Channel regulators

Abstract

This invention provides methods for treating conditions such as glaucoma, DME, ocular fibrosis, retinal perfusion disorder, or ocular hypoxia. [Solution] The present invention relates to compositions and articles of manufacture comprising connexin modifiers, panexin modifiers, gap junction modifiers, hemichannel modifiers, and panexin channel modifiers, as well as the use of these alone or in combination in the treatment of eye disorders and other disorders.

Description

[Technical Field]

[0001] Related applications This is a U.S. application claiming priority to U.S. Standard Application No. 62 / 080,217 filed November 14, 2014, No. 62 / 085,226 filed November 26, 2014, No. 62 / 146,128 filed April 10, 2015, No. 62 / 147,488 filed April 14, 2015, New U.S. Application No. 628630 filed August 22, 2014, and No. 709673 filed July 2, 2015, the contents of each of these are incorporated herein by reference in their entirety.

[0002] This invention relates to connexin and panexin channel modulators and their modulatory properties. [Background technology]

[0003] The following contains information that may be useful in understanding the present invention. No information, publications, or documents explicitly or implicitly referenced herein constitute prior art or are essential to the invention described herein or claimed herein. All publications, patents, related applications, and other written or electronic materials referred to or identified herein are incorporated herein by reference in their entirety. The incorporated information is substantially part of the filing application to the same extent as all of the text and other content is repeated within the filing application, and should be treated as part of the text and content of the filing application.

[0004] Gap junctions are specialized intercellular connections found between most animal cell types. They are expressed in virtually all tissues of the body, with the exception of mature skeletal muscle and mobile cell types such as sperm and red blood cells. Gap junctions directly connect the cytoplasm of two cells, allowing various molecules, ions, and electrical impulses to pass directly through a controlled gate between cells.

[0005] In contrast to closed (tight) junctions and fixed (adhesion and desmosome) junctions, the function of gap junctions is not to seal membranes together or to restrict the passage of substances across membranes. Rather, gap junction channels provide physical communication channels by allowing certain molecules to travel back and forth from one cell to another, and thus directly connecting the interiors of adjacent cells.

[0006] A single gap junction channel consists of two connexons (or hemichannels) that connect across the intercellular gap between adjacent cells, allowing intercellular molecules to flow between these cells. Each connexon in a gap junction is located within the membrane of the adjacent cell and is formed by the covalent oligomerization of six individual connexin ("Cx" or "Cxn") proteins. Yeager (1998) Structure of cardiac gap Junction intercellular channels, J Struct Biol 121:231-245. Connexons may contain one or more different connexin proteins, but they are usually in the form of homohexamers.

[0007] The human connexin family of genes and proteins will henceforth be numbered 21. (Sqhl G & Willecke K. (2004). Gap junctions and the connexin protein family. Cardiovasc Res. 62:228-232). Structural and functional diversity of connexin genes in th e mouse and human genome, Biol Chem 383:725-737. Many variants exist within the range of connexins expressed in various tissue types, and often two or more connexin forms are present within a cell type. See Sohl and Willecke (2004). Various combinations of connexins and connexons can interact with each other, but compatibility constraints exist. Marziano, et al. Hum Mol Genet. 12:805-812 (2003). Connexin proteins and their associated gap junction channels arise within a range of size and configuration that are thought to provide some specificity for the chemical species that can pass through. Niessen et al. (2000) Selective permeability of different connexin channels to the second messenger inositol 1,4,5-tris trisphosphate, J Cell Sci 113(Pt 8):1365-1372. All connexins share a common structure with four transmembrane domains, two extracellular loops, a cytoplasmic loop, a short cytoplasmic amino terminus, and a carboxyl terminus, which can vary considerably in length. Unger, et al. (1999) Electron cryo-crystallography of a recombinant cardiac gap junction channel, Novartis Found Symp 219:22-30 & discussion 31-43. Connexin proteins are generally named according to their molecular weight; for example, Cx26 is a 26 kDa connexin protein. The main structural difference between connexin proteins is the length of the C-terminal cytoplasmic tail, with connexin 26 having almost no tail (16 amino acids), while connexins 43 and 32 have long and intermediate tails (156 and 73 amino acids, respectively). Differences in the size and amino acid sequence of the cytoplasmic tails of different connexins are predicted to be involved in the conformation of channel opening and closing, among other things. Gap junction function and / or dysfunction have been linked to several disorders. For example, connexin 30 mutates in Crouston syndrome (sweaty ectodermal dysplasia), and mutations in the connexin 26 gene are the most common cause of hereditary hearing loss. Mutations in the human connexin 32 gene cause Charcot-Marie-Tooth disease, a hereditary neurological disorder, while oculodental dysplasia is generally thought to be caused by mutations in the gene encoding connexin 43.

[0008] Panexin is a family of transmembrane channel glycoproteins, including Panx1, Panx2, and Panx3. Panexin shares structural features similar to connexin, consisting of four transmembrane domains, two extracellular loops, and one intracellular loop, along with intracellular N-terminal and C-terminal tails. While Panx1 is expressed in many mammalian tissues, Panx2 and Panx3 expression is more limited. Panx1 is associated with calcium wave propagation, tone regulation, mucociliary-pulmonary clearance, and taste bud function. Panx1 is expressed in the brain, bladder, testes, and ovaries, while Panx2 is primarily expressed in the brain, and Panx3 is expressed in the skin, cartilage, heart, kidneys, and cochlea. Panx1 hemichannels are associated with ATP release, calcium signaling, keratinocyte and osteoblast differentiation, taste perception, cell death, post-ischemic neurodegeneration, tumor suppression, and seizures. Panx2 is involved in neuronal differentiation, while Panx3 is involved in chondrocyte and osteoblast differentiation, as well as sperm mutation and transport. Panx1 is localized to the plasma membrane, while Panx2 is located intracellularly. One major difference between connexin and panexin channels is that panexin channels do not form intercellular channels, suggesting that the highly glycosylated extracellular loop of the panexin protein interferes with the docking process. Like connexin hemichannels, panexin channels are said to be activated by several factors, but they also show some differences. Both connexin hemichannels and panexin channels contribute to glutamate and ATP release, but panexin channels do not respond to a decrease in calcium ion concentration. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Yeager (1998) Structure of cardiac gap junction intercellular channels, J Struct Biol 121:231-245 [Non-Patent Document 2] Sohl G&Willecke K. (2004). Gap junctions and the connexin protein family. Cardiovasc Res. 62:228-232 [Non-Patent Document 3] Structural and functional diversity of connexin genes in the mouse and human genome,Biol Chem 383:725-737 [Non-Patent Document 4] Marziano,et al.Hum Mol Genet. 12:805-812(2003) [Non-Patent Document 5] Niessen et al. (2000) Selective permeability of different connexin channels to the second messenger inositol 1,4,5-tris trisphosphate, J Cell Sci 113(Pt 8):1365-1372 [Non-Patent Document 6] Unger, et al. (1999) Electron cryo-crystallography of a recombinant cardiac gap junction channel, Novartis Found Symp 219:22-30&discussion 31-43 [Overview of the project]

[0010] The invention described and claimed herein has many features and embodiments, including, but is not limited to, those described or referred to in this abstract. Not intended to be comprehensive, the invention described and claimed herein has many features or embodiments that are included for illustrative purposes only and are not limiting.

[0011] An object of the present invention is to provide compounds, compositions, formulations, kits, and methods for the modulation of gap junction channels, hemichannels, and / or panexin channels, and / or for the treatment of disorders that benefit from the modulation of gap junction channels, hemichannels, and / or panexin channels. Accordingly, in one embodiment, the present invention relates to a method for modulating gap junction channels, gap junction hemichannels, and / or panexin channels, and more particularly, but not exclusively, a method for treating a disorder in which the modulation of gap junction channels, gap junction hemichannels, and / or panexin channels is effective, the method comprising administering a gap junction channel modulator, for example, a compound of formula I (e.g., tonaversat), a connexin peptide imitation compound, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or a panexin modulator such as a compound of formula VI (e.g., probenecid) and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or a panexin peptide imitation compound and / or one or more analogs or prodrugs of any of the aforementioned compounds.

[0012] In one embodiment, the present invention provides a method for modulating gap junction channels and / or hemichannels using a gap junction channel modulator or hemichannel modulator. In some embodiments, the gap junction channel modulator or hemichannel modulator Small molecule regulators may also be used. Small molecule gap junction channel regulators include, for example, compounds of formula I, e.g., tonaversat, and its analogs and / or prodrugs. In some embodiments, the gap junction channel regulator or hemichannel regulator may be peptide-mimicking compounds. Peptide-mimicking gap junction channel regulators include, for example, peptide 5 (VDCFLSRPTEKT) and its analogs. In other embodiments, the gap junction channel regulator or hemichannel regulator may be antisense oligonucleotides, which may be chemically modified or unmodified oligonucleotides, e.g., unmodified DNA oligonucleotides.

[0013] In some embodiments, the present invention provides a method for modulating panexin channels using a panexin modifier. In some embodiments, the panexin modifier may be a small molecule modifier. Examples of small molecule panexin channel modifiers include compounds of formula VI, e.g., probenecid, and analogues and / or prodrugs of any of the aforementioned compounds. In some embodiments, the panexin modifier may be a synthetic mimicry peptide blocker of panexin 1. Examples of peptide mimicry panexin channel modifiers include, 10 This includes Panx1 or its analogues. In some embodiments, the panexin modifier may be a synthetic mimic peptide blocker of panexin 2. In some embodiments, the panexin modifier may be a synthetic mimic peptide blocker of panexin 3.

[0014] In some embodiments, the method includes co-administration of a gap junction channel modulator and a panexin modulator. The co-administration of the gap junction channel modulator may be simultaneous with, following, or prior to the administration of the panexin modulator. In some embodiments, a compound of formula I, e.g., tonaversat, and / or peptide 5, or any analogue thereof, or analogues of both thereof, is used as a panexin antagonist, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10 It may be co-administered with Panx1 or its analogues.

[0015] In another embodiment, the present invention provides the manufacture of agents for modulating gap junction channels and / or hemichannels, or the use of hemichannel modulators in the treatment of any of the diseases, disorders, and / or pathologies described herein. Hemichannel modulators include, as described herein, for example, compounds of formula I, e.g., tonaversat, and / or analogs thereof, and / or peptide 5 or analogs thereof, and / or antisense oligonucleotides.

[0016] In another embodiment, the present invention provides gap junction channel modulators, hemichannel modulators, connexin modulators, and / or panexin modulators for use in the modulation of gap junction channels and / or hemichannels, such as compounds of formula I, e.g., tonaversat, and / or analogs of any of the aforementioned compounds, or peptide 5 or its analogs. In one embodiment, the gap junction channel modulators, hemichannel modulators, connexin modulators, and / or panexin modulators preferably modulate gap junction channels, and / or hemichannels and panexin, respectively, in humans or other animals. In some embodiments, the present invention provides panexin modulators for use in the modulation of panexin channels, e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or panexin synthetic mimic peptide blockers such as panexin 1, e.g., 10 Panx1 or its analogues are also discussed. A preferred panexin channel modulator is a panexin 1 channel modulator. In some embodiments, gap junction channel modulators and / or hemichannel modulators are panexin or panexin channel modulators. Along with modulation, it may be used in conjunction with panexin modifiers for the modulation of gap junction channels and / or hemichannels. In some embodiments, modulation of panexin and / or panexin channels may occur before, after, or simultaneously with modulation of connexin channels. In other embodiments, modulation of connexin channels may occur before or after modulation of panexin channels.

[0017] In another embodiment, the present invention provides a method for treating disorders in which modulation of gap junction channels and / or hemichannels may be beneficial, the method comprising administering a connexin channel modulator and / or hemichannel modulator to a subject. In some embodiments, the channel modulator may be, for example, a compound of formula I, e.g., tonaversat, and / or an analog of any of the aforementioned compounds, and / or a peptide mimic compound such as peptide 5 or its analog. In some embodiments in which modulation of panexin channels may be beneficial, the method further comprises administering a panexin antagonist or panexin channel modulator. The panexin modulator may be, for example, a compound of formula VI, e.g., probenecid, and / or an analog or prodrug of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10 This includes Panx1 or its analogues. In some embodiments, the method includes a panexin antagonist, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10 The treatment involves administering a compound of formula I, e.g., tonaversat, and / or an analog of any of the aforementioned compounds, together with Panx1 or an analog of the same compound. The administration of the compound of formula I, e.g., tonaversat, and / or an analog of any of the aforementioned compounds may occur simultaneously with, following, or before the administration of the panexin antagonist. The administration of the panexin antagonist may occur following or before the administration of the connexin channel antagonist, e.g., a compound of formula I, e.g., tonaversat, and / or an analog of any of the aforementioned compounds. In some embodiments, the treatment method is applicable to humans. In some embodiments, the treatment method is applicable to mammals, e.g., humans.

[0018] In another embodiment, the present invention addresses the use of panexin modulants in the manufacture of agents for modulating panexin channels, or the treatment of one or more of the diseases, disorders, and / or conditions described herein. Panexin modulants include, for example, compounds of formula VI, e.g., probenecid, and / or analogs and prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 This includes Panx1 or analogues thereof. In some embodiments, gap junction channel modulators or hemichannel modulators and panexin modulators may be used for the manufacture of a single agent or a set of agents for the modulation of gap junction channels and / or hemichannels, and panexin channels.

[0019] In another embodiment, the present invention provides the use of connexin modulators such as compounds of formula I, e.g., tonaversat, and / or analogs thereof, or peptide 5 or analogs thereof, in the manufacture of agents for the treatment of disorders in which modulation of gap junction channels and / or hemichannels may be beneficial. In some embodiments in which modulation of panexin channels may be beneficial, the present invention provides panexin antagonists or panexin channel modulators (e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 This section will discuss the use of Panx1 or its analogues.

[0020] In some embodiments, compounds of formula I, such as tonaversat, and / or analogs of any of the aforementioned compounds, may be used in conjunction with panexin antagonists in the manufacture of agents for the treatment of disorders in which modulation of gap junction channels and / or hemichannels, as well as panexin channels, is beneficial.

[0021] In another embodiment, the present invention provides gap junction channel modulators, e.g., compounds of formula I, e.g., tonaversat, and / or analogs of any of the aforementioned compounds, or peptide 5 or its analogues, or other gap junction channel modulators, for use in the treatment of disorders in which modulation of gap junction channels and / or hemichannels may be beneficial. In some embodiments in which modulation of panexin channels may be beneficial, the present invention provides panexin antagonists, e.g., compounds of formula VI, e.g., probenecid, and / or analogs or prodrugs of any one or more of the aforementioned compounds, and / or panexin 1, e.g., 10 We will also discuss Panx1 or its analogues, which are synthetic mimicking peptide blockers of panexin, or other panexin channel modulators. In several embodiments, a compound of formula I, e.g., tonaversat, and / or an analog or prodrug of any of the aforementioned compounds, or peptide 5 or its analogue, may be used in conjunction with a panexin antagonist for the treatment of disorders in which modulation of gap junction channels and / or hemichannels, and panexin channels, may be beneficial. Administration of a compound of formula I, e.g., tonaversat, and / or an analogue of any of the aforementioned compounds may occur simultaneously with, following, or before the administration of a panexin antagonist.

[0022] In any aspect of the present invention, for example, a compound of formula I, such as tonaversat or an analog thereof, peptide 5 or an analog thereof, may be used as a gap junction channel modulator. Other compounds with gap junction channel and / or hemichannel regulatory activity include anesthetics (e.g., isoflurane, halothane, ethane), octanol, heptanol, 18α-glycyrrhetinic acid (including its metabolites), carbenoxolone, fenamic acid (e.g., flufenamic acid or diflumic acid), cardiac glycosides (e.g., ouabain), platelet-derived growth factor (PDGF), IGF-1, carbochol, phorbol esters, and arachidonic acid, oleic acid, or palmitoleic acid (see Salameh A, et al., (2005) Biochim Biophys Acta 1719:36-58 for further examples), and / or quinoline or mefloquine compounds (e.g., Das S et al., Biochem Biophys Res Commun (2008) 373:504-508).

[0023] In various embodiments, the regulated gap junction channel and / or hemichannel includes one or more of connexins 23, 25, 26, 30, 30.2, 30.3, 31, 31.1, 31.9, 32, 36, 37, 40, 40.1, 43, 45, 46, 47, 50, 59, and 62. In one embodiment, the regulated gap junction channel and / or hemichannel includes one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one particular embodiment, the regulated gap junction channel and / or hemichannel includes connexin 30 and / or connexin 43.

[0024] In various embodiments, the panexin and / or panexin channel to be regulated is one or more of panexin 1, panexin 2, and panexin 3.

[0025] In another aspect, the present invention provides a method for the treatment of one or more diseases, disorders, or conditions set forth herein, which method comprises administering a gap junction channel modulator to a subject. In some aspects, the gap junction channel modulator may be, for example, a compound of Formula I, for example, tonabersat, and / or an analog of any of the foregoing compounds, or peptide 5 or an analog thereof. In some aspects, the present invention also provides a method for the treatment of one or more diseases, disorders, or conditions set forth herein, which method comprises administering a pannexin modulator, alone or in combination with one or more gap junction channel or hemichannel modulators. In some aspects, the pannexin modulator is, for example, a compound of Formula VI, for example, probenecid, and / or one or more analogs or prodrugs of any of these foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, for example, 10 Panx1 or an analog thereof. In certain embodiments, the one or more diseases, disorders, or conditions are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at the expected rate, dehiscent wounds; fibrosis, fibrotic disease, disorder, or condition; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory diseases; edema.

[0026] In another aspect, the present invention provides the use of a gap junction channel modulator or hemichannel modulator such as peptide 5, and / or an analog thereof, a compound of Formula I, for example, tonabersat, and / or an analog of any of the foregoing compounds, in the manufacture of a medicament for the treatment of one or more diseases, disorders, and conditions set forth herein. In some aspects, the present invention provides the use of a pannexin modulator, for example, a compound of Formula VI, for example, probenecid, and / or one or more analogs or prodrugs of any of these foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, for example, 10The use of Panx1 or any analogue thereof is also provided. In some embodiments, gap junction channel modulators may be used together with panexin modulators in the manufacture of separate or combination agents for the treatment of one or more diseases, disorders, and conditions shown herein. In certain embodiments, one or more disorders are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at the expected rate, dehiscent wounds; fibrosis, fibrous diseases, disorders, or conditions; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory diseases; and edema.

[0027] In another embodiment, the present invention provides gap junction channel modulators or hemichannel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs of any of the aforementioned compounds, for the treatment of one or more diseases, disorders, and pathologies as shown herein. In some embodiments, the present invention provides, for example, panexin modulators for the treatment of one or more diseases, disorders, and pathologies as shown herein, e.g., compounds of formula VI, e.g., probenecid, and / or analogs or prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 The disclosure also provides the use of Panx1, or any analogue thereof, either alone or in combination with the gap junction channel and / or hemichannel modulators of this disclosure. In certain embodiments, one or more diseases, disorders, or conditions are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at the expected rate, dehiscent wounds; fibrosis, fibrous diseases, disorders, or conditions; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory diseases; and edema.

[0028] In another embodiment, the present invention relates to gap junction channel modulators or hemichannels, such as peptide 5, for the treatment of one or more diseases, disorders, and pathological conditions as described herein. The present invention provides modulators and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs of any of the aforementioned compounds. In some embodiments, the present invention provides panexin modulators, e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 The use of Panx1, or any analogue thereof, either alone or in combination with gap junction channel modulators, including those contained herein, is also provided. In certain embodiments, one or more diseases, disorders, or conditions are selected from the group consisting of, for example, ischemia (including perinatal ischemia, cutaneous ischemia, and myocardial ischemia), stroke, asphyxia, traumatic brain injury, spinal cord injury, heart attack, inflammatory cardiac disorder (including pericarditis), reperfusion injury (including cardiac reperfusion after surgery or transplantation), hepatic reperfusion after surgery or transplantation, retinal ganglion cell (RGC) loss and / or retinal ischemia, or ocular fibrosis.

[0029] In some embodiments, the present invention provides a method for improving recovery from surgery or procedures and / or treating postoperative contractures, the method comprising administering to a subject a gap junction channel modulator such as peptide 5 and / or its analogues, a compound of formula I, e.g., tonaversat, and / or an analogue of any of the aforementioned compounds. In related embodiments, the present invention provides the use of a gap junction channel modulator such as peptide 5 and / or its analogues, a compound of formula I, e.g., tonaversat, and / or an analogue of any of the aforementioned compounds in the manufacture of a drug for improving recovery from surgery or procedures and / or treating postoperative contractures. In related embodiments, the present invention provides, for example, a gap junction channel modulator such as peptide 5 and / or its analogues, a compound of formula I, e.g., tonaversat, and / or an analogue of any of the aforementioned compounds for improving recovery from surgery or procedures and / or treating postoperative contractures.

[0030] In some embodiments, the present invention provides a method for improving recovery from surgery or procedure and / or treating postoperative contractures, the method comprising a panexin modifier, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, e.g. 10 The present invention includes administering Panx1 or any analogue thereof. In related embodiments, the present invention relates to the manufacture of a panexin modifier, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10The use of Panx1 or any analogue thereof is provided. In related embodiments, the present invention provides, for example, panexin modifiers, for example compounds of formula VI, for example probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, for improving recovery from surgery or procedure and / or treating postoperative contractures, and / or synthetic mimic peptide blockers of panexin 1, for example 10 The present invention provides Panx1 or any analogue thereof. In one embodiment, the surgery or procedure is an orthopedic surgery or procedure. In one embodiment, the postoperative contracture is an orthopedic postoperative joint contracture.

[0031] In another embodiment, the present invention provides a method for treating or reducing adhesion formation in a subject, the method comprising administering to the subject a gap junction channel modulator such as peptide 5 and / or its analogues, a compound of formula I, e.g., tonaversat, and / or an analogue of any of the aforementioned compounds. In a related embodiment, the present invention provides a method for treating or reducing adhesion formation in a subject The present invention provides the use of gap junction channel modulators such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs or prodrugs of any of the aforementioned compounds in the manufacture of agents for treating or reducing adhesion formation in elephants. In related embodiments, the present invention provides, for example, gap junction channel modulators such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs of any of the aforementioned compounds for treating or reducing adhesion formation in a subject.

[0032] In another embodiment, the present invention provides a method for treating or reducing adhesion formation in a subject. The present method provides a panexin regulator, for example, a compound of formula VI, for example probenecid, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or a synthetic mimic peptide blocker of panexin 1, for example, 10The present invention includes administering Panx1 or any analogue thereof. In related embodiments, the present invention relates to the manufacture of agents for treating or reducing adhesion formation in a subject, including panexin modifiers, e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, e.g. 10 The present invention provides the use of Panx1 or any analogue thereof. In related embodiments, the present invention provides, for example, panexin modifiers for treating or reducing adhesion formation in a subject, such as compounds of formula VI, such as probenecid, and / or one or more analogues or prodrugs of any of the aforementioned compounds, and / or synthetic mimic peptide blockers of panexin 1, such as 10 This provides Panx1 or any analogue thereof.

[0033] In another embodiment, the present invention relates, for example, to the use of a compound of formula I, e.g., tonaversat, and / or an analog of any of the aforementioned compounds, to directly and immediately block a Cx43 hemichannel and cause a concentration- and time-dependent decrease in GJ coupling.

[0034] In yet another embodiment, various disorders can be treated by compositions and methods of the present invention, including methods of treatment using gap junction channel (e.g., hemichannel) modulators alone or in combination with panexin channel modulators. These disorders include neurodegenerative diseases (e.g., Alzheimer's disease, AIDS-related dementia, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, spinal muscular atrophy, and cerebellar degeneration); ischemic injury; fibrosis of the lungs, kidneys, or liver; vascular diseases (e.g., restenosis, atherosclerosis, atherosclerotic coronary artery disease, or hypertension); respiratory diseases (e.g., asthma, chronic bronchitis, bronchiectasis, or cystic fibrosis); undesirable or abnormal hypertrophy; arthritis, rheumatoid arthritis (RA); psoriasis, psoriatic plaques, sarcoidosis; CNS trauma including spinal cord injury and optic nerve injury; diabetic and other proliferative retinopathy including retinopathy of prematurity; posterior lens fibrosis; open-angle glaucoma, closed-angle glaucoma, and normal-tension glaucoma; as well as secondary glaucoma, pigmentary glaucoma, and pseudoexfoliation. Glaucoma, traumatic glaucoma, neovascular glaucoma, and glaucoma including variations of open-angle glaucoma and closed-angle glaucoma such as iris-corneal endothelial syndrome (ICE) and neovascular glaucoma, senile macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant neovascularization, corneal graft rejection, retinal / choroidal neovascularization, angle neovascularization (rubeosis), ocular neovascular disease, vascular restenosis, uveitis, dry eye disease, and the eye and Conditions characterized by persistent corneal epithelial defects, arteriovenous malformations (AVMs), thyroid hyperplasia (including Graves' disease), corneal and other tissue transplants, chronic inflammation, pneumonia, ocular inflammation, acute lung injury / ARDS, sepsis, systemic capillary leak syndrome, multiple organ dysfunction syndrome (MODS), systemic inflammatory response syndrome (SIRS), acute respiratory distress syndrome, post-burn vascular permeability syndrome, ascites, pleural effusion, and pericardial effusion, (especially) Changes in permeability after cardiopulmonary bypass surgery (in infants and young children), reperfusion injury, snake bites, primary pulmonary hypertension, malignant pulmonary exudation, cerebral edema (e.g., associated with acute stroke / closed head injury / trauma), synovitis, osteoarthritis (OA), and third spacing of fluid (3rd spacing of fluid) disorders. This includes, but is not limited to, diseases such as pancreatitis, compartment syndrome, burns, intestinal diseases, chronic inflammation including inflammatory bowel disease (IBD) (including Crohn's disease and ulcerative colitis), allograft rejection, inflammatory bowel disease, nephrotic syndrome, hemophilic arthropathy, hypertrophic scarring, Osler-Rueh disease, pyogenic granuloma, post-lens fibrosis, scleroderma, trachoma, vascular adhesions, synovitis, dermatitis, pre-eclampsia, ascites, pericardial effusion (such as that associated with pericarditis), pleural effusion, postoperative tissue edema, acute orthopedic injuries, hypersensitivity reactions, cystic fibrosis, and chronic skin wounds, ulcers or ulcerative lesions including diabetic foot ulcers, venous leg ulcers, and pressure ulcers, as well as infectious diseases including malaria, dengue fever, and pneumonia.

[0035] Certain preferred treatments for these diseases, disorders, and conditions include the administration of gap junction channel modulators, e.g., compounds of formula I (e.g., tonaversat), connexin peptide imitation compounds, and / or one or more analogs or prodrugs of any of the aforementioned compounds, and / or panexin modulators such as compounds of formula VI (e.g., probenecid), and / or panexin peptide imitation compounds, and / or one or more analogs or prodrugs of any of the aforementioned compounds. Particularly preferred compounds are compounds of formula I, e.g., tonaversat, and compounds of formula VI, e.g., probenecid.

[0036] In some embodiments, gap junction channel modulators or connexin modulators are modulators of gap junctions and / or connexins present in blood vessels, such as connexin 43 gap junction channel modulators or connexin 43 modulators, connexin 40 gap junction channel modulators or connexin 40 modulators, or connexin 45 gap junction channel modulators or conneixn 45 modulators. Preferably, the connexin modulator is a connexin 43 modulator. Connexin modulators and connexin 43 modulators include means for downregulating connexin transcription or connexin translation, such as antisense molecules. These also include ZO-1 binding peptides in the case of connexin 43. Preferably, the gap junction channel modulator is a connexin 43 gap junction channel modulator. Preferred connexin 43 gap junction channel modulators are tonaversat or another compound of formula I. A pharmaceutical composition of the present invention for any of the uses described herein may include, for example, connexin 26 (Cx26), connexin 30 (Cx30), connexin 31.1 (Cx31.1), connexin 36 (Cx36), connexin 37 (Cx37), connexin 40 (Cx40), connexin 45 (Cx45), connexin 50 (Cx50), or connexin 57 (Cx57), or any other connexin, or a gap junction channel modulator, such as a polynucleotide, that can inhibit or block connexin gap junctions or connexin hemichannels in the eye or blood vessels. In another embodiment, a pharmaceutical composition of the present invention for any of the uses described herein may include at least one panexin modulator, and may further include any of the gap junction channel modulators or connexin modulators described or indicated herein.

[0037] In one embodiment, the present invention relates to a pharmaceutical composition, product, and method for treating ocular and other disorders, including, for example, glaucoma, diabetic retinopathy (DR), diabetic macular edema (DME), senile macular degeneration (AMD), ocular fibrosis, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one panexin modifier to the eye of the subject. In some embodiments, neuropathic ocular disorders may be, for example, glaucoma, loss of RGC, and / or glaucomatous ophthalmic neuropathy. In some embodiments, glaucoma is , which may be caused by high intraocular pressure. In some embodiments, glaucoma may be caused by low-tension glaucoma or normal-tension glaucoma. In some embodiments, administration of at least one connexin modulator in a therapeutically effective amount is effective in treating glaucoma, retinal ganglion cell loss (e.g., treatment, prevention, slowing, mitigation, cessation, or improvement), and / or reducing vitreous glutamate concentration. The pharmaceutical compositions of the present invention for any of the uses covered herein may also include, for example, panexin modulators that can inhibit or block panexin channels. In some embodiments, the panexin modulator may or may not include Panx1, Panx2, or Panx3 modulators. In some embodiments, the panexin modulator may or may not include Panx1 modulators.

[0038] In another embodiment, the present invention relates to pharmaceutical compositions, products, and methods for treating ocular and other disorders, including, for example, DR, glaucoma, DME, AMD, ocular fibrosis, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one panexin modifier to the eye of the subject. In some embodiments, neuropathic ocular disorders may be, for example, loss of retinal ganglion cells (RGCs) and / or glaucomatous ocular neuropathy. In some embodiments, administration of a therapeutically effective amount of at least one panexin modifier is effective in treating (e.g., treating, preventing, slowing, mitigating, stopping, or improving) loss of membrane ganglion cells, which is further useful in reducing vitreous glutamate concentration.

[0039] In one embodiment, the present invention relates to pharmaceutical compositions, products, and methods for treating intraocular pressure (IOP). In some embodiments, the treatment of IOP treats or prevents IOP-related neuropathy. In some embodiments, a method for treating IOP includes, for example, administering to the target eye a therapeutically effective amount of at least one hemichannel or connexin modulator and / or at least one panexin channel or panexin modulator. In one embodiment, the present invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma. A method herein provides treatment of IOP-related optic neuropathy, such as glaucoma, in an amount sufficient to reduce IOP. In some embodiments, connexin modulators and / or panexin modulators are useful in treating trauma associated with elevated IOP. In some embodiments, the connexin modulator is a connexin 43 modulator. In some embodiments, compositions and methods of the present invention are useful for treating IOP and reducing IOP to a normal level, for example, less than 21 mm Hg, for example, 8-21 mm Hg. In some embodiments, the compositions and methods of the present invention are useful for reducing intraocular pressure to about 22 mm, 21 mm, 20 mm Hg, or less.

[0040] The compositions, products, and methods described herein are useful in one aspect for treating glaucoma without toxic side effects. In some aspects, the glaucoma may be open-angle glaucoma or closed-angle glaucoma. In some aspects, administering therapeutically effective amounts of at least one connexin or hemichannel modulator, e.g., a connexin 43 modulator or a connexin 43 hemichannel modulator, and / or at least one panexin modulator, to the ocular tissue of the subject increases flow through the trabecular network.

[0041] In one embodiment, the present invention relates to a pharmaceutical composition, product, and method for treating normal tension glaucoma or normotensive glaucoma. In some embodiments, the method comprises, for example, administering to the target eye a therapeutically effective amount of at least one connexin or hemichannel modulator and / or at least one panexin modulator. In one embodiment, the present invention relates to a pharmaceutical composition and method for treating glaucoma, for example. In some embodiments, the connexin modulator is connexin 43 or connexin 43. Nexine 43 is a hemichannel modulator. In some embodiments, the connexin modulator is, for example, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin or hemichannel modulator containing the aforementioned connexins in the eye or blood vessels, and / or at least one panexin or panexin channel modulator, or may contain these, or may not contain them. In some embodiments, the compositions and methods of the present invention are useful for treating glaucoma even when intraocular pressure is at a normal level, for example, less than 21 mm Hg. In some embodiments, the modulator may contain any of the above, or may not contain them.

