Compositions and methods for silencing SCN9A expression

Abstract

This provides novel treatments for pain, such as chronic pain and pain-related disorders. [Solution] A double-stranded ribonucleic acid (dsRNA) agent is provided for inhibiting the expression of sodium channel voltage-gated type IX alpha subunit (SCN9A). The dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having a mismatch from one of the antisense sequences listed in any one of a specific antisense sequence group, and the sense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having a mismatch from one of the antisense sequences listed in any one of a specific antisense sequence group.

Description

[Technical Field]

[0001] Related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 006,328, filed on April 7, 2020, and to U.S. Provisional Patent Application No. 63 / 161,313, filed on March 15, 2021. The entire contents of the said applications are incorporated herein by reference.

[0002] Array List This application includes an array list submitted electronically in ASCII format, the entirety of which is incorporated herein by reference. The ASCII copy created on April 2, 2021, is named A2038-7235WO_SL.txt and is 1,514,568 bytes in size.

[0003] Areas of disclosure This disclosure relates to the specific inhibition of SCN9A gene expression. [Background technology]

[0004] Pain, such as chronic pain, is a common symptom and a major cause of disability. Chronic pain may result from inflammatory or neuropathic pain, or it may be associated with diseases or disorders, such as cancer, arthritis, diabetes, trauma, and / or viral infections. Hypersensitivity or decreased sensitivity to pain may also result from pain-related disorders, including, but are not limited to, analgesia, primary erythromelalgia (PE), and paroxysmal severe pain disorder (PEPD). [Overview of the project] [Problems that the invention aims to solve]

[0005] Current therapies for pain are non-selective to their targets and result in undesirable, misdirected effects involving the central nervous system (CNS). Novel treatments are needed for pain, such as chronic pain and pain-related disorders. [Means for solving the problem]

[0006] This disclosure describes methods and iRNA compositions for modulating SCN9A expression. In certain embodiments, SCN9A expression is reduced or inhibited using SCN9A-specific iRNA. Such inhibition may be useful in treating disorders associated with SCN9A expression, such as pain, for example, acute or chronic pain (e.g., inflammatory pain, neuropathic pain, pain hypersensitivity, pain hyposensitivity, analgesia, primary erythromelalgia (PE), paroxysmal excruciating pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections).

[0007] Accordingly, compositions and methods for achieving RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of SCN9A in cells or in subjects (e.g., mammals, e.g., human subjects) are described herein. Compositions and methods for treating disorders associated with SCN9A expression, such as pain (e.g., acute or chronic pain, e.g., inflammatory pain, neuropathic pain, hyperalgesia, hypoalgesia, analgesia, primary erythromelalgia (PE), paroxysmal severe pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections) are also described herein.

[0008] The iRNA (e.g., dsRNA) contained in the compositions characterized herein comprises an RNA chain (antisense chain) having a region of 30 nucleotides or less, generally 19 to 24 nucleotides in length, which is substantially complementary to at least a portion of the mRNA transcript of SCN9A (e.g., human SCN9A) (also referred to herein as "SCN9A-specific iRNA"). In some embodiments, the SCN9A mRNA transcript is a human SCN9A mRNA transcript, e.g., Sequence ID No. 1 herein.

[0009] In some embodiments, the iRNA (e.g., dsRNA) described herein includes an antisense strand having a region substantially complementary to the human SCN9A mRNA region. In some embodiments, the human SCN9A mRNA has the sequence NM_002977.3 (SEQ ID NO: 1) or NM_001365536.1 (SEQ ID NO: 4001). In some embodiments, the human SCN9A mRNA has the sequence NM_002977.3 (SEQ ID NO: 1). The sequence NM_002977.3 is also incorporated herein by reference in its entirety. The reverse complement of SEQ ID NO: 1 is provided herein as SEQ ID NO: 2. In some embodiments, the human SCN9A mRNA has the sequence NM_001365536.1 (SEQ ID NO: 4001). The sequence NM_001365536.1 is also incorporated herein by reference in its entirety. The reverse complement of SEQ ID NO: 4001 is provided herein as SEQ ID NO: 4002.

[0010] In some embodiments, the Disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium channel voltage-gated type IX alpha subunit (SCN9A), the dsRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches from a portion of the coding strand of human SCN9A, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches from a corresponding portion of the non-coding strand of human SCN9A, so that the sense strand is complementary to the at least 15 consecutive nucleotides in the antisense strand.

[0011] In some embodiments, the Disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of SCN9A, the dsRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprising a nucleotide sequence containing at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches of a portion of the nucleotide sequence of SEQ ID NO: 2, and consequently the sense strand being complementary to the at least 15 consecutive nucleotides in the antisense strand.

