Cell-specific transcriptional regulatory sequences and their use

JP2026143636APending Publication Date: 2026-09-08VALORISATION HSJ LLP
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2026095571
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-01-24
Filing Date
2026-06-08
Publication Date
2026-09-08

AI Technical Summary

Benefits of technology

【0067】 本発明の他の目的、利点及び特徴は、添付の図面を参照しながら、単に例示として与えられる以下のその特定の実施形態の非制限的な記載を一読することでより明らかになることとなる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026143636000028
    Figure 2026143636000028
  • Figure 2026143636000029
    Figure 2026143636000029
  • Figure 2026143636000030
    Figure 2026143636000030
Patent Text Reader

Abstract

The present invention generally relates to targeted gene expression in specific cell subtypes, such as immune cells, including T cells, B cells, and natural killer (NK) cells, and can be used in hematopoietic stem cell (HSC) engineering and therapies based on such cells. [Solution] Disclosed is a novel synthetic expression cassette comprising a minimal promoter and a cell-specific enhancer that expresses a target nucleic acid in one or more specific cell subtypes. Also disclosed are a vector and host cells comprising the synthetic expression cassette. The application also discloses a method of expressing a target nucleic acid, such as a nucleic acid encoding a chimeric antigen receptor (CAR), in cells, and of treating a disease or condition, such as cancer and genetic disorders, using the synthetic expression cassette, vector and cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-references to related applications This application claims the benefits of U.S. Provisional Application No. 62 / 796,254, filed on 24 January 2019, which is incorporated herein by reference in whole.

[0002] The present invention generally relates to targeted gene expression in specific cell subtypes, such as immune cells, including T cells, B cells, and natural killer (NK) cells, and can be used in hematopoietic stem cell (HSC) engineering and therapies based on such cells. [Background technology]

[0003] Targeted expression of a transduced gene into a given cell subtype or tissue is challenging. In the growing fields of stem cell engineering and induced pluripotent stem cell (iPS) research, the ability to express a given protein only in a target population derived from parental cells is desired. However, using conventional / natural promoters presents technical challenges regarding size and sometimes specificity. For example, in recent years, gene therapy for hematopoietic disorders has relied on transducing transgenes into HSCs under the control of strong promoters. 1、2 In this type of construct, cells derived from modified stem cells will express new genes regardless of the cell subtype, which could lead to dangerous consequences.

[0004] Chimeric antigen receptor (CAR) immunotherapy has emerged as a promising new treatment option for various cancers. In CAR immunotherapy, the patient's immune cells (e.g., T cells, NK cells) are modified to express CARs that bind to tumor antigens, allowing for the specific death of tumor cells expressing those antigens. Currently, this strategy is potent but usually not sustainable, due to in vivo T cell depletion and loss of the modified T cells. Furthermore, injecting large amounts of CAR-T cells can lead to high toxicity due to massive cytokine release (cytokine release syndrome). Therefore, there is a need for approaches that allow for continuous and progressive replenishment of CAR-modified cells in the bloodstream and that limit CAR expression to specific cells (e.g., T cells, NK cells).

[0005] This specification references several sources, the contents of which are incorporated herein by reference in their entirety. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] U.S. Provisional Application Serial Number 62 / 796,254 [Overview of the project] [Means for solving the problem]

[0007] This disclosure provides the following: 1. A synthetic expression cassette that expresses a target nucleic acid in cells, (i) The smallest promoter and (ii) A synthetic expression cassette comprising a transcription enhancer adaptably bound to the minimal promoter for expressing the target nucleic acid in the cells, the transcription enhancer comprising a sequence having at least 70% sequence identity with at least 50 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7 to 47.

[0008] 2. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises a sequence having at least 70% sequence identity with at least 100 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7 to 47.

[0009] 3. The synthetic expression cassette according to item 2, wherein the transcription enhancer comprises a sequence having at least 70% sequence identity with any one of the sequences described in SEQ ID NOs: 7 to 47.

[0010] 4. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with at least 50 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7 to 47.

[0011] 5. The synthetic expression cassette according to item 4, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with at least 100 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7-47.

[0012] 6. The synthetic expression cassette according to item 5, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with any one of the sequences described in SEQ ID NOs: 7 to 47.

[0013] 7. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity with at least 50 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7-47.

[0014] 8. The synthetic expression cassette according to item 7, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity with at least 100 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7-47.

[0015] 9. The synthetic expression cassette according to item 8, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity with any one of the sequences described in SEQ ID NOs: 7 to 47.

[0016] 10. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity with at least 50 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7-47.

[0017] 11. The synthetic expression cassette according to item 10, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity with at least 100 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7-47.

[0018] 12. The synthetic expression cassette according to item 11, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity with any one of the sequences described in SEQ ID NOs: 7 to 47.

[0019] 13. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises or consists of at least 50 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7 to 47.

[0020] 14. The synthetic expression cassette according to claim 13, wherein the transcription enhancer comprises or consists of at least 100 consecutive nucleotides from any one of the sequences described in SEQ ID NOs: 7 to 47.

[0021] 15. The synthetic expression cassette according to item 13, wherein the transcription enhancer comprises or consists of one of the sequences described in SEQ ID NOs: 7 to 47.

[0022] 16. The minimal promoter is the human cytomegalovirus CMV minimal promoter (miniCMV), as described in any one of items 1 to 15 of the synthetic expression cassette.

[0023] 17. The synthetic expression cassette according to item 16, wherein the minimum promoter comprises or consists of the sequence of SEQ ID NO: 6.

[0024] 18. The transcription enhancer is a synthetic expression cassette described in any one of items 1 to 17, located upstream of the minimal promoter in the synthetic expression cassette.

[0025] 19. A synthetic expression cassette according to any one of items 1 to 18, further comprising a polyadenylation (poly(A)) signal.

[0026] 20. A synthetic expression cassette according to any one of items 1 to 19, further comprising a transcription termination signal.

[0027] 21. A synthetic expression cassette according to any one of items 1 to 20, further comprising a target nucleic acid adsorbed to a minimal promoter and a transcriptional enhancer.

[0028] 22. A synthetic expression cassette according to any one of items 1 to 21, further comprising a selection marker.

[0029] 23. A synthetic expression cassette described in any one of items 1 to 22, wherein the cells are stem cells.

[0030] 24. The synthetic expression cassette described in item 23, wherein the stem cells are hematopoietic stem cells (HSCs), embryonic stem cells, totipotent stem cells, pluripotent stem cells, tissue stem cells (multipotent stem cells), or induced pluripotent stem cells (iPSCs).

[0031] 25. The cells are immune cells, as described in any one of items 1 through 22 of the synthetic expression cassette.

[0032] 26. The synthetic expression cassette described in item 25, wherein the immune cells are T cells, natural killer (NK) cells, or B cells.

[0033] 27. The target nucleic acid is a synthetic expression cassette described in any one of sections 1 to 26, encoding a chimeric antigen receptor (CAR).

[0034] A vector comprising a synthetic expression cassette as described in any one of sections 28.1 to 27.

[0035] 29. The above vector is a viral vector, as described in item 28.

[0036] 30. A host cell containing a synthetic expression cassette as described in any one of items 1 to 27 or a vector as described in item 28 or 29.

[0037] 31. The host cell described in item 30, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0038] 32. A composition comprising the host cells described in item 30 or 31.

[0039] 33. A method for inducing the expression of a target nucleic acid by cells, comprising introducing a synthetic expression cassette described in any one of items 1 to 27 or a vector described in item 28 or 29 into the cells.

[0040] 34. The method according to item 33, wherein the target nucleic acid codes for a protein that is deficient or missing in the cell.

[0041] 35. The method according to item 33 or 34, wherein the target nucleic acid described above encodes a chimeric antigen receptor (CAR).

[0042] 36. The method according to any one of items 33 to 35, wherein the cells are hematopoietic stem cells, T cells, natural killer (NK) cells, or B cells.

[0043] 37. A method for treating a disease, symptom, or disorder in a subject, comprising administering to the subject in an effective amount of the cells of item 30 or 31 or the composition of item 32.

[0044] 38. The method according to item 37, wherein the disease, symptom, or disorder is related to the absence of protein expression or the expression of a deficient protein, and the nucleic acid in question encodes a functional form of the protein.

[0045] 39. The method according to item 37, wherein the above-mentioned disease, symptom, or disorder is associated with the expression of an antigen, and the nucleic acid of interest encodes a recombinant receptor that specifically binds to the above-mentioned antigen.

[0046] 40. The recombinant receptor described above is a chimeric antigen receptor (CAR), as described in item 39.

[0047] 41. The method described in paragraph 39 or 40, wherein the disease, symptoms or disorder described above is cancer, an autoimmune or inflammatory disease, or an infection.

[0048] 42. The disease, symptoms or disorder described above is cancer, as described in paragraph 41.

[0049] 43. Cancer is a blood cancer, as described in paragraph 42.

[0050] 44. The method according to any one of items 37 to 43, wherein the cells are hematopoietic stem cells, T cells, natural killer (NK) cells, or B cells.

[0051] 45. The above method requires at least 1 × 10 2 , 1 x 10 3 or 1 × 10 4 The method according to any one of claims 37 to 44, comprising administering individual cells to the subject described above.

[0052] 46. ​​The above method is 1 × 10 6 ~1 × 10 8 The method according to item 45, comprising administering individual cells to the subject described above.

[0053] 47. The method according to any one of items 37 to 46, wherein the cells are autologous cells.

[0054] 48. The method according to any one of Items 37 to 46, wherein the cell is an allogeneic cell.

[0055] 49. The cell according to Item 30 or 31, or the composition according to Item 32, for use in treating a disease, condition or disorder in a subject.

[0056] 50. The cell or composition for use according to Item 50, wherein said disease, condition or disorder is associated with lack of protein expression or expression of a defective protein, and said subject nucleic acid encodes a functional form of said protein.

[0057] 51. The cell or composition for use according to Item 50, wherein said disease, condition or disorder is associated with antigen expression, and the subject nucleic acid encodes a recombinant receptor that specifically binds to said antigen.

[0058] 52. The cell or composition for use according to Item 51, wherein said recombinant receptor is a chimeric antigen receptor (CAR).

[0059] 53. The cell or composition for use according to Item 51 or 52, wherein said disease, condition or disorder is cancer, an autoimmune or inflammatory disease, or an infectious disease.

[0060] 54. The cell or composition for use according to Item 53, wherein said disease, condition or disorder is cancer.

[0061] 55. The cell or composition for use according to Item 54, wherein said cancer is a hematological cancer.

[0062] 56. The cell or composition for use according to any one of Items 49 to 55, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0063] 57. The method comprises at least 1×10 2 , 1×10 3 or 1×10 4A cell or composition for use according to any one of claims 49 to 56, comprising administering individual cells to the subject described above.

[0064] 58. The above method is 1 × 10 6 ~1 × 10 8 Cells or compositions for use according to item 57, comprising administering individual cells to the subject described above.

[0065] 59. The cells or composition for use according to any one of sub-items 49 to 58, wherein the cells are autologous cells.

[0066] 60. The cells or composition for use according to any one of sub-items 49 to 58, wherein the cells are allogeneic cells.

[0067] Other objects, advantages, and features of the present invention will become more apparent upon reading the following non-limiting description of its specific embodiments, which are given merely as examples, with reference to the accompanying drawings.

[0068] The attached drawings show the following: [Brief explanation of the drawing]

[0069] [Figure 1A] Figures 1A and 1B show the cloning strategy used to generate a T cell-specific (Tspe) promoter from Chr16-445. The sequence is shown from bottom to top. [Figure 1B] Same as above. [Figure 2] Figure 2 shows the cloning strategy used to generate a plasmid that produces lentiviral particles for Tenh(Chr16-445). The sequence is shown from bottom to top. [Figure 3A]Figure 3 shows the results of in vitro experiments to evaluate the expression pattern of GFP under the control of the T cell-specific synthetic promoter Chr16-445-minCMV. Figure 3A: Jurkat (T-cells) and K562 (bone marrow) cell lines were transfected with a GFP-encoding vector under a control promoter and a synthetic T-cell-specific promoter for comparison. [Figure 3B] Figure 3B: PBMCs were transfected with a GFP-encoding vector under a control spleen focus-forming virus (SFFV) promoter and under a synthetic T-cell-specific promoter for comparison. [Figure 4] Figure 4 shows the results of in vitro experiments to evaluate the expression pattern of GFP under the control of an NK cell-specific synthetic promoter (NK6, SEQ ID NO: 11). Various cell lines were transfected with a GFP-encoding vector under comparison with the control promoter and the synthetic NK cell-specific promoter. [Figure 5] Figure 5 shows the results of an in vitro experiment aimed at determining the timing and functional expression of GFP under a synthetic NK cell-specific (NKspe-NK8, SEQ ID NO: 14) promoter. In an in vitro differentiation system that allows CD34+ cells to mature into NK cells (OP9-DL4 in NK-specific medium, left box) or B cells (OP9, right box), GFP was shown to be expressed early in NK cell offspring but not in B cells, demonstrating its NK cell specificity. [Figure 6] Figure 6 shows GFP expression in Nalm6 cell lines (B cell lines) transduced with a GFP-encoding lentivirus under the control of a B-cell-specific promoter (B-enh-1, SEQ ID NO: 23, left panel) or a minimal CMV promoter sequence as a negative control (SEQ ID NO: 6, right panel). [Figure 7A]Figure 7 shows the results of in vivo experiments to evaluate the expression pattern of GFP under the control of the Chr16-445 T cell-specific synthetic promoter. In vivo confirmation of the synthetic promoter was evaluated by injecting sublethal irradiated NSG mice, either without human thymus transplantation (Figure 7A) or with human thymus transplantation (BLT model) (Figure 7B), with human CD34+ cells transduced to GFP under the control of the synthetic promoter. Blood analysis showed that the manipulated HSCs were capable of generating various immune populations, and that only T cells expressed the GFP protein, demonstrating the specificity of our promoter. [Figure 7B] Same as above. [Figure 7C] Figure 7C: GFP expression in various cell types in BLT mice transplanted with GFP-transduced CD34+ cells under the control of a nonspecific strong promoter. [Figure 8A] Figures 8A and 8B show the results of in vivo experiments aimed at testing the differentiation of GFP-modified CD34+ cells under the control of an NK cell-specific promoter (NK8, SEQ ID NO: 14). Figure 8A shows the percentage of human CD45+ cells expressing GFP in blood (each left bar graph), spleen (each center bar graph), and bone marrow (each right bar graph) (obtained from two humanized mice). [Figure 8B] Figure 8B shows GFP expression in human CD45+ cells isolated from the bone marrow of two humanized mice. The dot plot shows that when mice are humanized with GFP-transduced CD34+ under the control of an NK8- cell-specific promoter (SEQ ID NO: 14), NK cells (CD56+) express GFP, but B cells (CD19+CD3-) or T cells (CD3+CD19-) do not express GFP. [Figure 9]Figure 9 shows the results of an in vivo experiment aimed at testing the differentiation of GFP-modified CD34+ cells under the control of a B-cell-specific promoter (B-enh-1, SEQ ID NO: 23). GFP expression was observed in the blood of humanized mice 4 weeks after humanization. Cells were gated based on hCD45+ expression. The dot plot shows that when mice were humanized with GFP-transduced CD34+ under the control of a B-cell-specific promoter (SEQ ID NO: 23, center line), B cells (CD19+) expressed GFP, but monocytes (CD14+) did not. Humanized mice with GFP-expressing CD34+ under the control of a non-specific strong promoter (SFFV, lower panel) showed GFP expression in all human subpopulations (hCD45+), while GFP expression was not observed in untransduced CD34+ (negative control). At this point after humanization (4 weeks), no T cells were present in the blood of the mice. [Figure 10A] Figures 10A-D show experimental results to evaluate the ability of T-cell-specific promoters to express functional CARs. Figure 10A: CAR-CD33 expression was measured by flow cytometry after transduction of the CAR-CD33 construct into primary T cells under the control of either a non-specific SFFV promoter or a T-cell-specific promoter. [Figure 10B] Figure 10B: Cytotoxicity of CAR-CD33-expressing T- cells against AML cells by CD33+ or CD33- under the control of the SFFV (strong) promoter or T-cell-specific promoter (Tspe), in a ratio of 2:1 (no significant difference). *** indicates p<0.001. [Figure 10C] Figure 10C: CAR-CD22 expressed under the Tenh Chr16-445 (Tspe) promoter induced sufficiently strong CAR expression to result in CAR-specific cytotoxicity against RS4;11 ALL- cells, similar to the cytotoxicity under the SFFV (strong) promoter (ratios: 0.5:1 / 1:1 / 2:1 / 4:1). [Figure 10D]Figure 10D: Primary T cells transduced with CAR-GD2 under the control of a T-cell-specific promoter (Chr16-445) (square) induced cytotoxicity against the GD2+ NB cell line (SK-N-DZ) at a similar level to primary T cells transduced with a non-specific strong promoter (SFFV, circle). In contrast, unmodified primary T cells (rhomboid) did not kill the target cell line. **** indicates p<0.0001. [Figure 11A] Figures 11A-C show the results of in vitro experiments aimed at determining the T cell differentiation stage at which a T cell-specific promoter is expressed. The in vitro differentiation system that allows CD34+ cells to mature into T cells (OP9-DL4-, Figure 11A) or B cells (OP9, Figure 11B) showed that CAR is expressed early in the T cell differentiation process (CD1aCD7+ stage) but not in B cells, confirming its T cell specificity. [Figure 11B] Same as above. [Figure 11C] Figure 11C shows the expression rates of CAR-CD22 in various subpopulations obtained from the OP9-DL4 and OP9 systems when CAR-CD22 is expressed under the control of a T-cell specific promoter (Chr16-445, each center bar graph) or a non-specific strong promoter (UCOE-SFFV, each left bar graph). The black bar graph (left) shows the results obtained from untransduced cells as a negative control. DP: Double positive. [Figure 12] Figure 12 shows the results of an in vivo experiment aimed at testing the differentiation of CAR-CD22-transfected CD34+ cells under the control of a T-cell-specific promoter (Chr16-445). CAR-CD22 expression was observed in hCD45+ cells in the blood of BLT mice 30 weeks after humanization. The histogram plot shows that when mice were humanized with CAR-CD22-modified CD34+ under the control of the T-cell-specific promoter (Chr16-445) (left column), T cells (CD3+) expressed CAR-CD22, but B cells (CD19+) or monocytes (CD14+) did not. This expression was not observed when CD34+ was not transduced (negative control, right column). [Figure 13] The results of sequence analysis in Example 2, using the oPOSSUM tool (http: / / opossum.cisreg.ca / oPOSSUM3 / , Kwon AT, Arenillas DJ, Worsley Hunt R, Wasserman WW.G3.2012 Sep;2(9):987-1002.Epub 2012 Sep 1), which allows the detection of high-frequency conserved transcription factor binding sites and binding site combinations in the sequence set, are shown below. [Modes for carrying out the invention]

