to another aspect of the present invention, there is provided an engineered proteinaceous particle comprising a perforin and / or granzyme core, wherein the core is surrounded by a glycoprotein shell comprising thrombospondin protein, or a fragment, variant or ortholog thereof, and the granzyme and / or thrombospondin is genetically modified.
[0006] It has been found that activation of various cell types, particularly T lymphocytes or natural killer (NK) cells, results in the release of proteinaceous particles, also referred to herein as supramolecular attack particles (SMAPs), which are distinct from lipid-forming exosomes previously observed from extracellular release of such cells. The proteinaceous particles are capable of binding to local target cells. Once bound, SMAPs typically release from their core at least one granzyme (i.e., granzyme A, B, H, M or K) and one pore-forming protein (perforin 1). The enzyme and pore-forming protein are cytotoxic to their target cells (i.e., the cells to which they bind). This ultimately results in the death of the SMAP-bound cell. Accordingly, the SMAPs of the present invention can be used to treat or cure various diseases or conditions by killing appropriate cells associated with the condition. For example, SMAPs may be used to treat cancer by killing malignant tumor cells (e.g., glioblastoma), or may be used to treat bacterial or viral infections by killing infected cells, or directly kill bacteria and thus may be used to treat bacterial infection by killing bacteria. The SMAPs of the present invention are also advantageous because, unlike conventional biological therapies and cell therapies, they are less susceptible to the adverse extracellular environment (e.g., the immunosuppressive microenvironment of a tumor) and are therefore very stable.
[0007] The particles may remain stable outside the cell for, for example, at least 1, 2, 5, 12, 24, or 48 hours, or for more than one day (i.e., they may not decompose / disintegrate). The particles may remain stable outside the cell for 1 to 5 hours, or longer. The particles may remain stable outside the cell for at least 72 hours. The particles may remain stable outside the cell for 1 to 5 days, or longer.
[0008] A protein particle according to a second aspect of the present invention may be engineered to form a fusion polypeptide with any spherical polypeptide. A protein particle according to a second aspect of the present invention may be engineered to form a fusion polypeptide with a ligand (e.g., a targeted peptide) that specifically recognizes a protein (e.g., a receptor) expressed on a target cell of interest. The ligand can then be made specific to cells of a disease or condition, reducing / preventing any off-target effects that may be associated with the use of natural (i.e., unengineered) protein particles. In one embodiment, the fusion polypeptide comprises thrombospongin fused to a heterologous polypeptide.
[0009] The protein particles may have a diameter of less than 500 nm, for example, about 1 nm to 500 nm. Therefore, the particles may be spherical in shape. For example, the protein particles may have a diameter of less than about 500 nm, less than about 400 nm, less than about 300 nm, less than about 200 nm, less than about 150 nm, or less than about 100 nm. The protein particles may have a diameter of about 80 to about 500 nm, or about 90 nm to about 400 nm, or about 100 nm to about 300 nm, or about 50 nm to about 200 nm, or about 50 nm to about 180 nm, or about 70 nm to about 180 nm, or about 70 nm to about 170 nm, or about 70 nm to about 150 nm, or about 70 nm to about 140 nm, or about 90 nm to about 150 nm, or about 90 nm to about 140 nm, or about 100 nm to about 130 nm, or about 110 nm to about 130 nm. In one embodiment, the diameter of the protein particles may be about 120 nm. The protein particles do not have to have a diameter greater than about 200 nm. Preferably, the protein particles do not have a diameter greater than about 150 nm. In a more preferred embodiment, the protein particles are about 50 nm to about 150 nm. In embodiments in which multiple protein particles are present, for example, in a composition or population, the size of the protein particles discussed herein refers to the average size of the population / composition of protein particles.
[0010] The protein particles of the present invention may be isolated protein particles. The term "isolated" may refer to protein particles separated from cells (such as NK cells and T cells), as well as from cellular structures including exosomes and phospholipid cell membranes. The protein particles may be extracellular particles. In one embodiment, the protein particles are collected from extracellular plasma. The protein particles may not be intracellular particles and / or may not be collected from intracellular plasma.
[0011] The protein particles of the present invention may be manipulated protein particles. The protein particles of the present invention may be manipulated and isolated protein particles. The protein particles may be functional with a purity ranging from about 10% to about 100%. Therefore, the protein particles or compositions according to the present invention may be about 10% to about 100% pure, about 20% to about 100% pure, about 30% to about 100% pure, about 40% to about 100% pure, about 50% to about 100% pure, about 60% to about 100% pure, about 70% to about 100% pure, about 80% to about 1 It may be 00% pure, or about 90% to about 100% pure. In one embodiment, the protein particles are isolated with a purity of at least about 90%. Preferably, the protein particles or the composition of protein particles are substantially pure. However, in some embodiments, a fraction of small amounts of impurities, such as exosomes, may be present in the composition of protein particles. Less than 30% exosomes may be present. Preferably, less than 20%, or more preferably less than 10%, exosomes are present. The isolated protein particles may not contain cells.
[0012] The core of the protein particles may contain granzyme enzymes. Granzymes refer to a family of cytotoxic serine proteases that can cleave extracellular and intracellular proteins. Granzymes are found in the secretory lysosomes of lymphocytes, particularly cytotoxic T cells and natural killer (NK) cells. They are released by exocytosis, but generally must enter the cytoplasm of target cells to cleave intracellular proteins and induce cell death.
[0013] In humans, there are five members of the granzyme family, which are called granzymes A, B, H, M, and K. Human granzymes A, B, H, M, and K can induce cell death.
[0014] Granzyme A induces target cell death in a mitochondrial-dependent manner. The polypeptide sequence of the precursor of Granzyme A is 262 amino acids long and is provided herein as Sequence ID No. 1. [Table 1]
[0015] The bolded amino acids in Sequence ID No. 1 correspond to the signal peptide. The underlined amino acids in Sequence ID No. 1 correspond to the amino acids of the propeptide of Granzyme A. Amino acids 29-262 correspond to the polypeptide chain of Granzyme A.
[0016] Of all the granzymes, granzyme B is the most distinctive. It induces programmed cell death (apoptosis) in target cells. Apoptosis is achieved by activating mitochondrial / caspase-dependent and caspase-independent pathways. Granzyme B also induces annoikis (death due to lack of extracellular contact) in target cells. The polypeptide sequence of the precursor of granzyme B is 247 amino acids long and is provided herein as Sequence ID No. 2. [Table 2]
[0017] The bolded amino acids in Sequence ID No. 2 correspond to the signal peptide. The underlined amino acids in Sequence ID No. 2 correspond to the amino acids of the propeptide of Granzyme B. Amino acids 21-247 correspond to the polypeptide chain of Granzyme B.
[0018] Granzyme H mediates caspase-independent killing of target cells. The polypeptide sequence of the precursor of Granzyme H is 246 amino acids long and is provided herein as Sequence ID No. 3. [Table 3]
[0019] The bolded amino acids in Sequence ID No. 3 correspond to the signal peptide. The underlined amino acids in Sequence ID No. 3 correspond to the amino acids of the propeptide of Granzyme H. Amino acids 21-246 correspond to the polypeptide chain of Granzyme H.
[0020] Granzyme M induced cell death in a caspase- and mitochondrial-independent manner. The polypeptide sequence of the precursor of Granzyme M is 257 amino acids long and is provided herein as Sequence ID No. 4. [Table 4]
[0021] The bolded amino acids in Sequence ID No. 4 correspond to the signal peptide. The underlined amino acids in Sequence ID No. 4 correspond to the amino acids of the propeptide of Granzyme M. Amino acids 26-257 correspond to the polypeptide chain of Granzyme M.
[0022] Granzyme K has been shown to be necessary for NK cell-mediated killing of T lymphocytes. The polypeptide sequence of the granzyme K precursor is 264 amino acids long and is provided herein as Sequence ID No. 5. [Table 5]
[0023] The bolded amino acids in Sequence ID No. 5 correspond to the signal peptide. The underlined amino acids in Sequence ID No. 5 correspond to the amino acids of the propeptide of Granzyme K. Amino acids 27-264 correspond to the polypeptide chain of Granzyme K.
[0024] Therefore, the granzyme of the protein particles may contain granzyme A, B, H, M and / or K, or its variants, fragments or orthologues. Furthermore, the granzyme of the protein particles may also contain polypeptide sequences substantially represented in the polypeptide chains of SEQ ID NOs: 1, 2, 3, 4 and / or 5, or their variants, fragments or orthologues. The granzyme of the protein particles may also contain mature (i.e., non-precursor) polypeptide sequences substantially represented in the polypeptide chains of SEQ ID NOs: 1, 2, 3, 4 and / or 5, or their variants, fragments or orthologues. Preferably, the granzyme of the protein particles contains the polypeptide chain of granzyme B. Preferably, the granzyme of the protein particles contains the polypeptide sequence substantially represented in the polypeptide chain of SEQ ID NOs: 2.
[0025] Granzymes can induce cell death by cleaving intracellular proteins, but they may require the assistance of other enzymes to gain intracellular access. Perforin is one such enzyme. Perforin facilitates the entry of granzymes into the cytoplasm of target cells. Perforin oligomerizes to form pores / channels in the cell membrane of target cells. These channels allow for the free, non-selective, passive transport of ions, water, small molecules, and proteins (such as granzymes) into the target cell, which results in the disruption of the cell membrane and the protective effects it provides. Perforin can also trigger a response in target cells by inducing endocytosis of granzymes in target cells, followed by the rupture of granzyme-containing endosomes within the cell, releasing the granzymes into the cytoplasm where they can induce target cell death.
[0026] In one embodiment, the amino acid sequence of a human perforin monomer is provided herein as Sequence ID No. 6, as follows. [Table 6]
[0027] The protein particles perforin may also be variants thereof, fragments thereof, or orthologues thereof, which can form pores / channels in the cell membrane of target cells. Furthermore, perforin may also contain the polypeptide sequence substantially shown in SEQ ID NO: 6, or variants thereof, fragments thereof, or orthologues thereof.
[0028] The core refers to the inside of the proteinaceous particle, which is surrounded by a glycoprotein shell. In one embodiment, the core contains or consists of perforin and granzyme. The core contains perforin and / or granzyme (e.g., granzyme B), but may further contain other proteins (e.g., IFN gamma, CCL5, XCL2, selglycine (SRGN)).
[0029] Proteoglycans, such as cerglycine (a short polypeptide to which a long negatively charged glycosaminoglycan chain is attached), improve the stability and retention of granzymes and perforins within cytotoxic T cells and NK cells. Cerglycine may or may not be required by the protein particles to kill target cells. Therefore, the core may further contain cerglycine complexed with granzymes and / or perforins. Granzymes and / or perforins may form complexes with other negatively charged proteins (other than cerglycine). In addition, cerglycine may stabilize the complexes formed by granzymes and / or perforins with other enzymes within the core of the protein particles.
[0030] The shell of a protein particle has several functions. For example, a glycoprotein shell selectively protects the core contents from the extracellular environment. Therefore, the shell can stabilize and retain the core if the protein particle is released extracellularly. The shell may also act as a vector for the core. The shell may retain the concentrated core until the protein particle reaches the target cell, preventing the release of the core contents. The shell provides a surface for the presence of several proteins (e.g., TSP-1). The glycoprotein shell may have a higher density of organic material than the core. The shell may be a high-density shell of heterogeneous carbon (unlike exosomes, which have a homogeneous lipid and transmembrane glycoprotein-based boundary membrane).
[0031] Protein particles do not necessarily have an outer cell membrane or phospholipid / cholesterol membrane. The glycoprotein shell of the protein particle does not necessarily have to be a cell membrane or a phospholipid / cholesterol membrane. Therefore, the glycoprotein shell is a transmembrane glycoprotein. The glycoprotein shell may not contain proteins (such as CD45, CD81, T cell antigen receptors, and major histocompatibility complex proteins), or secreted transmembrane glycoproteins or "degranulation markers" (e.g., CD57 or CD107a). In one embodiment, the glycoprotein shell may not contain CD47, ICAM-1, and / or their extracellular fragments. The shell may further contain one or more other proteins, such as galectin-1, galectin-7, or thrombospondin-4 (TSP-4).
[0032] The shell may be porous. The pores may have a diameter of up to approximately 13 nm (based on the hydrodynamic diameter of IgG). The pores may be dynamic and selective. The pores in the shell allow IgG antibodies to bind to perforin and granzymes within the core without the use of surfactants, pore-forming agents such as saponins, or proteases.
[0033] TSP-1 is an adhesion protein that mediates cell-cell and cell-ECM (extracellular matrix) interactions by binding, in some cases, to ICAM-1, CD47, and / or integrins. Therefore, TSP-1 mediates the binding of proteinaceous particles to target cells or extracellular matrix proteins. TSP-1 belongs to a family of glycoproteins called thrombospondins. Members of the thrombospondin family include TSP-1, thrombospondin-2 (TSP-2), thrombospondin-3 (TSP-3), TSP-4, and thrombospondin-5 (TSP-5). The signature domain of thrombospondin is located at the C-terminus and contains Ca 2+ It contains a binding "wire" domain (also known as Type-3 repeats) and a lectin-like "globe" domain.
[0034] Thrombospongin has several functions within the protein particles of the present invention. For example, TSP-1 contributes to the induction of target cell death, is required for the release of granzymes and / or perforins in the protein particles, and stabilizes the protein particles once they are released extracellularly.
[0035] In humans, TSP-1 is encoded by the gene THBS1. The genomic DNA sequence (introns and exons) encoding one embodiment of thrombospondin-1 is referred to herein as Sequence ID 7 and can be found under gene ID: 7057 (https: / / www.ncbi.nlm.nih.gov / gene?Db=gene&Cmd=DetailsSearch&Term=7057).
[0036] A cDNA sequence (exons only) encoding one embodiment of THBS1 is provided herein as Sequence ID No. 8, as follows: [Table 7] TIFF2026143590000009.tif169170
[0037] The polypeptide sequence of thrombospondin-1 is provided herein as Sequence ID No. 9, as follows. [Table 8]
[0038] Therefore, the coding sequence encoding the TSP-1 polypeptide may include the nucleic acid sequence substantially shown in either SEQ ID NO: 7 or SEQ ID NO: 8, or a variant thereof, a fragment thereof, or an ortholog thereof. The TSP-1 protein particle may include the polypeptide sequence substantially shown in SEQ ID NO: 9, or a variant thereof, a fragment thereof, or an ortholog thereof. The variant or fragment of thrombospongin (e.g., TSP-1 and / or TSP-4) may be an amino acid sequence that cannot bind to CD47.
[0039] Variants of TSP-1 that cannot bind to CD47 may be mutated in the selection of eight amino acids involved in the ability of TSP-1 to bind to CD47. The eight amino acids involved in the ability of TSP-1 to bind to CD47 are shown in bold in SEQ ID NO: 9 (i.e., RFYVVMWK (SEQ ID NO: 35), which is the sequence corresponding to the 4N-1 peptide). Mutations in the amino acid RFYVVMWK (SEQ ID NO: 35) still allow TSP-1 to fold correctly and be incorporated into the proteinaceous particles of the present invention. Thus, variants of TSP-1 may be, contain, or consist of a variant of 4N-1.
[0040] TSP-1 is Ca 2+ Bonding repeat (Ca 2+ -Includes binding repeats), which include amino acids 691-954 of SEQ ID NO: 9 (Ca of TSP-1) 2+(See the underlined amino acids in SEQ ID NO: 9, which correspond to the binding repeat). Therefore, the TSP-1 fragment may contain amino acids 691-1170 of SEQ ID NO: 9. The TSP-1 fragment may contain the N-terminal or C-terminal region of TSP-1. Preferably, the N-terminal or C-terminal region of TSP-1 contains the Ca of TSP-1. 2+ Cooperative repeats The N-terminal region of TSP-1 may contain amino acids 19-270, 19-373, 19-547, or 19-690 of SEQ ID NO: 9. The C-terminal region of TSP-1 may contain amino acids 547-1170, 646-1170, 691-1170, or 727-1170 of SEQ ID NO: 9. Protein particles of TSP-1 may contain, or consist of, one of the TSP-1 amino acid sequences from SEQ ID NOs. 25 and 27-30.
[0041] The shell of the protein particles according to the present invention may further contain other members of the thrombospongin family, such as TSP-2, TSP-3, TSP-4, and / or TSP-5. Preferably, the shell of the protein particles according to the present invention further contains TSP-4.
[0042] In humans, thrombospondin-4 is encoded by the gene THBS4. Thus, the genomic DNA sequence (introns and exons) encoding one embodiment of thrombospondin-4 is referred to herein as Sequence ID 10 and can be found under gene ID: 7060 (https: / / www.ncbi.nlm.nih.gov / gene?Db=gene&Cmd=DetailsSearch&Term=7060).
[0043] A cDNA sequence (exons only) encoding one embodiment of THBS4 is provided herein as Sequence ID No. 11, as follows: [Table 9]
[0044] The polypeptide sequence of thrombospongin-4 is provided herein as Sequence ID No. 12, as follows. [Table 10]
[0045] Therefore, the coding sequence encoding the TSP-4 polypeptide may include the nucleic acid sequence substantially shown in either SEQ ID NO: 10 or SEQ ID NO: 11, or a variant thereof, a fragment thereof, or an ortholog thereof. Therefore, TSP-4 may include the polypeptide sequence substantially shown in SEQ ID NO: 12, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0046] TSP-4 is Ca 2+ It contains a binding repeat, which includes amino acids 463-727 of SEQ ID NO: 12 (Ca of TSP-4). 2+ (See the underlined amino acids in SEQ ID NO: 12, which correspond to the binding repeat). Therefore, the TSP-4 fragment may contain amino acids 463-727 of SEQ ID NO: 12. The TSP-4 fragment may contain the N-terminal or C-terminal region of TSP-4. Preferably, the TSP-4 fragment contains the N-terminal or C-terminal region of TSP-4. Preferably, the N-region fragment or C-terminal region of TSP-4 contains Ca 2+ It contains binding repeats. The N-terminal region of TSP-4 may contain amino acids 27-192, 27-325, 27-363, 27-419, or 27-462 of SEQ ID NO: 12. The C-terminal region of TSP-4 contains amino acids 420-945, 463-945, or 496-945 of SEQ ID NO: 12.
[0047] Therefore, the shell of the protein particle of the present invention may further comprise TSP-2, TSP-3, TSP-4 and / or TSP-5. Preferably, the shell of the protein particle according to the present invention further comprises the amino acid sequence substantially shown in SEQ ID NO: 12, or a variant thereof, a fragment thereof, or an orthologue thereof.
[0048] The shell of the proteinaceous particle of the present invention may further contain galectins. Galectins are a family of beta-galactosidase-binding proteins that mediate cell-cell interactions and cell-ECM (extracellular matrix) interactions. The family has several members, two of which are galectin-1 and galectin-7.
[0049] Human galectin-1 is encoded by the gene LGALS1. Therefore, in one embodiment, the genomic DNA sequence (introns and exons) encoding one embodiment of galectin-1 is referred to herein as Sequence ID No. 13, as follows: [Table 11] TIFF2026143590000014.tif59170
[0050] A cDNA sequence (exons only) encoding one embodiment of galectin-1 is provided herein as Sequence ID No. 14, as follows: [Table 12]
[0051] The polypeptide sequence of immature galectin-1 is provided herein as Sequence ID No. 15, as follows. [Table 13]
[0052] Amino acids 2-135 of SEQ ID NO: 15 correspond to the mature polypeptide chain of galectin-1. Galectin-1 contains two discontinuous sequences that constitute an active β-galactoside-binding motif, which includes amino acids 45-49 and 69-72 of SEQ ID NO: 15 (the underlined amino acids in SEQ ID NO: 15 correspond to the active β-galactoside-binding motif). Therefore, a fragment of galectin-1 may contain amino acids 45-49 and / or 69-72 of SEQ ID NO: 15. A fragment of galectin-1 may contain the N-terminal or C-terminal region of galectin-1. Preferably, the N-terminal or C-terminal region contains the active β-galactoside-binding motif.
