Translation enhancer, DNA, method for producing tomatoes, and tomato transgenic bodies.

JP2026144685APending Publication Date: 2026-09-09NAT AGRI & FOOD RES ORG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025032118
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2026-09-09

AI Technical Summary

Benefits of technology

【0016】 本発明によれば、トマト由来の翻訳エンハンサーに関する新規な技術を提供することができる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026144685000001_ABST
    Figure 2026144685000001_ABST
Patent Text Reader

Abstract

This provides a novel technology related to tomato-derived sequences that promote the expression of structural genes. [Solution] A translation enhancer is provided, which is DNA that promotes translation after transcription of a gene, and comprises a base sequence derived from the genome of a tomato or a base sequence to which a mutation such as deletion, substitution, addition or insertion of a base has been obtained.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a translation enhancer, a DNA, a method for producing tomato, and a tomato transformant. [Background Art]

[0002] Conventionally, DNAs that promote expression of structural genes, such as translation enhancers having a function of promoting translation into proteins after transcription into mRNA, are known.

[0003] For example, a translation enhancer is contained in the upstream region of a structural gene on the genome, and is contained in the 5'UTR (5'-untranslated region) located 5' to the translation initiation site of mRNA (i.e., the codon encoding the initiation methionine) even after transcription into mRNA.

[0004] For example, Patent Document 1 discloses a translation enhancer discovered from the 5'UTR of rice OsMAc1, OsMAc2 and OsMAc3 genes. [Prior Art Documents] [Patent Documents]

[0005] [Patent Document 1] Republished WO2015 / 174414 [Summary of the Invention] [Problem to be Solved by the Invention]

[0006] However, in each plant species, it is considered that there are still many unknown DNAs having the activity of promoting expression of structural genes.

[0007] The present invention has been made in view of such circumstances, and an object thereof is to provide a novel technique relating to a tomato-derived sequence that promotes expression of a structural gene. [Means for Solving the Problem]

[0008] As a result of diligent research to achieve the above objective, the inventors discovered that the sequences contained in the 5'UTR region of the tomato SlADH2 gene and the sequences contained in the 5'UTR region of the PSY1 (phytoenzyme synthase 1) gene each have the function of promoting translation from mRNA to protein, and thus completed the present invention. In other words, one aspect of the present invention that solves the above problems includes the following aspects.

[0009] [1] A translation enhancer which is DNA that promotes translation after transcription of a gene, comprising a base sequence derived from the genome of a tomato or a base sequence obtained by modifying the said base sequence by deletion, substitution, addition or insertion of a base.

[0010] [2] A translation enhancer according to [1], comprising any of the following base sequences (1) to (20), and having translation enhancer activity. (1) The base sequence shown in Sequence ID No. 1 (2) The base sequence shown in Sequence ID No. 2 (3) The base sequence shown in Sequence ID No. 3 (4) The base sequence shown in Sequence ID No. 4 (5) The base sequence shown in Sequence ID No. 5 (6) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 1 (7) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 2 (8) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 3 (9) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 4 (10) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 5 (11) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 1 (12) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 2. (13) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 3 (14) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 4. (15) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 5. (16) A sequence of 50 to 93 consecutive bases within the base sequence shown in Sequence ID No. 1 (17) The base sequence shown in Sequence ID No. 6 (18) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 6 (19) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 6 (20) A sequence of 50 to 86 consecutive bases within the base sequence shown in Sequence ID No. 6

[0011] DNA containing the translation enhancer described in [3][1] or [2].

[0012] [4] The DNA according to [3], wherein at least a portion of any structural gene possessed by the tomato (scientific name: Solanum lycopersicum) is included at the 3' end of the translational enhancer, and at least a portion of the promoter sequence that controls the transcription of the structural gene on the tomato genome is included at the 5' end of the translational enhancer.

[0013] [5] A method for producing tomatoes that overexpress structural genes possessed by tomatoes, comprising the step of introducing the DNA described in [3] or [4] into tomato cells and performing homologous recombination.

[0014] A tomato transformant, wherein the translation enhancer according to [6] [1] or [2] is introduced at a position between any structural gene on genomic DNA of tomato and a promoter sequence that controls transcription of said structural gene.

[0015] The transformant according to [6], which is any one selected from the group consisting of plant cells, plant tissues, plant bodies and seeds. [Effects of the Invention]

[0016] According to the present invention, a novel technique relating to a tomato-derived translation enhancer can be provided. [Brief Description of Drawings]

[0017] [Figure 1] Fig. 1 is a schematic explanatory diagram showing the difference between the expression level of a structural gene when a homologous recombination step is performed and the expression level of the structural gene when the homologous recombination step is not performed. [Figure 2] Fig. 2 is a vector map of a plasmid vector having a luciferase gene expression cassette containing a candidate sequence of a translation enhancer and a GUS gene expression cassette for standardization. [Figure 3] Fig. 3 is a drawing showing the sequences for inserting the nucleotide sequences set forth in SEQ ID NOs: 1 to 6, which are candidate sequences of a translation enhancer, into a plasmid vector, and the positional relationship between the candidate sequences set forth in SEQ ID NOs: 1 to 5. [Figure 4] Fig. 4 is a graph showing the results obtained by normalizing luciferase activity values with GUS activity values for each translation enhancer introduced into tomato protoplasts or each candidate sequence thereof. [Figure 5] Fig. 5 is a graph showing the results obtained by normalizing luciferase activity values with GUS activity values when the nucleotide sequence set forth in SEQ ID NO: 1 and each nucleotide sequence obtained by shortening the 5'-side and / or 3'-side of said nucleotide sequence are introduced into tomato protoplasts. [Figure 6]Figure 6 is a graph showing the luciferase activity values, standardized by GUS activity values, when the nucleotide sequences shown in Sequence ID No. 1 and Sequence ID No. 6 were introduced into tomato protoplasts. [Modes for carrying out the invention]