[0070] Unless otherwise specified herein, scientific and technical terms used in this disclosure shall have the meanings commonly understood by those skilled in the art. Furthermore, unless otherwise required by context, singular nouns shall include plural nouns, and plural nouns shall include singular nouns. In general, the technical terms used herein in relation to or in relation to cell and tissue culture, molecular biology, immunology, microbiology, genetics, and the chemistry and hybridization of proteins and nucleic acids are well known and commonly used in the art. The methods and techniques described herein are generally carried out in accordance with conventional and well known methods in the art, and, unless otherwise indicated, as described in the various general and more detailed references referenced and discussed throughout this specification. For example, Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3 rdSee also: ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). All enzymatic reactions or purification techniques are carried out according to the manufacturer's instructions, either as commonly achieved in the art or as described herein. The technical terms used herein in relation to analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry, as well as in these laboratory procedures and techniques, are well known and commonly used in the art.

[0071] In the context of describing technology (particularly in the claims), the use of the words "a," "an," and "the," and similar references, shall be interpreted to cover both singular and plural forms, unless otherwise indicated herein or unless the context clearly contradicts this interpretation.

[0072] Unless otherwise stated, the words "comprising," "having," "including," and "containing" are interpreted as open-ended words (i.e., meaning "including, but not limited to.").

[0073] The descriptions of value ranges in this specification are merely intended to serve as a simplified way of referring separately to each individual value that falls within that range, unless otherwise specified herein, and each individual value is included in the description as if it were individually described herein. All subsets of values ​​within that range are also included in the description as if they were individually described herein.

[0074] Any and all examples provided herein, or any use of exemplary language ("for example," "e.g."), is intended solely to better illustrate the technology and, unless otherwise requested, does not constitute a limitation on the scope of the present invention.

[0075] In this specification, no wording should be construed as indicating any element not claimed as essential to the procedure of the present invention.

[0076] In this specification, the word “approximately” has its usual meaning. The word “approximately” is used to indicate that a value includes inherent error variation in the device or method used to determine that value, or to include values ​​close to the stated value that are, for example, within 10% of the stated value (or range of values).

[0077] The inventors have developed a strategy to replace the use of conventional promoters by designing specific synthetic regulators that target the expression of target genes using a cell subtype-specific method. By manipulating transduced genes under the control of these synthetic regulators and transducing this construct into stem cells, it is possible to exclusively control gene expression in specific and targeted cell subtypes (or cell subtypes) derived from these genetically modified stem cells, which significantly improves practical methods. Several candidate cell-specific transcriptional enhancers were identified. As proof of concept, a first “synthetic regulator” was designed, including a candidate T cell-specific transcriptional enhancer that specifically induced transgene expression in a human T cell population. A similar methodology was successfully applied to design other cell-specific promoters, particularly two human NK cell-specific promoters and one B cell-specific promoter. The designed human T / NK / B cell-specific promoters are smaller in size and exhibit good specificity, making them acceptable for use in human gene therapy and HSC engineering.

[0078] Synthetic expression cassette Accordingly, in a first embodiment, the present disclosure provides a synthetic expression cassette for expressing a target nucleic acid (e.g., a gene, gRNA, miRNA, shRNA) in a cell, comprising a minimal promoter and a transcription enhancer configurably bound to the minimal promoter for the expression of the target nucleic acid in the cell, wherein the transcription enhancer comprises, in sequence numbers 7-47, at least 50 consecutive / adjacent nucleotides, preferably at least 100, 150, 200, or 250 consecutive / adjacent nucleotides, and a sequence having at least 70% sequence identity, preferably from one of the sequences described in sequence numbers 7-17 and 23.

[0079] The terms “enhancer,” “transcriptional enhancer,” or “transcriptional regulator” refer to a cis-acting sequence that includes one or more binding sites for a transcription factor or transcriptional activator and increases the activity of a promoter (e.g., a minimal promoter) in an orientation-dependent and position-dependent manner. The transcriptional enhancer may be located upstream or downstream of the minimal promoter. In some embodiments, the transcriptional enhancer is located upstream of the promoter.

[0080] In one embodiment, the transcriptional enhancer is a cell type or subtype-specific transcriptional enhancer, i.e., the transcriptional enhancer specifically increases promoter activity (and also the expression of the target peptide / protein or nucleic acid (e.g., miRNA, shRNA, gRNA)) in a particular cell type or subtype. As used herein, the term “specifically increases” means that the increase in the activity of the minimal promoter in the target cell type or subtype is greater than the increase in other cell types or subtypes. In an embodiment, the transcriptional enhancer is an immune cell-specific transcriptional enhancer, i.e., it specifically increases promoter activity in one or more immune cell types, such as T cells, NK cells, B cells, macrophages, dendritic cells, basophils, neutrophils, etc. In one embodiment, the immune cell-specific transcription enhancer includes a sequence in SEQ ID NOs: 7-47 that has at least 70% sequence identity with at least 50 consecutive / adjacent nucleotides, preferably at least 100, 150, 200, or 250 consecutive / adjacent nucleotides, from one of the sequences described in SEQ ID NOs: 7-17 and 23, and maintains transcriptional enhancement activity (i.e., exhibits transcriptional enhancement activity similar to or better than the native sequence). In one embodiment, the immune cell-specific transcription enhancer includes a sequence in SEQ ID NOs: 7-47 that has at least 70% sequence identity with one of the sequences described in SEQ ID NOs: 7-17 and 23, and maintains transcriptional enhancement activity (i.e., exhibits transcriptional enhancement activity similar to or better than the native sequence).

[0081] In further embodiments, the immune cell-specific transcription enhancer includes or comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with at least 50 consecutive / adjacent nucleotides, preferably at least 100, 150, 200, or 250 consecutive / adjacent nucleotides, from one of the sequences described in Sequence IDs 7-17 and 23.

[0082] In further embodiments, the immune cell-specific transcription enhancer comprises or consists of at least 50 consecutive / adjacent nucleotides, preferably at least 100, 150, 200, or 250 consecutive / adjacent residues, from one of the sequences described in Sequence IDs 7-47, preferably from one of the sequences described in Sequence IDs 7-17 and 23.

[0083] Some of the sequences described in SEQ ID NOs: 7-47 contain repeating domains / motifs. For example, the sequence described in SEQ ID NO: 7 contains a repeating domain / motif of approximately 50 nucleotides (sequence: GGTGTGGAGGGCCGGGTGGTGACX). 1 CTX 2 AGTGACAGGTGAGGATGTGGCAX 3 (Sequence number 63) is included, where X 1 is G or A, preferably G, X 2 is G or C, preferably G, and also X 3is C or T, preferably C. In some embodiments, the cell-specific transcription enhancer includes at least one, preferably at least two, three, four, five, six, seven, or eight repeat domains / motifs. A list of putative repeat motifs present in each of the sequences described in SEQ ID NOs. 7 to 47 is shown in Table IV (SEQ ID NOs. 64 to 82, and AAAACCACA). That is, in some embodiments, the transcription enhancer sequence includes one or more of the motifs shown in Table IV (SEQ ID NOs. 64 to 82, and AAAACCACA). For example, SEQ ID NOs. 8 includes one or more of the motifs shown in Table IV: #3 (SEQ ID NOs. 66), #4 (SEQ ID NOs. 67), #17 (SEQ ID NOs. 80), and 20 (AAACCACA). In further embodiments, the transcription enhancer sequence includes the motifs and repeats shown in Table IV for each of SEQ ID NOs. 7 to 47.

[0084] In one embodiment, the synthetic expression cassette is for expressing a target nucleic acid in T cells, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 7-10, 13, 14, preferably SEQ ID NOs: 7-10, 13, 14. In further embodiments, the synthetic expression cassette is for expressing the target nucleic acid in T cells, and the transcription enhancer contains or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 7, 9, 27, 33, 34, 36, 37, 42, 43, and 45, preferably SEQ ID NOs: 7 and 9. In one embodiment, the cells are CD4 + The cell, and the transcription enhancer, contains or comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 22, 34, 37, 38, 43, 45, and 47.

[0085] In one embodiment, the synthetic expression cassette is for expressing a target nucleic acid in NK cells, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 8, 10-14, 18-22, 24-26, 28-31, 35, 38-41, 44, and 47, preferably SEQ ID NOs: 11, 12, and 14.

[0086] In one embodiment, the synthetic expression cassette is for expressing the target nucleic acid in NK cells and T cells, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence described in SEQ ID NOs. 8, 10, 13, and 14.

[0087] In one embodiment, the synthetic expression cassette is for expressing a target nucleic acid in B cells, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs. 15-17, 23, 32, 44, and 46, preferably SEQ ID NOs. 15-17 and 23, and more preferably SEQ ID NO. 23.

[0088] In one embodiment, the synthetic expression cassette is for expressing a target nucleic acid in B cells and NK cells, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NO: 44.

[0089] In one embodiment, the synthetic expression cassette is for expressing a target nucleic acid in immune cells such as NK cells, T cells, basophils, and monocytes / macrophages, and the transcription enhancer includes or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence described in SEQ ID NO: 14.

[0090] In one embodiment, the cell is CD4 + Cells (e.g., CD4) + The T cell is a transcriptional enhancer and contains or comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 22, 34, 37, 38, 43, 45, and 47.

[0091] In another embodiment, the cells are CD8 + Cells (e.g., CD8) + The T cell is a transcriptional enhancer, and the transcriptional enhancer contains or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of the sequences described in SEQ ID NOs: 33, 35, and 39-41.

[0092] In some embodiments, the transcriptional enhancer sequence includes one or more binding sites for transcription factors. In some embodiments, the transcriptional enhancer sequence includes binding sites for at least two transcription factors. In some embodiments, the transcriptional enhancer sequence includes binding sites for at least three transcription factors. In some embodiments, the transcriptional enhancer sequence includes binding sites for at least four transcription factors. For example, the sequence described in Sequence ID No. 13 includes binding sites for the transcription factors RUNX3, GATA2, FOS, and JUN, meaning that in some embodiments, the cell-specific transcriptional enhancer sequence includes one, two, three, or all of these binding sites. Table V shows the putative binding sites for transcription factors in each of the sequences described in Sequence ID Nos. 7 to 47. That is, in some embodiments, the transcriptional enhancer sequence includes one or more of the binding sites for transcription factors shown in Table V.

[0093] The term “minimal promoter” refers to a promoter that contains only the minimum elements of a promoter, namely the TATA box (also known as the Goldberg-Hogness box) and the transcription start site, and is inactive (or poorly active) in inducing / driving gene expression in the absence of one or more appropriately placed (usually upstream) regulatory factors (transcriptional enhancers) that enhance promoter activity. Any minimal promoter sequence known to those skilled in the art is intended to be included in the minimal promoter sequences of this disclosure. Minimal promoter sequences are often derived from viruses or are cleavage-type eukaryotic promoters, i.e., minimal promoters may be the proopiomelanocortin minimal promoter (POMC), adenovirus minimal promoter, baculovirus minimal promoter, CMV minimal promoter, parvovirus minimal promoter, herpesvirus minimal promoter, poxvirus minimal promoter, adeno-associated virus minimal promoter, Semryki Forest virus minimal promoter, SV40 minimal promoter, vaccinia virus minimal promoter, or retrovirus minimal promoter. Examples of minimal promoters include the human simplexvirus thymidine kinase (HSV TK or miniTK) minimal promoter, the cauliflower mosaic virus (CaMV) 35S minimal promoter, the human cytomegalovirus CMV minimal promoter (miniCMV), CMV53 (minCMV with an upstream GC box added), the simian virus 40 minimal promoter (minSV40), MLP (the -38 to +6 region of the adenovirus major late promoter), minP (a synthetic minimal promoter consisting of a TATA box and transcription start site, from Promega), pJB42CAT5 (a minimal promoter derived from the human junB gene), YB_TATA, and the supercore promoter 1 (SCP1) minimal promoter (see Table I below). Several minimal promoters (sometimes called "core promoters") are described in Ede et al., ACS Synth Biol. 2016 May 20;5(5):395-404.