[0053] Therefore, the coding sequence encoding the galectin-1 polypeptide may contain a nucleic acid sequence substantially represented in either SEQ ID NO: 13 or SEQ ID NO: 14, or a variant thereof, a fragment thereof, or an ortholog thereof. The galectin-1 of the protein particles may contain a polypeptide sequence substantially represented in the mature polypeptide chain of SEQ ID NO: 15, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0054] Human galectin-7 is encoded by the gene LGALS7. A cDNA sequence (exons only) encoding one embodiment of galectin-7 is provided herein as Sequence ID No. 16, as follows. [Table 14]
[0055] The polypeptide sequence of immature galectin-7 is 136 amino acids long and is provided herein as Sequence ID No. 17, as follows. [Table 15]
[0056] Amino acids 6-136 of SEQ ID NO: 17 correspond to the mature polypeptide chain of galectin-7. Galectin-7 contains an active β-galactoside-binding motif, which includes amino acids 70-76 of SEQ ID NO: 17 (the underlined amino acids in SEQ ID NO: 17 correspond to the active β-galactoside-binding motif). Therefore, a fragment of galectin-7 may contain amino acids 70-76 of SEQ ID NO: 17. A fragment of galectin-7 may contain the N-terminal or C-terminal region of galectin-1. Preferably, the N-terminal or C-terminal region contains an active β-galactoside-binding motif.
[0057] Therefore, the coding sequence encoding the galectin-7 polypeptide may contain a nucleic acid sequence substantially represented in any of Sequence ID No. 16, or a variant thereof, a fragment thereof, or an ortholog thereof. The galectin-7 of the protein particles may contain a polypeptide sequence substantially represented in the mature polypeptide chain of Sequence ID No. 17, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0058] The core of the protein particle further contains a protein selected from the group including IFN gamma, CCL5 and XCL2, or their fragments, variants, or orthologues. That's good too.
[0059] The inventors have found that protein particles of CD8+ T cells come into contact with membrane vesicles / phospholipid particles containing FasL. Therefore, the glycoprotein shell of the protein particle may come into contact with the vesicles / phospholipid particles containing FasL to form hybrid particles. The protein particles of the present invention may be attached to membrane vesicles / phospholipid particles containing FasL (via TSP-1 on the protein particle and CD47 or ICAM-1 on the membrane vesicles / phospholipid particles). The hybrid particles may kill target cells using granzymes and / or perforins, as well as FasL-based mechanisms.
[0060] FasL is a transmembrane protein that is part of the TNF superfamily. It is a ligand for the receptor Fas, which can be found on target cells. Activation of Fas leads to apoptosis in target cells. Therefore, binding of hybrid particles to target cells via FasL can induce cell death (i.e., apoptosis) through an additional mechanism.
[0061] In one embodiment, the polypeptide sequence of FasL is provided herein as Sequence ID No. 18, as follows. [Table 16]
[0062] Therefore, the hybrid FasL may contain substantially the polypeptide sequence shown in SEQ ID NO: 18, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0063] The shell of the proteinaceous particle of the present invention may further contain one or more other proteins, such as IFN gamma, CCL5, XCL2, and toxins.
[0064] IFN-gamma (type II interferon) is an immunomodulatory cytokine. It stimulates cells to produce an antiviral or antitumor response by binding to a heterodimeric receptor consisting of interferon-gamma receptor 1 (IFNGR1) and interferon-gamma receptor 2 (IFNGR2). The polypeptide sequence of IFN-gamma is provided herein as Sequence ID No. 19, as follows. [Table 17]
[0065] Therefore, the IFN gamma of the protein particles may contain substantially the polypeptide sequence shown in SEQ ID NO: 19, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0066] CCL5(RANTES) is a chemokine that modulates inflammation by attracting leukocytes (e.g., one or more T cells, eosinophils, and basophils). The polypeptide sequence of CCL5 is provided herein as Sequence ID No. 20, as follows. [Table 18]
[0067] Therefore, the protein particle CCL5 may contain substantially the polypeptide sequence shown in Sequence ID No. 20, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0068] XCL2 is a chemokine. It is expressed by T cells and can attract cells that express the XCL2 receptor (i.e., the chemokine receptor XCR1). The polypeptide sequence of XCL2 is provided herein as Sequence ID No. 21, as follows. [Table 19]
[0069] Therefore, the protein particle XCL2 may contain substantially the polypeptide sequence shown in Sequence ID No. 21, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0070] The shell and / or core of the protein particles may further contain a toxin, such as chlorotoxin. This toxin may assist in the killing of target cells of the protein particles. The polypeptide sequence of one embodiment of chlorotoxin is provided herein as SEQ ID NO: 22, as follows. [Table 20]
[0071] The chlorotoxin of the proteinaceous particle may contain substantially the polypeptide sequence shown in SEQ ID NO: 22, or a variant thereof, a fragment thereof, or an ortholog thereof. Preferably, the chlorotoxin is the shell protein (e.g., TSP-1 or It is bound to the fragment, TSP-4 or a fragment thereof, galectin-1 or a fragment thereof, or galectin-7 or a fragment thereof). Therefore, chlorotoxin may be bound to the shell protein via a linker (e.g., GGGS (SEQ ID NO: 36)). Accordingly, in a further embodiment, the polypeptide sequence of chlorotoxin is provided herein as SEQ ID NO: 23 or SEQ ID NO: 24, as follows. [Table 21]
[0072] Therefore, the shell of the proteinaceous particle may further contain proteins selected from the group including IFN-gamma, CCL5, von Willebrand's Factor, XCL2, FasL (via vesicles / phospholipid particles), toxins (e.g., chlorotoxin), or fragments thereof or their orthologues.
[0073] Protein particles may be manipulated by incorporating genetically modified proteins into the particles. Genetically modified proteins may be genetically modified shell proteins (e.g., fusion proteins based on glycoprotein shell proteins, or fragments, variants, or orthologs of shell proteins, e.g., thrombospongin or galectin), genetically modified core proteins (e.g., granzyme fusion proteins, or fragments, variants, or orthologs of granzyme), heterologous proteins, e.g., transgenic proteins (e.g., transgenic ligands), and / or antibodies or fragments thereof. Therefore, shell proteins, e.g., thrombospongin (e.g., TSP-1 and / or TSP-4), galectins (e.g., galectin-1 and / or galectin-7), and / or proteins in the core of the protein particle (e.g., granzyme) may be fusion proteins. The fusion protein may be a granzyme B fusion protein. Protein particles may contain one or more, two or more, three or more, or four or more fusion proteins. Preferably, the shell protein is a fusion protein. Most preferably, thrombospongin (e.g., TSP-1 and / or TSP-4) is a fusion protein.
[0074] The fusion protein may be formed from the full-length protein / polypeptide or a fragment of the protein particle, and another polypeptide, e.g., a ligand of the target cell. For example, the protein particle may be modified so that galectin-1, galectin-7, granzyme B, TSP-1 and / or TSP-4 form a fusion protein with another polypeptide, e.g., a ligand of the target cell. A fusion protein containing TSP-1 may contain the full-length TSP-1 protein (e.g., SEQ ID NO: 9) or a fragment of it (e.g., amino acids 691-1170 of SEQ ID NO: 9, or amino acids 19-690 of SEQ ID NO: 9), and another polypeptide, e.g., a ligand. In another embodiment, a fusion protein containing TSP-4 may contain the full-length TSP-4 protein (e.g., SEQ ID NO: 12) or a fragment of it (e.g., amino acids 463-945 of SEQ ID NO: 12, or amino acids 27-462 of SEQ ID NO: 12), and another polypeptide, e.g., a ligand. In another embodiment, a fusion protein containing galectin-1 may contain the full-length galectin-1 protein (sequence The fusion protein may comprise (e.g., number 15) or a fragment thereof (e.g., amino acids 4-135 of SEQ ID NO: 15, or amino acids 2-135 of SEQ ID NO: 15), and another polypeptide, e.g., a ligand. In another embodiment, the fusion protein comprising galectin-7 may comprise the full-length galectin-7 protein (e.g., SEQ ID NO: 17) or a fragment thereof (e.g., amino acids 6-136 of SEQ ID NO: 17, or amino acids 1-136 of SEQ ID NO: 17), and another polypeptide, e.g., a ligand. The polypeptide / protein of the protein particle may be N-terminus relative to the other polypeptide fusion partner, e.g., a ligand. A linker sequence, e.g., a linker sequence of 1-10 residues, may also be provided between the fused polypeptides. The linker may be about 5 residues long. Preferably, the linker comprises or consists of a GGGGS (SEQ ID NO: 37) linker, which is not processed.
[0075] In one embodiment, thrombospongin, for example TSP-1, is manipulated to form a fusion protein with another polypeptide. In one embodiment, the genetically modified TSP-1 may include the sequence of the TSP-1 / GFP fusion described herein (SEQ ID NO: 25), where the GFP fusion is replaced with an alternative polypeptide molecule, such as a ligand or receptor for a target cell.
[0076] Therefore, the protein particle may be an engineered protein particle comprising a perforin and / or granzyme core, wherein the core is surrounded by a glycoprotein shell comprising a thrombospondin-1 (TSP-1) fusion protein and optionally galectin-1 or galectin-7, or a fragment thereof, a variant thereof, or an ortholog thereof.
[0077] The TSP-1 fusion protein may also be a TSP-1 / GFP fusion protein. The polypeptide sequence of the TSP-1 / GFP fusion protein is provided herein as Sequence ID No. 25, as follows. [Table 22]
[0078] The amino acid sequence MGLAWGLGVLFLMHVCGT (Sequence ID 38) in Sequence ID 25 corresponds to the signal peptide. The underlined amino acids in Sequence ID 25 correspond to the TSP-1 amino acids. The italicized amino acids in Sequence ID 25 correspond to the linker. The bolded amino acids in Sequence ID 25 correspond to the GFP amino acids.
[0079] Therefore, the TSP-1 fusion protein may contain substantially the polypeptide sequence shown in SEQ ID NO: 25, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0080] Furthermore, those skilled in the art will understand that the GFP sequence in SEQ ID NO: 25 can be replaced with the amino acid sequence of a globular protein or peptide tag. Additionally, one or more of the shell proteins galectin-1, galectin-7, and TSP-4 may form a fusion protein with GFP. The amino acid sequence of GFP is shown in bold in SEQ ID NO: 25.
[0081] The proteinaceous particle is an engineered proteinaceous particle comprising a core of perforin and / or granzyme, wherein the core comprises thrombospondin-1, or a fragment thereof, a variant thereof or its ortholog, and a galectin fusion protein (e.g., ga The manipulated protein particles may be surrounded by a glycoprotein shell containing a lectin-1 or galectin-7 fusion protein. Galectin-1 and galectin-7 are synthesized in the cytoplasm, and the N-terminal methionine and the N-terminal 5 amino acids are removed post-synthesis and before transport, respectively. Thus, sequence addition is preferentially performed on the fixed C-terminus by a linker. Preferably, the linker contains or consists of a GGGGS (SEQ ID NO: 37) linker, which is not processed.
[0082] In one embodiment, the protein particle is an engineered protein particle comprising a core of perforin and / or granzyme, the core being · TSP-1, or a fragment thereof, a variant thereof or an ortholog thereof, wherein TSP-1 is a fusion polypeptide with a ligand; and optionally Galectin, or fragments thereof, its variants, or its orthologues These may be manipulated proteinaceous particles surrounded by a glycoprotein shell containing [a specific component].
[0083] In another embodiment, the proteinaceous particle is an engineered proteinaceous particle comprising a core of perforin and / or granzyme, wherein the core is TSP-1, or a fragment thereof, a variant thereof, or an ortholog thereof; • TSP-4 fusion protein; and optionally Galectin, or fragments thereof, its variants, or its orthologues These may be manipulated proteinaceous particles surrounded by a glycoprotein shell containing [a specific component].
[0084] The TSP-4 fusion protein may also be a fusion protein with a ligand.
[0085] In one embodiment, the protein particle is an engineered protein particle comprising a granzyme core, wherein the granzyme is a fusion protein with a ligand, and the core is • TSP-1, or a fragment thereof, a variant thereof, or an ortholog thereof; and optionally Galectin, or fragments thereof, its variants, or its orthologues These may be manipulated proteinaceous particles surrounded by a glycoprotein shell containing [a specific component].
[0086] The manipulated protein particles according to the present invention may further contain genetically modified galectins. Therefore, the manipulated protein particles according to the present invention may further contain galectin fusion proteins, for example, galectin-1 fusion proteins or galectin-7 fusion proteins. The galectin fusion protein (e.g., galectin-1 fusion protein or galectin-7 fusion protein) may be a galectin fusion protein with a ligand.
[0087] The manipulated proteinaceous particles according to the present invention may further or alternatively contain granzyme fusion proteins, such as granzyme A, B, H, M and / or K fusion proteins. In one embodiment, the polypeptide sequence of a granzyme B fusion protein with mCherry and SEpHluorin is provided herein as SEQ ID NO: 26, as follows. [Table 23]
[0088] The italicized amino acids in Sequence ID No. 26 correspond to the linker (i.e., GGGGS (Sequence ID No. 37)). The bolded amino acids in Sequence ID No. 26 correspond to the amino acids of mCherry. The underlined amino acids in Sequence ID No. 26 correspond to the amino acids of SEpHluorin.
[0089] The granzyme fusion protein may include a fusion with a marker protein, such as a fluorescent marker protein. An example of a granzyme fusion protein with a marker protein is provided in SEQ ID NO: 26 and may be used in the present invention. In this example, the fusion is with mCherry and SEpHluorin (a GFP-like protein). In one embodiment, the mCherry and / or SEpHluorin sequences may be replaced with alternative polypeptide sequences.
[0090] Those skilled in the art will understand that granzymes are part of the particle's core, and polypeptides, such as ligands (e.g., target ligands), that bind to granzymes to form fusion proteins are only accessible to receptors on target cells through pores in the proteinaceous particle's shell.
[0091] In an alternative embodiment, the shell of the protein particle according to the present invention comprises a ligand (i.e., a non-fusion protein polypeptide). Therefore, the shell of the protein particle according to the present invention may further comprise a ligand for the target cell.
[0092] A ligand refers to a drug or moiety that (specifically) binds to a protein (e.g., a receptor or ion channel) or marker on a target cell. Preferably, the ligand binds specifically to the protein or marker. The ligand may be a polypeptide. Preferably, the ligand is heterogeneous, e.g., transgenic (e.g., heterogeneous / transgenic polypeptide). The ligand may be an antibody or a fragment thereof that specifically binds to a protein expressed on the target cell (e.g., scFv, VL, VH, Fd;Fv, Fab, Fab', F(ab')2, Fc fragment, or bispecific antibody). Preferably, the antibody is scFv. In another embodiment, the ligand is an antibody mimete It may include "ick".
[0093] Therefore, another embodiment of the TSP-1 fusion protein may be a TSP-1 / T1-scFv fusion protein. T1-scFv is a single-chain antibody that binds to peptides 157-165 of the neoantigen HLA-A2 NYESO-1. The NYESO-1 protein can be expressed in glioblastoma cells, and therefore, the addition of T1-scFv or its variants with modified affinity improves the targeting of protein particles to glioblastoma and other tumors expressing the NYESO-1 protein.
[0094] Another embodiment of the TSP-1 fusion protein may include a polypeptide sequence of a TSP-1 / T1-scFv fusion protein. This polypeptide sequence is provided herein as Sequence ID No. 27, as follows. [Table 24]
[0095] The underlined amino acids in SEQ ID NO: 27 correspond to TSP-1 amino acids. The italicized amino acids in SEQ ID NO: 27 correspond to linkers. The bolded amino acids in SEQ ID NO: 27 correspond to T1-scFV amino acids.
[0096] Therefore, the protein particles may contain substantially the polypeptide sequence shown in SEQ ID NO: 27, or a variant or fragment thereof.
[0097] Another embodiment of the TSP-1 fusion protein may be a T1-scFv / TSP-1 fusion protein. This fusion protein may contain the polypeptide sequence provided herein as SEQ ID NO: 28, as follows. [Table 25]
[0098] The amino acid sequence MGLAWGLGVLFLMHVCGT (Sequence ID 38) of SEQ ID NO: 28 corresponds to the signal peptide. The underlined amino acids in SEQ ID NO: 28 correspond to the TSP-1 amino acids. The italicized amino acids in SEQ ID NO: 28 correspond to the linker. The bolded amino acids in SEQ ID NO: 28 correspond to the T1-scFV amino acids.
[0099] Therefore, the proteinaceous particle TSP-1 may contain substantially the polypeptide sequence shown in Sequence ID No. 28, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0100] Another embodiment of the TSP-1 fusion protein may be the TSP-1 / chlorotoxin fusion protein. The chlorotoxin peptide interacts with chlorine channels selectively expressed on glioblastoma cells. Therefore, the TSP-1 / chlorotoxin fusion protein improves the targeting of proteinaceous particles to glioblastoma and other tumors having a chlorotoxin-binding phenotype. One embodiment of the TSP-1 / chlorotoxin fusion protein The polypeptide sequence is provided herein as Sequence ID No. 29, as follows. [Table 26]
[0101] The amino acid sequence MGLAWGLGVLFLMHVCGT (Sequence ID 38) in Sequence ID 29 corresponds to the signal peptide. The underlined amino acids in Sequence ID 29 correspond to the TSP-1 amino acids. The italicized amino acids in Sequence ID 29 correspond to the linker. The bolded amino acids in Sequence ID 30 correspond to the chlorotoxin amino acids.
[0102] Therefore, the proteinaceous particle TSP-1 may contain substantially the polypeptide sequence shown in Sequence ID No. 29, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0103] Another embodiment of the TSP-1 fusion protein may be a chlorotoxin / TSP-1 fusion protein. The polypeptide sequence of the chlorotoxin / TSP-1 fusion protein is provided herein as Sequence ID No. 30, as follows. [Table 27]
[0104] The amino acid sequence MGLAWGLGVLFLMHVCGT (Sequence ID 38) in SEQ ID NO: 30 corresponds to the signal peptide. The underlined amino acids in SEQ ID NO: 30 correspond to the TSP-1 amino acids. The italicized amino acids in SEQ ID NO: 30 correspond to the linker. The bolded amino acids in SEQ ID NO: 30 correspond to the chlorotoxin amino acids.
[0105] Therefore, the proteinaceous particle TSP-1 may contain substantially the polypeptide sequence shown in Sequence ID No. 30, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0106] The TSP-1 fusion protein may contain a linker that connects TSP-1 or a fragment thereof to another protein. The linker may be one of the linkers in SEQ ID NOs. 25-30.
[0107] In another embodiment, the proteinaceous particle comprises a fusion protein formed from a shell protein (e.g., TSP-1 fusion protein, TSP-4 fusion protein, galectin-1 fusion protein, or galectin-7 fusion protein) and / or a ligand of the target cell (e.g., a chlorine channel targeted by chlorotoxin) and / or an antibody (such as scFv) that specifically binds to a protein expressed on the target cell (e.g., CD19).
