Statins are inhaled to treat viral respiratory diseases.
Patent Information
- Application Number
- JP2026093420
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-03-08
- Filing Date
- 2026-06-03
- Publication Date
- 2026-09-17
Smart Images

Figure 2026148588000001_ABST
Abstract
Description
[Background Art]
[0001] Cross-reference to Related Applications The present application claims priority from U.S. Provisional Application No. 63 / 021,618 filed on May 7, 2020 and U.S. Provisional Application No. 63 / 158,144 filed on March 8, 2021, the entire contents of each of which are incorporated herein by reference for all purposes. Statement of Rights to an Invention Made Under Federally Funded Research and Development
[0002] This application was made with government support. The government has certain rights in this invention.
[0003] A previously unknown coronavirus emerged in late 2019 and spread to become a global pandemic by early 2020. The virus, SARS-CoV-2, can cause severe pulmonary complications, including severe respiratory failure, acute lung injury (ALI), acute respiratory distress syndrome (ARDS), pneumonia, sepsis, coagulopathy, and death, but is asymptomatic in many cases. The disease caused by this virus is known as COVID-19. By the end of April 2020, the COVID-19 pandemic had more than 3 million confirmed cases worldwide, with 200,000 deaths attributed to the disease.
[0004] This virus is thought to spread via respiratory droplets and / or aerosols, initially infecting epithelial cells of the nasopharynx, and then infecting the respiratory tract and lungs. SARS-CoV-2 accesses the cytoplasm of epithelial cells by binding to the cell surface receptor angiotensin-converting enzyme 2 (ACE2, UniProtKB Q9BYF1). For the virus to enter, both the binding of the S ("spike") protein to ACE2 and its cleavage by TMPRSS2 (transmembrane serine protease 2, UniProtKB O15393) are required. TMPRSS2 is a serine protease also found on the extracellular surface of epithelial cells (M. Hoffman et al., Cell (2020) 181:271-80).
[0005] SARS-CoV-2 spreads easily from person to person, but many COVID-19 infections appear asymptomatic, even if large amounts of the virus are being released from the nasopharynx. However, some COVID-19 infections can be fatal, often causing severe illness and requiring hospitalization and intensive care. Numerous candidate treatments exist, and a vaccine is under development, but there is currently no effective treatment for COVID-19. [Overview of the Initiative]
[0006] In some embodiments, the present invention provides a method for alleviating viral respiratory infections in subjects requiring alleviation, the method comprising administering to a subject with a viral respiratory infection a formulation containing a therapeutically effective amount of statin and a pharmaceutically acceptable base, either intranasally or by inhalation.
[0007] In some embodiments, the present invention provides a method for treating a viral respiratory infection in a person requiring treatment, the method comprising administering, intranasally or by inhalation, a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable base to a person suffering from or potentially exposed to the viral respiratory infection.
[0008] In some embodiments, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of statin; at least one additional therapeutic agent; and a pharmaceutically acceptable base.
[0009] In some embodiments, the present invention provides a pharmaceutical formulation for treating viral respiratory diseases, the composition comprising a therapeutically effective amount of a statin, or its isomer, enantiomer, or diastereomer; and a pharmaceutically acceptable base suitable for inhalation administration.
[0010] In some embodiments, the present invention provides a method for treating SARS-CoV-2 virus infection in subjects requiring treatment, the method comprising administering to a subject suffering from the viral respiratory infection an effective amount of statin and a formulation comprising a pharmaceutically acceptable base intranasally or by inhalation.
[0011] In some embodiments, the present invention provides a method for treating SARS-CoV-2 virus infection in subjects requiring treatment, the method comprising administering to subjects potentially exposed to the SARS-CoV-2 virus a formulation comprising a therapeutically effective amount of statin and a pharmaceutically acceptable base, either intranasally or by inhalation.
[0012] In some embodiments, the present invention provides a method for reducing the severity of COVID-19 in subjects infected with SARS-CoV-2, the method comprising administering a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable base intranasally or by inhalation.
[0013] In some embodiments, the present invention provides a method for preventing viral entry into cells, the method comprising administering a therapeutically effective amount of statin, wherein the virus is the SARS virus. [Brief explanation of the drawing]
[0014] [Figure 1] Figure 1 shows a reduction in cellular cholesterol in human bronchial epithelial cells (HBE1) after 48 hours of treatment with simvastatin. Simvastatin was applied at concentrations of 50, 100, 200, and 400 nM. Significant inhibition (p<0.05) is indicated by an asterisk (*).
[0015] [Figure 2] Figure 2 shows a reduction in cellular cholesterol in human bronchial epithelial cells (HBE1) after 48 hours of treatment with simvastatin. Simvastatin was applied at concentrations of 1, 5, 10, and 20 μM. Significant inhibition (p<0.05) is indicated by an asterisk (*).
[0016] [Figure 3A] Figures 3A-3C show data from the ACE2 assay. Figure 3A shows the capillary scan, Figure 3B shows the MST trace, and Figure 3C shows the dose-response curve.
[0017] [Figure 3B] Figures 3A-3C show data from the ACE2 assay. Figure 3A shows the capillary scan, Figure 3B shows the MST trace, and Figure 3C shows the dose-response curve.
[0018] [Figure 3C]Figures 3A to 3C show data from the ACE2 assay. Figure 3A shows a capillary scan, Figure 3B shows an MST trace, and Figure 3C shows a dose-response curve.
[0019] [Figure 4] Figure 4 shows data from the statin ligand assay.
[0020] [Figure 5] Figure 5 shows cell viability data of INS-102 and INS-103 after cells were treated with INS-102 and INS-103 for 72 hours.
[0021] [Figure 6] Figure 6 shows cell viability data of INS-102 and INS-103 after cells were pre-treated with the compounds for 6 to 24 hours.
[0022] [Figure 7] Figure 7 shows cell viability data of INS-102 and INS-103 after cells were infected with the virus for 1 hour, followed by addition of INS-102 or INS-103.
[0023] [Figure 8] Figure 8 shows cell viability data of INS-102 and INS-103 after cells were infected with the virus for 24 hours, followed by addition of INS-102 or INS-103. The compound was contacted with infected cells for 48 hours.
[0024] [Figure 9] Figure 9 shows cell viability data of INS-102 and INS-103 after cells were infected with the virus for 48 hours, followed by addition of INS-102 or INS-103. The compound was contacted with infected cells for 24 hours.
[0025] [Figure 10]Figure 10 shows data on cell viability for INS-102 and INS-103 after cells were pretreated with the virus for 6 hours and then infected with the virus for 72 hours.
[0026] [Figure 11] Figure 11 shows data on cell viability for INS-102 and INS-103 after cells were pretreated with INS-102 or INS-103 for 24 hours and then infected with the virus for 72 hours.
[0027] [Figure 12] Figure 12 shows data on cell viability for INS-102 and INS-103 after cells were pretreated with INS-102 or INS-103 for 1 hour and then infected with the virus for 72 hours.
[0028] [Figure 13] Figure 13 shows the viral load data for INS-102.
[0029] [Figure 14] Figure 14 shows the viral load data for INS-103.
[0030] [Figure 15] Figure 15 shows the Luminex experimental IL-6 production for INS-102 and INS-103.
[0031] [Figure 16] Figure 16 shows the Luminex experimental IL-8 production for INS-102 and INS-103.
[0032] [Figure 17] Figure 17 shows the Luminex experimental IL-10 production for INS-102 and INS-103.
[0033] [Figure 18]Figure 18 shows the Luminex experimental IL-1α production for INS-102 and INS-103.
[0034] [Figure 19] Figure 19 shows the ELISA experimental IL-6 production for INS-102 and INS-103.
[0035] [Figure 20] Figure 20 shows a schematic of the research design for the hamster model.
[0036] [Figure 21] Figure 21 shows that animals treated in the control group maintained a relatively constant body weight. Conversely, animals treated with SARS-CoV-2 and no medication experienced weight loss, while animals treated with pitavastatin experienced less weight loss.
[0037] [Figure 22] Figure 22 shows the viral titer from nasal swab samples.
[0038] [Figure 23] Figure 23 shows a comparison of viral titers.
[0039] [Figure 24] Figure 24 shows the viral titers in nasal swabs (left) and trachea (right) of hamsters treated with pitavastatin and a control on day 3 post-infection.
[0040] [Figure 25] Figure 25 shows the viral titers in lung samples (R2 - right lobe - right medial; R4 - right lobe - superior superior vena cava) from hamsters treated with pitavastatin and a control on day 3 post-infection.
[0041] [Figure 26] Figure 26 shows the histopathological examination of lungs from the treated and control samples.
[0042] [Figure 27] Figure 27 shows the blinded scores for the pneumonia grade of all infected animals, based on the mean ± SEM of lung histopathological examinations, graded according to the severity of inflammation.
[0043] [Figure 28] Figure 28 shows the histopathological score based on the percentage of lung tissue affected.
[0044] [Figure 29] Figure 29 shows data for INS-102 administered as prior treatment 6 hours before SARS-CoV-2 (MOI 0.01) infection. Viral load was measured by RT-PCR (ORF1ab gene) performed 24 hours post-infection. The reduction in viral load was enhanced with the use of remdesivir or dexamethasone in combination with statins compared to monotherapy.
[0045] [Figure 30] Figure 30 shows data for INS-103 and SARS-CoV-2 (MOI 0.01) mixed at room temperature for 1 hour before being added to cells. Viral load is measured by RT-PCR (ORF1ab gene) performed 24 hours after infection. The reduction in viral load is enhanced with the use of remdesivir or dexamethasone in combination with statins compared to monotherapy.
[0046] [Figure 31] Figure 31 shows data for INS-104 and SARS-CoV-2 (MOI 0.01) mixed at room temperature for 1 hour before addition to cells. Viral load was measured by RT-PCR (ORF1ab gene) performed 24 hours after infection. The effect of statins is synergistic with dexamethasone and remdesivir. INS-104 alone reduced viral load by only 22% compared to the control. Dexamethasone alone reduced it by 46%.
[0047] [Figure 32] Figure 32 shows the details of the cell setup and processing for INS-102.
[0048] [Figure 33] Figure 33 shows a statistical analysis of cell treatment using INS-102.
[0049] [Figure 34] Figure 34 shows the details of the cell setup and processing for INS-103.
[0050] [Figure 35] Figure 35 shows a statistical analysis of cell treatment using INS-103.
[0051] [Figure 36] Figure 36 shows the cell study setup for INS-102 and INS-103.
[0052] [Figure 37] Figure 37 shows the statistical analysis of the Luminex assay regarding IL-6 production.
[0053] [Figure 38] Figure 38 shows the statistical analysis of the Luminex assay regarding IL-8 production.
[0054] [Figure 39] Figure 39 shows the statistical analysis of the Luminex assay for IL-10 production.
[0055] [Figure 40] Figure 40 shows the statistical analysis of the Luminex assay for IL-1α production.
[0056] [Figure 41] Figure 41 shows the statistical analysis of the ELISA assay for IL-6 production.
[0057] [Figure 42A]Figure 42A shows the INS-102 combination data when the statin is 1 μM. Figure 42B shows the INS-102 combination data when the statin is 0.1 μM. Figure 42C shows the INS-102 combination data when the statin is 10 μM.
[0058] [Figure 42B] Figure 42A shows the INS-102 combination data when the statin is 1 μM. Figure 42B shows the INS-102 combination data when the statin is 0.1 μM. Figure 42C shows the INS-102 combination data when the statin is 10 μM.
[0059] [Figure 42C] Figure 42A shows the INS-102 combination data when the statin is 1 μM. Figure 42B shows the INS-102 combination data when the statin is 0.1 μM. Figure 42C shows the INS-102 combination data when the statin is 10 μM.
[0060] [Figure 43] Figure 43 shows the INS-103 combination data when the statin is 1 μM.
[0061] [Figure 44A] Figure 44A shows INS-104 combination data when the statin is 5 μM, dexamethasone is 1 nM, and remdesivir is 1 nM. Figure 44B shows INS-104 combination data when the statin is 5 μM, dexamethasone is 1 nM, and remdesivir is 10 nM.
[0062] [Figure 44B] Figure 44A shows INS-104 combination data when the statin is 5 μM, dexamethasone is 1 nM, and remdesivir is 1 nM. Figure 44B shows INS-104 combination data when the statin is 5 μM, dexamethasone is 1 nM, and remdesivir is 10 nM.
[0063] [Figure 45] Figure 45 shows the results measured 24 hours after infection with SARS-CoV-2 following pretreatment with a low dose of INS-102 for 6 hours.
[0064] [Figure 46] Figure 46 shows the results measured 24 hours after infection with SARS-CoV-2 following pretreatment with a low dose of INS-103 for 6 hours.
[0065] [Figure 47] Figure 47 shows the results measured 24 hours after infection with SARS-CoV-2 following pretreatment with a high dose of INS-104 for 6 hours.
[0066] [Figure 48] Figure 48 shows the results after low-dose INS-102 was pre-mixed with SARS-CoV-2 at room temperature for 1 hour, then incubated with Calu-3 cells, and measured 24 hours after infection.
[0067] [Figure 49] Figure 49 shows the results after pre-mixing a moderate dose of INS-103 with SARS-CoV-2 at room temperature for 1 hour, followed by incubation with Calu-3 cells, and measurements taken 24 hours after infection.
[0068] [Figure 50] Figure 50 shows the results after low-dose INS-104 was pre-mixed with SARS-CoV-2 at room temperature for 1 hour, then incubated with Calu-3 cells, and measured 24 hours after infection.
[0069] [Figure 51] Figure 51 shows the results after pre-mixing a moderate dose of INS-104 with SARS-CoV-2 at room temperature for 1 hour, followed by incubation with Calu-3 cells, and measurements taken 24 hours after infection.
[0070] [Figure 52] Figure 52 shows the results measured 72 hours after infection with SARS-CoV-2 following pretreatment with a low dose of INS-103 for 6 hours.
[0071] [Figure 53] Figure 53 shows the results measured 72 hours after infection with SARS-CoV-2 following pretreatment with a high dose of INS-103 for 6 hours.
[0072] [Figure 54] Figure 54 shows the results after INS-103 was pre-mixed with SARS-CoV-2 at room temperature for 1 hour, incubated with Calu-3 cells, and measured 72 hours after infection.
[0073] [Figure 55] Figure 55 shows the results after INS-104 was pre-mixed with SARS-CoV-2 at room temperature for 1 hour, incubated with Calu-3 cells, and measured 72 hours after infection. [Modes for carrying out the invention]
[0074] I. General The need for novel antiviral agents is being met by a new approach using statins. This approach provides a new mechanism to inhibit or prevent viral entry into cells and alleviates symptoms by directly delivering statins to the nasal passages and airways via inhalation.
[0075] Both ACE2 and TMPRSS2, as well as other receptors, are known to be associated with lipid rafts in the cell membrane. Lipid rafts are membrane microdomains that are more rigid and densely packed than the surrounding membrane. These rafts contain high concentrations of cholesterol and sphingolipids. Without being confined to any particular theory, it is currently believed that lipid rafts are necessary for the support and function of at least some surface receptors.
[0076] Statins are 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase) inhibitors that block mevalonic acid (MA) and the downstream isoprenoid lipids farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP). Currently in the United States, statins are the only oral lipid-lowering agents approved.
[0077] Direct administration of statins to the airways delivers an effective amount of statin to the airway epithelium and smooth muscle, but this is not achieved with oral administration. When inhaled, statins reduce intracellular cholesterol synthesis in airway epithelial cells, thereby reducing lipid rafts. Since ACE2 activity is inhibited without the support of lipid rafts, the entry routes for SARS-CoV-2 and other viruses that rely on ACE2 for entry are reduced or eliminated. This leads to a decrease in infection rates and, as a result, a reduction in symptoms. Similarly, viruses that rely on other surface proteins for entry are also inhibited or reduced by inhaled statin administration if their surface proteins depend on lipid rafts for structure and / or function.
[0078] II. Definition Unless otherwise specified, all scientific and technical terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention pertains. In addition, the present invention can be carried out using methods or materials similar to or equivalent to any method or material described herein. For the purposes of the present invention, the following terms are defined:
[0079] As used herein, “one” or “that” includes not only aspects having one member but also aspects having two or more members. For example, the singular forms “one” and “that” include plurals, unless the context clearly indicates something different. Thus, for example, a reference to “one cell” includes multiple such cells, and a reference to “that drug” includes one or more drugs known to those skilled in the art. “A and / or B” herein includes any of the following: namely “A,” “B,” “A or B,” and “A and B.”
[0080] Where a range of values is given, the values between the upper and lower limits of that range, and between any other values that fall within that range as described (up to 1 / 10 of the lower limit unit, unless the context makes it clear that they are different), are included in the present invention. The upper and lower limits of these narrower ranges can independently be included within those narrower ranges and are also included in the present invention, unless the limits within those ranges described are specifically excluded. If the described range includes one or both limits, the range excluding one or both of those limits is also included in the present invention.
[0081] Every scope disclosed herein includes all possible subscopes and combinations thereof. Any scope listed can be considered to adequately describe the same scope that can be divided into at least equal halves, thirds, quarters, fifths, tenths, etc., and the same scope can be divided in this way. As a non-restrictive example, each scope discussed herein can be readily divided into a lower third, a middle third, an upper third, etc. As will be apparent to those skilled in the art, all expressions such as “up to,” “at least,” “greater than,” and “less than” include the numbers listed and mean a scope that can then be divided into the subscopes described above. Finally, as will be apparent to those skilled in the art, each scope includes a distinct number. Thus, for example, the group having 1 to 3 articles means the group having 1, 2, or 3 articles. Similarly, the group having 1 to 5 articles means the group having 1, 2, 3, 4, or 5 articles, and so on.
[0082] For clarity, some features of this disclosure described in the context of separate embodiments may be combined and presented in a single embodiment. Conversely, various features of this disclosure described in the context of a single embodiment for brevity may be presented separately or in any appropriate subcombination. All combinations of embodiments relating to this disclosure are specifically included in this disclosure and are disclosed herein as if all individual combinations were individually and explicitly disclosed. In addition, all subcombinations of various embodiments and their elements are specifically included in this disclosure and are disclosed herein individually and explicitly as if all individual subcombinations were individually and explicitly disclosed.
[0083] "Statins" are small molecule HMG-CoA reductase inhibitors. Statins are designed to block the mevalonate metabolic pathway, thereby reducing the production of FPP, GGPP, and cholesterol in the body. Non-limiting examples of suitable statins in this disclosure include simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin, and their isomers, enantiomers, and diastereomers. Hydrophobic statins include simvastatin, pitavastatin, and other statins with similar hydrophobicity. Hydrophilic statins include pravastatin and other statins with similar hydrophilicity.
[0084] The term "therapeutic dose" means the amount of statin (or isomer, enantiomer, diastereomer) or mixture thereof that, when administered by inhalation, is sufficient to alleviate a viral respiratory infection. Alleviation of viral respiratory infections may include reducing damage to the airway epithelium, and reducing or preventing symptoms (including serious symptoms such as ARDS, viral pneumonia, pulmonary embolism, respiratory failure, sepsis, acute lung injury (ALI), or death). Subjects infected with some viruses (e.g., SARS-CoV-2) may be asymptomatic or exhibit only mild symptoms, leading to unnoticed transmission to others they come into contact with. Thus, another measurable alleviation of viral respiratory infections includes a reduction in the viral load (e.g., the amount of virus in the subject's body measured or estimated using a PCR-based assay) or the amount of virus released by a subject infected with a respiratory viral disease.