[0094] Table 1

[0095] Sequence identity between two nucleotide sequences can be determined by comparing their positions in aligned sequences. The degree of identity between nucleotide sequences is a function of the number of matching nucleotides at the positions they share. As used herein, a given degree of agreement between sequences indicates the degree of sequence identity in optimally aligned sequences. Optimal sequence alignment for identity comparison can be performed using various algorithms and sequence alignment methods, such as the local homology algorithm by Smith and Waterman, 1981, Adv.Appl.Math 2:482; the homology alignment algorithm by Needleman and Wunsch, 1970, J.Mol.Biol.48:443; and the search for similarity method by Pearson and Lipman, 1988, Proc.Natl.Acad.Sci.USA 85:2444, as well as computer-based implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package by Genetics Computer Group in Madison, Wisconsin, USA). Sequence identity may also be determined using the BLAST algorithm (using the publicly available default settings) described by Altschul et al., 1990, J.Mol.Biol.215:403-10. Software / methods for performing BLAST analysis may be available through the National Center for Biotechnology Information. Other sequence alignment methods, such as Needle, Stretcher, Clustal Omega, and Kalign, are available through the European Bioinformatics Institute (EMBL-EBI).

[0096] The terms “positioned to function,” “linked to function,” and “bound to function” mean that a promoter (and / or enhancer) is in a precise functional position and orientation relative to a nucleic acid sequence to control the transcription initiation and expression of that nucleic acid. An enhancer is “bound to function” a promoter (e.g., a minimal promoter) when it is in a precise functional position and orientation to increase the promoter’s transcriptional activity.

[0097] The term "synthetic" means that the expression cassette is an artificial or recombinant construct that does not exist in nature, i.e., the combination of minimal promoter and transcriptional enhancer does not exist naturally within the cell's native genome. In some embodiments, the minimal promoter is heterogeneous in the presence of the transcriptional enhancer, i.e., the minimal promoter does not normally bind to the transcriptional enhancer in its natural environment, for example, they do not regulate the expression of the gene in the cell's native genome. In some embodiments, the minimal promoter and transcriptional enhancer are from different cell types or different organisms (e.g., eukaryotic cells versus viruses). In some embodiments, the minimal promoter and / or transcriptional enhancer are heterogeneous in the presence of the target nucleic acid, i.e., they do not normally bind to the target nucleic acid in its natural environment. In some embodiments, the transcriptional enhancer is of human origin. In some embodiments, the minimal promoter is of viral origin.

[0098] In some embodiments, the synthetic expression cassette further includes a polyadenylation (poly(A)) signal. The poly(A) signal produces appropriate polyadenylation (transcription) of the target nucleic acid. The properties of the poly(A) signal are not considered to be critical to the success of the invention, and therefore any such sequence may be adopted. Representative examples of poly(A) signals include the SV40 poly(A) signal and / or the bovine growth hormone poly(A) signal, which are convenient and / or known to function well in various target cells. In some embodiments, the synthetic expression cassette further includes a posttranscriptional regulatory element (WPRE) of woodchuck hepatitis virus (WHP). Such factors are typically used to increase the expression of genes induced by viral vectors and are known to increase mRNA stability and protein yield (see, e.g., Lee, YB, et al. 2005. Exp Physiol. 90(1):33-7). In some embodiments, the WPRE is used in combination with the poly(A) signal. In another embodiment, WPRE is replaced by a poly(A) signal.

[0099] In one embodiment, the synthetic expression cassette further includes a transcription termination signal. The “termination signal” or “terminator” consists of a DNA sequence involved in the specific termination of RNA transcription by RNA polymerase. In other words, in one embodiment, a termination signal is envisioned that ends the production of RNA transcription.

[0100] In some embodiments, the synthetic expression cassette further comprises a target nucleic acid. The terms “target nucleic acid” or “target gene” are used to refer to the nucleic acid encoding the functional peptide or polypeptide (protein) of interest (natural or modified peptide / protein). In some embodiments, the functional peptide or polypeptide is a therapeutic peptide or polypeptide, i.e., a peptide or polypeptide that can be administered to a subject for the purpose of treating or preventing a disease. It is assumed that any nucleic acid encoding the target peptide or polypeptide, known to those skilled in the art, will be included in the synthetic expression cassette. The target peptide or polypeptide may be an enzyme, a signaling molecule (e.g., kinase, phosphatase), a receptor, a growth factor (e.g., cytokine), a chemotactic protein (e.g., chemokine), a structural protein (cytoskeletal protein), a transcription factor, a cell adhesion protein, or an antibody or antigen-binding fragment thereof. The peptide or polypeptide may be a naturally occurring peptide or polypeptide, a fragment or variant thereof, or a chimeric version thereof.

[0101] In some embodiments, the nucleic acid in question encodes a recombinant receptor, such as a chimeric antigen receptor (CAR). Such CARs typically include a ligand-binding domain (e.g., an antibody or antibody fragment, such as a single-chain variable fragment (scFv), which provides specificity for a desired antigen (e.g., a tumor antigen) linked via a linker and / or transmembrane domain to an intracellular activation domain portion, such as a T cell or NK cell activation domain, which provides a primary activation signal, in some embodiments.

[0102] In certain embodiments, the recombinant receptor (e.g., CAR) includes an activated cytoplasmic signaling domain (also referred to as an intracellular signaling region), such as an activated cytoplasmic (intracellular) domain that can induce primary activation signals in immune cells (e.g., T cells, NK cells), a cytoplasmic signaling domain of a T cell receptor (TCR) component (e.g., a cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling moiety thereof), and / or an intracellular signaling domain including an immune receptor tyrosine system activation motif (ITAM).

[0103] In some embodiments, the recombinant receptor (e.g., CAR) further comprises an extracellular ligand-binding domain that specifically binds to a ligand (e.g., antigen). In some embodiments, the ligand, such as an antigen, is a protein expressed on the cell surface. In some embodiments, the CAR is a TCR-like CAR, and the antigen is a treated peptide antigen, such as an intracellular protein peptide antigen, that is recognized on the cell surface in the context of a major histocompatibility complex (MHC) molecule.

[0104] Exemplary recombinant receptors include not only CARs and recombinant TCRs but also methods for engineering and introducing receptors into cells, for example, in the publication numbers of international patent applications: International Publication No. 2000 / 14257, International Publication No. 2013 / 126726, International Publication No. 2012 / 129514, International Publication No. 2014 / 031687, International Publication No. 2013 / 166321, International Publication No. 2013 / 071154, International Publication No. 2013 / 123061, and in the publication numbers of US patent applications: US2002 / 131960, US201 The inventions described in 3 / 287748, US2013 / 0149337, U.S. Patent Nos. 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118, and European Patent Application No. EP2537416, and / or Sadelain Examples include those described in et al., Cancer Discov. 2013 April;3(4):388-398;Davila et al. (2013) PLoS ONE 8(4):e61338;Turtle et al., Curr. Opin. Immunol, 2012 October;24(5):633-39;Wu et al., Cancer, 2012 March 18(2):160-75. In some embodiments, examples of genetically engineered antigen receptors include the CAR described in U.S. Patent No. 7,446,190 and the International Patent Publication No. 2014 / 055668, which is a published international patent application.

[0105] In some embodiments, the recombinant receptor (e.g., CAR) includes an antigen-binding domain or ligand-binding domain within the extracellular portion of the recombinant receptor that binds (specifically binds) to an antigen (or ligand), such as one or more antigen-binding fragments, domains or portions, or one or more antibody-variable domains, and / or an antibody molecule. In some embodiments, the CAR is, for example, the variable heavy chain (V) of a monoclonal antibody (mAb). H ) and variable light chain (V L The term "antibody" as used herein is used in a broad sense and includes polyclonal antibodies and monoclonal antibodies, and includes intact antibodies and functional (antigen-binding) antibody fragments, including single-chain antibody fragments (scFv) that can specifically bind to an antigen, single-chain antibody fragments containing single-chain variable fragments (scFv), and fragments of single-domain antibodies (e.g., sdAb, sdFv, nanobody). The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intracellular antibodies, peptide bodies, chimeric antibodies, fully human antibodies, and humanized antibodies, as well as heteroconjugate antibodies, such as bispecific, polyspecific, bispecific, tripspecific, and quadruplespecific antibodies, tandem di-scFv, and tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass its functional antibody fragment. The term also encompasses intact or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses IgM, IgE, IgA, and IgD.

[0106] In some embodiments, antigen-binding proteins, antibodies, and their antigen-binding fragments specifically recognize the antigen of a full-length antibody. In some embodiments, the heavy and light chains of the antibody may be full-length or may be antigen-binding moieties (Fab, F(ab')2, Fv, or single-chain Fv fragments (scFv)). In other embodiments, the constant region of the antibody's heavy chain is selected from, for example, IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, and more particularly from, for example, IgG1, IgG2, IgG3, and IgG4, and more specifically from IgG1 (e.g., human IgG1). In yet another embodiment, the constant region of the antibody's light chain is selected from, for example, kappa or lambda, and more particularly from kappa.

[0107] The term "variable region" or "variable domain" refers to the domains of the heavy or light chain of an antibody that are involved in the binding of the antibody to an antigen. (V) H and V L The variable domains of ) generally have a similar structure, and each domain contains four conserved framework regions (FRs) and three CDRs (e.g., Kindt et al. Kuby Immunology, 6 th See ed., WH Freeman and Co., page 91 (2007). V H or V L A single domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind to a specific antigen may each have complementary V L or V H From antibodies that bind to antigens to screen a library of domains, V L or V H It can be isolated using the domain. For example, see Portolano et al., J.Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0108] A single-domain antibody (sdAb) is an antibody fragment that contains all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In certain embodiments, the single-domain antibody is a human single-domain antibody.

[0109] Antibody fragments can be produced by various techniques, including, but are not limited to, protein digestion of intact antibodies as well as production by recombinant host cells. In some embodiments, the antibody is a recombinant fragment, such as a fragment containing a sequence that does not occur naturally and / or cannot be produced by enzymatic digestion of naturally occurring intact antibodies, for example, a synthetic linker that links two or more antibody regions or antibody chains, for example, a peptide linker. In some embodiments, the antibody fragment is an scFv.

[0110] A “humanized” antibody is one in which all or substantially all CDR amino acid residues are derived from non-human CDRs, and all or substantially all FR amino acid residues are derived from human FRs. A humanized antibody may optionally contain at least a portion of the antibody constant region derived from a human antibody. A “humanized form” of a non-human antibody refers to a variant of a non-human antibody that has been humanized in such a way that it retains the specificity and affinity of the parent non-human antibody, while typically reducing its immunogenicity against humans. In some embodiments, some FR residues in the humanized antibody are replaced with corresponding residues from a non-human antibody (e.g., an antibody from which CDR residues are derived) to retain or improve, for example, the specificity or affinity of the antibody.

[0111] In some embodiments, the CAR includes an antibody or antigen-binding fragment (e.g., scFv) that specifically recognizes an antigen expressed on the cell surface, such as an intact antigen.

[0112] In some embodiments, the CAR includes a TCR-like antibody, such as an antibody or antigen-binding fragment (e.g., scFv), that specifically recognizes intracellular antigens, such as tumor-associated antigens, that exist on the cell surface as MHC-peptide complexes. In some embodiments, the antibody that recognizes the MHC-peptide complex or its antigen-binding portion can be expressed on the cell as part of a recombinant receptor, such as an antigen receptor. Among antigen receptors are functional non-TCR antigen receptors, such as chimeric antigen receptors (CARs). Generally, a CAR containing an antibody or antigen-binding fragment that exhibits TCR-like specificity directed towards a peptide-MHC complex may also be called a TCR-like CAR.

[0113] In some embodiments, the recombinant receptor includes a recombinant T cell receptor (TCR) and / or a TCR cloned from a naturally occurring T cell. In some embodiments, the T cell receptor (TCR) includes variable α and β chains (also known as TCRα and TCRβ, respectively) or variable γ and δ chains (also known as TCRγ and TCRδ, respectively), or a functional fragment thereof, so that the molecule can specifically bind to an antigen peptide bound to an MHC receptor. In some embodiments, the TCR is in the αβ form. Typically, TCRs existing in the αβ and γδ forms are generally structurally similar, but the T cells expressing them may have characteristic anatomical locations or functions. TCRs can exist on the cell surface or in a soluble form. Generally, TCRs are located on the surface of T cells (or T lymphocytes) where they are generally involved in recognizing antigens that bind to MHC molecules. In some embodiments, the TCR may also comprise a constant domain, a transmembrane domain, and / or a short cytoplasmic end (e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3 rd(See ed., Current Biology Publications, p.4:33, 1997). For example, in some embodiments, each chain of the TCR may contain one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic end at the C-terminus. In some embodiments, the TCR binds to an invariant protein of the CD3 complex involved in mediating signaling.

[0114] In some embodiments, a TCR for a target antigen (e.g., a cancer / tumor antigen) is identified and introduced into cells. In some embodiments, the nucleic acid encoding the TCR can be obtained from various sources, for example, by polymerase chain reaction (PCR) amplification of a publicly available TCR DNA sequence. In some embodiments, the TCR is obtained from a biological origin, such as from cells, for example, T cells (e.g., cytotoxic T cells), T cell hybridomas, or other publicly available sources. In some embodiments, T cells can be obtained from cells isolated in vivo. In some embodiments, high-affinity T cell clones can be isolated from patients and isolated TCRs. In some embodiments, T cells can be cultured T cell hybridomas or clones. In some embodiments, the TCR clone for the target antigen was generated in a transgene mouse modified with human immune system genes (e.g., human leukocyte antigen system, or HLA). For example, see tumor antigens (see, for example, Parkhurst et al. (2009) Clin Cancer Res. 15:169-180 and Cohen et al. (2005) J Immunol. 175:5799-5808). In some embodiments, phage display is used to isolate a TCR for a target antigen (see, for example, Varela-Rohena et al. (2008) Nat Med. 14:1390-1395 and Li (2005) Nat BioTechnol. 23:349-354). In some embodiments, the TCR or its antigen-binding moiety can be generated by synthesis from knowledge of the sequence of the target TCR.

[0115] In some embodiments, the recombinant receptor (e.g., a CAR, which is an antibody or its antigen-binding fragment) further includes a spacer which may be at least a portion of, or include at least a portion of, the constant region of an immunoglobulin or a variant or modified version thereof, such as a hinge region, such as the IgG4 hinge region, and / or the CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is that of human IgG, such as IgG4 or IgG1. In some embodiments, the portion of the constant region functions as a spacer region between the antigen-recognizing component, such as scFv, and the transmembrane domain. This spacer may be of a length that increases cellular responsiveness after antigen binding compared to the absence of the spacer. Examples of spacers include those having at least about 10 to 220 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and also include any integer between either endpoint of any of the listed ranges. Examples of spacers include the IgG4 hinge alone, the IgG4 hinge linked to the CH2 and CH3 domains, or the IgG4 hinge linked to the CH3 domain. Examples of spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153, or PCT Patent Application Publication No., International Publication No. 2014 / 031687.

[0116] The antigen / ligand recognition domain generally links to one or more intracellular signaling components, such as signaling components, that mimic activation via an antigen-receptor complex (e.g., a TCR or NK receptor complex in the case of a CAR) and / or signaling via another cell surface receptor. That is, in some embodiments, the antigen-binding component (e.g., an antibody) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain fuses with an extracellular domain. In some embodiments, a transmembrane domain that naturally binds to one of the domains in a receptor, such as a CAR, is used. In some examples, the transmembrane domain is selected or modified by amino acid substitution to minimize interaction with other components of the receptor complex by preventing the binding of the domain to the transmembrane domain of the same or different cell surface membrane proteins.

[0117] In some embodiments, the transmembrane domains originate from either a natural or synthetic source. If the source is natural, the domains in some embodiments originate from any membrane-bound or transmembrane protein. The transmembrane region includes those derived from the alpha, beta, or zeta chains of TCR, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154 (i.e., including at least the transmembrane region of these). Alternatively, the transmembrane domains in some embodiments are synthetic. In some embodiments, the synthetic transmembrane domains include primarily hydrophobic residues such as leucine and valine. In some embodiments, a triplet of phenylalanine, tryptophan, and valine is present at each end of the synthetic transmembrane domain.

