Evaluation method for methane production system and methane production method

JP2026147111APending Publication Date: 2026-09-17MEIJO UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025034716
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-03-05
Publication Date
2026-09-17

Smart Images

  • Figure 2026147111000001_ABST
    Figure 2026147111000001_ABST
Patent Text Reader

Abstract

This technology provides biomarkers that serve as monitoring indicators in methane production systems. [Solution] The method for evaluating a methane production system is a method for evaluating a methane production system that produces methane by microbial decomposition of a target material containing cellulosic organic matter, wherein the microorganisms include methane-producing bacteria and bacteria other than methane-producing bacteria, and among the bacteria other than methane-producing bacteria, bacteria whose abundance increases in an environment with a pH of 5.0-6.6 are used as biomarkers.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for evaluating a methane production system and a methane production method. [Background Art]

[0002] Patent Literature 1 discloses a biomethane fermentation facility including: an embankment in which herbaceous biomass is mixed at a predetermined ratio and heaped to a predetermined height; a water-impermeable sheet that covers the embankment, has an outer peripheral edge fixed around the embankment, and has a through-hole formed at a position located at an upper part in a state of covering the embankment; and water stored around the embankment covered with the water-impermeable sheet. [Prior Art Literature] [Patent Literature]

[0003] [Patent Literature 1] Japanese Unexamined Patent Publication No. 2019-147089 [Summary of Invention] [Problem to be Solved by the Invention]

[0004] In order to construct a stable methane production system, a biomarker that serves as a monitoring index for the system is desired.

[0005] The present invention has been made in view of the above-described conventional circumstances, and an object of the present invention is to provide a technique related to a biomarker that serves as a monitoring index in a methane production system. [Means for Solving the Problem]

[0006] The method for evaluating a methane production system of the present invention is: a method for evaluating a methane production system that produces methane by subjecting a treatment object containing cellulosic organic matter to microbial decomposition treatment, wherein the microorganisms include methanogens and bacteria other than methanogens, Among bacteria other than the aforementioned methanogenic bacteria, those whose abundance increases in an environment with a pH of 5.0-6.6 will be used as biomarkers. [Brief explanation of the drawing]

[0007] [Figure 1] This is a cross-sectional view showing a biomethane fermentation facility according to one embodiment. [Figure 2] This graph shows the relationship between the elapsed time up to day 133, the amount of biomethane, the concentration of volatile organic acids (volatile fatty acids, also known as VFAs), the standard oxidation-reduction potential (Eh), and pH. [Figure 3] This graph shows the relationship between the elapsed time up to day 54, the amount of biomethane, the methane concentration, and the VFAs concentration. [Figure 4] This graph shows the results of quantitative analysis of the mcrA gene at each sample collection point. [Figure 5] This graph shows the results of quantitative analysis of Clostridium butylicum at each sample collection point. [Figure 6] This graph shows the results of quantitative analysis of Bacillus fumarioli at each sample collection point. [Figure 7] This graph shows the results of quantitative analysis of Bacillus flux at each sample collection point. [Modes for carrying out the invention]

[0008] First, embodiments of this disclosure will be listed and described. Any combination of the following embodiments, without causing any inconsistency, is also included as a form for carrying out the invention. [1] A method for evaluating a methane production system that produces methane by microbial decomposition of a material containing cellulosic organic matter, The aforementioned microorganisms include methanogenic bacteria and bacteria other than methanogenic bacteria. A method for evaluating a methane production system, using bacteria other than the aforementioned methanogenic bacteria, whose abundance increases in an environment with a pH of 5.0-6.6, as biomarkers. [2] The method for evaluating a methane production system as described in [1], wherein the bacteria are of the genus Bacillus. [3] The method for evaluating a methane production system according to [1] or [2], wherein the bacteria are detected using a primer pair consisting of a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 1. [4] A method for producing methane by microbially decomposing a target material containing cellulosic organic matter, The aforementioned microorganisms include methanogenic bacteria and bacteria other than methanogenic bacteria. A methane production method comprising a step of evaluating, as a biomarker, bacteria other than the aforementioned methanogenic bacteria whose abundance increases in an environment with a pH of 5.0-6.6. [5] The method for producing methane as described in [4], wherein the bacteria are of the genus Bacillus. [6] The methane production method according to [4] or [5], wherein the bacteria are detected using a primer pair consisting of a primer consisting of the base sequence of Sequence ID No. 1 and a primer consisting of the base sequence of Sequence ID No. 1.