[0085] The terms “preventive” or “preventive treatment” mean a preventive treatment that can protect against the development or progression of a disease or its symptoms, and / or minimize the adverse effects of the disease. In some cases, preventive treatment includes blocking or substantially reducing infection (e.g., viral entry into cells or tissues), so that the disease is blocked or substantially reduced.
[0086] "Sub-therapeutic dose" means the dose of one or more drugs in a synergistic or enhanced combination formulation, method, or system, where the dose of the drug is reduced to a level that would be considered insufficient or sub-therapeutic when administered alone, or as part of a non-synergistic or combination formulation, method, or system, but is therapeutically sufficient when administered as part of a synergistic or combination formulation, method, or system. Possible doses of the drug below the therapeutic dose include approximately 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of the effective dose of the drug when administered by inhalation as part of a non-synergistic formulation, method, or system according to this disclosure.
[0087] The term "pharmaceutically acceptable base" means an excipient that is non-toxic to the subject when administered within a range of amounts and concentrations that can dissolve and / or suspend the statin. In carrying out this disclosure, pharmaceutically acceptable bases are suitable for administration by inhalation. Pharmaceutically acceptable bases can assist in the administration of the activator to the subject and in the absorption of the activator by the subject. Non-limiting examples of pharmaceutically acceptable excipients useful in the present invention include binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, and colorants. Those skilled in the art will see that other pharmaceutically acceptable excipients are also useful in the present invention.
[0088] The term “nonviral airway disease” refers to nonviral diseases or disorders in which the substantial symptom is obstruction, restriction, or interference of airflow into and out of the lungs. Obstruction may result from contraction of airway smooth muscle (bronchoconstriction) and / or excessive mucus secretion and / or inflammation. Non-exclusive examples of nonviral lung airway diseases include asthma; exercise-induced bronchoconstriction (or exercise-induced asthma); chronic obstructive pulmonary disease (COPD) (which may include emphysema, chronic bronchitis, and / or alpha-1 antitrypsin deficiency (AATD)); asthma-COPD overlap syndrome (ACOS) (also known as asthma-COPD overlap or ACO); cystic fibrosis; acute bronchitis; eosinophilic bronchitis; stenosing bronchiolitis; infectious bronchiolitis; and bronchiectasis.
[0089] The term “viral respiratory infection” refers to a disease or disorder in which infection of airway epithelial cells and / or airway smooth muscle is the substantial symptom. Non-exclusive examples of viral respiratory infections include lung infections caused by coronaviruses (e.g., SARS-CoV, MERS-CoV, and SARS-CoV-2), morbilliviruses (e.g., measles and distemper), bunyaviruses (e.g., hantavirus and Crimean-Congo hemorrhagic fever virus), arenaviruses (e.g., lassa virus and Junin virus), influenza, rhinoviruses (e.g., the “common cold”), and adenoviruses (e.g., HAdV-B and HAdV-C).
[0090] "Antiviral" agents are compounds that can reduce or eliminate the effects of a virus on mammalian targets by inhibiting its proliferation, replication, infectivity, or other factors.
[0091] "To alleviate" or "to inhibit" refers to a compound's ability to reduce the symptoms associated with an infection. For example, the compound may reduce viral titers or viral load after administration to a target that needs it. In another, less restrictive example, the compound may reduce or suppress levels of a target's protein, cytokine, or immune response after administration.
[0092] The term "subject" refers to animals such as mammals, and its non-restrictive examples include primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, and mice. In some embodiments, the subject is a human.
[0093] The term "administer" means oral administration, administration as a suppository, topical contact, parenteral, intravenous, intraperitoneal, intramuscular, intrafocal, intranasal, or subcutaneous, intrathecal, or implantation of a sustained-release device (e.g., a mini osmotic pump).
[0094] "To treat," "to treat," and "treatment" mean any sign of success in treating or improving an injury, illness, condition, or symptom (e.g., pain), including any objective or subjective parameter, such as relief; remission; reduction of symptoms, or making the symptom, injury, illness, or condition more tolerable to the patient; reducing the frequency or duration of the symptom or condition; or, in some situations, preventing the onset of symptoms. Treatment or improvement of symptoms may be based on any objective or subjective parameter, such as the results of a physical examination.
[0095] The terms "viral titer" or "viral load" refer to the amount of virus in a certain volume of bodily fluids that can be measured by volume. Viral load can be expressed as viral particles or infectious particles per mL. A higher viral titer or viral load may correlate with the severity of an active viral infection. Non-exclusive examples of tests that can be included in determining viral load are reverse transcription-polymerase chain reaction (RT-PCR) tests, branched DNA (bDNA) tests, qualitative transcription-mediated amplification assays, and nucleic acid sequence-based amplification (NASBA) tests.
[0096] Tour. Pharmaceuticals The disclosed compositions are formulated for inhalation and administered by inhalation or spray into the nasopharynx and lungs. Ideally, the compositions are administered to be uniformly distributed throughout the nasal cavity and airways, delivering an effective amount of statin directly to the nasopharynx and orbital epithelium. This is generally achieved by administering the formulation as a collection of small particles suspended in the air or gas, where the particle size distribution affects the distance the particles penetrate distally into the trachea. The compositions may be in the form of solutions, suspensions, powders, or other forms suitable for pulmonary administration. See, for example, HM Mansour et al., Int J Nanomed (2009) 4:299-319. These compositions are administered to the lungs through appropriate devices known in the art, for example, in aerosolized, atomized, sprayed, or vaporized form. The amount of composition administered can be controlled by providing a valve for delivering a fixed dose, such as in a metered-dose inhaler (MDI) that delivers a fixed dose by spray each time the device is activated. In this way, an appropriate dose (e.g., a therapeutically effective amount) of the composition can be reliably delivered from a multi-dose device.
[0097] The formulations used for delivery are typically designed to operate in a specific mode of administration (such as aerosol formulations, spray formulations, or dry powder formulations).
[0098] The formulations of this disclosure contain a therapeutically effective amount of statin. In some embodiments, the therapeutically effective amount is at least about 0.005, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, 0.9, 1.0, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 12, 14, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 μg. In some embodiments, the therapeutically effective dose is at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, 0.9, 1.0, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 12, 14, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mg. In some embodiments, the therapeutically effective dose would be approximately 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, or 0.005 mg or less.
[0099] In some embodiments, the formulation further includes additional therapeutic agents. Since these additional therapeutic agents also do not undergo first-pass metabolism in the liver, they can also be administered in doses generally lower than those effective in oral or parenteral administration. In some embodiments, the effective dose when administered by inhalation is less than approximately 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of the dose usually recommended for oral administration.
[0100] In some embodiments, inhaled formulations are designed to deliver statins and / or additional therapeutic agents to the lower respiratory tract. In some embodiments, formulations are designed to deliver statins and / or additional therapeutic agents to the systemic circulation by absorption through the lower respiratory tract. Techniques and methods for producing inhaled formulations targeting the lower respiratory tract or systemic circulation are known: see, for example, JG Weers et al., AAPS Pharm Sci Tech (2019) 20(3):103; JS Patton et al., Proc Am Thorac Soc (2004) 1(4):338-44. Because some viruses target tissues other than the respiratory epithelium, systemic-targeted inhaled formulations are useful in reducing viral infections in non-respiratory tissues. Non-limited examples of tissues that can be targeted by delivering inhaled statins to the systemic circulation include the circulatory system, including the heart, arteries, veins, and capillaries; the intestines, including the esophagus, stomach, small intestine, and large intestine; and others.
[0101] The formulation may contain any pharmaceutically active statin or a mixture thereof. In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin, and their isomers, enantiomers, and diastereomers. In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, atorvastatin, lovastatin, and pravastatin. In some embodiments, the statin is selected from the group consisting of simvastatin and pitavastatin. In some embodiments, the statin is simvastatin. In some embodiments, the statin is pitavastatin.
[0102] Statins can be formulated as sponge-like, porous microspheres. Suitable microspheres are prepared by a two-step process. In the first step, a submicron oil-in-water (O / W) emulsion is prepared by high-pressure homogenization of long-chain saturated phospholipids (e.g., distearoylphosphatidylcholine) in water or phosphate-buffered saline. The result is a phospholipid that is incorporated as an emulsifier at the oil / water interface.
[0103] The second step involves mixing the API dropwise with a matrix-forming agent (such as sodium alginate (with controlled gelation using calcium), chitosan, trehalose, raffinose, leucine, hydroxypropyl methylcellulose, or hydroxypropyl-β-cyclodextrin) and / or a dispersant (such as Pluronics® F-68 (polyoxyethylene-polyoxypropylene diblock copolymer)) to form an oil-in-water emulsion. The resulting mixture is either atomized for administration or spray-dried to produce a dry powder formulation for administration.
[0104] The formulations of the present disclosure may further include additional therapeutic agents, which may be selected from antiviral agents such as RNA polymerase inhibitors, TMPRSS2 inhibitors, viral protease inhibitors, viral regulatory protein inhibitors, viral capsid assembly inhibitors, viral entry inhibitors, viral membrane coating or enucleation inhibitors, and immunostimulants (e.g., IFNγ). Non-limiting examples of antiviral agents include chloroquine or salts thereof, hydroxychloroquine or salts thereof, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, camostat or salts thereof, darunavir, oseltamivir, and ribavirin. In some embodiments, the formulations include additional antiviral agents selected from RNA polymerase inhibitors, TMPRSS2 inhibitors, viral protease inhibitors, viral regulatory protein inhibitors, viral capsid assembly inhibitors, viral entry inhibitors, and viral membrane coating or enucleation inhibitors. In some embodiments, the additional antiviral agent is chloroquine phosphate, hydroxychloroquine sulfate, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, camostat mesylate, darunavir, oseltamivir, or ribavirin. In some embodiments, the additional antiviral agent is chloroquine phosphate, hydroxychloroquine sulfate, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, camostat mesylate, or darunavir. In some embodiments, the additional antiviral agent is chloroquine or a salt or ester thereof. In some embodiments, the salt is chloroquine phosphate. In some embodiments, the additional antiviral agent is hydroxychloroquine or a salt or ester thereof. In some embodiments, the salt is hydroxychloroquine sulfate. In some embodiments, the additional antiviral agent is camostat or a salt or ester thereof. In some embodiments, the salt is camostat mesylate.In some embodiments, a combination of two or more additional antiviral agents is included. In some embodiments, the combination comprises azithromycin and chloroquine or a salt or ester thereof. In some embodiments, the combination comprises azithromycin and hydroxychloroquine or a salt or ester thereof. In some embodiments, the combination comprises azithromycin and camostat or a salt or ester thereof. In some embodiments, the additional therapeutic agent is remdesivir. In some embodiments, the additional therapeutic agent is dexamethasone. In some embodiments, the additional therapeutic agent is dexamethasone, further comprising remdesivir.
[0105] Other compounds and therapies that have been found to inhibit or interact with viral proteins, or that prevent the virus from utilizing host proteins, may also be available. In the case of SARS-CoV-2, the interaction and process between viral proteins and host proteins has recently been reported (see, for example, DE Gordon et al., Nature (2020) doi.org / 10.1038 / s41586-020-2286-9). Compounds that inhibit viral processes in vitro have recently been identified, and non-exclusive examples include bromodomain inhibitors, drugs targeting sigma 1 and / or sigma 2 receptors, antihistamines, protein translation inhibitors, antipsychotics, and anxiolytics. In some embodiments, additional antiviral agents are bromodomain inhibitors (BETS), drugs targeting sigma-1 and / or sigma-2 receptors (e.g., a non-limiting example is PB28), antihistamines (e.g., a non-limiting example is clemastine and / or cloperastine), protein translation inhibitors (e.g., a non-limiting example is zotatifine, ternatin-4, and / or pritidecin), antipsychotics (e.g., a non-limiting example is haloperidol and / or cloperazine); or cyramesin (antidepressant and anxiolytic). In some embodiments, the antiviral agent is PB28, clemastine, cloperastine, zotatifine, ternatin-4, pritidecin, haloperidol, cloperazine, or cyramesin.
[0106] The formulations of this disclosure may further include additional therapeutic agents, the choice of which may include: β-agonists; corticosteroids; muscarinic antagonists; RhoA inhibitors; GGTase-I or-II inhibitors; ROCK1 and / or ROCK2 inhibitors; soluble epoxide hydrolase inhibitors; fatty acid amide hydrolase inhibitors; leukotriene receptor antagonists; phosphodiesterase-4 inhibitors (e.g., roflumilast); 5-lipoxygenase inhibitors (e.g., dileuton); mast cell stabilizers (e.g., nedocromil); squalene synthase inhibitors (e.g., rapakistat, zaragodic acid, and RPR). 107393 etc); Farnesyl pyrophosphate synthase inhibitors (non-exclusive examples include the biphosphonates alendronate, etidronate, clodronate, tildronate, pamidronate, neridronate, olpadronate, ivadronate, risedronate, and zoledronate); Theophylline; Anti-IL5 antibodies; Anti-IgE antibodies; Anti-IL5 receptor antibodies; Anti-IL13 / 4 receptor antibodies; Biological agents (mepolizumab, reslizumab, benralizumab, omalizumab, and dupilumab etc); β-A Combinations of agonists and muscarinic antagonists (including both long-acting and short-acting formulations); combinations of β-agonists and corticosteroids (including both long-acting and short-acting formulations); combinations of corticosteroids and muscarinic antagonists (including both long-acting and short-acting formulations); and combinations of β-agonists, corticosteroids, and muscarinic antagonists (including both long-acting and short-acting formulations).
[0107] Antibody derivatives are proteins that are similar to antibodies or antibody-based and capable of binding to antigens. Examples of antibody derivatives include nanobodies, diabodies, triabodies, minibodies, F(ab')2 fragments, F(ab)v fragments, single-strand variable fragments (scFv), single-domain antibodies (sdAb), and functional fragments of these.
[0108] Non-exclusive examples of corticosteroids suitable for use as additional therapeutic agents include beclomethasone, fluticasone, budesonide, mometasone, flunisolide, alclomethasone, beclomethasone, betamethasone, clobetasol, clobetasol, crocortol, desoxymethasone, dexamethasone, diflorasone, diflucortol, flulchlorolone, flumethasone, fluocortin, fluocortol, and f These include lupredniden, fluticasone, fluticasone furoate, halomethasone, meprednisone, mometasone, mometasone furoate, parametasone, prednilidene, rimexolone, urobetasol, amcinonide, ciclesonide, deflazacort, desonide, formocortal, fluchlorone acetonide, fludroxycortide, fluocinolone acetonide, fluocinonide, halcinonide, and triamcinolone acetonide.
[0109] Muscarinic antagonists are anticholinergics that block muscarinic acetylcholine receptors, and therefore can inhibit bronchoconstriction. Non-exclusive examples of muscarinic antagonists suitable for use as additional therapeutic agents include ipratropium bromide, tiotropium bromide, glycopyrrolate, glycopyrronium bromide, lebefenacin, umeclidinium bromide, aclidinium, throspium chloride, oxytropium bromide, oxybutynin, tolterodine, solifenacin, fesoterodine, and dalifenacin.
[0110] Beta-agonists are compounds that activate β2-adrenergic receptors and are used to relax airway smooth muscle. Non-exclusive examples of beta-agonists (β-agonists) suitable for use as additional therapeutic agents include albuterol, alformoterol, buphenine, clenbuterol, bopexamine, epinephrine, fenoterol, formoterol, isoetaline, isoproterenol, orciprenaline, levoalbutamol, revalbuterol, pirbuterol, procaterol, ritodrine, albuterol, salmeterol, terbutaline, albutamine, blefonarol, bromoacetylalprenolol methane, broxaterol, simaterol, silazolin, etilephrine, hexoprenaline, higenamine, isoxuprine, mabuterol, methoxyphenamine, oxyfedrine, ractopamine, reproterol, limiterol, tretokinol, tulobuterol, zilpaterol, and dinterol.
[0111] ROCK inhibitors inhibit the enzyme ROCK kinase (ROCK1 and / or ROCK2). Appropriate ROCK inhibitors include, for example, 1-methyl-5-(1H-pyrrolo[2,3-b]pyridine-4-yl)-1H-indazole ("TS-f22", M. Shen et al., Sci Rep (2015) 5:16749), (1S)-2-amino-1-(4-chlorophenyl)-1-[4-(1H-pyrazol-4-yl)phenyl]ethanol ("AT13148", TA Yap et al., Clin Cancer Res (2012) 18(14):3912-23), and N-(6-fluoro-1H-indazol-5-yl)-6-methyl-2-oxo-4-[4-(trifluoromethyl)phenyl]-3,4-dihydro-1H-pyridine-5-carboxamide ("GSK429286A", E. Ahler et al., Mol These are Cell (2019) 74(2):393-408e20), 1-[(3-hydroxyphenyl)methyl]-3-(4-pyridine-4-yl-1,3-thiazol-2-yl)urea ("RKI-1447", H. Wang et al., Cancer Res (2017) 77(8):2148-60), and 4-[(1R)-1-aminoethyl]-N-pyridine-4-ylcyclohexane-1-carboxamide ("Y-27632", YC. Liao et al., Cell (2019) 179(1):147-64e20). Suitable RhoA inhibitors include compounds such as N-[1-(4-chloroanilino)-1-oxopropan-2-yl]oxy-3,5-bis-(trifluoromethyl)benzamide ("CCG-1423", DA Lionarons et al., Cancer Cell (2019) 36(1):68-83.e9).Suitable GGTI inhibitors include compounds such as N-(1-amino-1-oxo-3-phenylpropan-2-yl)-4-[2-(3,4-dichlorophenyl)-4-(2-methylsulfanylethyl)-5-pyridine-3-ylpyrazol-3-yl]oxybutanamide ("GGTI-DU40", YK Peterson et al., J Biol Chem (2006) 281:12445-50) and (2S)-2-[[4-[[(2R)-2-amino-3-sulfanylpropyl]amino]-2-naphthalene-1-ylbenzoyl]-amino]-4-methylpentanoic acid 2,2,2-trifluoroacetic acid ("GGTI-297", PA Subramani et al., Bioinformation (2015) 11(5):248-53). Suitable soluble epoxide hydrolase inhibitors include compounds such as 1-(1-acetylpiperidine-4-yl)-3-(1-adamantyl)urea ("AR9281", RH Ingraham et al., Curr Med Chem (2011) 18(4):587-603) and 1-(1-propanoylpiperidine-4-yl)-3-[4-(trifluoromethoxy)phenyl]urea ("TPPU", YM. Kuo et al., Mol Neurobiol (2019) 56:8451-74).
[0112] Non-limiting examples of suitable fatty acid amidohydrolase inhibitors include 4-hydroxy-N-[(5Z,8Z,11Z,14Z)-icosa-5,8,11,14-tetraenyl]benzamide ("AM-1172", CJ Hillard et al., J Mol Neurosci (2007) 33:18-24), N-phenyl-4-(3-phenyl-1,2,4-thiadiazol-5-yl)-1-piperidinecarboxamide ("JNJ 1661010", T. Lowin et al., Arth Res Ther (2015) 17:321), and N-3-pyridinyl-4-[[3-[[5-(trifluoromethyl)-2-pyridinyl]oxy]phenyl]methyl]-1-piperidinecarboxamide ("PF-3845", S. Ghosh et al.) These are compounds such as those described in al., J Pharmacol Exp (2015) 354(2):111-20). Non-limiting examples of suitable leukotriene receptor antagonists include compounds such as zafirlukast, montelukast, and dileuton.