[0118] Some intracellular signaling domains mimic or approximate signals mediated by innate antigen receptors, signals mediated by such receptors in combination with costimulatory receptors, and / or signals mediated by costimulatory receptors alone. In some embodiments, there are short oligolinkers or polypeptide linkers, for example, linkers with a length of 2 to 10 amino acids, such as those containing glycine and serine in the form of a glycine-serine doublet, that form a linkage between the transmembrane domain of the CAR and the cytoplasmic signaling domain.

[0119] For example, a receptor that is a CAR generally contains at least one intracellular signaling component. In some embodiments, the receptor contains an intracellular component of the TCR complex, such as the CD3 ζ chain, which mediates T-cell activation and cytotoxicity. That is, in some embodiments, the CAR is linked to one or more cellular signaling modules. In some embodiments, the cellular signaling module contains a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor that is a CAR further contains one or more further molecular portions, such as Fc receptor γ, CD8, CD4, CD25, or CD16. In some embodiments, the CAR contains a primary cytoplasmic signaling sequence that controls the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts upon stimulation may contain an immunoreceptor tyrosine system activating motif or a signaling motif known as an ITAM. Examples of ITAMs containing a primary cytoplasmic signaling sequence include those derived from TCR or CD3 ζ, FcR gamma, or FcR beta. In some embodiments, the cytoplasmic signaling molecule in the CAR includes a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3ζ. In some embodiments, components for generating secondary or co-stimulatory signals, such as the signaling domains of costimulatory receptors like CD28, 4-1BB, OX40, DAP10, and ICOS, are also included within the CAR to facilitate full activation. In some embodiments, additional CARs are expressed within the same cell to provide components for generating secondary or co-stimulatory signals. In some cases, the CARs are referred to as first-generation, second-generation, and / or third-generation CARs.In some embodiments, the first-generation CAR provides a signal that is induced by the antigen receptor (e.g., the CD3 chain) upon antigen binding; in some embodiments, the second-generation CAR provides both the signal and a co-stimulatory signal, including an intracellular signaling domain from a co-stimulatory receptor such as CD28 or CD137; and in some embodiments, the third-generation CAR, in some aspects, includes multiple co-stimulatory domains from different co-stimulatory receptors.

[0120] In some embodiments, the CAR or other antigen receptor may further contain a marker, or the cell may further express a marker, such as an alternative marker, which can be used to confirm the transduction or engineering of cells expressing a receptor, such as a cleaved cell surface receptor, such as a cleaved EGFR (tEGFR). In some embodiments, the marker includes all or part of CD34 (e.g., cleaved), NGFR, or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a polynucleotide encoding a linker sequence, such as a cleavable linker sequence, such as T2A. See International Publication No. 2014 / 031687. In some embodiments, by introducing a construct encoding a CAR and EGFRt separated by a T2A ribosome switch, two proteins from the same construct can be expressed, so that EGFRt can be used as a marker to detect cells expressing the construct. In some embodiments, the marker and optionally the linker sequence may be any of those disclosed in the published patent application, International Publication No. 2014 / 031687. For example, the marker may be a cleavable EGFR (tEGFR) which may be linked to a linker sequence, such as a T2A cleavable linker sequence.

[0121] Some antigens that can be targeted by chimeric receptors are expressed in the context of diseases, conditions, or cell types targeted via adoptive cell therapy. These diseases and conditions include proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, which are cancers of the immune system, such as hematological cancers, e.g., lymphoma, leukemia, and / or myeloma (e.g., B-cell, T-cell, and myeloid leukemia, lymphoma, and multiple myeloma).

[0122] In some embodiments, the antigen (or ligand) is a polypeptide. In some embodiments, it is a carbohydrate or another molecule. In some embodiments, the antigen (or ligand) is selectively expressed or overexpressed on disease or disorder cells, such as tumor / cancer or pathogenic cells, compared to normal or non-target cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or on modified cells.

[0123] In some embodiments, the antigen (or ligand) is a tumor antigen or cancer marker. In some embodiments, the antigen is an integrin (e.g., α v β6 integrin, α vβ3 integrin, integrin β7), B cell maturation antigen (BCMA), B7-H6, carbonic anhydrase 9 (also known as CA9, CAIX, or G250), cancer-testis antigen, cancer / testis antigen IB (also known as CTAG, NY-ESO-1, and LAGE-2), fetal cancer antigen (CEA), cyclin, cyclin A2, CC motif chemokine ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), truncated epidermal growth factor protein (tEGFR), type III epidermal growth factor receptor mutation (EGFR vIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrin B2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor-like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), folate-binding protein (FBP), folate receptor alpha, fetal acetylcholine receptor, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside GD3, glycoprotein 100 (gp100), Her2 / neu (receptor tyrosine kinase HerbB2, Her3 (erb-B3), Her4 (erb-B4), erbB dimer, human high molecular weight melanoma-associated antigen (HMW-MAA), hepatitis B surface antigen, human leukocyte antigen A1 (HLA-A1), human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Rα), IL-13 receptor alpha 2 (IL-13Rα2), kinase insertion domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1CAM), CE7 epitope of L1CAM, leucine-rich repeat sequence-containing 8 family member A (LRRC8A), LewisY, Melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, Mesothelin, c-Met, Mouse cytomegalovirus (CMV), Mucin 1 (MUC1), MUC16, Natural killer group 2 member D (NKG2D) ligand, Melan A (MART-1), Neuronal cell adhesion molecule (NCAM), Tumor embryonic antigen, Melanoma preferential expression antigen (PRAME), Progesterone receptor, Prostate-specific antigen, Prostate stem cell antigen (PSCA), Prostate-specific membrane antigen (PSMA), Receptor tyrosine kinase-like orphan receptor The antigens include Receptor 1 (ROR1), Survivin, Trophoblast Glycoprotein (TPBG, also known as 5T4), Tumor-Associated Glycoprotein 72 (TAG72), Vascular Endothelial Growth Factor Receptor (VEGFR), Vascular Endothelial Growth Factor Receptor 2 (VEGFR2), Wilms Tumor 1 (WT-1), Galectin (Galectin-1, Galectin-7), pathogen-specific antigens, or antigens that bind to a universal tag and / or to biotinylated molecules and / or to molecules expressed by HIV, HCV, HBV or other pathogens such as bacteria and parasites. Antigens targeted by the receptor in some embodiments include antigens that bind to B-cell malignancies, such as any of several known B-cell markers. In some embodiments, the antigens targeted by the receptor are CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Ig kappa, Ig lambda, CD79a, CD79b, or CD30. In some embodiments, multiple recombinant receptors targeting multiple antigens are used. In further embodiments, two recombinant receptors targeting two antigens are used.

[0124] Vector / plasmid In some embodiments, the synthetic expression cassette is contained within a plasmid or vector. That is, this disclosure also relates to a vector or plasmid containing the synthetic expression cassette described herein. The term “vector” is used to refer to a carrier into which a nucleic acid (e.g., a synthetic expression cassette as defined herein) can be inserted for introduction into a cell in which replication is possible. The terms “expression vector” or “nucleic acid vector” refer to a vector containing a nucleic acid or “expression cassette” that encodes a transcriptable gene product, as well as at least a portion of “regulatory” or “control” sequences that refer to nucleic acid sequences necessary for transcription and possibly translation of a coding sequence that is manipulably linked in a particular host cell. In addition to the regulatory sequences that govern transcription and translation, the expression vector may also contain nucleic acid sequences that similarly impart other functions.

[0125] In some embodiments, the vector further comprises a nucleic acid encoding a selection marker or reporter protein. The selection marker or reporter is defined herein to mean a nucleic acid encoding a polypeptide that, when expressed, provides cells with an identifiable characteristic (e.g., a detectable signal, resistance to a selectant) that allows for the easy identification, isolation, and / or selection of cells containing the selection marker from cells lacking the selection marker or reporter. The selection markers in the vectors of this disclosure are intended to include any selection marker or reporter known to those skilled in the art. For example, the selection marker may be a drug selection marker, an enzyme, or an immunomarker. Examples of selection markers or reporters include, but are not limited to, polypeptides that confer drug resistance (e.g., kanamycin / genethecin resistance), enzymes such as alkaline phosphatase and thymidine kinase, bioluminescent and fluorescent proteins such as luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), citrine and red fluorescent protein (dsRED) derived from discosoma, membrane-bound proteins for which high-affinity antibodies or ligands can be detected or produced by conventional methods, and fusion proteins including membrane-bound proteins that appropriately fuse to antigen-tagging domains from hemagglutinin (HA) or Myc. The nucleic acid encoding the selection marker or reporter protein may be under the control of the same promoter / enhancer as the target nucleic acid, or under the control of a different promoter / enhancer.

[0126] In some embodiments, the vector may include additional elements such as one or more replication sites of origin (often referred to as "ori"), restriction endonuclease recognition sites (multiple cloning sites, MCS), and / or intrasequence ribosome entry sites (IRES) elements.

[0127] In some embodiments, the vector is a viral vector. As used herein, the term “viral vector” refers to a recombinant virus that can transduce cells to introduce their genetic material into those cells. In some embodiments, the viral vector is suitable for use in gene therapy applications. Examples of viral vectors that can be used in gene therapy include retroviruses (lentiviruses), adenoviruses, adeno-associated viruses (AAVs), herpesviruses (herpes simplex virus), alphaviruses, and vaccinia viruses (poxviruses). In some embodiments, the vector is a lentiviral vector. As will be apparent to those skilled in the art, the term “lentiviral vector” is used to refer to lentiviral particles that mediate the transfer of nucleic acids. Lentiviral particles typically contain various viral components and may also contain host cell components in addition to nucleic acids. In certain embodiments, the terms “lentiviral vector” and “lentiviral expression vector” are used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles.

[0128] In one embodiment, the lentiviral vector is a pseudotyped lentiviral vector. The pseudotyped lentiviral vector consists of vector particles that hold an envelope protein (glycoprotein, GP) derived from another enveloped virus. These particles have the tropism of the virus from which the envelope protein is derived. One glycoprotein widely used for pseudotyped lentiviral vectors is vesicular stomatitis virus GP (VSV-G), which is due to the very broad tropism and stability of the resulting pseudotype. Pseudotyped lentiviral vectors are well known in the art, and some examples are described, for example, in Cronin et al., Curr. Gene Ther. 5(4):387-398. These vectors include lyssavirus GP, lymphocytic choriomeningitis virus (LCMV) GP, alphavirus GP (e.g., Ross River virus (RRV), Semryki forest virus (SFV), and Sindbis virus GP), filovirus GP (e.g., Marburg virus and Ebola Zaire virus GP), gamma retrovirus GP (e.g., ecotropic MLV, bitrophic 4070A MLV, 10A1 MLV, heterotrophic NZB MLV, mink cell fociform virus, gibbon leukemia (GALV) virus, RD1 14 GP), vesicular stomatitis virus type G (VSV-G), measles virus lentiviral vector (MV-LV), baboon envelope (BaEV)-LV, and lentiviral vectors pseudotyped with baculovirus GP (GP64).

[0129] In one embodiment, the vector is an episome-retained viral vector or a non-integrating vector, such as Sendai virus or a vector. The vector is not integrated into the genome but is retained in the episome by cell division due to the presence of a scaffold / matrix attachment region inside the vector (see, for example, Giannakopoulos A et al., J Mol Biol. 2009 Apr 17;387(5):1239-49; and Haase et al., BMC BioTechnol. 2010;10:20).

[0130] In another embodiment, the vector is a nonviral vector, such as nude DNA, liposomes, polymerizers, or molecular conjugates.

[0131] cell In another embodiment, the disclosure provides cells (host cells, modified cells) containing the synthetic expression cassette or vector / plasmid described herein. In one embodiment, the cells are primary cells, e.g., brain / nerve cells, peripheral blood cells (e.g., B or T lymphocytes, monocytes, NK cells), umbilical cord blood cells, bone marrow cells, cardiac cells, endothelial cells, epidermal cells, epithelial cells, fibroblasts, hepatocytes, or lung / pulmonary cells. In another embodiment, the cells are bone marrow cells, peripheral blood cells, or umbilical cord blood cells. In a further embodiment, the cells are, for example, T cells (e.g., CD8 + These are immune cells such as T cells, B cells, or NK cells.

[0132] In some embodiments, the cells are stem cells. As used herein, the term "stem cell" refers to a pluripotent cell that can be differentiated into a functionally mature cell. Stem cells include undifferentiated hematopoietic cells, progenitor cells, and mature stem cells, which are undifferentiated cells present in various tissues of the human body that are capable of regenerating themselves and giving rise to specific cell types and tissues from which they originate (e.g., muscle stem cells, skin stem cells, brain or neural stem cells, mesenchymal stem cells, lung stem cells, liver stem cells).

[0133] In one embodiment, the cells are undifferentiated hematopoietic cells. As used herein, the term "undifferentiated hematopoietic cells" refers to pluripotent cells that can differentiate into functionally mature blood cells of the bone marrow and lymphoid system, such as T cells, B cells, NK cells, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), platelets (e.g., megakaryoblasts, megakaryocytocyte-producing platelets, platelets), and monocytes (e.g., monocytes, macrophages), and which may or may not have the ability to regenerate (self-renew) while retaining their pluripotency. The cells include "hematopoietic stem cells" or "HSCs," which are pluripotent hematopoietic cells that not only possess both the pluripotency to differentiate into functionally mature cells such as granulocytes, erythrocytes, platelets, and monocytes, and the ability to regenerate (self-renew) while retaining their pluripotency, but also do not possess the ability to self-renew. The cells also include embryonic stem cells (ESCs), which are pluripotent stem cells derived from the inner cell mass of a blastocyst or early pre-implantation embryo. In one embodiment, the cell population includes ESCs. In another embodiment, the cell population includes hematopoietic stem cells (HSCs). HSCs can be obtained from the body or internal organs containing cells of hematopoietic origin. Such origins include unfractionated bone marrow (from the femur, buttocks, ribs, sternum, and other bones), umbilical cord blood, peripheral blood, liver, thymus, lymph, and spleen. All of the aforementioned unpurified or unfractionated blood products can be enriched with cells having the characteristics of HSCs by methods known to those skilled in the art. HSCs are characterized by their small size, lack of lin markers, for example, rhodamine 123 (rhodamineDULL , rho 0 They are phenotypically identified by being poorly stained with vital staining dyes such as (also known as) or Hoechst 33342 (side population), and by the presence or absence of various antigenic markers on their surface, many of which belong to a cluster of differentiated lineages, such as CD34, CD38, CD90, CD133, CD105, CD45 and c-kit.

[0134] In one embodiment, the stem cells are induced pluripotent stem cells (iPSCs). The term iPSC refers to pluripotent stem cells that can be generated directly from mature cells using appropriate factors to "reprogram" the cells.

[0135] In one embodiment, the cells are mammalian cells, such as human cells.

[0136] The synthetic expression cassettes or vectors / plasmids described herein may be introduced into cells using standard techniques for introducing nucleic acids into cells, such as transfection, transduction, or transformation. In some embodiments, the vector is a viral vector, and the cells are transduced by the vector. As used herein, the term "transduction" refers to the stable transfer of genetic material from a viral particle (e.g., a lentivirus) to a cellular genome (e.g., a hematopoietic cell genome). The term also encompasses the introduction of a non-integrated viral vector into a cell, which leads to transient or episomal expression of a target gene present in the viral vector.

[0137] Viruses can be used to infect cells in vivo, ex vivo, or in vitro using techniques well known in the art. For example, CD34 + When transducing cells or stem cells exovivoically, the vector particles are 10 5 1 × 10⁻¹⁶ cells per individual cell 5 ~100 or 50 x 105 These can be incubated with the cells using doses generally on the order of infection efficiencies (MOI) of 1 to 100 or 1 to 50, which also correspond to viral vectors as transduction units. Of course, this includes vector amounts corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI.