[0018] In this specification, the term "comprise" means that it may include components other than the component being discussed. The term "consist of" means that it does not include components other than the component being discussed. In this specification, when "comprise" is used, it includes "consist of" and "consist essentially of" embodiments. The term "consist essentially of" means that it does not include components other than the component being discussed in an embodiment that performs a special function (such as an embodiment that completely negates the effect of the invention).

[0019] Furthermore, in this specification, a numerical range represented by "~" means a range that includes the numbers written before and after "~" as the lower and upper limits, respectively.

[0020] The following describes in detail, with reference to drawings as appropriate, a preferred embodiment of the present invention, including a translation enhancer, DNA, a method for producing tomatoes, and a transformed tomato. However, the present invention is not limited to the following embodiments.

[0021] [Translation Enhancer] A translation enhancer according to a preferred embodiment of the present invention is DNA that promotes post-transcriptional translation of a gene and comprises a nucleotide sequence derived from the tomato genome or a nucleotide sequence obtained by modifying said nucleotide sequence by deletion, substitution, addition, or insertion of a nucleotide. In this specification, tomato refers to Solanum lycopersicum and includes all varieties and strains of tomatoes, as well as wild-type tomatoes. The translation enhancer of this embodiment can also be considered as DNA that increases the expression level of structural genes.

[0022] Translational enhancers are known to be present in the 5'UTR (untranslated region) of some structural genes, and they increase the amount of translation from mRNA transcribed from these structural genes to proteins, i.e., the amount of protein synthesized. In the following, the function of increasing the amount of translation from mRNA to protein after transcription of structural genes will also be referred to as "translational enhancer activity." Translational enhancers are transcribed from the genome to mRNA along with the structural gene in question, but they are not translated into protein. In this specification, "structural gene" refers to a gene that determines the amino acid sequence of a protein.

[0023] The translational enhancer of this embodiment is preferably DNA that contains any of the following base sequences (1) to (20) and has translational enhancer activity. (1) The base sequence shown in Sequence ID No. 1 (2) The base sequence shown in Sequence ID No. 2 (3) The base sequence shown in Sequence ID No. 3 (4) The base sequence shown in Sequence ID No. 4 (5) The base sequence shown in Sequence ID No. 5 (6) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 1 (7) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 2 (8) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 3 (9) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 4 (10) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 5 (11) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 1 (12) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 2. (13) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 3 (14) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 4. (15) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 5. (16) A sequence of 50 to 93 consecutive bases within the base sequence shown in Sequence ID No. 1 (17) The base sequence shown in Sequence ID No. 6 (18) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 6 (19) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 6 (20) A sequence of 50 to 86 consecutive bases within the base sequence shown in Sequence ID No. 6

[0024] Whether or not a DNA possesses translational enhancer activity can be determined by checking whether the amount of translation from mRNA increases when the DNA is inserted between the promoter and the structural gene, compared to when it is not inserted. Translational enhancer activity is only recognized when the amount of translation increases. Reporter genes such as GFP or luciferase may be used as the structural gene. Alternatively, the presence or absence of translational enhancer activity can also be confirmed by simply introducing a plasmid containing the DNA to be evaluated as an expression cassette with the DNA to be evaluated as an insert between the promoter and the structural gene into plant cells such as protoplasts, and checking whether the amount of translation increases compared to when a plasmid without the DNA to be evaluated as an insert is introduced. Alternatively, the presence or absence of translational enhancer activity can also be confirmed by adding a plasmid with the DNA to be evaluated as an insert to a cell-free transcription-translation expression system derived from eukaryotic cells such as wheat germ or rabbit reticulocyte lysate, and checking whether the amount of translation increases compared to when a plasmid without the DNA to be evaluated as an insert is added. Furthermore, the presence or absence of translational enhancer activity can also be confirmed by inserting (knock-in) the DNA whose translational enhancer activity is to be judged between a promoter and a structural gene on the genome of a plant cell, and observing whether the amount of translation increases compared to when the DNA is not inserted.