[0113] (a) Aerosol formulations An aerosol is a suspension of small solid particles or droplets suspended in air or another gas, typically with an average diameter of less than 10 μm. Aerosol formulations for delivering drugs to the airways are known in this field. See, for example, A. Adjei et al., J Pharm Res (1990) 1:565-69; P. Zanen et al., J Int J Pharm (1995) 114:111-15; I. Gonda, Crit Rev Ther Drug Carrier Syst (1990) 6:273-313; Anderson et al., Am Rev Respir Dis, (1989) 140:1317-24; all of these contents are incorporated herein by reference in their entirety.
[0114] Compositions for aerosol administration by pressurized metered-dose inhaler (pMDI) can be formulated as solutions or suspensions. Solution compositions are easier to manufacture because the activator dissolves completely in the propellant vehicle, avoiding physical stability problems (such as particle aggregation) that sometimes accompany suspension compositions. If the drug does not dissolve sufficiently in the propellant, a co-solvent such as ethanol can be used to increase the solubility in the pharmaceutical composition for pMDI administration. In some embodiments, the formulation contains a statin dissolved in the propellant and co-solvent.
[0115] Suspension formulations can typically contain pharmaceuticals in the form of small solid particles with an average diameter of less than approximately 10 μm. Such formulations can be prepared by grinding or pulverizing a crystalline form of the pharmaceutical, or by spray-drying a solution containing the pharmaceutical. In some embodiments, the formulation comprises a powdered statin, a propellant, and a suspension vehicle. In some embodiments, the suspension vehicle is selected from cyclodextrin, PEG400, PEG1000, and propylene glycol (1,2-propanediol).
[0116] The pharmaceutical composition can be formulated with one or more suitable propellants (e.g., hydrofluoroalkanes, CO2, or other suitable gases). In some embodiments, surfactants can be added to reduce the surface tension and interplanar tension between the composition, propellant, and cosolvent (if present). As the surfactant, any suitable non-toxic compound is possible that does not react with other components of the pharmaceutical composition and reduces the surface tension and / or interplanar tension between the composition, propellant, and cosolvent to the desired extent. In some embodiments, the formulation can be surfactant-free, as it does not require a surfactant to produce and / or maintain a stable pharmaceutical composition solution under normal operating conditions.
[0117] (b) Sprayer formulations "Atomization" means reducing a liquid to a fine spray or mist. Uniformly sized small droplets are produced in a controlled manner from a larger liquid formulation, typically with an average particle size of about 0.5 μm to about 10 μm. Atomization can be achieved by any suitable means, including mechanical atomizers (Respimat® Soft Mist atomizer (formulation is squeezed out of a nozzle under spring pressure); jet atomizer (compressor compresses air or oxygen to flow a high-speed liquid, forming a mist); ultrasonic atomizer (piezoelectric transducer vibrating at ultrasonic frequencies is brought into contact with the liquid formulation, forming a mist or aerosol by vibration); or vibrating mesh atomizer (a mesh or membrane with small holes vibrates on the surface of a liquid reservoir to form a fine mist). Atomizers utilizing any of these technologies are commercially available. When multiple active ingredients are needed to be suitable for administration together or individually via atomizer, they can be in the form of atomized suspensions or solutions, adjusted to the appropriate pH or isotonicity, or not, as unit-dose or multi-dose devices.
[0118] Formulations used in spray formulations are typically primarily aqueous solutions, but this is not always necessary. If the drug to be administered is only slightly soluble in water, a pharmaceutically acceptable co-solvent (such as ethanol) can be added to dissolve or assist in dissolving the drug. Alternatively, the formulation can be a suspension of appropriately sized particles suspended primarily on an aqueous carrier. Drugs can be formulated as solid lipid microparticles (SLMs), solid lipid nanoparticles (SLNs), or liposomes and suspended in a liquid carrier for spraying or aerosolizing. See, for example, M. Paranjpe et al., Int J Mol Sci (2014) 15:5852-73; MJ de Jesus Valle et al., J Antibiot (Tokyo) (2013) 66(8):447-51 (both incorporated herein by reference). The particle size of the sprayed droplets can be controlled by a number of parameters (including, for example, the viscosity and surface tension of the formulation and the characteristics of the sprayer), as taught in this art.
[0119] (c) Dried powder formulation: Dry powder formulations, as the name suggests, do not contain a liquid base. Instead, the activator and excipients are ground or pulverized into a fine powder with a particle size suitable for inhalation. The formulations are designed to be delivered into the lungs by rapid inhalation and / or by a single puff of compressed air or gas. Dry powder formulations are particularly useful when administering drugs that are difficult to dissolve or suspend in conventional liquid carriers.
[0120] Dry powder formulations often contain one or more activators in addition to excipients. These excipients are often included to improve the product's flow properties (including dispersion and absorption properties) as well as its chemical stability during storage. Formulations can be prepared, for example, by spray drying (AA Ambike et al., Pharm Res (2005) 22(6):990-98), grinding or pulverizing, extrusion, sedimentation, and / or screening using methods known in the art to obtain aspirable powders. Mixtures of ground excipients can also be used as excipients, which are obtained by mixing excipient fragments of different average particle sizes.
[0121] Examples of physiologically acceptable excipients that can be used in the preparation of inhalable powders for use in inhalers (or their cartridges) include monosaccharides (e.g., glucose, fructose, or arabinose), disaccharides (e.g., lactose, saccharose, maltose, trehalose), oligosaccharides and polysaccharides (e.g., dextran, dextrin, maltodextrin, starch, cellulose), polyalcohols (e.g., sorbitol, mannitol, xylitol), cyclodextrins (e.g., α-cyclodextrin, β-cyclodextrin, χ-cyclodextrin, methyl-β-cyclodextrin, hydroxypropyl-β-cyclodextrin, sulfobutyl-β-cyclodextrin (Captisol®, Dexolve®))), amino acids (e.g., arginine hydrochloride), and salts (e.g., sodium chloride, calcium carbonate), or mixtures thereof. Lactose, glucose, and other compounds can be used in hydrate form. Excipients can be combined with statins before, during, or after the powdering process.
[0122] Within the range of inhalable powders, excipients can have a maximum average particle size of 10–150 μm, or 15–80 μm, up to approximately 250 μm. Finer excipient fragments with an average particle size of 1–9 μm can also be added to the above excipients. The average particle size can be determined using methods known in the art (e.g., WO 02 / 30389). Finally, to prepare an inhalable powder, a micronized crystalline statin, which can be characterized by an average particle size of approximately 0.5–10 μm or approximately 1–5 μm, is added to the excipient mixture (see e.g., WO 02 / 30389). Methods for grinding and micronizing active substances are known in the art. If a specially prepared mixture is not used as the excipient, an excipient with an average particle size of 10–50 μm and a content of 10% fine particles of 0.5–6 μm can be used. In some embodiments, the maximum average particle size is smaller than approximately 250, 225, 200, 190, 180, 170, 160, 150, 140, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 μm. In some embodiments, the average particle size is at least about 0.001, 0.005, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 19, 20, 25, 30, 35, 40, 45, or 50 μm. In some embodiments, the average particle size is smaller than approximately 250, 225, 200, 190, 180, 170, 160, 150, 140, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 μm.
[0123] In one method for preparing a dry powder formulation, the excipient and activator are placed in a suitable mixing vessel. In some embodiments, the activator has an average particle size of 0.5–10 μm, 1–6 μm, or 2–5 μm. The excipient and activator are added using a sieve or granulating sieve with a mesh size of 0.1–2 mm, 0.3–1 mm, or 0.3–0.6 mm. The excipient may be added first, followed by the activator in the mixing vessel. During this mixing process, these two components may be added in batches and sieved in alternating layers. The excipient and activator can be mixed while these two components are still being added.
[0124] The inhalable powder can also be formulated as PulmoSpheres (see, e.g., JG Weers et al., Ther Deliv (2014) 5(3):277-95; JG Weers et al., AAPS PharSciTech (2019) 20(3):103; and United States Patent No. 9452139; all incorporated herein by reference), in which a suspension of micronized drug particles is spray-dried to form a powder. Alternatively, the powder and suspension can be prepared from self-assembling nanoparticles (see, e.g., NJ Kenyon et al., PLOS One (2013) doi.org / 10.1371 / journal.pone.0077730).
[0125] inhaler The three main types of inhalers are nebulizers, pressurized metered-dose inhalers (pMDIs), and dry powder inhalers (DPIs). Nebulizers convert a drug solution or suspension into a fine mist of droplets, which are then inhaled into the lungs. Nebulizers typically take longer to administer medication than pMDIs or DPIs and are less accurate in terms of the precise dose of medication absorbed due to drug loss within the device and ambient air. However, nebulizers are typically the easiest to use and can be used by subjects who are too young to operate pMDIs or DPIs, or by unconscious subjects. Nebulizers typically include a reservoir containing the drug formulation, a atomization chamber, a face mask, and a mechanism that atomizes the formulation. In jet nebulizers, the mechanism includes a nozzle that passes air at high speed, which draws the liquid formulation through capillaries. Droplets of the formulation enter the air jet, are carried along, and collide with a baffle, reducing the size of the droplets and / or filtering out excessively large droplets. The baffle also reduces the air velocity, so the resulting mist leaves the nebulizer at a slower speed, making it more likely to reach the lower respiratory tract. The atomization process in these devices also typically lowers the temperature of the formulation due to droplet evaporation. Jet nebulizers are typically noisier and less portable than other inhalers because they require a compressor to generate the airflow.
[0126] Ultrasonic atomizers use an element that vibrates at ultrasonic frequencies to break down liquid formulations into droplets. This vibrating element is often a rigid mesh or perforated membrane. These atomizers are generally quieter than jet atomizers and do not require a compressor, but they still require a powder source. The ultrasonic vibrations often raise the temperature of the formulation.
[0127] A pMDI contains a drug solution or suspension in a pressurized propellant and includes a valve that delivers a precisely measured amount of the formulation upon activation. The propellant is often a gas (such as a hydrofluoroalkane propellant) which is combined with the drug and, if applicable, a co-solvent (such as ethanol and / or a surfactant). The formulation is compressed into a liquid state and then loaded into the pMDI or pMDI cartridge. A typical pMDI releases the liquid formulation into a metering chamber that determines the dosage. When the device is activated, the measured formulation is released into an expansion chamber where the propellant vaporizes. For efficient and consistent drug delivery, the subject using the pMDI must coordinate their breathing with the device's operation to ensure that the maximum possible amount of aerosol reaches the lower respiratory tract. Modern pMDIs may further include a valve or sensing mechanism that releases the aerosol only when the subject is inhaling. Most pMDIs also use spacers. The spacer is essentially a tube between the pMDI and the target, improving the efficient delivery of the aerosol and allowing the propellant to evaporate over more time (and become smaller droplets).
[0128] DPIs generally contain a measured amount of drug as a dry powder, and sometimes have a dry powder carrier (such as powdered lactose). DPIs rely on rapid inhalation by the subject rather than the formation of a mist or aerosol to deliver the powder formulation. DPIs are generally easier to use than pMDIs, but the efficiency of delivery depends in part on the rate of air that the subject can produce. Newer DPIs that are initiated by respiration but require assistance are under development.
[0129] The formulations of this disclosure can be administered using commercially available inhalation devices (such as nebulizers). Non-limiting examples of inhalation devices include the Respimat® Soft Mist® inhaler; the RespiClick® inhaler; the Breezhaler® inhaler; the Rotahaler® inhaler; the Genuair® inhaler; the Ellipta® inhaler; and the Staccato® inhaler (Alexza Pharmaceuticals, Mountain View, California). The inhaler may be provided pre-filled with one or more therapeutic doses of the formulations of this disclosure, or it may be configured to house a cartridge pre-filled with one or more therapeutic doses of the formulations of this disclosure.
[0130] The inhalable powders and aerosols can be administered using an inhaler that measures a single dose from a reservoir by means of a measuring chamber (see, for example, United States Patent No. 4,570,630) or other means (see, for example, German Patent No. 3625685). In some embodiments, the inhalable powder is loaded into a capsule or cartridge, which is used with an inhaler (such as that described in WO 94 / 28958).
[0131] Capsules and cartridges used in inhalers may be in the form of a powder mixture containing the disclosed compound or pharmaceutical composition and a suitable powder base (such as lactose or starch).
[0132] system The methods of the present disclosure may also be carried out using a system of the present disclosure comprising a statin or statin formulation and one or more additional therapeutic agents, or a formulation comprising one or more additional therapeutic agents. In one system of the present disclosure, the statin and the additional therapeutic agents do not need to be in the same formulation and are administered at different time points. In some embodiments, the system includes statins selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin, and their isomers, enantiomers, and diastereomers. In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, and tenivastatin. In some embodiments, the statin is a hydrophobic statin. In some embodiments, the statin is simvastatin or pitavastatin. In some embodiments, the statin is pitavastatin. In some embodiments, the statin is simvastatin.
[0133] In some embodiments, the formulation is a dry powder formulation. In some embodiments, the formulation is an aerosol formulation. In some embodiments, the formulation is a sprayable formulation. In some embodiments, the sprayable formulation contains an aqueous solution of a statin. In some embodiments, the sprayable formulation further contains a pharmaceutically acceptable alcohol. In some embodiments, the pharmaceutically acceptable alcohol contains ethanol.
[0134] In some embodiments, the system further includes additional therapeutic agents. These additional therapeutic agents may treat the same disease, disorder, or symptom as the statin, or treat different symptoms of the same disease or disorder. A combination of one or more statins and one or more additional therapeutic agents may, in some cases, exhibit an additive effect, where the degree of response from this combination formulation is substantially the same as the sum of the degrees of response from each agent administered individually. The combination may also produce a less-than-additive effect (in which case the combination produces a response smaller than the sum of the degrees of response from each agent administered individually (but still greater than the response produced by either agent alone)); or a synergistic effect (in which case the combination produces a response greater than the sum of the degrees of response from each agent administered individually). Therefore, a combination of one or more statins and one or more additional therapeutic agents can be used to achieve a greater response while administering a given dose, the same response while administering a reduced dose, or any combination thereof.
[0135] If the combined effect is greater than desired or required, the dose of one or both drugs can be reduced until the desired effect is achieved. The dose reduction does not necessarily have to be the same amount or the same percentage for each drug. This can be used to reduce side effects or minimize the probability of encountering them. Therefore, the dose of one or more drugs in a synergistic combination formulation may be considered insufficient or sub-therapeutic when administered alone or as part of a non-synergistic combination formulation, but can be reduced to a level that is therapeutically sufficient when administered as part of a synergistic combination formulation. Sub-therapeutic doses of any agent in a synergistic combination formulation can be approximately 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of the effective dose of that agent when administered by inhalation as part of a non-synergistic formulation according to this disclosure.
[0136] In some systems, administration of an inhaled statin enhances the effect of an additional therapeutic agent administered after a given period, providing a greater therapeutic effect than statins alone or additional therapeutic agents alone. In some systems, administration of an inhaled statin enhances the effect of an additional therapeutic agent, the effect being other than the reduction of viral respiratory infections. In some systems, the additional therapeutic agent is administered after the statin. In some embodiments, the period is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or about 1, 2, or 3 days. In some embodiments, the period is less than or equal to about 72, 48, 36, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, or 6 hours.
[0137] As additional therapeutic agents, any of the additional therapeutic agents described herein may be used. In some embodiments, the additional therapeutic agent is chloroquine or a salt thereof, hydroxychloroquine or a salt thereof, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, camostat or a salt thereof, daunavir, oseltamivir, or ribavirin. In some embodiments, the additional therapeutic agent includes two or more antiviral agents. In some embodiments, additional antiviral agents are bromodomain inhibitors (BETS), drugs targeting sigma-1 and / or sigma-2 receptors (e.g., a non-limiting example is PB28), antihistamines (e.g., a non-limiting example is clemastine and / or cloperastine), protein translation inhibitors (e.g., a non-limiting example is zotatifine, ternatin-4, and / or pritidecin), antipsychotics (e.g., a non-limiting example is haloperidol and / or cloperazine); or cyramesin (antidepressant and anxiolytic). In some embodiments, the antiviral agent is PB28, clemastine, cloperastine, zotatifine, ternatin-4, pritidecin, haloperidol, cloperazine, or cyramesin.
[0138] Additional antiviral therapies available in conjunction with the inhaled statin formulations and systems of this disclosure include convalescent plasma and / or antibodies derived therefrom; selinexol (a selective inhibitor (SINE) compound that blocks the nuclear export of the cellular protein XPO1); inhaled nitric oxide; exome and microvesicle technologies (allogeneic cardiac stem cells); and umbilical cord blood regulatory T cells.
[0139] ACE2 converts angiotensin II (Angiotensin 1-7) into angiotensin (Angiotensin 1-7), which has anti-inflammatory, antioxidant, and antithrombotic effects. 1-7 ) converts to ). Because the reduction of these effects can be harmful, some systems and treatments of this disclosure further include alternatives or supplements to this activity. This is Ang 1-7, administering soluble ACE2 and / or other enzymes to convert angiotensin II to Ang 1-7 This can be achieved by administering a catalyst for the hydrolysis of angiotensin II. See, for example, P. Verdecchia et al., Eur J Int Med (2020) doi.org / 10.1016 / j.ejim.2020.04.037 (in press). Alternatively, or in addition to the above, non-limited examples of drugs that can reduce angiotensin II activity include administering ACE (angiotensin-converting enzyme) inhibitors, angiotensin II receptor inhibitors (angiotensin II receptor blockers or ARBs), or a combination thereof. Non-limited examples of suitable ACE inhibitors include captopril, benazepril, zofenopril, perindopril, trandolapril, enalapril, lisinopril, and ramipril. Suitable ARBs block the activity of the angiotensin II type 1 receptor (AT1). Non-specific examples of appropriate ARBs include losartan, valsartan, candesartan, telmisartan, and fimasartan.
[0140] In some embodiments, additional therapeutic agents are beclomethasone, fluticasone, budesonide, mometasone, flunisolide, alclomethasone, beclomethasone, betamethasone, clobetasol, clobetasol, crocortol, dexoxymethasone, dexamethasone, diflorasone, diflucortol, flurchlorolone, flumethasone, fluocortin, fluocortol, flupredniden, fluticasone, fluticasone furoate, halomethasone, meprednisone, mometasone, mometasone furoate, paramethasone, prednilidene, rimexolone, urobetasol, amcinonide, ciclesonide, deflazacort, desonide, formocortol, fluchlorone acetonide, fludroxycortide, fluocinolone acetonide, fluocinonide, halcinonide, or triamcinolone acetonide, or combinations thereof. In some embodiments, additional therapeutic agents are albuterol, alformoterol, buphenine, clenbuterol, bopexamine, epinephrine, fenoterol, formoterol, isoetaline, isoproterenol, orciprenaline, levoalbutamol, revalbuterol, pirbuterol, procaterol, ritodrine, albuterol, salmeterol, terbutaline, albutamine, blefonarol, bromoacetylalprenololmethane, broxaterol, simaterol, silazolin, etilephrine, hexoprenaline, higenamine, isoxuprine, mabuterol, methoxyphenamine, oxyfedrine, ractopamine, reproterol, limiterol, tretokinol, tulobuterol, zilpaterol, or dinterol, or combinations thereof. In some embodiments, the additional therapeutic agent is albuterol. In some embodiments, the additional therapeutic agent includes both an antiviral agent and a corticosteroid.