[0138] Cells may be cultured in a medium suitable for cell maintenance, growth, or proliferation before, during, and / or after transduction. The culture conditions for the cell population will vary depending on various factors, particularly the initial cell population. Suitable culture media and conditions are well known in the art. Culture may be carried out in natural, semi-synthetic, or synthetic media in terms of composition, and in terms of form, it may be a solid, semi-solid, or liquid medium, or any nutrient medium to which one or more growth factors may be added, such as those used in cell culture, including stem cell culture. The medium typically contains sodium, potassium, calcium, magnesium, phosphorus, chlorine, amino acids, vitamins, cytokines, hormones, antibiotics, serum, fatty acids, sugars, etc. Other chemical or biological components may be incorporated into the culture medium, individually or in combination, if necessary. The components incorporated into the culture medium may include fetal bovine serum, human serum, horse serum, insulin, transferrin, lactoferrin, cholesterol, ethanolamine, sodium selenite, monothioglycerol, 2-mercaptoethanol, bovine serum albumin, sodium pyruvate, polyethylene glycol, various vitamins, various amino acids, agar, agarose, collagen, methylcellulose, various cytokines, various growth factors, etc.Examples of basic media suitable for stem cell proliferation include: StemSpan® Serum-Free Expansion Medium (SFEM) (StemCell Technologies®, Vancouver, Canada), StemSpan® H3000-Defined Medium (StemCell Technologies®, Vancouver, Canada), CellGro®, SCGM (CellGenix®, Freiburg, Germany), StemPro®-34 SFM (Invitrogen®), Dulbecco Modified Eagle Medium (DMEM), Ham's Nutrient Mixture H12 Mixture F12, McCoy's 5A Medium, Eagle Minimum Essential Medium (EMEM), MEM Medium (Alpha Modified Eagle Minimum Essential Medium), RPMI 1640 Medium, Isocove Modified Dulbecco Medium (IMDM), StemPro34® (Invitrogen®), and X-VIVO®. Examples include, but are not limited to, 10 (Cambrex®), X-VIVO® 15 (Cambrex®), and Stemline® II (Sigma-Aldrich®).

[0139] After transduction, the transduced cells can be cultured under conditions suitable for their maintenance, growth, and / or proliferation. In certain embodiments, the transduced cells are cultured for approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days before transplantation.

[0140] Culture conditions for maintaining and / or proliferating stem cells are well known in the art. Typically, these culture conditions involve the use of factors such as cytokines and growth factors, which are generally known in the art of stem cell proliferation. Such cytokines and growth factors may be in the form of biological preparations or small molecules, and include, but are not limited to, IL-1, IL-3, IL-6, IL-11, G-CSF, GM-CSF, SCF, FIT3-L, thrombopoietin (TPO), erythropoietin, and their analogues. As used herein, “analog” includes, but is not limited to, any structural variant of cytokines and growth factors that are biologically active in their naturally occurring forms, variants in which biological activity is enhanced or reduced compared to their naturally occurring forms, or cytokine receptor agonists such as agonist antibodies against the TPO receptor (e.g., VB22B sc(Fv)2, as detailed in International Publication No. 2007 / 145227, etc.). The combination of cytokines and growth factors is selected to maintain / proliferate stem cells while limiting the production of terminally differentiated cells. In one particular embodiment, one or more cytokines and growth factors are selected from the group consisting of SCF, Flt3-L, and TPO.

[0141] Human IL-6 or interleukin-6, also known as B-cell stimulating factor 2, is described in (Kishimoto, Ann. review of Immunol. 23:1, 2005) and is commercially available. Human SCF or stem cell factor, mast cell growth factor, or hematopoietic stem cell factor (Steel factor), also known as c-kit ligand, is described in (Smith, MA et al., ACTA Haematologica, 105(3):143, 2001) and is commercially available. Flt3-L or FLT-3 ligand, also called FL, is a factor that binds to the flt3 receptor. It is described (Hannum C, Nature 368(6472):643-8) and is commercially available. TPO or thrombopoietin, also known as megakaryocyte growth factor (MGDF) or c-Mpl ligand, is a documented substance (Kaushansky K (2006). N.Engl.J.Med.354(19):2034-45) and is commercially available.

[0142] The chemical and biological components mentioned above can be used not only by adding them to the culture medium, but also by immobilizing them on the surface of the substrate or support used for cultivation; more precisely, by dissolving a component in a suitable solvent, coating the substrate or support with the resulting solution, and then washing away any excess component. The component to be used may also be added to a substrate or support that has been pre-coated with a substance that binds to this component.

[0143] Stem cells may be cultured in culture vessels commonly used in animal cell culture, such as Petri dishes, flasks, plastic bags, or Teflon® bags, after being optionally pre-coated with an extracellular matrix or cell adhesion molecules. Materials for this coating may include type I to type XIX collagen, fibronectin, vitronectin, laminin 1 to 12, nitrogen, tenascin, thrombospondin, von Willebrand factor, osteroponin, fibrinogen, various elastins, various proteoglycans, various cadherins, desmocolin, desmoglein, various integrins, E-selectin, P-selectin, L-selectin, immunoglobulin superfamily, Matrigel®, poly-D-lysine, poly-L-lysine, chitin, chitosan, Sepharose®, alginate gel, hydrogel, or fragments thereof. Such coating materials may be recombinant materials having artificially modified amino acid sequences. Stem cells may be cultured using a bioreactor that allows for high-density culture by mechanically controlling the culture medium composition, pH, etc. (Schwartz RM, Proc. Natl. Acad. Sci. USA, 88:6760, 1991; Koller MR, Bone Marrow Transplant, 21:653, 1998; Koller, MR, Blood, 82:378, 1993; Astori G, Bone Marrow Transplant, 35(1) 101, 2005).

[0144] The cell population can then be washed to remove the compound or composition of the present invention and / or any other components of the cell culture, and then resuspended in a cell suspension medium suitable for short-term use, or in a medium suitable for cryopreservation, such as DMEM containing 40% FCS and 10% DMSO, for long-term storage. Other methods for preparing cryopreservations for cells after culture are also available to those skilled in the art.

[0145] composition In another embodiment, this disclosure provides compositions comprising synthetic expression cassettes, vectors, or cells as described herein. The compositions may comprise one or more carriers or excipients, such as buffers, saline solutions, and preservatives. In one embodiment, the composition is a pharmaceutical composition comprising at least one pharmacologically acceptable carrier or excipient. As used herein, “excipient” has its usual meaning in the art and is any component that is not the active ingredient (drug) itself. Examples of excipients include binders, lubricants, diluents, fillers, viscosity modifiers, disintegrants, plasticizers, skins, barrier layer formulations, lubricants, stabilizers, delayed-release agents, and other components. As used herein, “pharmacologically acceptable excipient” means any excipient that does not interfere with the efficacy of the biological activity of the active ingredient and is not toxic to the subject, i.e., is a type of excipient and / or is used in an amount that is not toxic to the subject. Excipients are well known in the art (for example, Remington: The Science and Practice of Pharmacy, 2012, 22 by Loyd V Allen, Jr.) nd edition, Pharmaceutical Press; Handbook of Pharmaceutical Excipients by Rowe et al., 2012, 7 th (See edition, Pharmaceutical Press). Pharmaceutical compositions may be prepared using standard methods known in the art by mixing an active ingredient of a desired purity with one or more optionally pharmacologically acceptable carriers, excipients and / or stabilizers. Excipients may be selected for administration of the composition by any route, such as intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, intraocular, intraventricular, intra-articular, intraspinal, intrathecal, epidural, intracisional, intraperitoneal, intranasal, or intrapulmonary (e.g., aerosol). In some embodiments, pharmaceutical compositions are formulated for injection, such as in solutions, suspensions, or emulsions, including local injection, catheter administration, systemic injection, intravenous injection, intraperitoneal injection, subcutaneous injection, or parenteral administration.

[0146] In some embodiments, the pharmaceutical composition is provided as a sterile solution preparation, which in some embodiments may be buffered to a selected pH, for example, an isotonic aqueous solution, a suspension, an emulsion, a dispersant, or a viscous composition. Liquid preparations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Furthermore, liquid compositions are somewhat more convenient for administration by injection. Viscous compositions, on the other hand, may be prepared within a suitable viscosity range to provide a longer contact period with specific tissues. The liquid or viscous composition may include a carrier, which may be a solvent or dispersion medium, for example, water, physiological saline, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof.

[0147] Sterile injectable preparations can be prepared by incorporating cells into a mixture of a solvent and a suitable carrier, diluent, or excipient, such as sterile water, physiological saline, glucose, or dextrose. The composition can also be lyophilized. Depending on the desired administration route and preparation, the composition may contain, for example, wetting agents, dispersants, or emulsifiers (e.g., methylcellulose), pH buffers, gelling agents, or auxiliaries such as viscosity enhancers, preservatives, flavoring agents, and colorants. In some embodiments, suitable preparations may be prepared according to standard texts.

[0148] Various additives can be added to enhance the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffering agents. For example, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, and sorbic acid can ensure the prevention of microbial action. Sustained absorption of injectable pharmaceutical forms can be achieved by using absorption-delaying agents, such as aluminum monostearate and gelatin.

[0149] A sustained-release formulation may be prepared. A suitable example of a sustained-release formulation is a translucent matrix of a solid hydrophobic polymer containing an antibody, which may be in the form of a molded product such as a film or microcapsules.

[0150] Preparations intended for in vivo administration are generally sterile. Sterility can be easily achieved, for example, by filtration through a sterile filtration membrane.

[0151] Method / Usage This disclosure also relates to a method for inducing the expression of a target gene by cells, the method comprising introducing a synthetic expression cassette or vector described herein into such cells. This disclosure also relates to using a synthetic expression cassette or vector described herein to induce the expression of a target gene by cells. In some embodiments, the cells are primary cells, e.g., brain / nerve cells, peripheral blood cells (e.g., B or T lymphocytes, monocytes, NK cells), umbilical cord blood cells, bone marrow cells, cardiac cells, endothelial cells, epidermal cells, epithelial cells, fibroblasts, hepatocytes, or lung / pulmonary cells. In some embodiments, the cells are bone marrow cells, peripheral blood cells, or umbilical cord blood cells. In further embodiments, the cells are, for example, T cells (e.g., CD8 + These are immune cells such as T cells, B cells, or NK cells.

[0152] In some embodiments, the target gene encodes a protein that is deficient or absent in the cell. In some embodiments, the target gene encodes a recombinant receptor, such as a chimeric antigen receptor (CAR). In some embodiments, the target gene encodes a differentiation factor (for cell reprogramming).

[0153] This disclosure also relates to a method for treating a disease, symptom, or disorder in a subject, the method comprising administering cells containing a synthetic expression cassette or vector as described herein. This disclosure also relates to a method for treating a disease, symptom, or disorder in a subject, using cells containing a synthetic expression cassette or vector as described herein. This disclosure also relates to a method for producing a pharmacopoeia for treating a disease, symptom, or disorder in a subject, using cells containing a synthetic expression cassette or vector as described herein. In some embodiments, the disease, symptom, or disorder is associated with the absence or deficiency of protein expression (e.g., mutated) and the expression of a protein, and the synthetic expression cassette or vector comprises nucleic acids encoding a functional (e.g., native) protein (e.g., gene therapy).

[0154] Examples of diseases / disorders associated with the absence or deficiency (e.g., mutated) of protein expression (e.g., genetic diseases / disorders) include, for example, Wiscott-Aldrich syndrome (WAS) (Aiuti et al., Science 341(6148)), metachromatic leukodystrophy (MLD) (Biffi et al., Science 341(6148)), hematological disorders and lysosomal storage disorders such as leukocyte adherence deficiency, X-linked CGD, Fanconi anemia, adrenoleukodystrophy, and mucopolysaccharidosis type IIIA, as well as immunodeficiency disorders such as severe combined immunodeficiency (SCID) and adenosine deaminase (ADA) deficiency.

[0155] The disease or condition being treated may be any one in which the expression of an antigen is associated with and / or involved in the pathogenesis of the disease symptoms or disorder, for example, causing, exacerbating, or otherwise involved in such disease, symptoms, or disorder. Examples of diseases and conditions may include malignancies or transformations of cells (e.g., cancer), autoimmune or inflammatory diseases (e.g., arthritis, rheumatoid arthritis (RA), type 1 diabetes, systemic lupus erythematosus (SLE), inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, Graves' disease, Crohn's disease, multiple sclerosis, asthma, and / or diseases or conditions associated with transplantation), or diseases or conditions associated with infections caused by bacteria, viruses, or other pathogens. In certain embodiments, a recombinant receptor, for example, a CAR, specifically binds to the antigen associated with the disease or condition. In some embodiments, the disease, symptom, or disorder is cancer or an infection, and the target nucleus present in the synthetic expression cassette or vector encodes a recombinant receptor, such as a chimeric antigen receptor (CAR), that recognizes an antigen expressed by tumor cells or infected cells. The tumor may be a solid tumor or a hematological tumor (hematoma). In some embodiments, cancer is a hematological cancer, such as lymphoma, leukemia, and / or myeloma (e.g., B-cell, T-cell, and myeloid leukemia, lymphoma, and multiple myeloma). The infection may be a disease caused by any pathogenic infection, such as a viral, bacterial, parasitic (e.g., protozoan), or fungal infection, such as human immunodeficiency virus (HIV) or cytomegalovirus (CMV) infection.

[0156] Cells (modified cells including the synthetic expression cassette or vector described herein) or compositions containing them may be administered to subjects or patients with a specific disease or condition to be treated, for example, through adoptive cell therapy, such as adoptive T cell therapy or stem cell therapy. Methods for administering modified cells for adoptive cell therapy are known and may be used in conjunction with the methods and compositions provided. For example, adoptive T cell therapy is described, for example, in U.S. Patent Application Publication No. 2003 / 0170238 by Gruenberg et al.; U.S. Patent No. 4,690,915 by Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). For example, see Themeli et al. (2013) Nat BioTechnol. 31(10):928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1):84-9; and Davila et al. (2013) PLoS ONE 8(4):e61338.

[0157] As used herein, “treatment” (and its grammatical variations such as “to treat” or “to treat”) means the complete or partial recovery or reduction of a disease, condition, or disorder, or its symptoms, adverse effects, or consequences, or associated phenotypes. Desired effects of treatment include, but are not limited to, prevention of the onset or recurrence of the disease, relief of symptoms, reduction of any direct or indirect pathological consequences of the disease, prevention of metastasis, slowing of the rate of progression, recovery or relief of the condition, and remission or an improved prognosis. The term does not imply a complete cure of the disease, or the complete elimination of any symptoms, or an effect on all symptoms or consequences.

[0158] In some embodiments, cell therapy, such as adoptive T-cell therapy or stem cell therapy, is performed by autologous transplantation, where the cells are isolated from or derived from a subject to receive cell therapy and / or prepared by other means. That is, in some embodiments, the cells are derived from a subject in need of treatment, such as a patient, and the cells are administered to the same subject after isolation and processing.

[0159] In some embodiments, cell therapy, such as adoptive T-cell therapy or stem cell therapy, is performed by allogeneic transplantation, where the cells are isolated and / or prepared by other means from a subject other than, for example, the subject to receive cell therapy or the subject ultimately receiving cell therapy, which is the first subject. In such embodiments, the cells are then administered to a different subject of the same species, for example, the second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject. The cells can be administered by any preferred means. Dosing and administration may depend in part on whether the administration is short-term or long-term. Various dosing schedules include, but are not limited to, single doses or multiple doses over various time points, bolus doses and pulse infusions.