[0042] In some embodiments, the present invention relates to glaucoma including hypertensive glaucoma and normal-tension glaucoma, clinical geographic atrophy; AMD including dry AMD and exudative AMD, ocular abnormalities or disorders, chronic macular ischemia, fibrosis, idiopathic polypoidal choroidal vasculopathy (IPC); diabetic maculopathy, diabetic retinopathy; hypertensive retinopathy, inflammatory choroidal neovascularization; central serous choroidal retinopathy (CSR); macular telangiectasia; pattern dystrophy; subretinal / subPRD neovascularization; serous detachment of the retinal neurosensory epithelium; RPE detachment; hemorrhage (including rupture hemorrhage into the vitreous humor, subretinal, intraretinal, or preretinal); supraretinal, intraretinal, subretinal, or subpigmental scarring The present invention relates to pharmaceutical compositions, products, and methods for the treatment of eye disorders that may or may not include: scarring / glial tissue or fibrin-like deposits; retinal fibrosis, retinal hemangioma proliferation and retinal-choroidal anastomosis; choroidal neovascularization (CNV); cystic macular palsy; retinal thickening; non-exudative AMD; and retinal scarring, uveitis including posterior uveitis, scleritis, episclerotic retinitis including cytomegalovirus (CMV) retinitis, retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, sclerosis of the choroidal capillary plate, dry eye, diabetic macular edema (DME), neuropathic eye disorders, trauma-induced decreased intraocular pressure, epithelial basement membrane dystrophy, and / or other eye disorders. Compositions and products useful in any of the therapeutic methods described herein include a therapeutically effective amount of at least one connexin or hemichannel modulator, e.g., a connexin modulator, or at least one panexin or panexin channel modulator. In some embodiments, the connexin modulator is, for example, a hemichannel containing connexin 43 (Cx43), Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin or connexin hemichannel modulator in the eye or blood vessels. In embodiments for treating diabetic retinopathy, the composition may include, for example, a panexin or panexin channel modulator, and / or a small molecule connexin or hemichannel modulator, e.g., a small molecule inhibitor of the connexin 43 hemichannel or connexin 43 itself.In some embodiments, a connexin modulator for treating diabetic retinopathy or any other disease, disorder, or condition herein may be any connexin 43 modulator of this disclosure comprising or not comprising the polynucleotides having SEQ ID NOs: 1-3 and / or modified versions thereof. In some embodiments, the modulator may or may not comprise any of the foregoing.

[0043] The present invention, as described and claimed herein, may also be used in the treatment of cataracts. The central retinal artery supplies blood to the eye, with branches to the choroid perfusing the posterior part of the eye, and a superficial and deep vascular network supplying the anterior retina. Furthermore, long branches perfusing the iris and ciliary body, supplying nutrients and oxygen to the anterior part of the eye, including the lens (via the ciliary body). Surprisingly, the inventors have established that diseases affecting the vascular bed, including diabetic retinopathy and senile macular degeneration, also affect the flow to the anterior segment of the eye and thus contribute to cataract formation. It should be noted that cataracts are one of the most common causes of visual impairment in people with diabetes mellitus, and severe cataracts in the eye may also be associated with a higher prevalence of late-stage AMD.

[0044] In some embodiments, the present invention relates to pharmaceutical compositions, products, and methods for treating ocular disorders that may or may not include macular holes, macular degeneration, retinal tears, DME, diabetic retinopathy (DR), vitreoretinopathy, refractive errors, dry eye, viral conjunctivitis, ulcerative conjunctivitis and scar formation in wound healing, corneal epithelial wounds, Sjögren's syndrome, cataracts, sequelae of radial keratotomy, and increased corneal tissue thickness. In these embodiments, the composition may include, for example, a panexin modifier or a connexin modifier, such as a small molecule inhibitor or peptide inhibitor of connexin 43. In some embodiments, the connexin modifier is, for example, a modifier of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57, or any other connexin in the eye or blood vessels. In some embodiments of this embodiment, the composition may include any connexin 43 modifier of the Disclosure, for example, a polynucleotide having SEQ ID NOs: 1-3, or not. In some embodiments, the modifier may include or not include any of the aforementioned.

[0045] In some embodiments, the present invention relates to pharmaceutical compositions, products, and methods for treating cataracts. In these embodiments, the composition may include, for example, panexin or panexin channel modulators, gap junction modulators, gap junction or hemichannel phosphorylators, or connexin antagonists, such as polynucleotides, peptides or peptide mimetic agents, or small molecule antagonists of connexin. In some embodiments, the connexin modulator is a modulator of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessels. In some embodiments of this embodiment, the composition may include, for example, any Cx43 modulator of the present disclosure, except for tonaversat. In some embodiments, the modulator may or may not include any of the above.

[0046] In some embodiments, the present invention relates to pharmaceutical compositions, products, and methods for treating ocular disorders that may or may not include retinal vein or artery occlusion, glaucoma, retinal seizures, trauma causing elevated intraocular pressure, diabetic retinopathy, cystoid macular edema. In this embodiment, the composition may include, for example, panexin or panexin channel modulators, gap junction modulators, gap junction or hemichannel phosphorylators, in the case of Cx43, ZO-1 binding site peptide mimics, or other connexin antagonists, such as polynucleotides, peptides or peptide mimetic agents, or small molecule antagonists of connexin. In some embodiments, the connexin modulator is Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or modulators of any other connexin in the eye or blood vessels. In some embodiments of this model, the composition may include any Cx43 modifier of the Disclosure, for example, one that does not contain tonaversat. In some embodiments, the modifier may include or may not include any of the aforementioned modifiers.

[0047] In some embodiments, the present invention relates to pharmaceutical compositions, products, and methods for treating Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis, migraines, or aura with or without migraines, sciatica / radiculopathy. In these embodiments, the composition may contain, for example, a panexin modulator, a gap junction or hemichannel phosphorylator, or a connexin antagonist, for example, alone or in combination. In some embodiments, the connexin modulator is, for example, Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin modulator in the eye or blood vessels. In some embodiments of this embodiment, the composition may contain, for example, a compound of formula I, e.g. For example, the present invention may include any connexin 43 modifier of this disclosure, including tonaversat and any analogue of the aforementioned compounds, as well as, for example, tonaversat prodrugs and eye-targeting prodrugs of the formula I compounds of this disclosure. In some embodiments, the modifier may or may not include any of the aforementioned.

[0048] In one embodiment, the present invention relates to pharmaceutical compositions, products, and methods for treating ocular hypoxia, damage to blood vessels of the eye, and / or vascular leakage. In some embodiments, the treatment and prevention of ocular hypoxia includes the treatment or prevention of any other condition that causes vascular leakage, vascular rupture, and / or lower-than-normal oxygenated blood flow to the choroid or other blood vessels in the eye. In some embodiments, the treatment or prevention of ocular hypoxia includes the treatment of a condition that causes compression of blood vessels or otherwise affects blood flow to the eye. In some embodiments, a method for treating ocular disorders such as ocular hypoxia, glaucoma, AMD, DME, ocular fibrosis, and / or retinal perfusion disorder includes, for example, administering to the eye of the subject a therapeutically effective amount of at least one gap junction modifier or connexin modifier, or at least one panexin or panexin channel modifier. In one embodiment, the present invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma or AMD.

[0049] In some embodiments, the compositions of the present invention are useful as adjuvants to improve the success rate of trabeculectomy.

[0050] The anterior part of the eye is filled with aqueous humor, a clear fluid that nourishes the structures within the anterior portion of the eye. This fluid is constantly produced by the ciliary body surrounding the lens of the eye. The aqueous humor flows out of the eye through the pupil and through trabecular channels located at the junction where the cornea attaches to the iris, known as the drainage angle of the eye. In some embodiments of the present invention, one or more gap junctions or connexin modulators, or panexin or panexin channel modulators, are administered to the trabecular network or the ciliary body.

[0051] In one embodiment of the present invention, compositions, products, and methods for treating other ocular conditions in the subject, such as retinal ischemic disease or ocular ischemic disease, which include, for example, administering a therapeutically effective amount of a gap junction modifier, connexin modifier, or panexin or panexin channel modifier, in an amount effective in reducing inflammation in the endoretina. In some embodiments, retinal ischemic disease is retinal artery occlusion or central retinal vein occlusion. In some embodiments, ocular ischemic disease (optic ischemic disease) is also described. Examples of diseases include anterior ischemic optic neuropathy. In some embodiments, the connexin modifier is a connexin 43 modifier.

[0052] The present invention also relates to compositions, products, and methods for reducing impaired choroidal perfusion and / or choroiditis or choroidal overperfusion in a subject, wherein the subject is administered to the choroid in an amount effective in reducing impaired choroidal perfusion and / or choroiditis or choroidal overperfusion within the endoretina, such as a gap junction modifier, a connexin modifier, or a panexin or panexin channel modifier. This includes the following. In some embodiments of the present invention, administration to the choroid of a subject a therapeutically effective amount of a gap junction modifier, connexin modifier, or panexin or panexin channel modifier, which is effective in reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces choroidal capillary endothelial cell loss and / or choroidal capillary detachment, thereby treating or preventing ocular disorders. In some embodiments, the reduction of impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces retinal pigment epithelial degeneration and / or drusen development, otherwise dry macular degeneration or wet macular degeneration To improve, halt, slow, and / or reverse the progression of possible macular degeneration or macular dystrophy. In some embodiments, gap junction modifiers, connexin modifiers, or panexin or panexin channel modifiers for reducing impaired choroidal perfusion and / or choroiditis or choroidal hyperperfusion are Cx43 modifiers. Gap junction modifiers, connexin modifiers, or panexin or panexin channel modifiers for reducing impaired choroidal perfusion and / or choroiditis or choroidal hyperperfusion may be administered together with ophthalmic agents.

[0053] Impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, can induce vascular leakage in the choroid and lead to endothelial cell loss in the retinal pigment epithelium. Surprisingly, as described herein, impaired choroidal perfusion and / or choroiditis, as well as choroidal capillary plate degeneration, have been found to arise from the upregulation of Cx43, and that the upregulation of Cx43 is a contributing factor to AMD. Vascular structures were found in the choroids of the retinas of AMD organ donors associated with changes in Cx43 expression, supporting the role of Cx43 upregulation in AMD. In some embodiments, the treatment or prevention of vascular leakage and impaired choroidal perfusion, and / or choroiditis, or choroidal hyperperfusion, is useful in the treatment or prevention of retinal pigment epithelial degeneration or retinal neovascularization associated with conditions such as non-exudative or dry AMD, neovascular AMD, or wet AMD, and drusen formation. Surprisingly, upstream events such as impaired vascular leakage and choroidal perfusion and / or choroiditis, as described herein, are associated with choroidal changes in AMD, followed by symptoms such as retinal pigment epithelial degeneration or retinal neovascularization.

[0054] Accordingly, in one embodiment, the present invention relates to a method of administering the gap junction modifier, connexin modifier, and / or panexin or panexin channel modifier of the present invention alone or in combination with one or more ophthalmic therapeutic agents for use in the treatment of AMD, including ophthalmic agents for use in the treatment of neovascular AMD, wet AMD, drusen formation, dry AMD, retinal pigment epithelial degeneration, or geographic atrophy. The gap junction modifier, connexin modifier, or panexin or panexin channel modifier of the present invention may be administered separately from, simultaneously with, or in combination with ophthalmic therapeutic agents.

[0055] In some embodiments, the connexin or panexin oligonucleotides and polynucleotides of the present invention are prepared or otherwise manufactured chemically or synthetically. In some embodiments, the connexin modifier is a connexin oligonucleotide or polynucleotide. In one embodiment, the connexin modifier is a connexin antisense oligodeoxynucleotide, whether chemically modified or unmodified, for example, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or Cx43 antisense oligodeoxynucleotide or antisense oligodeoxynucleotide against any other connexin in the eye or blood vessels. In some embodiments, the modified connexin antisense polynucleotide or oligonucleotide may include a mixture of modified and unmodified nucleotides. In some embodiments, the connexin antisense compound used in the methods herein is an antisense oligonucleotide containing a native nucleotide and an unmodified nucleoside bond. In some embodiments, the connexin oligonucleotide or polynucleotide and / or connexin antisense oligodeoxynucleotide may be, for example, a Cx43 antisense oligonucleotide, polynucleotide, and / or Cx43 antisense oligodeoxynucleotide. In some embodiments, the modifier may or may not contain any of the above.

[0056] Connexin antisense oligonucleotide containing at least one unmodified nucleotide Alternatively, polynucleotides are included in the present invention. In one embodiment, a connexin antisense oligonucleotide or polynucleotide may contain at least one modified nucleotide and / or have at least one modified nucleoside bond and / or at least one modified sugar moiety. The modified nucleoside bond may be, for example, a phosphorothioate bond. In some embodiments, for example, a connexin polynucleotide may contain at least one nucleotide comprising conformationally tensioned nucleotides, such as locked nucleic acid (LNA) or cross-linked nucleic acid (BNA). The locked nucleotide may be selected from, for example, one of the following types: 2′-O-CH2-4′ (oxy-LNA), 2′-CH2-CH2-4′ (methylene-LNA), 2′-NH-CH2-4′ (amino-LNA), 2′-N(CH3)-CH2-4′ (methylamino-LNA), 2′-S-CH2-4′ (thio-LNA), and 2′-Se-CH2-4′ (seleno-LNA). In some embodiments, the modified nucleotide may be locked nucleic acid or unlocked nucleic acid. In some embodiments, the modified and unmodified connexin antisense oligonucleotide or polynucleotide is modified and unmodified Cx43 antisense oligonucleotide or polynucleotide. In some embodiments, the modified and unmodified connexin antisense oligonucleotides or polynucleotides are modified and unmodified Cx26 antisense oligonucleotides or polynucleotides, Cx31.1 antisense oligonucleotides or polynucleotides, Cx30 antisense oligonucleotides or polynucleotides, Cx45 antisense oligonucleotides or polynucleotides, Cx36 antisense oligonucleotides or polynucleotides, Cx37 antisense oligonucleotides or polynucleotides, Cx40 antisense oligonucleotides or polynucleotides, Cx50 antisense oligonucleotides or polynucleotides, or Cx57 antisense oligonucleotides or polynucleotides.In some embodiments, the connexin antisense oligonucleotide or polynucleotide includes a chiral phosphite moiety, such as that described in International Publication No. 2013012758.

[0057] Modified or unmodified connexin 43 antisense compounds, which include nucleotide sequences or are modified from nucleotide sequences selected from SEQ ID NOs: 1-16, are also covered herein. The polynucleotides of the present invention include polynucleotides having a length of less than 80 nucleotides, for example, 12-18 to about 50-80 nucleotides, preferably about 30 nucleotides or less, for example, 12-about 30 nucleotides, more preferably about 15-about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the present invention cover the use of connexin 43 antisense compounds having a maximum length of 40 nucleotides, for example, 15-40 nucleotides, which include nucleotide sequences selected from SEQ ID NOs: 1-17, SEQ ID NOs: 4-17, or about 8-40 nucleotides of SEQ ID NO: 17. In some embodiments, the Cx43 antisense compound may be modified by substituting one or more thymine nucleotides in SEQ ID NOs: 4-17, or SEQ ID NOs: 1-3, with one or more uridine nucleotide residues.

[0058] Modified or unmodified Cx45 antisense polynucleotides containing 8 to about 80 nucleotides, as of SEQ ID NO: 217, and modified and unmodified panexin antisense polynucleotides containing 8 to about 80 nucleotides, as of SEQ ID NO: 279, are also covered herein. The polynucleotides of the present invention include synthetic polynucleotides having a length of less than 80 nucleotides, for example, 12 to 18 to about 50 to 80 nucleotides, preferably about 30 nucleotides or less, for example, 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the present invention include a maximum length of 40 nucleotides, for example, 15 to 40 nucleotides, for example, about 8 to about 40 or about 15 to about 40 nucleotides, as of SEQ ID NO: 217 The use of a connexin 45 antisense compound containing a creotide is discussed. In some embodiments, the method of the present invention involves the use of a panexin antisense compound containing up to 40 nucleotides in length, for example, 15 to 40 nucleotides in length, for example, about 8 to about 40 nucleotides or about 15 to about 40 nucleotides in SEQ ID NOs. 283 to 287. In some embodiments, the connexin 45 or panexin antisense compound may be modified by substituting one or more thymine nucleotides in SEQ ID NOs. 217 or SEQ ID NOs. 283 to 287 with one or more uridine nucleotide residues.

[0059] Modified or unmodified Cx26 polynucleotides, Cx31.1 polynucleotides, Cx36 polynucleotides, Cx37 polynucleotides, Cx40 polynucleotides, Cx50 polynucleotides, or Cx57 polynucleotides, or modified or unmodified antisense polynucleotides, for use in any of the methods described herein. The pharmaceutically acceptable compositions of the present invention for any of the uses described herein may also include panexin antisense polynucleotide modifiers that can inhibit panexin channels, such as Panx1, Panx2, or Panx3. In some embodiments, the modifiers may or may not include any of the aforementioned.

[0060] In some embodiments of the present invention, a connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs. Connexin or panexin, which are oligonucleotides or polynucleotides, may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to 8 to 80 nucleotide parcels of each of these sequences. For example, a connexin 45 modifier, which is an oligonucleotide or polynucleotide, may have at least approximately 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to the 8-80 nucleotide portion of SEQ ID NO: 217, while a panexin modifier, which is an oligonucleotide or polynucleotide, may have SEQ ID NO: 283 (Panx1 polynucleotide), (Panx1 polynucleotide RefSeq number NM_015368.3), SEQ ID NO: 28 4(Panx2 polynucleotide), (for variant 1, Panx2 polynucleotide RefSeq number NM_052839.3), SEQ ID NO: 285 (for Panx2 polynucleotide variant 2, RefSeq number NM_001160300.1), SEQ ID NO: 286 (for Panx2 polynucleotide variant 3, RefSeq number NR_027691.1), or SEQ ID NO: 287(Panx3 polynucleotide) (Panx3 polynucleotide RefSeq number NM_052959.2), or 8 to 80 nucleotide segments of these variants may have at least approximately 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology. In some embodiments, the panexin modifier may or may not contain a panexin peptide sequence. The panexin peptide sequence may include 8 to 40 consecutive amino acids, an extracellular domain, an intracellular domain, a carboxyl terminus, or an amino terminus of polypeptide SEQ ID NO: 288 (Panx1 peptide), SEQ ID NO: 289 (Panx2 peptide), or SEQ ID NO: 290 (Panx3 peptide), or their variants. In some embodiments, the modifier may or may not contain any of the above.

[0061] In other embodiments, the gap junction modifier or connexin modifier is sometimes referred to as an anticonnexin peptide or peptide mimetic, such as an anticonnexin hemichannel blocking peptide or peptide mimetic, which includes the connexin extracellular domain, transmembrane region, and connexin carboxyterminal peptide. The gap junction regulator, or anti-connexin hemichannel blocking peptide or peptide mimetic, may be modified or unmodified. The gap junction regulator and anti-connexin hemichannel blocking peptide or peptide mimetic are prepared or otherwise manufactured chemically or synthetically. In some embodiments, the gap junction regulator or connexin regulator is a Cx43 peptide or peptide mimetic. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic contains a portion of the extracellular domain or transmembrane domain of connexin, such as Cx43 or Cx45. In other embodiments, the panexin or panexin channel regulator is a panexin peptide or peptide mimetic, e.g., a modified or unmodified peptide or peptide mimetic, sometimes referred to as an anti-panexin peptide or peptide mimetic.

[0062] In some embodiments, the modifier of the present invention comprises any of the peptides described herein, including an anti-Cx43 peptide or peptide mimetic, for example, a peptide comprising a portion of the extracellular domain of connexin, which is therapeutically effective, for example, effective in curing any of the neuropathic eye disorders described herein and useful in the methods of the present invention, and a peptide comprising a portion of the carboxyl terminus of connexin. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic comprises a portion of the extracellular domain or transmembrane domain of connexin such as Cx43.

[0063] In some embodiments, the regulator may be a gap junction closure compound and a hemichannel closure compound. In some embodiments, the gap junction closure compound and the hemichannel closure compound are a connexin 43 gap junction closure compound and a connexin 43 hemichannel closure compound. The preferred connexin carboxy-terminated polypeptide is a connexin 43 carboxy-terminated polypeptide.

[0064] In other embodiments, gap junction modifiers are modified or unmodified peptides or peptide mimetics, sometimes referred to as anti-gap junction peptides or peptide mimetics, such as anti-gap junction or hemichannel blocking peptides or peptide mimetics, which include the extracellular domain, transmembrane region, or connexin carboxy-terminal peptides of proteins containing intraocular gap junctions, such as Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57. The anti-gap junction or hemichannel blocking peptide or peptide mimetics may or may not be modified. The anti-gap junction or hemichannel blocking peptide or peptide mimetics are prepared chemically, synthetically, or otherwise manufactured. In some embodiments, the gap junction modifier is a Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57 peptide or peptide mimetic.

[0065] Treatment of any of the eye conditions described herein, such as glaucoma, DME, ocular fibrosis, AMD, or other eye disorders referenced herein together with one or more of the pharmaceutical compositions of the present invention, such as anticonnexin ODNs and gap junction modifiers, such as connexin hemichannel blockers, such as peptides or peptide mimics, may include simultaneous, individual, sequential, or continuous administration thereof.

[0066] In some embodiments of the present invention, the regulator is a gap junction closing or blocking compound, such as tonaversat, or a hemichannel closing or blocking compound. In some embodiments, the gap junction regulator may be a small molecule also referred herein to as an anticonnexin or connexin regulator. In some embodiments, the anticonnexin regulator drug is of formula I: [ka]

[0067] It may have the following structure, where Y is C-R1,

[0068] R1 is acetyl,

[0069] R2 is hydrogen, C 3-8 Cycloalkyl, optionally interrupted by oxygen, or substituted with hydroxyl. 1-6 Alkyl, C 1-6 Alkoxy or substituted aminocarbonyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonyloxy, C 1-6 Alkoxy, nitro, cyano, halo, trifluoromethyl, or CF3S; or the group CF3-A- (wherein A is -CF2-),

[0070] -CO-, -CH2-, CH(OH), SO2, SO, CH2-O, or CONH; or the group CF2H-A′- (wherein A′ is oxygen, sulfur, SO, SO2, CF2, or CFH); any of the aromatic moieties are optionally substituted, trifluoromethoxy, C 1-6 Alkyl sulfinyl, perfluoro C 2-6 Alkyl sulfonyl, C 1-6 Alkyl sulfonyl, C 1-6 Alkoxysulfinyl, C 1-6 Alkoxysulfonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulfinyl, heteroarylsulfinyl, arylsulfonyl, or heteroarylsulfonyl; any amino group may be one or two C molecules. 1-6 Alkyl alkyl group, or C 1-6 Alkyl sulfinylamino, C 1-6 Alkylsulfonylamino, C 1-6 Alkoxysulfinylamino or C1-6 Alkoxysulfonylamino, or C 1-6 Alkylcarbonyl, nitro, or cyano, or -C(C 1-6 Alkyl)NOH or -C(C 1-6 C 1-6 Alkylcarbonylamino, C 1-6 Alkoxycarbonylamino, C 1-6 Alkyl-thiocarbonyl, C 1-6 Alkoxy-thiocarbonyl, C 1-6 Alkyl-thiocarbonyloxy, 1-mercaptoC 2-7 Alkyl, formyl, or aminosulfinyl, aminosulfonyl, or aminocarbonyl; or optionally one or two C 1-6 By alkyl, or C 2-7 Amino compounds substituted with an alkanoyl group; one of R3 and R4 is either hydrogen or C. 1-4 It is alkyl, and the others are C 1-4 Alkyl, CF3, or CH2X a This is an optional choice of one or two Cs 1-4 Alkyl, cyano, or C 1-4 Fluorocarbonyl-substituted chlorocarbonyl, bromocarbonyl, iodine, C 1-4 Alkoxy, hydroxy, C 1-4 Alkylcarbonyloxy, -SC 1-4 Alkyl, nitro, amino; or R3 and R4 are both optionally C 1-4 C2 substituted with alkyl -5 It is polymethylene,

[0071] R5 is C 1-6 Alkylcarbonyloxy, benzoyloxy, ONO2, benzyloxy, phenyloxy or C 1-6 It is an alkoxy, and R6 and R9 are hydrogen, or R5 is hydroxyl, and R6 is hydrogen or C 1-2 It is an alkyl group, and R9 is hydrogen.

[0072] R7 is either a heteroaryl or phenyl compound, and optionally both of these, or optionally C 1-4 Alkyl, cyano, azide, C 1-4 Substituted once or twice with alkoxy, trifluoromethoxy, and trifluoromethyl, and then one or more times with a group or atom selected from chloro, fluoro, bromo, iodo, nitro, or amino,

[0073] R8 is hydrogen, C 1-6 Alkyl, OR 11 , or NHCOR 10 And R 11 is hydrogen, C 1-6 Alkyl, formyl, C 1-6 Alkanoyl, aroyl, or aryl-C 1-6 It is alkyl, R 10 is hydrogen, C 1-6 Alkyl, C 1-6 Alkoxy, mono, or di-C, sub-1-6 alkylamino, amino, amino-C, sub-1-6 alkyl, hydroxy-C 1-6 Alkyl, Halo-C 1-6 Alkyl, C 1-6 Acyloxy-C 1-6 Alkyl, C 1-6 Alkoxycarbonyl-C 1-6 - Alkyl, aryl, or heteroaryl, where the R8-N-CO-R7 group is in cis form relative to the R5 group, and X is oxygen or NR 12 And R 12 is hydrogen or C 1-6 It is alkyl.

[0074] In some embodiments, with respect to any of the above-mentioned Markush groups, each group may or may not include any of the species listed for that group.

[0075] In some embodiments, the small molecule connexin modifier may be tonavelsat, caravelsat, or SB-204269. SB-204269 is also known as (trans-(+)-6-acetyl-4S-(4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-benzo[b]pyran-3R-ol). Caravelsat is also known as N-[(3R,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl]-4-fluorobenzamide. Tonavelsat is also known as N-(6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl)-3-chloro-4-fluorobenzamide.

[0076] With respect to any of the above Markush groups, that group may or may not contain any of the species listed for that group.

[0077] In some embodiments, the connexin modifier may be a prodrug of any compound for use in the present invention. In one embodiment, the connexin modifier prodrug of the present invention is a compound of formula II: [ka]

[0078] But often, during the ceremony,

[0079] Q is O or an oxime,

[0080] R2 is H,

[0081] A is directly bonded, -C(O)O*-, -C(R3)(R4)O*-, -C(O)OC(R3)(R4)O*-, or -C(R3)(R4)OC(O)O*-, where the atom marked with * is directly bonded to R1, and R3 and R4 are independently H, fluoro, and C 1-4 Alkyl, or C 1-4selected from fluoroalkyl, or both R³ and R⁴ together with the atoms to which they are bonded form a cyclopropyl group,

[0082] R¹ is selected from groups [1], [2], [2A], [3], [4], [5] or [6], and the atom marked with ** is directly bonded to A,

Chemical Formula

[0083] R⁷ is independently H, C 1-4 alkyl, or C 1-4 selected from fluoroalkyl,

[0084] R⁸ is (i) H, C 1-4 alkyl, or C 1-4 fluoroalkyl, or (ii) a side chain of a natural or non-natural alpha-amino acid, or a peptide described herein, or (iii) selected from biotin or chemically bonded to biotin,

[0085] R⁹ is H, -N(R)(R 12 ), or -N + (R l )(R 12 )(R 13 )X - , or -N(R ll )C(O)R 14 selected from,

[0086] R 11 , R 12 , and R 13 are independently H, C 1-4 alkyl, or C 1-4 selected from fluoroalkyl, and R 14 is H, C 1-4 ​Alkyl, or C 1-4 It is a fluoroalkyl, R 10 and R 15 Independently, C 1-4 Alkyl or C 1-4 Selected from fluoroalkyl groups, X is a pharmaceutically acceptable anion.

[0087] In some embodiments, R2 is BR 21 And in the formula, B is a direct bond, -C(O)O*-, -C(R 23 )(R 24 )O*, C(O)OC(R 23 )(R 24 )*,or C(R 23 )(R 24 )OC(O)O*, and the atom marked with * is R 21 Directly connect, R 23 and R 24 These are independently H, fluoro, and C. 1-4 Alkyl, or C 1-4 Selected from fluoroalkyl groups, R 21 The atoms are selected from groups

[21] ,

[22] , [22A],

[23] ,

[24] ,

[25] , and

[26] , and the atoms marked with ** are directly bonded to B, [ka] R 25 and R 26 H and C are independent of each other. 1-4 Alkyl, C 1-4 Selected from fluoroalkyl or benzyl, R 27 H and C are independent of each other. 1-4 Alkyl, C 1-4 Selected from fluoroalkyl groups, R 28 teeth, (i) H, C 1-4 Alkyl, or C 1-4 Fluoroalkyl, or (ii) side chains of natural or non-natural alpha-amino acids, or peptides as described herein, or (iii) Biotin or a substance chemically bonded to biotin,

[0088] R 29 H, -N(R 31 )(R 32 ), or -N*(R 31 )(R 32 )(R 33 )X-, or -N(R 31 )C(O)R 34 Selected from, R 31 , R 32 , and R 33 H and C are independent of each other. 1-4 Alkyl, or C 1-4 Selected from fluoroalkyl groups, R 34 H, C 1-4 Alkyl, or C 1-4 It is a fluoroalkyl, X is a pharmaceutically acceptable anion, R 30 and R 35 Independently, C 1-4 Alkyl or C 1-4 It is a fluoroalkyl group.

[0089] With respect to any of the above Markush groups, that group may or may not contain any of the species listed for that group.

[0090] In some embodiments, the peptides described herein may be connexin modifiers, calmodulin modifiers, or panexin modifiers.

[0091] In some aspects, Q is given by the equation = NHOR 43 It is an oxime of, and in the formula, R 43 teeth, (i) H, C 1-4 Fluoroalkyl or optionally substituted C 1-4Selected from alkyl groups, or (ii)-A 300 -R 300 And, A 300 These are direct bonds, -C(O)O*-, -C(R3)(R4)O*-, -C(O)OC(R3)(R4)O*-, or -C(R3)(R4)OC(O)O*-, where the atom marked with * is R 30 Directly connect, R3 and R4 are independently H, fluoro, and C. 1-4 Alkyl, or C 1-4 Selected from fluoroalkyl groups, or Both R3 and R4 are atoms that bond and form a cyclopropyl group. R 300 The group is selected from [1], [2], [2A], [3], [4], [5], or [6], and atoms marked with ** are A 300 Directly connect, [ka]

[0092] R5 and R6 are independently H and C 1-4 Alkyl, C 1-4 Selected from fluoroalkyl or benzyl, R7 is independently H, C 1-4 Alkyl, or C 1-4 Selected from fluoroalkyl groups, The R8 is (iii) H, C 1-4 Alkyl, or C 1-4 Fluoroalkyl, or (iv) Side chains of natural or non-natural alpha-amino acids, or peptides as described herein, or (v) Selected from biotin or chemically bound to biotin, R9 is H, -N(R)(R 12 ), or -N + (R 1l )(R 12 )(R 13 )X -, or -N(R ll )C(O)R 14 Selected from, R 11 , R 12 , and R 13 H and C are independent of each other. 1-4 Alkyl, or C 1-4 Selected from fluoroalkyl groups, R 14 H, C 1-4 Alkyl, or C 1-4 It is a fluoroalkyl, R 10 and R 15 Independently, C 1-4 Alkyl or C 1-4 Selected from fluoroalkyl groups, X is a pharmaceutically acceptable anion.

[0093] In one embodiment, R 43 , optionally phosphate group (P(O)OR 61 R 62 C replaced by ) 1-4 It is alkyl. In an example of such an embodiment, OR 43 is -OCH2P(O)OR 61 Ure 62 And in the formula, R 61 and R 62 H or C 1-4 It is alkyl.

[0094] In another embodiment, R 43 is C(O)CH(R 100 ) An amino acid derivative having the structure NH2, where R is the group 100 This refers to the side chain of a natural or non-natural amino acid, or a peptide as described herein.

[0095] In one embodiment, OR 43 It is -OC(O)CH(CH(CH3)2)NH2.

[0096] In some embodiments, with respect to any of the above-mentioned Markush groups, each group may or may not include any of the species listed for that group.