[0009] The following provides a detailed explanation of this disclosure. In this specification, when numerical ranges are described using "-", unless otherwise specified, both the lower and upper limits are included. For example, the description "10-20" includes both the lower limit "10" and the upper limit "20". In other words, "10-20" has the same meaning as "10 or more and 20 or less". Furthermore, in this specification, the upper and lower limits of each numerical range can be combined in any way.

[0010] 1. Evaluation method for methane production systems A method for evaluating a methane production system is a method for evaluating a methane production system that produces methane by microbially decomposing a treatment object B containing cellulosic organic matter. The microorganisms include methanogens and non-methanogenic bacteria. In the method for evaluating a methane production system, among non-methanogenic bacteria, bacteria whose abundance increases in an environment with pH 5.0 to 6.6 are used as biomarkers.

[0011] (1) Methane production system The configuration of the methane production system is not particularly limited, and the present disclosure can be applied to various methane production systems. As an example of the methane production system, the biomethane fermentation facility 10 shown in Figure 1 will be described.

[0012] The biomethane fermentation facility 10 comprises: an embankment 10A, which is heaped up to a predetermined height on soil S and mixed with the treatment object B containing cellulosic organic matter; an impermeable sheet 10B covering the embankment; and water 10C filled around the embankment 10A covered with the impermeable sheet 10B. The biomethane fermentation facility 10 is useful as a green energy technology, a renewable energy technology, etc. that uses soil as a natural fermentation bed and the treatment object B as a fermentation substrate. The soil is not particularly limited as long as an anaerobic environment can be maintained, and is preferably paddy field soil. The biomethane fermentation facility 10 can address three important issues for promoting low-carbon sustainable development: methane emission from paddy fields, management of treatment objects B such as rice straw waste, and production of biomethane as a renewable energy. The biomethane obtained in the biomethane fermentation facility 10 can be appropriately stored and used in various devices (not shown) such as power generation engines and gas heat pumps for cooling and heating.

[0013] In addition to the biomethane fermentation facility 10, the present disclosure can also be applied to a methane production system that microbially decomposes a treatment object containing cellulosic organic matter in a reaction tank without using soil.

[0014] (2) Treatment object B The object to be treated B is not particularly limited as long as it contains cellulose-based organic matter. A suitable object to be treated B is herbaceous biomass such as rice straw and weeds. The object to be treated containing cellulose-based organic matter is converted into methane through microbial decomposition treatment.

[0015] (3) Microorganisms The microorganism of the present disclosure comprises methanogens and bacteria other than methanogens. Hereinafter, a microorganism comprising methanogens and bacteria other than methanogens is also simply referred to as a microbial community. Methanogens are, for example, archaea that produce methane under anaerobic conditions. Bacteria other than methanogens are not particularly limited and may include various bacteria. Cellulolytic bacteria can be exemplified as bacteria other than methanogens. It should be noted that bacteria other than methanogens may include miscellaneous bacteria whose classification is not clear at present. In the aforementioned biomethane fermentation facility 10, microorganisms inhabiting soil S are directly used as the microbial community. In cases where the object to be treated containing cellulose-based organic matter is microbially decomposed in a reaction tank without using soil, or when an effective biomarker is not detected even when soil is used, bacteria other than methanogens (for example, specific bacteria described later) may be added from the outside to form a microbial community together with the methanogens.

[0016] In methane production systems, the methane production process by microbial communities can be evaluated by the concentration of VFAs. VFAs are intermediate metabolites of anaerobic fermentation and serve as indirect indicators of the metabolic activity of bacteria involved in acid production. Examples of VFAs include one or more volatile fatty acids selected from the group consisting of formic acid, acetic acid, propionic acid, and butyric acid. Acetic acid, in particular, is important as a substrate for methane production and is known to have a significant impact on the growth and metabolic function of microbial communities. In this disclosure, it has been found that methane production increases significantly in environments where VFAs, especially acetic acid, are not detected. The reason for this is not clear, but it is possible that the increased activity level of the microbial community led to the rapid hydrolysis of cellulosic organic matter, followed by acid production, and that the resulting VFAs were quickly used for methane production, thus preventing detection of VFAs.