[0160] In one embodiment, an individual population of cells or a subtype of cells ranges from about 1 million to about 100 billion cells and / or the number of cells per kilogram of body weight, for example, from 1 million to about 5 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or any two of the aforementioned values), for example, from about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 800 The drug is administered to the subject in the following ranges: 0,000 cells, approximately 90 million cells, approximately 10 billion cells, approximately 25 billion cells, approximately 50 billion cells, approximately 75 billion cells, approximately 90 billion cells, or a range defined by any two of the aforementioned values; and in some cases, from approximately 100 million cells to approximately 50 billion cells (for example, approximately 120 million cells, approximately 250 million cells, approximately 350 million cells, approximately 450 million cells, approximately 650 million cells, approximately 800 million cells, approximately 900 million cells, approximately 3 billion cells, approximately 30 billion cells, approximately 45 billion cells), or any value within these ranges and / or per kilogram of body weight. The dosage may vary depending on the characteristics, particularly the disease or disorder and / or the patient and / or other treatments.

[0161] In some embodiments, for example, when the subject is human, the dose of cells, stem cells, T cells, or peripheral blood mononuclear cells (PBMCs) expressing recombinant receptors (e.g., CARs) is at least 1 × 10⁻¹⁶ 2 , 1 x 10 3 , 1 x 10 4 or 1 × 10 5 Individual cells, for example, about 1 × 10⁶ 6 From 1 x 10 8 A range of cells, for example, 2 × 10 6 , 5×10 6 , 1 x 10 7 , 5×10 7 or 1 × 10 8It is either the number of individual cells, the total number of such cells, or a range between any two of the aforementioned values.

[0162] In some embodiments, cells are administered as part of a combination therapy, either concurrently with or sequentially with another therapeutic intervention, such as an antibody, modified cells, receptor, or drug, such as a cytotoxic drug or therapeutic agent. In some embodiments, cells are administered concurrently with one or more additional therapeutic agents or concurrently with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, cells are administered concurrently with another therapy, time-sufficiently close, so that the cell population enhances or indirectly enhances the effect of one or more additional therapeutic agents. In some embodiments, cells are administered before one or more additional therapeutic agents. In some embodiments, cells are administered after one or more additional therapeutic agents. In some embodiments, one or more additional agents include cytokines, such as IL-2, to enhance persistence. In some embodiments, the method includes the administration of chemotherapeutic agents.

[0163] These cells may be used in combination with other therapies, such as other chemotherapy, immunotherapy, radiation therapy, or surgery, depending on the disease being treated.

[0164] In some embodiments, the synthetic expression cassette may be used as an investigation tool, for example, as a reporter tool, or in a commercially available detection method (assay development). For example, the synthetic expression cassette may be operably ligated to a nucleic acid encoding a reporter protein and may be used to detect the expression of a target gene in a specific cell type, for example, to confirm that the target gene has been taken up and expressed by cells of a specific cell type. The term "reporter protein" refers not only to easily identifiable and measurable proteins such as fluorescent and luminescent proteins (e.g., GFP, YFP), but also to enzymes that can produce detectable products from a substrate (e.g., luciferase). The synthetic expression cassette may also be used in vitro for cell-specific expression of a target gene, for example, to evaluate the effect of the expression of the target gene in target cells.

[0165] Modes for carrying out the invention The present invention will be described in more detail by the following non-limiting embodiments.

[0166] Example 1: Materials and Method Experimental Design The experimental strategy for generating a specific promoter (enhancer + minimal CMV promoter) by synthesis involved first selecting a specific enhancer sequence in silico, amplifying the sequence by PCR, and then cloning the endogenous enhancer sequence upstream of the minimal promoter, i.e., the CMV minimal promoter (minCMV). 5 To confirm the specificity of the synthetic promoter (enhancer + minCMV) through an expression pattern assay, the synthetic promoter was cloned upstream of the GFP reporter gene. As proof of functional use, the synthetic promoter was cloned upstream of a chimeric antigen receptor (CAR).

[0167] Design of specific promoter sequences Enhancer sequences that are specific to a particular cell type and located upstream of the transcription start site were selected in silico. For this in silico selection, the "Functional ANnotation Of The Mammalian genome" FANTOM5 database (created by RIKEN) was used. 3、4 This is based on the FANTOM5 database, which systematically and accurately investigated the sets of genes that are effectively active in all cell types throughout the human body, as well as the genomic regions that determine where those genes are read. Therefore, this database contains a large number of active enhancer sequences of various subtypes. To select enhancers by referring to this data, we used PrESSTo (Promoter Enhancer Slider Selector Tool) for human enhancers (http: / / enhancer.binf.ku.dk / enhancers.php). PrESSTo allows selection of enhancers expressed in one of many cells or tissues based on a slider.

[0168] The first step in selecting specific enhancer sequences was based on the Cap Analysis of Gene Expression (CAGE) score reported in the FANTOM5 database. A percentage of the target cell type (T cells or NK cells) was selected, i.e., 60% for T cells and 30% for NK cells. The percentage for each cell type represents the proportion of CAGE tags in a given cell population relative to the total number of CAGE tags from all cells. Only enhancers with an expression rate equal to or greater than the "lowest bound" value (i.e., a set value for the cell type) were returned. Percentages were selected according to the number of hits in the results box. On average, the percentage was set to less than 20 hits.

[0169] Next, we selected the identified enhancer sequence candidates based on the following criteria: • The high score in the sample (exceeding 0.15 tags / million) representing the target cell population (e.g., T cells or NK cells). • Low score (less than 0.15 tags / million) for all other groups • Significantly high frequency only in a given population, as defined by PreSSTo.

[0170] The selected enhancer sequence candidates were then verified based on ChIP-Seq data available through the UCSC Genome Browser tool (Kent WJ, et al. The human genome browser at UCSC. Genome Res. 2002 Jun;12(6):996-1006 - via the "View in UCSC" tab in the PrESSTo tool or via a link specifically available for the selected sequences at https: / / genome.ucsc.edu / cgi-bin / hgGateway). The presence of transcription factor fixation sites related to the target lineage (e.g., POU2F2 in the hematopoietic system, GATA3 related to T cells) or suggestive of active regions (e.g., POLR2A) was analyzed. The presence of such sites in the vicinity of the selected enhancers (within the range of 2000-3000 bp) was considered to suggest a transcriptionally active region. 7 .

[0171] Further bioinformatics analysis was used to impose more stringent selection criteria on the remaining candidate regulatory regions using the following cell-specific epigenetic properties (ENCODE database): (1) chromatin accessibility (i.e., DNase-seq, FAIRE-seq) and (2) histone modification of differentiation activity from inactive enhancer regions (ChiP-Seq for H3K27ac). For explanatory purposes, the following strategy was used to select B-cell-specific enhancer candidates. After using the PrESSTo tool to select B-cell-specific regulatory regions (i.e., CAGE signals that are specific in the genomic region of B cells but not elsewhere), the genomic coordinates of these candidate regulatory regions were submitted to the Galaxy bioinformatics web portal (https: / / usegalaxy.org / , Enis Afgan et al., Nucleic Acids Research, Volume 46, Issue W1, 2 July 2018, Pages W537-W544). B cells, T cells, CD4 cells, CD8 cells, NK cells, monocytes and / or neutrophils and / or CD34 cells +For the target human cell type, the same procedure was followed to upload the epigenomic data obtained from ENCODE to the Galaxy portal for chromatin accessibility (FAIRE-Seq and / or DNase-Seq) and H3K27ac modification (ChIP-Seq). The next step was to cross-reference an ensemble of B cell regulatory regions discovered by PrESSTo for the presence of B cell-specific H3K27Ac enrichment peaks, which restricts the list to CAGE regions showing an active H3K27Ac signature. Subsequently, the latter regions were examined for the presence of open chromatin in B cells (occurrence of DNA-seq peaks), which restricts CAGE B cell enhancers to those showing evidence of open chromatin state in B cells in addition to the associated H3K27Ac modification (epigenetic signature of transcriptional activity; strongly correlated with active enhancers). Furthermore, the latter list was purged to sequentially remove regions showing evidence of chromatin opening and H3K27 acetylation in unwanted cell types, such as T cells, NK cells, monocytes, and CD34+ cells. The resulting final list was then manually processed in the CAGE database for tag signal intensity and cell specificity, including further analysis of transcription factor binding, high-frequency DNA motif generation (MEME tool), and proximity to known cell-specific genes.

[0172] Enhancer amplification for cloning After selection using the methodology described above, candidate enhancer sequences were amplified by PCR from the genomic DNA of cell lines (Jurkat T cell line or NK92 cells) and subsequently inserted into cloning plasmids. To design PCR primers, aiming to minimize the PCR unit replication sequence size, a pair of primers consisting of 18 to 22 nucleotides had similar melting points and were separated from the enhancer sequence by at least 10 nucleotides. The specificity of these PCR primers was confirmed using the UCSC Genome Browser tool. The primers were designed to add randomly selected 6 bp restriction enzyme sites to enable effective cleavage (lowercase in Table II).

[0173] Table II lists all PCR primers (uppercase), their juxtaposed restriction sites (lowercase), and their PCR amplification conditions designed to amplify enhancer sequences from genomic DNA extracts of Jurkat T cells. PCR was performed using Q5 polymerase according to the manufacturer's instructions (New England Biolabs, Massachusetts). The amplification conditions were as follows: Denaturation: 98°C for 30 seconds; Amplification (35 cycles): 98°C for 10 seconds / Tm°C* for 30 seconds / 72°C for 30 seconds; and Extension: 2 minutes at 72°C *The appropriate Tm for each reaction is shown in Table I.

[0174] [Table 2]

[0175] The length of the PCR product was confirmed using an agarose gel, and the product was purified using the QIAquick® PCR purification kit (Qiagen, Federal Republic of Germany). The PCR product was then digested with the corresponding restriction enzyme (see Table 1) for cloning.

[0176] Cloning strategy for creating synthetic promoters from enhancers selected in silico To generate a specific promoter from selected and PCR-amplified enhancers, the endogenous enhancer sequence was cloned upstream of the minimal promoter, i.e., the CMV minimal promoter (minCMV:GTAGGCGTGTACGGTGGGAGG TCTATATAAGCAGAGC TCGTTTAGTGAACCGTCAGATC, SEQ ID NO: 6). 5 To confirm the specificity of the synthetic promoter (enhancer + minCMV) through expression pattern assays, the synthetic promoter was cloned upstream of the GFP reporter gene. To perform these tests, the pENTR1a vector (Addgene, #11813-011), digested with appropriate restriction enzymes, was treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs, Massachusetts) to prevent self-ligation of the pENTR1a vector. The final plasmid was constructed by ligation using T3 ligase enzyme (New England Biolabs, Massachusetts).

[0177] A detailed cloning strategy for Tenh (Chr16-445) is shown in Figures 1A-B (from bottom to top). Briefly, pENTR1A-IRES-GFP was obtained by inserting the IRES-GFP sequence from pIRES2-AcGFP (ClonTech / Takara) into the pENTR1a gateway plasmid (Addgene, #11813-011). minCMV was also cleaved from (ClonTech / Takara) and inserted using NotI and XhoI enzymes to obtain pENTR1A-minCMV-IRES-GFP. The IRES sequence was then removed by digestion of XhoI-NcoI to prevent interference with the function and specificity of the synthetic promoter, and pENTR1A-minCMV-GFP was produced. The SV40 poly(A) signal was inserted downstream of GFP to stabilize the mRNA, and pENTR1A-minCMV-GFP-SV40polyA was produced. The SV40 poly(A) sequence was amplified by PCR using a plasmid (Addgene #45461) as a template. This pENTR1A-minCMV-GFP-SV40polyA plasmid was used to clone all enhancer sequences and perform in vitro expression pattern analysis experiments. As described above, the PCR unit replication sequences of the selected enhancers were digested using appropriate restriction enzymes (listed in Table II) and inserted upstream of the minCMV sequence in pENTR1A-minCMV-GFP-SV40polyA. The plasmid was sequenced to confirm that it corresponded to the sequence designed by the construct.

[0178] Next, lentiviral particles were produced to perform expression pattern testing in vivo and / or in NK cells. To produce these particles, the pHR-SIN vector backbone was initially used. The cloning strategy is shown in Figure 2. Briefly, the pHR-SIN-Dest vector, which lacks the spleen focus-forming virus (SFFV)-GFP sequence originally contained in the pHR-SIN-SFFV-GFP vector (kindly provided by Els Veroheyen, France), was generated by introducing LR cloning sites (attB1 / attB2) amplified from pLenti CMV / TO Puro DEST (Addgene, #17293) to replace the SFFV-GFP fragment. Using this plasmid, the "ENH-minCMV-GFP-SV40polyA" sequence from pENTR1a (described above) was inserted using the Gateway LR clonase kit (Invitrogen, Canada) according to the manufacturer's instructions. To produce viral particles, this vector provides three other things: p8.91, a packaging enzyme, and CD34. + HEK293T cells (ATCC, CRL-3216) were co-transfected with two vectors, pHδ30 and pFδ24, which encode measles virus proteins that optimize transduction. 8、9 Regarding NK cell transfection, lentiviral particles possessing baboon retrovirus envelope glycoprotein (pBaEV vector, kindly provided by Els Veroheyen) were produced. 10 .

[0179] In vitro confirmation of Tenh (Chr16-445), NKspe (NK6), and Benh (B1, SEQ ID NO: 23). To evaluate the construct's specificity, the vectors were transfected into various hematopoietic human cell lines. First, Tenh(Chr16-445) was transfected into Jurkat T cells (T cell line, ATCC IB-152) and K-562 cells (erythrocyte myeloid cell line, CCL-243). pENTR1A-Tenh-minCMV-GFP-SV40polyA was transfected using Lipofectamine® 3000 (Invitrogen, Canada) according to the manufacturer's instructions. GFP signaling was analyzed by flow cytometry (BD LSRII-Fortessa). GFP expression was observed only in Jurkat cells. These findings were then confirmed in primary human cells. Peripheral blood mononuclear cells (PBMCs) (obtained from healthy controls with informed consent (REB#3527)) were transfused by electroporation using Lonza's Human Monocyte Nucleofector Kit, and a subpopulation expressing GFP was identified by flow cytometry. B cells (anti-CD19 PE clone HIB19, Biolegend) were identified using an anti-CD19 antibody, T cells (anti-CD3 PE clone HIT3a, BD Pharmingen) were identified using an anti-CD3 antibody, and monocytes (anti-CD14 APC-Cy7, clone HCD14, Biolegend) were identified using an anti-CD14 antibody.

[0180] A similar strategy was used to test the specificity of the NKspe enhancer (NK6). The vector pENTR1a-NK6-minCMV-GFP-SV40polyA was transfected into various hematopoietic cell lines. For this experiment, cells from NK-92 (NK cell line, ATCC, CRL-2407), Jurkat (T cell line, ATCC IB-152), 697 (B cell line, DSMZ ACC42), and K-562 (myeloid cell line, CCL-243) were transfected.

[0181] The ability of a B cell-specific enhancer (Benh, SEQ ID NO: 23) to induce protein expression in B cell lines was tested by transduction of BaEV lentiviral particles encoding Benh-minCMV-GFP-SV40polyA into the Nalm6 cell line (B cell line, ATCC, CRL-3273). The GFP expression pattern was analyzed by flow cytometry using anti-CD19 antibody co-stained B cells (anti-CD19 PE clone HIB19, Biolegend).