[0012] In some embodiments, the Disclosure provides human cells or tissues containing reduced levels of SCN9A mRNA or certain levels of SCN9A protein compared to otherwise similar untreated cells or tissues, the cells or tissues may be genetically engineered as appropriate (e.g., the cells or tissues contain one or more naturally occurring mutations, e.g., SCN9A), and the levels may be reduced as appropriate by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, the human cells or tissues are human peripheral sensory neurons (e.g., dorsal root ganglia, or nociceptive neurons, e.g., peripheral sensory neurons in A-delta fibers or C-type fibers).

[0013] In some aspects, this disclosure also provides cells containing the dsRNA agents described herein.

[0014] In some embodiments, the Disclosure also provides pharmaceutical compositions that inhibit the expression of the gene encoding SCN9A, comprising a dsRNA agent described herein. In some embodiments, the Disclosure also provides a method for inhibiting the expression of SCN9A in cells, the method being: (a) Contacting cells with a dsRNA agent or pharmaceutical composition described herein, and (b) Maintain the cells generated in step (a) for a sufficient time to obtain degradation of the SCN9A mRNA transcript, thereby inhibiting SCN9A expression in the cells. Includes.

[0015] This disclosure also provides, in some aspects, a method for inhibiting SCN9A expression in cells, the method being: (a) Contacting cells with a dsRNA agent or pharmaceutical composition described herein, and (b) Maintain the cells generated in step (a) for a sufficient time to reduce the levels of SCN9A mRNA, SCN9A protein, or both SCN9A mRNA and protein, thereby inhibiting SCN9A expression in the cells. Includes.

[0016] This disclosure also provides, in certain aspects, a method for inhibiting SCN9A expression in cells or tissues of the central nervous system (CNS), the method being: Includes. (a) Contacting cells or tissue with a dsRNA agent that binds to SCN9A, and (b) Maintain the cells or tissue generated in step (a) for a sufficient time to reduce the levels of SCN9A mRNA, SCN9A protein, or both SCN9A mRNA and protein, thereby inhibiting SCN9A expression in the cells or tissue. Includes.

[0017] In some aspects, this disclosure also provides a method for treating a subject diagnosed with an SCN9A-related disorder, comprising administering to the subject a therapeutically effective amount of a dsRNA agent or a pharmaceutical composition described herein, thereby providing a method for treating the disorder.

[0018] In aspects of this specification, for example, any of the compositions and methods described above, any of the embodiments (for example, the following) provided herein may be provided.

[0019] In some embodiments, the coding strand of human SCN9A has the sequence of SEQ ID NO: 1. In some embodiments, the non-coding strand of human SCN9A has the sequence of SEQ ID NO: 2. In some embodiments, the coding strand of human SCN9A has the sequence of SEQ ID NO: 4001. In some embodiments, the non-coding strand of human SCN9A has the sequence of SEQ ID NO: 4002.

[0020] In some embodiments, the sense strand includes a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches in the corresponding portion of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the sense strand includes a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches in the corresponding portion of the nucleotide sequence of SEQ ID NO: 4001.

[0021] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 2, and consequently the sense strand being complementary to the at least 17 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 1.

[0022] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 4002, and consequently the sense strand is complementary to the at least 17 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 4001.

[0023] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 2, and consequently the sense strand is complementary to the at least 19 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 1.

[0024] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 4002, and consequently the sense strand is complementary to the at least 19 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 4001.

[0025] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 2, and consequently the sense strand being complementary to the at least 21 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 1.

[0026] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence containing at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 4002, and consequently the sense strand being complementary to the at least 21 consecutive nucleotides in the antisense strand. In some embodiments, the sense strand comprises a nucleotide sequence containing at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 4001.

[0027] In some embodiments, the sense strand portion is a portion within nucleotides 581-601, 760-780, or 8498-8518 of SEQ ID NO: 4001. In some embodiments, the sense strand portion is a portion corresponding to SEQ ID NOs: 4827, 5026, or 4822.

[0028] In some embodiments, the sense chain portion is a portion of the sense chain in any one of the following tables: 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0029] In some embodiments, the portion of the antisense chain is a portion of the antisense chain in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0030] In some embodiments, the antisense strand includes a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches derived from one of the antisense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20. In some embodiments, the sense strand includes a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches derived from a sense sequence corresponding to the antisense sequence, listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0031] In some embodiments, the antisense strand includes a nucleotide sequence comprising at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from one of the antisense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20. In some embodiments, the sense strand includes a nucleotide sequence comprising at least 17 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from a sense sequence corresponding to the antisense sequence, listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0032] In some embodiments, the antisense strand includes a nucleotide sequence comprising at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from one of the antisense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20. In some embodiments, the sense strand includes a nucleotide sequence comprising at least 19 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from a sense sequence corresponding to the antisense sequence, listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0033] In some embodiments, the antisense strand includes a nucleotide sequence comprising at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from one of the antisense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20. In some embodiments, the sense strand includes a nucleotide sequence comprising at least 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches, derived from a sense sequence corresponding to the antisense sequence, listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20.