[0108] The protein particles of the present invention can be used to treat various diseases. This can be achieved using protein particles according to the first or second aspect of the present invention. However, an advantage of the particles according to the second embodiment is that they may be engineered to improve their specificity to proteins (e.g., biomarkers or receptors) expressed on target cells of a disease of interest. For example, the protein particles of the present invention may contain ligands, fusion proteins, and / or antibodies that specifically target cancer / tumor cells. Alternatively, the protein particles may contain specific ligands, fusion proteins, and / or antibodies that target target cells infected (with bacteria and / or viruses). Those skilled in the art will understand which ligands, fusion proteins, and / or antibodies confer targeting specificity to the protein particles for target cells. Similarly, those skilled in the art will understand which cells must be targeted to treat the disease or condition of interest. Target proteins that are specific to tumor or infected cells and shared only with non-essential normal cells include: (i) CD19 or CD20 which can be targeted in B-cell leukemia; (ii) co-tumor-testicular antigens and neoantigen peptides that bind to MHC molecules characteristic of certain types of tumors; (iii) pathogen-associated peptides not found in the host; (iv) metabolic sensors such as the Mr1 protein to which tumor or microorganism-associated metabolites bind, forming unique molecular patterns on the surface of cancer or infected cells; and (v) any peptide or polypeptide, such as chlorotoxin, that has been empirically found to bind to tumor cells but not to normal cells. Accordingly, the protein particles of the present invention may be engineered to target any one of the proteins in (i) to (v).
[0109] The shell of the protein particles of the present invention may or may not bind to target cells containing CD47 (also known as an integrin-related protein (IAP)). Therefore, the particles of the present invention may bind to CD47 via TSP-1 or other thrombospongins, such as TSP-2, TSP-3, TSP-4, or TSP-5. CD47 also acts as a signal that prevents phagocytic cells of the immune system from phagocytosing cells that express CD47. Therefore, target cells lacking CD47 may not be targeted by the protein particles of the present invention, but are more likely to be phagocytosed. This property of CD47 means that the absence of CD47 expression on tumor cells or infected cells can evade the protein particles, reducing the likelihood of success for the tumor or infected cells to survive.
[0110] CD47 is encoded by the gene CD47. Thus, the genomic DNA sequence (introns and exons) encoding one embodiment of CD47 is referred to herein as Sequence ID 31 and can be found under gene ID: 961 (https: / / www.ncbi.nlm.nih.gov / gene?Db=gene&Cmd=DetailsSearch&Term=961).
[0111] The polypeptide sequence of CD47 is provided herein as Sequence ID No. 32, as follows. [Table 28]
[0112] Therefore, the protein particles may or may not target cells containing the polypeptide sequence substantially shown in SEQ ID NO: 32, or a variant thereof, a fragment thereof, or an ortholog thereof. Furthermore, the coding sequence encoding the CD47 polypeptide may contain the nucleic acid sequence substantially shown in any of SEQ ID NO: 31, or a variant thereof, a fragment thereof, or an ortholog thereof.
[0113] The shell of the protein particles of the present invention may or may not bind to target cells containing the protein ICAM-1 (also known as cell adhesion molecule-1). ICAM-1 is a polypeptide that can act as a receptor for the protein particles according to the present invention. ICAM-1 expression is increased in many cells by cell activation or inflammatory cytokines, which can make target cells more sensitive to killing by protein particles.
[0114] The ICAM-1 protein was encoded by the gene ICAM1. Therefore, the genomic DNA sequence (introns and exons) encoding one embodiment of ICAM-1 is referred to herein as Sequence ID 33 and can be found under gene ID: 3383 (https: / / www.ncbi.nlm.nih.gov / gene?Db=gene&Cmd=DetailsSearch&Term=3383).
[0115] The polypeptide sequence of ICAM-1 is provided herein as Sequence ID No. 34, as follows. [Table 29]
[0116] Therefore, the protein particles may or may not target cells containing the polypeptide sequence substantially represented in SEQ ID NO: 34, or its variants, fragments thereof, or orthologues thereof.
[0117] Antibodies may be monovalent, divalent, or polyvalent. A monovalent antibody is a dimer (HL) containing a light chain (L) and a heavy chain (H) associated by a disulfide crosslink. A divalent antibody is a tetramer (H2L2) containing two dimers associated by at least one disulfide crosslink. A polyvalent antibody may also be produced, for example, by linking multiple dimers. The basic structure of an antibody molecule consists of two identical light chains and two identical heavy chains that are non-covalently associated and can be linked by disulfide bonds. Each heavy and light chain contains an amino-terminal variable region of about 110 amino acids and the rest of the chain's constant sequence. Variable region The antibody molecule contains several hypervariable regions or complementarity-determining regions (CDRs), which form the antigen-binding site of the antibody molecule and determine its specificity to the antigen or its variant or fragment (e.g., an epitope). On both sides of the CDRs of the heavy and light chains are framework regions, which are relatively conserved amino acid sequences that fix and orient the CDRs. Antibody fragments may include bispecific antibodies (BsAbs) or chimeric antigen receptors (CARs). The constant region consists of one of five heavy chain sequences (μ, γ, ζ, a, or ε) and one of two light chain sequences (κ, or λ). The heavy chain constant region sequence determines the antibody isotype and the effector function of the molecule.
[0118] In one embodiment, the antibody or its antigen-binding fragment comprises a polyclonal antibody or its antigen-binding fragment. The antibody or its antigen-binding fragment may be produced in rabbits, mice, or rats.
[0119] In another embodiment, the antibody or its antigen-binding fragment may include a monoclonal antibody or its antigen-binding fragment. Preferably, the antibody is a human antibody. As used herein, the term “human antibody” may mean an antibody, e.g., a monoclonal antibody, or a variant or fragment thereof, substantially containing the same heavy-chain and light-chain CDR amino acid sequences as those found in a particular human antibody exhibiting immunospecificity for an antigen. Amino acid sequences that are substantially the same as the heavy-chain or light-chain CDR exhibit a considerable degree of sequence identity when compared to a reference sequence. Such identity is definitively known or recognizable as representing the amino acid sequence of a particular human antibody.
[0120] Substantially identical heavy and light chain CDR amino acid sequences may have, for example, minor modifications or conserved substitutions of amino acids. Such human antibodies retain their function of selective binding to the antigen or its variant or fragment.
[0121] The term "human monoclonal antibody" may include monoclonal antibodies having a substantial or complete human CDR amino acid sequence produced by recombinant methods such as production by phage libraries, lymphocytes, or hybridoma cells. The term "humanized antibody" may mean an antibody derived from a non-human species (e.g., mouse or rabbit) whose protein sequence has been modified to increase its similarity to antibodies naturally produced in humans.
[0122] The antibody may be a recombinant antibody. The term "recombinant human antibody" may include human antibodies produced using recombinant DNA technology.
[0123] The term "antigen-binding region" may refer to a region of an antibody that has a specific binding affinity to its target antigen. Preferably, the fragment is an epitope. The binding region may also be a hypervariable CDR or a functional portion thereof. The term "functional portion" of a CDR may refer to a sequence within the CDR that exhibits a specific affinity to the target antigen. The functional portion of a CDR may contain a ligand that specifically binds to the antigen or its fragment.
[0124] The term "CDR" can refer to the hypervariable region in the heavy and light chains of an antibody. There may be one, two, three, or more CDRs in the heavy and light chains of an antibody. Typically, there are at least three CDRs in each chain, which together form the antigen-binding site, i.e., the three-dimensional binding site to which the antigen binds or specifically reacts. However, it is estimated that there may be four CDRs in the heavy chain of some antibodies.
[0125] The definition of CDR includes duplication or subsets of amino acid residues when compared to one another. The exact number of residues that constitute a particular CDR or its functional portion varies depending on the sequence and size of the CDR. Those skilled in the art can routinely determine which residues constitute a particular CDR by considering the amino acid sequence of the variable region of the antibody.
[0126] The term “(functional) fragment” of an antibody may mean a portion of the antibody that retains functional activity. Functional activity may be, for example, antigen-binding activity or specificity. Functional activity may also be, for example, effector function provided by the constant region of the antibody. The term “functional fragment” is also intended to include fragments produced, for example, by protease digestion or reduction of human monoclonal antibodies, and by recombinant DNA methods known to those skilled in the art. Examples of functional fragments of human monoclonal antibodies include individual heavy or light chains and their fragments, e.g., VL, VH, and Fd; monovalent fragments, e.g., Fv, Fab, and Fab'; bivalent fragments, e.g., F(ab')2; single-stranded Fv(scFv); and Fc fragments.
[0127] The term "VL fragment" may refer to a fragment of the light chain of a human monoclonal antibody that contains all or part of the light chain variable region, including the CDR. The VL fragment may further contain the light chain constant region sequence.
[0128] The term "VH fragment" can refer to a fragment of the heavy chain of a human monoclonal antibody that contains all or part of the heavy chain variable region, including the CDR.
[0129] The term "Fd fragment" can refer to the heavy chain variable region coupled to the first heavy chain steady region, i.e., VH and CH-i. The "Fd fragment" does not include the light chain or the second and third steady regions of the heavy chain.
[0130] The term "Fv fragment" may refer to a monovalent antigen-binding fragment of a human monoclonal antibody that includes all or part of the variable regions of the heavy and light chains, but lacks the constant regions of the heavy and light chains. Examples of variable regions of the heavy and light chains include the CDR. For example, an Fv fragment includes all or part of the amino-terminal variable regions of amino acids in both the heavy and light chains.
[0131] The term "Fab fragment" can refer to a monovalent antigen-binding fragment of a human monoclonal antibody that is larger than the Fv fragment. For example, a Fab fragment may include the variable region, as well as all or part of the first constant domains of the heavy and light chains.
[0132] The term "Fab' fragment" may refer to a monovalent antigen-binding fragment of a human monoclonal antibody that is larger than a Fab fragment. For example, a Fab' fragment may include all of the light chain, all of the variable region of the heavy chain, and all or part of the first and second constant domains of the heavy chain. For example, a Fab' fragment may further include some or all of amino acid residues 220-330 of the heavy chain. Alternatively, the antibody fragment may include a Fab'2 fragment containing the hinge portion of the antibody.
[0133] The term "F(ab) fragment" may refer to a bivalent antigen-binding fragment of a human monoclonal antibody. The F(ab) fragment may, for example, include all or part of the variable regions of the two heavy chains and two light chains, and may further include all or part of the first constant domains of the two heavy chains and two light chains.
[0134] The term "single-stranded Fv (scFv)" can refer to a fusion of heavy-chain variable regions (VH) and light-chain variable regions (VL) linked by a short linker peptide.
[0135] The term "bispecific antibody (BsAb)" can refer to a bispecific antibody containing two scFvs linked to each other by a shorter linked peptide.
[0136] It is known to those skilled in the art that the precise boundaries of an antibody fragment are not important as long as the fragment retains functional activity, such as target-binding activity. Using well-known recombination methods, those skilled in the art can manipulate polynucleotide sequences to express a functional fragment at any endpoint desired for a particular application. The functional fragment of an antibody may or may consist of a fragment having substantially the same heavy and light chain variable regions as a human antibody.
[0137] The antigen-binding fragment may include, or consist of, one of the VL antigen-binding region sequences, one of the VH antigen-binding region sequences, or a combination of the VL and VH antigen-binding regions of a human antibody. A suitable number and combination of VH and VL antigen-binding regions can be determined by those skilled in the art, depending on the desired affinity and specificity, as well as the intended use of the antigen-binding fragment. Functional or antigen-binding fragments of antibodies can be readily produced and isolated using methods well known to those skilled in the art. Such methods include, for example, proteolysis, recombination, and chemical synthesis. Proteolysis for the isolation of functional fragments involves using a human antibody as a starting material. Suitable enzymes for proteolysis of human immunoglobulins include, for example, papain and pepsin. A suitable enzyme can be readily selected by those skilled in the art, for example, depending on whether a monovalent or bivalent fragment is required.
[0138] Functional or antigen-binding fragments of antibodies produced by proteolysis may be purified by affinity chromatography and column chromatography procedures. For example, undigested antibodies and Fc fragments may be removed by binding to protein A. In addition, functional fragments may be purified by their charge and size, for example, using ion exchange chromatography and gel filtration chromatography. Such methods are well known to those skilled in the art.
[0139] Antibodies or their antigen-binding fragments may be generated by recombinant methodologies. Preferably, polynucleotides encoding desired regions of the antibody heavy and light chains are first isolated. Such regions may include, for example, all or part of the variable regions of the heavy and light chains. Preferably, such regions may include antigen-binding regions of the heavy and light chains, preferably antigen-binding sites, most preferably CDRs.
[0140] Polynucleotides encoding antibodies or their antigen-binding fragments may be produced using methods known to those skilled in the art. Polynucleotides encoding antibodies or their antigen-binding fragments may also be synthesized directly by oligonucleotide synthesis methods known in the art. Alternatively, smaller fragments may be synthesized and joined using recombination methods known to those skilled in the art to form larger functional fragments.
[0141] As used herein, the term “immunospecificity” may mean that binding regions are capable of an immune response with an antigen or its variant or fragment by specifically binding to them.
[0142] The term "immunely responsive" can mean that a binding region can trigger an immune response upon binding to an antigen or its epitope.
[0143] The inventors have found that protein particles may be engineered to contain a protein of interest. This may involve transcribing a specific RNA (e.g., mRNA, tRNA, or miRNA) and / or expressing a specific protein, and then... This was achieved by creating modified cells in which the protein is incorporated into protein particles within the cell. Thus, cells (e.g., CD8 T cells / cytotoxic T cells or NK cells) may be genetically modified to contain nucleic acid sequences encoding heterologous proteins, such as ligands, which can be expressed on the shell of protein particles and are also specific to proteins (e.g., receptors) expressed on target cells / tissues, in order to enable targeted delivery of protein particles to them.
[0144] Therefore, according to another aspect of the present invention, a modified cell capable of producing manipulated protein particles according to the present invention, wherein the modified cell is • Perforin and / or granzyme; Thrombospongin-1 (TSP-1), or its fragments, variants or orthologues; and • Transgenic ligands in the form of fusion proteins with heterologous polypeptides, such as thrombospongin, galectin, or granzymes. Modified cells are provided that contain or encode nucleic acids.
[0145] In embodiments in which the fusion protein comprises thrombospondin and a heterologous polypeptide, the thrombospondin may also contain TSP-1. In particular, TSP-1 may be a fusion protein with a heterologous polypeptide, such as a ligand.
[0146] The cells may further contain shell proteins selected from the group including galectin-1, galectin-7, TSP-4, its fragments, its variants or orthologues.
[0147] Cells that do not naturally produce the protein particles according to the present invention may also be modified to produce naturally occurring (i.e., unmanipulated) protein particles.
[0148] Therefore, according to another aspect of the present invention, a modified cell capable of producing protein particles according to the present invention, wherein the modified cell is • Perforin and / or granzyme; Thrombospongin-1 (TSP-1), or its fragments, variants, or orthologues. Modified cells are provided that contain or encode nucleic acids.
[0149] Perforin, granzyme, and / or TSP-1 may be recombinant. Perforin, granzyme, and / or TSP-1 may be heterogeneous to cells.
[0150] According to another aspect of the present invention, a method for generating modified cells capable of producing manipulated proteinaceous particles according to the present invention, wherein the method involves generating modified cells that express a fusion protein encoded by a nucleotide sequence, • Perforin and / or granzyme; and Thrombospongin-1 (TSP-1), or its fragments, variants, or orthologues. This includes introducing them into cells that contain or are capable of expressing them. A method is provided in which the fusion protein comprises thrombospongin, galectin or granzyme, and a heterologous polypeptide, such as a transgenic ligand.
[0151] According to another aspect of the present invention, the manipulated protein particles according to the present invention are produced. A method is provided for generating modified cells capable of producing proteinaceous particles according to the present invention, the method comprising preparing cells capable of producing proteinaceous particles according to the present invention and introducing a nucleotide sequence encoding a fusion protein, wherein the fusion protein comprises a heterologous polypeptide, such as a transgenic ligand, and thrombospongin, galectin, or granzyme.
[0152] According to another aspect of the present invention, a method for generating modified cells capable of producing manipulated protein particles according to the present invention, wherein the method is • Heterogeneous polypeptides, e.g., transgenic ligands; and / or • Perforin and / or granzyme; and / or Thrombospongin-1 (TSP-1), or its fragments, variants, or orthologues. A method is provided which comprises introducing a nucleotide sequence encoding a granzyme into cells for expression, wherein the heterologous polypeptide is encoded as a fusion protein comprising thrombospongin, galectin, and / or granzyme.
[0153] According to another aspect of the present invention, a method for generating modified cells capable of producing protein particles according to the present invention, wherein the method is • Perforin and / or granzyme; and Thrombospongin-1 (TSP-1), or its fragments, variants, or orthologues. A method is provided which includes introducing a nucleotide sequence encoding into cells for expression.
[0154] A heterologous polypeptide, such as a transgenic ligand, may be encoded as a fusion protein with thrombospondin and / or a granzyme. In one embodiment, the heterologous polypeptide, such as a transgenic ligand, is encoded as a fusion protein with thrombospondin. In another embodiment, the heterologous polypeptide, such as a transgenic ligand, is encoded as a fusion protein with a granzyme. The fusion protein with thrombospondin may be a fusion protein of TSP-1 and a heterologous polypeptide, such as a transgenic ligand.
[0155] In embodiments of the present invention in which a fusion polypeptide / protein is provided, the heterologous polypeptide (such as a transgenic peptide) may be C-terminated relative to its fusion partner. For example, thrombospondin may be N-terminated relative to the heterologous polypeptide (such as a transgenic peptide). Galectin may be N-terminated relative to the heterologous polypeptide (such as a transgenic peptide). Granzyme may be N-terminated relative to the heterologous polypeptide (such as a transgenic peptide).
[0156] According to another aspect of the present invention, a modified cell is provided, wherein the modified cell comprises a nucleic acid that encodes a component of an engineered proteinaceous particle according to the present invention.
[0157] According to another aspect of the present invention, a modified cell is provided, wherein the modified cell contains a nucleic acid that encodes a component of a proteinaceous particle according to the present invention.
[0158] The nucleotide sequence introduced into the cell may contain DNA. In one embodiment, the nucleotide sequence introduced into the cell is provided in the form of a vector for transfection into the cell. The nucleotide sequence introduced into the cell may be stably transformed into a cell (e.g., incorporated into a chromosome). The nucleotide sequence introduced into the cell may be a fusion protein with thrombospongin, galectin, or granzyme. In the application, the nucleotide sequences may replace or knock out any existing sequence of thrombospondin, galectin, or granzyme (e.g., by insertion). In particular, existing nucleotide sequences (genes) encoding wild-type thrombospondin, galectin, or granzyme may be replaced or knocked out (e.g., by insertion) with an equivalent fusion protein, where the fusion protein is a heterologous polypeptide. Insertion of a nucleotide sequence may involve the use of homologous recombination, for example, by providing a homologous sequence to the insertion site adjacent to the nucleotide sequence to be inserted. Those skilled in the art are familiar with many techniques and methods for transforming cells with nucleotide sequences for their expression in cells.
[0159] A ligand refers to a drug or moiety that (specifically) binds to a protein (e.g., a receptor or ion channel) or marker on a target cell. Preferably, the ligand specifically binds to the protein or marker. The ligand may be a protein or a peptide. The ligand may be a transgenic ligand (e.g., a transgenic polypeptide). The transgenic ligand may be an antibody, or an antibody fragment (e.g., scFv), or a fusion protein. The ligand may be chlorotoxin or T1-scFv.
[0160] The cells may be T cells (T lymphocytes), CD3+ cells, CD8+ cells, or natural killer (NK) cells. Preferably, the cells are CD8+ T cells (cytotoxic T cells or CD3+CD8+ cells). The cells may be CD57+ cells. Most preferably, the cells are CD3+CD8+CD57+ T cells. The cells may be activated CD3+ cells, activated CD8+ cells, or activated natural killer (NK) cells. Most preferably, the cells are activated CD3+CD8+ T cells or activated CD3+CD8+CD57+ T cells. The cells may be cells containing protein particles. The cells may be natural killer-like cell lines including human fetal kidney (HEK) cells, Chinese hamster ovary (CHO) cells, NK92, and YT. The cells may be cells capable of producing protein particles according to the present invention, or cells containing them.
[0161] The nucleotide sequence may encode a heterologous ligand, such as a transgenic ligand. Therefore, the nucleotide sequence may encode one or more amino acid sequences of sequence numbers 28-31.