[0141] In some embodiments, additional therapeutic agents include ipratropium bromide, tiotropium bromide, glycopyrrolate, glycopyrronium bromide, lebefenacin, umeclidinium bromide, acridinium, throspium chloride, oxytropium bromide, oxybutynin, tolterodine, solifenacin, fesoterodine, dalifenacin, or combinations thereof. In some embodiments, additional therapeutic agents include roflumilast, dileuton, nedocromil, squalene synthase inhibitors (such as rapaquistat), zaragosic acid, and RPR 107393; farnesyl pyrophosphate synthase inhibitors (non-limiting examples include biphosphonates such as alendronate, etidronate, clodronate, tildronate, pamidronate, neridronate, olpadronate, ivadronate, risedronate, zoledronate, etc.); theophylline, anti-IL5 antibodies or antibody derivatives, anti-IgE antibodies or antibody derivatives, anti-IL5 receptor antibodies or antibody derivatives, anti-IL13 / 4 receptor antibodies or antibody derivatives, mepolizumab, reslizumab, benralizumab, omalizumab, dupilumab, or combinations thereof. In some embodiments, additional therapeutic agents include TS-f22, AT13148, GSK429286A, RKI-1447, Y-27632, CCG-1423, GGTI-DU40, GGTI-297, AR9281, TPPU, AM-1172, JNJ 1661010, PF-3845, zafirlukast, montelukast, dileuton, or a combination thereof.
[0142] In some embodiments, the additional therapeutic agent is provided in a formulation comprising the additional therapeutic agent and a pharmaceutically acceptable carrier or vehicle. In some embodiments, the formulation is suitable for administration by inhalation. In some embodiments, the formulation is suitable for administration by oral administration or injection.
[0143] Additional antiviral therapies that can be used with the inhaled statin formulations and systems of the present disclosure include convalescent plasma or antibodies extracted therefrom; selinexol (a selective inhibitor (SINE) compound of nuclear export that blocks the cellular protein XPO1); inhaled nitric oxide; exosomes and / or microvesicles (e.g., allogeneic cardiac stem cells); and umbilical cord blood regulatory T cells. In some embodiments, the system comprises the statin formulation of the present disclosure and convalescent plasma or antibodies extracted therefrom; selinexol; inhaled nitric oxide; exosomes and / or microvesicles; or umbilical cord blood regulatory T cells.
[0144] IV. Pharmaceutical Compositions In some embodiments, pharmaceutical compositions comprising a therapeutically effective amount of statin; at least one additional therapeutic agent; and a pharmaceutically acceptable carrier are provided herein.
[0145] In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin. In some embodiments, the statin is selected from the group consisting of simvastatin and pitavastatin. In some embodiments, the statin is simvastatin. In some embodiments, the statin is pitavastatin. In some embodiments, the additional therapeutic agent is a β-agonist, a corticosteroid, a muscarinic antagonist, or any combination thereof. In some embodiments, additional therapeutic agents are dexamethasone, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, mostat or its salts, daunavir, oseltamivir, ribavirin, convalescent plasma or antibodies extracted therefrom; selinexol; inhaled nitric oxide; exosomes and / or microvesicles; and umbilical cord blood regulatory T cells. In some embodiments, statins are selected from the group consisting of pitavastatin and simvastatin; and additional therapeutic agents are selected from the group consisting of remdesivir, dexamethasone, and combinations thereof.
[0146] In some embodiments, pharmaceutical formulations for treating viral respiratory diseases are provided herein, comprising a therapeutically effective amount of a statin or its isomer, enantiomer, or diastereomer, and a pharmaceutically acceptable carrier suitable for inhalation administration.
[0147] In some embodiments, the pharmaceutical formulation is administered by inhalation and / or intranasal inhalation. In some embodiments, the pharmaceutical formulation comprises a statin and an additional therapeutic agent as described herein. In some embodiments, the additional therapeutic agent is remdesivir or dexamethasone. In some embodiments, the additional therapeutic agent is remdesivir. In some embodiments, the additional therapeutic agent is dexamethasone.
[0148] In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is administered by inhalation and / or intranasally. In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is remdesivir, administered by inhalation and / or intranasally. In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is dexamethasone, administered by inhalation and / or intranasally. In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is administered orally. In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is remdesivir, administered orally. In some embodiments, the statin is administered by inhalation and / or intranasally, and the additional therapeutic agent is dexamethasone, administered orally.
[0149] The compositions of the present invention can be prepared in a variety of dosage forms, including oral, parenteral, and topical. Oral preparations include tablets, pills, powders, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, and suspensions suitable for patient ingestion. The compositions of the present invention can also be administered by injection, i.e., intravenously, intramuscularly, intradermally, subcutaneously, duodenumly, or intraperitoneally. Furthermore, the compositions described herein can be administered by inhalation (e.g., intranasally). In addition, the compositions of the present invention can be administered transdermally. The compositions of the present invention can also be administered by intraocular, intravaginal, and intrarectal routes (including suppositories, inhaled, powders, and aerosol formulations (see, for example, steroid inhalants, Rohatagi, J. Clin. Pharmacol. 35:1187-1193, 1995; Tjwa, Ann. Allergy Asthma Immunol. 75:107-111, 1995)). Therefore, the present invention also provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier or excipient and the compound of the present invention.
[0150] To prepare pharmaceutical compositions from the compounds of the present invention, pharmaceutically acceptable carriers can be solid or liquid. Solid preparations may include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. One or more substances that can also function as diluents, flavoring agents, binders, preservatives, tablet disintegrants, or encapsulating materials are possible as solid carriers. Technical details for formulation and administration are well known and are adequately described in the scientific and technical literature. See, for example, the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Co., Easton, Pennsylvania ("Remington's").
[0151] In the powder form, the carrier is a finely divided solid, which is then mixed with the finely divided active ingredient. In the tablet form, the active ingredient is mixed in an appropriate ratio with a carrier having the required binding properties and compressed into the desired shape and size. The powder and tablets preferably contain 5% or 10% to 70% of the compound of the present invention.
[0152] Suitable solid excipients include, but are not limited to, magnesium carbonate; magnesium stearate; talc; pectin; dextrin; starch; tragacanth; low-melting-point waxes; cocoa butter; carbohydrates; sugars (non-limited examples include lactose, sucrose, mannitol, or sorbitol), starches (from corn, wheat, rice, potato, or other plants); cellulose (such as methylcellulose, hydroxypropyl methylcellulose, or sodium carboxymethylcellulose); and gum (such as gum arabic and gum tragacanth); as well as proteins (non-limited examples include gelatin and collagen). Disintegrants or solubilizers (such as cross-linked polyvinylpyrrolidone, agar, alginic acid, or salts thereof (such as sodium alginate)) may be added if desired.
[0153] The core of the dragée is coated with an appropriate coating (such as a concentrated sugar solution), which may also contain gum arabic, talc, polyvinylpyrrolidone, carbol gel, polyethylene glycol, and / or titanium dioxide, a lacquer solution, and a suitable organic solvent or solvent mixture. Dyes or pigments may be added to the coating of the tablets or dragées to identify the product or to characterize the amount (i.e., dose) of the active compound. The pharmaceutical preparations of the present invention can also be administered orally using, for example, gelatin-based indentation capsules, or soft-seal capsules made of gelatin and a coating (such as glycerol or sorbitol). Indentation capsules may contain a mixture of the compound of the present invention with a filler or binder (such as lactose or starch), a lubricant (such as talc or magnesium stearate), and optionally a stabilizer. In soft capsules, the compound of the present invention can be dissolved or suspended in a suitable liquid (such as fatty oil, liquid paraffin, or liquid polyethylene glycol) with or without a stabilizer.
[0154] To prepare the suppositories, a low-melting-point wax (such as a mixture of fatty acid glycerides or cocoa butter) is first melted, and the compound of the present invention is uniformly dispersed therein while stirring. Then, the molten, homogeneous mixture is poured into a mold of appropriate size and allowed to solidify by cooling.
[0155] Liquid preparations include solutions, suspensions, and emulsions, such as water or a water / propylene glycol solution. For parenteral injection, the liquid preparation may be a solution in an aqueous polyethylene glycol solution.
[0156] An aqueous solution suitable for oral use can be prepared by dissolving the compound of the present invention in water and then adding appropriate colorants, flavorings, stabilizers, and thickeners as desired. A suspension suitable for oral use can be prepared by dispersing finely divided active ingredients in water together with a viscous material. Viscous materials include natural or synthetic rubber, resins, methylcellulose, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, tragacanth gum, and gum arabic), and dispersants or wetting agents (natural phosphatides (e.g., lecithin), condensation products of alkylene oxides and fatty acids (e.g., polyoxyethylene stearate)), condensation products of ethylene oxide and long-chain aliphatic alcohols (e.g., heptadecaethyleneoxycetanol), condensation products of partial esters derived from ethylene oxide, fatty acids, and hexitol (e.g., polyoxyethylene sorbitol monooleate), or condensation products of partial esters derived from ethylene oxide, fatty acids, and anhydrous hexitol (e.g., polyoxyethylene sorbitan monooleate). The aqueous suspension may also contain one or more preservatives (such as ethyl p-hydroxybenzoate or n-propyl p-hydroxybenzoate), one or more colorants, one or more flavoring agents, and one or more sweeteners (such as sucrose, aspartum, or saccharin). The osmotic pressure of the formulation can be adjusted.
[0157] Solid-form preparations are also included, which are intended to be converted into liquid-form preparations for oral administration shortly before use. Such liquid forms include solutions, suspensions, and emulsions. These preparations may contain, in addition to the active ingredient, colorants, flavorings, stabilizers, buffers, natural and organic sweeteners, dispersants, thickeners, solubilizers, and the like.
[0158] Oil suspensions can be formulated by suspending the compounds of the present invention in vegetable oil (such as peanut oil, olive oil, sesame oil, or coconut oil), mineral oil (such as liquid paraffin), or mixtures thereof. Oil suspensions may contain thickeners (such as beeswax, solid paraffin, or cetyl alcohol). Sweeteners (such as glycerol, sorbitol, or sucrose) can be added to provide a palatable oral preparation. These formulations can be preserved by adding antioxidants (such as ascorbic acid). For an example of an injectable oil vehicle, see Minto, J. Pharmacol. Exp. Ther. 281:93-102, 1997. Pharmaceutical formulations of the present invention can also be in the form of oil-in-water emulsions. The oil phase can be the above-mentioned vegetable oils or mineral oils, or mixtures thereof. Suitable emulsifiers include natural rubber (such as gum arabic and gum tragacanth), natural phosphatides (such as soy lecithin), esters or partial esters derived from fatty acids and anhydrous hexitol (such as sorbitan monooleate), and condensation products of these partial esters with ethylene oxide (such as polyoxyethylene monooleate). Emulsions may also contain sweeteners and flavorings, as in syrup and elixir formulations. Such formulations may also contain lubricants, preservatives, or colorants.
[0159] The compositions of the present invention can also be delivered as microspheres for sustained release within the body. For example, the microspheres can be formulated so that the drug-containing microspheres are administered by intradermal injection. These microspheres are released slowly subcutaneously as a biodegradable and injectable gel formulation (see, e.g., Gao Pharm. Res. 12:857-863, 1995) or as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997) (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995). Both transdermal and intradermal routes provide consistent delivery over several weeks or months.
[0160] In another embodiment, the composition of the present invention can be formulated for parenteral administration (such as intravenous (IV) administration or administration into body cavities or organ lumens). Formulations for administration generally consist of a solution of the composition of the present invention dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be used are water, Ringer's solution, and isotonic sodium chloride. In addition, sterile non-volatile oils can conventionally be used as solvents or suspension media. For this purpose, any non-irritating non-volatile oil (including synthetic monoglycerides or diglycerides) can be used. In addition, fatty acids (such as oleic acid) can similarly be used in the preparation of injectable substances. Since these solutions are sterile, there are generally no undesirable problems. These formulations can be sterilized by conventionally known sterilization techniques. Formulations may contain pharmaceutically acceptable auxiliary substances (such as pH adjusters / buffers, toxicity modifiers (e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc.)) necessary to achieve appropriate physiological conditions. Since the concentration of the composition of the present invention in these formulations can vary considerably, it will be selected based on the volume of the fluid, viscosity, body weight, etc., depending on the specific mode of administration chosen and the patient's needs. For IV administration, the formulation can be a sterile injection preparation (such as a sterile aqueous or oily suspension for injection). This suspension can be formulated according to known techniques using these appropriate dispersants or wetting agents and suspending agents. As a sterile injection preparation, a sterile injectionable solution or suspension in a non-toxic, parenterally administered diluent or solvent (such as a solution of 1,3-butanediol) is also possible.
[0161] In another embodiment, formulations of the composition of the present invention can be delivered using liposomes that fuse with the cell membrane or undergo endocytosis; that is, they can be delivered using ligands that are attached to liposomes or directly attached to oligonucleotides and bind to cell surface membrane protein receptors, thereby inducing endocytosis. In particular, if the liposomes have target cell-specific ligands on their surface, or otherwise selectively target specific organs, the use of liposomes can focus on the delivery of the composition of the present invention to target cells in vivo. (See, for example, Al-Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989).
[0162] V. Methods and Treatments (a) Administration by inhalation or intranasal administration The therapies described herein are based on the administration of appropriate statins by inhalation or intranasal administration. The methods, formulations, and systems described herein treat viral respiratory infections and therefore provide therapies for diseases that are not effectively or completely treated with existing therapeutic agents. Administration by inhalation has the advantages of (a) direct contact with the airways, (b) avoidance of first-pass metabolism in the liver, and (c) avoidance of injection (JL Rau, Resp Care (2005) 50(3):367-82; M. Ibrahim et al., Med Dev Evidence Res (2015) 8:131-39). Because drugs are not subject to first-pass metabolism and are administered locally to the lungs rather than systemically to the entire body, the dose for drugs administered by inhalation is often less than the dose that would be administered orally.
[0163] As described herein, in some embodiments, the formulations of the Disclosure are administered to a subject with the help of an inhalation device ("Inhaler"). Possible inhalers include nebulizers, pMDIs, DPIs, or other devices capable of delivering the formulation to the lower respiratory tract. In some embodiments, the formulations of the Disclosure are administered intranasally using, for example, a spray, nebulizer, or nasal drops. The frequency of administration will depend on the clearance rate of the statin and / or additional therapeutic agent from the subject's lungs. In some embodiments, the statin formulation is administered up to 8, 7, 6, 5, 4, 3, 2, or 1 time per day, or up to once every 2, 3, 4, 5, 6, or 7 days. In some embodiments, the statin formulation is administered at least once every 4, 3, or 2 days, or at least 1, 2, 3, 4, 5, or 6 times per day. The treatment period can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days. In some embodiments, the treatment period is 5 to 7 days. In some embodiments, the treatment period is 1 to 10 days. In some embodiments, the treatment period is 1 to 12 days. In some embodiments, the treatment period is 1 to 14 days. In some embodiments, the formulation is administered to the subject while the subject is receiving mechanical ventilation (e.g., a subject who is continuously intubated and / or receiving respiratory support). In some embodiments, the formulation of this disclosure is administered to the subject through a ventilator or respiratory device.
[0164] In the method of this disclosure, the therapeutic composition is administered directly to the lungs (e.g., by inhalation or intranasal delivery) and therefore does not undergo first-pass metabolism in the liver. As a result, the active ingredient in the formulation is not diluted throughout the subject's body and is not metabolized by the liver, so a smaller amount is required to reach a therapeutic concentration in the subject's airways than would be required with conventional oral administration. The therapeutically effective amount will depend on the condition being treated, the severity of the infection, the subject's overall health and condition, and the specific statin (and / or isomers, enantiomers, and / or diastereomers) selected. Therefore, the therapeutically effective dose of statin when implementing this disclosure can be reduced to approximately 0.005 μg, 0.008 μg, 0.01 μg, 0.05 μg, 0.08 μg, 0.1 μg, 0.5 μg, 0.8 μg, 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 11 μg, 12 μg, 14 μg, 15 μg, 16 μg, 18 μg, or 20 μg. The therapeutically effective dose of statin when implementing this disclosure can be increased to approximately 40 mg, 20 mg, 18 mg, 15 mg, 12 mg, 10 mg, 9 mg, 8 mg, 7 mg, 6 mg, 5 mg, 4 mg, 3 mg, 2 mg, or 1 mg.
[0165] In some embodiments, the therapeutically effective dose of statins is at least about 0.005 μg / kg, about 0.008 μg / kg, about 0.01 μg / kg, about 0.05 μg / kg, about 0.08 μg / kg, about 0.1 μg / kg, about 0.5 μg / kg, about 0.8 μg / kg, about 1 μg / kg, about 2 μg / kg, about 3 μg / kg, about 4 μg / kg, about 5 μg / kg, about 6 μg / kg, about 7 μg / kg, about 8 μg / kg, about 9 μg / kg, about 10 μg / kg, about 11 μg / kg, about 12 μg / kg, about 14 μg / kg, about 15 μg / kg, about 16 μg / kg, about 18 μg / kg, or about 20 μg / kg. In some embodiments, the therapeutically effective dose of statins is not greater than approximately 40 mg / kg, 20 mg / kg, 18 mg / kg, 15 mg / kg, 12 mg / kg, 10 mg / kg, 9 mg / kg, 8 mg / kg, 7 mg / kg, 6 mg / kg, 5 mg / kg, 4 mg / kg, 3 mg / kg, 2 mg / kg, or 1 mg / kg.
[0166] (b) Inhibition and prevention of viral entry As described herein, many viruses require specific receptors to enter host cells, and these receptors often need to be localized to lipid rafts within the host cell membrane in order to function. Statins can deplete cholesterol from lipid rafts, resulting in a reduction in the number of lipid rafts. Without being bound by any particular theory, it is thought that a reduction in lipid rafts destabilizes the receptors that depend on them, thereby reducing or blocking viral entry into host cells and thus reducing infectivity.
[0167] In some embodiments, statins directly interact with viruses (such as coronavirus or SARS-CoV-2), thereby reducing the uptake of the virus into cells. In some cases, the cells are airway cells, nasal cells, oral cells, or lung cells (such as lung epithelial cells). In some embodiments, administration of statins prevents the uptake and entry of the virus (such as SARS-CoV-2) into cells, thereby inhibiting, reducing, or preventing viral infection. In some embodiments, administration of statins prevents the uptake of the virus into cells, thereby reducing the overall amount (titer) of the virus in the subject. In some cases, such administration reduces the severity of the infection and / or the symptoms of the virus as a result (such as reduction of the severity or symptoms of COVID-19). In some embodiments, such administration reduces the transmissibility of the virus from an infected subject by lowering the level of virus present in the subject or specific tissues (e.g., lungs and / or airway epithelium) or openings of the subject (such as the nose or mouth). In some embodiments, statins are administered prophylactically to a subject to reduce, inhibit, block, or prevent a viral infection (such as infection with SARS-CoV-2). In some embodiments, statins are administered to a subject after they have tested positive for a virus (such as the SARS-CoV-2 virus) or have been exposed to the virus, but before they show clear symptoms of infection.