[0182] In vivo confirmation of T cell-specific (T-specific / Chr16-445), NK cell-specific (NK8), and B cell-specific promoter constructs. To evaluate whether the GFP expression pattern was similar in vivo, human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure, MiltenyI Biotec, Germany) were transduced with measles or BaEV lentiviral particles encoding one of the following: Tenh-minCMV-GFP-SV40polyA, Tenh-minCMV-CAR-CD22-SV40polyA, NK8-minCMV-GFP-SV40polyA, or Benh-minCMV-GFP-SV40polyA. Umbilical cord blood was obtained from the CHU Sainte-Justine Biobank of Cord Blood for research with maternal consent. Briefly, 200 μL of concentrated measles lentiviral particles were coated in a 12-well plate containing retronectin (Takara Bio, USA) at 37°C for 4 hours. 250,000 purified CD34 cells in 150 μL of StemSpan (StemCell, Canada) containing 5 nM rapamycin and 3 μM CIHR99021. + By adding HSC, the stemness was maintained. 12 The plate was then centrifuged at 1,000 g for 1 hour, followed by the addition of 700 μL of StemSpan / rapamycin / CIHR99021 medium. The cells were cultured for 3 days and then injected into mice. NOD-scid IL2Rγnull NSG mice (#005557) were obtained from Jackson Laboratories and reared and maintained under specific sterile conditions. The mice were pre-treated by gamma irradiation at 2 Gy. 10 mice were then exposed to lentiviral particles. 5 individual CD34 + The cells were intravenously injected (IV) into 7-11 week old NSG mice.

[0183] To test the activity of T-cell-specific promoters in the more physiological context in which the maturation of modified T-offspring occurs in the human thymus, a group of mice also had three pre-cultured human thymus fragments transplanted into their quadriceps muscles. 13 The thymus was obtained from a cardiac surgery procedure after approval of the research protocol by the Sainte-Justine Hospital Tissue Ethics Review Board (and informed consent based on full explanation from the donor). (The thymus is removed for the surgery.) Thymus (2-5 mm) 3 The samples were cultured for 10 days on a GelFoam sponge and a 0.8 μm Isopore membrane in Ham's F-12 nutrient mix 1X medium (F12) supplemented with 0.025 M HEPES, pH 7.5 and 10% fetal bovine serum (FBS) (Life Technologies). 13、14 .

[0184] Mice were kept in a regular environment, and the rearrangement of human cells was observed. Rearrangement and GFP expression were analyzed by flow cytometry using anti-mouse CD45-PerCP-Cy5.5 (clone 30F11), anti-human CD45-PE-Cy7 (clone HI31), anti-human CD19-PE (clone HIB19), anti-human CD14-APC-Cy7 (clone HCD14), and anti-human CD3-APC (clone HIT3a) (all from Biolegend). All mice were maintained at the animal facility of the CHU Sainte-Justine Research Center.

[0185] Functional confirmation of the T-specific promoter construct (T-specific / Chr16-445) To evaluate the potential therapeutic applications of the Tenh promoter, the eGFP sequence was replaced with a sequence encoding CAR-CD33 or CAR-CD22. Gemtuzumab ozogamicin monoclonal antibody 15 CAR-CD33 was generated by synthesizing an ScFv sequence from IDT Technologies and cloning it into a second-generation CAR construct (CD28-CD3ζ). The CAR-CD22 construct was based on the m971 ScFv sequence fused to 28z and BBz (Haso W et al., Blood. 2013;121(7):1165-1174). The CAR-GD2 construct was based on the 14g2a ScFv sequence cloned into the second-generation CAR construct (CD28-CD3ζ) (Louis CU et al., Blood. 2011;118:6050-6). To produce VSVg lentivirus particles, the constructs were cloned into a pHRSIN vector, and the particles were produced in HEK293 as described above.

[0186] Primary T cells were isolated from 10 ml blood samples from healthy donors. PBMCs were isolated using Ficoll®, and the T cells were purified using a T cell enrichment kit (#19051, StemCell Technologies, Canada). 500,000 T cells were then cultured in 900 μL of RPMI / 10% FBS supplemented with 30 U / mL of human recombinant IL-2 and 1:1 ratio of DynaBeads (12.5 μL / well; Life Technologies). On day 2, 100 μL of concentrated lentiviral particles were added along with 8 μg / mL of protamine sulfate, and the cells were cultured for the following 6 days. Recombinant human IL-2 (30 U / mL) was added every other day. CAR-CD33 expression on the surface of T cells was verified using soluble CD33-Fc chimeric protein (Siglec3 / CD33 Fc, R&D Systems, Michigan), and detected by flow cytometry with secondary staining using polyclonal anti-IgG PE (Jackson Immunoresearch). Similarly, CAR-CD22 expression was detected by incubating cells with 2 μl of Siglec2(CD22)-Fc chimera (50 mg / ml, R&D) at 4°C for 30 minutes, washing, and staining with anti-Fc-PE (Jackson Immune), anti-CD56-APC, and anti-CD3-FITC (Biolegend). CAR-GD2 was detected by washing with anti-mouse Fab (Jackson Immune 115-065-006) at 4°C for 30 minutes, followed by staining with streptavidin-PE (Biolegend).

[0187] Next, regarding the functionality of CAR-CD33 transduced T cells, natural CD33 + (ATCC Corporation #CCL-240) or CD33 -The HL-60 cell line (generated using CRISP technology) was evaluated using a cytotoxic assay. Similarly, the functionality of CAR-CD22 transduced T cells was tested using a cytotoxic assay against RS4;11 (a B-ALL cell line expressing CD22, ATCC, #CRL-1873), and the functionality of CAR-GD2 transduced T cells was evaluated against a GD2-expressing SK-N-DZ neuroblastoma cell line (ATCC, CRL-2149). In short, target cells of HL-60 (for CAR-CD33), RS4;11 (for CAR-CD22), or SK-N-DZ (for CAR-GD2) were stained with PKH26, a membrane-labeled dye with long aliphatic ends that stably stain the cell membrane. After incubation with effector T cells, the absolute count of surviving targets was calculated not only using CountBright® absolute counting beads (ThermoFisher) but also using a survival dye (7-AAD). In short, 2 × 10 6 Each target cell was washed twice in RPMI 1640 or D-PBS, resuspended in 100 μL of Diluent C, then 100 μL of PKH26 (8 μM in Diluent C) was added, and the cells were incubated at room temperature for 5 minutes. Staining was stopped by adding FBS. The cells were then seeded in various effector:target ratios (1:8, 1:4, 1:2, 1:1, 2:1, 4:1) and incubated for 24 hours. After 24 hours, the cells were harvested, stained with 7-AAD (BD Biosciences), and analyzed by flow cytometry. Cytotoxicity was calculated as follows: Specific lysis % = 100 - [(effector cells and PKH26 after incubation)] + 7-AAD - (Absolute count of target) / (PKH26 after incubation alone) + 7-AAD - (Absolute count of the target) × 100].

[0188] Dynamics of CAR expression during T-cell differentiation in vitro under a T-specific promoter construct (T-specific / Chr16-445) First, human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure®, MiltenyI Biotec, Germany) were transduced with BaEV lentivirus particles encoding Tenh-minCMV-CAR-CD22-SV40polyA as described above. CD34 + To test CAR expression by cell progeny, modified CD34 + Co-culture the cells with OP9-DL4 cells or OP9 (without DL4) to obtain CD34 +Differentiation into T cells and B cells was induced from these cells, respectively (La Motte-Mohs RN et al., Blood. 2005;105(4):1431-9. Epub 2004 Oct 19). The cells were co-cultured in a medium containing alpha-MEM (Gibco), 20% HyClone® Characterized FBS (GE Healthcare), GlutaMAX-I®, PenStrep, 5 ng / mL IL-7 (Perpotech), 5 ng / mL FLT-3L (Peprotech), and 800 μM L-Ascorbic acid 2-phosphate (Sigma-A). The cells were co-cultured for 2 weeks, with the medium changed twice a week and the feeder cells (OP9 or OP9-DL4) changed weekly. CAR expression in different subpopulations was evaluated by flow cytometry using the following two antibody panels: 1) anti-CD1a-BV421 (clone HI49, Biolegend), anti-CD7-FITC (clone M-T701, BD Biosciences), anti-CD45-PeCy7 (clone HI30, Biolegend), anti-CD34-APC (clone 581, Biolegend), anti-CD19-APC-Cy7 (clone HIB19, Biolegend); and 2) anti-CD4-APC-Cy7 (clone RPA-T4, Biolegend), anti-CD8-APC (RPA-T8, BD Biosciences), anti-CD3-FITC (clone UCHT1, Biolegend), anti-CD45-PeCy7 (clone HI30, Biolegend). In all panels, CAR-CD22 expression was detected by incubating 2 μl of Siglec2(CD22)-Fc chimera (50 mg / ml, R&D) at 4°C for 30 minutes, washing, and staining with anti-Fc-PE (Jackson Immune). DAPI was used as a survival stain.

[0189] Evaluation of the specificity of the NK8 promoter The specificity of the NK8 promoter was also evaluated in an OP9 co-culture system under conditions favorable for NK cell differentiation (Beck RC et al., Biol Blood Marrow Transplant. 2009, 15(9):1026-37). Human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure™, MiltenyI Biotec, Germany) were transduced with BaEV lentivirus particles encoding the aforementioned NK8-minCMV-GFP-SV40polyA. The transduced cells were co-cultured with OP9 cells, with IL-15 (10 ng / mL) added for NK cell differentiation, as described above. GFP expression was evaluated by flow cytometry. Co-staining with anti-CD56, anti-CD45, anti-CD4, and anti-CD8 (Biolegend) was performed to identify cell subpopulations.

[0190] Example 2: Testing and confirmation of promoter sequence The first step was to identify specific enhancers for creating synthetic promoters for T cells. Five candidate enhancer sequences that met the above criteria were identified (Chr16-445 (SEQ ID NO: 7); Chr14-591 (SEQ ID NO: 13); Chr8-438 (SEQ ID NO: 8); Chr8-230 (SEQ ID NO: 9); Chr12-199 (SEQ ID NO: 10)). Of these, the Chr16-445 sequence was thoroughly examined because each confirmation step was reliable. This sequence, as detailed in Table III, contains a highly repeating motif and is significantly overexpressed only in T cells (tags / million score of 0.511 in T cells). It is located on chromosome 16 (position 88536883-88537327) and is 445 nucleotides long. Within 2.5 kb upstream of the enhancer sequence, 23 putative binding sites for transcription factors such as Gata1, POLR2A, POU2F2, and MYC were identified, providing compelling evidence that it is located in a transcriptionally active region.

[0191] Similarly, two potential NK-specific enhancer sequences were selected (NK6 and NK20 - see Table IIIa), of which one (NK6) resulted in a consistent pattern of expression in preliminary data. This sequence is located on chromosome 6, is 379 nucleotides long, and contains a highly repeating motif. It was significantly overexpressed only in NK cells (tag score in NK cells: 0.719). This sequence has 19 transcription factor binding sites within a sequence of less than 2 kb. A second NK-specific candidate (NK20), located on chromosome 20, had a tag score of 1.823 in NK cells.

[0192] Enhancer sequences that induce transgene expression in both T cells and NK cells are of interest in the context of gene therapy for cytotoxic cells. A putative T cell and NK cell-specific promoter sequence was identified on chromosome 14, at positions 61804524–61805115 (591 nucleotides). Its tags / million score was high in T cells (6.629) and NK cells (3.327), indicating significant expression only in these two cell subtypes. Four transcriptional binding sites—RUNX3, GATA2, FOS, and JUN—are located within the range of the enhancer sequence itself.

[0193] Furthermore, four putative specific enhancers for B cells, located on chromosomes 1, 3, 10, and 13, that met the selection criteria were also identified (see B-spe candidates #1, 2, 3, and 4 - Table IIIa).

[0194] Finally, several other candidate enhancers for different cell types were also identified (Table IIIb).

[0195] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

[0196] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0197] To further characterize the enhancer candidates listed in Tables IIIa and IIIB, bioinformatics analysis was performed. First, the sequences were analyzed using the Multiple Em for Motif Elicitation (MEME) tool (Timothy L. Bailey and Charles Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994) to identify repeat motifs within the enhancer candidate sequences. The results are shown in Table IV.

[0198] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0199] Array of motif IDs 1.CGGTGTGGAGGGCCGGGTGGTGACGCTGAGTGACAGGTGAGGATGTGGCA(Sequence No. 64) 2.GTGGGACACCCATCATCTTACCACATCACATCGTCACTGCC (Sequence ID 65) 3.YSCCTYCCCCWCCYCYTYCCH(Sequence ID 66) 4.AAAADAAANAAARWA (Sequence No. 67) 5.YTGGKGGSHRGGSGKSTGTG(Sequence No. 68) 6.CTCVGVSCDGGNDGCCHGGCHMANVCCGGGCCWGBBBCGCGGVSG(Sequence No. 69) 7.TCWSTKTTCTG (Sequence ID 70) 8. GTGDMASGTGCCTG (Sequence ID 71) 9.GCAGCCRCCYCRCKGKCTGAG (Sequence ID 72) 10.CCCCTGCRGAGCAYRGGACGCTTCCTGCC (Sequence ID 73) 11.TGKCCTCTMCCCACM (Sequence ID 74) 12.GCCYTBHTGTYASRCAMAASM(Sequence ID 75) 13.SWMTGACACMCTGTGKGTGTGMSYYWGMMSYCASYWG(Sequence ID 76) 14.ACYTKCTGCWCWGCCTTMTTT(Sequence ID 77) 15.CGGGGAGCGCC (Sequence ID 78) 16.AGGHAGCAVAGKCACCCTC (Sequence ID 79) 17.TBTGGCGAGBCDCCTTNGNHTTCWGYGBGCCHCACT(Sequence ID 80) 18. TGTGCCCAGGG (SEQ ID NO: 81) 19. GAGGTGTCCCC (SEQ ID NO: 82) 20. AAACCACA * Motifs 1 and 2 are highly repeated in SEQ ID NO: 7 and SEQ ID NO: 11, respectively (bold text in the table)

[0200] Next, sequences were analyzed using the oPOSSUM tool (http: / / opossum.cisreg.ca / oPOSSUM3 / , Kwon AT, Arenillas DJ, Worsley Hunt R, Wasserman WW. G3. 2012 Sep; 2(9): 987-1002. Epub 2012 Sep 1), which allows detection of highly frequent conserved transcription factor binding sites and combinations of binding sites in sequence sets. The results are shown in Table V and Figure 13.

[0201]

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

Table 6-6

Table 6-7

Table 6-8

Table 6-9

Table 6-10

[0202] Example 3: In vitro confirmation of T cell-specific promoter construct (Chr16-445, SEQ ID NO: 7) The T cell-specific synthetic promoter was constructed by juxtaposing the identified and selected enhancer sequences described above with a minimal promoter, such as CMV. The pENTR1A-Chr16-445-minCMV-GFP-SV40polyA vector was transfected into T cell lines (Jurkat) and bone marrow cell lines (K562), and GFP expression was detected by flow cytometry only in the Jurkat T cell line. Conversely, when transfected with a vector encoding a non-specific strong promoter (spleen focus-forming virus (SFFV) promoter) instead of the Chr16-445-minCMV promoter, both cell lines expressed GFP (Figure 3A). Subsequently, when human PBMCs were transfected with the T cell-specific synthetic promoter, GFP protein was expressed only in T cells and not in monocytes or B cells (Figure 3B). On the other hand, when the PBMCs were transfected with the non-specific promoter, all cell types expressed GFP.

[0203] Example 4: In vitro confirmation of NK-specific promoter construct (NK6, SEQ ID NO: 11) NK cell line (NK92), bone marrow cell line (K562), B cell line (697), and T cell line (Jurkat) were transfected with the pENTR1A-NK6-minCMV-GFP-SV40polyA vector. The NK6 synthetic promoter induced GFP expression only in NK92 cells, while the SFFV strong promoter resulted in GFP expression in all cell lines (Figure 4), confirming the specificity of the NK6 promoter.