[0017] Furthermore, this disclosure reveals that (1) in the initial stages of the process by the methane production system, the pH value of the methane production system increases as the concentration of VFAs increases, and (2) thereafter, as the concentration of VFAs decreases and the environment becomes such that VFAs are hardly detectable, the pH value remains below 6.6. And new findings have been obtained that stable methane production can be achieved during the period when the pH value remains below 6.6 as described in (2) above. In the methane production system of this disclosure, it is thought that the activity level of the microbial community is maintained at a high level during the period when the pH value remains below 6.6, the process of VFAs production from cellulosic organic matter and the process of methane production from VFAs reach an equilibrium state, and the rapid decomposition of cellulosic organic matter leads to the rapid production of methane.

[0018] (4) Biomarkers The inventors of this application have elucidated that the dynamic changes in bacteria other than methanogenic bacteria, whose abundance increases in an environment with a pH of 5.0-6.6 (hereinafter also referred to as "specific bacteria"), are the main factors influencing the microbial community structure within a methane production system, and that the trend of these changes is closely related to the methane production dynamics of the entire methane production system. Based on these findings, they have developed the technology of this disclosure, which uses specific bacteria as a biomarker.

[0019] Specific bacteria are determined appropriately depending on the types of bacteria included in the microbial community. Bacteria whose abundance increases in an environment with a pH of 5.0-6.6 can be identified by collecting samples at multiple time points in the methane production system process, measuring the pH value, and analyzing the microbial community composition.

[0020] The period, interval, and number of times samples are collected are not particularly limited and can be set appropriately considering the dynamics of the entire methane production system. The period for collecting samples can be set to, for example, 10 days or more. The interval for collecting samples can be set to, for example, 10 hours or more and 100 days or less. The number of times samples are collected can be set to, for example, 4 times or more. Furthermore, since the technology disclosed herein is a semi-permanently sustainable technology by continuously feeding in the material to be treated, there are no particular upper limits on the period and number of times samples are collected.

[0021] The pH value can be measured using a sensor embedded in the biomethane fermentation facility 10, or a general-purpose pH meter. For example, if the methane production system is the biomethane fermentation facility 10, the pH value can be measured by extracting soil pore water from the sample. The composition of microbial communities can be analyzed by analyzing genes extracted from soil, for example, using next-generation sequencing and real-time quantitative PCR. The abundance of specific bacteria can be measured, for example, as the copy number of a specific gene per unit amount.

[0022] The specific bacteria are preferably microorganisms that include cellulose-degrading bacteria whose abundance increases in an environment with a pH of 5.0-6.6. Among these, the specific bacteria are preferably bacteria of the genus Bacillus, and more preferably Bacillus fumarioli and / or closely related microorganisms (hereinafter simply referred to as B. fumarioli). Bacillus fumarioli is also said to be an acidophilic bacterium, and it is possible that it proliferates suitably and its abundance increases in an environment with a pH of 5.0-6.6. Whether a microorganism is Bacillus fumarioli and / or closely related can be determined by designing a primer based on the nucleotide sequence of known Bacillus fumarioli and identifying it based on the homology of the nucleotide sequence of 16S rRNA. For example, if a bacterium can be detected using a primer pair consisting of 15-25 nucleotides each that specifically hybridizes to the 16S rRNA of Bacillus fumarioli, it can be identified as "Bacillus fumarioli and / or a closely related microorganism". Examples of such primer pairs include a primer pair consisting of a primer with the nucleotide sequence of Sequence ID No. 1 and a primer with the nucleotide sequence of Sequence ID No. 2, as described later.

[0023] While bacteria phylogenetically closely related to Bacillus fumarioli have been known as aerobic bacteria, in this disclosure, Bacillus fumarioli and / or closely related microorganisms are considered to play an important role in methane production in anaerobic environments. Specifically, Bacillus fumarioli may contribute to the decomposition of cellulosic organic matter into VFAs, and subsequently to the methane production process from VFAs reaching equilibrium. This is also evident from the examples described in detail later, where, when new cellulosic organic matter was introduced in a state where Bacillus fumarioli was abundant (at time F_6 in Figure 5), the decomposition of cellulosic organic matter, the utilization of VFAs, and methane production reached an optimal balance, as shown from F_7 to F_9 in Figure 1.