[0025] The following nucleotide sequence shown in Sequence ID No. 1 is the nucleotide sequence of the translational enhancer region located in the 5'UTR of the SlADH2 gene in tomato. Sequence ID 1: TATAAATATCCACTGCCTCAACTGAGTAAACAAACCAAAATTTGTGTTCTATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAA

[0026] The nucleotide sequences shown in the following Sequence IDs 2-5 are all parts of the nucleotide sequence shown in Sequence ID 1, and are shortened versions of the nucleotide sequence shown in Sequence ID 1 by removing the 5' and / or 3' ends. Sequence ID 2: CAACTGAGTAAACAAACCAAAATTTGTGTTCTATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAA Sequence ID 3: GTTCTATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAA Sequence ID 4: TATAAATATCCACTGCCTCAACTGAGTAAAACAACCAAAATTTGTGTTCTATAAAAAGTTTTCATATTTAGTGATCAC Sequence ID 5: CAACTGAGTAAACAAACCAAAATTTGTGTTCTATAAAAAGTTTTCATATTTAGTGATCAC

[0027] The nucleotide sequence shown in Sequence ID No. 6 below is the nucleotide sequence of the translational enhancer region located in the 5'UTR of the PSY1 (phytoensynthase 1) gene, which encodes one of the enzymes in the carotenoid synthesis system in tomatoes. Sequence ID 6: TATAAACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGA

[0028] As will be detailed in the examples later, DNA having the base sequences shown in SEQ ID NOs: 1-6 has been confirmed to possess translational enhancer activity.

[0029] The base sequence in (6) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 1, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 1.

[0030] The base sequence in (7) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 2, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 2.

[0031] The base sequence in (8) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 3, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 3.

[0032] The base sequence in (9) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 4, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 4.

[0033] The base sequence of (10) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 5, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 5.

[0034] The base sequence of (18) above is preferably a base sequence having 95% or more sequence identity with the base sequence shown in Sequence ID No. 6, and more preferably a base sequence having 98% or more sequence identity with the base sequence shown in Sequence ID No. 6.

[0035] In this specification, the sequence identity of a target nucleotide sequence (for example, the nucleotide sequences shown in (6) to (10) and (18) above) with respect to a reference nucleotide sequence (for example, the nucleotide sequences shown in SEQ ID NOs. 1 to 6 above) can be determined as follows. First, the reference base sequence and the target base sequence are aligned. Gaps may be included in each base sequence to maximize sequence identity. Next, the number of matching bases between the reference base sequence and the target base sequence is calculated, and the sequence identity can be calculated according to formula (1) below. Sequence identity (%) = Number of matching bases / Total number of bases in the target base sequence × 100 ... (1)

[0036] In the base sequences of (11) to (15) and (19) above, "one or more bases" means one or more and 10 or fewer bases, preferably one or more and 8 or fewer bases, more preferably one or more and 5 or fewer bases, and even more preferably one or more and 3 or fewer bases.

[0037] The translational enhancer of this embodiment may be, for example, DNA isolated from or artificially synthesized from the 5'UTR region of the tomato SlADH2 gene or PSY1 gene, or DNA replicated from them, or it may be a translational enhancer located in the 5'UTR region of a structural gene other than the SlADH2 gene and PSY1 gene in an organism (i.e., a translational enhancer introduced into the genome of an organism).

[0038] The types of organisms mentioned above are not particularly limited; for example, they may be plants or microorganisms, or tomatoes. However, translational enhancers having any of the base sequences (1) to (16) above, located in the 5'UTR region of the tomato's SlADH2 gene, and translational enhancers having any of the base sequences (17) to (20) above, located in the 5'UTR region of the tomato's PSY1 gene, are not included because they are natural translational enhancers present in tomatoes.

[0039] When isolating a translation enhancer from the 5'UTR region of the tomato's SlADH2 or PSY1 gene, the tomato can be any Solanum lycopersicum, such as a wild species or any artificially created variety or strain.

[0040] As will be detailed in the examples below, the translation enhancer of mRNA transcribed from any structural gene can be promoted and its expression enhanced. The translation enhancer has been described in detail above; below, we will provide a detailed explanation of embodiments of DNA containing the translation enhancer.

[0041] [DNA] DNA according to another preferred embodiment of the present invention includes a translational enhancer, which is the same as the translational enhancer detailed in the [Translational Enhancer] embodiment. The DNA of this embodiment may include a region having translational enhancer activity and other regions. The other regions can be of any length and any base sequence, and are not particularly limited. The DNA of this embodiment may be double-stranded or single-stranded.

[0042] The DNA may also include, as other regions, at least a portion of any structural gene possessed by the tomato (scientific name: Solanum lycopersicum) at the 3' end (in other words, the 3' side) of the translational enhancer, and at least a portion of the promoter sequence that controls the transcription of the above structural gene on the tomato genome at the 5' end (in other words, the 5' side) of the translational enhancer. In this case, the remaining region includes the so-called homology arm, where "at least a portion of the structural gene" is the right arm and "at least a portion of the promoter sequence" is the left arm. The DNA in this case may be single-stranded or double-stranded. If the DNA is double-stranded, the ends may be blunt ends or overhanging ends. Hereafter, the DNA described above, including the translation enhancer, "at least a portion of the structural gene," and "at least a portion of the promoter sequence," will also be referred to as "donor DNA." As an example of donor DNA, please also refer to the range of "homologous recombination" shown by the bidirectional arrow in Figure 1, which will be described later. The donor DNA may also be in the form of a gene transfer vector.

[0043] The above-mentioned "at least a portion of the promoter sequence" includes the 3' end of the promoter sequence, and the above-mentioned "at least a portion of the structural gene" includes the 5' end of the structural gene.