[0097] In some embodiments, the peptides described herein may be any of the peptides or peptide mimicry drug modifiers disclosed herein, such as peptides or peptide mimicry connexin modifiers or panexin modifiers. In some embodiments, the peptide connexin modifier may be any of SEQ ID NOs: 140-200, 237-313, and 343-356.

[0098] The compositions described herein may be used for eye conditions that include or do not include those described herein.

[0099] In some embodiments, the prodrug may be one described in International Publication No. 2014 / 006407, which is incorporated herein by reference. In some embodiments, the promoyety of the connexin regulator may comprise a chaperone moiety that targets one or more regions or structures of the eye. The promoyety may also be any peptide mimic or peptide antagonist of this disclosure. In some embodiments, the promoyety may be a single amino acid that is optionally protected on the functional group of a single amino acid. In some embodiments, the promoyety may be a target species. In some embodiments, the promoyety may also be a substrate of an inward or outward flux transporter on the cell membrane. Yeti may be, for example, chemically bonded biotin. PromoYeti may be, for example, chemically bonded D-serine.

[0100] In one embodiment of the method of the present invention, one or more gap junction modulators, one or more panexin channel modulators, one or more hemichannel modulators, one or more connexin modulators, or one or more panexin modulators described herein may be administered in combination with one or more ophthalmic therapeutic agents useful for treating ocular disorders, including, for example, glaucoma, ocular fibrosis, ocular hypoxia, AMD, DME, ocular hypoxia, and / or ocular neuropathic disorders. In some embodiments of the present invention, one or more connexin modulators or panexin modulators administered for the treatment of ocular disorders, such as wet AMD or dry AMD, neuropathic ocular disorders, such as intraocular retinal ganglion cell loss, glaucomatous ophthalmic neuropathy, and / or intraocular pressure-related neuropathy, may be administered together with ophthalmic therapeutic agents. In some embodiments, one or more gap junction modifiers, one or more panexin channel modifiers, one or more hemichannel modifiers, one or more connexin modifiers, or more panexin modifiers may be co-administered in a formulation comprising one or more gap junction modifiers, one or more panexin channel modifiers, one or more hemichannel modifiers, one or more connexin modifiers, or more panexin modifiers, and an ophthalmic therapeutic agent.

[0101] One or more gap junction modifiers, one or more panexin channel modifiers, one or more hemichannel modifiers, one or more connexin modifiers, or ophthalmic therapeutic agents for use in combination with one or more panexin modifiers of the present invention include, for example, anti-VEGF modifiers such as VEGF antagonists, mTOR inhibitors, PDGF modifiers such as PDGF antagonists, S1P production inhibitors, squalamine, PEDF metabolites, tubulin binders, integrin inhibitors, or other therapeutic agents useful in the treatment of neovascularization AMD or wet AMD, for example. Preferably, the ophthalmic therapeutic agent for use in combination with one or more modifiers of the present invention is a PDGF modifier. In some embodiments, the modifier may or may not include any of the above-described modifiers.

[0102] In some embodiments, the VEGF modulator may be an antagonist that suppresses and / or inhibits VEGF, or suppresses and / or blocks an upstream agonist of VEGF. In some embodiments, the VEGF antagonist may include, for example, an antagonist that binds to and suppresses VEGF, a compound that suppresses VEGF expression, and / or a VEGF inhibitor, or a viral vector encoding a protein or antisense polynucleotide that blocks or suppresses VEGF. In some embodiments, the species that suppresses VEGF and / or the upstream agonist of VEGF may be an antibody or antibody fragment, a nanobody, a peptide or peptide mimetic, a receptor fragment, a recombinant fusion protein, an aptamer, a small molecule, or a single-stranded variable region fragment (scFv). In some embodiments, the VEGF antagonist antibody may be, for example, Lucentis® (ranibizumab) and / or Avastin® (bevacizumab).

[0103] An increase in mTOR activity in cells may result in the secretion of VEGF and PDGF, which promote angiogenesis by increasing mTOR activity in vascular cells. In some embodiments of the present invention, a VEGF modulator reduces the activity of VEGF-R or mTOR, thereby reducing angiogenesis. In some embodiments, a VEGF antagonist that inhibits and / or blocks upstream agonists of VEGF binding partners and suppresses VEGF may be an RTP801 inhibitor or blocker. Furthermore, an increase in mTOR activity in cells may result in the secretion of VEGF and PDGF, which promote angiogenesis by increasing mTOR activity in vascular cells. Therefore, in some embodiments, the VEGF modulator may be an mTOR inhibitor, such as a macrolide or small molecule.

[0104] The ophthalmic therapeutic agents for use in combination with the gap junction modifiers of the present invention, one or more panexin channel modifiers, one or more hemichannel modifiers, one or more connexin modifiers, or one or more panexin modifiers include, for example, complement modifiers, as well as other therapeutic agents useful in the treatment of, for example, geographic atrophy, dry AMD, non-exudative AMD, and / or drusen development. The complement modifiers may be, for example, compstatin, TP10, eculizumab, ARC1905, JPE-1375, PMX53, lamparizumab, or rhCFHp.

[0105] In some embodiments, the ophthalmic therapeutic agents for use in combination with the gap junction modifiers of the present invention, one or more panexin channel modifiers, one or more hemichannel modifiers, one or more connexin modifiers, or one or more panexin modifiers may include TNF-alpha inhibitors, C-raf kinase inhibitors, NSAIDs, or nAChR inhibitors.

[0106] The anticonnexin modifier used in any of the administration, co-administration, composition, kit, or therapeutic methods of the present invention may be a Cx43 modifier, a Cx45 modifier, a Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, and Cx57 modifier, or a modifier of any connexin present in the ocular (or other) blood vessels.

[0107] Useful ophthalmic agents in the treatment of ocular disorders such as glaucoma and / or retinal perfusion disorder, wet and / or dry AMD, or any other ocular disorders as described herein, may include, for example, alpha-2 agonists such as brimonidine, anyhydrase inhibitors, beta-blockers, F2α-prostaglandin analogs, anti-apoptotic agents, N-methyl-D-aspartate (NMDA) receptor antagonists, Rho kinase inhibitors, or glutamate-releasing inhibitors. The ophthalmic agents may also be combination therapies comprising administering two or more ophthalmic agents, which may include, for example, a beta-blocker and carbonic anhydrase inhibitor such as timolol and travoprost or timolol and dorzolamide, a combination of an alpha-2 agonist and a beta-blocker such as brimonidine and timolol, or a combination of an alpha-2 agonist and an anyhydrase inhibitor such as brinzolamide and brimonidine, or may not include such a combination. In some embodiments, the ophthalmic therapeutic agent may or may not contain a Rho kinase inhibitor. In other embodiments, the ophthalmic therapeutic agent may be an adenosine imitator. Other ophthalmic therapeutic agents may contain neurotrophins such as ciliary neurotrophic factor or nerve growth factor. In some embodiments, the ophthalmic therapeutic agent may or may not contain one or more of alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab (e.g., Lucentis®), bevacizumab (e.g., Avastin®), protein ciliary neurotrophic factor, vascular endothelial growth factor modifiers, and hypoxia-inducible factor 1-alpha modifiers, or any mixture thereof. In one embodiment, a gap junction modulator, panexin channel modulator, hemichannel modulator, connexin modulator, or panexin modulator administered alone or in combination with one or more ophthalmic therapeutic agents may be modified or unmodified. In some embodiments of the present invention, the modified connexin or panexin modulator may include modified and unmodified moieties such as modified and unmodified nucleotides or modified and unmodified amino acids.In some embodiments, the connexin or other modifier may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide, or peptide mimic, as described herein. In some embodiments, the connexin modifier may be administered before, together with, or after one or more ophthalmic therapeutic agents, or in the same or parallel administration schedule, or in the same formulation. In some embodiments, the panexin or other modifier. This may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide or peptide mimic as described herein. In some embodiments, panexin or other modifiers may be administered together with or after the treatment of one or more ophthalmic neuropathy, or in the same or parallel administration schedule. In some embodiments, panexin or other modifiers may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide or peptide mimic as described herein. In some embodiments, panexin or other modifiers may be administered together with or after the treatment of one or more ophthalmic neuropathy, or in the same or parallel administration schedule.

[0108] In some embodiments of the methods of the present invention, two or more gap junction modulators, hemichannel modulators, or two or more connexin modulators as described herein may be administered, which may be the same or different types of modulators, for example, two or more polynucleotides, two or more peptides or peptide mimics, or two or more compounds. For example, in some embodiments of the methods of the present invention, two or more Cx43 modulators as described herein may be administered, which may be the same or different types of modulators, for example, two or more polynucleotides, two or more peptides or peptide mimics, or two or more compounds. In some embodiments, for example, one or more Cx43 polynucleotides may be co-administered with one or more Cx43 peptides or peptide mimetics and / or one or more anticonnexin compounds, or any combination thereof. In some embodiments, the methods of the present invention may include the administration of connexin antisense polynucleotides to transiently modulate gap junction channels by regulating protein expression, and further include the administration of connexin peptides or peptide mimics to directly and more rapidly modulate gap junction channel function. For example, the method of the present invention may include the administration of a Cx43 antisense polynucleotide to transiently modulate gap junction channels by regulating protein expression, and further includes the administration of a Cx43 peptide or peptide mimic to directly modulate gap junction channel function. The modifier may also target the same or different proteins such as Cx43, Cx45, and / or panexin. The connexin modifier and / or blocker, panexin modifier and / or blocker, gap junction modifier, hemichannel modifier and / or blocker may or may not be modified.

[0109] In some embodiments of the method of the present invention, one or more gap junction modifiers and / or connexin modifiers described herein may be administered together with panexin modifiers, which may be the same or different types of modifiers, for example, two or more polynucleotides, two or more peptides or peptide-like compounds, or two or more compounds. In some embodiments, the connexin modifier is a Cx43 modifier.

[0110] In some embodiments of the method of the present invention, two or more panexin modifiers or panexin channel modifiers described herein may be administered, which may be the same or different types of modifiers, for example, two or more polynucleotides, two or more peptides or peptide-like compounds, or two or more compounds.

[0111] As further described herein, the modified oligonucleotide further comprises the following selected components: modified nucleoside bonds, e.g., phosphorothioate bonds, and modified sugar moieties, e.g., conformationally stressed sugars, e.g., one or more of LNA or BNA.

[0112] In some embodiments of the present invention, connexin modifiers (e.g., Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx43, Cx45, Cx50, or The Cx57 modifier) ​​or the panexin modifier of the present invention is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. In some embodiments, suitable carriers and diluents include buffered aqueous solutions, isotonic salines, such as phosphate-buffered saline or isotonic water.

[0113] In another embodiment, P2X7 receptor antagonists are administered alone or in combination with gap junction modulators, panexin channel modulators, hemichannel modulators, connexin modulators, and / or panexin modulators to treat the diseases, disorders, and conditions described herein. P2X7 antagonists include NF279 (a suramin analog), carmidazolium (a calmodulin antagonist), KN-62 (a CaM kinanse II antagonist), zinc, calcium, magnesium, and copper.

[0114] Various preferred embodiments treat the diseases, disorders, and pathological conditions described herein. This includes the use of a small molecule that blocks or improves, or otherwise antagonizes or inhibits, hemichannel opening, either alone or in combination with a small molecule that blocks or improves, or otherwise antagonizes or inhibits, panexin channel opening. In various preferred embodiments, the small molecule that blocks, improves or inhibits hemichannel opening is tonaversat or its analogues, or a prodrug of any of these. In various preferred embodiments, the small molecule that blocks, improves or inhibits panexin channel opening is probenecid or its analogues, or a prodrug of any of these. In various preferred embodiments, the disease, disorder, or condition is ocular neovascular disease, ocular edema, ocular microvascular disorders, and diabetic eye diseases. In certain embodiments, the disease, disorder, or condition is diabetic retinopathy, ischemic retinopathy, choroidal neovascularization, iris neovascularization, corneal neovascularization, retinal neovascularization, intraocular neovascularization, moist senile macular degeneration, dry senile macular degeneration, geographic atrophy of the eye, diabetic macular edema, diabetic retinopathy, diabetic retinal ischemia, proliferative diabetic retinopathy, Coats' disease, central retinal vein occlusion (CRVO), branched central retinal vein occlusion (BRVO), retinopathy of prematurity (ROP), subconjunctival hemorrhage, and hypertensive retinopathy, uveitis, or cataract.

[0115] In another preferred embodiment, the disease, disorder, or condition is glaucoma, including open-angle glaucoma, closed-angle glaucoma, and normal-tension glaucoma, as well as secondary glaucoma, pigmentary glaucoma, pseudoexfoliation glaucoma, traumatic glaucoma, neovascular glaucoma, and iris-corneal endothelial syndrome (ICE), and variations of open-angle and closed-angle glaucoma such as neovascular glaucoma. In yet another preferred embodiment, the disease, disorder, or condition is dry eye disease. In yet another embodiment, the disease, disorder, or condition is persistent intraocular and corneal epithelial defects. In yet another preferred embodiment, the disease, disorder, or condition is ulcers or ulcerative lesions, including chronic skin wounds, diabetic foot ulcers, venous leg ulcers, and pressure ulcers. In yet another preferred embodiment, the disease, disorder, or condition is CNS trauma, including spinal cord injury and optic nerve injury. The present invention also addresses methods for treating patients diagnosed with neovascularization or at risk of developing neovascularization, and in addition to the administration of small molecules that block or improve, or otherwise antagonize or inhibit hemichannel opening, either alone or together with small molecules that block or improve, or otherwise antagonize or inhibit, panexin channel opening, the method also includes administering an anti-VEGF agent and / or anti-PDGF agent to the patient as a therapeutic measure. In one embodiment, the PDGF antagonist and / or VEGF antagonist is administered in an amount sufficient to suppress neovascularization in the patient, concurrently with the administration of the hemichannel antagonist and / or panexin channel antagonist, or within about 1 to 5, 10, or 90 days. In certain embodiments of the method of the present invention, the PDGF antagonist and / or VEGF antagonist is administered concurrently with the hemichannel antagonist or inhibitor and / or panexin channel antagonist or inhibitor. In one embodiment, the PDGF antagonist is a PDGF-B antagonist. In another embodiment, the VEGF antagonist is a VEGF-A antagonist. In certain embodiments, the PDGF antagonist is a nucleic acid molecule, aptamer, antisense RNA molecule, ribozyme, RNAi molecule, protein, peptide, cyclic peptide, antibody, antibody fragment conjugate, sugar, polymer, or small molecule. In other embodiments, the VEGF antagonist is a nucleic acid molecule, aptamer, antisense RNA molecule, ribozyme, RNAi molecule, protein, peptide, cyclic peptide, antibody, antibody fragment conjugate, sugar, polymer, or small molecule. In certain embodiments, the present method of the present invention involves administration of a VEGF antagonist which is an aptamer such as EYE001 aptamer. In other embodiments, the present method of the present invention involves administration of a VEGF antagonist which is an antibody or its conjugate, such as Avastin® (bevacizumab) or Lucentis® (ranibizumab). In certain embodiments, the present method of the present invention involves administration of a PDGF antagonist which is an aptamer, antibody, or their conjugate. In another specific embodiment, the present method of the present invention involves the administration of a PDGF antagonist, which is an antisense oligonucleotide. In yet another embodiment of this aspect of the present invention, the PDGF antagonist and / or VEGF antagonist is a prodrug. In another embodiment, the present method of the present invention provides a means for suppressing or treating ocular neovascularization. In some embodiments, ocular neovascularization suitable for treatment or suppression by the method of the present invention includes ischemic retinopathy, iris neovascularization, intraocular neovascularization, senile macular degeneration, corneal neovascularization, retinal neovascularization, choroidal neovascularization, diabetic retinal ischemia, or proliferative diabetic retinopathy. In yet another embodiment, the present method of the present invention provides a means for suppressing or treating psoriasis or rheumatoid arthritis in patients requiring treatment, or patients diagnosed with such disorders or at risk of developing such disorders. The present invention also provides pharmaceutically acceptable carriers as well as pharmaceutically acceptable carriers, comprising a PDGF antagonist and / or a VEGF antagonist, either alone or in combination with one or more small molecules that block or improve, or otherwise antagonize or inhibit, panexin channel opening, or hemichannel opening.In this embodiment, the PDGF and / or VEGF antagonist is present in an amount(s) sufficient to suppress neovascularization in the patient. This pharmaceutically acceptable composition of the present invention may include a pharmaceutically acceptable carrier comprising microspheres, nanoparticles, or a hydrogel formulation. Another embodiment of this aspect of the present invention provides a pharmaceutical pack comprising a PDGF antagonist and / or VEGF antagonist, either alone or together with a small molecule that blocks or improves, or otherwise antagonizes or inhibits, panexin channel opening, or hemichannel opening. In one embodiment of this aspect, the pharmaceutical pack comprises a PDGF antagonist, which is a PDGF-B antagonist. In another embodiment of this aspect, the pharmaceutical pack comprises a VEGF antagonist, which is a VEGF-A antagonist. In another embodiment, the PDGF antagonist and VEGF antagonist of the pharmaceutical pack are formulated separately and in individual doses. In yet another embodiment, the PDGF antagonist and VEGF antagonist of the pharmaceutical pack are formulated together. It will be understood that combinations of anti-VEGF agents and / or anti-PDGF agents can also provide remarkable synergistic therapeutic effects for the treatment of ocular neovascular disease. [Brief explanation of the drawing]

[0116] [Figure 1A] A scrape loading study using Lucifer Yellow, which diffuses into adjacent hCMVEC cells, was conducted as an indicator of gap junction coupling levels. In the untreated group, the dye diffused rapidly into adjacent cells. Peptide 5 at a lower dose of 100 μM had little effect on coupling, while at a higher dose of 500 μM, diffusion decreased immediately. Over time, both peptide concentrations delayed gap junction uncoupling by 2 hours. The graph shows quantification of a similar experiment comparing the blocking efficacy of peptide 5 (immediate blockade, 500 μM) with carbenoxolone, a nonspecific gap junction channel blocker. [Figure 1B]A scrape loading study using Lucifer Yellow, which diffuses into adjacent hCMVEC cells, was conducted as an indicator of gap junction coupling levels. In the untreated group, the dye diffused rapidly into adjacent cells. Peptide 5 at a lower dose of 100 μM had little effect on coupling, while at a higher dose of 500 μM, diffusion decreased immediately. Over time, both peptide concentrations delayed gap junction uncoupling by 2 hours. The graph shows quantification of a similar experiment comparing the blocking efficacy of peptide 5 (immediate blockade, 500 μM) with carbenoxolone, a nonspecific gap junction channel blocker. [Figure 2] Quantification of the diffusion of scrape-loaded dye in hCMVEC cells treated with 50 μM tonavelsat over various periods. Tonavelsat has a somewhat immediate channel-blocking effect, and its efficacy increases over time. *=p<0.05, **=p<0.001, ***=p<0.001. [Figure 3] Dose-dependent knockdown of Cx43 in APRE-19 cells using tonavelsat. APRE-19 cells 6 hours after pre-incubation with tonavelsat in a control medium and with concentrations of 50 and 100 micromoles. Cells are labeled for connexin 43. In control cells, gap junctions are clearly localized at the intercellular contact surface, or after 6 hours with 50 micromoles of tonavelsat, most of the binding is internalized or lost. After 6 hours with a higher concentration of 100 micromoles of tonavelsat, only slight connexin 43 labeling remains. [Figure 4] DAPI (nuclear staining) and labeling of the gap junction protein connexin 43 in ARPE-19 cells (left panel), as well as labeling of connexin 43 only (right panel). In untreated cells, gap junction labeling is mainly located on the intercellular contact surface (upper panel). In cells treated with peptide 5 (500 μM) for 1 hour, the intercellular contact surface remains clear, but most of the gap junctions have been moved internally (lower panel). [Figure 5]Electrophysiological recordings of HeLa cells with the connexin 43 gene transfected (upper output recording) and HeLa cells lacking connexin (lower output recording). As the voltage step increased, an increase in channel activity was observed in the transfected cells, but not in the connexin-deficient cells. Therefore, the channel activity in the transfected cells is a result of connexin 43 hemichannel opening. [Figure 6] Electrophysiological output recordings from connexin 43 gene-transfected HeLa cells treated with the nonspecific channel blockers carbenoxolone and LaCl3, as well as peptide 5 (100 μM). The nonspecific channel blockers showed virtually complete hemichannel blockade (compared to untreated HeLa cells in Figure 7), with almost no remaining channel activity. Peptide 5 also showed considerable hemichannel blockade. [Figure 7] Electrophysiological output recordings form an experiment equivalent to those shown in Figures 5 and 6. In this case, HCMVEC cells are shown before the addition of tonaversat (50 μM) (top panel), during incubation with tonaversat (middle panel), and 3 minutes after washing (bottom panel). These results show that tonaversat almost completely abolishes hemichannel activity, and signs of activity return after washing, indicating that tonaversat is highly effective and a direct hemichannel blocker. [Figure 8A] Tonavelsat controls hemichannel-mediated ATP release from damaged hCMVEC cells. ATP released from hCMVEC cells after 2 hours of in vitro exposure to damage. Total extracellular ATP release is quantified for each treatment group as a percentage of the damaged control group. Significant reductions in ATP were observed across all treatment groups compared to the damaged control group: 100 μM CBX, 100 μM peptide 5 and 1 mM probenecid, and 100 μM peptide 5 combined with 1 mM probenecid, with the latter combination reducing total ATP release to the same level as CBX. Values ​​represent mean ± standard error. ***P<0.001 compared to the damaged control group. [Figure 8B]Tonavelsat regulates hemichannel-mediated ATP release from damaged hCMVEC cells. Total extracellular ATP release is quantified for each treatment group as a percentage of the damaged control group. Significant ATP reductions were present in all treatment groups: 0.1 μM to 100 μM tonavelsat combined with 100 μM CBX and 1 mM probenecid, compared to the damaged control group. Values ​​represent mean ± standard error. ***P<0.001 compared to the damaged control group. [Figure 8C] Tonavelsat regulates hemichannel-mediated ATP release from damaged hCMVEC cells. In this experiment, tonavelsat did not reduce ATP release from hCMVEC cells in the absence of Tukey's multiple comparison test, with 1 mM probenecid (p>0.09) and one-way ANOVA. Values ​​represent mean ± standard error. ***P<0.001 compared to the damaged control group. [Figure 9] Hypoxia-reperfusion: ATP released from subconfluent hCMVEC cells after 2 hours of exposure to injury followed by 2 hours of exposure to reperfusion in vitro. ATP is quantified as a percentage of the injury-reperfusion (IR) control group. Significant decreases in ATP were observed with 100 μM CBX, 100 μM Peptide 5, and 100 μM Peptide 5 and 1 mM probenecid, but not with 1 mM probenecid alone. Significant decreases in ATP were also observed with 10 μM Tonaversat. Values ​​represent mean ± standard error. One-way ANOVA Tukey's multiple comparison test* P<0.05 compared to the IR control group. [Figure 10A] One hour of treatment with tonavelsat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Immunolabeling of Cx43 for one hour in 100 μM tonavelsat (above) and 100 μM tonavelsat + NH4Cl in serum replacement medium (n=3 wells, 2 independent experiments). [Figure 10B] Quantification of the total area of ​​Cx43 plaques per cell after 1 hour of treatment with Tonabelsat (5-500 μM). [Figure 10C]Quantification of the total area of ​​Cx43 plaques per cell after 6 hours of treatment with Tonabelsat (50-500 μM) along with NH4Cl. B and C are normalized to the untreated control group. Significant differences are expressed as ***p<.0001. Bars represent mean ± SEM and inter-segmental differences. Scale bar = 30 μm. [Figure 11A] Tonavelsat internalizes and downregulates Cx43 GJ plaques within ARPE-19 cells. A. Immunolabeling of Cx43 for 1 hour in serum replacement medium, untreated group (top), and 100 μM tonavelsat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of total Cx43 plaque area per cell after 1 hour treatment with tonavelsat (5-500 μM). Quantification of total Cx43 plaque area per cell after 6 hours treatment with tonavelsat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, and significant differences are represented as ***p<.0001. Statistical test: one-way ANOVA, scale bar = 30 μm. [Figure 11B] Tonavelsat internalizes and downregulates Cx43 GJ plaques within ARPE-19 cells. A. Immunolabeling of Cx43 for 1 hour in serum replacement medium, untreated group (top), and 100 μM tonavelsat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of total Cx43 plaque area per cell after 1 hour treatment with tonavelsat (5-500 μM). Quantification of total Cx43 plaque area per cell after 6 hours treatment with tonavelsat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, and significant differences are represented as ***p<.0001. Statistical test: one-way ANOVA, scale bar = 30 μm. [Figure 11C]Tonavelsat internalizes and downregulates Cx43 GJ plaques within ARPE-19 cells. A. Immunolabeling of Cx43 for 1 hour in serum replacement medium, untreated group (top), and 100 μM tonavelsat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of total Cx43 plaque area per cell after 1 hour treatment with tonavelsat (5-500 μM). Quantification of total Cx43 plaque area per cell after 6 hours treatment with tonavelsat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, and significant differences are represented as ***p<.0001. Statistical test: one-way ANOVA, scale bar = 30 μm. [Figure 12A] Six-hour treatment with tonavelsat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Immunolabeling of Cx43 for six hours in serum replacement medium with 100 μM tonavelsat (above) and in 100 μM tonavelsat + NH4Cl (n=3 wells, 2 independent experiments). [Figure 12B] Six hours of treatment with tonavelsat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Quantification of the total area of ​​Cx43 plaques per cell after one hour of treatment with tonavelsat (5–500 μM). [Figure 12C] Six-hour treatment with tonavelsat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Quantification of total Cx43 plaque area per cell after six hours of treatment with tonavelsat (50–500 μM) together with NH4Cl. B and C are normalized to the untreated control group. Significant difference ***p<.0001. Bars represent mean ± SEM and between differences. Scale bar = 30 μm. [Figure 13]Cx43 mRNA levels in confluent monolayers of ARPE-19 cells incubated for 1 hour in DMSO (solvent control group) or 50 μM tonavelsat. Bars represent mean ± SEM (n=3). No significant differences in Cx43 mRNA levels in ARPE-19 cells after treatment with 50 μM tonavelsat were observed compared to both the untreated group (p=0.7572) and the solvent control group (p=0.10245). One-way ANOVA, Tukey's multiple comparison test. [Figure 14A] ATP concentrations compared to the control group for various treatment groups. [Figure 14B] Comparison of % cell survival rates for various treatment groups compared to a control group. [Figure 15] Retinal ganglion cell density 7 days after retinal ischemia at 120 mm Hg for 60 minutes. Results for both ischemic and contralateral eyes are shown. Mean ± standard error. N=2, 6, 6, 6, 5, 4, 4. NT, untreated; T, tonavelsat. A statistically significant (p<0.01) 31% loss of RGCs was found in untreated ischemic eyes (167111±14188 cells / cm2, mean ± standard error) compared to the normal control group (242558±15840 cells / cm2). A statistically significant (p=0.03) 35% loss of RGCs was found in ischemic eyes treated with 10 mg / kg tonavelsat (158739±26370 cells / cm2). However, ischemic eyes treated with 1 mg / kg tonavelsat maintained less cell loss than the other groups (18%, 199927 ± 26058 cells / cm2). The difference between this group and the normal control group was a trend (p=0.17). RGC loss was not observed in any contralateral eye. [Figure 16A] Functional effects of tonavelsat on intercellular communication within hCMVEC cells in vitro. In the solvent control group, the LY dye rapidly diffuses to adjacent cells via coupled GJs. Immediate or 2-hour tonavelsat treatment (50 μM) causes a decrease in LY dye movement as the GJs are uncoupled. [Figure 16B]Functional effects of tonavelsat on intercellular communication within hCMVEC cells in vitro. Quantification of LY-positive hCMVEC cells treated with 50 μM tonavelsat at time intervals from immediate to 24 hours. Tonavelsat-mediated uncoupling of GJ cells increased over time. [Figure 16C] Functional effects of tonavelsat on intercellular communication within hCMVEC cells in vitro. Lower concentrations of tonavelsat (10 μM, 1 μM, 0.1 μM) did not induce GJ uncoupling after 2 hours in this experiment. Bars represent mean ± SEM (one-way ANOVA, followed by Tukey's post-hoc test) n=3 wells, 3 independent experiments. *=p<0.05, **=p<0.001, ***=p<0.001. [Figure 16D] Functional effects of tonavelsat on intercellular communication within hCMVEC cells in vitro. Lower concentrations of tonavelsat (10 μM, 1 μM, 0.1 μM) did not induce GJ uncoupling after 24 hours in this experiment. Bars represent mean ± SEM (one-way ANOVA, followed by Tukey's post-hoc test) n=3 wells, 3 independent experiments. *=p<0.05, **=p<0.001, ***=p<0.001. [Figure 17] FACS data of gene transfer incorporation of multiple selected antisense oligonucleotides. [Figure 18] Confocal microscopy images of living HUVEC cells (4 hours after gene transfer) showing the uptake (modification) of FAM-labeled SEQ4-PTO. Green represents the oligo sequence 1-O (FAM-labeled), and blue represents the cell nucleus stained with DAPI. [Figure 19] Green represents oligo-SEQ1-O (FAM labeled), and blue represents cell nuclei stained with DAPI. [Figure 20] This shows the knockdown efficiency of connexin 43 as measured by qPCR. The data shows the standard deviation of three replicates. [Figure 21] Knockdown efficiency of connexin 43 measured by Western blotting (n=3). The data shows the standard deviation of three replicas. [Figure 22A] Knockdown efficiency of modified (PTO) and unmodified sequences measured by qPCR 4 hours after gene transfer. Oligonucleotide concentrations: (1)=200nM, (3 / 4)=150nM, (1 / 2)=100nM, C:SEQ1, SEQ4:37501, Cscr:SEQ1 recombinant, LP2scr:SEQ4 recombinant, orange bar: negative control group. (n=3 for each result). [Figure 22B] Knockdown efficiency of modified (PTO) and unmodified sequences measured by qPCR 8 hours after gene transfer. Oligonucleotide concentrations: (1)=200nM, (3 / 4)=150nM, (1 / 2)=100nM, C:SEQ1, SEQ4:37501, Cscr:SEQ1 recombinant, LP2scr:SEQ4 recombinant, orange bar: negative control group. (n=3 for each result). [Figure 23] Knockdown efficiency measured by Western blotting. The data shows the standard deviation of three replicates. Knockdown efficiency measured by Western blotting (n=3). Oligo concentration: (1)=200nM; (3 / 4)=150nM; (1 / 2)=100nM; C:SEQ1; SEQ4:37501; Cscr:SEQ1 recombinant; LP2scr:SEQ4 recombinant; Orange bar: Negative control group [Figure 24] Different sequences were analyzed by qPCR for the knockdown efficiency of connexin 43. Cscr: SEQ1 recombinant, Csen: SEQ1 sense strand, LP2scr2: SEQ4 recombinant, LP2sen: SEQ4 sense strand, 47001scr2: SEQ5 recombinant, 47001sen: SEQ5 sense strand, NC1: universally negated 1, NC2: universally negated 2 [Figure 25] Different sequences were analyzed by Western blotting for the knockdown efficiency of connexin 43. Cscr: SEQ1 recombinant, Csen: SEQ1 sense strand, LP2scr2: SEQ4 recombinant, LP2sen: SEQ4 sense strand, 47001scr2: SEQ5 recombinant, 47001sen: SEQ5 sense strand, NC1: universal negation 1, NC2: universal negation 2. [Figure 26]Results of Cxn43 knockdown of oligonucleotide sequences in different cell types. H: human, P: pig, LP2: SEQ4, C: SEQ1, Cscr: SEQ1 recombinant, Csen: SEQ1 sense strand, 47001scr2: SEQ5 recombinant, 47001sen: SEQ5 sense strand. Other numbers represent other antisense sequences against connexin 43 as described herein. [Figure 27] Dose-response performance in HUVEC cells by qPCR for various oligonucleotide sequences. LP2:SEQ4, Coda:SEQ1, 47001scr2:SEQ5 recombinants; other numbers represent other antisense sequences for connexin 43 as described herein. [Figure 28A] Knockdown efficiency of Cxn43 by unmodified sequences (without phosphorothioate bonds in the backbone) as measured by qPCR. Oligosaccharide concentrations: (1)=200nM; (2)=400nM; (3)=600nM; SEQ1; SEQ4:37501; Cscr:SEQ1 recombinant; LP2scr:SEQ4 recombinant. [Figure 28B] Knockdown efficiency of Cxn43 by unmodified sequences (without phosphorothioate bonds in the backbone) as measured by qPCR. Oligosaccharide concentrations: (1)=200nM; (2)=400nM; (3)=600nM; SEQ1; SEQ4:37501; Cscr:SEQ1 recombinant; LP2scr:SEQ4 recombinant. [Figure 29A] Comparison of knockdown efficiency of modified sequences (total thiophosphoriate skeleton). Oligosaccharide concentrations: (1)=200nM; (2)=400nM; (3)=600nM. SEQ1: SEQ1; SEQ4: 37501; Cscr: SEQ1 recombinant; LP2scr: SEQ4 recombinant. [Figure 30A] In vitro knockdown of an unmodified oligo sequence. Cscr:SEQ1 recombinant; 133704: Another antisense oligo for connexin 43. [Figure 30B]Knockdown of unmodified oligonucleotide sequences in vitro. Cscr: SEQ1 recombinant; 133704: another antisense oligo against connexin 43. [Figure 31] Comparative knockdown activity of ASNs from Table 4. [Figure 32] Comparative knockdown activity of ASNs from Table 4. [Figure 33] Dose-response curve of candidate connexin 43 antisense oligonucleotides. [Figure 34] Dye perfusion of Evans blue dye after ischemia for mapping connexin 43 after ischemia-reperfusion. [Figure 35A] Calculated area of dye leakage (via ImageJ as described herein) as a function of time after ischemia-reperfusion. These results show baseline performance of dye leakage. [Figure 35B] Calculated area of connexin 43 spot counts (via ImageJ as described herein) as a function of time after ischemia-reperfusion. These results show baseline performance of dye leakage. [Figure 36] Effect on total dye leakage after treatment with a Cxn43 modulator and treatment without a Cxn43 modulator. [Figure 37A] Ability to delay Cxn43 expression (Y-axis) compared to variants of a specific core sequence. Peptide 5 = SEQ ID NO: 168, Mod1 = SEQ ID NO: 171, Mod2 = SEQ ID NO: 172, Mod3 = SEQ ID NO: 173, Mod4 = SEQ ID NO: 174, Mod5 = SEQ ID NO: 175, Mod6 = SEQ ID NO: 176. [Figure 37B] Ability to delay Cxn43 expression (Y-axis) compared to variants of a specific core sequence. Peptide 5 = SEQ ID NO: 168, Mod1 = SEQ ID NO: 171, Mod2 = SEQ ID NO: 172, Mod3 = SEQ ID NO: 173, Mod4 = SEQ ID NO: 174, Mod5 = SEQ ID NO: 175, Mod6 = SEQ ID NO: 176. [Figure 38] SEM images of nanoparticles (Nps, panels A and C) and microparticles (Mps, panels B and D) in release medium, 3 days before (panels A and B) and 3 days after (panels C and D). [Figure 39] In vitro release study of connexin 43 regulator from particulate formulations (data points represent mean ± SD, n=3). [Figure 40] Measurement of vascular leakage after ischemia using unmodified (Cxn43 MP) and chemically modified (C12-C12 Cxn43 MP) connexin 43 modifier peptides. [Figure 41] Representative images of stained tissue, and quantification of spot counts reduced by further chemical modification (C12-C12 Cxn43 MP) connexin 43 modifier peptides compared to unmodified peptides. [Figure 42] Representative images and quantifications of stained tissues showing that formulations with nanoparticles for delivery induced lower Cxn43 expression than formulations without nanoparticles. [Figure 43] Representative images and quantifications of stained tissue (ischemia only) show that chemically modified peptide therapy resulted in over 93% RGC survival at 28 days compared to less than 70% in untreated eyes. [Figure 44] Representative images of stained tissue showing Cxn43 distribution located within the choroid from a young (29-year-old) donor without AMD (A) and an older donor diagnosed with AMD (B). In the young donor, Cxn43 labeling (red, under the label "RPE") is particularly dense adjacent to Bruch's membrane, and the labeling mainly defines the boundaries of gap junctions between endothelial cells (white arrows). Carefully stained nuclei with the nuclear marker DAPI are endothelial cell nuclei. Scale bar represents 20 μm. [Figure 45] Representative images of stained tissue showing the Cxn43 expression profile in retinal images taken near hemorrhages in retinal samples from deceased individuals. Integrated image of DAPI-stained nuclei (blue) and Cxn43 gap junction plaques (red). [Figure 46] Representative images of stained tissue showing the Cxn43 expression profile in retinal images taken near hemorrhages in retinal samples from deceased humans. The figure shows an integrated image of DAPI-stained nuclei (blue) and Cxn43 gap-junction plaques (red). [Figure 47]Representative confocal microscopy images of the retina showing the Cxn43 expression profile within ARPE-19 cells. After 8 hours of exposure to the native peptide (B), Cxn43 levels in ARPE-19 cells were slightly reduced, while after 24 hours (C), Cxn43 levels returned to normal (A). After 8 hours of incubation with Nps (D) and Mps (F), there was no significant difference in Cxn43 labeling. However, after 24 hours of exposure, both the Nps (E) and Mps (G) groups showed a considerable reduction in Cxn43 levels, indicating sustained peptide release. Therefore, the potential for longer-term treatment with these particles may reduce the formation of new gap junction channels. The figure shows an integrated image of nuclei stained with DAPI (blue) and Cxn43 gap junction plaques (red) (scale bar represents 50 μm). [Figure 48A] Representative confocal microscopy images of the retina labeled with GFAP (red), Cxn43 (green), and DAPI (blue). 28 days after ischemia-reperfusion, Cx43 and GFAP were significantly upregulated in the untreated group (B). Intravitreal injection of natural Cxn43 MP in solution showed limited Cxn43 upregulation at 28 days (C). While the Nps-Cxn43 MP treatment group ended up with a significant decrease in Cxn43 upregulation at 28 days post-injury (D), Mps-Cxn43 MP exhibited similar Cxn43 and GFAP levels at 28 days (E) and 90 days (F) post-ischemia-reperfusion (scale bar represents 50 μm). [Figure 48B] (G) Mean Cxn43 spot counts in undamaged control retinas, and after ischemia-reperfusion with and without treatment. Stars indicate statistical significance between groups (n=3, mean ± SD, *p<0.05, **p<0.01). [Figure 49-1]Representative confocal microscopy images of a flattened retina (red) with Brn3a-labeled RGCs after ischemia-reperfusion. RGC distribution is significantly reduced, with almost complete loss of vascularity in the untreated retina (B). Eyes treated with Cxn43 MP in solution and Nps-Cxn43 MP showed patches of less RGC loss (C and D). Eyes treated with Mps still showed some RGC loss at 28 (E) and 90 (E). Scale bar = 300lm. [Figure 49-2] (G) Average density of RGCs. (H) Stars indicate the statistical significance between each group (n=6, mean ± SD, **p<0.01, *p<0.05).