[0024] Preferably, the specific bacteria are those that can be detected using a primer pair consisting of a primer with the nucleotide sequence of SEQ ID NO: 1 and a primer with the nucleotide sequence of SEQ ID NO: 2. Identifying bacteria that can serve as biomarkers in a methane production system requires complicated analytical work. By using the above primer pair, biomarkers for evaluating a methane production system can be detected without performing complicated analytical work. The sequences of the primers with the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 are as follows. The sequences are written from left to right, from the 5' end to the 3' end. Sequence ID 1 (forward primer): CGGGTCGTAAAGCTCTGTTG Sequence ID 2 (Reverse Primer): CCGTGGCTTTCTGGTTAGGTT

[0025] (5) Example of an evaluation method The evaluation method for the methane production system uses specific bacteria as biomarkers. For example, an increase in the abundance of specific bacteria serves as an indicator of improved methane production system condition. A specific example of the evaluation method is that if the abundance of specific bacteria increases at measurement point F_B compared to measurement point F_A, it is judged that the condition of the methane production system at F_B is better than at F_A. Measurement point F_A may be the measurement point immediately preceding F_B, the point immediately after the initial (first) input of the material to be treated, or an arbitrarily set measurement point. In addition, a decrease in the abundance of specific bacteria may also be used as an indicator of poor methane production system condition. Furthermore, the evaluation method may determine that the methane production system is in good condition if the abundance of specific bacteria at a certain measurement point is above a predetermined amount. The predetermined amount is not particularly limited, but can be set according to the overall condition of the methane production system. For example, the predetermined amount may be set based on the abundance immediately after the initial input of the material to be treated, or based on the copy number of the base sequence derived from the specific bacteria, etc. Furthermore, the evaluation method may also be used to determine that the methane production system is in poor condition if the amount of a specific bacterium present at a certain measurement point is below a predetermined amount.

[0026] The manner in which the evaluation results are used is not particularly limited. For example, a methane production system may use an increase in the abundance of specific bacteria as an indicator to increase the efficiency of methane production by adding the material to be treated. Specifically, if it is determined that the abundance of specific bacteria has increased significantly at a certain measurement time point F_B compared to the previous measurement time point F_A, the amount of methane produced can be significantly increased by adding the material to be treated. A significant increase means, for example, that the number of specific bacteria per unit amount has more than doubled. In addition, a methane production system may also perform management based on the abundance of specific bacteria by performing one or more of the following: adjustment of the microbial community structure, adjustment of the pH value, adjustment of Eh, change of anaerobic conditions, adjustment of temperature, and adjustment of water volume. Note that Eh is one of the values ​​that serve as an indicator of anaerobic fermentation.

[0027] 2. Methane production methods The methane production method described herein is a method for producing methane by microbially decomposing a target material B containing cellulosic organic matter. The microorganisms include at least methanogenic bacteria and non-methaneogenic bacteria. The methane production method includes a step (hereinafter also referred to as the evaluation step) for evaluating bacteria among the non-methaneogenic bacteria whose abundance increases in an environment with a pH of 5.0-6.6 as biomarkers.

[0028] The methane production method, for example, involves the evaluation method for the methane production system described above. In the methane production method, the descriptions of "(1) Methane Production System," "(2) Target Material B," "(3) Microorganisms," "(4) Biomarkers," and "(5) Example of Evaluation Method" are applied as is.

[0029] The methane production method may further include a step of adding the material to be treated, using the increase in the abundance of specific bacteria as an indicator. In addition, the methane production method may further include a control step of performing one or more of the following based on the abundance of specific bacteria: adjusting the microbial community structure, adjusting the pH value, adjusting Eh, changing anaerobic conditions, adjusting the temperature, and adjusting the water volume.

[0030] 3. Effects of this embodiment The inventors of this application have long been conducting research on efficiently producing and recovering biomethane from cellulosic waste such as rice straw as a resource in idle land such as abandoned farmland, and utilizing it as renewable energy. They had found that the productivity of biomethane was more efficiently improved when cellulosic waste was continuously administered. However, the reason for this was unknown. In order to implement this technology as a stable biomethane production technology in society, elucidating this reason was the biggest challenge. To solve this problem, the microorganisms involved in the various processes of methane production from cellulosic waste were analyzed using molecular genetic methods. As a result, it was confirmed that bacteria involved in the hydrolysis of cellulosic waste, rather than archaea directly involved in methane production, play a more important role. This disclosure is an invention relating to specific bacteria that serve as monitoring indicators in a system for more efficient biomethane production, and a method for detecting them. It is judged to have high practical value as an effective biosensor that can be useful in the system management of commercially available and proven biomethane production technologies. [Examples]