[0044] The lengths of "at least a portion of the promoter sequence," i.e., the left arm, and "at least a portion of the structural gene," i.e., the right arm, are not particularly limited, but may be, for example, 500-1200 base pairs (nt), 600-1100 base pairs, or 900-1100 base pairs, respectively. If the donor DNA has protruding ends, the shorter strand should be used for counting.

[0045] In donor DNA containing a translation enhancer, the above-mentioned "at least a portion of the promoter sequence," and the above-mentioned "at least a portion of the structural gene," the translation enhancer is expected to promote translation from mRNA to protein if it is located 5' end-to-5' of the translation start codon of the structural gene and 3' end-to-3' of the promoter sequence. For this reason, the more precise location of the translation enhancer is not particularly limited. For example, the translation enhancer may be located directly ligated to the translation start codon (such as ATG) (simply put, immediately upstream of the translation start codon).

[0046] The promoter sequence is any nucleotide sequence found in the tomato (Solanum lycopersicum) that has the function of controlling the transcription of structural genes. It may be the promoter sequence of any tomato variety or strain, or it may be the promoter sequence included in the tomato reference genome (for example, SL4.0).

[0047] The structural genes contained in the donor DNA are any structural genes present in the tomato genome, and the type is not particularly limited, but preferably they are structural genes that are expected to produce desirable effects through translation promotion (expression promotion), such as genes that contribute to lycopene synthesis or genes that contribute to disease resistance.

[0048] According to the DNA of this embodiment, as will be explained in the following embodiments, a translation enhancer can be introduced between any structural gene of a tomato and the promoter sequence that controls the transcription of the structural gene, thereby increasing the amount of translation of the structural gene without affecting transcription.

[0049] [How to grow tomatoes] A further preferred embodiment of the present invention is a method for producing tomatoes that overexpress structural genes of the tomato (Solanum lycopersicum), and includes a step of introducing DNA into tomato cells to perform homologous recombination (hereinafter also referred to as the "homologous recombination step"). The DNA introduced into the tomato cells is the donor DNA detailed in the [DNA] embodiment. The tomato may be any Solanum lycopersicum, for example, a wild species, or any artificially created variety or strain.

[0050] Figure 1 is a schematic diagram illustrating the difference in expression levels of structural genes when homologous recombination is performed versus when homologous recombination is not performed. In Figure 1, an example of the range of homologous recombination by donor DNA is shown with bidirectional arrows, and an example of a structural gene is shown, which is a gene involved in lycopene synthesis. However, the range of homologous recombination and the types of structural genes are not particularly limited.

[0051] The donor DNA introduced into tomato cells during homologous recombination contains at least a portion of the 3' end of the tomato promoter sequence upstream of the translational enhancer, and at least a portion of the 5' end of one of the tomato's structural genes downstream. Therefore, as shown in Figure 1, the homologous recombination process allows a translational enhancer containing one of the base sequences (1) to (20) above to be precisely knocked in at the 5' end (in other words, upstream) of the target structural gene to be overexpressed, and at the 3' end (in other words, downstream) of the promoter sequence that controls the transcription of the target structural gene. As a result, even with the same transcription rate, tomato cells that overexpress the target structural gene are obtained by translating a larger amount of it.

[0052] Here, the structural gene after homologous recombination, and some or all of the promoter sequence that controls the transcription of the structural gene, are replaced by the structural gene and promoter sequence of the donor DNA. However, since the structural gene and promoter sequence of the donor DNA are derived from tomatoes, the structural gene and promoter sequence after homologous recombination are endogenous genes and endogenous promoters. Therefore, homologous recombination can be considered self-cloning, which may make it more acceptable to consumers than introducing foreign genes and / or foreign promoters into the tomato genome.

[0053] In addition, generally, when a promoter is replaced with a foreign promoter, the downstream structural genes may be expressed at locations and times where they would not normally be expressed, which can inhibit plant growth and reproduction.

[0054] In contrast, according to the homologous recombination process of this embodiment, the promoter sequence that controls the transcription of structural genes remains an endogenous promoter after recombination, and therefore does not affect the transcription of structural genes. Therefore, it is possible to prevent situations where structural genes are expressed in locations or at times when they should not be expressed (for example, lycopene, which is produced in mature fruit, accumulates in petals and leaves), thereby inhibiting the growth and reproduction of tomatoes.

[0055] Methods for introducing donor DNA into tomato cells in homologous recombination include, but are not limited to, the Agrobacterium method, the PEG (polyethylene glycol) method, the electroporation method, the liposome method, the particle gun method, and the microinjection method.

[0056] In the homologous recombination process, in addition to the donor DNA described above, it is preferable to introduce a genome editing method into tomato cells that cuts genomic DNA at a location upstream (5' side) of the translation start codon of the structural gene and downstream (3' side) of the promoter sequence, which is the target site for knock-in.

[0057] Examples of genome editing methods include, but are not limited to, the CRISPR-Cas system, TALEN, and zinc finger nuclease (ZFN).

[0058] As a genome editing method, the CRISPR-Cas system is particularly preferred from the viewpoint of editing efficiency and ease of handling. The CRISPR-Cas system comprises a guide RNA (gRNA) and a Cas protein.