[0162] Preferably, the method is used to produce modified cells according to the present invention.
[0163] The protein particles according to the present invention are similar in size to exosomes. Therefore, they are typically co-purified together with exosomes from the supernatants of NK cells and T cells. Accordingly, the inventors have developed a method for isolating and purifying the protein particles according to the present invention.
[0164] According to another aspect of the present invention, a method for isolating protein particles from cells according to the present invention, wherein the method is (i) Provide cells in a liquid; (ii) Centrifuging cells and liquid or filtering cells to pelletize them, thereby producing cell-free liquid; (iii) Collecting the released protein particles by centrifugation or filtration of the cell-free liquid in order to collect the protein particles. Includes, Any exosome released from a cell collects the above-mentioned non-exosome protein particles. A method is provided for removing cellular fluid before or after centrifugation or filtration.
[0165] Cells that produce the protein particles of the present invention may also produce exosomes. However, exosomes can be co-purified with the protein particles of the present invention using the same centrifugal force or the same filter. Therefore, removal of exosomes may be necessary for substantially pure or more pure collection of protein particles. Removal of exosomes after centrifugation or filtration of the protein particles for their collection can advantageously increase the concentration of any exosomes, which can make such removal, e.g., immunosuppression, more efficient and convenient.
[0166] The protein particles may be natural / wild-type protein particles according to the present invention, or modified protein particles according to the present invention.
[0167] The cells may be cells capable of producing the protein particles according to the present invention, or manipulated protein particles according to the present invention. The cells may be manipulated cells according to the present invention, modified to produce native or manipulated protein particles. The cells may be T cells (T lymphocytes), CD3+ cells, CD8+ cells, or natural killer (NK) cells. The cells may be CD57+ cells. Most preferably, the cells are CD3+CD8+CD57+ T cells. The cells may be activated CD3+ cells, activated CD8+ cells, or activated natural killer (NK) cells. Most preferably, the cells are activated CD3+CD8+ T cells, or activated CD3+CD8+CD57+ T cells. The cells may be natural killer-like cell lines including human embryonic kidney (HEK) cells, Chinese hamster ovary (CHO) cells, NK92, and YT. The cells may contain or express the protein particles according to the present invention.
[0168] Cells may spontaneously release protein particles. However, the method according to the present invention may include a step of activating the cells to increase the release of protein particles. Cells may be activated using any technique known in the art. However, those skilled in the art will understand that the way in which cells are activated depends on the type of cell. For example, CD3+ cells may be activated with an anti-CD3 antibody, and optionally with an anti-CD28 antibody and / or Fas. NK cells may be activated with an anti-CD16 antibody.
[0169] The liquid may be a culture medium, for example, a cell culture medium. Preferably, step (i) includes providing cells in the culture medium. The composition of the medium is controlled so as not to contain exosomes and other particles of similar size to the protein particles. The medium may have a low-protein, fully defined composition to facilitate the purification of protein particles.
[0170] Step (ii) includes centrifugation of cells in a liquid (e.g., culture medium) to produce a centrifuged cell-free liquid. Centrifugation of cells (e.g., culture medium) may include spinning at a speed sufficient to pellet the cells in the liquid, so that they can be separated from protein particles and exosomes in the supernatant. The centrifugation for pelleting the cells may be 100-1000 g. After the cells have been gently removed, the supernatant may be subjected to further centrifugation of 10,000 g to remove particles smaller than cells, which are pelleted as they are >500 nm. Alternatively, step (ii) may include filtering the cells from the liquid. For example, the cells may be filtered by passing the liquid through a filter having a pore size that prevents the passage of cells but not protein particles, or that prevents the passage of cells larger than protein particles, so that the cells are They can be fractionated. More specifically, the cells may be filtered from the liquid by culturing them in a hollow fiber cell culture system having pores large enough for protein particles to pass through but small enough for cells not to pass through, and as a result the protein particles are collected in the filtrate of the hollow fiber cell culture system. The pore size will be about 0.45 μm in diameter, preferably greater than about 0.2 μm, but less than about 1 μm in diameter.
[0171] Centrifuging the cell-free liquid to collect the released protein particles may include centrifugation for pelletizing the protein particles. After the cell-free liquid is discarded, such pellets may then be resuspended in, for example, a buffer or other medium. Centrifuging the cell-free liquid to collect / pelletize the released protein particles may include ultracentrifugation. The ultracentrifugation may be fast and time sufficient to pelletize the protein particles according to the present invention. For example, ultracentrifugation may be sufficient to pelletize protein particles of a size of 50-100 nm. In one embodiment, the ultracentrifugation may be about 25,000 g to about 400,000 g, or about 50,000 g to about 200,000 g. Most preferably, the ultracentrifugation is 100,000 g. In one embodiment, the ultracentrifugation is at least 25,000 g.
[0172] Ultracentrifugation may last at least about 15 minutes, at least about 30 minutes, at least about 1 hour, or at least about 2 hours. Ultracentrifugation may last from about 15 minutes to about 4 hours, from about 30 minutes to about 2 hours, or at least about 1 hour.
[0173] In one embodiment, ultracentrifugation is performed at approximately 50,000 g to approximately 200,000 g for approximately 30 minutes to approximately 2 hours. Most preferably, ultracentrifugation is performed at 100,000 g for at least approximately 1 hour.
[0174] In one embodiment, step (ii) (i.e., filtering cells to produce a cell-free fluid) includes ultrafiltration. In one embodiment, step (iii) (i.e., filtering the cell-free fluid to collect the released proteinaceous particles) includes gel filtration, as a result of separating the proteinaceous particles into a fraction that does not contain smaller components (i.e., components with a diameter of less than about 80 nm). In another embodiment, step (ii) includes ultrafiltration and step (iii) includes gel filtration.
[0175] Ultrafiltration, which involves filtering a cell-free fluid to collect released protein particles, may also involve filtering the protein particles to capture them on a filter. For example, the filter pores may be sized to allow the passage of liquid and molecules smaller than protein particles, but to prevent the passage of protein particles. For example, the pores may have a diameter of less than 50 nm. Filtration of the cell-free fluid to collect released protein particles may include the use of size exclusion chromatography. In another embodiment, a combination of bind-elute chromatography and size exclusion chromatography may be used. Those skilled in the art are familiar with filtration techniques for isolating protein particles, for example, based on their size, charge, and / or binding properties. Such methods have been described by Corso et al. (2017 Scientific Reports | Vol. 7: pp. 11561 | DOI: 10.1038 / s41598-017-10646-x3, which is incorporated herein by reference) and Vader et al. (2017 Andrew F. Hill (ed.), Exosomes and Microvesicles: Methods and Protocols. Methods in Molecular Biology, Vol. 1545, DOI 10.1007 / 978-1-4939-6728-5_14) for isolating exosomes of similar size, which are protein granules of the present invention. This may be applied to children. For example, such techniques may use liquid chromatography, such as core bead chromatography.
[0176] Exosomes may be removed by using any technique known in the art. Those skilled in the art will understand that there are various techniques that can be used to remove exosomes, for example, exosomes in a centrifuged culture medium. In one embodiment, exosomes are immunoremoved. Preferably, exosomes are removed using antibodies produced against exosome markers, for example, CD81, CD63, and / or CD9. Exosomes may also be removed using magnetic beads coated with antibodies immunospecific to exosome markers, for example, CD81, CD63, and / or CD9. Because exosomes are membrane-based, they can also be destroyed by mild nonionic surfactants (e.g., octyl-β-D glucopyranoside) that are non-destructive to protein particles and easy to remove. Thus, in one embodiment, exosomes are removed by destroying (i.e., breaking) the exosome membrane with a surfactant. In one embodiment, the surfactant comprises or consists of octyl-β-D glucopyranoside. Those skilled in the art will readily identify alternative surfactants that can disrupt the exosome membrane but do not affect (e.g., do not denature) the protein particles.
[0177] The method according to the present invention may further include, for example, centrifuging the exosome-removed liquid to pelletize protein particles for collection. The exosome-removed liquid may be spun at a speed and time sufficient to pelletize protein particles according to the present invention. For example, centrifugation may be sufficient to pellet protein particles of a size of 50 to 100 nm. In one embodiment, the exosome-removed liquid may be spun at about 25,000 g to about 400,000 g, or about 50,000 g to about 200,000 g. Most preferably, the liquid is spun at 100,000 g. In one embodiment, the exosome-removed liquid may be centrifuged at at least 25,000 g.
[0178] The exosome-removed liquid may be centrifuged (spinned) for at least about 15 minutes, at least about 30 minutes, at least about 1 hour, or at least about 2 hours. The exosome-removed liquid may also be spun for about 15 minutes to about 4 hours, about 30 minutes to about 2 hours, or at least about 1 hour.
[0179] In one embodiment, the exosome removal liquid is spun at a volume of about 50,000 g to about 200,000 g for about 30 minutes to 2 hours. Most preferably, the exosome removal liquid is spun at a volume of 100,000 g for at least about 1 hour.
[0180] Prior to step (i), the cells (e.g., activated CD3+CD8+ T cells) may be cultured in the culture medium for at least about 6 hours, at least about 12 hours, at least about 24 hours, or at least about 48 hours. The cells may be cultured in the culture medium for about 6 to 192 hours, or about 12 to 96 hours, or about 24 to 48 hours.
[0181] The inventors have developed an alternative method for isolating proteinaceous particles according to the present invention.
[0182] Therefore, according to another aspect of the present invention, a method for isolating protein particles from cells according to the present invention, wherein the method is (a) Adhering cells to a substrate, thereby causing protein particles released from the cells to also adhere to the substrate; (b) Detach the cells from the substrate, leaving behind the adhered protein particles: and (c) Collecting protein particles by eluting them from the substrate. A method is provided that includes this.
[0183] Advantageously, we have found that cells adhered to a substrate, such as a lipid bilayer, can be activated and release protein particles according to the present invention that can adhere to the substrate, such as a lipid bilayer. The adhered protein particles can then be collected. This process has the advantage of rapidly generating and isolating the desired protein particles, for example, in a few hours (less than a day).
[0184] [Step (a) of adhering cells to the substrate] This step may include bringing the cells into contact with the substrate. The cells may be those mentioned in the previous embodiment (i.e., the method prior to isolating the protein particles from the cells).
[0185] The substrate may be a surface on which cells (e.g., T cells or NK cells) can adhere and detach. The substrate may be a model lipid bilayer, such as a supported lipid bilayer (SLB), or a glass surface, preferably a planar glass surface, or glass beads on which an SLB can be formed.
[0186] The substrate may be coated with one or more, two or more, or three or more proteins for cell adhesion and / or activation, such as ICAM-1 and MICA. Preferably, if the cells are NK cells, the substrate (e.g., SLB or isolation beads) is coated with ICAM-1 and MICA. Preferably, if the cells are T cells (T lymphocytes), CD3+ cells, or CD8+ cells, the substrate (e.g., SLB) is coated with ICAM-1. The substrate (e.g., SLB or isolation beads) may be coated with CD47. The substrate (e.g., SLB or isolation beads) may be coated with CD47, ICAM-1, and MICA, or with CD47 and ICAM-1.
[0187] The substrate (e.g., SLB) may be further coated with one, two, three or more cell activators, e.g., anti-CD16 (for NK cells) and / or anti-CD3 (for T cells), so that the substrate is active. The cell activators promote exocytosis of the protein particles. Preferably, the active substrate (e.g., SLB) is coated with ICAM-1 and anti-CD3 (for T cells). The active substrate may also further contain anti-CD28. The active substrate may further contain the Fas receptor, so that the core and / or hybrid particles contain FasL. Therefore, the active substrate for T cells may contain ICAM-1 and anti-CD3, as well as / or the Fas receptor. Preferably, the active substrate (e.g., SLB) contains ICAM-1, MICA, and anti-CD16 (for NK cells). More preferably, the active substrate is a lipid bilayer surface containing ICAM-1, MICA, and anti-CD16 (for activating NK cells) or CD3 (for activating T cells). The active substrate may be further coated with CD58 to improve the activation of T cells and / or NK cells. CD58 can bind to adhesion molecules, increasing the activation of T cells and / or NK cells and promoting the release of proteinaceous particles.
[0188] The step of adhering the cells to the substrate may take at least about 20 minutes, at least about 30 minutes, at least about 45 minutes, at least about 60 minutes, or at least about 90 minutes. The step of adhering the cells to the substrate may take about 20 minutes to about 4 hours, about 30 minutes to about 3 hours, about 45 minutes to about 3 hours, about 60 minutes to about 2 hours, or about 90 minutes. Preferably, the step of adhering the cells to the substrate is performed for about 90 minutes.
[0189] The step of adhering the cells to the substrate may be performed at a temperature of at least about 20°C, at least about 30°C, at least about 35°C, or at least about 37°C. Preferably, the step of adhering the cells to the substrate is performed at about 37°C.
[0190] In one embodiment, the step of adhering cells to a substrate is performed at about 37° C. for at least about 60 minutes (for example, about 60 minutes to about 2 hours, or about 90 minutes), or at about 37° C. for at least about 90 minutes.
[0191] Preferably, the step of adhering cells (and subsequently proteinaceous particles) to the substrate is performed at a pH of about 6.5 to 7.5.
[0192] [Step (b) of detaching cells from the substrate] Cells may be detached from the substrate by washing. The proteinaceous particles may remain adhered to a surface, for example, a surface bound with ICAM-1 and / or CD47. The washing step may comprise shocking and mechanical flushing mechanisms to detach cells, which are well known to those skilled in the art. Washing may be performed using a buffer, for example phosphate buffered saline (PBS), preferably cold PBS. Cold PBS may be PBS at a temperature of less than about 15°C, less than about 14°C, less than about 13°C, less than about 12°C, less than about 11°C, less than about 10°C, less than about 9°C, less than about 8°C, less than about 7°C, less than about 6°C, less than about 5°C, less than about 4°C, less than about 3°C, less than about 2°C, or less than about 1°C. Preferably, the PBS is less than about 4°C.
[0193] [Step (c) of eluting proteinaceous particles from the substrate] The step of eluting proteinaceous particles from the substrate may comprise washing the substrate with a solvent to obtain an eluate of proteinaceous particles. The solvent may comprise an agent capable of releasing the proteinaceous particles from the substrate surface. In one embodiment, the substrate surface is treated with imidazole. A chelating agent may also be used to release the proteinaceous particles from the substrate surface. The chelating agent is Ca 2+The chelating agent may be EDTA. In addition or alternatively, the step of eluting the protein particles from the substrate (e.g., separation beads) may include a change in pH. For example, the pH may be raised to less than about pH 5.5, less than about pH 5, less than about pH 4.5, less than about pH 4, less than about pH 3.5, or less than pH 3 in order to elute the protein particles from the substrate. Preferably, the pH is raised to between about pH 5.5 and about pH 3.
[0194] Advantageously, imidazole can release ICAM-1 from the substrate surface holding the proteinaceous particles to be eluted. The co-eluted ICAM-1 can then be separated from the proteinaceous particles by ultracentrifugation or gel filtration. Even if ICAM-1 binds to TSP-1 on the proteinaceous particles, the affinity is low (Kd > 1 μM), and most ICAM-1 does not bind to TSP-1 at the concentration of ICAM-1 present in the system (< 10 nM).
[0195] The step of eluting protein particles from the substrate may include washing the substrate with an agent capable of releasing protein particles (e.g., imidazole) for at least about 5 minutes, at least about 10 minutes, at least about 10 minutes, at least about 15 minutes, at least about 20 minutes, at least about 25 minutes, at least about 30 minutes, at least about 35 minutes, at least about 40 minutes, or at least about 45 minutes.
[0196] The step of eluting protein particles from the substrate may include washing the substrate with an agent capable of releasing protein particles (e.g., imidazole) for about 5 minutes or less, about 10 minutes or less, about 10 minutes or less, about 15 minutes or less, about 20 minutes or less, about 25 minutes or less, about 30 minutes or less, about 35 minutes or less, 40 minutes or less, or 45 minutes or less. Preferably, the step of eluting protein particles from the substrate includes washing the substrate with an agent capable of releasing protein particles (e.g., imidazole) for about 10, 20, or 30 minutes.
[0197] The step of eluting protein particles from the substrate may be followed by a step of centrifugation of the eluted material and / or a step of removal of the eluted material. Centrifugation may include ultracentrifugation. The eluted material may be spun (centrifuged) for at least about 15 minutes, at least about 30 minutes, at least about 1 hour, or at least about 2 hours. The eluted material may be spun for about 15 minutes to about 4 hours, about 30 minutes to about 2 hours, or about 1 hour.
[0198] Prior to step (a), the cells (e.g., activated CD3+CD8+ T cells) may be cultured in the culture medium for at least about 6 hours, at least about 12 hours, at least about 24 hours, or at least about 48 hours. The cells may be cultured in the culture medium for about 6 to 192 hours, or about 12 to 96 hours, or about 24 to 48 hours.
[0199] Isolation of protein particles of the present invention by one of these methods may increase their ability to kill cancer cells, infected cells, or bacteria (without further manipulation). The methods according to the present invention may be used to produce protein particles with a purity ranging from about 10% to about 100%. Thus, the methods according to the present invention may be used to produce protein particles that are about 10% to about 100% pure, about 20% to about 100% pure, about 30% to about 100% pure, about 40% to about 100% pure, about 50% to about 100% pure, about 60% to about 100% pure, about 70% to about 100% pure, about 80% to about 100% pure, or about 90% to about 100% pure. In one embodiment, the method may be used to produce protein particles that are at least about 90% pure or at least about 95% pure. Preferably, the methods according to the present invention are used to produce substantially pure protein particles. However, in some embodiments, minor fractions of impurities, such as exosomes, may be present in the protein particle composition. Less than 30% of exosomes may be present. Preferably, less than 20%, or more preferably less than 10%, of exosomes are present. The isolated protein particles may not contain cells. Therefore, protein particles isolated / purified using the method according to the present invention may be used in therapy.
[0200] References to the isolation and generation of protein particles according to the present invention may also refer to the isolation and generation of hybrid particles, for example, hybrid particles derived from CD8+ cells. Purification of hybrid particles, including vesicle / phospholipid particles containing FasL, would not involve immunodesorption using anti-CD81, anti-CD63, or anti-CD9.
[0201] In another embodiment, a composition comprising protein particles of the present invention is provided, wherein the composition is optionally a pharmaceutical composition.
[0202] In another embodiment, a kit comprising cells and a substrate according to the present invention is provided.
[0203] According to another aspect, there is provided a proteinaceous particle according to the invention or a composition according to the invention for use as a medicament.
[0204] According to another aspect, there is provided according to the invention, for use in the treatment of a disease or condition in a subject a proteinaceous particle or a composition according to the invention.
[0205] According to another aspect, there is provided a proteinaceous particle according to the invention or a composition according to the invention for use in the treatment of cancer.
[0206] The cancer may be a cancer selected from the group consisting of kidney cancer, bladder cancer, ovarian cancer, breast cancer, endometrial cancer, pancreatic cancer, lymphoma, thyroid cancer, bone cancer, CNS cancer, leukemia, liver cancer, prostate cancer, lung cancer, esophageal cancer, colon cancer, rectal cancer, brain cancer (e.g., glioblastoma) or melanoma.
[0207] According to another aspect, there is provided an engineered proteinaceous particle according to the invention or a composition according to the invention for use in targeted cell killing in a subject.
[0208] The proteinaceous particle or proteinaceous particle of the above composition for use according to the invention may have been isolated by the method according to the invention.
[0209] According to another aspect, there is provided a method of treating cancer, the method comprising administering to a subject a proteinaceous particle according to the invention or a composition according to the invention.
[0210] According to another aspect, there is provided a method of targeted cell killing, the method comprising administering to a subject an engineered proteinaceous particle according to the invention or a composition according to the invention.