[0204] Example 5: In vitro confirmation of another NK-specific promoter construct (NK8, SEQ ID NO: 14) Specificity of the NK8 sequence was evaluated in CD34 + cells transduced with NK8-minCMV-GFP-SV40polyA or SFFV-GFP-SV40polyA or non-transduced CD34 + cells in an OP9 co-culture system. GFP expression was observed in NK cells recovered after co-culture in wells containing NK8-transduced cells, but not in B cells (Figure 5). Cells transduced with the non-specific strong promoter (SFFV) resulted in GFP expression in both NK cells and B cells, while non-transduced cells were not GFP-positive. These results provide strong evidence that the NK8 synthetic promoter is specific to NK cells.

[0205] Example 6: In vitro confirmation of a B cell-specific promoter construct (SEQ ID NO: 23) A B cell line (Nalm6) was transduced with BaEV-LV particles encoding Benh-minCMV-GFP-SV40polyA. It was shown that the B cell-specific synthetic promoter induces GFP expression in B cells (Figure 6), which suggests that this promoter is capable of inducing expression of a target protein in a B cell-specific manner.

[0206] Example 7: In vivo confirmation of a T-specific promoter construct (Chr16-445) Human CD34 + cells were transduced with the Chr16-445-minCMV T cell-specific promoter or a non-specific SFFV promoter, then transplanted into NSG mice with or without co-transplantation of human thymus (huNSG and BLT models, see Methods). In both models, GFP + T cell growth was observed, whereas CD34 +No other human cells expressed GFP when transduced with our Chr16-445-minCMV T cell-specific promoter (Figure 7A, B). In contrast, CD34 + When transduced with the nonspecific strong promoter SFFV, all strains expressed GFP (Figure 7C). These results also demonstrate that the manipulated HSCs can differentiate into various strains of both myeloid (monocytes) and lymphoid (T and B cells).

[0207] Example 8: In vivo confirmation of the NK-specific promoter construct (NK8). Human CD34 + Cells were transduced with NK8-minCMV, which drives GFP expression, and the specificity of the NK cell-specific promoter was investigated in vivo. Human NK cells expressing GFP were found in mouse blood, spleen, and bone marrow (Figure 8A, B). In contrast, only a small number of human B cells and T cells recovered from the same mice expressed GFP, which provides evidence of the specificity of the NK8 synthesis-specific promoter.

[0208] Example 9: In vivo confirmation of a B cell-specific promoter construct (SEQ ID NO: 23). Human CD34 + Cells were transduced with Benh-minCMV, which drives GFP expression, and the specificity of the B cell-specific promoter was investigated in vivo. Four weeks after humanization, human cells circulating in the blood were analyzed by flow cytometry. At this point, B cells (CD19) were observed. + ) and monocytes (CD14 + Only the nonspecific strong promoter (SFFV) was growing in humanized mice. While the nonspecific strong promoter (SFFV) induced GFP expression in all cell subtypes, GFP-positive cells were observed only in the B cell population (Figure 9). These results suggest that the B cell synthesis-specific promoter is specifically induced only in the B cell population.

[0209] Example 10: Functional confirmation of the T-specific promoter construct (Chr16-445) The therapeutic potential of this construct was explored via cytotoxicity assays using CAR-CD33, CAR-CD22 or CAR-GD2. Sequences encoding CAR-CD33, CAR-CD22 or CAR-GD2 were placed under the control of a non-specific strong promoter (SFFV) or a synthetic T-cell specific promoter (Tenh Chr16-445). Its ability to drive expression of the functional transgene it carries was assessed by transducing CAR into primary T cells and performing cytotoxicity assays against human AML cell lines that either do or do not express CD33, against the human ALL cell line (RS4;11) that expresses CD22, or against GD2 + neuroblastoma (NB) cell line (SK-N-DZ). Primary T cells transduced with the CAR-CD33 construct under the control of the non-specific SFFV promoter or the T-cell specific promoter showed CAR-CD33 expression as confirmed by flow cytometry (Figure 10A). The results of the cytotoxicity experiments show that the CAR-CD33 construct effectively induced lysis of CD33 + AML cells, even when its expression is driven by the specific T-cell promoter (Figure 10B). Non-specific lysis measured in CD33 - negative cells (right-hand bar graph) was minimal and significantly lower than CAR-mediated lysis (***p<0.001). Similarly, CAR-CD22 expressed under the Tenh Chr16-445 promoter induced sufficiently strong CAR expression to induce CAR-specific cytotoxicity against the RS4;11 ALL cell line that was comparable to the cytotoxicity obtained with the SFFV (strong) promoter (Figure 10C). Likewise, the results shown in Figure 10D demonstrate that in the context of solid tumors, CAR-GD2 expressed under the Tenh Chr16-445 promoter construct also induced target lysis at a level significantly higher than that of non-transduced primary T cells (****p<0.0001) and comparable to the level of CAR-GD2 driven by the non-specific strong promoter SFFV.

[0210] Example 11: Dynamics of CAR Expression During T-Cell Differentiation Under the T-Specific Promoter Construct (Chr16-445) Using OP9-DL4 cells that mimic thymic differentiation in vitro, and using the CAR-CD22 construct, it was observed that the specific promoter induced expression of CAR-CD22 (immediately at the stage of CD7 + CD1 + in early T-cell differentiation process) (FIG. 11A). As a control, HSC-modified cells were co-cultured with OP9 cells, which resulted in B-cell differentiation, and no CAR expression was detected (FIG. 11B). This data further demonstrates the specificity of the T-specific / Chr16-445 synthetic promoter. The results shown in FIG. 11C indicate that the Tenh Chr16-445 promoter is active in all the following stages of T-cell differentiation: pro-T, CD7 + , CD7 + CD1a + , CD4 + CD8 + double positive, as well as in CD4 + and CD8 + single positive T cells. Similar results were obtained when Chr16-445 was inserted in the reverse orientation, which confirmed that this sequence shares the characteristic of transcription enhancers (i.e., it is not affected by orientation).

[0211] Example 12: In Vivo T-Cell Differentiation of CAR-Transduced CD34 + Cells Under a T-Specific Promoter Construct In vivo T-cell differentiation of CAR-transduced CD34 + cells, using transduced CD34 +Cells were evaluated in mice transplanted with human fetal thymus (BLT model). Blood samples from mice 30 weeks after humanization showed that T cells expressed CAR-CD22 on their surface (Figure 12). Consistent with previous findings, B cells and monocytes did not express GFP. Similar results were obtained again when Chr16-445 was inserted in reverse. These results confirm the specificity of the T-specific / Chr16-445 promoter, which also suggests that thymic selection does not interfere with the growth of CAR-positive T cells.

[0212] The present invention has been described above herein by its specific embodiments, which can be modified without departing from the spirit and nature of the subject matter invention as set forth in the appended claims. In the claims, the phrase “comprising” is used as an open-ended phrase and is substantially equivalent to the phrase “including, but not limited to.” The singular forms “a,” “an,” and “the” include their corresponding plural forms unless otherwise specified in the context.

[0213] References 1. Hacein-Bey-Abina S, Hauer J, Lim A, et al. Efficacy of gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 2010;363:355-64. 2. Hacein-Bey-Abina S, Pai SY, Gaspar HB, et al. A modified gamma-retrovirus vector for X-linked severe combined immunodeficiency. N Engl J Med 2014;371:1407-17. 3. Lizio M, Harshbarger J, Shimoji H, et al. Gateways to the FANTOM5 promoter level mammalian expression atlas. Genome Biol 2015;16:22. 4. Andersson R, Gebhard C, Miguel-Escalada I, et al. An atlas of active enhancers across human cell types and tissues. Nature 2014;507:455-461. 5. Boshart M, Weber F, Jahn G, et al. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 1985;41:521-30. 6. Ede C, Chen X, Lin MY, et al. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells. ACS Synth Biol 2016;5:395-404. 7. Matsuda K, Mikami T, Oki S, et al. ChIP-seq analysis of genomic binding regions of five major transcription factors highlights a central role for ZIC2 in the mouse epiblast stem cell gene regulatory network. Development 2017;144:1948-1958. 8. Levy C, Amirache F, Costa C, et al. Lentiviral vectors displaying modified measles virus gp overcome pre-existing immunity in in vivo-like transduction of human T and B cells. Mol Ther 2012;20:1699-712. 9. Humbert JM, Frecha C, Amirache Bouafia F, et al. Measles virus glycoprotein-pseudotyped lentiviral vectors are highly superior to vesicular stomatitis virus G pseudotypes for genetic modification of monocyte-derived dendritic cells. J Virol 2012;86:5192-203. 10. Girard-Gagnepain A, Amirache F, Costa C, et al. Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood 2014;124:1221-31. 11. Lowe E, Truscott LC, De Oliveira SN. In Vitro Generation of Human NK Cells Expressing Chimeric Antigen Receptor Through Differentiation of Gene-Modified Hematopoietic Stem Cells. Methods Mol Biol 2016;1441:241-51. 12. Huang J, Nguyen-McCarty M, Hexner EO, et al. Maintenance of hematopoietic stem cells through regulation of Wnt and mTOR pathways. Nat Med 2012;18:1778-85. 13. Markert ML, Devlin BH, McCarthy EA. Thymus transplantation. Clin Immunol 2010;135:236-46. 14. Kalscheuer H, Danzl N, Onoe T, et al. A model for personalized in vivo analysis of human immune responsiveness. Sci Transl Med 2012;4:125ra30. 15. Laing AA, Harrison CJ, Gibson BES, et al. Unlocking the potential of anti-CD33 therapy in adult and childhood acute myeloid leukemia. Exp Hematol 2017;54:40-50. 16. La Motte-Mohs RN, Herer E, Zuniga-Pflucker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood 2005;105:1431-9. 17. Halkias J, Melichar HJ, Taylor KT, et al. Tracking migration during human T cell development. Cell Mol Life Sci 2014;71:3101-17. 18. Kurd N, Robey EA. T-cell selection in the thymus: a spatial and temporal perspective. Immunol Rev 2016;271:114-26. 19. Poulin JF, Sylvestre M, Champagne P, et al. Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease. Blood 2003;102:4600-7. 20. Dion ML, Poulin JF, Bordi R, et al. HIV infection rapidly induces and maintains a substantial suppression of thymocyte proliferation. Immunity 2004;21:757-68. 21. Sportes C, Hakim FT, Memon SA, et al. Administration of rhIL-7 in humans increases in vivo TCR repertoire diversity by preferential expansion of naive T cell subsets. J Exp Med 2008;205:1701-14. 22. Kershaw MH, Westwood JA, Darcy PK. Gene-engineered T cells for cancer therapy. Nat Rev Cancer 2013;13:525-41. 23. Porter DL, Hwang WT, Frey NV, et al. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci Transl Med 2015;7:303ra139. 24. Savoldo B, Ramos CA, Liu E, et al. CD28 costimulation improves expansion and persistence of chimeric antigen receptor-modified T cells in lymphoma patients. J Clin Invest 2011;121:1822-6. 25. Maude SL, Teachey DT, Porter DL, et al. CD19-targeted chimeric antigen receptor T-cell therapy for acute lymphoblastic leukemia. Blood 2015;125:4017-23. 26. Maude SL, Frey N, Shaw PA, et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 2014;371:1507-17. 27. Grupp SA, Kalos M, Barrett D, et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. N Engl J Med 2013;368:1509-18. 28. Haso W, Lee DW, Shah NN, et al. Anti-CD22-chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia. Blood 2013;121:1165-74. 29. Lee DW, Kochenderfer JN, Stetler-Stevenson M, et al. T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial. Lancet 2015;385:517-28. 30. Fitzgerald JC, Weiss SL, Maude SL, et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Crit Care Med 2017;45:e124-e131. 31. Teachey DT, Lacey SF, Shaw PA, et al. Identification of Predictive Biomarkers for Cytokine Release Syndrome after Chimeric Antigen Receptor T-cell Therapy for Acute Lymphoblastic Leukemia. Cancer Discov 2016;6:664-79. 32. Jena B, Maiti S, Huls H, et al. Chimeric antigen receptor (CAR)-specific monoclonal antibody to detect CD19-specific T cells in clinical trials. PLoS One 2013;8:e57838.

Claims

1. A synthetic expression cassette that expresses a target nucleic acid in T cells, (i) Minimum promoter and (ii) A synthetic expression cassette comprising a transcription enhancer competently bound to the minimal promoter for expressing the target nucleic acid in the cells, the transcription enhancer comprising a sequence having at least 95% sequence identity with the nucleotide sequence described in SEQ ID NO:

9.

2. The synthetic expression cassette according to claim 1, wherein the transcription enhancer includes the sequence described in Sequence ID No.

9.

3. The synthetic expression cassette according to claim 1 or 2, wherein the minimal promoter is the human simplex virus thymidine kinase (HSV TK or miniTK) minimal promoter, the cauliflower mosaic virus (CaMV) 35S minimal promoter, the human cytomegalovirus CMV minimal promoter (miniCMV), CMV53, the monkey virus 40 minimal promoter (minSV40), MLP, minP, pJB42CAT5, YB_TATA, or the supercore promoter 1 (SCP1) minimal promoter.

4. The synthetic expression cassette according to claim 3, wherein the minimum promoter includes or consists of the sequence of sequence number 6.

5. The synthetic expression cassette according to any one of claims 1 to 4, wherein the transcription enhancer is located upstream of the minimal promoter in the synthetic expression cassette.

6. A synthetic expression cassette according to any one of claims 1 to 5, further comprising a polyadenylation (poly(A)) signal and / or a transcription termination signal.

7. A synthetic expression cassette according to any one of claims 1 to 6, further comprising the target nucleic acid adsorbed to a minimal promoter and a transcription enhancer.

8. A synthetic expression cassette according to any one of claims 1 to 7, further comprising a selection marker.

9. The synthetic expression cassette according to any one of claims 1 to 8, wherein the target nucleic acid encodes a chimeric antigen receptor (CAR).

10. A vector comprising a synthetic expression cassette according to any one of claims 1 to 9.

11. A host cell comprising a synthetic expression cassette according to any one of claims 1 to 9 or a vector according to claim 10.

12. A composition comprising the host cell described in claim 11.

13. An in vitro method for inducing the expression of a target nucleic acid by T cells, comprising introducing a synthetic expression cassette according to any one of claims 1 to 9 or a vector according to claim 10 into the T cells or hematopoietic stem cells.

14. The method according to claim 13, wherein the target nucleic acid encodes a protein or chimeric antigen receptor (CAR) that is deficient or lacking in the cell.

15. Use of a synthetic expression cassette according to any one of claims 1 to 9 or a vector according to claim 10 for inducing the expression of a target nucleic acid by T cells.

16. A synthetic expression cassette according to any one of claims 1 to 9, a vector according to claim 10, cells according to claim 11, or a composition according to claim 12, for use in treating a disease, symptom, or disorder in a subject.

17. The synthetic expression cassette, vector, cell, or composition for use according to claim 16, wherein the disease, symptom, or disorder is (i) associated with the absence or expression of a protein, and the nucleic acid of interest encodes a functional form of the protein, or (ii) associated with the expression of an antigen, and the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.

18. The recombinant receptor is a chimeric antigen receptor (CAR), according to claim 17, a synthetic expression cassette, vector, cell, or composition for use.

19. The synthetic expression cassette, vector, cell, or composition for use according to any one of claims 16 to 18, wherein the disease, symptom, or disorder is cancer, an autoimmune or inflammatory disease, or an infectious disease.

20. The synthetic expression cassette, vector, cells, or composition for use according to claim 19, wherein the cancer is a hematological cancer.

Citation Information

Patent Citations

  • US62/796,254