[0059] The Cas protein forms a complex with gRNA, recognizes the PAM sequence on the genome, and cleaves genomic DNA near the PAM sequence. The type of Cas protein is not particularly limited, but Cas9 is preferred.

[0060] The base sequence of a gRNA can be easily designed by someone skilled in the art using commercially available gRNA design tools.

[0061] The CRISPR-Cas system may be introduced into tomato cells, for example, in the form of DNA encoding gRNA (in other words, DNA complementary to gRNA) and DNA encoding the Cas protein; in the form of RNA containing a region that functions as gRNA and a region that codes for the Cas protein; or in the form of gRNA and Cas protein (a form that actually exhibits cleavage activity in the cell). The DNA encoding gRNA and the DNA encoding the Cas protein may be the same (single) DNA strand or separate DNA strands. The region that functions as gRNA and the region that codes for the Cas protein may be the same RNA strand or separate RNA strands.

[0062] By introducing genome editing techniques, when the tomato genome is cut upstream (5' side) of the translation start codon of a structural gene and downstream (3' side) of the promoter sequence, homologous recombination with the donor DNA occurs at that location with high efficiency and precision, and the translation enhancer contained in the donor DNA is incorporated at that location.

[0063] In the homologous recombination process, the tomato cells transformed by the introduction of donor DNA may be, for example, stem cells, leaf cells, petal cells, seed cells, embryo cells, ovule cells, ovary cells, root cells, shoot apical cells, anther cells, or pollen cells, or they may be cells of callus, which is an undifferentiated cell mass, or plant culture cells such as protoplasts, but are not limited to these. Furthermore, as will be explained below, from the viewpoint of facilitating callus formation in tomatoes, the tomato cells into which the donor DNA is introduced may be leaf cells of seedling cotyledons.

[0064] To ensure that the transformation induced by the introduction of donor DNA is reflected (in other words, inherited) in the next generation of tomatoes, the method for producing tomatoes may further include, in addition to the homologous recombination process described above, a process of forming callus (a mass of undifferentiated cells) from the tomato cells into which the donor DNA has been introduced, and then redifferentiating them into a plant (hereinafter also referred to as the "redifferentiation process"). By returning the tomato cells into which the donor DNA has been introduced to an undifferentiated state and then differentiating them into a plant again, pollen and ovules can be obtained, and by pollinating them, next-generation seeds with translational enhancers upstream of the target structural gene can be obtained.

[0065] In the redifferentiation process, plant hormones, such as auxin and cytokinin, can be added to induce redifferentiation into plant bodies.

[0066] [Tomato transgenic] In another preferred embodiment of the present invention, a tomato transformant (in other words, a transformed tomato) has a translational enhancer introduced (in other words, located) in the 5'UTR region of a structural gene on the tomato genomic DNA, specifically between the structural gene and the promoter sequence that controls the transcription of the structural gene. This translational enhancer is the same as the translational enhancer detailed in the [Translational Enhancer] embodiment. The transformant of this embodiment can be produced, for example, by the method detailed in the [Method for Producing Tomatoes] embodiment (a recombinant Solanum lycopersicum). The structural gene is any structural gene present on the tomato genomic DNA as described above, but from the viewpoint of excluding wild tomatoes, the translational enhancer having the base sequences (1) to (16) above is introduced in the 5'UTR region of a structural gene other than the SlADH2 gene, and the translational enhancer having the base sequences (17) to (20) above is introduced in the 5'UTR region of a structural gene other than the PSY gene.

[0067] The transformant of this embodiment is not particularly limited in form as long as it contains transformed tomato cells, but may be selected from the group consisting of, for example, plant cells (tomato cells), plant tissue (tomato tissue), plant bodies (tomato seedlings), and seeds. Those skilled in the art can obtain tomato plant bodies (seedlings) or seeds from tomato callus in which a translation enhancer has been knocked in by, for example, the homologous recombination process described above, using plant hormones as appropriate.

[0068] The present invention is not limited to the embodiments described above, and it goes without saying that various modifications are possible within the scope of the invention as described in the claims, and these modifications are also included within the scope of the present invention. [Examples]

[0069] The present invention will be described below with reference to examples, but the present invention is not limited to these examples.

[0070] [Materials and Methods] <Experimental Example: Construction of a plasmid vector containing candidate sequences for translational enhancers> First, we created recombinant plasmid vectors containing an expression cassette in which one of the nucleotide sequences shown in Sequence IDs 1-6, which are candidate translational enhancer sequences, was inserted between the cauliflower mosaic virus 35S (CaMV35S) promoter and the click beetle-derived luciferase gene, and a GUS gene expression cassette for standardizing different tests.

[0071] Figure 2 is a vector map of a plasmid vector having a luciferase gene expression cassette containing candidate sequences for translational enhancers and a GUS gene expression cassette for standardization.

[0072] pUC19 was used as the backbone of the plasmid vector, and the GUS gene expression cassette and the luciferase gene expression cassette were placed side by side at the multi-cloning site.