[0117] Detailed disclosure The present invention relates to connexin transcription, translation, function, and / or activity modulators, including gap junction channel modulators, hemichannel modulators, panexin channel modulators, panexin transcription, translation, function, and / or activity modulators, and small molecule modulators. The modulators may be used alone or in combination to treat diseases, disorders, or conditions described herein, including diseases, disorders, or conditions of the eye in the anterior segment, posterior segment, and intravascularly, including within the retina, choroid, and choroidal capillary lamina.

[0118] Tonavelsat, benzoylaminobenzopyrane, has been reported to be central nervous system specific and to act at a level of downregulation of connexin 26 and / or p38 expression. Surprisingly, the inventors have confirmed that gap junction channel modulators such as tonavelsat can modulate the activity of gap junction channels and hemichannels in several different cell types, not limited to the central nervous system, and in a manner that is not specific to a particular connexin (such as connexin 26). Specifically, the inventors show that tonavelsat can modulate the activity of hemichannels including connexin 43. While not wishing to be bound by any particular theory, the inventors have surprisingly found that tonavelsat acts directly on gap junction channels and / or hemichannels rather than indirectly through cell receptors or by affecting the expression of connexins (e.g., connexin 26) and / or p38.

[0119] Gap junction channel modulators such as peptide-5 have been shown to suppress Cx43 hemichannel activity and / or ATP release during and after injury, for example, during ischemia and hypoxic reperfusion, as described in detail herein. Panexin modulators such as probenecid have also been shown to suppress injury-induced ATP release, for example, ATP release during ischemia.

[0120] The present invention particularly relates to (1) a method for modulating gap junction channels and / or hemichannels, and (2) the manufacture of agents for modulating gap junctions and / or hemichannels, including gap junction channel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10The use of Panx1 or any analogue thereof, and (3) gap junction channel modulators such as peptide 5 and / or analogues thereof, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 Panx1, or any analogue thereof, and (4) the modulation of gap junction channels, hemichannels, and / or panexin channels, such as gap junction channel modulators such as peptide 5 and / or analogues thereof, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 (5) In the manufacture of a drug for the treatment of a disorder in which administration of Panx1 or any analog thereof may be beneficial, a gap junction channel modulator such as peptide 5, peptide 5, and / or analogs thereof, a compound of formula I, e.g., tonaversat, and / or an analog or prodrug of any of the aforementioned compounds, and / or a panexin modulator, e.g., probenecid and / or a synthetic mimic peptide blocker of panexin 1, e.g., , 10 For use in the treatment of disorders in which the use of Panx1 or any analogue thereof and (6) modulation of gap junction channels and / or hemichannels may be beneficial, gap junction channel modulators such as peptide 5 and / or analogues thereof, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10This provides Panx1, or any analogue thereof.

[0121] In some embodiments, the present invention relates to panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., for one of these purposes, either alone or in combination with gap junction channel modulators disclosed herein, 10 Regarding the use of Panx1 or any analogue thereof.

[0122] In certain embodiments, the inventors have provided the following methods: administering to a subject, either alone or in combination with a gap junction channel modulator, a gap junction channel modulator such as peptide 5, and / or its analogues, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 A method comprising administering Panx1 or any analog thereof, a method for preventing or reducing abnormal or excessive scar formation in a subject undergoing surgical treatment, excising a scar, and then administering to the subject, either alone or in combination with a gap junction channel modulator, a gap junction channel modulator such as peptide 5 and / or its analogue, a compound of formula I, e.g., tonaversat, and / or an analogue or prodrug of any of the aforementioned compounds, and / or a panexin modulator, e.g., probenecid and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10Methods for treating subjects with abnormal scarring by administering Panx1 or any analogue thereof, including: methods for preventing or reducing contracture in the tissue of the subject and thereby alleviating fibrosis; methods for tissue engineering related to ophthalmic procedures; methods for promoting the accumulation of epithelial cells in the eye or eye-related tissue; methods for suppressing cellular hyperplasia in the eye or eye-related tissue; methods for preventing, reducing, or decreasing lesion progression; methods for treating vascular leakage or any disorder involving vascular leakage; methods for treating one or more of the following: ischemia (including perinatal ischemia, cutaneous ischemia and myocardial ischemia), stroke, asphyxia, traumatic brain injury, spinal cord injury, heart attack, inflammatory cardiac disorder (including pericarditis), reperfusion injury (including cardiac reperfusion after surgery or transplantation, hepatic reperfusion after surgery or transplantation), injury related to surgical or medical procedures (including chemotherapy, radiotherapy, orthopedic surgery, and such treatments related to stomatitis or rashes, for example); tissue injury, or Methods for treating inflammation, methods for treating trauma or lesions (e.g., persistent corneal epithelial defects, ulcers, burns, psoriasis), methods for treating hearing impairment, methods for treating eye disorders (e.g., retinal vein or artery occlusion, glaucoma, retinal seizures, trauma causing increased intraocular pressure, diabetic retinopathy, cystoid macular edema, senile macular degeneration, infections, burns (e.g., chemical burns and thermal burns)), methods for treating epilepsy, Parkinson's disease, and (e.g., vascular hemorrhage, edema, lesions, disease) In any of the methods for treating trauma (including trauma associated with expansion and / or inflammation), the use of a gap junction channel modulator such as peptide 5 and / or its analogues, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, either alone or in combination with a gap junction channel modulator, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 The inventors intend to provide an invention that offers one or more doses of Panx1 or any analogue thereof. Furthermore, the inventors intend to provide a peptide in the manufacture of a pharmacopoeia for the treatment of the disorders described herein. Gap junction channel modulators such as 5, and / or analogs thereof, compounds of formula I, e.g., tonaversat, and / or analogs or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 Panx1, or any analogue thereof, and / or gap junction channel modulators such as peptide 5, and / or analogues thereof, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 The invention aims to provide a bandage for preventing and / or treating fibrosis or other disorders, comprising the administration of Panx1 or any analogue thereof.

[0123] In some embodiments, the present invention covers the use of a compound of formula I, for example, tonabersat, and / or an analog or prodrug of any of the foregoing compounds, for directly and immediately blocking Cx43 hemichannels and causing a concentration- and time-dependent reduction in GJ coupling. In some aspects, a low concentration of a compound of formula I, for example, tonabersat, and / or an analog or prodrug of any of the foregoing compounds, may be used in any of the therapeutic methods or uses of the present invention. In some embodiments, a low dose of a compound of formula I, for example, tonabersat, and / or an analog or prodrug of any of the foregoing compounds, may be combined with a pannexin channel modulator in any of the therapeutic methods or uses of the present invention. In some embodiments, a low dose of a compound of formula I, for example, tonabersat, and / or an analog or prodrug of any of the foregoing compounds, may be combined with a pannexin channel modulator that can be used as an effective treatment during ischemic injury, for example, to protect RGCs from damage after retinal ischemia, or to treat retinal ischemia or ocular fibrosis, or in any of the therapeutic methods or uses of the present invention.

[0124] Channel modulator By way of example, tonabersat may be known by the IUPAC names N-[(3S,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-3-chloro-4-fluorobenzamide or (3S-cis)-N-(6-acetyl-3,4-dihydro-3-hydroxy-2,2-(dimethyl-d6)-2H-1-benzopyran-4-yl)-3-chloro-4-fluorobenzamide.

[0125] In one embodiment, tonabersat and / or an analog or prodrug thereof is of formula I:

Chemical Structure

[0126] R5 is C 1-6 Alkylcarbonyloxy, benzoyloxy, ONO2, benzyloxy, phenyloxy or C 1-6 It is an alkoxy, and R6 and R9 are hydrogen, or R5 is hydroxyl, and R6 is hydrogen or C 1-2 It is an alkyl group, and R9 is hydrogen.

[0127] R7 is either a heteroaryl or phenyl compound, and optionally both of these, or optionally C 1-4 Alkyl, cyano, azide, C 1-4 Substituted once or twice with alkoxy, trifluoromethoxy, and trifluoromethyl, and then one or more times with a group or atom selected from chloro, fluoro, bromo, iodo, nitro, or amino,

[0128] R8 is hydrogen, C 1-6 Alkyl, OR 11 , or NHCOR 10 And R 11 is hydrogen, C 1-6 Alkyl, formyl, C 1-6 Alkanoyl, aroyl, or aryl-C 1-6 It is alkyl, R 10 is hydrogen, C 1-6 Alkyl, C 1-6 Alkoxy, mono, or diC 1-6 Alkylamino, amino, amino-C, sub.1-6 alkyl, hydroxy-C 1-6 Alkyl, Halo-C 1-6 Alkyl, C 1-6 Acyloxy-C 1-6 Alkyl, C 1-6 Alkoxycarbonyl-C 1-6 - Alkyl, aryl, or heteroaryl, and the R8-N-CO-R7 group is in the cis form relative to the R5 group, X is oxygen or NR 12 And R 12 is hydrogen or C 1-6 It is alkyl.

[0129] With respect to any of the above Markush groups, that group may or may not contain any of the species listed for that group.

[0130] Tonabelsat is sometimes known by the IUPAC name N-[(3S,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-3-chloro-4-fluorobenzamide or (3S-cis)-N-(6-acetyl-3,4-dihydro-3-hydroxy-2,2-(dimethyl-d6)-2H-1-benzopyran-4-yl)-3-chloro-4-fluorobenzamide.

[0131] In embodiments, analogs of Formula 1 are the compound caravelsat (N-[(3R,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-4-fluorobenzamide) or trans-(+)-6-acetyl-4-(S)-(4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-1-benzo[b]pyran-3R-ol, hemihydrate.

[0132] In certain embodiments, tonaversat and / or analogs thereof in the form of a free base or a pharmaceutically acceptable salt. For example, pharmaceutically acceptable salts include, but are not limited to, 1-hydroxy-2-naphthoic acid, 2,2-dichloroacetic acid, 2-hydroxyethanesulfonic acid, 2-oxoglutaric acid, 4-acetamidobenzoic acid, 4-aminosalicylic acid, acetic acid, adipic acid, ascorbic acid (L), aspartic acid (L), benzenesulfonic acid (besylic acid), benzoic acid, camphoric acid (+), camphor-10-sulfonic acid (+), capric acid (decanoic acid), caproic acid (hexanoic acid), caprylic acid (octanoic acid), carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecyl sulfate, ethane-1,2-disulfonic acid, ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid (D), The compounds include hydrochlorides and salts derived from acids, including gluconic acid (D), glucuronic acid (D), glutamine, glutaric acid, glyceroline, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, isobutyric acid, lactic acid (DL), lactobionic acid, lauric acid, maleic acid, malic acid (-L), malonic acid, mandelic acid (DL), methanesulfonic acid (mesylate), naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, nicotinic acid, nitric acid, oleic acid, oxalic acid, palmitic acid, pamoic acid, phosphoric acid, propionic acid, pyroglutamic acid (-L), salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, tartaric acid (+L), thiocyanic acid, toluenesulfonic acid (p), and undecylenic acid. In one embodiment, the salt is a hydrochloride salt.

[0133] In other embodiments, one or more polymorphs, isomers, and / or solvated compounds of tonaversat and / or its analogs may be used.

[0134] Peptide 5 Various small organic molecules have been reported to be active in inhibiting gap junction or hemichannel currents. These include triarylmethane (TRAM), kinins, mefloquines, fenamic acid, 2-aminophenoxyborates and derivatives, glycyrrhetinic acid and derivatives, volatile anesthetics such as halothane and ethane, lipophilic compounds such as long-chain alcohols (e.g., heptanol and octanol), fatty acid amides including oleamide, cyclodextrins, cisplatin, polyamines, and tetraalylammonium ions. Increasingly, studies have also used peptides corresponding to specific sequences in the extracellular loops E1 and E2 and the cytoplasmic loop (Gap19 peptide), with the conserved QPG and SHVR motifs of E1 (Gap26 peptide), as well as the SRPTEK motif in E2 (Gap27 peptide), to inhibit gap junction channels and hemichannel currents. It has been reported to inhibit hemichannels. The most effective such peptide mimic is peptide 5 (VDCFLSRPTEKT) (SEQ ID NO: 168).

[0135] In some embodiments, the gap junction channel modulator is a connexin peptide or peptide mimetic, sometimes referred to as an anticonnexin peptide or peptide mimetic, e.g., an anticonnexin hemichannel blocking peptide or peptide mimetic (e.g., a modified or unmodified peptide or peptide mimetic comprising the connexin extracellular domain, transmembrane region, and connexin carboxy-terminal peptide). The anticonnexin hemichannel blocking peptide or peptide mimetic may or may not be modified. The anticonnexin hemichannel blocking peptide or peptide mimetic is prepared chemically, synthetically, or otherwise manufactured. In some embodiments, the gap junction channel modulator is a connexin 43 peptide or peptide mimetic. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic comprises a portion of the extracellular domain or transmembrane domain of connexin, such as connexin 43 or connexin 45. In some embodiments, the peptide or peptide mimicry drug comprises a portion of the extracellular or transmembrane domain of connexin Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessels.

[0136] In some embodiments, the modifier of the present invention includes any of the peptides described herein, including an anticonnexin 43 peptide or peptide mimetic, for example, a peptide containing a portion of the extracellular domain of connexin, which is therapeutically effective, for example, in treating any of the neuropathic eye disorders described herein and useful in the methods of the present invention, and a peptide containing a portion of the carboxyl terminus of connexin. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic contains a portion of the extracellular domain of connexin, such as connexin 43 or connexin 45, preferably connexin 43.

[0137] Peptide 5 is an established gap junction channel blocker that can act in a dose-dependent manner; lower doses block gap junction hemichannel opening, while higher doses uncouple intercellular gap junctions. See, for example, O'Carroll et al, 2008. With sustained low-dose application of peptide 5, there is a gradual loss of gap junction coupling, which is thought to be peptide interference to hemichannel docking (in parallel with the gradual uncoupling of existing gap junctions during normal turnover). Peptide 5 has been proven effective in several in vitro, in vitro, and in vivo (animal) studies, particularly when used in doses that block hemichannels without uncoupling gap junctions (see, for example, Davidson et al, 2012; Danesh-Meyer et al, 2012; O'Carroll et al, 2013). The results in O'Carroll et al, 2008 show that low or high concentrations of peptide 5 block hemichannels, but high concentrations directly uncouple gap junctions. Peptide-5 data are shown here for comparison with Tonavelsat.

[0138] The compound for panexin regulation is the compound of formula VI: [ka] <t0 / > But often, during the ceremony,

[0139] Z1 and Z2 are independently selected from (C1-C4)alkyl, halo(C1-C4)alkyl, (C1-C4)alkoxy, halo(C1-C4), (C1-C4)cycloalkyl, (C1-C4)alkyl-S-, (C1-C4)alkylamino, (C1-C4)cycloalkylamino, di(C1-C4)alkylamino, and amino(C1-C4)alkyl.

[0140] Y is hydrogen, halo, cyano, hydroxy, (C1-C4)alkyl, halo(C1-C4)alkyl, (C1-C4)alkoxy, halo(C1-C4)alkoxy, cyano(C1-C4)alkyl, amino, (C1-C4)alkylamino, di(C1-C4)alkylamino, amino(C1-C4)alkyl, (C1-C4)alkylamino(C1-C4)alkyl, di[(C1-C4)alkyl]amino(C1-C4)alkyl, trifluoromethylthio, hydroxy Selected from C1-C4 alkyl, C1-C4 alkoxy(C1-C4) alkyl, -C(O)R1, -C(O)OR1, -OC(O)R1, -C(O)-N(R1)2, -CH2-C(O)R1, -CH2-C(O)OR1, -CH2-OC(O)R1, -CH2-C(O)-N(R1)2, S(O)2R1, S(O)2N(R1)2, (C3-C8) cycloalkyl, (C3-C8) cycloalkyl(C1-C4) alkyl, SO3H, and SO4H.

[0141] R1 is selected from hydrogen, NH2, NR2R3, OH, -CH2OH, and -CH2CH2OH.

[0142] R2 and R3 are independently selected from hydrogen, (C1-C4)alkyl, (C1-C4)alkoxy, and (C1-C4)cycloalkyl.

[0143] Halos are chlorine, bromine, iodine, or fluorine.

[0144] For example, the compound of formula VI may be probeneside, as shown below.

[0145] [ka]

[0146] Probeneside is known by its IUPAC name p-[dipropylsulfamoyl]benzoic acid. In some cases, it has the structure described above.

[0147] In certain embodiments, probenecid and / or its analogues are nonionic and exist in the form of a free base, a free acid, or a pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts include, but are not limited to, hydrochloride(s) derived from acids including hydrobromic acid, phosphoric acid, acetic acid, fumaric acid, maleic acid, salicylic acid, citric acid, oxalic acid, lactic acid, malic acid, methanesulfonic acid, and p-toluenesulfonic acid, as well as salts of the hydrochloride(s) or the hydrochloride(s) themselves. In one embodiment, the salt is a hydrochloride salt. In other embodiments, one or more polymorphs, one or more isomers, and / or one or more solvated compounds of probenecid and / or its analogues may be used.

[0148] Panx1 In some embodiments, the panexin regulator may or may not contain a panexin peptide sequence. The panexin peptide sequence may include 8 to 40 consecutive amino acids, an extracellular domain, an intracellular domain, a carboxyl terminus, or an amino terminus of polypeptide Panx1, Panx2, or Panx3. In some embodiments, the panexin regulator may contain a portion of the extracellular loop of Panx1, 2, or 3. In some embodiments, for example, the panexin regulator may be, for example, a Panx1 mimic blocker peptide. 10It may also include Panx1(WRQAAFVDSY). In some embodiments, panexin modifiers, which are oligonucleotides or polynucleotides, may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to 8 to 80 nucleotide portions of SEQ ID NO: 283 (Panx1 polynucleotide), (RefSeq number NM_015368.3), SEQ ID NO: 284 (Panx2 polynucleotide), (RefSeq number NM_052839.3 for variant 1), SEQ ID NO: 285 (RefSeq number NM_001160300.1 for Panx2 polynucleotide variant 2), SEQ ID NO: 286 (RefSeq number NR_027691.1 for Panx2 polynucleotide variant 3), or SEQ ID NO: 287 (Panx3 polynucleotide), (RefSeq number NM_052959.2 for Panx3 polynucleotide). In some embodiments, the panexin regulator may or may not contain a panexin peptide sequence. The panexin peptide sequence may include 8 to 40 consecutive amino acids, an extracellular domain, an intracellular domain, a carboxyl terminus, or an amino terminus of polypeptide SEQ ID NO: 288 (Panx1 peptide), SEQ ID NO: 289 (Panx2 peptide), or SEQ ID NO: 290 (Panx3 peptide), or their variants. The sequences of Panx1, 2, and 3 polypeptides are shown below.

[0149] Sequence ID 288 (Panx1) Sequence Listing 1 [ka]

[0150] Sequence ID 289 (Panx2) Sequence Listing 2 [ka]

[0151] Sequence ID 290 (Panx3) Sequence Listing 3 [ka]

[0152] The mRNA sequence encoding panexin is shown below.

[0153] Sequence ID 283 (Panx1 mRNA) Sequence Listing 4-1 [ka] Sequence Listing 4-2 [ka] Sequence Listing 4-3 [ka]

[0154] Sequence ID No. 284 (Panx2 mRNA, transcription variant 1) Sequence Listing 5-1 [ka] Sequence Listing 5-2 [ka] Sequence Listing 5-3 [ka]

[0155] Sequence ID No. 285 (Panx2 mRNA, transcription variant 2) Sequence Listing 6-1 [ka] Sequence Listing 6-2 [ka] Sequence Listing 6-3 [ka]

[0156] Sequence ID No. 286 (Panx2 mRNA, transcription variant 3) Sequence Listing 7-1 [ka] Sequence Listing 7-2 [ka]

[0157] Sequence ID 287 (Panx3 mRNA) Sequence Listing 8 [ka]

[0158] Connexin and panexin are hemichannel-forming proteins in vertebrates. In one embodiment, the present invention relates to pharmaceutical compositions, products, and methods for treating ocular and other disorders, such as glaucoma, DME, AMD, DR, ocular fibrosis, ocular hypoxia, retinal perfusion disorder, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one connexin modulator to the eye of the subject. In some embodiments, neuropathic ocular disorders may be, for example, loss of retinal ganglion cells and / or glaucomatous optic neuropathy. In some embodiments, administration of a therapeutically effective amount of at least one connexin modulator that is effective in stopping, preventing, or treating retinal ganglion cell loss is further useful in increasing neurotrophic factors in glaucomatous optic nerves and decreasing vitreous glutamate concentration.

[0159] The primary risk factor for most cases of glaucoma is elevated intraocular pressure, or ocular hypertension. Intraocular pressure is the function of producing aqueous humor by the ciliary process of the eye and draining it through the trabecular network. The aqueous humor flows from the ciliary process into the posterior chamber, which is connected posteriorly by the lens and ciliary bodies of the common ring of tendinus, and anteriorly by the iris. The aqueous humor then flows through the pupil of the iris into the anterior chamber, which is connected posteriorly by the iris and anteriorly by the cornea. From here, the trabecular network drains the aqueous humor into the scleral plexus and anterior blood flow via Schlemm's canal. However, normal-tension glaucoma can exist in other glaucoma patients.

[0160] In open-angle glaucoma / broad-angle glaucoma, flow is reduced through the trabecular network due to degeneration and blockage of the trabecular network, whose original function is to absorb aqueous humor. The loss of aqueous humor absorption leads to increased resistance, and therefore a chronic, painless increase in intraocular pressure. In closed-angle glaucoma / narrow-angle glaucoma, the iris-corneal angle undergoes final roll and the cornea... The complete closure due to the forward movement of the iris root prevents aqueous humor from flowing from the posterior to the anterior chamber and then through the trabecular network. This accumulation of aqueous humor causes acute pressure elevation and pain.

[0161] The inconsistent relationship between high intraocular pressure and glaucoma has driven research into anatomical structures, ocular development, nerve compression trauma, optic nerve blood flow, excitatory neurotransmitters, nutrients, retinal ganglion cell / axon degeneration, glial supporting cells, the immune system, aging mechanisms of neuronal loss, and scleral nerve fiber transection. In some embodiments, as discussed herein, the gap junctions, connexins, and / or panexin modulo agents discussed herein are useful for the treatment or prevention of ocular disorders disclosed herein, including, for example, hypertensive and normal-tension glaucoma, as well as for other uses discussed herein, such as the treatment or prevention of DME or ocular fibrosis, or AMD, from its earliest stages to its later stages.

[0162] Senile macular degeneration (ARMD or AMD) is another leading cause of irreversible visual impairment and another leading cause of visual impairment in people aged 61 and older in developed countries. AMD most commonly affects the macula, the area of ​​the retina that assists in fine and detailed vision (although it can not be limited to the macula). In the United States, one in seven people aged 50 and older have neovascular AMD and / or geographic atrophy, and 1.8 million people have AMD (this is projected to increase to 3 million by 2020). Friedman, et al. (2004) Prevalence of age-related macular degeneration in the United States, Arch. Ophthalmol 122:564-572. The incidence of AMD increases dramatically with age, but more than 15% of Caucasian women over 81 years of age have neovascular AMD and / or geographic atrophy. The global cost of AMD is estimated at $345 billion annually, of which $255 billion is direct medical costs. AMD was included in the 2010 World Health Organization's priority list of eye diseases as a disease for which there are no satisfactory treatment options.

[0163] The pathogenesis of AMD is likely multifactorial, involving a complex interaction of metabolic, genetic, and environmental factors. The conventional understanding of AMD is that it affects four functionally interrelated layers within the eye: photoreceptors, RPE, Bruch's membrane, and choroidal capillary plate. Shelley, et al. (2009) Cone degeneration in aging and age-related macular degeneration, Arch Ophthalmol 127: 483-492. Research has primarily focused on RPE degeneration, which leads to irreversible damage to photoreceptors. Nowak (2006) Age-related macular degeneration (AMD): pathogenesis and therapy, Pharmacol Rep 58: 353-363. Along with this degeneration, deposits (drusen) can accumulate in the RPE and Bruch's membrane. These deposits may be associated with abnormal vascular epithelial proliferation, which can then lead to leakage, hemorrhage, and ultimately scar formation in the macula. See also de Jong PT (2006) Age-related macular degeneration, N Engl J Med 355: 1474-1485; Finger, et al. (1999) Ophthalmic plaque radiotherapy for age-related macular degeneration associated with subretinal neovascularization, Am J Ophthalmol 127: 170-177.

[0164] In one embodiment, the present invention involves, for example, administering to the target eye a therapeutically effective amount of at least one connexin modifier and / or at least one panexin modifier. The present invention relates to pharmaceutical compositions, products, and methods for treating eye disorders, such as glaucoma, DME, AMD, DR ocular fibrosis, and / or ocular hypoxia, and / or retinal perfusion disorders, and / or neuropathic eye disorders, including intraocular pressure-related neuropathy. In one embodiment, the present invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma. The methods described herein provide treatment of intraocular pressure-related optic nerve disorders, such as glaucoma, in an amount sufficient to reduce intraocular pressure. In some embodiments, connexin modifiers are useful for treating trauma associated with elevated intraocular pressure. In some embodiments, the connexin modifier is a connexin 43 modifier. In some embodiments, the compositions and methods of the present invention are useful for reducing intraocular pressure to a normal level, for example, less than 21 mm Hg, for example, less than 21, 20, or 19 mm Hg, for example, to a level of about 8 to about 21 mm Hg.