[0168] The effective dose for inhibiting viral entry and thus mitigating viral respiratory infections will depend on what the viral receptor and the host receptor targeted by the virus are, the severity of the condition, the overall health and condition of the subject, and the specific statin (and / or isomers, enantiomers, and / or diastereomers) selected. The treatments of the Disclosure (formulations, methods, and systems of the Disclosure) reduce viral entry and / or replication by at least 10, 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. This efficacy can be measured using standard microbiological assays and tests. For example, a culture of relevant cells or tissues may be exposed to a virus or a sample suspected of containing a virus, in the presence or absence of a statin or statin preparation of this disclosure, incubated under physiological conditions, and measured, quantified, or titrated for the amount of virus, viral nucleic acid, viral protein, or a combination thereof. Relevant cells or tissues may be similar to or identical to cells, cell cultures, or tissue samples that the virus under study would normally infect or is expected to infect. In the case of viral respiratory infections, non-limiting examples of relevant cells and tissues may include airway epithelial cells, lung sections, epithelial cell cultures, or other model cells or organisms. Alternatively, such tests may be performed in vivo using a model animal susceptible to the virus, or in humans in the context of, for example, a clinical trial (but not limited to).
[0169] The therapeutically effective dose of statin when implementing this disclosure can be reduced to approximately 0.005 μg, 0.008 μg, 0.01 μg, 0.05 μg, 0.08 μg, 0.1 μg, 0.5 μg, 0.8 μg, 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 11 μg, 12 μg, 14 μg, 15 μg, 16 μg, 18 μg, or 20 μg. The therapeutically effective dose of statin when implementing this disclosure can be increased to approximately 40 mg, 20 mg, 18 mg, 15 mg, 12 mg, 10 mg, 9 mg, 8 mg, 7 mg, 6 mg, 5 mg, 4 mg, 3 mg, 2 mg, or 1 mg.
[0170] In some embodiments, the therapeutically effective dose of statins is at least about 0.005 μg / kg, about 0.008 μg / kg, about 0.01 μg / kg, about 0.05 μg / kg, about 0.08 μg / kg, about 0.1 μg / kg, about 0.5 μg / kg, about 0.8 μg / kg, about 1 μg / kg, about 2 μg / kg, about 3 μg / kg, about 4 μg / kg, about 5 μg / kg, about 6 μg / kg, about 7 μg / kg, about 8 μg / kg, about 9 μg / kg, about 10 μg / kg, about 11 μg / kg, about 12 μg / kg, about 14 μg / kg, about 15 μg / kg, about 16 μg / kg, about 18 μg / kg, or about 20 μg / kg. In some embodiments, the therapeutically effective dose of statins is not greater than approximately 40 mg / kg, 20 mg / kg, 18 mg / kg, 15 mg / kg, 12 mg / kg, 10 mg / kg, 9 mg / kg, 8 mg / kg, 7 mg / kg, 6 mg / kg, 5 mg / kg, 4 mg / kg, 3 mg / kg, 2 mg / kg, or 1 mg / kg.
[0171] Under certain conditions, early treatment of an infection can yield more effective results due to the exponential nature of viral replication. In some embodiments, subjects with a respiratory viral infection are treated as early as possible (using the formulations, methods, and systems of the Disclosure) after exposure to the virus or to another subject with a respiratory viral infection. In some embodiments, subjects are treated within 48, 36, 24, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 hour of exposure, or within less than 1 hour. In some cases, because the time of exposure is unknown, subjects are treated as soon as possible after diagnosis of infection or after the onset of symptoms consistent with a respiratory viral infection (e.g., cough, shallow and rapid breathing, shortness of breath, sputum production, sneezing, fever, etc.), depending on what the virus is. The diagnosis of infection can be made, for example, by detecting antiviral antibodies in a biological sample obtained from the subject by nucleic acid detection methods using PCR assays or CRISPR-based viral detection assays specific to one or more viruses, by the replication of the virus in a cell culture, or by the practice of standard medical diagnostics. In some embodiments, the subject is treated within 48, 36, 24, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 hour, or less than 1 hour, from the diagnosis of infection or the onset of symptoms.
[0172] In some cases, subjects may receive treatment of the Disclosure before or during exposure to a respiratory virus because they are at risk of being exposed to that risk. Non-limiting examples include healthcare workers, public health laboratory personnel, disease outbreak researchers and staff, medical researchers, and other persons who may be exposed to one or more respiratory viruses and may receive treatment before exposure to prevent infection and / or reduce the probability of infection. In some embodiments, subjects receive treatment within 48, 36, 24, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 hour or less before experiencing possible exposure to a respiratory virus. For example, hospital staff may receive treatment before entering the hospital for work to limit or avoid viral respiratory infections. Teachers may receive treatment before the first day of school to limit or avoid possible viral respiratory infections from students (and other teachers) returning to class.
[0173] In some embodiments, the respiratory virus is coronavirus or SARS-CoV-2. In some embodiments, the respiratory virus is SARS-CoV-2. In some embodiments, statin administration inhibits the uptake of SARS-CoV-2, the entry of SARS-CoV-2 into cells, thereby inhibiting, mitigating, or preventing SARS-CoV-2 infection. In some embodiments, statin administration inhibits the uptake of SARS-CoV-2 into cells, thereby reducing the total amount (titer) of SARS-CoV-2 in the subject. In some embodiments, such administration reduces the severity of SARS-CoV-2 infection and / or the resulting symptoms. In some embodiments, such administration reduces the transmissibility of SARS-CoV-2 from an infected subject by lowering the level of virus present in the subject or in specific tissues (e.g., lungs and / or airway epithelium) or in the subject's openings (e.g., nose or mouth).
[0174] In some embodiments, statins are administered prophylactically to subjects at risk of exposure to SARS-CoV-2 or to subjects after exposure to SARS-CoV-2. In some embodiments, statins are administered prophylactically to subjects at risk of exposure to SARS-CoV-2. In some embodiments, statins are administered after exposure to SARS-CoV-2. In some embodiments, statins are administered to subjects after they test positive for SARS-CoV-2. In some embodiments, statins are administered after a subject tests positive for SARS-CoV-2, but before the subject develops clear symptoms of the infection.
[0175] In some embodiments, for subjects at risk of exposure or suspected of exposure (due to contact with the virus or an infected individual), the statin preparation is administered up to 8, 7, 6, 5, 4, 3, 2, or 1 time per day, or up to once every 2, 3, 4, 5, 6, or 7 days. In some embodiments, the statin preparation is administered at least once every 4, 3, or 2 days, or at least 1, 2, 3, 4, 5, or 6 times per day. The treatment period can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days. In some embodiments, the treatment period is 5 to 7 days. In some embodiments, the treatment period is 1 to 10 days. In some embodiments, the treatment period is 1 to 12 days. In some embodiments, the treatment period is 1 to 14 days.
[0176] In a pandemic situation where a large number of subjects are at risk of infection, any subject may be treated: in such cases, risk events can be considered to be the formal declaration of a pandemic, the declaration of an epidemic in a geographical area in which the subject lives, works, or has recently visited; or the commencement of travel to a geographical area experiencing an epidemic, pandemic, or outbreak. In some cases, a subject is treated during a pandemic if they are at increased risk of serious complications (non-limited examples of which are viral pneumonia, pulmonary embolism, respiratory failure, ARDS, sepsis, acute lung injury (ALI), or death). Such patients are at increased risk from time to time due to pre-existing comorbidities (such as diabetes, obesity, heart disease, lung disease, liver disease, kidney disease, immunocompromised state, cancer, or other conditions that reduce the subject's ability to resist disease). In some embodiments, the formulations or systems of the present disclosure are administered to subjects who have a viral respiratory infection concurrently with diabetes, obesity, heart disease, lung disease, liver disease, kidney disease, immunocompromised state (including immunosuppression due to viruses and / or drugs (such as chemotherapy)), or cancer.
[0177] Reducing viral respiratory infections can also reduce the progression from milder forms of infection (e.g., mild infections of the nose, mouth, and / or throat) to more severe forms (e.g., bronchitis, pneumonia, pulmonary embolism, respiratory failure, ARDS, sepsis, ALI, myocarditis, or death). Reducing viral respiratory infections can also reduce the extent of necessary invasive medical treatments (such as intensive care unit (ICU) admission, tracheal intubation, mechanical ventilation, and / or extracorporeal membrane oxygenation (ECMO)).
[0178] In some embodiments, statin administration by inhalation or intranasal administration is performed during the early stages of infection when the virus may be present in the nose, or in the nose and throat, but has not substantially entered the lower respiratory tract and lungs.
[0179] In some embodiments, statins are administered to protect subjects from virus-induced epithelial cell death. Such administration of statins can maintain the viability of epithelial cells facing viral infection, thereby reducing the severity of the infection and the resulting symptoms. In some embodiments, statin administration protects against SARS-CoV-2-induced epithelial cell death.
[0180] In some embodiments, administration of statins (such as inhaled or intranasal statins) reduces the immune response that could cause a severe reaction to a viral infection (such as infection by a coronavirus such as SARS-CoV-2). In some embodiments, administration of statins lowers IL-6 levels in infected subjects (such as subjects infected with SARS-CoV-2). In some embodiments, administration of statins reduces, inhibits, or prevents a cytokine storm in subjects with severe systemic inflammation as a result of the infection.
[0181] In some embodiments, administration of statins (such as inhaled or intranasal statins) reduces or protects against complications and / or damage caused by respiratory viruses (such as SARS-CoV-2). Such complications and damage may include damage to the lungs and other tissues. In some embodiments, administration of statins (such as inhaled or intranasal statins) reduces or protects against acute respiratory distress syndrome (ARDS) and pulmonary scarring or pulmonary fibrosis that may be associated with respiratory virus (such as SARS-CoV-2) infection. In some embodiments, administration of statins (such as inhaled or intranasal statins) reduces or protects against ARDS-induced embolism (clotting) associated with COVID-19. In some embodiments, administration of statins (such as inhaled or intranasal statins) may reduce or protect against “long-term” symptoms (also known as “long COVID-19”), which may include one or more of the following: fatigue, cough, joint pain, shortness of breath, chest pain, muscle pain, headache, cognitive impairment, fever, and depression.
[0182] Reducing viral entry may affect areas other than the respiratory system. For example, in some cases, the virus targets tissues other than the respiratory system, or tissues other than the respiratory system. As a non-limiting example, SARS-CoV-2 has also been found to target ACE2-containing cells in the heart, vascular system, and intestines, potentially causing myocarditis. In such cases, viral entry can be reduced by inhalation administration of the formulations or systems of the present disclosure that target the systemic circulation. In some embodiments, viral infection is reduced by inhalation administration of the formulations or systems of the present invention that target the systemic circulation. In some embodiments, viral infection also infects the respiratory system. In some embodiments, viral infection does not infect the respiratory system.
[0183] In some embodiments, methods for mitigating viral respiratory infections in subjects requiring mitigation are provided herein, the methods comprising administering to subjects with viral respiratory infections a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable carrier, either intranasally or by inhalation.
[0184] In some embodiments, methods for treating viral respiratory infections in subjects requiring treatment are provided herein, the methods comprising administering to a subject suffering from a viral respiratory infection, or a subject potentially exposed to a viral respiratory infection, a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable carrier, either intranasally or by inhalation.
[0185] In some embodiments, the viral respiratory infection of the method of the present invention is any viral respiratory infection known to those skilled in the art. In some embodiments, the viral respiratory infection is selected from the group consisting of coronaviruses, morbilliviruses, bunyaviruses, arenaviruses, influenza viruses, rhinoviruses, and adenoviruses. In some embodiments, the viral respiratory infection is selected from the group consisting of SARS-CoV-2, SARS, MERS, hantavirus pulmonary syndrome, measles, Lassa fever, influenza, influenza A, influenza A H1, influenza A H1-2009, influenza A H3, influenza B, polynuclear respiratory virus (RSV) A, RSV B, parainfluenza 1, parainfluenza 2, parainfluenza 3, parainfluenza 4, metapneumoviruses, enteroviruses, and adenoviruses. In some embodiments, the viral respiratory infection is selected from the group consisting of CoV-2, SARS, MERS, hantavirus pulmonary syndrome, measles, Lassa fever, influenza, influenza A, influenza A H1, influenza A H1-2009, influenza A H3, and influenza B. In some embodiments, the viral respiratory infection is COVID-19.
[0186] In some embodiments, the formulation of the method of the present invention is administered by any known method known to those skilled in the art. In some embodiments, the formulation is administered as described in the above section. In some embodiments, the formulation is administered intranasally or by inhalation. In some embodiments, the formulation is administered intranasally. In some embodiments, the formulation is administered by inhalation. In some embodiments, administration is by mechanical inhaler. In some embodiments, the mechanical inhaler is a metered-dose powder inhaler, a pressurized aerosol inhaler, a dry powder inhaler, or a nebulizer. In some embodiments, the mechanical inhaler is selected from the group consisting of Respimat® Soft Mist® inhaler, RespiClick® inhaler, Breezhaler® inhaler, Genuair® inhaler, Rotahaler® inhaler, Staccato® inhaler, and Ellipta® inhaler.
[0187] In some embodiments, the method of the present invention includes any statin known to those skilled in the art. In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin. In some embodiments, the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, and atorvastatin. In some embodiments, the statin is selected from the group consisting of pitavastatin and simvastatin. In some embodiments, the statin is pitavastatin. In some embodiments, the statin is simvastatin.
[0188] In some embodiments, the method of the present invention involves administering a statin in any therapeutically effective amount known to those skilled in the art. The statin may be administered in any therapeutically effective amount as described in the above section. In some embodiments, the therapeutically effective amount is between about 0.005 μg and about 40 mg. In some embodiments, the therapeutically effective amount is between about 0.1 μg and 15 mg. In some embodiments, the therapeutically effective amount is between about 0.1 μg and about 5 mg. In some embodiments, the therapeutically effective amount is between about 0.5 μg and about 15 mg. In some embodiments, the therapeutically effective amount is between about 1.0 μg and about 10 mg. In some embodiments, the therapeutically effective amount is between about 1.0 μg and about 5 mg. In some embodiments, the therapeutically effective amount is between about 0.1 μg and about 100 μg.
[0189] In some embodiments, the method of the present invention further comprises administering at least one additional therapeutic agent. In some embodiments, the method of the present invention comprises any additional therapeutic agent known to those skilled in the art. In some embodiments, each additional therapeutic agent is independently selected from the group consisting of RNA polymerase inhibitors; viral protease inhibitors; host protease inhibitors; TMPRSS2 inhibitors; antiviral agents; chloroquine or a salt thereof, hydroxychloroquine or a salt thereof, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, mostat or a salt thereof, daunavir, oseltamivir, ribavirin, convalescent plasma or antibodies extracted therefrom; selinexol; inhaled nitric oxide; exosomes and / or microvesicles; and umbilical cord blood regulatory T cells. In some embodiments, the additional therapeutic agent is nelfinavir mesylate, azithromycin, bafilomycin, camostat mesylate, camostat or camostat salt, arbidol, amantadine, rimantadine, lopinavir, darunavir, ribavirin, remdesivir, favipirvir, chloroquine, hydroxychloroquine, tocilizumab, or sarilumab. In some embodiments, the additional therapeutic agent is remdesivir.
[0190] In some embodiments, each additional therapeutic agent may be a β-agonist; corticosteroid; muscarinic antagonist; RhoA inhibitor; GGTase-I or-II inhibitor; ROCK1 and / or ROCK2 inhibitor; soluble epoxide hydrolase inhibitor; fatty acid amide hydrolase inhibitor; leukotriene receptor antagonist; phosphodiesterase-4 inhibitor (e.g., roflumilast); 5-lipoxygenase inhibitor (e.g., dileuton); mast cell stabilizer (e.g., nedocromil); squalene synthase inhibitor (e.g., rapakistat, zaragodic acid, and RPR). 107393 etc); Farnesyl pyrophosphate synthase inhibitors (non-exclusive examples include the biphosphonates alendronate, etidronate, clodronate, tildronate, pamidronate, neridronate, olpadronate, ivadronate, risedronate, and zoledronate); Theophylline; Anti-IL5 antibodies; Anti-IgE antibodies; Anti-IL5 receptor antibodies; Anti-IL13 / 4 receptor antibodies; Biological agents (mepolizumab, reslizumab, benralizumab, omalizumab, and dupilumab etc); β-A The group is selected from combinations of agonists and muscarinic antagonists (including both long-acting and short-acting formulations); combinations of β-agonists and corticosteroids (including both long-acting and short-acting formulations); combinations of corticosteroids and muscarinic antagonists (including both long-acting and short-acting formulations); and combinations of β-agonists, corticosteroids, and muscarinic antagonists (including both long-acting and short-acting formulations). In some embodiments, each additional therapeutic agent is a β-agonist, a corticosteroid, a muscarinic antagonist, or any combination thereof. In some embodiments, the additional agent is dexamethasone. In some embodiments, the additional agent includes dexamethasone and further includes remdesivir.
[0191] The additional therapeutic agent of the present invention can be administered by any method and in any dose known to those skilled in the art. In some embodiments, the additional therapeutic agent is administered intranasally or by inhalation. In some embodiments, the additional therapeutic agent is administered intranasally. In some embodiments, the additional therapeutic agent is administered by inhalation. In some embodiments, the additional therapeutic agent is administered in a therapeutic dose or less. In some embodiments, the additional therapeutic agent is administered in a therapeutic dose. In some embodiments, the additional therapeutic agent is administered in a dose less than therapeutic.
[0192] In some embodiments, the formulation for the method of the present invention can be administered at any appropriate time. In some embodiments, the formulation is administered prophylactically. In some embodiments, the formulation is administered before exposure to a viral respiratory infection. In some embodiments, the formulation is administered between 1 hour and 7 days before exposure to a viral respiratory infection. In some embodiments, the formulation is administered between 1 hour and 24 hours before exposure to a viral respiratory infection. In some embodiments, the formulation is administered between 3 hours and 12 hours before exposure to a viral respiratory infection. In some embodiments, the formulation is administered about 4 hours, 6 hours, 8 hours, or 10 hours before exposure to a viral respiratory infection. In some embodiments, the formulation is administered about 6 hours before exposure to a viral respiratory infection.
[0193] In some embodiments, the formulation is administered after exposure to a viral infection. In some embodiments, the formulation is administered after the subject is diagnosed with an infection. In some embodiments, the formulation is administered after exposure to a respiratory virus is suspected.
[0194] In some embodiments, the formulation is administered 1 to 24 hours before potential exposure to a viral respiratory infection, the statin comprises pitavastatin or simvastatin, and the formulation further comprises at least one of remdesivir or dexamethasone.
[0195] In some embodiments, methods for treating SARS-CoV-2 virus infection in subjects requiring treatment are provided herein, the methods comprising administering to a subject suffering from a viral respiratory infection a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable carrier, either intranasally or by inhalation.
[0196] In some embodiments, methods for treating SARS-CoV-2 virus infection in subjects requiring treatment are provided herein, the methods comprising administering to subjects potentially exposed to the SARS-CoV-2 virus a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable carrier, either intranasally or by inhalation.
[0197] In some embodiments, methods for reducing the severity of COVID-19 in subjects infected with SARS-CoV-2 are provided herein, the methods comprising administering to the infected subjects, either intranasally or by inhalation, a formulation comprising a therapeutically effective amount of a statin and a pharmaceutically acceptable carrier.