[0211] The terms “treatment” and “treating,” as used herein, are understood to mean the management and care of an object for the purpose of combating a condition such as a disease or disorder. This term is intended to encompass the entire range of treatments for a given condition in which an object is suffering, including not only reducing symptoms or complications, slowing the progression of a disease, disorder or condition, reducing or alleviating symptoms and complications, and / or curing or eliminating a disease, disorder or condition, but also preventing the condition. Here, prevention should be understood as the management and care of an object for the purpose of combating a disease, condition or disorder, and includes the administration of ligands that prevent the onset of symptoms or complications.
[0212] The subject to treatment is preferably a mammal, particularly a human, but this may also include animals, such as dogs, cats, horses, cattle, sheep, and pigs.
[0213] The pharmaceutical composition according to the present invention may further comprise a pharmaceutically acceptable salt or other form thereof. The pharmaceutical composition according to the present invention may comprise one or more pharmaceutically acceptable excipients, such as carriers, diluents, fillers, disintegrants, lubricants, binders, colorants, pigments, stabilizers, preservatives, antioxidants and / or solubility enhancers. The pharmaceutical composition according to the present invention may comprise a pharmaceutically acceptable salt and one or more pharmaceutically acceptable excipients.
[0214] Pharmaceutical compositions can be formulated by techniques known in the art. Pharmaceutical compositions can be formulated as dosage forms for oral, parenteral, for example, intramuscular, intravenous, subcutaneous, intradermal, intra-arterial, intracardiac, nasal, or aerosol administration. Pharmaceutical compositions may be formulated as dosage forms for oral administration.
[0215] Exposure to the cytotoxic protein particles according to the present invention may induce the release of IGFBP-3 from cells. In one embodiment, IGFBP-3 may be used as a marker for cells exposed to the cytotoxic protein particles according to the present invention. However The presence and / or level of IGFBP-3 produced by cells may be determined after contact with or administration of the protein particles according to the present invention.
[0216] The term "isolated" may refer to biological material that has been isolated from its natural environment, preferably by a technical process. The term "isolated" may also include being isolated from cells, i.e., from the extracellular waste products of a producing cell.
[0217] The term "genetically modified" may refer to a biomolecule or cell having nucleotides (e.g., proteins) and / or amino acid sequences that have been altered so as not to be found in nature.
[0218] The adjective "transgenic" can refer to an organism, tissue, or cell that contains genetic information from another organism. Therefore, a transgenic nucleotide sequence refers to a nucleotide sequence that has been transferred from one organism to the cell, tissue, or organism of the present invention. Similarly, a transgenic ligand refers to a ligand whose nucleotide sequence has been transferred from one organism to the cell, tissue, or organism of the present invention.
[0219] The term "ortholog" can refer to a gene that has diverged from another due to speciation (i.e., when a population becomes a different species).
[0220] The nucleotide sequences in the gene construct of the present invention may be DNA (such as cDNA) or RNA (such as mRNA). Preferably, the first and second nucleotide sequences referred to herein are of the same type, for example, both are DNA or both are RNA.
[0221] The term "comprising" is an open term, meaning it refers to all the characteristics that follow it, but is not limited to those characteristics alone. However, the term "comprising" is a closed term. The terms "consisting of" and "consisting essentially of" are also included. "Consisting of" refers to and is limited to all the features that follow the term. "Consisting essentially of" refers to all the features that follow the term, but may also include unexpressed features that do not substantially affect the essential features of the invention. Therefore, the term "contains" may refer to "consisting of" or "consisting essentially of".
[0222] The term "protein particles" can sometimes refer to hybrid particles.
[0223] It will be understood that the present invention extends to any nucleic acid or peptide, or its variant, derivative, or analog, substantially comprising any amino acid or nucleic acid sequence, or variant or fragment thereof, of any of the sequences referred to herein. The terms “substantially amino acid / nucleotide / peptide sequence,” “variant,” and “fragment” may be sequences having at least 40% sequence identity with any one of the amino acid / nucleotide / peptide sequences referred to herein, for example, sequences having 40% identity with the nucleic acids or polypeptides described herein. Amino acid / polynucleotide / polypeptide sequences having sequence identity of more than 50%, more preferably more than 65%, 70%, 75%, and even more preferably more than 80% sequence identity with any of the sequences referred to herein are also conceivable. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity with any of the sequences referred to herein, more preferably at least 90%, 92%, 95%, 97%, 98%, and most preferably at least 99%. The amino acid / polynucleotide / polypeptide sequence may have 100% identity with any of the sequences referred to herein.
[0224] Where a variant polypeptide or nucleotide sequence is referred to, a person skilled in the art will understand that substitutions, deletions, or additions of one or more amino acid residues or nucleotides may be permitted, and optionally, two substitutions may be permitted in the sequence, such that it maintains its function. A person skilled in the art will understand that one, two, three, four, five or more amino acid residues or nucleotides may be substituted, added, or removed without affecting the function. References to sequence identity may be determined by BLAST sequence alignment (www.ncbi.nlm.nih.gov / BLAST / ) using standard / default parameters. For example, a sequence may have at least 99% identity and still have the function according to the present invention. In another embodiment, a sequence may have at least 98% identity and still have the function according to the present invention. In yet another embodiment, a sequence may have at least 95% identity and still have the function according to the present invention. In yet another embodiment, a sequence may have at least 90%, 85%, or 80% identity and still have the function according to the present invention. In one embodiment, the deformation and sequence identity may follow the full-length sequence. In other embodiments, the deformation may be limited to non-conserved sequences and / or sequences outside the active site, such as the binding domain. Thus, the active site or binding site of the protein may be 100% identical, but the flanking sequence may include deformations defined in terms of identity. Such deformations may be referred to as “conserved active site variants.”
[0225] Amino acid substitutions may be conservative substitutions. For example, the modified residue may comprise substantially similar properties to the residue substituted in the wild-type sequence. For example, the substituted residue may have a charge or hydrophobicity that is substantially similar or equivalent to that of the residue substituted in the wild-type sequence. For example, the substituted residue may have a molecular weight or steric volume that is substantially similar to that of the residue substituted in the wild-type sequence. As for "variant" nucleic acid sequences, those skilled in the art will understand that one, two, three, four, five or more codons may be substituted, added or deleted without affecting function. For example, conservative substitutions may be considered.
[0226] Preferably, the term "fragment" refers to a "functional fragment". A functional fragment may refer to a fragment that has the amino acids / nucleotides essential for exerting the function of the full-length fragment / polypeptide.
[0227] Those skilled in the art will understand how to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences. To calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences, an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value. The percentage identity for two sequences may take different values depending on: (i) the method used to align the sequences, for example ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example local versus global alignment), the pair-score matrix used (e.g., BLOSUM62, PAM250, Gonnet, etc.), and gap-penalty, e.g., functional form and constants.
[0228] Once an alignment is performed, there are many different ways to calculate the percentage of identity between two sequences. For example, the number of identities can be divided by: (i) the length of the shortest sequence; (ii) the length of the alignment; (iii) the average length of the sequences; (iv) the number of non-gap positions; or (iv) the number of equivalent positions excluding overhangs. Furthermore, it will be understood that the percentage of identity is also strongly length-dependent. Thus, the shorter the pair of sequences, the higher the sequence identity that can be expected to occur by chance.
[0229] Therefore, it will be understood that the precise alignment of protein or DNA sequences is a complex process. The general multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, Vol. 22, pp. 4673-4680; Thompson et al., 1997, Nucleic Acids Research, Vol. 24, pp. 4876-4882) is a preferred method for creating multiple alignments of protein or DNA according to the present invention. Preferred parameters for ClustalW may be as follows: For DNA alignment: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignment: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and protein alignment: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will know that these and other parameters may need to be changed to achieve optimal sequence alignment.
[0230] Preferably, the percentage of identity between two amino acid / polynucleotide / polypeptide sequences may then be calculated from an alignment such as (N / T) × 100, where N is the number of positions in which the sequences share identical residues, and T is the total number of positions compared, including gaps but excluding overhangs. Therefore, the most preferred method for calculating the percentage of identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program, for example, using a preferred set of parameters as shown above; and (ii) inserting the values of N and T into the following formula: Sequence Identity = (N / T) × 100. Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, substantially similar nucleotide sequences are encoded by any of the sequences referred to herein or sequences that hybridize to their complements under stringent conditions. Stringent conditions mean that the nucleotides hybridize to filter-bound DNA or RNA in 3× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by at least one wash in 0.2× SSC / 0.1% SDS at approximately 20–65°C. Alternatively, substantially similar polypeptides may differ from the polypeptide sequences described herein by at least one amino acid, and fewer than 5, 10, 20, 50, or 100 amino acids.
[0231] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein can be varied or changed to provide variants without substantially affecting the sequence of the protein it encodes. Preferred nucleotide variants have sequences that have been modified by the substitution of different codons encoding the same amino acid in the sequence, thus resulting in silent changes. Other preferred variants have homologous nucleotide sequences, but are otherwise This involves all or part of a sequence modified by the substitution of different codons, encoding an amino acid with a side chain having similar biophysical properties to the amino acid being substituted, resulting in a conservation change. For example, small nonpolar hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large nonpolar hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Thus, it is understood which amino acids can be substituted with amino acids having similar biophysical properties, and those skilled in the art will know the nucleotide sequences encoding these amino acids.
[0232] When a reference to a polypeptide sequence refers to a sequence containing a precursor or propeptide sequence, those skilled in the art will recognize that, in some embodiments, the reference to a sequence may refer only to the mature polypeptide. For example, precursor residues and signal peptides may not be portions of the mature polypeptide present in the proteinaceous particle according to the present invention. Thus, a reference to a variant of such a sequence may refer only to the mature polypeptide portion of a given sequence.
[0233] All embodiments and characteristics described herein (including any appended claims, abstract and drawings), and / or all steps of any methods or processes disclosed herein, may be combined with any of the above embodiments or characteristics in any combination, unless otherwise stated with respect to specific combinations, for example, combinations in which at least some of such characteristics and / or steps are mutually exclusive.
[0234] For a better understanding of the present invention and to demonstrate that embodiments of the present invention can be carried out, the accompanying drawings are referenced hereby as examples. [Brief explanation of the drawing]
[0235] [Figure 1] Figure 1 shows that SMAP was released in IS and exhibited autonomous cytotoxicity. (A) Slow-speed confocal image showing the transfer of SMAP labeled with Gzmb-mCherry+ (green) and WGA (red-violet) from antigen-specific CTL clones to pp65-pulsed JY target cells (targets). Arrows and insets indicate the presence of SMAP inside the target. Scale bar, 10 μm. Quantification of Gzmb mean fluorescence intensity (MFI) and the number of double-positive particles inside target cells in CTL conjugates with non-pulsed or pulsed target cells. Each dot represents one target cell (<50 cells). Horizontal lines and error bars represent the mean ± SD from two independent experiments. ****, p<0.0001. (B) Live-cell imaging of SMAP release by CD8+ T cells transfected with Gzmb-mCherry-SEpHluorin (red-violet / green) in activated SLB. IRM, interference reflection microscopy. Scale bar, 5 μm. (C) Schematic diagram of a working model for capturing SMAPs released by activated CD8+ T cells. CD8+ T cells (gray) were incubated on an SLB presenting the activated ligand for the indicated time. Cells were removed with cold PBS, leaving the SMAPs (purple) released on the SLB. Each element is not shown to scale. (D) TIRFM image of CD8+ T cells incubated on an activated SLB in the presence of anti-Prf1 (green) and anti-Gzmb (red-purple) antibodies (upper panel). After cell removal, Prf1+ and Gzmb+ SMAPs remained on the SLB (lower panel). Formation of mature IS is indicated by the ICAM-1 ring (blue). IRM, interference reflection microscopy. Scale bar, 5 μm. (E) Cytotoxicity of target cells induced by density-dependent release of SMAPs captured on the SLB, as measured by an LDH release assay. The data points and error bars represent the mean ± SEM from three independent experiments. [Figure 2] Figure 2 shows that TSP-1 is a major component of SMAP and contributes to the killing of CTL targets. (A) Two sets of Venn diagrams showing the number of individual and common proteins identified by MS analysis of material released by CD8+ T cells incubated on inactive (ICAM-1)SLB or activated (ICAM-1 + anti-CD3ε)SLB. Representatives from three independent experiments using eight donors. (B) Normalized abundances of 285 proteins identified by MS under each condition. Cytotoxic proteins are highlighted in red (GZMM, PRF1, GZMB, GZMA), chemokines / cytokines in blue (CCL5, IFNG, XCL2), and adhesion proteins in green (LGALS1, THBS1, THBS4). (C) TIRFM images of SMAP released from CD8+ T cells transfected with TSP-1-GFPSpark (green; top row) or untransfected cells (bottom row). The released SMAP was further stained with anti-Gzmb (yellow) and anti-Prf1 (red-purple) antibodies. IRM, interference reflection microscopy. BF, bright-field microscopy. Scale bar, 5 μm. (D) Percentage of galectin-1 and TSP-1 knockout in CD8+ T cells by CRISPR / Cas9 genome editing, measured from immunoblot analysis (left). Each colored dot represents one donor. Bars represent mean ± SEM. Representative immunoblots for Lgals1 and TSP-1 in CD8+ T cells edited with galectin-1 (Lgals1) and TSP-1, respectively (right). CD8+ T cells (blasts) were analyzed in parallel as a control. (E) Cytotoxicity of target cells mediated by CD8+ T cells gene-edited with galectin-1 (Lgals1-CRISPR) or TSP-1 (TSP-1-CRISPR), measured by LDH release assay. T cell blasts were used as a control. Bars represent mean ± SEM. **, p<0.01. The donor is the same as in (D). [Figure 3]Figure 3 shows that the SMAP shells were rich in glycoproteins, TSP-1, and organic material. (A) dSTORM images of SMAPs released on an SLB activated by multiple cells (left; scale bar, 2 μm) and two examples of individual SMAPs (upper right; scale bar, 200 nm), showing their size heterogeneity. SMAPs were labeled with WGA. Quantification of SMAP size and number released per cell (lower right; n>1800 and n=67, respectively). Horizontal lines and error bars represent the mean ± SD from 5 donors. (B) dSTORM image of TSP-1 (green) positive SMAPs (labeled with WGA, reddish-purple) released on an activated SLB. Scale bar, 1 μm. (C) Multiplex CSXT example of released SMAPs after cell removal. Scale bar, 500 nm. (D) CSXT of CD8+ T cells interacting with a carbon-coated EM grid containing ICAM-1 and anti-CD3ε (note the grid pores in C and D). Scale bar, 2 μm or 500 nm (right) for magnified area. Arrows indicate SMAP. [Figure 4] Figure 4 shows that SMAPs have a TSP-1 shell and a core of cytotoxic proteins. (A and B) dSTORM images of individual SMAPs, positive for Prf1 (green), Gzmb (red-purple), and TSP-1 (A, orange), or stained with WGA (B, orange). Scale bar, 200 nm. (C) Quantification of cytotoxic particle size based on their protein composition (n=64 for Prf1- and Gzmb- cytotoxic particles, n=149 and n=83 for Prf1+ and Gzmb+ cytotoxic particles, respectively). ****, p<0.0001. ns, not significant. (D) Quantification of percentage of particles positive and negative for Prf1 or Gzmb. (C~D) Horizontal lines / bars and error bars represent the mean ± SD from 5 donors. [Figure 5]Figure 5 shows the transfer of Gzmb-mCherry+ SMAP from antigen-specific CTLs to target cells. Maximum intensity projection of confocal z-stack images showing the transfer of SMAP labeled with Gzmb-mCherry+ (green) and WGA (red-purple) from antigen-specific CTL clones to pp65-pulsed JY target cells (A, top row). CTLs were also incubated with unpulsed JY target cells (A, bottom row). Target cells are labeled with CTV and highlighted by dashed circles (Target). BF, bright-field microscopy. Scale bar, 10 μm. (B) 3D z-stack mosaic demonstrating the presence of SMAP from pp65-pulsed target cells in different z-planes in panel A. SMAP was labeled with Gzmb-mCherry+ (green) and WGA (red-purple). Dashed circles define the boundaries of target cells. Scale bar, 10 μm. [Figure 6] Figure 6 shows live imaging of SMAP release by Gzmb-mCherry-SEpHluorin-transfected CD8+ T cells. CD8+ T cells transfected with Gzmb-mCherry-SEpHluorin (red-purple / green) were incubated on activated (ICAM-1+ anti-CD3ε)SLB and imaged live by TIRFM. Snapshots at different time points are shown. Formation of mature IS is indicated by the ICAM-1 ring (blue). Maximum intensity projection from slow-speed imaging (bottom row). Interferometric reflection microscopy (IRM) and composite images are shown. BF, bright-field microscopy. Scale bar, 5 μm. [Figure 7] Figure 7 shows the time-dependent release of Prf1+ and Gzmb+ SMAPs in IS. TIRFM images of time-incubated CD8+ T cells shown on inactive (ICAM-1)SLB or activated (ICAM-1+anti-CD3ε)SLB in the presence of anti-Prf1 (green) and anti-Gzmb (red-purple) antibodies. After fixation, cells were stained with WGA (yellow) to visualize the cell membrane. Formation of mature IS is indicated by the ICAM-1 ring (blue). IRM, interference reflection microscopy. Scale bar, 5 μm. [Figure 8-1]Figure 8-1 shows live imaging of Prf1+ and Gzmb+ SMAP release by CD8+ T cells. CD8+ T cells were incubated on activated (ICAM-1+ anti-CD3ε) SLB in the presence of anti-Prf1 (A, green) and anti-Gzmb (B, red) antibodies and imaged live for 50 minutes by TIRFM. Snapshots at different time points are shown. Time zero indicates the start of imaging after