[0031] 1. Construction of a methane production system As the material to be treated, which contains cellulosic organic matter, sun-dried rice straw (carbon content: 40.7%, nitrogen content: 1.5%) was prepared. The test was conducted in an experimental unfertilized paddy field (light clay, clay: 27.2%, silt: 25.0%, sand: 47.8%) at Meijo University in Kasugai City, Aichi Prefecture (35°16′10″N, 136°58′0″E).

[0032] The method for constructing the methane production system (GET system) is as described in SH Chen, H Murano, T Hirano, Y Hayashi, H Tamura, Establishment of a novel 471 technology permitting self-sufficient, renewable energy from rice straw in 472 paddy fields. Journal of Cleaner Production., 272, (2020). A brief explanation follows. Rice straw was cut to a length of approximately 15 cm and mixed with paddy field soil to construct an embankment (fermentation bed) measuring 4.5 m in length, 0.8 m in width, and 0.2 m in height. A pH / Eh meter (Orion 3-Star plus, Thermo Fisher Scientific) and a soil liquid sampling device (DIK-8392, Daiki Rika Kogyo) were installed in the center of the embankment. The embankment was covered with an impermeable rubber sheet (2.0 m wide x 10 m long x 1 mm thick, Taiyo Kogyo) and the edges were sealed with soil. After connecting the gas collection device via the connector at the top of the rubber sheet, the experimental area was filled with water to create an anaerobic fermentation bed, and the fermentation bed was sealed using water pressure.

[0033] Rice straw was added twice. The amount added the first time was 14 kg / m². 2 The first application was counted as day 0, and the second application was carried out on day 61. The amount of the second application was 14 kg / m³. 2 In Figure 2, the point of the second injection is indicated by a dotted line (*1). The measurement samples were collected at points F_1 (day 2) to F_9 (day 133) as shown in Figure 2.

[0034] 2.Analysis method (1) Measurement of biomethane quantity, measurement of methane concentration, VFAs analysis The collected samples underwent measurements of biomethane quantity, methane concentration, and VFAs analysis. Biomethane is a methane-containing gas produced by the reductive decomposition (methane fermentation) of treated materials containing cellulosic organic matter by microorganisms. Biomethane contains 10-80% methane, with the remainder being mostly non-toxic and non-flammable gaseous components such as nitrogen and carbon dioxide. Biomethane is a low-pressure gas at a pressure slightly higher than 1 atmosphere. For the analysis of methane concentration and biomethane quantity, the amount of gas stored in the gas collection device was measured, and a portion of it was analyzed for gas composition using gas chromatography (Shimadzu Corporation).

[0035] VFAs analysis was performed by obtaining soil pore water from the sample using a soil liquid sampling device and then using high-performance liquid chromatography (HPLC) equipped with an electrical conductivity detector (Shimadzu Corporation, Prominence, organic acid analysis system).

[0036] (2) DNA and RNA extraction, cDNA synthesis DNA and RNA were extracted from the collected samples. The extraction was performed using a DNA extraction kit (FastDNA™ SPIN Kit for Soil, catalog number 6560200).

[0037] cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems®, Thermo Fisher Scientific KK).

[0038] (3) Next-generation sequencing (NGS) Library construction and sequencing of each extracted genomic DNA were performed using the Illumina MiSeq system. The V3-V4 hypervariable region was amplified using primer sets 341F(5′-CCTACGGGNGGCWGCAG-3′) (SEQ ID NO: 11) and 805R(5′-GACTACHVGGGTATCTAATCC-3′) (SEQ ID NO: 12), and the microbial community structure and diversity in the GET system were analyzed.

[0039] The nucleotide sequences of the purified samples were determined by an external institution. The determined sequences were subjected to homology searches using NCBI BLAST.