[0073] As shown in Figure 2, the GUS expression cassette for standardization includes the CaMV35S promoter and GUS gene derived from pBI121, and the Nos terminator (not shown). The portion from NcoI in CaMV35S to the EcoRI site at the end of the Nos terminator was used. An Ω sequence is inserted between the XbaI site and the BamHI site located at the 5'-UTR (3' end of the CaMV35S promoter) of the GUS gene. The Ω sequence is known as a translational enhancer sequence found in tobacco mosaic virus, as described in the following literature. Gallie and Walbot 1992, Identification of the motifs within the tobacco mosaic virus 5′-leader responsible for enhancing translation, Oxford University Press, vol 20, No. 17, 4631-4638.

[0074] For the luciferase gene expression cassette, we used the CaMV35S promoter and Nos terminator derived from pBI121 (Clontech). The luciferase gene (CBG99luc) was derived from pCBG99-Basic (Promega), and a portion of the pEGFP (Clontech) sequence was used as the linker sequence for inserting the luciferase gene. The luciferase gene fragment (from the NcoI site to the XbaI site) was linked to the CaMV35S promoter fragment (from the EcoRV site to the BamHI site) via the linker sequence, and the Nos terminator fragment (from the SacI site to the EcoRI site) was further linked via the linker sequence.

[0075] Subsequently, a known translational enhancer sequence or a candidate translational enhancer sequence was inserted into the obtained plasmid between the KpnI site and the NcoI site located near the 5' end of the translation start site of the luciferase gene.

[0076] For the known translational enhancer sequence, the 5'UTR sequence of the tobacco NtADH1 gene was used. A comparative experimental system without the insertion of a translational enhancer sequence was also prepared separately. In Figure 2, "Psy" refers to the nucleotide sequence shown in SEQ ID NO: 6. "Tmt" refers to the nucleotide sequence shown in SEQ ID NO: 1. "Tbc" refers to the aforementioned 5'UTR sequence of the tobacco NtADH1 gene. "Ω" refers to the aforementioned Ω sequence. The 5'UTR sequence of the tobacco NtADH1 gene used was the sequence described in the following literature. Satoh et al 2004, The 5'-untranslated region of the tobacco alcohol dehydrogenase gene functions as an effective translational enhancer in plant, J Biosci Bioeng, vol.98(1), 1-8.

[0077] In addition, a separate experimental system was set up in which the nucleotide sequences shown in SEQ ID NOs. 2-5, which are shortened versions of the nucleotide sequence shown in SEQ ID NO. 1, were inserted into the 5' side of the translation start site of the luciferase gene in a luciferase gene expression cassette.

[0078] Figure 3 is a diagram showing the sequence when the nucleotide sequences shown in SEQ ID NOs. 1-6, which are candidate sequences for translational enhancers, are inserted into a plasmid vector, and the positional relationship between the candidate sequences shown in SEQ ID NOs. 1-5.

[0079] In Figure 3, the bases shown in uppercase are the bases that constitute the translational enhancer sequence endogenously present in the tomato genome, while the bases shown in lowercase are the bases added to the 5' and / or 3' ends of the above translational enhancer sequence to create restriction enzyme sites.

[0080] "Tomato" is a double-stranded DNA molecule consisting of two sequences: one in which a base (c:cytosine) for linking to a restriction enzyme site is added to the 5' end of the base sequence shown in Sequence ID No. 1, and another base (c:cytosine) for linking to a restriction enzyme site is added to the 3' end of the base sequence shown in Sequence ID No. 1 (see Sequence ID No. 7); and another in which a base sequence (ggtac) for linking to a restriction enzyme site is added to the 3' end of a base sequence complementary to the base sequence shown in Sequence ID No. 1, and a base sequence (catgg) for linking to a restriction enzyme site is added to the 5' end (see Sequence ID No. 8). "Tomato-a" is a double-stranded DNA molecule consisting of two sequences: one in which a base (c:cytosine) for linking to a restriction enzyme site is added to the 5' end of the base sequence shown in Sequence ID No. 2, and another in which a base sequence (c:cytosine) for linking to a restriction enzyme site is added to the 3' end of a base sequence complementary to the base sequence shown in Sequence ID No. 2, and a base sequence (catgg) for linking to a restriction enzyme site is added to the 5' end of a base sequence (see Sequence ID No. 10). "Tomato-b" is a double-stranded DNA molecule consisting of two sequences: one in which a base (c:cytosine) for linking to a restriction enzyme site is added to the 5' end of the base sequence shown in Sequence ID No. 3, and another in which a base sequence (c:cytosine) for linking to a restriction enzyme site is added to the 3' end of a base sequence complementary to the base sequence shown in Sequence ID No. 3, and a base sequence (catgg) for linking to a restriction enzyme site is added to the 5' end of a base sequence (see Sequence ID No. 12). "Tomato-c" is a double-stranded DNA molecule consisting of a base sequence (see Sequence ID No. 13) in which a base (c: cytosine) for linking to a restriction enzyme site is added to the 5' end of the base sequence shown in Sequence ID No. 4, and a base sequence (see Sequence ID No. 14) in which a base sequence complementary to the base sequence shown in Sequence ID No. 4 is added to the 3' end for linking to a restriction enzyme site (ggtac), and a base sequence (catg) for linking to a restriction enzyme site is added to the 5' end for linking to a restriction enzyme site. "Tomato-d" is a double-stranded DNA molecule consisting of a nucleotide sequence (see SEQ ID NO: 15) in which a base (c: cytosine) for linking to a restriction enzyme site is added to the 5' end of the nucleotide sequence shown in SEQ ID NO: 5, and a nucleotide sequence (see SEQ ID NO: 16) in which a nucleotide sequence (ggtac) for linking to a restriction enzyme site is added to the 3' end of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 5, and a nucleotide sequence (catg) for linking to a restriction enzyme site is added to the 5' end. "PSY1" is a double-stranded DNA molecule consisting of a base sequence (see SEQ ID NO: 17) in which a base (c:cytosine) for linking to restriction enzyme sites is added to the 5' end of the base sequence shown in SEQ ID NO: 6, and a base (c:cytosine) for linking to restriction enzyme sites is added to the 3' end of a base sequence complementary to the said base sequence, with a base sequence (ggtac) for linking to restriction enzyme sites added to the 3' end and a base sequence (catgg) for linking to restriction enzyme sites added to the 5' end (see SEQ ID NO: 18).