[0165] The compositions, products, and methods described herein are useful in one aspect for treating glaucoma without toxic side effects. In some aspects, the glaucoma may be open-angle glaucoma or closed-angle glaucoma. In some aspects, administering therapeutically effective amounts of at least one panexin modulator and / or at least one connexin modulator, e.g., a connexin 43 channel modulator, to ocular tissue in need increases flow through the trabecular network. Gap junction modulators, panexin channel modulators, and hemichannel modulators are also useful. In some aspects, the compositions of the present invention are useful as adjuvants to improve the success rate of trabeculectomy.

[0166] The anterior part of the eye is filled with aqueous humor, a clear fluid that nourishes the structures within the anterior portion of the eye. This fluid is constantly produced by the ciliary body surrounding the lens of the eye. The aqueous humor flows out of the eye through the pupil and through trabecular channels located at the junction where the cornea attaches to the iris, known as the iridocorneal drainage angle. In some embodiments of the present invention, one or more gap junction or connexin modulators, or panexin modulators, such as a connexin 43 modulator, are administered to or near the trabecular network or ciliary body. Gap junction modulators, panexin channel modulators, and hemichannel modulators are also useful.

[0167] In one embodiment of the present invention, compositions, products, and methods for treating retinal perfusion disorders, retinal ischemic diseases, or ocular ischemic diseases in a subject include administering a therapeutically effective amount of a gap junction modulator and / or connexin modulator, and / or a panexin modulator or panexin channel modulator, which is effective in reducing inflammation within the inner retina. In some embodiments, retinal ischemic disease is retinal artery occlusion or central retinal vein occlusion. In some embodiments, ocular ischemic disease is, for example, anterior ischemic optic nerve injury. In some embodiments, the connexin modulator is a modulator of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessels. In some embodiments, the connexin modulator is a Cx43 modulator, for example, a Cx43 hemichannel modulator. In some embodiments, the regulator may or may not include any of the aforementioned.

[0168] The present invention also includes compositions, products, and methods for treating ocular disorders, such as glaucoma, AMD, ocular fibrosis, and / or ocular hypoxia, and / or retinal perfusion disorders, and / or neuropathic ocular disorders, such as intraocular pressure-related neuropathy, by reducing choroidal perfusion disorders and / or choroiditis, or choroidal hyperperfusion, in the subject, by administering to the choroid of the subject an amount of gap junction modifiers and / or connexin modifiers, and / or panexin modifiers or panexin channel modifiers, in an amount effective in reducing choroidal perfusion disorders and / or choroiditis, or choroidal hyperperfusion, in the subject. In some embodiments of the present invention, the choroid of the subject is administered Administration of therapeutically effective amounts of gap junction modifiers and / or connexin modifiers, which are effective in reducing impaired choroidal perfusion and / or choroiditis or choroidal hyperperfusion, also reduces choroidal capillary endothelial cell loss and / or choroidal capillary detachment. In some embodiments, reduction of impaired choroidal perfusion and / or choroiditis or choroidal hyperperfusion also reduces retinal pigment epithelial degeneration and / or drusen development, otherwise improving, stopping, slowing, and / or reversing the progression of macular degeneration or macular dystrophy, which may be dry or wet macular degeneration. Connexin modifiers or panexin modifiers for reducing impaired choroidal perfusion and / or choroiditis or choroidal hyperperfusion may be administered together with ophthalmic agents. In some embodiments, the modifiers for reducing choroidal perfusion impairment and / or choroiditis, or choroidal hyperperfusion, are Cx43 modifiers, hemichannel modifiers, panexin modifiers, or panexin channel modifiers.

[0169] In some embodiments of the method of the present invention, gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers may be administered to the eye by intraocular injection or intravitreal injection. Gap junction modifiers and / or connexin modifiers, panexin or panexin channel modifiers may be administered once or twice or more times. Other methods of administering modifiers are described herein.

[0170] In some embodiments, the connexin modifier of the present invention is a connexin oligonucleotide such as a connexin antisense oligonucleotide or polynucleotide. The invention includes creotides or polynucleotides, or connexin peptides or peptide mimetic drugs such as connexin peptides or peptide mimetic drugs. The connexin peptides or peptide mimetic drugs include, for example, any of the peptides described herein, which include peptides containing a portion of the extracellular domain of connexin, and peptides containing a portion of the carboxyl terminus of connexin or gap junction closure compounds, as well as hemichannel closure compounds useful in the method of the invention, such as the treatment of any of the eye disorders described herein.

[0171] In some embodiments, the connexin protein modulators of the present invention include connexin 43 oligonucleotides or polynucleotides, such as connexin 43 antisense oligonucleotides or polynucleotides, which are useful in the methods of the present invention, such as the treatment of any of the neuropathic eye disorders described herein, or any of the peptides described herein, including anticonnexin 43 peptides or peptide mimetic agents, such as peptides comprising a portion of the extracellular domain of connexin, and peptides comprising a portion of the carboxyl terminus of connexin or a gap junction closure compound, as well as hemichannel closure compounds.

[0172] In some embodiments, the panexin modifiers of the present invention include panexin oligonucleotides or polynucleotides, such as panexin antisense oligonucleotides or polynucleotides, that are useful in the methods of the present invention, such as the treatment of any of the ocular disorders described herein, including neuropathic ocular disorders, or glaucoma, AMD, ocular fibrosis, DME, ocular hypoxia, and / or anti-panexin peptides or peptide mimetic agents.

[0173] In some embodiments, “promoyety” refers to a species that acts as a protecting group, shielding a functional group within the activator, thereby converting the activator into a prodrug. The activator may be any of the modulators or ophthalmic therapeutics disclosed herein. Typically, the promoyety binds to the drug via a bond(s) that are cleaved in vivo by enzymatic or non-enzymatic means, thereby converting the prodrug into its active form. In some embodiments, the promoyety may be the activator. In some embodiments, the promoyety is a gap junction modulator, a connexin modulator, or a panexin modulator. It may be conjugated with a drug adjuvant. In some embodiments, the promoyety may be conjugated with a polynucleotide, a peptide or peptide mimetic, a small molecule antagonist and / or any of the ophthalmic therapeutics disclosed herein. In some embodiments, the promoyety may be conjugated with a compound of formula I, and in some embodiments, the prodrug may be a compound of formula II.

[0174] In some embodiments, the promoyety may be any peptide mimic or peptide antagonist of the present disclosure. In some embodiments, the promoyety is a single amino acid that is optionally protected on the functional group of a single amino acid. In some embodiments, the promoyety is a target species. In some embodiments, the promoyety is a substrate of an inward or outward flux transporter on a cell membrane, e.g., as described in Gaudana, R. et al. The AAPS Journal, 12:3, 348-360 (2012). The promoyety may be, for example, chemically bound biotin. The promoyety may be, for example, chemically bound D-serine.

[0175] In some embodiments, the panexin modifier of the present invention includes a panexin oligonucleotide or polynucleotide, such as a panexin antisense oligonucleotide or polynucleotide, or an antipanexin peptide or peptide mimetic, which is useful in the methods of the present invention, such as the treatment of any of the ocular hypoxia or neuropathic eye disorders described herein.

[0176] Definition: In this specification, "small molecule" means having a molecular weight of less than approximately 600 daltons and is generally organic. It is defined as a compound. Small molecules may also be prodrug activators.

[0177] As used herein, “treatment” (and its grammatical variations such as “treat” or “treating”) refers to a clinical intervention in an attempt to alter the natural course of an individual, tissue, or cell being treated, which may be done for preventive purposes or during the course of a clinicopathological condition. Desired effects of treatment include, but are not limited to, prevention of the onset or recurrence of a disease, disorder, or condition; reduction of signs or symptoms; reduction of any direct or indirect pathological consequences of the disease; reduction of the rate of disease progression; improvement or mitigation of the condition; and remission or an improved prognosis. In some embodiments, the compounds, methods, and compositions of the present invention may be used to delay the onset of a disease, disorder, or condition, or to slow the progression of a disease, disorder, or condition. The term does not necessarily mean that treatment continues until the subject is completely cured. Thus, “treatment” includes reducing, mitigating, or improving the symptoms or severity of a particular disease, disorder, or condition, or preventing or reducing the risk of developing a particular disease, disorder, or condition. "Treatment" may also include maintaining or promoting a complete or partial state of relief of the disease.

[0178] "Treatment of eye disorders," including terms, diseases, and conditions, may refer to the prevention, delay, reduction, decrease, cessation, and / or reversal of eye disorders, diseases, or conditions such as intraocular neuronal loss and / or neuropathy, vascular leakage and / or hemorrhage, angiogenesis, inflammation and / or edema.

[0179] The term "prevent" means to prevent, improve, or control something, either entirely or partially.

[0180] As used herein, “effective dose” means an amount effective in achieving the desired therapeutic or preventive outcome in the required dosage and duration. For example, “effective dose” is not limited to and can treat the signs and / or symptoms of a disease, disorder, or pathological condition. This may refer to the amount of the compound or composition disclosed in the details.

[0181] When used herein, the “therapeutably effective amount” of the substance / molecule, agonist, or antagonist of the present invention may be modified according to factors such as the individual’s medical condition, age, sex, and weight, as well as the ability of the substance / molecule, agonist, or antagonist to produce the desired response in that individual. The therapeutically effective amount is preferably such that the therapeutically beneficial effect outweighs any toxic or harmful effects of any of the substance / molecule, agonist, or antagonist.

[0182] As used herein, “prophylactic effective dose” refers to the amount effective in achieving the desired prophylactic outcome in the required dose and duration. Generally, though not necessarily, prophylactic doses are used before or at an earlier stage of disease, disorder, or pathology; therefore, a prophylactic effective dose is less than a therapeutically effective dose.

[0183] The term "pharmaceutical preparation" refers to a preparation that is effective, contains active ingredients in a form that allows for their biological activity, and does not contain additional components that are unacceptably toxic to the recipient.

[0184] "Pharmacologically acceptable carrier" refers to a component of a pharmaceutical preparation other than the active ingredient that can be safely administered to the subject when used herein. Examples of pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0185] As used herein, terms such as "subject," including "individual" and "patient," may all be used interchangeably herein and refer to all mammals, including humans, domestic animals such as dogs, horses, cats, sheep, pigs, and cattle, as well as animals in zoos, wildlife parks, sports parks, or as pets. Preferred mammals herein are humans, including adults, children, and the elderly. Preferred sports animals are horses and dogs. Preferred pet animals are dogs and cats. Subjects may also be aquatic park animals such as dolphins, whales, sea lions, or walruses. In certain embodiments, subject, individual, or patient is human.

[0186] The present invention is described herein with reference to the use of gap junction channel modulators comprising peptide 5 and / or its analogues, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10Panx1, or any analogues thereof. It should be understood that one or more salts, polymorphs, solvated compounds and / or isomers of gap junction channel modulators such as peptide 5 and / or its analogues, compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and / or synthetic mimic peptide blockers of panexin 1, e.g., 10Panx1, or any analogues thereof may also be used in the present invention. Therefore, references to “Tonaversat and / or its analogues,” “Peptide 5 and / or its analogues,” “Probenecid and / or its analogues,” or “10Panx1, or any analogue thereof” should be considered to include references to any one or more salts, solvated compounds, polymorphs, and / or isomers of any of the aforementioned compounds.

[0187] The methods, uses, and compositions of the present invention relate to compounds of formula I, for example, tonaversat, and / or analogs of any of the aforementioned compounds and one or more analogs thereof, peptide D5 and one or more analogues thereof, probenecid and one or more analogues thereof, 10 This may include the use of Panx1 and one or more of its analogs, or one or more of these analogs. Accordingly, the terms used herein, "compounds of formula I, e.g., tonaversat, and / or analogs," "peptide 5 and / or its analogs," "compounds of formula VI, e.g., probenecid, and / or its analogs," or " 10 A reference to Panx1, or any analogue thereof, should be considered to include a reference to such combination.

[0188] As used herein, the term “hemichannel” is a part of a gap junction (a gap junction formed when two hemichannels or connexons connect across the intercellular space between adjacent cells) and includes several connexin proteins, typically hexamers of homomers or heteromers of connexin proteins that form the pore of the gap junction between the cytoplasm of two adjacent cells. Hemichannels are supplied by the cell on one side of the junction, and two hemichannels from the opposing cell usually unite to form a complete intercellular gap junction channel. However, in some cells, and under certain circumstances, the hemichannel itself is effective as a conduit between the cytoplasm and extracellular space, allowing the movement of ions and small molecules.

[0189] Compounds of formula I, e.g., tonaversat, and / or analogues or prodrugs of any of the aforementioned compounds can modulate the function and / or activity of hemichannels, preferably hemichannels containing any type of connexin protein. Therefore, unless the context requests otherwise, the reference to “hemichannel” should be broadly understood to include hemichannels containing any one or more of several different connexin proteins. However, as an example, hemichannels include connexin 23, It may include one or more of 25, 26, 30, 30.2, 30.3, 31, 31.1, 31.9, 32, 36, 37, 40, 40.1, 43, 45, 46, 47, 50, 59, and 62. In one embodiment, the hemichannel consists of one of the aforementioned connexins. In one embodiment, the hemichannel includes one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one embodiment, the hemichannel consists of one of connexins 26, 30, 32, 36, 37, 40, 45, or 47. In one particular embodiment, the hemichannel includes one or more of connexins 30 and 43. In one particular embodiment, the hemichannel consists of one of connexins 30 or 43. In one particular embodiment, the hemichannel comprises one of connexin 45, connexin 46, or connexin 50, and in one embodiment, the hemichannel comprises one or more connexins other than connexin 26.

[0190] As used herein, the term “gap junction channel” includes two hemichannels that connect across the intercellular gap between adjacent cells, allowing certain molecules to flow between these cells.

[0191] Hemichannels and gap junction channels can be present in any type of cell. Therefore, a reference to “hemichannel” or “gap junction channel” should be considered to include a reference to hemichannels or gap junction channels present in any cell type unless the context requires otherwise. In one embodiment, the hemichannel or gap junction channel is present in a cell outside the central nervous system. In one embodiment, the hemichannel or gap junction channel comprises one or more connexins other than connexin 26 and is present in a cell outside the central nervous system. In one embodiment, the hemichannel or gap junction channel is present in a cell inside the eye. In one embodiment, the hemichannel or gap junction channel is present in a cell in the anterior part of the eye, i.e., in the anterior segment of the eye. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells posterior to the eye, i.e., in the posterior segment of the eye. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells within the uvea. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells within the optic nerve. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells within the microvascular system of the eye. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells within the choroid. In one embodiment of the present invention, hemichannels or gap junction channels are located in cells within the choroidal capillary plate.

[0192] As used herein, “modulation of hemichannels and / or gap junction channels” means the modulation of one or more functions and / or activities of hemichannels and / or gap junction channels. Such functions and activities may include, for example, the docking of hemichannels to adjacent cells and openings to form gap junction channels. These may also include intercellular communication between cells and intercellular molecular flow through gap junction channels. Such functions and activities may include, for example, the flow of molecules into cells through hemichannels from the extracellular space or environment, and / or the flow of molecules into the extracellular space or environment through hemichannels from the intracellular space or the cellular environment.

[0193] Modulation of the function of hemichannels and / or gap junction channels can occur by any means. However, as just one example, modulation can occur by preventing, blocking, inhibiting, or reducing gap junction formation by hemichannel docking; inducing or promoting hemichannel closure; preventing, blocking, inhibiting, or reducing hemichannel opening; inducing or promoting loss of coupling between hemichannels; or causing, inducing, or promoting intracellular translocation of hemichannels and / or gap junctions. The use of terms such as “block,” “inhibit,” “block,” “reduce,” and “antagonize” should not be considered to mean complete blockade, inhibition, inhibition, or antagonism, although this may be preferable and should be considered to include at least partial blockade, inhibition, inhibition, or antagonism to reduce the function or activity of hemichannels and / or gap junction channels. Similarly, “inducing” or “facilitating” should not be interpreted as meaning a complete loss of coupling or a complete internal migration of hemichannels and / or gap junctions (or groups of hemichannels and / or gap junctions), but rather as including at least a partial loss or partial internal migration of coupling to reduce the function or activity of hemichannels and / or gap junction channels.

[0194] As used herein, the term “gap junction channel modulator” refers to a compound that blocks, inhibits, and / or reduces the function or activity of a gap junction channel, or the function or activity of a gap junction hemichannel, together or separately, including, for example, the expression, transport and / or construction of a connexin protein, its transport and / or construction, the expression, activity and / or formation of a hemichannel and / or gap junction. The blockage, inhibition and / or reduction of function or activity may be direct or indirect (e.g., directly blocking the channel, inducing a conformational change or altering the connexin phosphorylation state). The gap junction channel blocker may have any chemical properties. However, as an example, the agonist may be a nucleic acid (including antisense molecules, RNAi molecules, morpholino and other nucleic acids described herein), a peptide, a small molecule, a chemical element, a hormone, an antibody, an antibody fragment, or a metabolite. In certain embodiments, the agonist is a compound that targets one or more components of a gap junction, including connexins, hemichannels (also known as connexons), for inhibiting or blocking the activity, expression, transport, and / or construction of the gap junction. "Inhibiting" or "blocking" the activity, expression, transport, and / or construction of the connexin, hemichannel, or gap junction. This should not be considered to mean that construction is completely suppressed or blocked, although this may be preferable, and should be considered to involve any reduction in the activity, expression, transport, and / or construction of connexins, hemichannels, or gap junctions.

[0195] As used herein, the term “disorders in which modulation of gap junction hemichannels and / or gap junction channels may be beneficial” may include any disease, disorder, or condition in which the function or activity of gap junction channels and / or hemichannels may be associated with the onset, progression, or persistence of the disease, disorder, or condition. In one embodiment, the disease, disorder, or condition is associated with the function or activity of gap junction channels and / or hemichannels comprising one or more of the connexins 23, 25, 26, 30, 30.2, 30.3, 31, 31.1, 31.9, 32, 36, 37, 40, 40.1, 43, 45, 46, 47, 50, 59, and 62. In one embodiment, the disease, disorder, or condition is associated with the function or activity of gap junction channels and / or hemichannels comprising one of the aforementioned connexins. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of a gap junction channel and / or hemichannel comprising one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of a gap junction channel and / or hemichannel comprising one of connexins 26, 30, 32, 36, 37, 40, 45, or 47. In one particular embodiment, the disease, disorder, or pathology is associated with the function or activity of a gap junction channel and / or hemichannel comprising one or more of connexins 30 and 43. In one particular embodiment, the disease, disorder, or pathology is associated with the function or activity of a gap junction channel and / or hemichannel comprising one of connexins 30, 43, 45, 46, or 50. In one embodiment, the disease, disorder, or pathological condition is associated with the function or activity of gap junction channels and / or hemichannels, which include one or more connexins other than connexin 26.In one embodiment, the disease, disorder, or pathology is associated with the function or activity of gap junction channels and / or hemichannels located in cells outside the central nervous system. In one embodiment, the disease, disorder, or pathology comprises one or more connexins other than connexin 26, and is associated with the function or activity of gap junction channels and / or hemichannels located in cells outside the central nervous system. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of regulated hemichannels or gap junction channels located in cells within the eye. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of regulated hemichannels or gap junction channels located in cells within the anterior part of the eye, i.e., the anterior segment. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of regulated hemichannels or gap junction channels located in cells within the posterior part of the eye, i.e., the posterior segment. In one embodiment, the disease, disorder, or pathology is associated with the function or activity of regulated hemichannels or gap junction channels located in cells within the uvea. In one embodiment, the disease, disorder, or pathology is characterized by the presence of regulated hemichannel or gap junction channel function or activity within cells of the optic nerve. In one embodiment, the disease, disorder, or pathology is characterized by the presence of regulated hemichannel or gap junction channel function or activity within cells of the choroid. In one embodiment, the disease, disorder, or pathology is characterized by the presence of regulated hemichannel or gap junction channel function or activity within cells of the choroidal capillary plate. In one embodiment, the disease, disorder, or pathology is characterized by the presence of regulated hemichannel or gap junction channel function or activity within cells of the ocular microvascular system. In one embodiment, the composition may contain any of the aforementioned gap junction channels and / or hemichannel modulators. or may not include.

[0196] As used herein, the term “disorders in which modulation of panexin channels may be beneficial” should be understood to include any disorder in which the function or activity of panexin or panexin channels may be associated with the onset, progression, or persistence of a disease, disorder, or condition. In one embodiment, the disease, disorder, or condition is one in which the function or activity of panexin channels includes one or more of the three isoforms of panexin. In one embodiment, the disease, disorder, or condition is one in which the function or activity of the panexin channel being regulated includes panexin 1. In one embodiment, the disease, disorder, or condition is one in which the function or activity of the panexin channel being regulated is associated with the surface of the eye, the retina, and the eye, or This refers to the inside or above the eye, including the blood vessels within the eye.

[0197] When used herein, the terms and expressions “chronic wound,” “wound that does not heal at the expected rate,” and “dehiscent wound” have the meanings provided in U.S. Patent No. 2011 / 0300130, which are incorporated herein by reference and include some examples of the types of wounds to which the present invention may apply. However, as an example, such wounds may include diabetic ulcers (including, for example, diabetic foot ulcers), venous ulcers, venous congestive ulcers, pressure ulcers, pressure-induced ulcers, vasculitic ulcers, arterial ulcers, infectious ulcers, pressure ulcers, burn ulcers, traumatic ulcers or trauma-induced ulcers, inflammatory ulcers, ulcer formation associated with pyoderma gangrenosum, ocular ulcers including persistent epithelial defects, and mixed ulcers.

[0198] The terms and expressions “fibrosis” and “fibrous disease, disorder, or condition” or similar terms and expressions, when used herein, have the meanings provided in U.S. Patent No. 2011 / 0092449, which include some examples of fibrosis, disease, disorder, or condition to which the present invention may apply. However, as examples, such fibrosis, fibrous disease, disorder, or condition may include hepatic fibrosis, cardiac fibrosis, pulmonary fibrosis (including, for example, silicosis, asbestosis, and idiopathic pulmonary fibrosis), oral fibrosis (including, for example, submucosal fibrosis of the oral cavity), retroperitoneal fibrosis, deltoid fibrosis, endocardial fibrosis, renal fibrosis (including, for example, diabetic nephropathy), glomerulosclerosis, and acute fibrosis. In one embodiment, hepatic fibrosis may result from chronic liver injury or be associated with hemoglobinosis, Wilson's disease, alcoholism, schistosomiasis, viral hepatitis, biliary obstruction, exposure to toxins, and / or metabolic disorders. In one embodiment, cardiac fibrosis is endocardial fibrosis or endocardial myocardial fibrosis. In one embodiment, acute fibrosis is associated with injury from an accident, infection, and / or radiation and / or chemotherapy. In one embodiment, fibrosis may occur in subjects with a disease, disorder, or condition selected from the group including scleroderma, pancreatitis, inflammatory bowel disease, Crohn's disease, nodular fasciitis, and / or eosinophilic fasciitis. In one embodiment, scleroderma may be macular scleroderma, systemic macular scleroderma, or linear scleroderma.

[0199] When used herein, “abnormal or excessive scarring” and similar terms have the meanings provided in U.S. Patent No. 2011 / 0130710, which include some examples of abnormal or excessive scarring to which the present invention may apply. However, examples of abnormal or excessive scarring may include intracutaneous or extracutaneous scarring, intraocular or extraocular scarring, keloid scarring, hypertrophic scarring, atrophic scarring, and widespread scarring.

[0200] When used herein, “vascular disorders” and similar terms or expressions have the meanings provided in European Patent No. 2510939, which are incorporated herein by reference and include some examples of vascular disorders to which the present invention may apply. However, for example, vascular disorders include atherosclerosis, microvascular disorders, macrovascular disorders, thrombosis, and blood disorders resulting from trauma. This may include vascular disorders, blood vessel damage, diabetic retinopathy, organ ischemia, endothelial cell destruction, and vascular diseases of the limbs.

[0201] The terms “orthopedic disease or disorder” and similar expressions, when used herein, have the meanings provided in European Patent No. 2238250, which are incorporated herein by reference and include several examples of orthopedic diseases or disorders to which the present invention may be applied. However, as an example, orthopedic diseases or disorders include those characterized in whole or in part by abnormal tissue formation within and / or around joints, such as metabolic disorders, ischemia, trauma, injury to joints, capsules, bones, cartilage, tendons, ligaments, or muscles, fractures, subluxations, dislocations, crush injuries, prolonged immobilization (e.g., immobilization of joints in casts or splints), and / or paralysis, which are associated with, or may be caused by, altered or abnormal joint mobility or joint structure.

[0202] The expression “orthopedic surgery or procedure” and similar expressions will be readily understood by those skilled in the art when used herein. However, for example, “orthopedic surgery or procedure” and similar expressions should be considered to include any surgery or procedure outlined in European Patent No. 2242844. The “improvement” of recovery from such a procedure should also be considered broadly and may include, for example, pain reduction, as well as improved mobility and / or recovery time.

[0203] When used herein, “post-orthopedic joint contracture” has the meaning provided in European Patent No. 2242844, which is incorporated herein by reference.

[0204] When used herein, “adhesion” and similar expressions have the meanings provided in European Patent No. 2252690, which is incorporated herein by reference. However, for example, “adhesion” may include surgical adhesions as well as adhesions formed within any tissue, including epithelium, connective tissue, muscle, and tissue.

[0205] The terms “tissue damage,” “tissue damage associated with ophthalmic procedures,” and similar expressions and terms, when used herein, are incorporated herein by reference and have the meanings provided in U.S. Patent No. 2012 / 0093768, including some examples of tissue damage to which the present invention may be applied. However, for example, tissue damage may include facilitating tissue repair processes and / or improving tissue damage.

[0206] The terms “inflammatory disorder,” “inflammatory disease,” and similar expressions, when used herein, have the meanings provided in International Publication No. 2013 / 148736, which are incorporated herein by reference and include some examples of disorders to which the present invention may be applied. In one embodiment, hemichannels and panexin modulators are used alone or together to suppress the activation of one or more inflammasomes. In one embodiment, modulators comprising hemichannels and panexin modulators or panexin channel modulators are used alone or together to suppress the activation of inflammatory cascades by inflammasomes. In one embodiment, modulators comprising gap junctions, hemichannels and panexin and / or panexin channel modulators are used alone or together to treat a subject of disease, disorder, or pathology characterized at least partially by the activation of one or more inflammasomes and / or the activation of inflammatory cascades by inflammasomes. In one embodiment, gap junctions, hemichannels, panexin channels, connexin and panexin modulators are used alone or together to modulate the activity of the NLRP3 inflammasome.

[0207] The inflammasome contains caspase-1, PYCARD, NALP, and optionally (CyCARD). The inflammasome is a multiprotein complex containing caspase 5 (also known as spase 11 or ICH-3). The exact composition of the inflammasome depends on the activator that initiates inflammasome construction. For example, dsRNA results in one inflammasome composition, while asbestos constructs different variants. The inflammasome promotes the maturation of the inflammatory cytokines interleukin 1β (IL-1β) and interleukin 18 (IL-18). The inflammasome is involved in the activation of inflammatory processes and has been shown to induce cellular pyroptosis, a programmed cell death process distinct from apoptosis. Blocking the NLRP3 inflammasome suppresses VEGF-A-induced senile macular degeneration.

[0208] The terms “modulator,” “modulator,” and “modulation,” when used herein in various forms, refer to the overall or partial inhibition of the expression, action, or activity of a gap junction channel, hemichannel, panexin or panexin channel, or panexin or panexin channel, and may function as anticonnexin agents, including gap junction modulators, and as antipanexin agonists, including panexin channel modulators. In some embodiments, gap junction modulators and / or connexin modulators may also be modulators of connexins present in blood vessels, e.g., connexin 43 modulators and / or connexin 45 modulators. Therefore, as used herein, the term “connexin modifier” generally refers to a connexin modifier, but unless otherwise specified, it also specifically refers to connexin 43 modifiers and connexin 45 modifiers (as well as Cx43 and Cx45 hemichannel modifiers), and other vascular connexin and hemichannel modifiers. In some embodiments, a connexin modifier is a connexin 43 modifier, for example, a connexin 43 hemichannel modifier that blocks hemichannel opening. In some embodiments, gap junction modifiers also include other connexins found in the eye, such as Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, and Cx57, as well as modifiers of their hemichannels and gap junctions. In some embodiments, a panexin and / or panexin channel modifier may be a panexin 1 modifier, specifically a panexin 1 channel opening modifier. In some embodiments, the regulator may or may not include any of the aforementioned.

[0209] In some embodiments, “ocular disorders” include glaucoma, including hypertensive glaucoma and normal-tension glaucoma; clinical geographic atrophy; dry AMD and exudative AMD; AMD, including abnormalities or disorders; chronic macular ischemia; ocular fibrosis; idiopathic polypoidal choroidal vasculopathy (IPC); diabetic maculopathy; diabetic retinopathy; hypertensive retinopathy; inflammatory CNV; central serous chorioretinopathy (CSR); macular telangiectasia; pattern dystrophy; subretinal / subPRD neovascularization; serous detachment of the retinal neurosensory epithelium; RPE detachment; hemorrhage (subretinal pigment epithelium, subretinal, intraretinal, or preretinal, including rupture hemorrhage into the vitreous humor); and scarring of the retina, intraretinal, subretinal, or subpigment epithelium. This includes, but does not include, other eye disorders, including, scarring / glial tissue or fibrin-like deposits; retinal fibrosis, retinal hemangioma proliferation and retinal-choroidal anastomosis; choroidal neovascularization (CNV); cystic macular disorders; retinal thickening; non-exudative AMD; and retinal scarring, uveitis including posterior uveitis, scleritis, episcleritis viral retinitis including cytomegalovirus (CMV) retinitis, retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, sclerosis of the choroidal capillary plate, dry eye, persistent epithelial defects of the eye and cornea, diabetic macular edema (DME), neuropathic eye disorders, trauma-induced decreased intraocular pressure, epithelial basement membrane dystrophy, and / or other eye disorders, including those described elsewhere in this specification.

[0210] As used herein, “ocular nerve disorder” or “neuropathic eye disorder” means the cessation or reduction of loss of RGCs, or damage or loss of other ocular neurons or structures, or the repair of lost RGCs or other ocular structures or neurons. This includes any ocular disorder, disease, or condition that would benefit from an agent that treats neuronal loss. It also includes injuries associated with neuropathic, ischemic perfusion, inflammatory, or microvascular lesions of the eye, which may result from choroidal or retinal perfusion impairment, ocular hypertension, inflammation of the choroid or endoretina or other internal tissues of the eye, or retinal vein or artery occlusion. In some embodiments, choroidal or retinal perfusion impairment may cause ocular hypoxia. It also includes any ocular disease, disorder, and condition characterized by increased expression of connexins present in the blood vessels or neurons of the eye. Unwanted panexin. This also includes eye diseases, disorders, and conditions characterized by activity; diseases, disorders, and conditions characterized by undesirable ZO-1 protein or ZO-1 protein activity, or that benefit from reduced ZO-1 protein or ZO-1 protein activity; diseases, disorders, and conditions characterized by undesirable lower Rac1 or Rac1 activity, or that benefit from increased Rac1 or Rac1 activity; and diseases, disorders, and conditions characterized by undesirable decreases in RhoA GTPase or RhoA GTPase activity, or that benefit from reduced RhoA GTPase or RhoA GTPase activity.

[0211] "Glaucomatous ophthalmic neuropathy" refers to any "ophthalmic neuropathy" associated with glaucoma, such as neuropathic damage to retinal ganglion cells (RPGs) associated with glaucoma and glaucomatous optic neuropathy. In some embodiments, glaucomatous optic neuropathy may or may not be associated with elevated intraocular pressure or impaired choroidal or retinal perfusion. In some embodiments, a method for treating neovascular glaucoma includes treatment by administering modifiers, including gap junction modifiers, panexin modifiers, panexin channel modifiers, and / or connexin modifiers.

[0212] The term "intraocular pressure-related neuropathy" refers to optic nerve damage associated with high intraocular pressure, i.e., elevated intraocular pressure, in glaucoma.

[0213] The term “ocular hypoxia” refers to any ocular condition or disorder resulting from hypoxia, including, for example, intraocular ischemia and / or vascular leakage and / or vascular rupture, choroidal or retinal perfusion disorder, hypertension, or interruption of blood flow and / or oxygen flow to the eye. Conditions resulting from ocular hypoxia include, for example, glaucoma, glaucomatous ophthalmic neuropathy, intraocular pressure-related neuropathy, ophthalmic neuropathy, clinical geographic atrophy, DME, choroidal capillary plate dehiscence and / or choroidal capillary rupture, or other conditions described herein and below.