[0040] (4) Real-time quantitative PCR To determine the copy number of the gene, real-time quantitative PCR was performed using Step One Plus® (Applied Biosystems). The sequence of the target gene and the primers used for amplification are as follows. The sequence is written from left to right, from the 5' end to the 3' end. Forward primer (B. fumarioli f) CGGGTCGTAAAGCTCTGTTG (SEQ ID NO: 1) Reverse primer (B. fumarioli r) CCGTGGCTTTCTGGTTAGGTT (SEQ ID NO: 2) Forward primer (B. flexus f) CAGCCCCACCCTTGACTTT (SEQ ID NO: 3) Reverse primer (B. flexus r) CGGCCATTGTATGACGTGTG (SEQ ID NO: 4) Forward primer (C. butyricum f) ATGCAGCACCCAAGTTAAGC (SEQ ID NO: 5) Reverse primer (C. butyricum r) AGCGTTGTCCGGATTTACTG (SEQ ID NO: 6) Forward primer (C. bowmani f) TAAATCCGGACAACGCTTGC (SEQ ID NO: 7) Reverse primer (C. bowmani r) GACGGTCTTCGGATTGTAAAGC (SEQ ID NO: 8) Forward primer (McrA159F f) AAAGTGCGGAGCAGCAATCACC (SEQ ID NO: 9) Reverse primer (McrA345R r) TCGTCCCATTCCTGCTGCATTGC (Sequence ID 10)

[0041] The PCR reaction mixture consisted of 10.0 μL of Fast SYBR Green Master Mix, 1.6 μL of template (10 ng / 1.6 μL), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), and 7.6 μL of water, totaling 20 μL. The PCR reaction conditions were 95°C for 20 seconds → 95°C for 3 seconds, 60°C for 20 seconds, 95°C for 15 seconds for 40 cycles → 60°C for 10 seconds → 95°C for 15 seconds.

[0042] 3. Results regarding biomethane quantity, methane concentration, VFAs concentration, and pH value. Figure 2 shows the results for biomethane volume, methane concentration, VFAs concentration, and pH value. In Figure 2, the graph in the gray area represents the biomethane volume (L day). -1 The graphs with white triangles represent the concentration of butyric acid (mM). The graphs with white circles represent the concentration of propionic acid (mM). The graphs with white diamonds represent the concentration of acetic acid (mM). The thick gray line graph represents the concentration of formic acid (mM). The concentration of formic acid remained at approximately 0 mM throughout the test period. Figure 3 shows an enlarged view of the biomethane amount, methane concentration, and VFAs concentration results from day 2 to day 54 in Figure 2. In Figure 3, the graphs with crossed-out plots represent the methane concentration (%).

[0043] The following details regarding the amount of biomethane, methane concentration, and VFAs concentration at each sample collection point. F_1 (Day 2): Immediately after the first application of rice straw. F_2 (Day 9): The amount of biomethane and the methane concentration begin to increase. The concentrations of acetic acid and butyric acid reach their maximum. F_3 (Day 19): The amount of biomethane and the methane concentration reach their maximum. The concentrations of acetic acid and butyric acid are on a downward trend. F_4 (Day 27): The concentration of propionic acid reached its maximum, but acetic acid and butyric acid were not detected. F_5 (Day 40): No VFAs were detected. F_6 (Day 54): Phase 1 complete. F_7 (Day 61): Second batch of rice straw added. F_8 (Day 72): The amount of biomethane and the methane concentration reach their maximum. F_9 (Day 133): Phase 2 complete.

[0044] After the first addition of rice straw, the pH value rose to approximately 6.7, which correlated with a sharp increase in VFAs concentration. After the second addition of rice straw, the pH value decreased despite the absence of detected VFAs, and remained generally below pH 6.6.

[0045] 4. Classification based on next-generation sequencing results (1) Classification at the phylum level The GET system identified 34 phyla, with Proteobacteria (32.5%), Firmicutes (17.8%), Actinobacteria (11.2%), Chloroflexi (10%), and Acidobacteria (8.6%) being the major groups.

[0046] (2) Classification at the genus level In the GET system, among the 280 genera classified, the genus Bacillus was dominant, with the genus Clostridium accounting for 2.7%. Among methanogenic bacteria, only the genus Methanosaeta reached an average abundance of 1.5%.