[0198] In some embodiments, formulations for the methods of the present disclosure can reduce or suppress viral titer, viral load, or symptoms of a viral infection or pro-inflammatory response. In some embodiments, the formulation inhibits an increase in viral titer. In some embodiments, the formulation reduces the viral load in a subject. In some embodiments, the formulation mitigates or inhibits one or more symptoms of a viral infection. In some embodiments, the formulation mitigates or inhibits one or more pro-inflammatory responses.
[0199] In some embodiments, the pro-inflammatory response is an increase in cytokine, chemokine, or IL-6 levels. In some embodiments, the pro-inflammatory response is cytokine or chemokine. In some embodiments, the formulation reduces or suppresses the increase in IL-6 levels in the subject. In some embodiments, the formulation blocks, inhibits, or mitigates a cytokine storm in the subject.
[0200] In some embodiments, the formulation is administered after suspected exposure to a respiratory virus. In some embodiments, the formulation is administered after exposure to the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject within 1, 2, 6, or 24 hours after suspected exposure. In some embodiments, the formulation is administered to the subject within 1 to 14 days after suspected exposure. In some embodiments, the formulation is administered to the subject within 1, 2, 3, 4, 5, 6, or 7 days after suspected exposure. In some embodiments, the formulation is administered to the subject within 7 to 10 days after suspected exposure.
[0201] In some embodiments, the formulation is administered before potential exposure to a respiratory virus. In some embodiments, the formulation is administered before potential exposure to the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject within 1 hour, 2 hours, 6 hours, or 24 hours prior to potential exposure.
[0202] The formulations of the present invention can be administered as described in the above section. In some embodiments, the formulation is administered to the subject once, twice, three times, four times, or five times. In some embodiments, the formulation is administered to the subject once, twice, three times, four times, or five times after the subject has been exposed to the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject once, twice, three times, four times, or five times before the subject has been exposed to the SARS-CoV-2 virus.
[0203] In some embodiments, the formulation is administered to the subject before and / or after vaccination for the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject before vaccination for the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject after vaccination for the SARS-CoV-2 virus. In some embodiments, the formulation is administered to the subject in combination with the vaccine for the SARS-CoV-2 virus.
[0204] In some embodiments, the formulation is administered to the subject in combination with additional COVID-19 treatment. Any treatment known to those skilled in the art may be used as additional COVID-19 treatment. In some embodiments, the additional COVID-19 treatment is remdesivir or dexamethasone.
[0205] The statins of the present invention can preserve the viability of cells. In some embodiments, the statins preserve the viability of epithelial cells within a subject. In some embodiments, the viability of epithelial cells is preserved in lung tissue and / or throat tissue. In some embodiments, the viability of epithelial cells is preserved in lung tissue.
[0206] In some embodiments, methods for preventing viral entry into cells are provided herein, the methods comprising administering a therapeutically effective amount of statin, wherein the virus is the SARS virus.
[0207] Any SARS virus known to those skilled in the art can be used as the SARS virus. In some embodiments, the virus is the SARS-CoV-2 virus.
[0208] Any suitable cells known to those skilled in the art can be used as cells in the method of the present invention. In some embodiments, the cells are airway epithelial cells. In some embodiments, the cells are airway epithelial cells of the mouth, nose, trachea, or lung.
[0209] In some embodiments, epithelial cells are present in subjects infected with SARS-CoV-2, and the statin is administered to the infected subject by intranasal administration or inhalation as a formulation containing a therapeutically effective amount of statin and a pharmaceutically acceptable carrier.
[0210] VI. Examples The following examples are provided for guidance and are not intended to limit the scope of the claims herein.
[0211] To enhance cellular uptake and predictable cell relaxation properties, simvastatin was activated by alkaline hydrolysis to chemically convert simvastatin lactone to simvastatic acid (SA). In vivo, hydrolysis may occur spontaneously within cells by lactonases, paraoxonases, alkaline hydrolases, and carboxylesterases. Simvastatin was activated by opening its lactone ring using a protocol provided by Merck, resulting in the conversion to a hydroxyl acid. Briefly, 8 mg of simvastatin (0.019 mM) was dissolved in 0.2 mL of 100% ethanol, followed by the addition of 0.3 mL of 0.1 N NaOH. This solution was then heated in a sand bath at 50°C for 2 hours, followed by neutralization with HCl to a pH of 7.2 (CC Ghosh et al., Crit Care Med (2015) 43(7):e230-40).
[0212] Example 1: Cholesterol depletion Normal human bronchial epithelial cells (cell line HBE1) were grown and confluenced at the air-liquid interface (ALI), then treated with 50, 100, 200, or 400 nM and 1, 5, 10, or 20 μM simvastatin for 48 hours. Total cholesterol in the cells was measured by spectrophotometric analysis, and the ratio of absorbance to total protein was plotted (in μg). Figure 1 shows the results of treatment with 50, 100, 200, and 400 nM simvastatin. Figure 2 shows the results of treatment with 1, 5, 10, and 20 μM simvastatin. A significant reduction in cholesterol content (≥50%, p<0.05) is shown (*).
[0213] Example 2: Antiviral activity Airway epithelial cells were grown to confluence under biphase ALI conditions and then treated with simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin at concentrations of 1–5 μM for 24–72 hours. Viral replication was measured by plaque assay, and viral levels were determined using quantitative RT-PCR of viral RNA.
[0214] Cell death is also elucidated by MTT assay, LDH release, and Alamar Blue (C. osterlund et al., J Appl Toxicol (2005) 25:328-37; R. Hamid et al., Toxicol Vitr (2004) 18(5):703-10; and J. O'Brien et al., Eur J Biochem (2000) 267(17):5421-26). Expression of pro-inflammatory genes (IFNγ, IFNβ, TNFα, IL6, IL8, IL1β).
[0215] Pre- and post-drug experiments will be conducted to demonstrate the efficacy of the drug before and after SARS-CoV-2 infection in Calu-3 human epithelial cell lines and primary human bronchial epithelial cells or precisely cut human lung sections (PCLS). ACE2 and TMPRSS2 expression will be measured using qRT-PCR and ELISA, and infectivity will be determined by plaque assay. Cell death, viral levels, and inflammatory gene expression will be clarified as described above.
[0216] Example 3: formulation The pitavastatin sponge microsphere formulation is prepared as follows: Disperse distearoylphosphatidylcholine (1.24 g) in 50 mL of deionized water using a Model T-25 Ultra-Turrax mixer at 8,000 rpm for 2-5 minutes (T=60-70°C). Mix the oil-in-water emulsion using a Model T-25 Ultra-Turrax mixer (T=60-70°C) at 10,000 rpm for an additional period of 4 minutes or more. Then, homogenize the resulting crude emulsion under high pressure using an Avestin (Ottawa, Canada) homogenizer five times at 18,000 psi.
[0217] Add 500 mL of deionized water to Pluronics® F68 (BASF) (2.0 g) and mix this composition using a Model T-25 Ultra-Turrax mixer at 10,000 rpm for 60 minutes (T=60~70°C). While maintaining the temperature at 60~70°C, add pitavastatin (0.4 g) to the Pluronics® mixture in 10 mg increments at 5-minute intervals to form the pharmaceutical raw material.
[0218] Next, the pharmaceutical ingredients are added drop by drop to the O / W emulsion under continuous magnetic stirring while maintaining the temperature of each ingredient at 60°C. If the filter is clogged and sterilization filtration is not possible, this combination of ingredients can be sterilized with UV or gamma rays before being atomized. The final product is packaged for administration by a sprayer or spray-dried for administration as a dry powder. Example 4: In silico-2 binding assay [Table 1]
[0219] Protein Labeling and Interaction Test: SARS-CoV-2 S1 was labeled with the Monolith His-Tag Labeling Kit RED-Tris-NTA 2nd Generation (NanoTemper Technologies) in PBS pH 7.4, 0.005% Tween®, according to the manufacturer's instructions. To ensure stable interaction between the His-tag and the dye, an MST binding assay was performed in the full dose-response range. SARS-CoV-2 S1 (0.0305-1000 nM) in a range of concentrations of a constant 5 nM RED-Tris-NTA dye was supplied in a premium capillary of a Monolith NT.115pico instrument (NanoTemper Technologies, Munich, Germany) at 25°C with 40% MST power and 10% LED power. The binding buffer was PBS pH 7.4, 0.005% Tween®.
[0220] Microscale Thermophoresis (MST) binding assay of SARS-CoV-2 S1 (labeled) versus ACE2. Microscale Thermophoresis (MST) binding experiments were performed using 25 nM RED-Tris-NTA-labeled SARS-CoV-2 S1 in binding buffer (PBS pH 7.4, 0.005% Tween®) and ACE2 within a specified concentration range (0.2332~7.640 nM) in a Monolith NT.115 pico instrument (NanoTemper Technologies, Munich, Germany) at 25°C in a premium capillary chamber with 40% MST power and 10% LED power. Data were analyzed using MO.Affinity analysis software (version v2.3, NanoTemper Technologies) with a standard MST-on time of 15 seconds. A binding event was defined as a combination of an amplitude greater than 5 units and a signal-to-noise level greater than 5 units.
[0221] Microscale Thermophoresis (MST) binding assays were performed using SARS-CoV-2 S1 (labeled) versus ligands. Microscale Thermophoresis (MST) binding experiments were conducted using 25 nM RED-Tris-NTA-labeled SARS-CoV-2 S1 in binding buffer (PBS pH 7.4, 0.005% Tween® + 2% DMSO) with various ligands in a range of concentrations (6.1035 to 200.000 nM) in a premium capillary chamber of a Monolith NT.115 pico instrument (NanoTemper Technologies, Munich, Germany) at 25°C, with 40% MST power and 10% LED power. Data were analyzed using MO.Affinity analysis software (version v2.3, NanoTemper Technologies) with different appropriate MST-on times (1 to 20 seconds) for each dataset. A coupled event was defined as a combination of a data-fit processing amplitude exceeding 5 units and a signal-to-noise level exceeding 5 units.
[0222] Comprehensive MST binding assay: Target: SARS-CoV-2 S1, used at constant 25nM Ligand: Titrate INS101-INS107 by reducing the concentration from 200 μM through 16 1:1 dilution steps. Equipment: Monolith NT.115 Pico Buffer: 1x PBS pH 7.4, 0.2% CHAPS, 2% DMSO Repetition: Technical
[0223] Data from the ACE2 assay are shown in Figure 3.
[0224] Data from the statin ligand assay are shown in Figure 4.
[0225] Data regarding ligand affinity and signal-to-noise (S / N) ratio are shown in Table 1 below. [Table 2]
[0226] The complete results for affinity and docking scores between ACE2 receptors and statin ligands are shown in Table 2 below. [Table 3]
[0227] It should be noted that INS-101 and INS-102S showed weak binding. INS-107 did not show binding, but it may show very weak binding. The order of affinity based on the binding assay is hACE2 > INS-104 > INS-102 > INS-105 > INS-103 > INS-106.
[0228] The docking scores were generated by in silico modeling of statins and S-protein targets. A negative docking score indicates a higher binding affinity. Therefore, the order of affinity based on the docking scores is hACE2 > INS-104 > INS-109 > INS-103 > INS-105 > INS-106 > INS-102.
[0229] In conclusion, INS-102, INS-103, and INS-104 are hydrophobic statins that bind to the SARS-CoV-2 S-protein at nanomolar (nM) concentrations. INS-101 is hydrophilic and has little to no affinity for the S-protein. INS-102, INS-103, and INS-104 can interfere with the interaction between SARS-CoV-2 and hACE2.
[0230] Example 5: Oncodesign research This study evaluates the SARS-CoV-2-induced cytokine profile during the replication phase of the SARS-CoV-2 virus in a human lung epithelial cell model, specifically in the human lung cell line Calu-3, at three concentrations of the two compounds. At the end of the experiment, the supernatant was collected and IL-6 was examined using Elisa, and a 10-fold duplicated panel was examined using multiplexing technology. Final viral load was also assessed using RTqPCR.
[0231] Test materials. Two test material compounds, INS102 and INS103, were provided by the sponsor and stored at -20°C until use. INS102 and INS103 were supplied in 25 mM DMSO.
[0232] Cell systems. The cell systems used in this study are detailed below: [Table 4]
[0233] Cell culture conditions. The Calu-3 cell model is already well documented in the literature for SARS-CoV (e.g., Tseng et al., 2005, J Virol, https: / / doi:10.1128 / JVI.79.15.9470-9479). Calu-3 cells were grown as a monolayer at 37°C in a humidified atmosphere (5% CO2, 95% air) and placed in the corresponding cell medium (MEM + 1% pyruvate + 1% glutamine + 10% fetal bovine serum). All cells adhered to a plastic flask. For cell passage, cells were detached from the culture flask by treatment with trypsin-bersen for 5 minutes and neutralized by adding complete medium. For study purposes, cells were coated on a 96-well plate. Cells were counted and their viability was evaluated using a V-cell counter.
[0234] Virus isolate. The virus strain was supplied through the European Virus Archive goes Global (Evag) platform (https: / / www.european-virus-archive.com / ). For this study, a Slovakia isolate was used (reference SARS-CoV-2 strain Slovakia / SK-BMC5 / 2020). Virus titer: SARS-CoV-2 was amplified and titrated in the Vero E6 TMPRSS2 cell line (obtained from NIBsc, United Kingdom) by Oncodesign.
[0235] The goal of the experiment is to evaluate the antiviral effect against human lung epithelial cell lines during the replication phase. All experiments were independently repeated once (N=2).
[0236] Infection and treatment protocol: Calu-3 cells were counted, and their cell viability was evaluated using a Vi-Cell automatic device. Approximately 2 hours before testing (the time required for cells to adhere to the bottom of the well plate), cells were seeded in 96-well plates at a density of 30,000 cells / well. Cells were cultured until they reached confluence. This approach is used to study the effect of compounds during the replication phase (after cell infection) - briefly, the virus was prepared at a multiplicity of infection (M.O.I = about 0.01). Since the titer of the virus stock is 5×10e4 pfu / mL, the virus master mix was calculated and prepared according to the number of Calu3 cells / well at the time of the experiment. - The cell culture medium contained in the plate was removed, and 100 μL of the virus-compound mixture was immediately added to the corresponding wells. 1 hour after transferring the plate to a 37°C incubator, 80 μL of complete cell culture medium was added to all wells. - Reference control (chloroquine diphosphate (#C6628, Sigma) was prepared at 300 μM in cell culture medium: that is a 10-fold concentration, and 20 μL is added to the cells). The final concentration of the compound on the surface of infected cells is described below. Table 5
[0237] We studied different cases: - Case A: One hour after infection, 20 μL of a compound at 10 times the concentration is added (the compound is in contact with the infected cells for 72 hours in a 37°C incubator). - Case B: 24 hours after infection, 20 μL of a compound at 10 times the concentration is added (the compound is in contact with the infected cells for 48 hours in a 37°C incubator). - Case C: 48 hours after infection, 20 μL of a 10-fold concentrated compound is added (the compound is in contact with infected cells for 24 hours in a 37°C incubator). - Case D: Six hours before infection, 20 μL of the compound at 10 times the concentration was added (the compound was in contact with infected cells for 72 hours in a 37°C incubator, and the total statin exposure time was 78 hours). - Case E: 24 hours before infection, 20 μL of the compound at 10 times the concentration is added (the compound is in contact with infected cells for 72 hours in a 37°C incubator, and the total statin exposure time is 96 hours). - Case F: One hour before infection, 20 μL of the compound at 10 times the concentration was added (the compound was in contact with infected cells for 72 hours in a 37°C incubator, and the total statin exposure time was 73 hours).
[0238] At the end of the study, all supernatant was collected from the virus-containing cell plates and stored for viral load quantification by RT-qPCR.
[0239] Cell viability. Cell viability was measured using the CellTiter Glow kit from Promega, which measures intracellular ATP. The protocol for this kit can be found on the CellTiter-Glo 2.0 Cell Viability Assay page of the Promega website.
[0240] Supernatant collection for IL-6 assay by ELISA. At the end of the experiment (72 hours after infection), supernatant was collected from individual wells and divided into three separate plates to avoid freeze / thaw cycles. One arm of the study was to analyze interleukin-6 (IL-6) using Elisa® technology. The protocol followed the manufacturer's recommendations strictly (#430507, LEGEND MAX® Human IL-6 ELISA Kit, BioLegend).
[0241] Supernatant collection for analysis of a decuplicated cytokine panel. The other arm of the study is to analyze a decuplicated cytokine panel (IL6, IL8, IL10, TNFα and IL1α, IL1β, IL18, eotaxin-3, MCP-1, IP10) at the end of the experiment. This approach simultaneously analyzes numerous biomarkers of cytokines and chemokines using a bead-based multiplex assay utilizing Luminex technology. The protocol strictly followed the manufacturer's recommendations (#MX3227W-PPX10, Life Technologies).
[0242] Supernatant recovery for RT-qPCR technique. The third arm of the study is the quantification of viral load by RT-qPCR at the end of the experiment. Within the targeted region, these assays involve the use of the IP2 / IP4 gene (based on the protocol published by the Pasteur Institute in France and posted by the WHO: https: / / www.who.int / docs / default-source / coronaviruse / real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-pasteur-paris.pdf?sfvrsn=3662fcb6_2).
[0243] Viral RNA extraction was performed using the QIAamp Viral RNA Mini Kit (Qiagen) or a similar kit. The RNA was frozen at -20°C until RTqPCR; complete RT-PCR was performed using the SuperScript® III One-Step QRT-PCR System Kit (commercial kit #1732-020, Life Technologies) with primers targeting the IP2 / IP4 genes and under RT-PCR conditions. Amplification was performed using a Bio-Rad CFX96® or Thermo instrument and its accompanying software.
[0244] The research results are shown below.
[0245] Effects of INS-102 and INS-103 on the cell viability of Calu3 cells in the absence of virus. Cells were treated with these compounds for 72 hours. No loss of cell viability was observed when INS-102 and INS-103 were used at the working concentrations shown in Figure 5. Details of the cell setup and treatment are shown below. [Table 6]
[0246] APP stands for appilimod, an antiproliferative agent, and ChIQ stands for chloroquine. The concentration is shown in μM.
[0247] The cells were pre-treated with the compound for 6 or 24 hours, followed by 72 hours of DMSO-containing medium. No loss of cell viability was observed when INS-102 and INS-103 were used at the working concentrations shown in Figure 6. Concentrations are shown in μM. Details of the cell setup and treatment are shown below. [Table 7]
[0248] Case A. After infecting cells with the virus for 1 hour, INS102 or INS103 was added and the compound was contacted with the infected cells for 72 hours. As shown in Figure 7, it was found that treatment with INS102 and INS103 provided dose-dependent protection against virus-induced loss of cell viability. % Cell viability was calculated as [(value - mean value of infected cells) / (mean value of cells)] × 100. Details of cell setup and treatment are shown below.
Table 8
Table 9
[0249] Table 3 below shows statistics compared with samples treated with DMSO.
Table 10
[0250] From the t-test results shown above, it was demonstrated that INS102 at doses of 10 uM and 1 uM, and INS103 at doses of 5 uM, 1 uM, and 0.2 uM were significant when compared with the DMSO control.
[0251] Case B. After infecting cells with the virus for 24 hours, INS102 or INS103 was added and the compound was contacted with the infected cells for 48 hours. As shown in Figure 8, it was found that treatment with INS102 provided dose-dependent protection against virus-induced loss of cell viability. % Cell viability is calculated as described above.