[0214] Clinical geographic atrophy (GA) The symptoms of GA are usually insidious and are often discovered during routine fundus examinations. When GA is bilateral and involves the fovea of ​​both eyes, patients may complain of decreased central vision. A common symptom is difficulty reading small print initially, then later, larger print and / or letters. Confirmation of a diagnosis of GA is by clinical examination using a high-resolution fundus lens of stereobioscopy. This shows a characteristic area of ​​fading (one or more) with a distinct and wavy edge, like the edge of a scallop shell. When the area of ​​GA is larger than 500 micrometers, large choroidal vessels are clearly visible within the area of ​​fading.

[0215] Typically, drusen and areas of focal hyperpigmentation appear within the retina adjacent to the GA patches. Several imaging modalities, specifically fundus autofluorescence, can be useful in evaluating GA. Fundus autofluorescence combined with spectral domain OCT has made the diagnosis of GA easier because these imaging modalities can reveal areas of GA that may not be clinically visible on in vivo microscopy.

[0216] Geographic atrophy is an advanced (late) form of dry AMD. Herein, atrophy refers to the degeneration of the deepest cells of the retina. It is usually defined as any clearly defined circular or oval area of ​​reduced pigmentation, or the apparent absence of retinal pigment epithelium (RPE) in which choroidal vessels are more visible than in the surrounding area. The most common sequence of events leading to GA is progression to hyperpigmentation of large drusen, sometimes beginning with the appearance of refractive deposits, accompanied by the development of atrophic areas of the retina and the underlying choroidal capillary lamina, followed by drusen regression, reduced pigmentation, and ultimately RPE cell death.

[0217] In some embodiments, modifiers, such as gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers, prevent inflammation of choroidal blood vessels, maintain the retinal pigment epithelial cell layer, and / or prevent atrophy in the region of the retina and the underlying choroidal capillary plate.

[0218] Exudative senile macular degeneration (AMD) The most prominent symptom typical of exudative AMD is blurred and distorted central vision. Most patients report that straight lines appear curved or wavy. Patients may not notice visual symptoms when the first eye is affected. When exudative AMD occurs in the second eye, patients suddenly become unable to read, drive, or see details such as facial expressions and features. This symptom is described by many patients with AMD who experience a dark patch in the center of their field of vision, which they notice at night but which resolves within minutes as they adjust. This symptom can also be present in patients with AMD who do not necessarily develop exudative AMD.

[0219] Macular examination typically reveals exudative macular lesions, along with other features of early AMD, such as drusen and pigment abnormalities. These latter features may be obscured after the onset of exudative AMD. However, the other eye, in the absence of advanced disease, often presents some or all of these early clinical signs, and their presence is useful in supporting the diagnosis that neovascularization is attributable to AMD. After slit-lamp biomicroscopy, attention should be paid to the presence or absence of the following signs: (1) subretinal or sub-RPE neovascularization, which may be visible as grayish-green lesions (sometimes these lesions will have a darkened edge, thought to be due to proliferation of RPE at the edge of the membrane), serous detachment of the retinal neurosensory epithelium, (3) RPE detachment, (4) hemorrhage - subretinal, subretinal, intraretinal, or preretinal (rupture hemorrhage into the vitreous humor may also occur), (5) hard exudates (lipids) in the macular region relating to any of the above, unrelated to other retinal vascular diseases, (6) scarring / glial tissue or fibrin-like deposition on the retina, intraretina, subretinal, or sub-pigment epithelium, (7) retinal hemangioma proliferation and retinal-choroidal anastomosis. This disorder may be treated with modifiers, e.g., gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers, as described herein.

[0220] Idiopathic polypoidal choroidal vasculopathy (IPC) This is a typical form of neovascular AMD, characterized by highly exudative lesions with steep-walled hemorrhagic pigment epithelial detachment, most typically adjacent to the optic disc, but potentially occurring within or even outside the macula. Rapid fluorescein or indocyanine green angiography typically reveals hyperfluorescent dilated complexes (branching vascular networks) of choroidal vessels leaking late in angiography. These dilated complexes resemble polyps or grapes, hence the name. This was originally described in middle-aged Black populations and was more common in women. IPCs are considered part of the spectrum of AMD and their strong association with hypertension and ischemic heart disease has been explained. The use of confocal rapid imaging devices has made it possible to diagnose IPCs more frequently, and IPCs are increasingly seen in older Asian populations. This condition accounts for more than one-third of blood maculopathy cases and 8-13% of those seen in Caucasians. This disorder can also be treated with modifiers, such as gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers, as described herein.

[0221] ocular fibrosis Disruption of the highly ordered tissue structure within the eye, resulting from vascular leakage, hemorrhage, and concomitant fibrosis, can lead to mechanical disruption of the visual axis and / or biological dysfunction. Ocular fibrosis may also include, for example, fibrosis of the lens, macula, or retina, and may include, for example, progressive subretinal fibrosis and preretinal fibrosis (PMF). Macular fibrosis occurs when a lamina of fibrous scar tissue forms on the upper part of the macula in response to injury or damage. Damage to the macula can result from eye trauma, retinal tear or detachment, vitreous contraction, or systemic diseases such as diabetes or hypertension. Macular fibrosis may also be called macular fold formation, epiretinal membrane, or cellophane maculopathy. Subretinal fibrosis may be associated with chronic vitreous inflammation resulting in progressively expanding and adhering fibrous subretinal lesions and may be associated with cystoid macular edema. PMF affects the macula on the anterior side of the retina, while macular degeneration affects the lower side of the retina. The primary symptom of PMF is the gradual onset of visual distortion in one eye, which may take several weeks to several months to develop. This disorder can be treated with modulators, such as gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0222] Uveitis Uveitis is inflammation of the uvea, the middle layer of the eye. The uvea consists of the pigmented vascular structure in the middle of the eye and includes the iris, choroid, and ciliary body. The choroid is sandwiched between the retina and the white of the eye (sclera) and provides blood flow to the deep layers of the retina. Uveitis may include inflammation of the iris, called iritis (anterior uveitis). This disorder may also be treated with modifiers, such as gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers, as described herein.

[0223] diabetic maculopathy This is the most common type of exudative central macular impairment in older adults. Patients with diabetes frequently present with retinal microaneurysms, hemorrhage, and exudate, often against the background of macular edema. The presence of more extensive vascular findings outside the macular arcade, often accompanied by venous congestion or bead formation, would alert clinicians to a diagnosis of diabetic maculopathy. Reduced visual function is less pronounced in eyes with diabetic maculopathy compared to eyes with CNV involving the fovea. Vascular vessels near the macula leak fluid or protein into the macula. Fluorescein angiography is required to confirm the absence of choroidal neovascularization and pathological conditions under RPE. Exudative AMD and diabetic maculopathy can coexist, as both are common conditions. This disorder, such as high myopia associated with choroidal neovascularization, can be treated with modifiers, such as gap junction modifiers and / or connexin modifiers, or panexin modifiers or panexin channel modifiers, as described herein.

[0224] High myopia may be associated with choroidal neovascularization. These neovascular complexes are thought to arise as a result of the development of microcracks in the thinned Bruch's membrane, which allow choroidal vessels to access the subretinal space.

[0225] diabetic macular edema Diabetic macular edema is swelling of the retina in individuals with diabetes, caused by leakage of fluid from blood vessels within the macula. The macula is the central part of the retina, a small area rich in cone photoreceptor cells, which are differentiated nerve endings on which color detection and daytime vision depend. As macular edema develops, blurring occurs in the center of the central field of vision, or just to the sides of it. Vision loss resulting from diabetic macular edema can progress over several months and make it impossible to focus clearly. Macular edema is common in diabetes. The lifetime risk of developing macular edema in people with diabetes is approximately 10%. This condition is closely related to the degree of diabetic retinopathy (retinal disease). High blood pressure and fluid retention also increase the hydrostatic pressure in the capillaries, which causes fluid to flow from the blood vessels into the retina. A common cause of fluid retention in people with diabetes is kidney disease with loss of protein in the urine (proteinuria). Diabetic macular edema is classified into localized and diffuse types. This is an important difference because the treatment of these two types differs. Localized macular edema is caused by lesions of vascular abnormalities that tend to leak fluid, mainly retinal microaneurysms, while diffuse macular edema is caused by dilated retinal capillaries in the retina. This disorder may also be treated with a modifier, such as a gap junction modifier and / or a connexin modifier, or a panexin modifier or panexin channel modifier, as described herein.

[0226] diabetic retinopathy Diabetic retinopathy can ultimately lead to blindness. It is the ocular manifestation of a systemic disease and affects up to 80% of all patients who have had diabetes for at least 10 years. Diabetic retinopathy-induced hyperglycemia induces pericyte death and basement membrane thickening, which leads to damage to the vascular walls. This damage alters the blood-retinal barrier, making retinal blood vessels permeable. Microvessels, such as those in the eye, are particularly vulnerable to poor glycemic control. Abnormal connexin expression in diabetes is associated with complications in several tissues, including the skin, kidneys, bladder, perineurium, lens, and heart.76 In the retina, hyperglycemia is known to induce apoptosis, which leads to vascular dropout and pericyte loss, a characteristic of the underlying diabetic retinopathy. Recent findings indicate that decreased Cxn43 expression initiates apoptosis and disruption of vascular homeostasis (Bobbie MW, Roy S, Trudeau K, Munger SJ, Simon AM, Roy S, Invest Ophthalmol Vis Sci.; 51(7):3758-63, 2010). However, the above description largely refers to the underlying background of the disease in the early stages of nonproliferative diabetic retinopathy, where some patients develop macular edema as damaged blood vessels leak fluid and lipids into the macula, but most patients are unaware of any changes in their vision. As the disease progresses, diabetic retinopathy enters the vascular proliferation stage. Due to low oxygen levels in the retina, new blood vessels are fragile and grow along the retina into the vitreous fluid. These vessels can bleed, cloud vision, and destroy the retina. Fibrovascular proliferation can cause retinal detachment, and blood vessels can also grow into the anterior chamber angle of the eye, causing neovascular glaucoma. Diabetic retinopathy is characterized by chronic and asymptomatic inflammation (Zhang W, Liu H, Rojas M, Caldwell RW, Caldwell RB, Immunotherapy, 3(5):609-28, 2011). This disorder can be treated with modulators, for example, gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators. In some embodiments, these modulators can also treat the inflammatory phase of this diabetic retinopathy.

[0227] Inflammatory CNV Some choroidal inflammatory leukoplasty syndromes (e.g., presumptive ocular histoplasmosis, punctate choroidal endometriosis, multifocal choroidal endometriosis) may be associated with inflammatory choroidal angiogenesis. In some embodiments, the modulators described herein prevent choroidal inflammation and thereby prevent inflammatory CNV.

[0228] Central serous retinochoroidopathy (CSR) Central serous chorioretinopathy (CNV) is characterized by serous accumulation beneath the retinal neurosensory epithelium with no trace of neovascularization. Chronic CSR is sometimes confused with AMD, and a combination of medical history, symptoms, and retinal imaging usually helps to distinguish between the two. CNV and IPC V can occur as a complication of chronic CSR. Chronic CSR is characterized by leakage of subretinal fluid that tends to accumulate beneath the central macula. This allows choroidal fluid to leak into the subretinal space. The accumulation of leakage occurs due to small tears in the retinal pigment epithelium. In some embodiments, the modulators described herein prevent or otherwise improve choroidal inflammation and / or prevent or improve choroidal capillary degeneration. Choroidal maintenance can prevent leakage of choroidal fluid into the subretinal space.

[0229] Macular telangiectasia Idiopathic macular telangiectasia (MACTEL), sometimes also called perifoveal peripheral telangiectasia or parafoveal peripheral telangiectasia, can be difficult to distinguish, especially from nAMD with the RAP morphology. Two types of telangiectasia have been described: Type 1 MACTEL occurs in middle-aged individuals, is usually unilateral, and exhibits exudative characteristics with leaky vessels and accumulation of intraretinal fluid, along with cystic macular damage and perifoveal exudation. Type 2 MACTEL occurs in older individuals and is usually bilateral, with clear, time-dependent crystallin deposition, pigment changes, and traces of right-angle venules extending throughout the perifoveal region. Leakage is detectable by fluorescein angiography, while there is no evidence of retinal thickening. Cystic cavities are traces within the retina using OCT, and these cavities are thought to reflect the loss of retinal tissue. Occasionally, subretinal neovascularization develops from the retinal circulation. Macular telangiectasia develops when there is a problem with the small blood vessels surrounding the fovea, the center of the macula. There are two types of macular telangiectasia, each developing separately. Type 2 macular telangiectasia: The most common form of macular telangiectasia is type 2 macular telangiectasia, in which the small blood vessels around the fovea leak and dilate (spread), or both. In some cases, new blood vessels form under the retina, and these can rupture or leak. Fluid from the leaking vessels causes swelling or thickening of the macula, a condition called macular edema, which affects central vision. Also, scar tissue can occasionally form on the macula and fovea, causing loss of fine vision. Both types can occur in both eyes, but not necessarily to the same degree. Type 1 Macular Telangiectasia: In type 1 macular telangiectasia, blood vessels dilate to form small aneurysms, causing swelling and damage to macular cells. This disease almost always occurs in one eye, which distinguishes it from type 2. These disorders can also be treated with modifiers, such as gap junction modifiers and / or connexin modifiers described herein, or panexin modifiers or panexin channel modifiers.

[0230] Pattern dystrophy (PD) PD affects the macula and can be mistaken for non-exudative AMD. The most common type of PD seen is adult vitiligo macular dystrophy (AVMD), while the less common is butterfly pattern dystrophy. PD is a condition with a genetic basis, but there is often no family history. PD is usually associated with better visual outcomes than AMD, unless complicated by choroidal neovascularization or atrophic changes. Differentiating AVMD from AMD in particular can be difficult. Symptoms can be similar, especially if CNV or atrophy is present in PD, but often AVMD is identified in asymptomatic individuals on routine fundus examinations. Fundus autofluorescence imaging, especially when combined with optical coherence tomography, can help differentiate PD from AMD. Fluorescein angiography can show the typical "corona sign" in AVMD, and the branching lines seen in butterfly-shaped PD are associated with hyperfluorescence dispersed across the area of ​​deposition, showing no leakage throughout the angiographic stages. Occasionally, fluorescent angiography of vitiligo lesions can be mistaken for active leakage from CNVs. This disorder can be treated with modifiers, such as gap junction modifiers and / or connexin modifiers described herein, or panexin modifiers or panexin channel modifiers.

[0231] Subretinal / subPRD angiogenesis Subretinal neovascularization is a pathological process consisting of the formation of new blood vessels within the choroid. In the wet form of AMD, abnormal blood vessels grow submacularly, leaking fluid and blood. These abnormal vessels, known as subretinal neovascularization, can also lift the retina. This disorder can be treated with modifiers, such as gap junction modifiers and / or connexin modifiers described herein, or panexin modifiers or panexin channel modifiers.

[0232] Serous detachment of the retinal neurosensory epithelium Retinal detachment occurs when subretinal fluid accumulates between the retinal sensory epithelium and the retinal pigment epithelium. This process can occur in three ways. One mechanism involves a tear in the retina that allows the vitreous humor to enter the subretinal space directly. This is known as rhegmatogenous retinal detachment. A second mechanism involves a proliferative membrane on the surface of the retina or vitreous humor. These membranes pull on the retinal sensory epithelium, causing a physical separation between the retinal sensory epithelium and the retinal pigment epithelium. This is called tractional retinal detachment. A third mechanism of retinal detachment results from the accumulation of subretinal fluid due to the exudation of fluid from inflammatory mediators or tumor lesions. This mechanism is known as serous retinal detachment or exudative retinal detachment. Serous detachment is caused by several inflammatory or exudative retinal disease processes, such as sarcoidosis or choroidal neoplasms. In some embodiments, the modulators described herein are used to control inflammation in the underlying choroidal capillary plate, control the accumulation of subretinal fluid, and / or prevent the accumulation of subretinal fluid that may lead to, for example, serous detachment of the retinal neurosensory epithelium.

[0233] RPE peeling RPE detachment is a nonspecific anatomical change that can result from any number of choroidal disorders that disrupt the normal connection between the basement membrane of the RPE and the inner collagen layer of Bruch's membrane. This disruption allows serous fluid from the lower choroidal capillary plate to gain access to the subretinal pigment epithelial space. Senile macular degeneration, choroidal neovascularization, high myopia, pigment streaks, hereditary choroidal degeneration, POHS, and choroidal tumors have all been identified as predisposing conditions in the development of RPE detachment. This disorder can be treated with modifiers, such as gap junction modifiers and / or connexin modifiers described herein, or panexin modifiers or panexin channel modifiers.

[0234] Hemorrhage - including rupture hemorrhage into the vitreous humor, subretinal pigment epithelium, subretinal, intraretinal, or preretinal hemorrhage. Retinal hemorrhage is an eye injury in which bleeding occurs within the retensitive tissue on the posterior wall of the eye. Retinal hemorrhage can be caused by hypertension, retinal vein occlusion (blockage of the retinal veins), or diabetes mellitus (which causes the formation of small, fragile blood vessels that are easily damaged). Retinal hemorrhages, especially mild ones not associated with chronic disease, usually reabsorb on their own without treatment. Laser surgery is a treatment option, which uses a laser beam to seal off the damaged blood vessels in the retina. This injury can be treated with modulators, such as gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0235] Scarring / glial tissue or fibrin-like deposits on, within, or beneath the retina, or subretina, or subpigment epithelium. In some embodiments, connexin modulators can prevent scarring, inflammation, and fibrin formation. Therefore, connexin modulators can prevent scarring / glial tissue or fibrin-like deposition on, within, or beneath the retina, intraretina, subretina, or subpigment epithelium. This disorder can be treated with modulators, such as gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0236] Retinal hemangioma proliferation and retinochoroidal anastomosis Retinal-choroidal anastomoses represent communication between the retina and choroidal circulation and are described in a subset of patients with neovascular senile macular degeneration (AMD). Retinal hemangioma proliferation is demonstrated by the presence of anastomoses between the retinal and choroidal circulation in eyes with discoidal scarring. This disorder can be treated with modulators, such as gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0237] Choroidal neovascularization (CNV) Choroidal neovascularization (CNV) is the formation of new blood vessels in the choroidal layer of the eye. It is a common sign of wet-type senile macular degeneration (AMD). CNV can develop rapidly in individuals with defects in Bruch's membrane, the innermost layer of the choroid. CNV has also been associated with excessive amounts of vascular endothelial growth factor (VEGF). Like wet-type AMD, CNV can often occur with pseudoxanthoma elasticum, a rare genetic disorder, and less often with the more common optic disc drusen. CNV has also been associated with extreme myopia or malignant myopic degeneration and primarily occurs in the presence of cracks in the retinal (specific) macular tissue, known as lacquer cracks in choroidal neovascularization. This disorder can be treated with modulators, such as gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0238] Cystic macular disorder Cystic macular disorders are cysts within or around the macula and can be treated with modifiers, such as gap junction modifiers and / or connexin modifiers described herein, or panexin modifiers or panexin channel modifiers.

[0239] retinal thickening Macular thickening (edema) is swelling or thickening of a portion of the retina involved in central vision. In some embodiments, the modulators described herein can control choroidal capillary rupture, thereby preventing retinal thickening. Thus, modulators can treat retinal thickening. Retinal thickening can be treated with modulators, for example, gap junction modulators and / or connexin modulators described herein, or panexin modulators or panexin channel modulators.

[0240] wet AMD Non-exudative AMD ("dry AMD") is caused by the gradual breakdown of the retinal pigment epithelium (RPE), the accumulation of drusen deposits, and the loss of function of the covering photoreceptors. In some embodiments, as described above, modifiers, such as gap junctions or connexin modifiers, can be used to treat non-exudative AMD alone or in combination with panexin modifiers or panexin channel modifiers as described herein.

[0241] Retinal scarring Retinal scarring is the progression of scar tissue on, within, or under the retina, a vital structure at the back of the eye. Mild scarring may not be a major medical problem, but larger scars can cause visual distortion and eventually vision loss. A caregiver may assess a patient with retinal scarring to determine the extent and provide advice on treatment options. Treatment for this condition can be invasive, and physicians do not want to suggest procedures that may do more harm than good. Patients may develop retinal scarring for several reasons, including very severe myopia, ocular histoplasmosis syndrome, and wet senile macular degeneration. Retinal scarring begins with irritation to the retina that causes inflammation, leading to changes in the tissue. If this occurs repeatedly, it can begin to cause serious problems for the patient. This can cause wrinkles on the surface of the retina or lead to swelling of the retina. Occasionally, retinal scarring can lead to retinal detachment. In some embodiments, modulators, such as gap junction modulators and / or connexin modulators, and / or panexin modulators or panexin channel modulators, can control or suppress retinal scarring and retinal inflammation, thereby controlling tissue changes and preventing or improving retinal scarring.

[0242] Ocular hypoxia Ocular hypoxia, including retinal hypoxia, is a potentially blinding mechanism that underlies several vision-threatening disorders, including several types of glaucoma, central retinal artery occlusion, ischemic central retinal vein thrombosis, complications of diabetic eye disease (e.g., DME), AMD, and ocular fibrosis. Hypoxia is associated with the loss of retinal ganglion cells (RGCs) that occur in such conditions. RGC death occurs by apoptosis or necrosis. Hypoxic ischemia induces the expression of hypoxia-inducible factor-1α, as well as its target genes such as vascular endothelial growth factor (VEGF) and nitric oxide synthase (NOS). Increased VEGF production leads to disruption of the blood-retinal barrier, resulting in retinal edema. Enhanced NOS expression leads to increased production of nitric oxide, which can be toxic to cells and causes cell death. Excessive glutamate release in hypoxic-ischemic states causes excitotoxic damage to RGCs through activation of ion channel glutamate receptors and metabotropic glutamate receptors. Activation of glutamate receptors is thought to initiate retinal damage through a cascade of biochemical effects, including neuronal NOS activation, and intracellular Ca 2+ Elevated levels are a major factor in RGC loss. In the posterior segment of the eye, diabetes-related retinal hypoxia can lead to fibrosis and tractional retinal detachment, which are complications of advanced diabetic retinopathy (DR). Subretinally, similar fibrosis can occur after subretinal hemorrhage associated with neovascular senile macular degeneration (AMD). A therapeutically effective amount of modifier, such as a connexin modifier including connexin 43 modifier, is any amount effective in slowing, stopping, or reversing ophthalmic neuropathy or treating any of the ocular disorders described herein.

[0243] The gap junction and / or connexin polynucleotide or oligonucleotide may be selected from modified or unmodified connexin polynucleotides or oligonucleotides, such as modified or unmodified connexin 43 antisense polynucleotides or oligonucleotides. In some embodiments, the modified connexin antisense polynucleotide or oligonucleotide or polynucleotide comprises a mixture of modified and unmodified nucleotides. In some embodiments, the connexin 43 antisense compound used in the methods herein is an antisense oligonucleotide comprising a native nucleic acid base and an unmodified nucleoside bond.

[0244] In some embodiments, gap junction, connexin, and / or panexin modulators are antagonists that inhibit and / or block gap junctions, connexin, and / or panexin, or inhibit and / or block upstream agonists of gap junctions, connexin, and / or panexin. In some embodiments, gap junction, connexin, and / or panexin antagonists include, for example, antagonists that bind to and inhibit gap junctions, connexin, and / or panexin; compounds that suppress the expression of gap junctions, connexin, and / or panexin; and / or gap junction, connexin, and / or panexin inhibitors; or viral vectors that encode proteins or antisense polynucleotides that block or inhibit gap junctions, connexin, and / or panexin. In some embodiments, species that inhibit gap junctions, connexins, and / or panexins, and / or upstream agonists of gap junctions, connexins, and / or panexins may be antibodies or antibody fragments, nanobodies, peptides or peptide mimetic drugs, receptor fragments, recombinant fusion proteins, aptamers, small molecules, or single-stranded variable region fragments (scFv).

[0245] The methods described herein provide treatment for intraocular pressure-related optic nerve disorders, such as glaucoma, in amounts sufficient to reduce intraocular pressure. In some embodiments, panexin modifiers and conexin modifiers are useful for treating trauma associated with elevated intraocular pressure. In some embodiments, the compositions, products, and methods of the present invention are useful for reducing intraocular pressure to normal levels, for example, below 21 mm Hg, for example, below 21, 20, or 19 mm Hg. In some embodiments, for example, the conexin modifiers and panexin modifiers and methods of the present invention are useful for reducing intraocular pressure to, for example, about 8 to about 21 mm Hg, about 10 to about 22 mm Hg, about 10 to about 21 mm Hg, or about 12 to about 21 mm Hg. In some embodiments, the compositions and methods of the present invention are also useful for treating glaucomatous optic nerve disorders even in the absence of high intraocular pressure. In some embodiments, the conexin modifier is, for example, a conexin 43 modifier or a conexin 45 modifier, preferably a conexin 43 modifier. In some embodiments, the connexin modifier is a modifier of Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessels. In some embodiments, the connexin modifier may or may not include any of the aforementioned.

[0246] The present invention includes connexin or panexin antisense oligonucleotides or polynucleotides containing at least one unmodified nucleotide. In one embodiment, the connexin antisense oligonucleotide or polynucleotide may contain at least one modified nucleotide and / or have at least one modified nucleoside bond and / or at least one modified sugar moiety. The modified nucleoside bond may be, for example, a phosphorothioate bond. In some embodiments, for example, the connexin 43 polynucleotide may contain at least one nucleotide comprising conformationally tensioned nucleotides, such as locked nucleic acid (LNA) or cross-linked nucleic acid (BNA). The locked nucleotide may be selected from, for example, one of the following types: 2′-O-CH2-4′ (oxy-LNA), 2′-CH2-CH2-4′ (methylene-LNA), 2′-NH-CH2-4′ (amino-LNA), 2′-N(CH3)-CH2-4′ (methylamino-LNA), 2′-S-CH2-4′ (thio-LNA), and 2′-Se-CH2-4′ (seleno-LNA). In some embodiments, the modified nucleotide may be a locked nucleic acid or an unlocked nucleic acid. In some embodiments, the connexin antisense oligonucleotide or polynucleotide may be, for example, a connexin 43 antisense oligonucleotide or polynucleotide, or a connexin 45 antisense oligonucleotide or polynucleotide, preferably a connexin 43 antisense oligonucleotide or polynucleotide. In some embodiments, the connexin antisense oligonucleotide or polynucleotide is, for example, Cx26, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin modifier in the eye or blood vessels.

[0247] Examples of modified or unmodified connexin 43 antisense compounds that include a nucleotide sequence or are modified from a nucleotide sequence selected from SEQ ID NOs: 1 to 16, and / or may be included in or excluded from the methods, compositions, kits, and products of this disclosure, are also covered herein. The polynucleotides of the present invention include synthetic polynucleotides having a length of less than 80 nucleotides, e.g., 12 to 18 to about 50 to 80 nucleotides, preferably about 30 nucleotides or less, e.g., 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the present invention take up the use of a connexin 43 antisense compound having a maximum length of 40 nucleotides, e.g., 15 to 40 nucleotides, that includes a nucleotide sequence selected from SEQ ID NOs: 1 to 17, or about 8 to 40 nucleotides of SEQ ID NO: 17. [Table 1]

[0248] Table 1 lists polynucleotide sequences of example connexin 43 polynucleotide modifiers. When sequences such as SEQ ID NOs. 1-16 are provided, they represent both modified and unmodified oligonucleotides or polynucleotides. In some embodiments, the bonds between nucleotides and the structures of the sugar moieties of the nucleotides may be modified. In some embodiments, the nucleoside bond between any two nucleotides may be a standard phosphodiester bond. In some embodiments, the nucleoside bond between any two nucleotides may be a phosphorothioate bond. For example, SEQ ID NO: 1 is the following selected structure: G s T s A s A s TTGCGGCAAGAAGAATTGTTTC s T s G s T s Any one of C is acceptable, and in the formula, s" is between two nucleotides This shows a phosphorothioate bond. As another non-restrictive example, Sequence ID No. 1 may also be (G)(T)(A)(A)TTGCGGCAAGAAGAATTGTTTC(T)(G)(T)(C), where the inserted nucleotide has a modified sugar moiety as described below.

[0249] Example sequences are shown in Table 2, and these are useful in the treatment of ocular diseases, disorders, and conditions characterized by undesirable ZO-1 protein or ZO-1 protein activity, or that benefit from reduced ZO-1 protein or ZO-1 protein activity. [Table 2]

[0250] Table 2 lists the polynucleotide sequences of ZO-1 AS ODN (antisense oligodeoxyribonucleotide), shRNA (small hairpin RNA molecule), and siRNA (small interfering RNA molecule).

[0251] ZO-1 was initially identified in tight junctions that form intracellular networks. These structures are present only at the crossings between two cells in the intercellular contact zone. ZO-1 is a 220-kDa membrane protein that coexists with the transmembrane proteins claudin and occludin. Later, ZO-1 was demonstrated and identified in adherent junctions that bind cells together, thereby maintaining cell and tissue polarity. These junctions also fix the cytoskeleton, enabling the formation of large complexes of the plasma membrane.

[0252] One sequence selected for the synthesis of an antisense polynucleotide targeting ZO-1,5'-CTGCTTTCTGTTGAGAGGCT-3' (SEQ ID NO: 325) matches the segment from base pair 3154-3169 of MUSZO1 acceptance number D14340I.

[0253] In some embodiments, the connexin 43 antisense compound is directed to at least about eight nucleic acid bases of a nucleic acid molecule encoding connexin having a nucleic acid base sequence selected from Sequence ID No. 17, such as polynucleotides and oligonucleotides, e.g., connexin 43 The antisense compound may have about 8 to about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, or about 80 nucleotides of sequence SEQ ID NO: 17 or a sequence complementary thereto, and / or the antisense polynucleotide or oligonucleotide may include any range of lengths between any two of the listed lengths. The polynucleotides of the present invention include synthetic polynucleotides having a length of less than 80 nucleotides, for example, 12 to about 18 to about 50 to 80 nucleotides, preferably about 30 nucleotides or less, for example, 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the method of the present invention involves the use of a connexin 43 antisense compound having a maximum length of 40 nucleotides, for example, 15 to 40 nucleotides, comprising a nucleotide sequence selected from SEQ ID NOs: 1 to 17.

[0254] Human Cx43, α1 (SEQ ID NO: 17) locus NM_000165 3088b p mRNA linear PRI 26-OCT-2004 Definition: Homo sapiens gap junction protein, alpha-1, 43 kDa (connexin 43) (GJA1), mRNA. Sequence Listing 9-1 [ka] Sequence Listing 9-2 [ka]

[0255] In some embodiments, the sugar moiety may be a modified sugar moiety. In some embodiments, the modified sugar moiety may be a conformationally tensioned sugar moiety. In some embodiments, the conformationally tensioned sugar may be a locked nucleotide (locked nucleic acid, or LNA). In some embodiments, the locked nucleotide may be selected from one of 2′-O-CH2-4′ (oxy-LNA), 2′-CH2-CH2-4′ (methylene-LNA), 2′-NH-CH2-4′ (amino-LNA), 2′-N(CH3)-CH2-4′ (methylamino-LNA), 2′-S-CH2-4′ (thio-LNA), and 2′-Se-CH2-4′ (seleno-LNA). In some embodiments, the conformationally tensioned sugar may be a cross-linked nucleic acid (BNA).

[0256] As shown in Equation III, the conformationally tensioned sugar may also be locked nucleic acid. In some embodiments, the sugar moiety of the nucleoside compound may be ribofuranose. Therefore, a particularly preferred substituent X is oxygen. However, various other alternative sugar moieties are also suitable, and it is intended that modified sugars and carbocyclic moieties are generally considered suitable for use herein. Therefore, X may also include atoms or groups other than oxygen, and particularly intended alternative groups X include S when the sugar is a sulfur sugar, and CH2 when the sugar is a carbocyclic compound. Examples include C=O, C=CH2, or a covalent bond, and NR (where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl) where the sugar is an amino sugar. The groups Y and Z can also be varied. In some embodiments, the substituents Y and Z may be selected from the group consisting of O, S, CH2, NR, C=O, C=CH2, or a covalent bond, where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl. In some embodiments, Q may be none, O, S, NHR, or CH2, where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl. [ka]

[0257] In some embodiments, B may be a base selected from one of the following types of bases: substituted and unsubstituted deazaprines, azapurines, deazapyrimidines, purines, pyrimidines, and azapyrimidines. The term “substituted” as used herein means the addition of one or more functional groups, of which functional groups are particularly intended include nucleophiles (e.g., -NH2, -OH, -SH, and -NC) as well as electrophiles (e.g., C(O)OR and C(X)OH), polar groups, nonpolar groups (e.g., aryl, alkyl, alkenyl, or alkynyl), and ionic groups (e.g., -NH3). + Examples include ), as well as halogens (-F, -Cl, -I, -Br) and all chemically appropriate combinations thereof. In some embodiments, B is selected from one of adenosine, thymine, uracil, guanine, and cytosine.