CTLs have interacted with the SLB for 20 minutes. Formation of mature IS is indicated by the ICAM-1 ring (blue). Arrows indicate the presence of SMAP. Interferometric reflection microscopy (IRM) and composite images are shown. Scale bar, 5 μm. [Figure 8-2] Figure 8-2 shows live imaging of Prf1+ and Gzmb+ SMAP release by CD8+ T cells. CD8+ T cells were incubated on activated (ICAM-1+ anti-CD3ε) SLB in the presence of both anti-Prf1 (green) and anti-Gzmb (red) antibodies (C) and imaged live for 50 minutes by TIRFM. Snapshots at different time points are shown. Time zero indicates the start of imaging after CTLs have interacted with the SLB for 20 minutes. Formation of mature IS is indicated by the ICAM-1 ring (blue). Arrows indicate the presence of SMAP. Interferometric reflection microscopy (IRM) and composite images are shown. Scale bar, 5 μm. [Figure 9] Figure 9 shows that Prf1 and Gzmb are components of SMAP released by CD8+ T cells. TIRFM images of SMAP released by CD8+ T cells captured on an activated (ICAM-1 + anti-CD3ε) SLB over a 7-hour time course. Images of the same region were acquired hourly. Time zero indicates the start of imaging after SMAP release and CD8+ T cell removal. SMAP was labeled with anti-Prf1 (green) and anti-Gzmb (red-purple) antibodies, as well as WGA (yellow). IRM, interference reflection microscopy. Scale bar, 5 μm. [Figure 10-1]Figure 10-1 shows the protein abundances of major proteins identified by mass spectrometry in SMAPs released by CD8+ T cells. (A) Network plot and GO pathway of proteins specifically identified in SMAPs released on activated SLBs. (B) Protein abundances of five major proteins detected in SMAPs released from CD8+ T cells on inactivated (ICAM-1)SLBs or activated (ICAM-1 + anti-CD3)SLBs. Each dot represents one donor. Red dots (*) mark the donor used as an example in Figure 2B. Horizontal lines and error bars represent mean ± SEM. ****, p<0.0001. Not significant is not indicated. [Figure 10-2] Figure 10-2(C) shows the peptides (SEQ ID NOs. 39, 40) detected in proteomics analysis of the protein in Figure 10-1(B) using a 1% FDR and a score cutoff of 20. Peptide sequences are highlighted in red and bold. [Figure 10-3] Figure 10-3 (continuation of C) shows the peptides (SEQ ID NOs. 41, 42) detected in proteomics analysis of the protein in Figure 10-1 (B) using a 1% FDR and a score cutoff of 20. Peptide sequences are highlighted in red and bold. [Figure 10-4] Figure 10-4 (continuation of C) shows the peptide (SEQ ID NO: 43) detected in proteomics analysis of the protein in Figure 10-1 (B) using a 1% FDR and a score cutoff of 20. The peptide sequence is highlighted in red and bold. [Figure 11]Figure 11 shows the detection of Prf1, Gzmb, and β2-integrin in SMAP released by CD8+ T cells by immunoblotting. (A) SMAP released on inactive (ICAM-1)SLB or activated (ICAM-1 + anti-CD3ε)SLB was lysed and analyzed by immunoblotting with the indicated antibody (right side of the panel). Whole cell lysates (WCL) were analyzed in parallel to control for the absence of cell membrane contamination. MW, molecular weight (left side of the panel). (B) Quantification of SMAP component expression from immunoblot data. Each colored dot represents one donor. Horizontal lines and error bars represent mean ± SEM. [Figure 12] Figure 12 shows that TSP-1-containing SMAPs were released in the IS and co-localized with Prf1. TIRFM images of time-incubated CD8+ T cells shown on activated (ICAM-1 + anti-CD3ε)SLB in the presence of anti-Prf1 (green) and anti-TSP-1 (red-purple) antibodies. After fixation, cells were stained with WGA (yellow) to visualize the cell membrane. Formation of mature IS is indicated by the ICAM-1 ring (blue). IRM, interference reflection microscopy. Scale bar, 5 μm. [Figure 13] Figure 13 shows GFP+SMAPs released by CD8+ T cells transfected with TSP-1-GFPSpark. (A) TIRFM image of TSP-1-GFP+SMAPs (green) released from CD8+ T cells transfected with TSP-1-GFPSpark. The released SMAPs were further stained with anti-Gzmb (yellow) and anti-Prf1 (red-purple) antibodies. (B) SMAPs released from untransfected CD8+ T cells lacked a GFP signal but were still positive for Gzmb (yellow) and Prf1 (red-purple). IRM, interference reflection microscopy. BF, bright-field microscopy. Scale bar, 5 μm. [Figure 14]Figure 14 shows TSP-1+ SMAP released by CD8+ T cells transfected with Gzmb-mCherry-SEpHluorin. (A) TIRFM image of Gzmb+ SMAP (yellow / green) released from CD8+ T cells transfected with Gzmb-mCherry-SEpHluorin. The released SMAP was further stained with anti-TSP-1 (red-purple) antibody. (B) SMAP released from untransfected CD8+ T cells lacked mCherry and pHluorin signals but was still positive for TSP-1 (red-purple). IRM, interference reflection microscopy. BF, bright-field microscopy. Scale bar, 5 μm. [Figure 15] Figure 15 shows that Gzmb and TSP-1 were already associated in SMAP under non-activation conditions. (A) 3D confocal z-stack projection and orthogonal view of CD8+ T cells co-transfected with Gzmb-mCherry-SEpHluorin (red-purple) and TSP-1-GFPSpark (green) on non-activation (ICAM-1; left) SLB or activation (ICAM-1 + anti-CD3ε; right) SLB. pHluorin is non-fluorescent in secretory lysosomes. Therefore, the co-localization between GFPSpark and mCherry signals represents TSP-1 and Gzmb. Cells were stained with WGA (yellow) to visualize the cell membrane. Formation of mature IS is indicated by the ICAM-1 ring (blue). Scale bar, 2 μm. (B) Quantification of co-localization between Gzmb and TSP-1 staining under inactive (ICAM-1) or activated (ICAM-1 + anti-CD3ε) conditions, evaluated by Pearson coefficient (left), superposition coefficient (center), and Mander coefficient (right). Each dot represents one cell. Horizontal lines and error bars represent mean ± SD; n=1 donor. No significant difference is indicated. [Figure 16]Figure 16 shows the detection of Gzmb, Prf1, and TSP-1 in SMAP released by CD8+ T cells by ELISA. SMAP released on inactive (ICAM-1)SLB or activated (ICAM-1 + anti-CD3ε)SLB was lysed and analyzed by ELISA. Supernatants from both the inactive and activated conditions were analyzed in parallel. Each colored dot represents one donor. Bars represent mean ± SEM. *, p<0.05, **, p<0.01. No statistical significance is indicated. [Figure 17] Figure 17 shows the detection of TSP-1 in CD8+ T cells and primary NK cells by immunoblotting. (A) Schematic diagram of the epitope arrangement along the human TSP-1 protein. A-D show the binding sites of the anti-TSP-1 antibodies used in this experiment. (B, C) Immunoblotting analysis of TSP-1 in blasted CD8+ T cells (blasts), primary NK cells (pNKs), and primary CTLs (CD8+CD57+ T cells; pCTLs) under non-reducing (B) and reducing (C) conditions using different anti-TSP-1 antibodies (as shown below the panel). Purified whole human TSP-1 protein isolated from platelets was used as a control. Note that platelet material shows evidence of proteolysis producing a 100kDa C-terminal fragment and a 60kDa N-terminal fragment, which do not match the C-terminal fragment found in CTLs and NK cells. We detected the N-terminal peptide of TSP-1 by mass spectrometry (Figure 10, SF6C), but these did not associate with the immunoreactive domain in SMAP on the SLB. [Figure 18]Figure 18 shows that SMAP released from TSP-1 knockout CD8+ T cells contained less perforin and granzyme B. (A-B) Diffusion regions of CD8+ T cell blasts (blasts), galectin-1 (Lgals1-CRISPR), and TSP-1 (TSP-1-CRISPR) genome-edited CD8+ T cells on an activated SLB (A), and the diffusion region of SMAP released by the corresponding CD8+ T cells (B). (C-F) Mean fluorescence intensity (MFI) of WGA (C), TSP-1 (D), Prf1 (E), and Gzmb (F) in the released SMAP. Each dot represents the region occupied by one cell (A) or SMAP released from one cell (B-F). Horizontal lines and error bars represent mean ± SD. *, p<0.05, **, p<0.01, ****, p<0.0001. No statistically significant difference will not be indicated. [Figure 19] Figure 19 shows that CD8+ T cells released SMAPs, which contain glycoproteins but lack a phospholipid membrane. Examples of TIRFM images of CD8+ T cells (A) and released SMAPs (B) captured on activated (ICAM-1+ anti-CD3ε) SLBs labeled with WGA (green) or membrane dye (DiI or DiD; red). Interferential reflection microscopy (IRM) and a composite image between WGA and IRM are shown. Scale bar, 5 μm. [Figure 20] Figure 20 shows that TSP-1 is the main component of SMAP. (A) Example of dSTORM images of individual SMAPs (labeled with WGA, reddish-purple) positive for TSP-1 (green) released on an activated (ICAM-1 + anti-CD3ε)SLB. Scale bar, 200 nm. (B) Quantification of the percentage of co-localization between TSP-1 and WGA staining, assessed by CBC analysis. Bars represent mean ± SD. The percentage of co-localization is the sum of percentages from +0.5 to +1 (59 ± 3%) and is highlighted in dark gray. [Figure 21] Figure 21 shows the SMAP size quantified from CSXT analysis. The average SMAP diameter was 111 ± 36 nm from n=10¹. The horizontal lines and error bars represent the mean ± SD. [Figure 22] Figure 22 shows that Srgn is a component of SMAP. TIRFM(A) and dSTORM(B) images of SMAP released by CTLs captured on activated SLBs. SMAP was labeled with anti-Prf1 (green), anti-Gzmb (yellow), and anti-Srgn (red-purple) antibodies. Interferometric reflection microscopy (IRM) and composite images are shown. Three examples from different fields of view are shown for each condition. Representative data from two experiments. Scale bar, 1 μm. [Figure 23] Figure 23 shows SMAPs released by primary NK and CTLs. dSTORM images of individual SMAPs positive for Prf1 (green), WGA (orange), and Gzmb (reddish-purple) released by pNK cells (A) or primary CTLs (B). Scale bar, 200 nm. [Figure 24] Figure 24 shows particles released by CTLs containing FasL in response to the Fas signal. (A) Confocal images of CTLs captured on SLBs loaded with hCD58 and ICAM-1 in the presence or absence of Fas-AlexaFluor647 (red-purple) and anti-CD3ε (upper panel). Cells were labeled with phalloidin to visualize actin (blue), and with anti-Fas ligand (yellow) and anti-Prf1 (green) antibodies. Synthetic and bright-field microscopy (BF) images are shown. (B) TIRFM images of particles released by CTLs captured on an activated SLB (hCD58+ICAM-1-AF405 (blue)) in the presence or absence of Fas-AlexaFluor647 (red-purple). Particles were labeled with anti-Fas ligand (yellow) and anti-Prf1 (green) antibodies. Interferometric reflection microscopy (IRM) and synthetic images are shown. Scale bar, 5 μm. [Figure 25] Figure 25 shows the hybrid particles according to the present invention. The hybrid particles include SMAP particles in contact with phospholipid particles expressing FasL. [Figure 26]Characterization of NK92 EVs. Extracellular vesicles (EVs = exosomes + SMAPs) were isolated from the NK92 cell line, and positive and negative EV markers, as well as SMAP markers such as TSP-1 and granzyme B, were examined by Western blotting. TCL = total cell lysates. [Figure 27] NK92 EV-mediated cytotoxicity of Calu-3 cells. The data show that EVs containing SMAP derived from the NK92 cell line can kill Calu-3 cells. Calu-3 is a lung adenocarcinoma cell line. EVs from NK92 cells at 48 hours did not produce SMAP (based on WB), and therefore the level of killing was lower compared to EV-mediated killing from EVs at 96 hours. [Figure 28] Characterization of NK92 EVs by nanoparticle tracking analysis (NTA). The data show that EVs from NK92 cells have a size distribution similar to that of exosomes and SMAPs. [Figure 29] Characterization of NK92 EVs by nanoparticle tracking analysis (NTA). The data show that EVs from NK92 cells have a size distribution similar to exosomes and SMAPs, and are counted as "exosomes" with an average diameter of 130 ± 5 nm at 96 hours when SMAPs are present. [Figure 30] Calu-3 cell response to 48-hour EVs from NK92. At 48 hours, cytotoxic protein content and killing of NK92 EVs are low. Calu-3 cells, induced by 48-hour EVs, release numerous secretory proteins, including chemokines such as CXCL5 and CXCL10. [Figure 31] Calu-3 cell response to EVs from NK92 at 96 hours. At 96 hours, cytotoxic protein content and killing are high. The spectrum of proteins released by viable Calu-3 cells in response to 96-hour EVs is similar to that released in response to 48-hour EVs, except for a selective increase in IGFBP-3. [Modes for carrying out the invention]
[0236] [Examples] [material and method] Generation of cytotoxic T cells (CTL) Peripheral blood from a healthy donor was obtained from the National Health Service Blood Service under the ethical license REC 11 / H0711 / 7 (University of Oxford). CD8 + T cells are negatively selected according to the manufacturer's protocol (RosetteSep(trademark) human CD8). + T cell enrichment cocktail (Human CD8 + Isolated by T-cell Enrichment Cocktail (STEMCELL technologies; no. 15023). Cytotoxic CD8 + T cells were activated using anti-CD3 / anti-CD28 T cell activation and proliferation beads (Dynabeads ThermoFisher Scientific; No. 11132D) in complete R10 medium (RPMI 1640 (No. 31870074), 10% FBS (ThermoFisher Scientific; No. A3160801), 1% penicillin-streptomycin (No. 15140122), 1% L-glutamine (No. 25030024), 25 mM HEPES (No. 15630080), 1% non-essential amino acids (No. 11140035), all from ThermoFisher Scientific) supplemented with 50 units / mL recombinant human IL-2 (PreproTech; No. 200-02). After 3 days of incubation, the beads were removed and the cells were incubated for a further 2 days. 6 Individual cells / mL were seeded in complete R10 medium with 35 units / mL of IL-2. Activated, quiescent cytotoxic CD8 + The T cells were used within two days thereafter.
[0237] Isolation of primary NK cells and primary CTLs Primary NK cells were isolated by negative selection (RosetteSep® Human NK Cell Enrichment Cocktail, STEMCELL technologies; No. 15065) according to the manufacturer's protocol. CD8 + CD57 + Primary CTLs, defined as T cells, are processed according to the manufacturer's protocol, using CD57 + Positive selection using magnetic beads (Miltenyi Biotec; number 130-092-073) allows for total CD8 to be determined as described above. + The cells were isolated from T cells. They were kept in complete R10 medium (IL-2-free) and used immediately.
[0238] NK92 cell line NK cells were cultured in complete NK92 medium (RPMI 1640 (No. 31870074)) supplemented with 100 units / mL recombinant human IL-2 (PreproTech; No. 200-02), 5% FBS (ThermoFisher Scientific; No. A3160801), 5% human serum (Sigma Aldrich; No. H4522), 50 μM 2-mercaptoethanol (Sigma Aldrich; No. M3148), 1% penicillin-streptomycin (No. 15140122), 2 mM L-glutamine (No. 25030024), 10 mM HEPES (No. 15630080), 1 mM sodium pyruvate (No. 11360070), all ThermoFisher (From Scientific) The cells were cultured in a solution. The cells were divided every two days.
[0239] Calu-3 cell line Calu-3 cells were fed complete Calu medium (DMEM (No. 31966047), Hams F12 (No. 21765029), 1 mM sodium pyruvate (No. 11360070), 1% non-essential amino acids (No. 11140035), 1% penicillin-streptomycin (No. 15140122), all from ThermoFisher Science. The cells were cultured in (tific). Once a culture density of 90% was achieved, the cells were divided every 5 days.
[0240] Create a CTL clone Human CD8 + T cells, RosetteSep human CD8 + T cell enrichment cocktail (Human CD8 + Purified from healthy donor blood samples using T Cell Enrichment Cocktail. For cloning, HLA-2A restrictive CD8 peptide specific to the cytomegalovirus protein pp65 NLVPMVATV (SEQ ID NO: 44) was used. + T cells (HLA-A2-restricted CD8 + T-cells were tetramer-stained and single-cell sorted into 96U bottom plates using a BD FACSAria II cell sorter. Cells were cultured in RPMI 1640 medium supplemented with 5% human AB serum (Inst. Biotechnologies J.BOY), minimal essential amino acids, HEPES and sodium pyruvate, 150 units / mL of human recombinant IL-2, and 50 ng / mL of human recombinant IL-15. CD8 + T cell clones were placed in complete RPMI / HS medium containing 1 mg / mL of PHA, 1 × 10⁶ cells. 6 Allogeneic peripheral blood mononuclear cells irradiated at 35 Gy cells / mL (isolated from fresh heparinized blood samples from healthy donors on a Ficoll Paque gradient, obtained from EFS) and 1 × 10⁶ cells / mL 5The cells were stimulated with EBV-transformed B cells irradiated at 70 Gy per cell / mL. Clones were re-stimulated every two weeks. After obtaining written informed consent from each donor and approval from the French Ministry of the Research (Transfer Agreement AC-2014-2384), blood samples were collected and processed according to standard ethical procedures (Helsinki Protocol). The French Ministry of the Research's ethics department agreed to the preparation and storage of cell lines and clones starting from human blood samples from healthy donors (Approval No. DC-2018-3223).
[0241] EBV-transformed B cells (JY) HLA-A2 + Cells were used as target cells and cultured in RPMI 1640 GlutaMAX supplemented with 10% FCS and 50 μM 2-mercaptoethanol, 10 mM HEPES, 1× MEM NEAA, 1× sodium pyruvate, and 10 μg / mL ciprofloxacin. All cell lines were routinely screened for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
[0242] Supported lipid bilayer (SLB) The preparation of liposomes and the formation of mobile SLBs are described in detail elsewhere. Briefly, SLBs were formed by incubation with a mixture of small monolayer vesicles to create a final lipid composition of 12.5 mol% DOGS-NTA and 1 mol% DOPE-CAP biotin, with a total lipid concentration of 0.4 mM and 30 molecules / μm in DOPC. 2Anti-CD3ε(UCHT1)-Fab was obtained. Lipid droplets were placed on a clean glass coverslip (SCHOTT; no. 1472315) in a flow chamber (adhesive slide VI 0.4, Ibidi; no. 80608). After incubation for 20 minutes, the flow chamber was immersed in Hepes-buffered saline (HBS) supplemented with 0.1% human serum albumin (HSA) (Merck-Millipore; no. 12667-50 mL) and flushed to remove excess liposomes. The NTA sites were saturated by blocking with 5% casein in PBS containing 100 μM NiSO4, and then 10 μg / mL of unlabeled streptavidin (Europa Bioproducts Ltd; no. PZSA10-100) was coupled to the biotin head groups for 15 minutes. SLB was run through HSA / HBS, with a reading of 200 molecules / μm. 2 ICAM-1-AlexaFluor405-His tagged protein (unstimulated), or addition of 5 μg / mL anti-CD3ε-Fab (stimulated). The samples were incubated for 20 minutes under the specified conditions. Unbound proteins were washed away with HSA / HBS to make the SLB ready for immediate use. The SLB was a homogeneous fluid, as determined by fluorescence recovery after photobleaching. The protein concentration required to achieve the desired density in the bilayer was calculated from a calibration curve constructed from flow cytometry measurements of bilayer-related fluorescence of proteins attached to the bilayer formed on the glass beads, compared to reference beads containing a known number of suitable fluorophores (Bangs Laboratories; No. 647-A). All lipids were purchased from Avanti Polar Lipids, Inc.
[0243] Emission of Supramolecular Attack Particles (SMAPs) CD8 +T cells, primary NK cells, and primary CTLs were seeded on stimulated or unstimulated SLBs at 37°C for 90 minutes. After incubation, the cells were washed at least three times with ice-cold PBS. The released SMAPs captured on the SLBs were further analyzed by ELISA, immunostaining, or immunoblotting.
[0244] Isolation of extracellular vesicles (EVs) from the NK92 cell line. NK92 cells were seeded for 48 hours and 96 hours (10 × 10) in modified NK92 cell medium (5% human serum and 5% FBS replaced with 10% exosome-removed FBS (ThermoFisher Scientific; No. 15624559)). 6 Individual cells. EVs were isolated from cell medium (HansaBioMed, no. HBM-EXP-C25) using the EXO-Prep one-step isolation reagent, according to the manufacturer's instructions. EVs were resuspended in PBS and used for immunoblotting, NTA analysis, and cytotoxic assays.
[0245] CD8 + T cell transfection CD8 + T cells were activated with anti-CD3 / anti-CD28 T cell activation and expansion growth beads in complete R10 medium supplemented with 50 units / mL of IL-2. After 3 days of incubation, the beads were removed and the cells were transfected with mRNA or cDNA. 6 Individual cells / mL were cultured in complete R10 medium with 35 units / mL of IL-2. 0.2 × 10⁶ 6 CD8 +T cells were transfected with 2 μg of Gzmb-mCherry-SEpHluorin mRNA or 2 μg of TSP-1-GFPSpark cDNA (Sino Biological; no. HG10508-ACG) in 10 μL of buffer R using the Neon transfection system (ThermoFisher Scientific), a 1600 V electrical pulse, 10 ms, and three pulses. Transfection levels were assessed after 24 hours.
[0246] CTL clone transfection For efficient transfection of human CTLs with tagged molecules, we synthesized capped and poly(A)-tailed mCherry-tagged Gzmb mRNA by in vitro transcription from the plasmid pGzmb-mCherry-SEpHluorin. 1 μg of pGzmb-mCherry-SEpHluorin was first linearized by NotI digestion and used as a template for in vitro transcription by T7 RNA polymerase using the mMESSAGE mMACHINE T7 Ultra Kit, according to the manufacturer's protocol.