[0252] Table 4 below shows statistics for Case B compared with samples treated with DMSO. From the t-test results, it was demonstrated that INS102 at doses of 10 uM and 1 uM was significant compared with the DMSO control.
Table 11
[0253] Case C. After infecting cells with the virus for 48 hours, INS102 or INS103 was added, and the compound was kept in contact with the infected cells for 24 hours. The data is shown in Figure 9. % cell viability was calculated as described above.
[0254] Table 5 below shows the statistics for Case C compared to the sample treated with DMSO. The t-test results shown above demonstrate that INS102 at a dose of 10 μM was significantly more effective than the DMSO control. [Table 12]
[0255] Case D. Cells were pretreated with INS102 or INS103 for 6 hours, then infected with the virus for 72 hours, and the compounds were kept in contact with the cells for 78 hours. As shown in Figure 10, treatment with INS102 and INS103 was found to provide dose-dependent protection against virus-induced loss of cell viability. % cell viability was calculated as described above. Details of cell setup and treatment are shown below. [Table 13]
[0256] Table 6 below shows the statistics for Case D compared to the sample treated with DMSO. The t-test results shown above demonstrate that all doses of INS102 and INS103 were statistically significant compared to the DMSO control. [Table 14]
[0257] Table 7 below shows Dunnett's multiple comparison test for one-way ANOVA. [Table 15]
[0258] Case E. Cells were pretreated with INS102 or INS103 for 24 hours, then infected with the virus for 72 hours, and the compound was kept in contact with the cells for 96 hours. Treatment with high and medium doses of INS102 and high doses of INS103 was found to provide dose-dependent protection against virus-induced loss of cell viability. % cell viability was calculated as described above. Details of cell setup and treatment are shown below. [Table 16]
[0259] Table 8 below shows the statistics for Case E compared to the sample treated with DMSO. The t-test results shown above demonstrate that INS102 at a dose of 10 μM and INS103 at a dose of 5 μM were significantly more effective than the DMSO control. [Table 17]
[0260] Table 9 below shows Dunnett's multiple comparison test for one-way ANOVA. [Table 18]
[0261] Case F. Cells were par-treated with INS102 or INS103 for 1 hour, then infected with a virus for 72 hours, allowing the compound to remain in contact with the cells for 73 hours. As shown in Figure 12, treatment with high doses of INS102 and all doses of INS103 was found to provide dose-dependent protection against virus-induced loss of cell viability. % cell viability was calculated as described above. Details of cell setup and treatment are shown below. [Table 19]
[0262] Table 10 below shows the statistics for Case E compared to the sample treated with DMSO. The t-test results shown above demonstrate that INS102 at a dose of 1 μM and INS103 at doses of 5 μM, 1 μM, and 0.2 μM were significantly superior to the DMSO control. [Table 20]
[0263] Table 11 below shows Dunnett's multiple comparison test for one-way ANOVA. [Table 21]
[0264] The effect of INS102 on SARS-CoV-2 viral load in cases A-C is illustrated: As shown in Figure 13, a dose of 10 μM of INS-102 reduced viral load at 24, 48, and 72 hours. Details of cell setup and treatment are shown in Figure 32. Statistical analysis is shown in Figure 33.
[0265] The effect of INS103 on SARS-CoV-2 viral load in cases A to C is illustrated in Figure 14: As shown in Figure 14, INS-103 reduced viral load in a dose-dependent manner. Details of cell setup and treatment are presented in Figure 34. Statistical analysis is shown in Figure 35.
[0266] Figure 36 shows the setup for cell research involving INS102 and INS103.
[0267] Luminex. The cytokines used in the Luminex experiment are specified above. The results of the IL-6 production experiments for cases A to C are shown in Figure 15. The statistical analysis is shown in Figure 37.
[0268] The results of the experiments on IL-8 production for cases A to C are shown in Figure 16. The statistical analysis is shown in Figure 38.
[0269] The results of the experiments on IL-10 production for cases A to C are shown in Figure 17. The statistical analysis is shown in Figure 39.
[0270] Figure 18 shows the experimental results regarding IL-1α production for cases A to C. Figure 40 shows the statistical analysis.
[0271] ELISA. The setup for the ELISA experiment is specified above. The results of the IL-6 production experiments for cases A to C are shown in Figure 19. The statistical analysis is shown in Figure 41.
[0272] Oncodesign studies have shown that SARS-CoV-2 reduces the viability of Calu-3 cells. As demonstrated herein, INS-102 and INS-103 were not cytotoxic to Calu-3 cells or Vero cells. INS-102 and INS-103 inhibited SARS-CoV-2-induced loss of viability in Calu-3 cells. Pretreatment with INS-102 and INS-103 for 6 hours inhibited SARS-CoV-2-induced loss of viability in Calu-3 cells. Incubation of SARS-CoV-2 with INS compounds inhibited SARS-CoV-2-induced loss of viability in Calu-3 cells. High doses (10 μM INS-102, 5 μM INS-103) reduced the viral load of SARS-CoV-2. Both INS-102 and INS-103 inhibited the production of SARS-CoV-2-induced cytokines and chemokines in Calu-3 cells.
[0273] Example 6: Intracellular inhalation therapy for SARS-CoV-2 To investigate the effects of statin inhalation on SARS-CoV-2, a hamster model was selected. Hamsters are forced to breathe through their noses and serve as a model for respiratory disease and treatment. A schematic diagram of the overall study design is shown in Figure 20.
[0274] Adult male hamsters (7-9 weeks old; Charles River) were placed in ABSL-3 containment cages, two hamsters per cage. Hamsters were weighed daily, starting two days before infection and continuing until day six post-infection. Hamsters were treated with medication, PPBS, or a control vehicle, also starting two days before infection. The medication (pitavastatin) was prepared as a citrate buffer formulation, and the control vehicle (DV) contained the same formulation without pitavastatin. Medication and DV samples were kept protected from light until use. [Table 22]
[0275] Day 0 (i.e., 2 days after the start of treatment), 15 hamsters in the first group received 10 4 A 30 μl volume of PFU containing SARS-CoV-2 was intranasally inoculated into the first group of 15 hamsters, while the second group received the same volume of DPBS intranasally. Inoculation (virus and control) was administered approximately 2 hours after treatment with the drug or control vehicle. The virus and control vehicle were prepared as described in Table 12. Prior to inoculation, the hamsters were anesthetized with isoflurane (2-5% saturated) in a bell jar system. After the hamsters recovered from anesthesia in an empty cage, they were returned to group housing with bedding. [Table 23]
[0276] Throat swabs were performed on each hamster 1-3 days after infection with the virus. On day 3, half of each treatment group was euthanized, and the remaining animals were euthanized 6 days after infection. The treatment groups are shown in Table 13. For throat swabs, the hamsters were anesthetized with isoflurane (2-5% saturated) in a bell jar system before swabbing. On days 3 and 6, the hamsters were anesthetized with a cocktail of ketamine, xylazine, and acepromazine, and then euthanized by cervical dislocation. Autopsies were performed and the tissues listed in Table 14 were collected. [Table 24] [Table 25] The samples from the recovered tissue were analyzed as follows:
[0277] Plaque assay: Lavage fluid from tracheal swabs, serum, and lung and brain homogenates were thawed at 37°C and the inoculum was analyzed directly without freezing. Samples were serially diluted 10-fold, starting with an initial dilution of 1:8 in DMEM containing 1% bovine serum albumen (BSA). 125 μL of each dilution was added to confluent VeroCCL-81 cells (ATCC) in 12-well cluster plates filled with cell medium. The virus was incubated on the cells at 5% CO2 for 1 hour in a moistened incubator at 37°C. The cell monolayer was covered with 0.5% agarose dissolved in DMEM containing 5% fetal bovine serum (FBS) and 1× antibiotic-antifungal agent (ThermoFisher), and incubated at 5% CO2 and 37°C for 3 days in a moistened incubator. After fixing the cells in 4% buffered formalin for over 30 minutes, the agarose plug was removed. The cells were stained with 20% ethanol containing 0.05% crystal violet for 10 minutes, then rinsed three times with water. After inverting the plate and allowing it to dry completely, the cells were counted in double wells. Viral titers were recorded by averaging the reciprocals of the maximum dilutions at which plaque was observed, and expressed as PFUs per swab or PFUs per mg of solid tissue.
[0278] Plaque reduction neutralization test: Serum from hamsters on days 3 and 6 after inoculation was thawed at 37°C, and 30 μL was heated in a water bath at 56°C for 30 minutes to inactivate complement proteins. The serum was diluted fourfold with a viral diluent consisting of PBS and 1% FBS, and then serially diluted 2-fold 11 times to achieve a dynamic range of 1:4 to 1:4096. Equal volumes of viral diluents containing 80 PFU of SARS-CoV-2 were added to each antibody diluent and to an antibody-free control consisting only of viral diluent, resulting in a final dynamic range of 1:4 to 1:8192 for one antibody-free control. The antibody-viral dilution series was applied to confluent VeroCCL-81 cells in single replicates and incubated in a humidified incubator at 5% CO2 and 37°C for 1 hour. For the plaque assay, cells were covered, incubated, fixed, and stained as described above. The neutralizing titer is defined as the reciprocal of the dilution at which less than 20% of the plaque was detected (more than 80% neutralization) compared to the no-antibody control.
[0279] Statistics: All statistical tests were performed using GraphPadPRISM 9.0.2 (GraphPad software). Log-rank (Mantel-Cox) tests for survival rates were performed pairwise, and p-values were adjusted for Bonferroni correlation using the R version 4.0.0 (RProject) p-adjustment function. The correlation between death and positive virus detection was calculated using Fisher's exact test. Repeated measures two-way ANOVA was performed log 10 The process was performed on the converted values, and multiple comparisons were calculated according to Tukey's method. The weight normalized to the starting value at the time of the virus challenge, or log 10 A two-way main-effects ANOVA was performed on the converted viral titers, and multiple comparisons were calculated using Tukey's method. The area under the curve (AUC) was calculated for tracheal swabs collected longitudinally and then transformed to log10. The grouped log... 10 -Analysis of variance of AUC was performed along with multiple comparisons calculated using Tukey's method. The Kruskal-Wallis H test was performed on the untransformed PRNT80 neutralization values, and multiple comparisons were calculated according to Dunn's method.
[0280] Histopathological examination: At autopsy, the lungs were inflated with 10% buffered formalin (ThermoFisher), and the hamster tissues were fixed in 10 times the volume of 10% buffered formalin at room temperature for 48 hours. The skulls were desalted in 10 times the volume of 0.5 M ethylenediaminetetraacetic acid (EDTA) (pH=7) at 4°C for 18 days, with the EDTA solution replaced every 5 days. The tissues were embedded in paraffin, thinly sectioned, and stained with hematoxylin and eosin (H&E) according to standard procedures. The H&E slides were scanned using an Aperio slide scanner with 2x magnification and a resolution of 0.25 μm / pixel, and magnified 40x using whole-slide imaging technology. The image files were uploaded to a Leica-hosted web-based site, where qualified veterinary anatomical pathologists blindly evaluated the sections for histological lesions induced by SARS-CoV-2. To quantitatively evaluate pneumonia, digital images were acquired and analyzed using ImageJ software (Fiji). The area of inflammatory tissue (which becomes visible to the naked eye when magnified) was evaluated as a percentage of the total surface area of the lung section.
[0281] The results of the treatment study are shown in Figures 21-28.
[0282] A protective effect (compared to the control) was observed with intranasal inhalation of pitavastatin. As shown in Figure 21, animals treated with the control (no virus) maintained a relatively constant body weight. Animals treated with SARS-CoV-2 and no medication experienced weight loss that began around day 3 and continued until the end of the experiment on day 6. Conversely, animals treated with intranasal inhalation of pitavastatin experienced less weight loss, which was statistically significant on day 4.
[0283] Figure 22 shows viral titers from nasal swabs. Animals treated with pitavastatin inhaled intranasally tended to have lower viral titers compared to animals treated with DPBS or a control vehicle (DV). Figure 23 shows a comparison of viral titers in each infection treatment group. Treatment with pitavastatin reduced viral titers in throat swabs on day 1, but this trend was not observed on day 2 or 3. This may be due to the fact that the virus spontaneously cleared from the animals' upper respiratory tract and / or descended into the lower respiratory tract.
[0284] Figure 24 shows the viral titers three days post-infection in nasal swabs (left) and trachea (right) of hamsters treated with pitavastatin inhaled intranasally and a control. A decrease in viral titer was observed in animals treated with pitavastatin. This difference was not observed at subsequent time points.
[0285] Figure 25 shows the viral titers 3 days post-infection in lung samples from hamsters treated with intranasal inhalation pitavastatin versus control (R2 left; R4 right). In the R4 sample, a significant decrease in viral titer was observed in animals treated with intranasal inhalation pitavastatin compared to the control.
[0286] Histopathological examinations of lungs from treated and control samples are shown in Figure 26. Hamsters treated with intranasal inhaled pitavastatin showed a reduction in acute ringitis compared to controls. Figure 27 shows a semi-quantitative plot of blinded pneumonia grades of all infected animals based on mean ± SEM of lung histopathological examinations, graded according to the severity of inflammation. The mock group represents no viral infection and intranasal (in) PBS infusion.
[0287] Figure 28 shows lung histopathological examination scores based on the percentage of affected lung tissue (i.e., the amount of lung tissue affected by acute inflammation). All treatment groups (mock infection and viral treatment) on days 3 and 6. On day 3, only slight inflammation attributable to viral infection was observed in the animals (approximately 25%). By day 6, virally infected animals showed a clear increase in inflammation due to SARS-CoV-2 infection (approximately 50%). Treatment with intranasal inhaled pitavastatin reduced inflammation by approximately 30% on day 6. The dotted boxes highlight the comparison between virally infected animals treated with the drug and those treated with the control.
[0288] Intranasal inhalation of pitavastatin demonstrates protective / therapeutic effects against SARS-CoV-2 (COVID-19), as indicated by statistically significant effects on weight maintenance, a trend toward reduced viral load in the nose, airways, throat, and lungs, and a reduction in mild / moderate pneumonia in hamsters.
[0289] Example 7: Combination Therapy The effects of statins in combination with dexamethasone or remdesivir against viral infection were investigated in Calu-3 human lung epithelial cells, following the method presented in Example 5 regarding cell infection and therapeutic agent application. Information regarding the cell line is shown below. [Table 26]
[0290] Cell culture conditions. The Calu-3 cell model is already well documented in the literature for SARS-CoV (e.g., Tsengetal., 2005, JVirol, https: / / doi:10.1128 / JVI.79.15.9470-9479). Calu-3 cells were grown as a monolayer at 37°C in a humidified atmosphere (5% CO2, 95% air) and placed in the corresponding cell medium (MEM + 1% pyruvate + 1% glutamine + 10% fetal bovine serum). All cells adhered to a plastic flask. For cell passage, cells were detached from the culture flask by treatment with trypsin-bersen for 5 minutes and neutralized by adding complete medium. For the study, cells were coated on a 96-well plate. Cells were counted and their viability was evaluated using a V-cell counter.
[0291] Virus isolates. Virus strains were supplied through the EuropeanVirusArchiveGoesGlobal (Evag) platform (https: / / www.european-virus-archive.com / ). For this study, Slovakia isolates were used (reference SARS-CoV-2 strain Slovakia / SK-BMC5 / 2020). Viral titers: SARS-CoV-2 was amplified and titrated by Oncodesign in the VeroE6TMPRSS2 cell line (source NIBsc, United Kingdom).
[0292] Calu-3 cells were counted, and their cell viability was assessed using a Vi-Cell automated system. Cells were seeded in 96-well plates and cultured to reach confluence. This approach involved studying the effect of compounds during the infection and replication phases (two arms were completed: cells treated with the compound before infection, and viruses treated with the compound before infection of the cells). Based on what was obtained from the viral raw material during the experimental phase, the virus was prepared with one infection multiplicity (MOI = approximately 0.01). Since the titer of the viral raw material was 1.5 × 10⁶ pfu / mL, the viral master mix was calculated and prepared according to the number of Calu-3 cells per well during the experiment.
[0293] Case 1. Cells were treated with one of the statins (INS-102, INS-103, or INS-104) either as monotherapy or in combination with dexamethasone (Dex) or remdesivir (Remde) for 6 hours and incubated at 37°C. Following this 6-hour pretreatment, cells were infected with SARS-CoV-2 virus at a MOI of 0.01 and incubated at 37°C for 72 hours. Control and comparative treatments were also performed with vehicle alone (DMSO), Dex alone, and Remde alone. Statins were tested at 10 μM, 1 μM, and 0.1 μM, or 5 μM, 1 μM, and 0.2 μM; Dex was tested at 10 μM, 1 μM, and 0.1 μM; and Remde was tested at 1 nM, 10 nM, and 100 nM.
[0294] Case 2. Cells were treated with one of the statins (INS-102, INS-103, or INS-104) either as monotherapy or in combination with dexamethasone (Dex) or remdesivir (Remde) for 1 hour at room temperature. Following this 1-hour pretreatment, cells were infected with SARS-CoV-2 virus at a MOI of 0.01 and incubated at 37°C for 72 hours. Control and comparative treatments were also performed with vehicle alone (DMSO), Dex alone, and Remde alone. Statins were tested at 10 μM, 1 μM, and 0.1 μM, or 5 μM, 1 μM, and 0.2 μM; Dex was tested at 10 μM, 1 μM, and 0.1 μM; and Remde was tested at 1 nM, 10 nM, and 100 nM.
[0295] Cells were collected 24 hours after infection, and viral load was measured by RT-PCR of relative gene expression for the open reading frame 1ab (ORF1ab) gene (the largest gene in SARS-CoV-2, encoding the polyproteins PP1ab and PP1a, which are responsible for viral transcription and replication). Gene expression was evaluated by RT-PCR using the following primers: RTPCR primers: ORF1ab_FwCCGCAAGGTTCTTCTTCGTAAG; ORF1ab_RvTGCTATGTTTAGTGTTCCAGTTTTC; ORF1ab_probe AAGGATACAGTGCCAAGCTCGTCGCC[5']HEX[3']BHQ-1.
[0296] The results are shown in Tables 15-17 below, and representative bar graphs are shown in Figures 42-55.
[0297] Viral load decreased in all monotherapy treatments compared to the DMSO control. Each combination that showed an enhancement of viral load reduction compared to the two monotherapys is indicated by "E". A combination that showed a slight trend toward an enhancement of viral load reduction compared to the two monotherapys is indicated by "(e)".
[0298] The combination of INS-102 and dexamethasone showed a reduction in viral load compared to monotherapy using 1 μM INS-102 and 0.1 μM and 1 μM Dex, and also compared to monotherapy using 0.1 μM INS-102 and 1 μM and 10 μM Dex. The combination of INS-102 and remdesivir, when remdesivir was provided at 100 nM, showed an enhanced reduction in viral load compared to monotherapy using 1 μM and 10 μM INS-102. [Table 27]
[0299] Combinations of INS-103 with additional agents showed less enhancement in terms of viral load reduction. The combination of 1 μM INS-103 and 1 μM Dex demonstrated enhanced viral load reduction compared to monotherapy. [Table 28]
[0300] The combination of 5 μM INS-104 and 1 μM Dex showed a synergistic enhancement of viral load reduction compared to monotherapy, and this enhancement was maintained at a lower level when Dex was at a 10 μM level. The combination of INS-104 and remdesivir showed enhanced viral load reduction compared to monotherapy using 5 μM INS-104 when remdesivir was delivered at 10 nM. [Table 29]
[0301] The data below shows the sequences of the primer and probe. [Table 30]
[0302] SARS-CoV-2 has a genome that is approximately 30 kbp long. This genome contains the open reading flame 1ab (ORF1ab) gene, which encodes the polyproteins PP1ab and PP1a, the largest gene in SARS-CoV-2 and responsible for viral transcription and replication.