[0258] The groups R1, R2, and R3 may be selected from the group consisting of none, -H, -OH, -OCH3, alkyl, and especially methyl, -O-acyl, -N3, -CN, and halogen. Furthermore, if the intended nucleoside analog contains a phosphate, phosphonate, or phosphorothioate group, particularly preferred R1 and / or R2 groups are intended to include monophosphate, diphosphate, triphosphate, monophosphonate, diphosphonate, triphosphonate, phosphorothioate, amino acid esters having a sugar OH group, or prodrugs of monophosphate, diphosphate, triphosphate, monophosphonate, diphosphonate, triphosphonate, or phosphorothioate.

[0259] As shown in Formula IV, the structure of locked nucleic acid may further contain Z as oxygen ("O"), Y is CH2, Q is absent, and R3 is absent. The groups B, R1, and R2 may be selected from the groups described above.

[0260] In some embodiments, with respect to any of the above-mentioned Markush groups, each group may or may not include any of the species listed for that group. [ka]

[0261] As shown in formula V, the conformational tensioned nucleotide structure may also be a cross-linked nucleic acid (BNA). The groups are X, Y, Z, R1, R2, R 3、 And B may be selected from the above-mentioned elements. [ka]

[0262] In some embodiments, the connexin 43 regulator may include peptides. The peptide sequences may include, for example, one or more of the following sequences: SRPTEKT "Mod3" (SEQ ID NO: 173), "Peptide 1" ADCFLSRPTEKT (SEQ ID NO: 291), "Peptide 2" VACFLSRPTEKT (SEQ ID NO: 292), "Peptide 11" VDCFLSRPTAKT (SEQ ID NO: 293), "Peptide 12" VDCFLSRPTEAT (SEQ ID NO: 294), "Peptide 5" VDCFLSRPTEKT (SEQ ID NO: 168), "Mod1" CFLSRPTEKT (SEQ ID NO: 171), "Mod2" LSRPTEKT (SEQ ID NO: 172). In some embodiments, the carboxyl terminus may be modified. In some embodiments, the carboxyl terminus modification may optionally include an n-alkyl chain that can be further bonded to hydrogen or other moieties. In some embodiments, the connexin 43 peptide may or may not include any of the peptides listed above or disclosed herein.

[0263] In some embodiments of the present invention, a connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs: 1 to 64.

[0264] Modified or unmodified connexin 45 antisense polynucleotides containing 8 to approximately 80 nucleotides as of SEQ ID NO: 217, and 8 to approximately 80 nucleotides as of SEQ ID NO: 279 Modified and unmodified panexin antisense polynucleotides are also included herein. The polynucleotides of the present invention include synthetic polynucleotides having a length of less than 80 nucleotides, for example, 12 to 18 to about 50 to 80 nucleotides, preferably about 30 nucleotides or less, for example, 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the present invention include the use of a conexin 45 antisense compound containing up to 40 nucleotides in length, for example, 15 to 40 nucleotides, for example, about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NO: 217. In some embodiments, the methods of the present invention include the use of a panexin antisense compound containing up to 40 nucleotides in length, for example, 15 to 40 nucleotides, for example, about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NO: 283 to 287. In some embodiments, the connexin 45 or panexin antisense compound may be modified by substituting one or more thymine nucleotides in SEQ ID NO: 217 or SEQ ID NOs: 283-287 with one or more uridine nucleotide residues.

[0265] Human Cx45, α7 (SEQ ID NO: 217) locus NM_005497 1191 bp mRNA linear PRI 23-DEC-2003 Definition: Homo sapiens gap junction protein, alpha-7, 45 kDa (connexin 45) (GJA7), mRNA. Sequence Listing 10 [ka]

[0266] In some embodiments of the present invention, a connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs. Connexins or panexins, which are oligonucleotides or polynucleotides, may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to 8 to 80 nucleotide parcels of each of these sequences. For example, a connexin 45 regulator, which is an oligonucleotide or polynucleotide, has at least about Panexin modifiers, which are oligonucleotides or polynucleotides, may have 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology, while others, such as SEQ ID NO: 283 (Panx1 polynucleotide), (Panx1 polynucleotide RefSeq number NM_015368.3), SEQ ID NO: 284 (Panx2 polynucleotide), (in the case of variant 1, Panx2 polynucleotide RefSeq number NM_052839.3), SEQ ID NO: 285 (Panx2 polynucleotide In the case of polynucleotide variant 2, RefSeq number NM_001160300.1), sequence number 286 (in the case of Panx2 polynucleotide variant 3, RefSeq number NR_027691.1), or sequence number 287 (Panx3 polynucleotide) (Panx3 polynucleotide RefSeq number NM_052959.2) may have at least approximately 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to 8 to 80 nucleotide segments.

[0267] In some embodiments, the panexin regulator may or may not contain a panexin peptide sequence. The panexin peptide sequence may include 8 to 40 consecutive amino acids, an extracellular domain, an intracellular domain, a carboxyl terminus, or an amino terminus of polypeptide SEQ ID NO: 288 (Panx1 peptide), SEQ ID NO: 289 (Panx2 peptide), or SEQ ID NO: 290 (Panx3 peptide).

[0268] In other embodiments, the connexin modifier is a connexin peptide or peptide mimetic, sometimes referred to as an anticonnexin peptide or peptide mimetic, e.g., an anticonnexin hemichannel blocking peptide or peptide mimetic (e.g., a modified or unmodified peptide or peptide mimetic comprising the connexin extracellular domain, transmembrane region, and connexin carboxy-terminal peptide). The anticonnexin hemichannel blocking peptide or peptide mimetic may or may not be modified. The anticonnexin hemichannel blocking peptide or peptide mimetic is prepared chemically, synthetically, or otherwise manufactured. In some embodiments, the connexin modifier is a connexin 43 peptide or peptide mimetic. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic comprises a portion of the extracellular domain or transmembrane domain of connexin, such as connexin 43 or connexin 45. In some embodiments, the peptide or peptide mimetic agent comprises a portion of the extracellular or transmembrane domain of connexin Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessels. In other embodiments, the modifier is a panexin peptide or peptide mimetic agent, e.g., a modified or unmodified peptide or peptide mimetic agent, sometimes referred to as an anti-panexin peptide or peptide mimetic agent. In other embodiments, the modifier is a panexin peptide or peptide mimetic agent, e.g., a modified or unmodified peptide or peptide mimetic agent, sometimes referred to as an anti-panexin panexin or peptide mimetic agent. In some embodiments, the connexin modifier may or may not contain any of the above.

[0269] In some embodiments, the connexin modifier of the present invention comprises any of the peptides described herein, including an anti-connexin 43 peptide or peptide mimetic, for example, a peptide containing a portion of the extracellular domain of connexin, and a peptide containing a portion of the carboxyl terminus of connexin, which is therapeutically effective, for example, effective in curing any of the neuropathic eye disorders described herein and useful in the methods of the present invention. In some embodiments, the therapeutically effective modified or unmodified peptide or peptide mimetic comprises a portion of the extracellular domain of connexin such as connexin 43 or connexin 45, preferably connexin 43. The protein sequence of connexin 43 is shown below. Connexin 43 (SEQ ID NO: 19) Sequence Listing 11-1 [ka] Sequence Listing 11-2 [ka]

[0270] Table 3 shows the extracellular loops of connexin 43 and connexin 45. In some embodiments, therapeutically effective modified or unmodified peptides or peptide mimics contain a connexin such as connexin 43 or connexin 45, preferably a portion of the E2 extracellular domain of connexin 43. In some embodiments, therapeutically effective modified or unmodified peptides or peptide mimics contain a connexin such as connexin 43 or connexin 45, preferably a portion of the C-terminal domain of connexin 43. When the peptide or peptide mimic modifier contains a portion of the intracellular domain of connexin, in some embodiments, the peptide may be complexed with an intracellular transporter and, in some cases, may block zona occludens (ZO-1) bound to connexin 43. [Table 3]

[0271] The sequences of the E2 domains of different connexin isotypes are shown in Table 4, along with homologous amino acids to peptide SEQ ID NO: 35 and peptide SEQ ID NO: 36, which are shown in bold. Note that the last four amino acids of peptide SEQ ID NO: 36 are part of the fourth membrane domain.

[0272] Table 4 provides extracellular domains of connexin family members used to develop the peptide inhibitors described herein. In certain non-limiting embodiments, peptides and those provided in Table 4, as well as fragments thereof, are used as peptide inhibitors. In other non-limiting embodiments, peptides containing about 8 to about 15 amino acids, or about 11 to about 13 amino acid sequences from the peptides in this table, are peptide inhibitors of the present invention. In other embodiments, modest amino acid changes are made to the peptide or fragments thereof. [Table 4]

[0273] Other peptide sequences known to inhibit connexin-connexin binding, which can regulate connexin activity, include the cytoplasmic loop of the connexin 43 (amino acids 119-144) L2 peptide and subparts of the connexin 43 L2 peptide. In some embodiments, these peptides include, for example, the nine-amino acid sequence of Gap19, KQIEIKKFK (SEQ ID NO: 299); the natural Gap19 sequence, DGVNVEMHLKQIEIKKFKYGIEEHGK (SEQ ID NO: 300); the His144→Glu L2 derivative of Gap19 reported by Shibayama (Shibayama, J. et al., Biophys. J. 91, 405404063, 2006), DGVNVEMHLKQIEIKKFKYGIEEQGK (SEQ ID NO: 301); the TAT-Gap19 sequence, YGRKKRRQRRRKQIEIKKFK (SEQ ID NO: 302); the SH3 binding domain, CSSPTAPLSPMSPPGYK (SEQ ID NO: 303), or its subpart PTAPLSPMSPP (SEQ ID NO: 304); the C-terminal sequence of a CT9 or CT10 peptide, with or without a TAT reader sequence for increasing cell permeability, RPRDDEI (SEQ ID NO: 303). 05) may or may not include SRPRDLEI (SEQ ID NO: 307), YGRKKRRQRRRSRPRDDEI (SEQ ID NO: 306), or YGRKKRRQRRRRPRDDEI (SEQ ID NO: 308). Sequences of other peptide mimics that may or may not be included in the compositions, methods, kits, or products disclosed herein are those reported by Dhein (Dhein, S., Arch. Pharm., 350:174-184, 1994) for AAP10 peptide, H2N-Gly-Ala-Gly-4Hyp-Pro These include Tyr-CONH2 (SEQ ID NO: 309), ZP123 peptide (rotigapeptide), and Ac-D-Tyr-Pro-D-4Hyp-Gly-D-Ala-Gly-NH2 (SEQ ID NO: 310) (Dhein, S., et al. Cell Commun. Adhes. 10, 371-378, 2013). Rotigapeptide contains a D-type peptide to improve its efficacy compared to the natural L-type peptide.

[0274] Examples of antipanexin agents are antipanexin polynucleotides, including antipanexin antisense oligodeoxynucleotides ("ODNs") as described below. Examples of antipanexin polynucleotides include antisense (including modified and unmodified skeletal antisense), RNAi, and antipanexin oligodeoxynucleotides including miRNA and siRNA. Suitable antipanexin peptides include, for example, peptides that conjugate the extracellular domain of panexin or the intracellular domain of panexin. Suitable antipanexin agents include, for example, antisense ODNs, peptides, and peptide mimes against Panx1. Peptides or peptide mimes include antipanexin peptides or peptide mimes, e.g., panexin complex blocking peptides (e.g., antipanexin antibodies and antibody-binding fragments) or peptide mimes (e.g., peptide mimes directed to one or more extracellular or intracellular regions of panexin). Peptide mimes may be complexed with one or more other agonists, e.g., Antennapedia, to facilitate membrane transport for the binding of intracellular panexin regions and domains.

[0275] The terms “peptide,” “peptide mimic,” and “mimic” include synthetic or genetically modified chemical compounds that may possess substantially the same structural and functional properties as the protein region they mimic. In the case of connexins, these may mimic, for example, the extracellular loops of antagonistic connexins involved in interconnexon docking and intercellular channel formation, and / or the extracellular loops of hemichannel connexins.

[0276] As used herein, the term “peptide analog” refers to a compound that has properties similar to those of a template peptide and may be a non-peptide drug. “Peptide mimetic drugs,” which include peptides and peptide-based compounds (also known as peptide imitators), also include such non-peptide compounds, such as peptide analogs. Peptide mimetic drugs that are structurally similar to therapeutically useful peptides may be used to produce equivalent or improved therapeutic or prophylactic effects. In some embodiments, peptides and peptide mimetic drugs may be modified or unmodified. Generally, a peptide mimetic drug is a structural or functional mimetic (e.g., identical or similar) to a paradigm polypeptide (i.e., a polypeptide having biological or pharmacological function or activity), but may also optionally have one or more peptide bonds replaced by bonds selected from the group consisting of, for example, -CH2NH-, -CH2S-, -CH2-CH2-, -CH=CH- (cis and trans), -COCH2-, -CH(OH)CH2-, and -CH2SO-. Imitations may be composed entirely of natural amino acids, synthetic chemical compounds, or non-natural analogs of amino acids, or they may be chimeric molecules of partial natural peptide amino acids and partial non-natural analogs of amino acids. Imitations may also include any amount of conservative substitution of natural amino acids, as such substitutions do not substantially alter the activity of the imitation. In the case of connexins, these may mimic, for example, the extracellular loops of antagonistic connexins involved in interconnexon docking and intercellular channel formation. For example, a mimic composition may be useful as a gap junction modifier if it can downregulate biological effects or connexon activity, such as by interfering with the docking of connexons to form gap junction-mediated intercellular communication or by interfering with the opening of connexons to expose the cytoplasm to the extracellular environment. Peptide mimetic agents include those described herein and those that may be known in the art, whether currently known or to be developed later. Peptides and peptide mimetic connexin modifiers may also be modified to increase stability, improve bioavailability, and / or increase cell membrane permeability.

[0277] In some embodiments of the present invention, the connexin modifier is a peptide or a peptide mimic. Examples of connexin 43 (Cx43), or Cx26, Cx30, Cx30.3, Cx31, Cx31.1, Cx32, Cx36, Cx37, Cx40.1, Cx43, Cx46, Cx46.6, or Cx40 peptide modifiers, which may or may not be included in certain embodiments of the present disclosure, are provided in Table 64 below (E2 and T2 refer, for example, to the position of the peptide in a second extracellular domain or a second transmembrane domain). [Table 5] TIFF2026143697000037.tif208170 TIFF2026143697000038.tif215170 TIFF2026143697000039.tif218170 TIFF2026143697000040.tif73170

[0278] In some embodiments, the connexin 43 regulator may include, for example, a peptide or peptide mimic containing SEQ ID NO: 173 (SRPTEKT). The peptide or peptide mimic may also include, for example, SEQ ID NO: 168 (VDCFLSRPTEKT). The peptide may contain one or more modified amino acids, amino acid analogs, or otherwise may be modified to improve bioavailability or increase permeability across the cell membrane. For example, SEQ ID NO: 168 may be modified to obtain SEQ ID NOs: 300-306. In some embodiments, the peptide or peptide mimic containing, for example, SEQ ID NO: 173 (SRPTEKT) or SEQ ID NO: 168 (VDCFLSRPTEKT) contains 7-40 amino acids or amino acid analogs and does not contain a C-terminal peptide. In some embodiments, the peptide may be used as a promoyety.

[0279] In some embodiments, the connexin 45 modifier may be a peptide or peptide mimetic containing a portion of the connexin 45 protein that antagonizes, inhibits, or blocks interactions between connexins. Examples of peptide sequences for connexin 45 peptides and peptide mimetic modifiers are provided in Table 63. [Table 6]

[0280] In some embodiments, the connexin 45 modifier may include a peptide or peptide mimic containing a portion of the E2 or C-terminal domain of connexin 45, for example, SEQ ID NO: 280 (SRPTEKT). The peptide or peptide mimic may also include, for example, SEQ ID NO: 279 (DCFISRPTEKT). In some embodiments, the peptide may be SRL, PCH, LCP, CHP, IYY, SKF, QPC, V It can be as short as 3 amino acids, including CY, APL, and HVR or higher.

[0281] In some embodiments, the connexin 40 modulator may be a peptide or peptide mimetic containing a portion of the connexin 40 protein that antagonizes, inhibits, or blocks interactions between connexins.

[0282] Peptide chemical modification In certain embodiments, the connexin 43 modulator peptide of the present invention may be bound to an intracellular transporter at its amino or carboxyl terminus. The intracellular transporter bound to the connexin 43 modulator peptide of the present invention may be any intracellular transport sequence known or newly discovered in the art, or a conserved variant thereof. Non-limiting examples of intracellular transporters and sequences include Antennapedia sequences, TAT, HIV-Tat, penetratin, Antp-3A (Antp variant), bufonin II, transportan, MAP (model amphiphilic peptide), K-FGF, Ku70, prion, pVEC, Pep-1, SynB1, Pep-7, HN-1, BGSC (bis-guanidinium-spermidine-cholesterol), and BGTC (bis-guanidinium-tren-cholesterol).

[0283] Examples of intracellularly distributed peptide sequences are provided in Table 65 below. [Table 7]

[0284] Table 65 lists examples of intracellular transporter sequences.

[0285] In some embodiments, connexin, panexin, and / or panexin modifier peptides are fused to a transport peptide to increase permeability into target cells. In some embodiments, the transport peptide may be part of a viral coating for cell permeability. In some embodiments, the transport peptide has a carboxyl terminus. Alternatively, they may be fused at the amino terminus to form connexin and / or panexin modulator peptides. The transport peptide may be selected from one of the following peptides: ANTP, HIV-TAT, transportan, bufonin II, Tat, penetratin, MAP, K-FGF, Ku70, prion, pVEC, Pep-1, SynB1, Pep-7, RGD, or HN-1. In some embodiments, the connexin, panexin, and / or panexin modulator peptides may or may not contain any of the aforementioned.

[0286] In one embodiment of the present invention, the amino acid sequence of the connexin 43 regulator peptide may be selected from the group consisting of any peptide sequence numbers listed herein or their conserved variants. In a further embodiment of the present invention, the connexin 43 regulator peptide may comprise the amino acid sequences of sequence numbers 140-200. In another embodiment of the present invention, the connexin 43 regulator peptide further comprises an intracellular transporter. In a further embodiment, the connexin 43 regulator peptide may be bound to the intracellular transporter at its amino terminus.

[0287] When a particular protein is shown herein, derivatives, variants, and fragments are intended. Protein derivatives and variants are well understood by those skilled in the art and may involve alterations of the amino acid sequence. For example, amino acid sequence alterations can be classified into one or more of three classes: insertion variants, substitution variants, or deletion variants. Insertions include amino and / or carboxyl-terminated fusions, as well as intrasequential insertions of one or more amino acid residues. Insertions may be smaller than amino or carboxyl-terminated fusions, such as 1 to 4 residues. Deletions are characterized by the removal of one or more amino acid residues from a protein sequence. Substitutions, deletions, insertions, or any combination thereof may be combined to arrive at the final construct. A substitution variant is one in which at least one residue is removed and a different residue is inserted in its place. Such substitutions are referred to as conserved substitutions. The replacement of one amino acid residue with another that is biologically and / or chemically similar is known as a conserved substitution in the art. Conservative substitutions may replace one hydrophobic residue with another, or one polar residue with another. Conservative substitution variants of sequences, each explicitly disclosed, are included in the peptides provided herein. Conservative substitutions typically have little effect on the biological activity of the resulting polypeptide. Conservative substitutions may also be amino acid substitutions within a peptide that substantially do not affect the biological function of the peptide. A peptide may contain one or more amino acid substitutions, two to ten conservative substitutions, two to five conservative substitutions, or four to nine conservative substitutions.

[0288] Chemical structure modification In certain embodiments, the chemical structure of the peptide or peptide mimetic may be synthetically modified to increase the gene transfer uptake of the peptide. In some embodiments, for example, the peptide or peptide mimetic may be modified by conjugating the peptide with a hydrophobic compound through a linker moiety. The hydrophobic compound may be, for example, one or more n-alkyl groups, which may be, for example, C6-C14 alkyl groups. In some embodiments, the peptide may be conjugated with one or two dodecyl (C12) groups at the N-terminus, as described in Chen, YS et al., J. Pharm. Sci., 102:2322-2331 (2013), which is incorporated herein by reference. In one embodiment, the peptide sequence CFLSRPTEKT or VD CFLSRPTEKT can conjugate with two dodecyl groups to produce a modified peptide capable of modulating connexin 43, "C12-C12-Cxn43 MP" (SEQ ID NO: 326). The resulting structure is shown in Figure 80. [ka] Figure 80. Structure of C12-C12-Cxn43 MP (SEQ ID NO: 326). R1 ​​and R2 may be hydrogen or alkyl groups. In some embodiments, R1=R2=n-dodecyl chain.

[0289] Anticonnexin modifier drugs In some embodiments, the gap junction modifier may be a small molecule that is an anticonnexin modifier drug. In some embodiments, the anticonnexin modifier drug may have the structure of formula I as described herein.

[0290] Panexin, panexin channel modulators, and other gap junction modulators Panexin and panexin channel modulators, as well as modulators comprising gap junction modulators or conexin modulator drugs, which may be used in place of or in addition to conexin modulators or panexin modulators in any of the compositions, kits, and methods described herein, are also useful in the methods of the present invention.

[0291] The modifiers of the present invention for any of the uses described herein may also include gap junction modifiers that can inhibit or block Cx26, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexins in the eye or blood vessels. The pharmaceutical compositions of the present invention for any of the uses described herein may also include, for example, panexin modifiers that can inhibit or block panexin channels.

[0292] Gap junction modifiers include connexin modifiers and gap junction drugs. Therefore, connexin modifiers are not necessarily gap junction drug modifiers, and not all gap junction drug modifiers are connexin modifiers. Tonavelsat, caravelsat, and the compound of formula I are connexin modifiers.

[0293] Gap junction drugs may include, for example, mycotoxins, glycyrrhetinic acid and glycyrrhetinic acid derivatives, phorbol esters, DDT, triphenylmethane, triphenylethane, long-chain alcohols, anesthetics, fatty acid amides, fenamic acid, kinins and kinin derivatives, 2-APB and 2-APB derivatives, polyamines, cyclodextrins, and peptides not discussed above.

[0294] In some embodiments, gap-binding drugs include carbamazepine, octanol, bisphenol-A, heptanol, 4-(2-butyl-6,7-dichloro-2-cyclopentyl-indan-1-on-5-yl)oxobutyrate (DCPIB), caravelsat, genistein, trans-resveratrol, carbenoxolone, HMG-CoA reductase inhibitor lovastatin, rotigaptide, metoprolol, forskolin, aigenin, tangeritin, halothane, ochratoxin A mycotoxin, patulin mycotoxin, okadaic acid, 18-alpha- and 18-beta-glycyrrhetinic acid, and 17-beta- Stradiol methyl ester, testosterone methyl ester, 12-O-tetradecanoylphorbol-13-acetate (TPA), phorbol ester, 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane, triphenylmethane, tris(4-chlorophenyl)methanol, (2-chlorophenyl)(diphenyl)methane, triphenylmethyl chloride, sodium tetraphenylborate, tamoxifen, clomiphene, enflurane, oleamide, anandamide, arylaminobenzoates such as meclofenamic acid and flufenamic acid, diflumic acid, 5-nitro-2-(3-phenylpropyl The following may be selected from six, seven, or eight glycopyranose units containing phenylpropylmino benzoic acid (NPPB), quinine, quinidine, mefloquine, PQ1 (primaquine derivative of mefloquine), 2-aminophenoxyborate (2-APB), spermidine, spermine, and cyclodextrin: Gap26 peptide (Val-Cys-Tyr-Asp-Lys-Ser-Phe-Pro-Ile-Ser-His-Val-Arg) and Gap27 peptide (Ser-Arg-Pro-Thr-Glu-Lys-Thr-Ile-Phe-Ile-Ile).

[0295] Any antisense molecule or shRNA that targets a region suitable for interfering with panexin expression is useful in the practice of the present invention. In some embodiments, the present invention addresses RNA interference (RNAi) with panexin. As with the expression of many other genes, panexin expression can be knocked down in vivo or in vitro by the use of RNAi. A representative class of molecules that can be used for RNAi is short hairpin RNA (shRNA). One such anti-panexin shRNA molecule can be constructed using a vector called pSuper-Ncad as follows:

[0296] Antisense and short hairpin RNAs targeting human panexin include those targeting specific sequences. Any antisense molecule or shRNA that targets a region suitable for interfering with panexin expression, e.g., Panx1, Panx2, or Panx3, is useful in the practice of the present invention. In some embodiments, the present invention addresses RNA interference (RNAi) with Panx1, Panx2, or Panx3. As with the expression of many other genes, Panx1, Panx2, or Panx3 expression can be knocked down in vivo or in vitro by the use of RNAi. A representative class of molecules that can be used for RNAi is short hairpin RNA (shRNA). Panx1 inhibitors may include probenecid, mefloquine, and carbenoxolone, or antipeptides.

[0297] Chemical delivery modification The modifiers comprising gap junctions, connexins, and / or panexins, as well as panexin channel modifiers, of the present invention can also be formulated as microparticles (microspheres, Mps) or nanoparticles (nanospheres, Nps), or both. Microparticle ocular drug delivery systems include nanoparticles (1-1,000 nm) and microparticles (1-1,000 μm), which are further classified into nanospheres and microspheres, as well as nanocapsules and microcapsules. In nanocapsules and microcapsules, drug particles or droplets are encapsulated within a polymer membrane. Microparticle systems offer advantages for intraocular delivery by injection, and their size and polymer composition clearly influence their biological behavior in vivo. Microspheres can remain in the vitreous humor for much longer periods than nanospheres; therefore, microparticles function like a storage area after intravitreal injection. Nanoparticles diffuse rapidly and migrate internally into ocular tissue, as well as into anterior and posterior segment cells.

[0298] The pharmaceutical composition is in the form of a combined preparation for co-administration, for example, two or more modifiers, for example, a gap junction, connexin, and / or panexin modifier, or panexin channel modifier, for example, 1 The invention is also provided as a mixture of one or more gap junctions, connexins, and / or panexin regulators, or panexin channel regulator polynucleotides, and one or more gap junctions, connexins, and / or panexin regulators, or panexin channel regulator peptides or peptide mimetic drugs.

[0299] The term “combined preparation” includes “kit of parts” or “product,” in the sense that the previously defined combination partners, whether in pharmaceutical form, bandage / matrix form, or both, can be administered independently or by the use of different predetermined combinations using different amounts of combination partners (a) and (b), i.e., simultaneously, separately, or sequentially. The kit of parts can then be administered, for example, simultaneously or, with respect to any part of the kit of parts, at different points in time and staggered over time by equal or different time intervals.

[0300] In one embodiment, a combined preparation is administered, and two or more separate modifier compositions are administered to a subject, the first composition comprising a therapeutically effective amount of a gap junction, connexin, and / or panexin modifier, e.g., an anticonnexin 43 polynucleotide, peptide, or peptide mimetic, or a hemichannel occlusion compound; the second composition comprising a therapeutically effective amount of a second modifier, e.g., a gap junction, connexin, and / or panexin modifier, or an ophthalmic agent, e.g., an anticonnexin 43 polynucleotide, peptide, or peptide mimetic, a hemichannel occlusion compound, and / or an ophthalmic agent. In another embodiment, a third composition comprising one or more anticonnexin polynucleotides, peptides, or peptide mimetics, hemichannel occlusion compounds, and / or ophthalmic agents is administered.

[0301] Pharmaceutical compositions are provided for single-dose, concomitant, concurrent, individual, sequential, or continuous administration. In one embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin modifier polynucleotides is administered in one or more desired doses. In another embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin modifiers is administered at approximately the same time as one or more peptides or peptide mimetic gap junctions, connexins, and / or panexin modifiers. When the two compositions are administered at different times, they may be administered within any time interval between any two of the listed periods, for example, 30 minutes, 1 hour, 1 day, 1 week, or 1 month. In one embodiment, for example, a composition comprising one or more anticonnexin polynucleotides is administered at approximately the same time as one or more anticonnexin peptides or peptide mimetics. In one embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin-modulating polynucleotides is administered within at least about 30 minutes of one or more gap junctions, connexins, and / or panexin-modulating peptides. In one embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin-modulating polynucleotides is administered within at least 1 hour of one or more gap junctions, connexins, and / or panexin-modulating peptides, or peptide mimetic drugs. In one embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin-modulating polynucleotides is administered within at least 12 hours of one or more gap junctions, connexins, and / or panexin-modulating peptides, or peptide mimetic drugs. In one embodiment, a composition comprising one or more gap junctions, connexins, and / or panexin-modulating polynucleotides is administered within at least 24 hours of one or more gap junctions, connexins, and / or panexin-modulating peptides, or peptide mimetic drugs.In another embodiment, anticonnexin polynucleotides and gap junctions, connexins, and / or panexin modulating peptides or peptide mimics are administered within approximately one hour, one day, or one week of each other. In other embodiments, one or more gap junctions, connexins are administered. The treatment includes the administration of a panexin modulatory polynucleotide, and / or one or more anticonnexin peptides or peptide mimetic agents (e.g., anticonnexin peptides or peptide mimetic agents containing connexin extracellular and / or connexin carboxy-terminal peptides useful for wound healing), and one or more gap junction closure compounds useful for wound healing, one or more hemichannel closure compounds useful for wound healing, and / or one or more connexin carboxy-terminal polypeptides useful for wound healing. The modulatory agent may be administered once daily, twice daily, three times daily, four times daily, or once a week, for example, four times a week, twice a week, or once a week. These may also be administered before sleep and before sleep.

[0302] Medication form, formulation, and administration Unless otherwise explicitly stated, all descriptions relating to drug administration apply to the modifiers of the present invention, including gap junction modifiers, panexin channel modifiers, conexin modifiers, and panexin modifiers.

[0303] The modifiers comprising the hemichannel, gap junction, and / or panexin modifier of the present invention may be administered, given, or formulated as described herein.

[0304] The modulator comprising the hemichannel, gap junction, and / or panexin modulator of the present invention may be administered to subjects in need of treatment who have ophthalmic neuropathy. Accordingly, the present invention provides a formulation in which panexin and / or connexin, e.g., connexin 43 or connexin 45, can be modulated and / or intercellular communication can be downregulated in a transient and site-specific manner.

[0305] Modifiers, including gap junctions, connexins, and / or panexins and panexin channel modifiers, may be present in the formulation in substantially isolated forms. It will be understood that the product may be mixed with a carrier or diluent that does not interfere with the intended purpose of the product and may still be considered substantially isolated. The product of the present invention may also be in substantially generated form, in which case the product generally contains about 80%, 85%, or 90%, for example, at least about 88%, at least about 90%, 95%, or 98%, or at least about 99%, of, for example, polynucleotides (or other connexin modifiers such as connexin 43 modifiers), or the dry mass of the preparation.

[0306] In one embodiment, the gap junction, connexin, and / or modifier is a modified or unmodified connexin 43 or 45 antisense polynucleotide or oligonucleotide, a modified or unmodified connexin peptide, or an anticonnexin 43 or 45 peptide mimic. In some embodiments, the connexin modifier may block or reduce hemichannel opening. In some embodiments, the modified or unmodified connexin peptide or peptide mimic is administered to block hemichannel or gap junction function and / or to provide a control effect that reduces connexin expression or hemichannel or gap junction formation, for example, by downregulating connexin protein expression. In some embodiments, the modified or unmodified connexin peptide or peptide mimic is administered before the administration of a modified or unmodified anticonnexin polynucleotide or oligonucleotide to block hemichannel or gap junction function before downregulating connexin protein expression by the polynucleotide or oligonucleotide. In some embodiments, the connexin modifier is a connexin 43 modifier.