[0081] <Experimental Example 2: Expression in Tomato Protoplasts> First, the leaves of aseptically grown tomatoes were shredded and added to a cell wall lysis enzyme solution (1% Cellulase Onozuka® RS, 0.5% Macerozyme R10, 0.5M Mannitol, 20mM (mol / L) MES pH 5.7), and then shaken at 25°C for 3 hours.

[0082] Next, an equal volume of W5 (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES, pH 5.7) was added to the enzyme solution, filtered through a 108 μm nylon mesh, and centrifuged at 100 × g for 2 minutes to precipitate the protoplasts. After removing the supernatant, the solution was resuspended in W5 and allowed to stand on ice for 30 minutes.

[0083] After standing, the protoplasts were centrifuged at 100 × g for 2 minutes to precipitate, and then suspended in MMG (15 mM MgCl2, 0.4 M mannitol, 4 mM MES pH 5.7) for 1 × 10⁶ times. 6 Diluted to a concentration of / mL.

[0084] In Experimental Example 1, the PEG method was used to introduce the expression plasmid into the protoplast. 100 μL of protoplast was mixed with 10 μg / 10 μL of plasmid solution, and 110 μL of PEG solution (40 w / v% PEG4,000, 0.2 M mannitol, 0.1 M CaCl2) was added and allowed to stand for 10 minutes.

[0085] Next, 1 mL of W5 was mixed in, and the mixture was centrifuged at 200 × g for 3 minutes to remove the supernatant. The precipitated protoplast was suspended in 1000 μL of WI (0.5 M mannitol, 20 mM KCl, 4 mM MES pH 5.7) and incubated at 25°C in the dark for 16 hours.

[0086] After culturing, the cells were centrifuged at 200 × g for 5 minutes to precipitate the protoplasts. The supernatant was discarded and resuspended in lysis buffer (0.1 M K2HPO4, 0.1 M KH2PO4, 1 mM EDTA, 1% Triton X-100, 10 v / v% glycerol, 7 mM β-mercaptoethanol). The cells were then allowed to stand on ice for 5 minutes. Subsequently, the cells were centrifuged at 12000 × g for 2 minutes. The resulting supernatant was collected as a cell extract, and luciferase activity and GUS activity were measured.

[0087] For measuring luciferase activity, first, 50 μL of luciferase measurement buffer (60 mM TrisHCl pH 8.0, 20 mM MgCl2, 20 mM DTT, 2 mM EDTA, 2 mM ATP) was added to 25 μL of cell extract and allowed to stand at 37°C for 10 minutes. Then, 25 μL of 0.2 mM luciferin solution was added, and the luminescence value was counted starting 2 seconds later. The cumulative value up to 22 seconds was taken as the luciferase activity value.

[0088] For GUS activity measurement, 20 μL of cell extract was first added to 200 μL of GUS measurement buffer (10 mM TrisHCl pH 8.0, 2 mM MgCl2, 1 mM 4-methylumbelliferyl be-D-glucuronide) and allowed to stand at 37°C. After 5 minutes and 35 minutes, 20 μL samples were taken and mixed with 180 μL of stop buffer (0.2 M Na2CO3) to stop the reaction. For the samples after 5 minutes and 35 minutes, fluorescence (filter wavelength 460 nm) was measured when irradiated with excitation light at a wavelength of 355 nm. The GUS activity value was obtained by subtracting the measurement at 5 minutes from the measurement at 35 minutes.

[0089] After measuring luciferase activity and GUS activity, the luciferase activity was standardized by dividing it by the GUS activity.

[0090] [result] Figure 4 is a graph showing the results of standardizing luciferase activity values ​​using GUS activity values ​​for each translational enhancer or candidate sequence introduced into tomato protoplasts. "Tobacco" is a system in which the 5'UTR sequence of the tobacco NtADH1 gene, a known translational enhancer sequence, was introduced. "None" is a comparative example in which no translational enhancer sequence was inserted. Figure 4 shows the relative values ​​of the standardized luciferase activity in each system, with the standardized luciferase activity value in the "None" experimental system set to 1.