[0047] The genera Bacillus and Clostridium belong to the phylum Firmicutes. It was found that changes in the abundance ratio within the Firmicutes phylum were primarily caused by the genus Bacillus. The abundance ratio of Bacillus increased from 3.2% in F_5 to 16.2% in F_6. After the second application of rice straw, the average abundance ratio of Bacillus remained around 15%. The abundance ratio of Bacillus after the second application was approximately five times that after the first application. In contrast, the abundance ratio of Clostridium did not show significant changes throughout the experiment, consistently remaining at around 2%. The abundance ratio of Methanosaeta also remained stable at around 1.5% throughout the experiment. The difference in the microbial community before and after the second application of rice straw was found to be due to the increase in the abundance ratio of Bacillus after the second application. This suggests that the genus Bacillus is a major factor influencing the accumulated microbial community structure within the GET system.

[0048] 3. Species-level quantitative analysis based on real-time quantitative PCR (1) Methanogenic bacteria (archaea) The mcrA gene (methylcoenzyme M reductase alpha subunit gene) encodes the alpha subunit of methylcoenzyme M reductase, a crucial enzyme in the methane synthesis pathway of methanogenic bacteria, and catalyzes the final step in the reduction of methylcoenzyme M to methane. Quantitative analysis of the mcrA gene can be used to estimate the abundance of methanogenic bacteria.

[0049] Figure 4 shows the results of quantitative analysis of the mcrA gene. The horizontal axis, F_1 ​​to F_9, indicates the time at which each sample was collected, and the vertical axis shows the copy number of the target gene per unit amount. In the graph in Figure 4, the dotted line represents the time when rice straw was added for the second time.

[0050] Quantitative analysis of the mcrA gene revealed that after the first application of rice straw, methanogenic bacteria slowly increased, then decreased from F4 onwards. After the second application of rice straw, the decrease in methanogenic bacteria continued, reaching its lowest point at F8, before recovering and stabilizing.

[0051] Throughout the entire experiment, the fluctuations in methanogenic bacteria were not significant. After the second application of rice straw, methane production in the GET system increased significantly, but these results suggest that this increase was not due to methanogenic bacteria.

[0052] (2)Clostridium genus Analysis of species-level classification using next-generation sequencing identified the dominant species in the genus Clostridium as Clostridium bowmani and Clostridium butylicum. Quantitative analysis of these two species was performed using the specific primers described above, based on the sequences obtained from next-generation sequencing.

[0053] As a result, the abundance of Clostridium bowmani tended to decrease slowly after the first and second application of rice straw, and then gradually increase thereafter (not shown). Figure 5 shows the results of the quantitative analysis of Clostridium butylicum. The horizontal axis, F_1 ​​to F_9, indicates the time at which each sample was collected, and the vertical axis shows the copy number of the target gene per unit amount. In the graph in Figure 5, the dotted line represents the time when the second batch of rice straw was added. The abundance of Clostridium butylicum remained stable throughout the experiment period, except for F_1, which was immediately after the first batch of rice straw was added.

[0054] After the second application of rice straw, methane production in the GET system increased significantly, but these results suggest that this increase was not due to bacteria of the genus Clostridium.

[0055] (3) Bacillus genus Analysis of species-level classification using next-generation sequencing identified Bacillus fumarioli and Bacillus flux as the dominant species classified under the genus Bacillus. Quantitative analysis of these two species was performed using the specific primers described above, based on the sequences obtained from next-generation sequencing.

[0056] Figure 6 shows the results of the quantitative analysis of Bacillus fumarioli. The horizontal axis, F1 to F9, indicates the time at which each sample was collected, and the vertical axis shows the copy number of the target gene per unit amount. In the graph in Figure 6, the dotted line represents the time when rice straw was added for the second time. The copy number of Bacillus fumarioli from F1 to F5 was 4 × 10⁻⁶. 12 The levels remained low as follows. The copy number of Bacillus fumarioli increased fourfold in F_6 compared to F_5. After the second application of rice straw immediately following F_6, the copy number of Bacillus fumarioli decreased slightly, and then increased significantly. The change in the abundance of Bacillus fumarioli corresponded to an increase in the proportion of Bacillus species in the GET system after the second application of rice straw and a significant increase in methane production. This suggests that the significant increase in methane production after the second application of rice straw, despite the absence of detectable VFAs, is attributable to the increased abundance of Bacillus fumarioli. Therefore, Bacillus fumarioli was found to be usable as a biomarker in the GET system.