[0307] The pharmaceutical formulation of the present invention may further comprise one or more pharmaceutically acceptable excipients suitable for delivering a regulator, including a gap junction, connexin, and / or panexin, and a panexin channel modulator, to the eye. In some embodiments, a panexin modulator or connexin modulator (e.g., a connexin 43 modulator or connexin) to the target eye. Administration of a gap junction modifier (preferably a connexin modifier) ​​provides a therapeutically effective amount of the connexin modifier or panexin modifier to the eye or a specific compartment of the eye. In some cases, the gap junction, connexin, and / or panexin modifier may be administered topically, corneal, intravitreal, subconjunctival, or periorbital. In some embodiments, administration may be intraperitoneal or parenteral, provided that a therapeutically effective dose is in contact with the eye. In some embodiments of the method of the present invention, the gap junction, connexin, and / or panexin modifier may be administered to the eye by injection, for example, by intraocular injection, intravitreal injection, or by periorbital administration routes including subconjunctival, retrobulbar, peribulbar, and posterior sub-Tenon's capsule injections. In some embodiments, the gap junction, connexin, and / or panexin modifier may be provided to the trabecular network or injected directly into or around the trabecular network. In some embodiments, subconjunctival administration can provide sustained delivery while minimizing the frequency of administration. In some embodiments, subconjunctival administration can increase the bioavailability of hydrophilic drugs because it does not require permeation through the conjunctival epithelium. In some embodiments, microneedles, needles, ionophoresis devices, or implants may be used for the administration of connexin modifiers or panexin modifiers. The implants may be soluble disc materials, such as those described in S. Pflugfelder et al., ACS Nano, 9(2), pp1749-1758 (2015). The modifiers, such as the gap junctions, connexins, and / or panexin modifiers or panexin channel modifiers of the present invention, may be administered to or around the trabecular network and / or ciliary body, so that the gap junctions, connexins, and / or panexin modifiers or panexin channel modifiers come into contact with the trabecular network and / or ciliary body, respectively. Modulators, such as gap junctions, connexins, and / or panexins and / or panexin channel modulators, may be administered once, twice or more times. Connexin modulators may be, for example, connexin 43 modulators or connexin 45 modulators, preferably connexin 43 modulators.In some embodiments, microneedles may be used to deliver any of the compositions of the present invention to the choroid.

[0308] For example, in some embodiments, a modifier such as a connexin 43 modifier may be administered to a subject, for example, the eye of the subject, to provide a therapeutically effective amount of the modifier to the eye or a specific compartment of the eye. In some cases, the modifier, for example, connexin 43 or panexin 1 or a panexin 1 channel modifier, may be administered topically, corneal, intravitreous, subconjunctival, or periorbital. In some embodiments, administration may be intraperitoneal. In some embodiments, a microneedle, needle, ionophoresis device, or implant may be used for the administration of the modifier, for example, a connexin 43 modifier. The modifier, for example, the connexin 43 modifier of the present invention, may also be administered to the trabecular retina or ciliary body. In some embodiments, the modifier, for example, the connexin 43 modifier of the present invention, may be administered intraventricular and / or intrathecal, and / or epidural and / or subdural and / or via an epidural route.

[0309] Modulators, such as gap junction channel modulators such as peptide 5 and / or analogs or prodrugs thereof, compounds of formula I, such as tonaversat, and analogs or prodrugs of any of the aforementioned compounds, and / or panexin modulators or panexin channel modulators, such as compounds of formula VI, such as probenecid and analogs or prodrugs thereof, and / or synthetic mimic peptide blockers of panexin 1, such as 10Panx1 or analogs or prodrugs thereof, may be administered alone or in combination with one or more additional components, and may be formulated into pharmaceutical compositions comprising one or more pharmaceutically acceptable excipients, diluents, and / or carriers.

[0310] "Pharmacologically acceptable diluents, carriers, and / or excipients" are compounds of formula I, for example, While tonaversat and any analogue of the aforementioned compounds may be co-administered, the compounds of formula I, e.g., tonaversat and any analogue of the aforementioned compounds, are intended to contain substances that are generally safe, non-toxic, and useful in the preparation of pharmaceutical compositions that are neither biological nor undesirable. Pharmaceutically acceptable diluents, carriers, and / or excipients include those suitable for veterinary and human pharmaceutical use. Suitable carriers and / or excipients will be readily apparent to those skilled in the art, considering the properties of the compounds of formula I, e.g., tonaversat and any analogue of the aforementioned compounds. However, examples of diluents, carriers, and / or excipients include solutions, solvents, dispersions, retarders, polymer and lipid activators, and emulsions. As further examples, suitable liquid carriers, especially for injectable solutions, include water, physiological saline solution, and dextrose solution. Isotonic solutions are preferred for intravenous, intraspinal, and intracapsular administration, while vehicles such as liposomes are particularly suitable for administering agonists.

[0311] The composition may take the form of any standard known dosage form, including tablets, pills, capsules, semi-solids, powders, sustained-release formulations, solutions, suspensions, elixirs, aerosols, liquids for injection, gels, creams, transdermal delivery devices (e.g., transdermal patches), implants such as eye implants, or any other suitable composition. Those skilled in the art will readily understand the most appropriate dosage form, considering the condition being treated and the properties of the active ingredients used, without any unnecessary experimentation. Gap junction channel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonaversat and analogs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and its analogs, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 It should be understood that Panx1 or one or more of its analogues may be formulated into a single composition. In certain embodiments, preferred forms of administration include injectable solutions and oral formulations.

[0312] The compositions of the present invention, taking into consideration the drug form and mode of administration, include modifiers, such as gap junction channel modifiers such as peptide 5 and / or analogs thereof, compounds of formula I, such as tonaversat and analogs of any of the aforementioned compounds, and / or panexin modifiers, such as probenecid and analogs thereof, and / or synthetic mimic peptide blockers of panexin 1, for example, 10 It may contain any appropriate level of Panx1 or its analogues. However, for example, the compositions used in the present invention may contain, depending on the method of administration, approximately 0.1% to approximately 99% by weight, preferably approximately 1% to approximately 60% by weight of a compound of formula I, such as tonaversat and any analogue of the aforementioned compounds.

[0313] In addition to standard diluents, carriers, and / or excipients, compositions according to the present invention include, for example, gap junction channel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, such as tonaversat and analogs of any of the aforementioned compounds, and / or panexin modulators, such as probenecid and analogs thereof, and / or synthetic mimic peptide blockers of panexin 1, for example, 10 Panx1 or its analogues may be formulated with or in conjunction with one or more additional components to enhance their activity or bioavailability, protect their integrity, help extend their half-life or shelf life, enable slow release after administration to a subject, or provide other desirable benefits. Examples of slow-release vehicles include macroma, poly(ethylene glycol), hyaluronic acid, poly(vinylpyrrolidone), or hydrogels. Further examples may include preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavoring agents, coating agents, buffers, etc. Those skilled in the art who relate to the present invention will readily identify further additives that may be desirable for specific purposes.

[0314] Compounds of formula I, such as tonaversat and any analogue of the aforementioned compounds, may be administered by a sustained-release system. Suitable examples of sustained-release compositions include semipermeable polymer matrices in the form of molded articles, such as films or microcapsules. Sustained-release matrices include polylactide (U.S. Patent No. 3,773,919, European Patent No. 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamic acid, poly(2-hydroxyethyl methacrylate), ethylene vinyl acetate, or poly-D-(-)-3-hydroxybutyric acid (European Patent No. 133,988). Sustained-release compositions also include liposome-encapsulated compounds. Liposomes containing compounds of formula I, such as tonavelsat and analogs of any of the aforementioned compounds, may be prepared by known methods, including, for example, those described in German Patent No. 3,218,121, European Patent No. 52,322, 36,676, 88,046, 143,949, 142,641, Japanese Patent Application No. 83-118008, U.S. Patents No. 4,485,045 and 4,544,545, and European Patent No. 102,324. Typically, the liposomes are small (or about 200-800 angstroms) monolayers with a lipid content of more than about 30 mole percent cholesterol, and the selected proportions are adjusted for the most effective therapy. Slow-release delivery using, for example, PGLA nanoparticles or microparticles, or in-situ ion-activated gelation systems may also be used.

[0315] Furthermore, it is intended that pharmaceutical compositions according to the present invention may be formulated with additional active ingredients or agents that may offer further benefits to the subject in therapeutic or specific cases. Those skilled in the art to whom the present invention relates will readily understand, in consideration of the description of the invention herein and the nature of the disorder being treated, suitable additional active ingredients.

[0316] This composition is, for example, Gennaro AR: Remington: The Science and Practice of Pharmacy, 20th The formulation may be carried out according to standard techniques that can be found in standard references such as Lippincott, Williams & Wilkins, 2000. However, as further examples, the information provided in U.S. Patent No. 2013 / 0281524 or No. 5948811 may be used.

[0317] In certain embodiments, the present invention provides a combination product comprising (a) a compound of formula I, for example, tonaversat and any analogue of the aforementioned compounds, and (b) one or more additional activators, wherein components (a) and (b) are adapted for simultaneous or sequential administration.

[0318] In certain embodiments of the present invention, the combination product according to the present invention is used in such a manner that at least one of the components is administered while the other components still affect the subject being treated.

[0319] Gap junction channel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, for example, tonaversat and analogs of any of the aforementioned compounds, and / or panexin modulators, for example, probenecid and its analogs, and / or synthetic mimic peptide blockers of panexin 1, for example, 10 Panx1 or an analogue thereof, along with one or more additional activators, may be formulated in a form suitable for direct administration to a subject (e.g., as an agonist or pharmaceutical composition). Alternatively, the combination product may comprise one or more pharmaceutical carrier compositions in one or more separate containers, and the agonist(s) are mixed with one or more pharmaceutical carrier compositions before administration.

[0320] The compounds of formula I, for example, tonaversat and any analogue of the aforementioned compounds, as well as one or more additional activators, may be placed in the same or one or more different containers and administered separately, or they may be mixed together in any combination and administered simultaneously.

[0321] The combined product may also include additional agents and compositions in further separate containers, which may be necessary for specific applications.

[0322] Any container suitable for storing and / or administering the pharmaceutical composition may be used in the combination product of the present invention. Suitable containers will be understood by those skilled in the art. Examples of such containers include vials and syringes. The containers may preferably be sterilized and sealed.

[0323] Such combination products may be manufactured according to the methods and guidelines provided herein, as well as methods and guidelines known in the art.

[0324] Combination products used in the methods described herein are also provided.

[0325] The pharmaceutical compositions of the present invention include, for example, ocular delivery forms and formulations. Such delivery forms and formulations include those for the treatment of subjects disclosed herein. The pharmaceutical formulations of the present invention may further include one or more pharmaceutically acceptable excipients. The pharmaceutically acceptable excipients for ocular administration may also be ophthalmologically acceptable excipients. In some embodiments, the formulations may provide sustained delivery of a connexin modulator and / or ocular therapeutic agent to a selected eye or compartment of the eye. In some embodiments, the formulations may provide high ocular pharmacobioavailability, may be safe and non-toxic, and / or have little to no systemic side effects or site-of-administration complications. Polynucleotide formulations, which are examples for use in the methods of the present invention, have ease of local delivery, ease of administration, and a “no side effects” profile.

[0326] In some embodiments, the pharmaceutical formulation of the present invention may contain any modifier, such as a gap junction modifier and / or a connexin modifier as described herein, or a panexin modifier, such as a modified or unmodified connexin 43 antisense oligonucleotide or polynucleotide, or a modified or unmodified connexin 43 peptide or peptide mimic. In some embodiments, the connexin 43 antisense oligonucleotide included in the formulation may be an unmodified connexin 43 antisense oligodeoxynucleotide or a modified connexin 43 antisense oligodeoxynucleotide. In some embodiments, the pharmaceutical composition may or may not contain any of the above.

[0327] In some embodiments, administration of modifiers, e.g., connexin modifiers, panexin modifiers, and / or gap junction modifiers (e.g., connexin 43 modifiers or Cx45, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye) to the target eye provides a therapeutically effective amount of the connexin modifier or panexin modifier to the eye or a specific compartment of the eye. The connexin modifier may preferably be a connexin 43 modifier. In some cases, the panexin modifier or connexin modifier may be administered topically, intravitreally, subconjunctivally, or periorbitally. In some embodiments, administration may be intraperitoneal or parenterally, provided that a therapeutically effective dose comes into contact with the eye. In some embodiments of the method of the present invention, the connexin modifier or panexin modifier is administered by injection, for example, by intraocular injection, intravitreous injection, or subconjunctival, retrobulbar, The connexin modifier may be administered to the eye by periocular administration routes, including periocular and sub-posterior Tenon's capsule injections. In some embodiments, the connexin modifier may be injected directly into or around the trabecular meshwork. In some embodiments, subconjunctival administration may provide sustained delivery while minimizing the frequency of administration. In some embodiments, subconjunctival administration may increase the bioavailability of the hydrophilic drug because it does not need to permeate the conjunctival epithelium. In some embodiments, microneedles, needles, or implants may be used for the administration of the connexin modifier. The connexin modifier of the present invention may also be administered to the ciliary body. The connexin modifier may be administered once or more times. The connexin modifier may be, for example, any of the connexin modifiers described herein. In some embodiments, the connexin or panexin modifier may or may not contain any of the aforementioned.

[0328] The connexin and panexin channel modulators of the present invention may also be administered to the trabecular network or ciliary body.

[0329] The connexin and panexin channel modulators of the present invention may also be administered to the trabecular network or ciliary body.

[0330] In some embodiments, gap junctions, connexins, hemichannels, and / or panexin modifiers, such as connexin 43 modifiers and panexin 1 modifiers, may be formulated to provide controlled and / or compartmentalized release to an intraocular administration site. In some embodiments of the present invention, the formulation may be immediate, long-acting, or sustained-release dosage form. In some embodiments, the dosage form may include both immediate-release dosage forms and long-acting and / or sustained-release dosage forms. In some embodiments, both immediate and sustained and / or long-acting release of connexin or panexin modifiers can be obtained by combining modified or unmodified connexin or panexin antisense oligonucleotides or polynucleotides with modified or unmodified peptides or peptide mimics of the immediate-release form. In some embodiments of the present invention, the connexin modifier is, for example, a connexin 43 modifier or other connexin modifiers of the present disclosure. In some embodiments of the present invention, the dosage form may be an ocular implant, such as a biodegradable or non-biodegradable implant.

[0331] In some embodiments of the present invention, caderin modifiers or gap junction modifiers and / or connexin modifiers, such as connexin 43 modifiers, may be formulated for compartmentalized release of the modifier, for example, by adjusting the particle size or coating. For example, in some embodiments, particle formulations of caderin modifiers or connexin modifiers, such as connexin 43 modifiers, may be administered for use in the methods of the present invention. In some embodiments, the ophthalmic drug delivery system containing particles may include nanoparticles having an average diameter of less than 1,000 nm, for example, 1 to 1,000 nm, and / or microparticles having an average diameter of 1 to 1,000 μm. The nanoparticles or microparticles may be, for example, nanospheres or microspheres in which the connexin modifier is encapsulated within a polymer coating, or encapsulated nanocapsules and microcapsules. The particle formulation may also include liposomes. In some embodiments, the connexin modifier may or may not include connexin 45, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, or Cx57 or any other connexin modifier in the eye or blood vessels.

[0332] In some embodiments, gap junction modifiers and / or connexin modifiers or panexin modifiers may be formulated for peripheral administration, for example, targeted delivery to the choroid and / or retina after intravenous or intraperitoneal administration. The connexin regulator may be, for example, a connexin 43 regulator or other connexin regulators of the present disclosure.

[0333] In some embodiments, formulations for targeted delivery to the choroid and / or retina may include the administration of gap junction modifier and / or connexin modifier or panexin modifier-injected particles that indicate the target portion of the eye on the surface of the particles.

[0334] The present invention relates to methods for modulating the function of gap junction channels and / or hemichannels, and for treating various disorders. This includes. It should be understood that such methods may be carried out in vivo, in vitro, and / or in vitro as appropriate. In certain embodiments, the method may be carried out for experimental and / or non-experimental purposes. In certain embodiments, such a method may be carried out in vitro or in vitro on one or more cells or a sample containing one or more cells, a gap junction channel modulator such as peptide 5 and / or its analogues, a compound of formula I, e.g., tonaversat, and an analogue of any of the aforementioned compounds, and / or a panexin modulator, e.g., probenecid and its analogues, and / or a synthetic mimic peptide blocker of panexin 1, e.g., 10 The method may include the step of administering Panx1 or an analog thereof. In other embodiments, such a method may involve administering gap junction channel modulators and / or analogs thereof, such as peptide 5, compounds of formula I, e.g., tonaversat and analogs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and its analogs, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 The step may include administering Panx1 or an analogue thereof.

[0335] The method of the present invention involves modifiers, such as gap junction channel modifiers such as peptide 5 and / or analogs thereof, compounds of formula I, such as tonaversat and analogs of any of the aforementioned compounds, and / or panexin modifiers, such as probenecid and analogs thereof, and / or synthetic mimic peptide blockers of panexin 1, for example, 10 This includes administering Panx1 or its analogues alone, or in combination with one or more other agents or therapies as desired (e.g., activators).

[0336] Modulators, for example, gap junction channel modifiers such as peptide 5 and / or analogs thereof, compounds of formula I, for example, tonaversat and analogs of any of the aforementioned compounds, and / or panexin modifiers, for example, probenecid and analogs thereof, and / or synthetic mimic peptide blockers of panexin 1, for example, 10 Administration of Panx1 or its analogs to a subject may occur by any means capable of delivering the agonist to a target site within the subject's body. Examples include gap junction channel modulators and / or analogs thereof such as peptide 5, compounds of formula I, e.g., tonaversat and analogs of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and its analogs, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 Panx1 or its analogues may be administered orally, topically, systemically (e.g., intravenously, intra-arterially, intraperitoneally, percutaneously, intranasally, or via suppositories), parenterally (e.g., intramuscularly, subcutaneously, or intravenously or intra-arterially by injection), by implantation, and by infusion through a device such as an osmotic pump, or by a percutaneous patch, etc. Those skilled in the art may identify other suitable routes of administration. An example of such a route of administration is found in Binghe, W. and B. Wang (2005). Drug delivery: principles and applications, Binghe Wang, Teruna Siahaan, Richard Soltero, Hoboken, NJ Wiley-Interscience, c2005, is also outlined. In one embodiment, gap junction channel modulators such as peptide 5 and / or analogs thereof, compounds of formula I, for example, Tonabelsat, and any analogue of the aforementioned compounds, and / or panexin modifiers, such as probenecid and its analogues, and / or synthetic mimic peptide blockers of panexin 1, such as 10Panx1 or its analogues are administered systemically. In another embodiment, gap junction channel modulators such as peptide 5 and / or its analogues, compounds of formula I, e.g., tonaversat and analogues of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and its analogues, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 Panx1 or its analogues are administered orally. In another embodiment, gap junction channel modulators such as peptide 5 and / or its analogues, compounds of formula I, e.g., tonaversat and analogues of any of the aforementioned compounds, and / or panexin modulators, e.g., probenecid and its analogues, and / or synthetic mimic peptide blockers of panexin 1, e.g., 10 Panx1 or its analogues are administered topically.

[0337] In another embodiment, the compound of formula I, for example, tonaversat and any analog of the aforementioned compounds, is administered systemically by intravenous, intra-arterial, or intraperitoneal administration, etc., so that the final circulating concentration is approximately 0.001 to approximately 150 micromoles or more, with a maximum of 200, 300, 400, 500, 600, 700, 800, 900, or 1000 micromoles.The final circulation concentrations are 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2. 9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 5...

Claims

1. A method for treating a subject with glaucoma, DME, ocular fibrosis, retinal perfusion disorder, or ocular hypoxia, comprising administering a therapeutically effective amount of a gap junction modifier, connexin modifier, panexin modifier, or panexin channel modifier to the eye of the subject.

2. The method according to claim 1, wherein the glaucoma is characterized by glaucomatous ophthalmic neuropathy and / or intraocular pressure-related neuropathy.

3. The method according to claim 1 or 2, wherein the connexin modifier is a connexin 43 modifier.

4. The method according to claim 3, wherein the glaucoma is an intraocular pressure-related neuropathy.

5. The method according to claim 4, wherein the glaucoma is open-angle glaucoma or closed-angle glaucoma.

6. The method according to claim 5, wherein the loss of retinal ganglion cells is treated.

7. The method according to claim 1, wherein inflammation in the inner retina is reduced.

8. The method according to claim 1, wherein the flow through the small column network is increased.

9. The method according to claim 1, wherein the gap junction modifier, connexin modifier, or panexin modifier modifier is administered in combination with one or more of the following: a Rho kinase inhibitor, a prostaglandin, a prostaglandin analog, an anihydrase (anyhydrogen carbonate) inhibitor, an alpha-2 agonist, a beta-blocker, an F2α-prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, and a glutamate release inhibitor.

10. The method according to claim 9, wherein the gap junction regulator is a connexin regulator administered in combination with a Rho kinase inhibitor.

11. The method according to claim 1, for the treatment of ocular hypoxia, which reduces choroiditis.

12. The method according to claim 11, wherein the connexin modifier is a connexin 43 modifier.

13. The method according to claim 11, wherein the connexin modifier is a connexin 43 modifier, and the connexin 43 modifier is administered in combination with an eye treatment drug.

14. The method according to claim 11, wherein choroidal capillary endothelial cell loss and / or choroidal capillary detachment is reduced.

15. The method according to claim 11, which reduces choroiditis.

16. The method according to claim 12, wherein choroidal capillary endothelial cell loss is slowed or prevented.

17. A method for treating a subject with retinal artery occlusion or central retinal vein occlusion, comprising administering a therapeutically effective amount of a connexin modifier or panexin modifier to the eye of the subject.

18. The method according to any one of claims 1, 3, 11, or 17, wherein the gap junction modifier, connexin modifier, or panexin modifier is selected from the group consisting of antisense oligonucleotides, antisense polynucleotides, compounds of formula I, and compounds of formula VI.

19. The method according to claim 18, wherein at least one nucleotide among the oligonucleotide or polynucleotide is modified.

20. The method according to claim 18, wherein at least one nucleotide among the oligonucleotide or polynucleotide comprises at least one conformationally tensioned nucleotide, at least one modified nucleoside bond, at least one modified sugar moiety, and / or at least one modified nucleic acid base.

21. The method according to claim 19, wherein the conformationally stressed nucleotide is a locked nucleotide (LNA).

22. The method according to claim 19, wherein the conformationally tensioned nucleotide is a cross-linked nucleic acid (BNA). (BNA).

23. The aforementioned loctonucleotide is of the following type: 2′-O-CH ２ -4' (oxy-LNA), 2'-CH ２ -CH ２ -4′(methylene-LNA), 2′-NH-CH ２ -4′(amino-LNA), 2′-N(CH ３ ) - CH ２ -4′(methylamino-LNA),2′-S-CH ２ -4′ (thio-LNA), and 2′-Se-CH ２ The method according to claim 21, selected from one of -4' (seleno-LNA).

24. The method according to claim 19, wherein the antisense compound is an antisense oligonucleotide comprising a native nucleic acid base and an unmodified nucleoside bond.

25. The method according to claim 18, wherein the antisense compound is an antisense oligonucleotide comprising at least one modified internucleoside bond.

26. The method according to claim 25, wherein the modified nucleoside bond is a phosphorothioate bond.

27. The method according to claim 19, wherein the antisense compound is an oligonucleotide comprising at least one modified sugar moiety or at least one modified nucleic acid base.

28. The method according to claim 18, wherein the antisense compound comprises an oligonucleotide sequence selected from SEQ ID NOs: 1 to 16, and the oligonucleotide is 40 nucleotides or less in length.

29. The method according to claim 18, wherein the antisense compound targets at least about eight nucleotides of a nucleic acid molecule encoding a connexin having a sequence selected from Sequence ID No.

17.

30. The method according to any one of claims 1, 3, 11, or 18-29, wherein the antisense compound is an antisense oligonucleotide having a length of about 15 to about 35 nucleotides, or about 15 to about 40 nucleotides.

31. The method according to claim 18, wherein the antisense compound comprises a nucleic acid base sequence having a length of 40 nucleotides or less, selected from a region of SEQ ID NOs: 1 to 16 or SEQ ID NO:

17.

32. The method according to any one of claims 1, 3, 11, 13, 17, or 18, wherein the connexin modulator is administered locally, cornea, intraocular, intravitreous, subconjunctival, or periorbitally.

33. The method according to claim 32, wherein the connexin modulator is administered by intraocular injection or intravitreous injection.

34. The method according to claim 32 or 33, wherein the antisense compound is administered in a single dose.

35. The method according to any one of claims 1 to 34, wherein the subject is a human.

36. The method according to claim 28, wherein the antisense compound has at least about 80 percent, at least about 90 percent, at least about 95 percent, or at least about 97 percent homology to a polynucleotide having a sequence selected from a region of SEQ ID NOs: 1 to 16 or SEQ ID NO:

17.

37. The method according to claim 13, wherein the ophthalmic therapeutic agent is selected from anti-VEGF modifiers, mTOR inhibitors, complement modifiers, PDGF modifiers such as PDGF antagonists, S1P production inhibitors, squalamine, PEDF-producing substances, tubulin binders, integrin inhibitors, and any mixture thereof.

38. The method according to claim 37, wherein the ophthalmic therapeutic agent is selected from one or more of the following ophthalmic therapeutic agents: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, protein ciliary neurotrophic factor, vascular endothelial growth factor modifiers, and hypoxia-inducible factor 1-alpha modifiers, brimonidine, timolol, travoprost, dorzolamide, an anihydrase carbonate inhibitor, a beta-blocker, a prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, or a glutamate-releasing inhibitor, a combination of an alpha-2 agonist and a beta-blocker, a combination of an alpha-2 agonist and an anihydrase carbonate inhibitor, and any mixture thereof.

39. The method according to claim 38, wherein choroidal capillary plate shedding is reduced compared to subjects treated with monotherapy using the ophthalmic drug alone.

40. The method according to claim 39, wherein the connexin 43 modifier is an anticonnexin 43 antisense oligonucleotide comprising a nucleotide sequence of 40 nucleotides or less in length, selected from a region of SEQ ID NOs: 1 to 16 or SEQ ID NO:

17.

41. The method according to claim 40, wherein the anticonnexin 43 antisense oligonucleotide further comprises a native nucleotide and an unmodified nucleoside bond.

42. The method according to claim 40, wherein the anticonnexin 43 antisense oligonucleotide is modified.

43. The modified oligonucleotide has at least one modified nucleoside bond, and at least The method according to claim 42, further comprising one modified sugar moiety, or at least one modified nucleic acid base, or any combination thereof.

44. The method according to claim 1, 3, 11, 13, 17, or 38, wherein the connexin regulator is a compound according to formula I.

45. The method according to claim 1, 3, 11, 13, 17, or 38, wherein the connexin modifier is a compound according to formula II.

46. The method according to claim 1, 3, 11, 13, 17, or 38, wherein the connexin modifier is tonavelsat.

47. The method according to any one of claims 1, 3, 11, 13, 17, or 38, wherein the connexin 43 modifier is a peptide containing SEQ ID NO: 173 (SRPTEKT).

48. The method according to any one of claims 1, 3, 11, 13, 17, 38, and 47, wherein the connexin 43 peptide further comprises SEQ ID NO: 168 (VDCFLSRPTEKT).

49. The method according to claim 48, wherein the connexin 43 peptide is modified.

50. The method according to claim 49, wherein the connexin 43 peptide modification comprises two C12 alkyl groups, SEQ ID NO: 326 (C12-C12-VDCFLSRRPTEKT).

51. The method according to any one of claims 38 to 50, wherein the connexin modifier is administered locally, cornea, locally, intraocularly, intravitreally, subconjunctivally, by ion electrophoresis, or periocularly.

52. The method according to claim 51, wherein the connexin modulator is administered by intraocular injection or intravitreous injection.

53. The method according to claim 51 or 52, wherein the antisense compound is administered in a single dose.

54. The method according to claim 51 or 52, wherein the antisense compound is administered two or more times.

55. The method according to claim 51 or 52, wherein the antisense compound is administered before, together with, or after the administration of the ophthalmic drug.

56. The method according to claim 51 or 52, wherein the antisense compound is formulated as an ophthalmic aqueous formulation, microspheres, nanospheres, or implants.

57. The method according to claim 56, wherein the microspheres or nanospheres comprise poly(D,L-lactide-co-glycolic acid).

58. The method according to claim 56, wherein the nanospheres have an average particle size of 100 to 140 nm.

59. The method according to claim 56, wherein the microspheres have an average particle size of 6 to 12 microns.

60. The method according to claim 56, wherein the microsphere, nanosphere, or implant has an encapsulation efficiency of more than 50%.

61. The method according to claim 60, wherein the microsphere, nanosphere, or implant has an encapsulation efficiency of more than 65%.

62. The method according to claim 56, wherein the microsphere, nanosphere, or implant contains a load of more than 1.5%.

63. The method according to claim 62, wherein the microspheres, nanospheres, or implants include a load of more than 1.7%.

64. The method according to claim 51, wherein the connexin regulator is formulated for parenteral administration.

65. The method according to claim 64, wherein the connexin modifier is formulated for intravenous or intraperitoneal administration.

66. AMD, clinical geographic atrophy, chronic macular ischemia, ocular fibrosis, idiopathic polypoidal choroidal vasculopathy (IPC), diabetic maculopathy, diabetic retinopathy, hypertensive retinopathy, inflammatory CNV, central serous chorioretinopathy (CSR), macular telangiectasia, pattern dystrophy, subretinal / subPRD neovascularization, serous detachment of retinal neurosensory epithelium, RPE detachment, hemorrhage (including rupture hemorrhage into the vitreous humor, subretinal pigment epithelium, subretinal, intraretinal, or preretinal), scarring / glial tissue or fibrin-like deposition on the retina, intraretinal, subretinal, or subpigment epithelium, retinal lines A method for treating conditions such as vascular disease, retinal hemangioma proliferation and retinochoroidal anastomosis, choroidal neovascularization (CNV), cystic macular disorder, retinal thickening, retinal scarring, uveitis (including posterior uveitis), scleritis, episcleritis viral retinitis (including cytomegalovirus (CMV) retinitis), retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, sclerosis of the choroidal capillary plate, dry eye, neuropathic eye disorder, trauma-induced decrease in intraocular pressure, or epithelial basement membrane dystrophy, comprising administering a therapeutically effective amount of a connexin modifier.

67. The method according to claim 66, wherein the connexin regulator is selected from the compound of formula I, the compound of formula II, tonaversat, peptides, and modified peptides.

68. The method according to claim 67, wherein the peptide is a peptide containing SEQ ID NO: 173 (SRPTEKT).

69. The method according to claim 68, wherein the peptide further comprises the peptide SEQ ID NO: 168 (VDCFLSRPTEKT).

70. The method according to claim 67, wherein the modified peptide is SEQ ID NO: 326 (C12-C12-VDCFLSRRPTEKT).

71. A pharmaceutical composition comprising a combination of anticonnexin 43 compounds, wherein the compounds include connexin-43 that modifies a peptide, The following compounds: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, protein ciliary neurotrophic factor, Rho kinase, and adenosine mimics, vascular endothelial growth factor modifiers, and hypoxia-inducible factor 1-alpha modifiers, brimonidine, timolol, A pharmaceutical composition comprising travoprost, dorzolamide, an anyhydrase carbonate inhibitor, a beta-blocker, a prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, or a glutamate-releasing inhibitor, a combination of an alpha-2 agonist and a beta-blocker, a combination of an alpha-2 agonist and an anyhydrase carbonate inhibitor, and a compound selected from any mixture thereof.

72. A pharmaceutical composition comprising a combination of anticonnexin 43 antisense compounds, wherein the antisense compound comprises the following selected components: a nucleoside bond which is a phosphorothioate bond, and a modified sugar moiety which is a conformationally strained sugar, A pharmaceutical composition comprising one or more antisense oligonucleotides, including the following compounds: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, protein ciliary neurotrophic factor, vascular endothelial growth factor modifiers, and hypoxia-inducible factor 1-alpha modifiers, and compounds selected from any mixture thereof.

73. The composition according to claim 72, wherein the antisense oligonucleotide comprises a nucleic acid base sequence having a length of 40 nucleotides or less, selected from a region of SEQ ID NOs: 1 to 16 or SEQ ID NO: 17.

Images