[0091] As shown in Figure 4, luciferase activity was significantly improved in both the system in which the Ω sequence, a known translational enhancer sequence, was introduced into the vector, and the system in which the 5'UTR sequence of the tobacco NtADH1 gene was introduced into the vector, compared to the comparative example without a translational enhancer sequence. This result confirms that these known translational enhancer sequences possess translational enhancer activity.

[0092] Furthermore, as shown in Figure 4, the system into which the "Tomato" nucleotide sequence shown in Sequence ID No. 7 was introduced exhibited luciferase activity stronger than that of the Ω sequence and comparable to that of the 5'UTR sequence of the tobacco NtADH1 gene. These results suggest that the sequence of sequence number 1 contained within the sequence number 7, that is, the sequence contained in the 5'UTR region of the SlADH2 gene, possesses potent translational enhancer activity.

[0093] Figure 5 is a graph showing the luciferase activity values ​​standardized by GUS activity values ​​when the nucleotide sequence shown in Sequence ID No. 1, and each nucleotide sequence obtained by shortening the 5' and / or 3' ends of that sequence, were introduced into tomato protoplasts. Figure 5 shows the relative values ​​of the standardized luciferase activity in each system, with the standardized luciferase activity value in the "nothing" experimental system set to 1.

[0094] In Figure 5, "a" is the system with the "Tomato-a" sequence introduced above. "b" is the system with the "Tomato-b" sequence introduced above. "c" is the system with the "Tomato-c" sequence introduced above. "d" is the system with the "Tomato-d" sequence introduced above.

[0095] As shown in Figure 5, luciferase activity exceeding that of the Ω sequence was observed in all systems, including those incorporating "Tomato-a," "Tomato-b," "Tomato-c," and "Tomato-d." These results suggest that the nucleotide sequences shown in SEQ ID NOs. 2-5, which are obtained by shortening the 5' and / or 3' ends of the nucleotide sequence shown in SEQ ID NO. 1, all possess potent translational enhancer activity.

[0096] On the other hand, Figure 6 is a graph showing the results of standardizing the luciferase activity values ​​using GUS activity values ​​when the nucleotide sequences shown in Sequence ID No. 1 and Sequence ID No. 6 were introduced into tomato protoplasts. Figure 6 shows the relative values ​​of the standardized luciferase activity in each system, with the standardized luciferase activity value in the "no input" experimental system set to 1.

[0097] As shown in Figure 6, the system into which the nucleotide sequence shown in Sequence ID No. 6 was introduced exhibited stronger luciferase activity than the Ω sequence, although it was not as strong as the "Tomato" system. These results suggest that the nucleotide sequence in the 5'UTR region of the PSY1 gene, shown in Sequence ID No. 6, possesses potent translational enhancer activity. [Industrial applicability]

[0098] According to the present invention, the translation rate of structural genes can be increased using the nucleotide sequence contained in the 5'UTR region of the SlADH2 gene or the PSY1 gene. Therefore, the present invention is industrially applicable.

Claims

1. A translation enhancer is a DNA molecule that promotes translation after gene transcription. A translation enhancer comprising a nucleotide sequence derived from the genome of a tomato or a nucleotide sequence obtained by modifying the said nucleotide sequence by deletion, substitution, addition, or insertion of a nucleotide.

2. A translation enhancer according to claim 1, comprising any of the following base sequences (1) to (20), and having translation enhancer activity. (1) The base sequence shown in Sequence ID No. 1 (2) The base sequence shown in Sequence ID No. 2 (3) The base sequence shown in Sequence ID No. 3 (4) The base sequence shown in Sequence ID No. 4 (5) The base sequence shown in Sequence ID No. 5 (6) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 1 (7) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 2 (8) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 3 (9) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 4 (10) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 5 (11) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added or inserted in the nucleotide sequence shown in Sequence ID No. 1 (12) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 2 (13) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added or inserted in the nucleotide sequence shown in Sequence ID No. 3 (14) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added or inserted in the nucleotide sequence shown in Sequence ID No. 4 (15) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted in the nucleotide sequence shown in Sequence ID No. 5 (16) A sequence of 50 to 93 consecutive bases in the base sequence shown in Sequence ID No. 1 (17) The base sequence shown in Sequence ID No. 6 (18) A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 6 (19) A nucleotide sequence in which one or more nucleotides are deleted, substituted, added or inserted in the nucleotide sequence shown in Sequence ID No. 6 (20) A sequence of 50 to 86 consecutive bases within the base sequence shown in Sequence ID No. 6

3. DNA comprising the translation enhancer according to claim 1 or 2.

4. At least a portion of any structural gene possessed by the tomato (scientific name: Solanum lycopersicum) is included at the 3' end of the translational enhancer, The DNA according to claim 3, wherein at least a portion of the promoter sequence that controls the transcription of the structural gene on the tomato genome is included at the 5' end of the translational enhancer.

5. A method for producing tomatoes that overexpress structural genes present in tomatoes, A method for producing tomatoes, comprising the step of introducing the DNA described in claim 4 into tomato cells and performing homologous recombination.

6. A tomato transformant wherein the translation enhancer according to claim 1 or 2 is introduced at a position between any structural gene on the tomato genomic DNA and a promoter sequence that controls the transcription of the structural gene.

7. The transformant according to claim 6, which is selected from the group consisting of plant cells, plant tissue, plant bodies, and seeds.