[0247] Human CTLs were transfected using the GenePulser Xcell electroporation system (BioRad). 1x10 6 The individual CTLs (5 days after restimulation, therefore in the expanded growth stage) were washed and placed in 100 μL of Opti-MEM medium at room temperature. The cells were then resuspended with 2 μg of mCherry-tagged Gzmb mRNA (300V square wave electrical pulse, 2 msec, 1 pulse). Sixteen hours after transfection, the efficiency was verified by FACS analysis (typically 50–80% of cells were transfected).
[0248] Total Internal Reflection Fluorescent Microscopy (TIRFM) Imaging TIRFM imaging was performed using an Olympus IX83 inverted microscope (Olympus) equipped with a 150 × 1.45 NA oil immersion objective lens. For TIRFM imaging, cells were seeded on stimulated or unstimulated SLBs for 5, 10, 20, or 30 minutes, and then fixed in 4% PFA / PBS at room temperature for 30 minutes. After fixation, cells were blocked with 5% BSA / PBS for 1 hour, followed by staining for 1 hour with 10 μg / mL of directly conjugated anti-Gzmb-AlexaFluor647 (BD Biosciences; no. 560212), tissue-labeled anti-TSP-1-AlexaFluor647 (Abcam; no. 1823), and anti-Prf1-AlexaFluor488 (BD Biosciences; no. 563764) primary antibodies. Wheat germ agglutinin (WGA) conjugated with CF568 (Biotium; No. 29077-1) or AlexaFluor488 (ThermoFisher Scientific; No. W11261), or DiD / DiI (ThermoFisher Scientific; No. V22887 / No. V22888) membrane dyes are used to inspect the cell membrane or CD8 + SMAPs released by T cells were labeled. Fluorescence emission was collected using the same objective lens with an electron multiplier charge-coupled camera (Evolve Delta, Photometrics). Post-processing of the fluorescence images was performed using ImageJ (National Institutes of Health).
[0249] Live-cell TIRFM imaging Live cell TIRFM imaging was performed at 37°C using an Olympus IX83 inverted microscope (Olympus) equipped with a 150 × 1.45 NA oil immersion objective lens. Before live cell imaging, CD8 +T cells were pre-incubated on stimulated SLB for 20 minutes with anti-Prf1-AlexaFluor488 and anti-Gzmb-AlexaFluor647, or tissue-labeled anti-TSP-1-AlexaFluor647. Cells were recorded every minute for approximately 50 minutes, after which the stage was washed with ice-cold PBS. A focus-lock system was used to maintain the sample at the focal plane.
[0250] For live-cell imaging of fluorescently tagged Gzmb-mCherry-SEpHluorin, transfected CTLs were seeded on stimulated SLBs 24 hours after transfection. Fluorescence emission was recorded every 30 seconds for approximately 20 minutes. Post-processing of fluorescence images and video creation were performed using ImageJ (National Institutes of Health).
[0251] Confocal imaging CTLs and JY cells were prepared for time-lapse live-cell confocal microscopy. Transfected CTLs were conjugated with target cells (centrifugation at 1500 rpm for 1 minute) and incubated in 5% FCS / RPMI / 10 mM HEPES at 37°C and 5% CO2 for 2 hours. Cells were resuspended, seeded on poly-L-lysine coated slides, and fixed in 3% PFA / PBS at room temperature for 15 minutes. Cells were placed on 90% glycerol / PBS containing 2.5% DABCO (Sigma Aldrich) and examined using a laser scanning confocal microscope (LSM780 or LSM880, Zeiss, Germany) with a 63× oil immersion objective lens. Post-processing of fluorescence images and z-stack creation were performed using ImageJ(N). The study was conducted using the International Institute of Health (IHS). The number of SMAPs in target cells was manually counted from two independent experiments. The mean fluorescence intensity of the Gzmb-mCherry signal was quantified from the maximum intensity projection of a confocal z-stack highlighting the target cell region.
[0252] 3D confocal imaging of Fas-Fas ligand was performed using a Nikon A1R HD25 confocal system with a 60× oil immersion objective lens (Nikon, UK). Cells were measured at approximately 200 and / or 100 molecules / μm, respectively. 2 Cells were seeded on stimulated or unstimulated SLBs in the presence or absence of tissue-labeled Fas-AlexaFluor647 and / or unlabeled human CD58 at the specified concentrations. After incubation at 37°C and 5% CO2 for 20 minutes, cells were fixed in 4% PFA / PBS at room temperature for 30 minutes. After fixation, cells were blocked with 5% BSA / PBS for 1 hour, followed by staining for 1 hour with 10 μg / mL of directly conjugated tissue-labeled anti-FasLigand-AlexaFluor568 (Abcam; no. 134401) and anti-Prf1-AlexaFluor488 (BD Biosciences; no. 563764) primary antibodies. CTL actin cytoskeletons were labeled using phalloidin conjugated with Scientific (A30104). Fluorescence emission was collected sequentially. Post-processing of the fluorescence images was performed using ImageJ (National Institutes of Health).
[0253] Living cell confocal imaging Transfected CTLs were loaded with 1 μg / mL AlexaFluor647 conjugate wheat germ agglutinin (WGA, Invitrogen) for 4 hours and broadly washed with 5% FCS / RPMI / 10 mM HEPES. JY cells were loaded with CTV (Invitrogen) either unpulsed or pulsed with 10 μM peptide, washed, and then imaged on 15-well chamber slides (Ibidi) coated with poly-D-lysine, 2 × 10⁶ cells per well, prior to imaging. 4Individual cells were seeded. Chamber slides were placed on a heating stage in a temperature-controlled chamber maintained at 37°C and a constant CO2 concentration (5%), and examined by slow-speed laser scanning confocal microscopy (LSM 780 or LSM880, Zeiss, Germany).
[0254] dSTORM imaging and analysis Multicolor dSTORM imaging was performed using a TIRFM imaging system (Olympus) with primary antibodies directly conjugated to AlexaFluor488 and AlexaFluor647, acquired sequentially. The antibodies used were anti-Prf1 (BD Biosciences; no. 563764), anti-Gzmb (BD Biosciences; no. 560212), anti-TSP-1 (Abcam; no. 1823), and anti-galectin-1 (ThermoFisher Scientific; no. 43-7400). CD8 + SMAPs released by T cells were further stained with WGA-CF568 (Biotium; no. 29077-1) or WGA-AlexaFluor647 (ThermoFisher Scientific; no. W32466). The released SMAPs were enhanced and well resolved using a Fab2 conjugate secondary antibody with CF568 (Sigma Aldrich; no. SAB4600309). First, the AlexaFluor647 dye was excited using a 640 nm laser and then switched to a dark state. Second, the AlexaFluor488 dye was excited using a 488 nm laser and then switched to a dark state. Third, the CF568 dye was excited using a 560 nm laser and then switched to a dark state. Finally, the fluorescence of AlexaFluor647, AlexaFluor488, and CF568 was reactivated using a 405 nm laser. Synchrotron radiation from all dyes was collected using the same objective lens and imaged using an electron-multiplier charge-coupled camera at a frame rate of 10 ms per frame. Up to 5,000 frames were acquired for AlexaFluor647 and AlexaFluor488, and a minimum of 50,000 frames for CF568.
[0255] Since multicolor dSTORM imaging is performed sequentially using three different photodetector paths (same dichroism but different emission filters), image registration is necessary to create the final tricolor dSTORM image. Therefore, the 488nm to 640nm channels were aligned using a 100nm reference marker (TetraSpeck® microsphere, ThermoFisher Scientific; number T7279) that was visible in the 488nm, 561nm, and 640nm channels. The difference between the 561nm and 640nm channels was negligible, and therefore, no conversion was performed for the 561nm channel. Using the bead images in both channels, ImageJ (National Institute of Science and Technology) was used. Using the MultiStackReg plugin from Health, a polynomial transformation function was calculated to map the 488nm channel onto the 640nm channel, for example, to construct the difference in magnification and rotation. The transformation was applied to each frame of the 488nm channel. The dSTORM images were analyzed and rendered using custom-written software (Insight3, provided by B. Huang, University of California, San Francisco). Briefly, peaks in the single-molecule images were identified based on thresholds and fitted to a simple Gaussian to determine their x and y positions. Localizations that appeared within one pixel across five consecutive frames, including only those with photons ≥ 2000, were combined and fitted as a single localization. The final image was rendered by representing the x and y positions of the localizations as Gaussians with a width corresponding to the determined localization accuracy. Sample drift during acquisition was calculated and subtracted by reconstructing dSTORM images from a subset of frames (500 frames) and correlating these images with reference frames (initial time segments). High-resolution rendered images were integrated using ImageJ (National Institutes of Health).
[0256] Coordinate-based colocalization (CBC) analysis Co-localization (CBC) analysis based on coordinates between TSP-1 and WGA was performed using an algorithm. To evaluate the correlation function for each localization, xy coordinate lists from the dSTORM channels of TSP-1 and WGA were used. For each localization from the TSP-1 channel, the correlation function for the corresponding localization from the WGA channel was calculated. This parameter can range from -1 (perfectly separated) to 0 (uncorrelated distribution) to +1 (perfectly co-localized). The correlation coefficients were plotted as a histogram of the percentage of occurrences with 0.1 binning. The percentage of TSP-1 positive signals co-localizing with WGA signals is the sum of percentages from +0.5 to +1.
[0257] mass spectrometry CD8 captured on stimulated or unstimulated SLBs + SMAP released by T cells was lysed in 1x ice-cold lysis buffer (Cell Signaling Technology; No. 9806S) supplemented with a 1x protease / phosphatase inhibitor cocktail (Cell Signaling Technology; No. 5872). The lysate was clarified by centrifugation, digested with trypsin, and analyzed using ULC ultimate 3000. An LC-MS / MS platform consisting of an RSLCnano (ThermoFisher Scientific) connected to an Orbitrap Fusion Lumos. The data was analyzed using Maxquant (V1.5.7.4) and Progenesis QI 4.1 (Waters, ID: Mascot) with default parameters and Label Free Quantitation. The analysis was performed in section 2.5 (Matrix Science). Data were searched against the human Uniprot database (15 / 10 / 2014). Only proteins detected as specific to the stimulated condition compared to the unstimulated condition were identified. Using the STRING version 11.0 database (https: / / string-db.org / ), network plots of proteins specifically identified in SMAP released on activated SLBs and present in at least two of the three independent experiments were visualized. A list of all identified proteins is available (Data.S1).
[0258] Cryo-Soft X-ray Tomography (CSXT) A carbon-coated transmission electron microscope (TEM) grid (Quantifoil, TAAB Laboratories equipment Ltd; no. G255) was coated with 0.01% poly-L-lysine (PLL) (Sigma Aldrich; no. P8920) for 20 minutes. After PLL coating, the TEM grid was incubated in PBS with 2.5 μg / mL ICAM-1-Fc (R&D Systems; no. 720-IC) and 5 μg / mL anti-CD3ε (BioLegend; no. 317302) at 37°C, followed by broad rinsing with PBS. CD8 + T cells were incubated on a TEM grid for 2 hours, washed with ice-cold PBS, and the released SMAP was immediately rapid-frozen in liquid ethane. Tilt series were collected using a Pixis-XO:1024B CCD camera (Princeton Instruments), a 40 nm zone plate, and 500 eV X-rays on an Xradia UltraXRM-S220c X-ray microscope (Zeiss) at the B24 beamline of the diamond synchrotron. Tilt series were collected in 0.5° increments from -70° to +70°.
[0259] The X-ray tomographic images were reconstructed using the etomo portion of the IMOD package. CD8 + Manual segmentation of SMAPs released by T cells was performed using the TrakEM2 plugin for ImageJ (National Institutes of Health).
[0260] CRISPR / Cas9 genome editing Newly isolated CD8 + T cells were washed three times in Opti-MEM (Gibco; no. 11058021). 1.5 × 10 6 For individual cells, RNP complexes were prepared by mixing transactivated CRISPR RNA (Alt-R Cas9 tracrRNA) and target-specific CRISPR-Cas9 gRNA for TSP-1 (IDT; Hs.Cas9.THBS1.1.AC; sequence: GTCTTCAGCGTGGTGTCCAA (SEQ ID NO: 45)) or galectin-1 (IDT; Hs.Cas9.LGALS1.1.AA; sequence: CGCACTCGAAGGCACTCTCC (SEQ ID NO: 46)) in equimolar amounts (200 pmol), and then incubated at 90°C for 5 minutes. 150 pmol of Alt-R SpCas9 nuclease V3 (IDT; number 1081058) and double-stranded gRNA were mixed in IDT nuclease-free double-stranded buffer and assembled at 37°C for 15 minutes. Alt-R Cas9 electroporation enhancer (IDT; no. 1075915) (200 pmol) was added to the resulting RNP complex, mixed with cells in 50 μL of Opti-MEM, and then electroporated using an ECM 880 square wave electroporator (BTX Harvard Apparatus). The cells were then transferred to complete R10 medium supplemented with 50 units / mL of IL-2. The cells were then incubated with anti-CD3 / anti-CD28 T cell activation and proliferation beads for 3 days. After 3 days of incubation, the beads were removed, and the cells were incubated for another 2 days. 6 Individual cells / mL were seeded in complete R10 medium with 35 units / mL of IL-2. Activated, quiescent cytotoxic CD8+ T cells were used the following day. The percentage of knockout cells was evaluated by immunoblotting.
[0261] Nanoparticle Tracking Analysis (NTA) NTA analysis of NK92 cell-derived extracellular organisms (EVs) was performed using a ZetaView (Particle Metrix) instrument. Five 30-second videos were recorded for each sample, and the average EV diameter, total number of EVs, and EV concentration were calculated from these videos. Each sample was measured using two replicates.
[0262] LDH cytotoxicity assay CD8 + T cells on stimulated or unstimulated SLBs in increasing amounts of anti-CD3ε-Fab (30, 300, and 3000 molecules / μm). 2 The cells were seeded with ) at 37°C for 90 minutes. After incubation, the cells were washed with ice-cold PBS, and the released SMAP captured on SLB was incubated with target cells (CHO) for a further 4 hours. After incubation, the supernatant was collected and spun down to remove cells and cell debris, and used to assess the cytotoxicity level by measuring the amount of released lactate dehydrogenase (LDH) according to the manufacturer's protocol (TaKaRa Bio; No. MK401). For the cell-cell-mediated cytotoxicity assay, 5 × 10⁶ 6 Target cells (K562) were pulsed with 10 μg / mL anti-CD3ε (BioLegend; no. 317326) at 4°C for 1 hour. After washing off unbound anti-CD3ε, the target cells were treated with CD8 in a 1:1 ratio. + T cell blasts, or TSP-1 or galectin-1 knockout CD8 + The cells were incubated with T cells at 37°C for 2 hours. After incubation, the cells were spun down, and cytotoxicity levels were quantified by measuring the amount of LDH released in the supernatant according to the manufacturer's protocol. The data were compared to the control condition (CD8). + Normalized for T cell blasts.
[0263] Enzyme-Linked Immunosorbent Assay ELISA CD8 + T cells were seeded on stimulated or unstimulated SLBs at 37°C for 90 minutes. After incubation, the supernatant was collected and the cells were removed with ice-cold PBS. CD8 + SMAP released by T cells was rinsed twice with ice-cold PBS and then disrupted with 1× ice-cold lysis buffer (Cell Signaling Technology; No. 9806S) supplemented with a 1× protease / phosphatase inhibitor cocktail (Cell Signaling Technology; No. 5872). Cell supernatant and CD8 + The lysate of SMAP released by T cells was clarified by centrifugation. The presence of TSP-1, Prf1, and Gzmb was quantified by sandwich ELISA (Abcam;ab193716;ab46068;ab235635, respectively) according to the manufacturer's instructions. Absorbance was measured at 450 nm.
[0264] Cytokine assay Calu-3 cells were seeded on 8-well μSlide IBIDI wells (IBIDI; number 80821) (25 × 10 3 pieces, 50×10 3 pieces and 100 × 10 3 (Individual cells / well). After 3 days, EVs (48 hours and 96 hours) from the NK92 cell line were incubated with Calu-3 cells for 4 hours. The cell supernatant was collected and centrifuged at 350 g for 5 minutes at room temperature to remove cells and cell debris. Cytokine and chemokine production was measured according to the manufacturer's instructions using the Human XL Cytokine Array Kit (R&D System). Quantification was performed in the supernatant using ms (number ARY022B). Positive signals from cytokines were determined by measuring the mean signal of pairs of two replicate spots using ImageJ (National Institutes of Health). Differences between arrays were corrected using the mean intensity of positive spots within the array. Fold changes in cytokine and chemokine production between conditions were determined at 48 and 96 hours by normalizing the data to EV alone.
[0265] Immunoblot CD8 + T cells were seeded on stimulated or unstimulated SLBs at 37°C for 90 minutes. After incubation and cell removal with ice-cold PBS, CD8 cells were collected. + SMAPs released by T cells were rinsed twice with ice-cold PBS and then destroyed with 1× ice-cold lysis buffer (Cell Signaling Technology; no. 9806S) supplemented with a 1× protease / phosphatase inhibitor cocktail (Cell Signaling Technology; no. 5872). The lysates were clarified by centrifugation, reduced in protein sample loading buffer (Li-Cor; No. 928-40004), separated on a 4-15% Mini-PROTEAN SDS-PAGE gel (Bio-Rad; No. 4561084), transferred to a nitrocellulose membrane, and immunoblotted with anti-Gzmb (Cell Signaling Technology; No. 4275S), anti-CD45 (Cell Signaling Technology; No. 13917S), anti-LAMP-1 (Cell Signaling Technology; No. 9091S), anti-β2-integrin (Cell Signaling Technology; No. 73663S), anti-TSP-1 (ThermoFisher Scientific; No. MA5-11330), anti-galectin-1 (Cell Signaling Technology; No. 12936), and anti-Prf1 (Abcam; No. Ab97305) antibodies. CD8 was analyzed under reducing and non-reducing conditions. +Immunoblot analysis of TSP-1 in whole cell lysates of T cells, primary NK cells, and primary CTLs was performed using anti-TSP-1 antibodies that bind to different TSP-1 epitopes (Abcam; no. 263952; Cell Signaling Technology; no. 37879s; ThermoFisher Scientific; no. MA5-11330, no. MA5-13390). Purified full-length human TSP-1 protein isolated from platelets (Sigma Aldrich; no. 605225-25UG) was used as a control.
[0266] The following primary antibodies were used to characterize EVs derived from NK92 cells: anti-CD63 (Biolegend; no. 353017), anti-CD81 (Biolegend; no. 349514), anti-TSG101 (Sigma Aldrich; no. T5701), anti-cytochrome C (Cell Signaling Technology; no. 11940S), anti-calnexin (Cell Signaling Technology; no. 2679S), anti-GM130 (Cell Signaling Technology; no. 12480S), and anti-β-actin (Cell Signaling Technology; no. 3700S).
[0267] Near-infrared Western blot quantitative detection was performed using the Odyssey CLx system (Li-Cor), and the images were quantified using Image Studio Lite software.
[0268] statistical analysis The samples were tested for normality using the Kolmogorov-Smirnov test. Statistical significance for multiple comparisons was evaluated using one-way analysis of variance (ANOVA) with Tukey's post-hoc test. Statistical analysis was performed using OriginPro 9.1 (OriginLab) analysis software.
[0269] [Example 1: Dynamics of SMAP (protein particle) release] First, we investigated the dynamics of SMAP release. Human CD8 transfected with Gzmb-mCherry-SEpHluorin. + T cells were incubated on a supported lipid bilayer (SLB) coated with laterally mobile ICAM-1 and anti-CD3ε (Figure 1B, Figure 6, SF2). Total internal reflection fluorescence microscopy (TIRFM) demonstrated that CTLs recruited acidic SLs, which exhibited only mCherry fluorescence in the activated SLB, to the IS. Subsequently, a spot of SEpHluorin rapidly (within 1 minute) appeared in the IS (Figure 1B, Figure 6, SF2, video S4). Consistent with the release of Gzmb in SMAP, the SEpHluorin signal persisted in the IS for 20 minutes rather than dispersing.