[0057] Figure 7 shows the results of quantitative analysis of Bacillus flux. The horizontal axis, F_1 ​​to F_9, indicates the time points at which each sample was collected, and the vertical axis shows the copy number of the target gene per unit amount. The abundance of Bacillus flux fluctuated significantly throughout the entire experiment. This fluctuation pattern did not coincide with the changes observed in the genus Bacillus in next-generation sequencing, suggesting that it cannot serve as a biomarker for understanding the dynamics of the methane production system.

[0058] 4. Discussion In the GET system, the abundance (proportion) of Bacillus increased significantly after F6, but the concentration of VFAs, particularly acetic acid, the main substrate for methanogenic bacteria, decreased to below the detection limit. Subsequently, acetic acid was not detected throughout the entire experiment after the second application of rice straw. Generally, acidification of methane production systems is known to suppress methane production, but in the GET system, after F6, when the pH dropped below 6.4, the amount of biomethane after the second application of rice straw was higher than the maximum value after the first application of rice straw.

[0059] The main difference between the composition ratio of microbial communities from F1 to F6 and the composition ratio of microbial communities from F6 onward was attributed to the abundance of Bacillus species. It was found that the change in the composition ratio of microbial communities from F6 onward was due not to methanogenic bacteria or Clostridium species, which are generally assumed to be involved in methane production, but rather to an increase in Bacillus species, whose abundance increases in environments with a pH of 5.0-6.6.

[0060] Regarding the role of the Bacillus genus in anaerobic fermentation, it has been shown that they may play an important role in the biodegradation of organic compounds under anaerobic conditions. For example, several studies have reported that Bacillus bacteria decompose volatile fatty acids such as acetic acid under anaerobic conditions. Furthermore, some Bacillus bacteria have been reported to decompose lignocellulosic biomass and produce biofuels such as methane and ethanol in anaerobic fermentation processes. In addition, the role of Bacillus bacteria in the production of biofuels and bioproducts has been extensively studied, and it has been reported that Bacillus bacteria exhibit the ability to produce ethanol, butanol, and other biofuels through the fermentation of various substrates. Moreover, Bacillus bacteria can produce a wide range of enzymes, including proteases, lipases, and cellulases, and have shown various industrial applications. However, it is not known that Bacillus bacteria, whose abundance increases in environments with a pH of 5.0-6.6, can be used as biomarkers in methane production systems. This disclosure is based on the discovery of previously unknown attributes of bacteria of the genus Bacillus, which have led to the finding that these attributes make these bacteria suitable for use in new applications.

[0061] This embodiment provides a novel and unprecedented technology for evaluating methane production systems using bacteria, particularly those of the genus Bacillus, which increase in abundance under pH 5.0-6.6 conditions, as biomarkers. The GET system is a useful technology that can also contribute to climate change mitigation, and the biomarkers in this embodiment are groundbreaking in that they provide an indicator for confirming whether the GET system is functioning correctly.

[0062] This disclosure is not limited to the embodiments detailed above, and various modifications or changes are possible. [Explanation of Symbols]

[0063] 10… Biomethane fermentation equipment 10A... Embankment 10B...Waterproof sheet 10C…water

Claims

1. A method for evaluating a methane production system that produces methane by microbially decomposing a target material containing cellulosic organic matter, The aforementioned microorganisms include methanogenic bacteria and bacteria other than methanogenic bacteria. A method for evaluating a methane production system, using bacteria other than the aforementioned methanogenic bacteria, whose abundance increases in an environment with a pH of 5.0–6.6, as biomarkers.

2. The method for evaluating a methane production system according to claim 1, wherein the bacteria are bacteria of the genus Bacillus.

3. The method for evaluating a methane production system according to claim 1 or claim 2, wherein the bacteria are bacteria detected using a primer pair consisting of a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO:

2.

4. A methane production method that produces methane by microbially decomposing a target material containing cellulosic organic matter, The aforementioned microorganisms include methanogenic bacteria and bacteria other than methanogenic bacteria. A methane production method comprising a step of evaluating, as a biomarker, bacteria other than the aforementioned methanogenic bacteria whose abundance increases in an environment with a pH of 5.0-6.

6.

5. The methane production method according to claim 4, wherein the bacteria are bacteria of the genus Bacillus.

6. The methane production method according to claim 4 or 5, wherein the bacteria are bacteria detected using a primer pair consisting of a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO: 2.

Citation Information

Patent Citations

  • Bio methane fermentation equipment

    JP2019147089A