[0303] The results of the treatment study are shown in Figures 29-31.
[0304] While specific alternatives to the claims herein have been disclosed, it should be understood that various modifications and combinations are possible and should be considered within the true spirit and scope of the appended claims. Therefore, there is no intention to limit the exact summary and disclosures set forth herein.
[0305] Any publications, patents, and patent applications referenced herein are incorporated herein by reference to the same extent that individual publications or patent applications are incorporated by reference specifically and individually. No reference cited herein constitutes prior art. Discussions of references state what their authors claim, and inventors retain the right to challenge the accuracy and validity of the cited documents. Numerous sources are referenced herein, including academic journal articles, patent documents, and textbooks, but it should be clearly understood that this reference does not constitute an acknowledgment that any of these documents constitutes part of the common general knowledge in the art.
Claims
1. A method for alleviating viral respiratory infections in individuals who require mitigation of such infections, For subjects with viral respiratory infections, A therapeutically effective dose of statins; A formulation containing a pharmacopoeia-acceptable base, A method including administration into the nasal cavity or by inhalation.
2. The method of claim 1, wherein the viral respiratory infection is selected from the group consisting of coronavirus, morbillivirus, bunyavirus, arenavirus, influenza, rhinovirus, and adenovirus.
3. The method according to claim 1 or 2, wherein the viral respiratory infection is selected from the group consisting of SARS-CoV-2, SARS, MERS, hantavirus pulmonary syndrome, measles, Lassa fever, influenza, influenza A, influenza A H1, influenza A H1-2009, influenza A H3, influenza B, polynuclear respiratory virus (RSV) A, RSVB, parainfluenza 1, parainfluenza 2, parainfluenza 3, parainfluenza 4, metapneumovirus, enterovirus, and adenovirus.
4. The method according to any one of claims 1 to 3, wherein the viral respiratory infection is COVID-19.
5. The method according to any one of claims 1 to 4, wherein the preparation is administered intranasally.
6. The method according to any one of claims 1 to 4, wherein the preparation is administered by inhalation.
7. The method according to any one of claims 1 to 4 and 6, wherein the administration is performed by a mechanical inhaler.
8. The method of claim 7, wherein the mechanical inhaler is a metered-dose powder inhaler, a pressurized aerosol inhaler, a dry powder inhaler, or a sprayer.
9. The method of claim 7 or 8, wherein the mechanical inhaler is selected from the group consisting of Respimat® SoftMist® inhaler, RespiClick® inhaler, Breezhaler® inhaler, Genuair® inhaler, Rotahaler® inhaler, Staccato® inhaler, and Ellipta® inhaler.
10. The method according to any one of claims 1 to 9, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin.
11. The method according to any one of claims 1 to 10, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, and atorvastatin.
12. The method according to any one of claims 1 to 11, wherein the statin is selected from the group consisting of pitavastatin and simvastatin.
13. The method according to any one of claims 1 to 12, wherein the amount effective for the aforementioned treatment is between approximately 0.005 μg and approximately 40 mg.
14. The method according to any one of claims 1 to 13, wherein the amount effective for the aforementioned treatment is between approximately 0.5 μg and approximately 15 mg.
15. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is between approximately 1.0 μg and approximately 10 mg.
16. The method according to any one of claims 1 to 15, wherein the amount effective for the aforementioned treatment is between approximately 1.0 μg and approximately 5 mg.
17. The method according to any one of claims 1 to 16, further comprising administering at least one additional therapeutic agent.
18. The method of claim 17, wherein each additional therapeutic agent is independently selected from the group consisting of RNA polymerase inhibitors; viral protease inhibitors; host protease inhibitors; TMPRSS2 inhibitors; antiviral agents; chloroquine or a salt thereof, hydroxychloroquine or a salt thereof, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin, mostat or a salt thereof, daunavir, oseltamivir, ribavirin, convalescent plasma or antibodies extracted therefrom; selinexol; inhaled nitric oxide; exosomes and / or microvesicles; and umbilical cord blood regulatory T cells.
19. The method of claim 17 or 18, wherein each additional therapeutic agent is nelfinavir mesylate, azithromycin, bafilomycin, camostat mesylate, camostat or camostat salt, arbidol, amantadine, rimantadine, lopinavir, darunavir, ribavirin, remdesivir, favipirvir, chloroquine, hydroxychloroquine, tocilizumab, or sarilumab.
20. The method of claim 19, wherein the additional therapeutic agent is remdesivir.
21. Each additional therapeutic agent is a biphosphonate such as β-agonist; corticosteroid; muscarinic antagonist; RhoA inhibitor; GGTase-I or-II inhibitor; ROCK1 and / or ROCK2 inhibitor; soluble epoxide hydrolase inhibitor; fatty acid amide hydrolase inhibitor; leukotriene receptor antagonist; phosphodiesterase-4 inhibitor (e.g., roflumilast); 5-lipoxygenase inhibitor (e.g., dileuton); mast cell stabilizer (e.g., nedocromil); squalene synthase inhibitor (e.g., rapakistat, zaragosic acid, and RPR107393); farnesyl pyrophosphate synthase inhibitor (non-limiting examples include biphosphonates such as alendronate, etidronate, clodronate, tildronate, pamidronate, neridronate, olpadronate, ivadronate, and ri The method of claim 17, selected from the group consisting of: cedronate (including zoledronate); theophylline; anti-IL5 antibody; anti-IgE antibody; anti-IL5 receptor antibody; anti-IL13 / 4 receptor antibody; biological agents (such as mepolizumab, reslizumab, benralizumab, omalizumab, and dupilumab); combinations of β-agonists and muscarinic antagonists (including both long-acting and short-acting formulations); combinations of β-agonists and corticosteroids (including both long-acting and short-acting formulations); combinations of corticosteroids and muscarinic antagonists (including both long-acting and short-acting formulations); and combinations of β-agonists, corticosteroids, and muscarinic antagonists (including both long-acting and short-acting formulations).
22. The method of claim 21, wherein each additional therapeutic agent is a β-agonist, a corticosteroid, a muscarinic antagonist, or any combination thereof.
23. The method of claim 21 or 22, wherein the additional agent is dexamethasone.
24. The method of claim 23, further comprising remdesivir.
25. The method according to any one of claims 17 to 24, wherein each additional therapeutic agent is administered either intranasally or by inhalation.
26. The method according to any one of claims 17 to 25, wherein each additional therapeutic agent is administered in a dose less than or equal to the therapeutic dose.
27. A method for treating viral respiratory infections in patients who require treatment for such infections, For individuals who have contracted the aforementioned viral respiratory infection or who may be exposed to the aforementioned viral respiratory infection, A therapeutically effective dose of statins; A formulation containing a pharmacopoeia-acceptable base, A method including administration into the nasal cavity or by inhalation.
28. The method of claim 27, wherein the preparation is administered prophylactically.
29. The method of claim 28, wherein the preparation is administered before exposure to the viral respiratory infection.
30. The method of claim 29, wherein the preparation is administered one hour to seven days before exposure to the viral respiratory infection.
31. The method according to claim 29 or 30, wherein the preparation is administered one hour to 24 hours before exposure to the viral respiratory infection.
32. The method according to any one of claims 29 to 31, wherein the preparation is administered 3 hours to 12 hours before exposure to the viral respiratory infection.
33. The method according to any one of claims 29 to 32, wherein the preparation is administered approximately six hours before exposure to the viral respiratory infection.
34. The method according to any one of claims 27 to 33, wherein the viral respiratory infection is selected from the group consisting of coronavirus, morbillivirus, bunyavirus, arenavirus, influenza, rhinovirus, and adenovirus.
35. The method according to any one of claims 27 to 34, wherein the viral respiratory infection is selected from the group consisting of SARS-CoV-2, SARS, MERS, hantavirus pulmonary syndrome, measles, Lassa fever, influenza, influenza A, influenza A H1, influenza A H1-2009, influenza A H3, influenza B, polynuclear respiratory virus (RSV) A, RSVB, parainfluenza 1, parainfluenza 2, parainfluenza 3, parainfluenza 4, metapneumovirus, enterovirus, and adenovirus.
36. The method according to any one of claims 27 to 35, wherein the viral respiratory infection is COVID-19.
37. The method according to any one of claims 27 to 36, wherein the preparation is administered intranasally.
38. The method according to any one of claims 27 to 36, wherein the preparation is administered by inhalation.
39. The method according to any one of claims 27 to 36 and 38, wherein the administration is performed by a mechanical inhaler.
40. The method of claim 39, wherein the mechanical inhaler is a metered-dose powder inhaler, a pressurized aerosol inhaler, a dry powder inhaler, or a sprayer.
41. The method of claim 39 or 40, wherein the mechanical inhaler is selected from the group consisting of Respimat® SoftMist® inhaler, RespiClick® inhaler, Breezhaler® inhaler, Genuair® inhaler, Rotahaler® inhaler, Staccato® inhaler, and Ellipta® inhaler.
42. The method according to any one of claims 27 to 41, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin.
43. The method according to any one of claims 27 to 42, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, and atorvastatin.
44. The method according to any one of claims 27 to 43, wherein the statin is selected from the group consisting of pitavastatin and simvastatin.
45. The method according to any one of claims 27 to 44, wherein the amount effective for the aforementioned treatment is between approximately 0.005 μg and approximately 40 mg.
46. The method according to any one of claims 27 to 45, wherein the amount effective for the aforementioned treatment is between approximately 0.1 μg and approximately 15 mg.
47. The method according to any one of claims 27 to 46, wherein the amount effective for the aforementioned treatment is between approximately 0.1 μg and approximately 5 mg.
48. The method according to any one of claims 27 to 47, wherein the amount effective for the aforementioned treatment is between approximately 0.1 μg and approximately 100 μg.
49. The method according to any one of claims 27 to 48, further comprising administering at least one additional therapeutic agent.
50. The method of claim 49, wherein each additional therapeutic agent is independently selected from the group consisting of RNA polymerase inhibitors; viral protease inhibitors; host protease inhibitors; TMPRSS2 inhibitors; antiviral agents; chloroquine or a salt thereof, hydroxychloroquine or a salt thereof, amantadine, rimantadine, lopinavir, ritonavir, umifenovir, remdesivir, favipiravir, nelfinavir mesylate, azithromycin, bafilomycin camostat or a salt thereof, daunavir, oseltamivir, ribavirin, convalescent plasma or antibodies extracted therefrom; selinexol; inhaled nitric oxide; exosomes and / or microvesicles; and umbilical cord blood regulatory T cells.
51. The method of claim 49 or 50, wherein each additional therapeutic agent is nelfinavir mesylate, azithromycin, bafilomycin, camostat mesylate, camostat or camostat salt, arbidol, amantadine, rimantadine, lopinavir, darunavir, ribavirin, remdesivir, favipirvir, chloroquine, hydroxychloroquine, tocilizumab, or sarilumab.
52. The method of claim 51, wherein the additional therapeutic agent is remdesivir.
53. Each additional therapeutic agent is a biphosphonate such as β-agonist; corticosteroid; muscarinic antagonist; RhoA inhibitor; GGTase-I or-II inhibitor; ROCK1 and / or ROCK2 inhibitor; soluble epoxide hydrolase inhibitor; fatty acid amide hydrolase inhibitor; leukotriene receptor antagonist; phosphodiesterase-4 inhibitor (e.g., roflumilast); 5-lipoxygenase inhibitor (e.g., dileuton); mast cell stabilizer (e.g., nedocromil); squalene synthase inhibitor (e.g., rapakistat, zaragosic acid, and RPR107393); farnesyl pyrophosphate synthase inhibitor (non-limiting examples include biphosphonates such as alendronate, etidronate, clodronate, tildronate, pamidronate, neridronate, olpadronate, ivadronate, and ri The method of claim 49, selected from the group consisting of: sedronate (including zoledronate); theophylline; anti-IL5 antibody; anti-IgE antibody; anti-IL5 receptor antibody; anti-IL13 / 4 receptor antibody; biological agents (such as mepolizumab, reslizumab, benralizumab, omalizumab, and dupilumab); combinations of β-agonists and muscarinic antagonists (including both long-acting and short-acting formulations); combinations of β-agonists and corticosteroids (including both long-acting and short-acting formulations); combinations of corticosteroids and muscarinic antagonists (including both long-acting and short-acting formulations); and combinations of β-agonists, corticosteroids, and muscarinic antagonists (including both long-acting and short-acting formulations).
54. The method of claim 53, wherein each additional therapeutic agent is a β-agonist, a corticosteroid, a muscarinic antagonist, or any combination thereof.
55. The method of claim 53, wherein the additional drug is dexamethasone.
56. The method of claim 55, further comprising remdesivir.
57. The method according to any one of claims 49 to 56, wherein each additional therapeutic agent is administered either intranasally or by inhalation.
58. The method according to any one of claims 49 to 57, wherein each additional therapeutic agent is administered in a dose less than or equal to the therapeutic dose.
59. The method according to any one of claims 29 to 57, wherein the preparation is administered one hour to 24 hours before potential exposure to the viral respiratory infection, the statin comprising pitavastatin or simvastatin, and the preparation further comprising at least one of remdesivir or dexamethasone.
60. A therapeutically effective dose of statins; At least one additional therapeutic agent; and Pharmaceutically acceptable base A pharmaceutical composition containing the following:
61. The pharmaceutical composition of claim 60, wherein the statin is selected from the group consisting of pitavastatin and simvastatin; and the additional therapeutic agent is selected from the group consisting of remdesivir, dexamethasone, and combinations thereof.
62. A therapeutically effective amount of statin, or its isomer, enantiomer, or diastereomer; A pharmacopoeially acceptable base suitable for administration by inhalation. A pharmaceutical formulation for the treatment of viral respiratory diseases, including [specific ingredient / condition].
63. A method for treating SARS-CoV-2 virus infection in a person requiring treatment, For subjects suffering from viral respiratory infections, A therapeutically effective dose of statins; A formulation containing a pharmacopoeia-acceptable base, A method including administration into the nasal cavity or by inhalation.
64. The method of claim 63, wherein the preparation inhibits an increase in viral titer.
65. The method of claim 63 or 64, wherein the formulation reduces the amount of virus in the subject.
66. The method according to any one of claims 63 to 65, wherein the formulation reduces or inhibits one or more symptoms of the viral infection.
67. The method according to any one of claims 63 to 66, wherein the formulation reduces or inhibits one or more pro-inflammatory responses.
68. The method of claim 67, wherein the pro-inflammatory response is a cytokine or chemokine.
69. The method of claim 67, wherein the formulation reduces or inhibits the increase in IL-6 levels in the subject.
70. A method for treating SARS-CoV-2 virus infection in a person requiring treatment, For individuals who may be exposed to the SARS-CoV-2 virus, A therapeutically effective dose of statins; A formulation containing a pharmacopoeia-acceptable base, A method including administration into the nasal cavity or by inhalation.
71. The method of claim 70, wherein the preparation is administered after exposure to the respiratory virus is suspected.
72. The method of claim 71, wherein the preparation is administered to the subject within one hour, two hours, six hours, or 24 hours after the suspected exposure.
73. The method of claim 71, wherein the preparation is administered to the subject within one day, two days, three days, four days, five days, six days, or seven days after the suspected exposure.
74. The method of claim 71, wherein the preparation is administered to the subject within 7 to 10 days after the suspected exposure.
75. The method of claim 70, wherein the formulation is administered before potential exposure to the respiratory virus.
76. The method of claim 75, wherein the formulation is administered to the subject within one hour, two hours, six hours, or 24 hours prior to potential exposure.
77. A method for reducing the severity of COVID-19 in subjects infected with SARS-CoV-2, A therapeutically effective dose of statins; A formulation containing a pharmacopoeia-acceptable base, A method including administration into the nasal cavity or by inhalation.
78. The method of claim 77, wherein the formulation is administered prior to potential exposure to the SARS-CoV-2 virus.
79. The method of claim 77, wherein the preparation is administered after exposure to the SARS-CoV-2 virus.
80. The method according to any one of claims 77 to 79, wherein the preparation inhibits an increase in viral titer.
81. The method according to any one of claims 77 to 79, wherein the preparation reduces the amount of the target virus.
82. The method according to any one of claims 77 to 79, wherein the formulation reduces or inhibits one or more symptoms of the viral infection.
83. The method according to any one of claims 77 to 79, wherein the formulation reduces or inhibits one or more pro-inflammatory responses.
84. The method of claim 83, wherein the pro-inflammatory response is a cytokine or chemokine.
85. The method of claim 84, wherein the formulation reduces or inhibits the increase in IL-6 levels in the subject.
86. The method according to any one of claims 77 to 79, wherein the formulation prevents, inhibits, or reduces a cytokine storm in the subject.
87. The method according to any one of claims 63 to 86, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, atorvastatin, lovastatin, fluvastatin, mevastatin, cerivastatin, tenivastatin, and pravastatin.
88. The method according to any one of claims 63 to 86, wherein the statin is selected from the group consisting of simvastatin, pitavastatin, rosuvastatin, and atorvastatin.
89. The method according to any one of claims 63 to 86, wherein the statin is selected from the group consisting of pitavastatin and simvastatin.
90. The method according to any one of claims 63 to 89, wherein the preparation is administered to the subject once, twice, three times, four times, or five times.
91. The method according to any one of claims 63 to 69 and 77 to 90, wherein the subject is administered the formulation once, twice, three times, four times, or five times after exposure to the SARS-CoV-2 virus.
92. The method according to any one of claims 70-76 and 87-90, wherein the subject is administered the formulation once, twice, three times, four times, or five times before being exposed to the SARS-CoV-2 virus.
93. The method according to any one of claims 63 to 89, wherein the preparation is administered to the subject before vaccination for the SARS-CoV-2 virus.
94. The method according to any one of claims 63 to 89, wherein the preparation is administered to the subject after vaccination for the SARS-CoV-2 virus.
95. The method according to any one of claims 63 to 89, comprising administering the preparation to the subject in combination with vaccination for the SARS-CoV-2 virus.
96. The method according to any one of claims 63 to 89, wherein the preparation is administered to the subject in combination with additional COVID-19 treatment.
97. The method of claim 96, wherein the additional COVID-19 treatment is remdesivir or dexamethasone.
98. The method according to claim 77, wherein the statin maintains the ability of epithelial cells to survive in the subject.
99. The method of claim 98, wherein the viability of the epithelial cells is maintained in the lung tissue.
100. A method for preventing a virus from entering a cell, comprising administering a therapeutically effective amount of a statin, wherein the virus is the SARS virus.
101. The method of claim 100, wherein the virus is the SARS-CoV-2 virus.
102. The method according to claim 100 or 101, wherein the cells are airway epithelial cells of the mouth, nose, trachea, or lung.
103. The method of claim 102, wherein the epithelial cells are present in a subject infected with SARS-CoV-2, and the statin is administered to the infected subject intranasally or by inhalation as a formulation containing a therapeutically effective amount of statin and a pharmaceutically acceptable base.