[0270] [Example 2: SMAP remained attached to the SLB even after the removal of CTLs.] Next, we determined whether SMAP remained attached to the SLB after CTL removal (Figure 1C, video S5). Untransfected CTLs were incubated on activated SLB and prepared directly for immunofluorescence detection of Prf1 and Gzmb, or the cells were removed before analysis (Figure 1D). Immunoreactivity of Prf1 and Gzmb was detected in IS within 20 minutes due to antibody binding dynamics (Figures 7-8-2, SF3-4; video S6-9), and remained attached to the SLB as individual particles even after CTL removal (Figure 1D). SMAP remained stable for several hours without fixation and without loss of Prf1 and Gzmb (Figure 9, SF5).
[0271] [Example 3: SMAP's target cell killing ability] The ability of SMAP to kill target cells was tested using a cytotoxic assay based on the release of the cytoplasmic enzyme lactate dehydrogenase (LDH). Target cells were corrected for "autonomous release" of LDH by target cells (Figure 1E, red circle). *The cells were killed by SLB-immobilized SMAP (Figure 1E, black circle). It was also confirmed that SMAP lacked LDH activity (Figure 1E, blue triangle). Therefore, SMAP is stable after release from CTLs and can autonomously kill cells.
[0272] [Example 4: Characterization of SMAP] SMAPs captured on SLBs (as discussed in Example 3) were subjected to mass spectrometry (MS). More than 285 proteins consistently present in the SMAPs (Figure 2A, B) were identified. Of these, 82 were unique to SMAPs on SLBs containing ICAM-1 and anti-CD3ε compared to ICAM-1 alone, and 18 proteins were detected in most experiments (Figures 10-1 to 10-4, SF6). One peptide derived from Prf1 was detected in multiple experiments, and several Gzmb peptides were identified in all experiments (Figure S6). Several proteins involved in cell signaling (cytokines and chemokines) were identified (Figures 10-1 to 10-4, SF6). The presence of Prf1 and Gzmb in the SMAPs was further confirmed by SDS-PAGE and immunoblotting (Figure 11, SF7). Cell membrane proteins such as phosphatase CD45 and the degranulation marker LAMP-1 (CD107a) were not detected (Figure 11, SF7). This suggested minimal cell membrane contamination. LFA-1 was confirmed by immunoblotting but not by immunofluorescence of SMAP, and therefore, in parallel with SMAP, may represent adhesion sites remaining on the SLB. Thrombospondin-1 (TSP-1) was detected by Ca 2+ It stands out as a candidate based on binding repeats, which is a well-established Ca in CTL-borne killing. 2+ Justified by the dependency step. Live image of SMAP's release on an activated SLB. The stimuli demonstrated that TSP-1 and Prf1 were released together (Figure 12, SF8; video S10). In addition, TIRFM in SMAPs derived from CTLs transfected with full-length TSP-1 having a C-terminal GFPSpark revealed co-localization of Gzmb and Prf1 antibody staining and GFP signaling in SMAPs (Figure 2C; Figure 13, SF9), as well as co-localization of mCherry and pHluorin signals and anti-TSP-1 antibody staining in CTLs transfected with Gzmb-mCherry-pHluorin (Figure 14, SF10). TSP-1-GFPSpark and Gzmb-mCherry-SEpHluorin co-localized within the cytoplasmic compartment in co-transfected CTLs (Figure 15, SF11). These results suggest that SMAPs were pre-formed and stored in the SL. Primary CD8 + CD57 + Enzyme-linked immunosorbent assays of soluble and SLB fractions from CTL stimulation revealed similar levels of Gzmb and Prf1 in both fractions, but the dependence on anti-CD3ε stimulation was higher in the SLB fraction (Figure 16, SF12). In contrast, TSP-1 was present almost exclusively in the SLB fraction and showed a significant dependence on anti-CD3ε stimulation (Figure 16, SF12). We analyzed the TSP-1 protein by SDS-PAGE and immunoblotting and found that CTLs and SMAPs did not contain the full-length 145 kDa seed stored in platelets, but contained the C-terminal 60 kDa fragment under non-reducing and reducing conditions, which is Ca 2+We found that it contained binding repeats (Figure 17, SF13). 60% CRISPR / Cas9-mediated knockout of TSP-1 in CTLs reduced anti-CD3ε redirection killing of K562 cells by 30% (n=5, p<0.001), while 90% knockout of another similar enrichment protein, galectin-1, had no effect on killing (Figure 2D, E). TSP-1 is associated with T cell adhesion to the extracellular matrix, while TSP-1 knockout did not alter T cell adhesion to activated SLBs but reduced signaling for TSP-1, Prf1, and Gzmb in SMAP (Figure 18, SF14). These results suggest that the C-terminal domain of TSP-1 is a component of SMAP and is important in CTL-mediated killing.
[0273] [Example 5: Molecular composition within SMAP] The molecular composition within SMAPs was investigated at a resolution of 20 nm by direct probabilistic reconstruction optical microscopy (dSTORM). SMAPs were detected using WGA in clusters of 27 ± 12 SMAPs per IS (Figure 3A). Upon closer examination, WGA staining appeared as a dense ring in 2D projection, which indicated a spherical shell with an average diameter of 120 ± 43 nm (Figure 3A). Since many supramolecular assemblies use a phospholipid bilayer as a scaffold, we investigated whether SMAPs would stain with the lipid-soluble membrane dye DiD, which brightly stains extracellular vesicles or lipoproteins. DiD did not stain SMAPs, which was consistent with the deficiency of membrane proteins detected by mass spectrometry (Figure 19, SF15). Therefore, the WGA staining pattern closely matched the glycoprotein shell rather than the phospholipid membrane surrounding the SMAPs. The location of TSP-1 within SMAPs was investigated by multicolor dSTORM. Notably, TSP-1 co-localizes with WGA (59±3%) and similarly enhances the shape of SMAP (Figure 3B; Figure 20, SF16). Therefore, SMAPs derived from CTLs have a glycoprotein shell containing TSP-1.
[0274] [Example 6: Further Characterization of SMAP] The structure of SMAP was further investigated using cryo-soft tomography (CSXT) at a resolution of 40 nm, employing a non-destructive 3D method based on preferential X-ray absorption by carbon-rich cellular structures within unstained vitrified specimens. For this purpose, CTLs were incubated on EM grids coated with ICAM-1 and anti-CD3ε. After incubation, the samples were either rapidly frozen in place with the T cells or removed, leaving only the SMAPs. Released SMAPs captured on the grid after cell removal (Figure 3C; video S12). The SMAPs were readily resolved and had an average diameter of 111 ± 36 nm (Figure 21, SF17). The slightly larger SMAPs by dSTORM reflect a contribution of approximately 9 nm based on the hydrodynamic radius of WGA, which is 2.45 nm. The high-density carbon shell observed in CSXT was consistent with the TSP-1 / WGA shell observed by dSTORM. CSXT analysis further highlighted intracellular multicore granules in the CTLs that appeared to be densely packed with SMAPs, where lower-density cores were resolved (video S13). As expected, these multicore granules associated with the basal surface of the CTLs near the activated grid (Figure 3D; video S14).
[0275] [Example 7: Location of cytotoxic proteins within SMAP] The location of cytotoxic proteins within the SMAP was determined using 3-color dSTORM. The TSP-1 / WGA shell surrounded partially overlapping Prf1 and Gzmb-positive regions in 2D projection (Figure 4A, B). Srgn was also detected in the core of the SMAP (Figure 22, SF18). Given the apparent density of the material in the shell and the stability of the SMAP, it was surprising that a 150kDa antibody was able to access the components in the core. SMAPs containing Prf1 and / or Gzmb were found in WGA lacking cytotoxic proteins. + They were larger than particles and more abundant (Figure 4C, D). Primary CD8 derived from peripheral blood. + CD57 +CTLs and NK cells also released SMAPs containing Prf1, Gzmb, and TSP-1 (Figure 23, S1F9). These results confirmed that SMAPs are autonomously cytotoxic, possess a high-density shell containing TSP-1, a core of Prf1, Gzmb, and Srgn with a diameter of approximately 120 nm, and remarkable antibody accessibility.
[0276] [Example 8: Hybrid Particles] CTLs can also kill targets expressing Fas using a ligand for the death receptor Fas (FasL). We detected FasL in CTL IS only when the Fas glycoprotein was incorporated into the SLB along with ICAM-1 and anti-CD3ε (Figure 24, SF20). In these cases, the distribution of FasL in IS differed from that of Prf1 and Gzmb. The related protein CD40L is released in a CD40-dependent manner in the IS of helper T cells. Synaptic ectosomes are a type of extracellular vesicle similar to exosomes, but are generated by budding from the cell membrane of T cells in IS. These results suggest that there are two types of cytotoxic particles released by CTLs in contact with Fas-expressing targets: vesicles containing FasL and SMAPs.
[0277] [Conclusion] A working model for SMAP function is that they act as autonomous killing entities with innate targeting by TSP-1 and other possible shell components. SMAPs introduced via IS may affect only one target, and CTLs can be killed without IS using a process involving rapid motility. The ability of SMAPs to autonomously select targets may be important in situations where delivery accuracy is low. SMAPs may potentially have other mechanisms of action, including chemoattraction by CCL5 and immunomodulation by IFNγ. The C-terminus of TSP-1 contains a binding site for CD47, a ubiquitous "don't eat me" signal. Thus, SMAPs may work in conjunction with myeloid cells to ensure that any cells that cannot be killed by SMAPs are eliminated by phagocytosis.
Claims
1. Isolated protein particles comprising a perforin and / or granzyme core, wherein the core is surrounded by a glycoprotein shell comprising thrombospondin-1 (TSP-1), a fragment thereof, a variant thereof, or an ortholog thereof.
2. An engineered proteinaceous particle comprising a perforin and / or granzyme core, wherein the core is surrounded by a glycoprotein shell comprising thrombospondin protein, or a fragment thereof, a variant thereof, or an ortholog thereof, Genetically modified, engineered protein particles containing granzyme and / or thrombospongin.
3. Protein particles according to claim 1 or 2, comprising granzyme A, B, H, M and / or K, or its variants, fragments or orthologues.
4. The protein particle according to claim 1, claim 2, or claim 3, wherein the shell comprises a mature polypeptide sequence substantially represented in the polypeptide chain of SEQ ID NOs: 1, 2, 3, 4, and / or 5, or a variant, fragment, or ortholog thereof.
5. The protein particle according to any one of the preceding claims, wherein the perforin comprises the polypeptide sequence substantially shown in SEQ ID NO: 6, or a variant thereof, a fragment thereof, or an ortholog thereof.
6. The proteinaceous particle according to any one of the preceding claims, wherein the glycoprotein shell is not a cell membrane or a phospholipid / cholesterol membrane.
7. A protein particle according to any one of the preceding claims, wherein TSP-1 comprises a polypeptide sequence substantially represented in Sequence ID No. 9, or a variant thereof, a fragment thereof, or an ortholog thereof.
8. The proteinaceous particle according to any one of the preceding claims, wherein the shell further comprises other members of the thrombospongin family, such as TSP-2, TSP-3, TSP-4 and / or TSP-5.
9. The protein particle according to any one of the preceding claims, wherein the polypeptide sequence of TSP-4 is substantially that shown in SEQ ID NO: 12, or a variant thereof, a fragment thereof, or an ortholog thereof.
10. The protein particle according to any one of the preceding claims, wherein the shell further comprises galectin-1 and / or galectin-7.
11. The protein particle according to claim 10, wherein the polypeptide sequence of galectin-1 is substantially that shown in the mature polypeptide chain of SEQ ID NO: 15, or a variant thereof, a fragment thereof, or an ortholog thereof.
12. The protein particle according to claim 10, wherein the polypeptide sequence of galectin-7 is substantially that shown in the mature polypeptide chain of SEQ ID NO: 17, or a variant thereof, a fragment thereof, or an ortholog thereof.
13. The protein particle according to any one of the preceding claims, wherein the protein particle is attached to a membrane vesicle / phospholipid particle containing FasL.
14. The protein particle according to any one of the preceding claims, wherein the shell and / or core of the protein particle further comprises a toxin, for example, chlorotoxin.
15. The protein particle according to claim 14, wherein the chlorotoxin comprises a polypeptide sequence substantially represented in SEQ ID NO: 22, or a variant thereof, a fragment thereof, or an ortholog thereof.
16. A proteinaceous particle according to any one of the preceding claims, comprising a genetically modified shell protein (e.g., a fusion protein based on the glycoprotein shell protein), a genetically modified core protein (e.g., a granzyme), a transgenic protein (e.g., a transgenic ligand), and / or an antibody or a fragment thereof.
17. The proteinaceous particle according to claim 16, wherein the genetically modified shell protein is a thrombospongin fusion protein, a galectin fusion protein (e.g., a galectin-1 fusion protein), and / or a granzyme fusion protein (e.g., a granzyme B fusion protein).
18. The proteinaceous particle according to claim 17, wherein the fusion protein comprises an antibody or antibody fragment, for example, scFv, VL and / or VH, Fd, Fv, Fab, Fab', F(ab')2, Fc fragment, antibody mimetic, or bispecific antibody.
19. The proteinaceous particle according to claim 17 or claim 18, wherein the thrombospondin fusion protein is a TSP-1 fusion protein or a TSP-4 fusion protein.
20. The proteinaceous particle according to claim 19, wherein the TSP-1 fusion protein is a TSP-1 / T1-scFv fusion protein, a T1-scFv / TSP-1 fusion protein, a TSP-1 / chlorotoxin fusion protein, or a chlorotoxin / TSP-1 fusion product.
21. The protein particle according to claim 16, wherein the antibody or its fragment is scFv, VL and / or VH, Fd, Fv, Fab, Fab', F(ab')2, Fc fragment, antibody mimetic, or bispecific antibody.
22. A modified cell capable of producing manipulated protein particles according to any one of claims 1 to 21, wherein the modified cell is • Perforin and / or granzyme; Thrombospongin-1 (TSP-1), or fragments thereof, variants thereof or orthologs thereof; and • Transgenic ligands in the form of fusion proteins with heterologous polypeptides, such as thrombospongin, galectin, or granzymes. Modified cells containing or encoding nucleic acids.
23. A modified cell capable of producing protein particles according to any one of claims 1 to 21, wherein the modified cell is • Perforin and / or granzyme; Thrombospongin-1 (TSP-1), or a fragment thereof, a variant thereof, or ortholog Contains or encodes nucleic acids, Modified cells in which perforin, granzyme, and / or TSP-1 are recombinants.
24. The cell according to claim 22 or 23, wherein the cell further comprises a shell protein selected from the group comprising galectin-1, galectin-7, TSP-4, fragments thereof, variants thereof, or orthologs thereof.
25. A method for generating modified cells capable of producing manipulated protein particles according to any one of claims 2 to 21, wherein the method involves, in order to generate modified cells expressing a fusion protein encoded by a nucleotide sequence, the nucleotide sequence encoding the fusion protein, - Perforin and / or granzyme; and Thrombospongin-1 (TSP-1), or a fragment thereof, its variant, or its ortholog. This includes introducing them into cells that contain or are capable of expressing them. A method wherein the fusion protein comprises thrombospongin, galectin, or granzyme, and a heterologous protein, such as a transgenic ligand.
26. A method for generating modified cells capable of generating manipulated protein particles according to any one of claims 2 to 21, wherein the method is - Heterogeneous proteins, e.g., transgenic ligands; and / or - Perforin and / or granzymes; and / or Thrombospongin-1 (TSP-1), or a fragment thereof, its variant, or its ortholog. This includes introducing a nucleotide sequence encoding into cells for expression, A method wherein, optionally, the heterologous protein, for example, the transgenic ligand, is encoded as a fusion protein comprising thrombospongin, galectin, and / or granzyme.
27. A method for generating modified cells capable of generating manipulated protein particles according to any one of claims 2 to 21, the method comprising preparing cells capable of generating protein particles according to claim 22 or claim 23, and introducing a nucleotide sequence encoding a fusion protein, A method wherein the fusion protein comprises a heterologous protein, such as a transgenic ligand, and thrombospongin, galectin, or granzyme.
28. The method according to claim 25, claim 26, or claim 27, wherein the fusion protein with thrombospondin is a fusion protein of a heterogeneous protein, such as a transgenic ligand, with TSP-1.
29. A method for generating modified cells capable of generating protein particles according to any one of claims 1 to 21, wherein the method is - Perforin and / or granzyme; and Thrombospongin-1 (TSP-1), or a fragment thereof, its variant, or its ortholog. This includes introducing a nucleotide sequence encoding into cells for expression, A method in which, optionally, the encoded perforin, granzyme, and / or TSP-1 are recombinants.
30. A method for isolating protein particles according to any one of claims 1 to 21 from cells, wherein the method is (i) To provide cells in a liquid; (ii) Centrifuging cells and liquid or filtering cells to pelletize them, thereby producing cell-free liquid; (iii) Collecting the released protein particles by centrifugation or filtration of the cell-free liquid in order to collect the protein particles. Includes, Any exosomes released from the cells are removed before or after centrifuging or filtering the cell-free fluid to collect protein particles, optionally. A method wherein the cells are selected from the group including T cells (T lymphocytes), CD3+ cells, CD8+ cells or natural killer (NK) cells, and CHO cells, and preferably the cells are activated cells.
31. The method according to claim 30, wherein the cells are a natural killer-like cell line.
32. The method according to claim 30 or 31, wherein the centrifugation of cells and liquid for pelletizing cells is performed at a volume of 100 to 1000 g.
33. The method according to any one of claims 30 to 32, wherein the centrifugation of the cell-free liquid for collecting / pelletizing the released protein particles includes ultracentrifugation.
34. A method for isolating protein particles according to any one of claims 1 to 21 from cells, wherein the method is (a) Adhering cells to a substrate, thereby causing protein particles released from the cells to also adhere to the substrate; (b) Detach the cells from the substrate, leaving behind the adhered protein particles; and (c) Collecting protein particles by eluting them from the substrate. This includes, and optionally, A method wherein the cells are selected from the group comprising T cells (T lymphocytes), CD3+ cells, CD8+ cells or natural killer (NK) cells, and CHO cells, and preferably the cells are activated cells; or the cells are a natural killer-like cell line.
35. The method according to claim 34, wherein the substrate is separation beads or a lipid bilayer, for example, a supported lipid bilayer (SLB).
36. The method according to claim 34 or claim 35, wherein the step of detaching cells from the substrate includes washing the cells from the substrate.
37. The method according to any one of claims 34 to 36, wherein the step of eluting protein particles from a substrate includes washing the substrate with a solvent containing an agent that can detach protein particles from the substrate in order to obtain an eluate of protein particles.
38. The method according to claim 37, wherein the drug is imidazole.
39. A composition comprising protein particles according to any one of claims 1 to 21, wherein the composition is optionally a pharmaceutical composition.
40. Protein particles according to any one of claims 1 to 21 or the composition according to claim 39, for use as a pharmaceutical.
41. Protein particles according to any one of claims 1 to 21 or the composition according to claim 39, for use in the treatment of a target disease or condition.
42. The protein particles or composition for use according to claim 41, wherein the disease or condition includes cancer.
43. A modified protein particle according to any one of claims 1 to 21 or a composition according to claim 39 for use in killing target cells in a subject.
44. A method for treating cancer, the method comprising administering a protein particle according to any one of claims 1 to 21 or a composition according to claim 39 to a target.
45. A method for killing target cells, the method comprising administering manipulated protein particles according to any one of claims 1 to 21 or the composition according to claim 39 to a target.