[0034] In some embodiments, the sense strand of the dsRNA agent is at least 23 nucleotides long, for example, 23 to 30 nucleotides long.

[0035] In some embodiments, the sense strand portion is a portion within the sense strand derived from a double helix selected from AD-1251284(UGUCGAGUACACUUUUACUGA (SEQ ID NO: 4827)), AD-961334(CAACACAATUTCUUCUUAGCA (SEQ ID NO: 5026)), or AD-1251325(AAAACAAUCUUCCGUUUCAAA (SEQ ID NO: 4822)). In some embodiments, the portion is a portion of the corresponding chemically modified sequence provided in Tables 5A, 13A, 14A, 15A, and 16.

[0036] In some embodiments, the sense strand portion is a sense strand selected from the sense strands of AD-1251284(UGUCGAGUACACUUUUACUGA (SEQ ID NO: 4827)), AD-961334(CAACACAATUTCUUCUUAGCA (SEQ ID NO: 5026)), or AD-1251325(AAAACAAUCUUCCGUUUCAAA (SEQ ID NO: 4822)). In some embodiments, the portion is a corresponding chemically modified sequence portion provided in Tables 5A, 13A, 14A, 15A, and 16.

[0037] In some embodiments, the antisense chain portion is a portion within the antisense chain derived from a double helix selected from AD-1251284(UCAGTAAAAGUGUACTCGACAUU (SEQ ID NO: 5093)), AD-961334(UGCUAAGAAGAAATUGUGUUGUU (SEQ ID NO: 5292)), or AD-1251325(UUUGAAACGGAAGAUUGUUUUCC (SEQ ID NO: 5088)). In some embodiments, the portion is a portion of the corresponding chemically modified sequence provided in Tables 5A, 13A, 14A, 15A, and 16.

[0038] In some embodiments, the antisense chain portion is an antisense chain selected from the antisense chains of AD-1251284(UCAGTAAAAGUGUACTCGACAUU (SEQ ID NO: 5093)), AD-961334(UGCUAAGAAGAAATUGUGUUGUU (SEQ ID NO: 5292)), or AD-1251325(UUUGAAACGGAAGAUUGUUUUCC (SEQ ID NO: 5088)). In some embodiments, the portion is a corresponding chemically modified sequence portion provided in Tables 5A, 13A, 14A, 15A, and 16.

[0039] In some embodiments, the sense and antisense strands of the dsRNA agent include nucleotide sequences of a double-stranded pair of sense and antisense strands selected from AD-1251284 (SEQ ID NOs. 4827 and 5093), AD-961334 (SEQ ID NOs. 5026 and 5292), or AD-1251325 (SEQ ID NOs. 4822 and 5088). In some embodiments, the sense and antisense strands include the corresponding chemically modified sense and antisense sequences provided in Tables 5A, 13A, 14A, 15A, and 16.

[0040] In some embodiments, at least one of the sense strand and the antisense strand is conjugated to one or more lipophilic moieties. In some embodiments, the lipophilic moieties are conjugated to one or more positions in the double-stranded region of the dsRNA agent. In some embodiments, the lipophilic moieties are conjugated via a linker or carrier. In some embodiments, the lipophilicity of the lipophilic moieties, as measured by logKow, is greater than 0. In some embodiments, the hydrophobicity of the double-stranded RNAi agent, as measured by the unbound fraction in a plasma protein binding assay of the double-stranded RNAi agent, is greater than 0.2. In some embodiments, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.

[0041] In some embodiments, the dsRNA agent contains at least one modified nucleotide. In some embodiments, five or fewer nucleotides in the sense strand and five or fewer nucleotides in the antisense strand are unmodified nucleotides. In some embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand contain modifications.

[0042] In some embodiments, at least one of the modified nucleotides is selected from the group consisting of deoxy-nucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformation-restricted nucleotides, restricted ethyl nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramides, nucleotides containing unnatural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a phosphorothioate group, nucleotides containing a methylphosphonate group, nucleotides containing a 5'-phosphate, nucleotides containing a 5'-phosphate mimetic, glycol-modified nucleotides, and 2-O-(N-methylacetamide)-modified nucleotides, and combinations thereof. In some embodiments, five or fewer nucleotides in the sense strand and five or fewer nucleotides in the antisense strand include modifications other than 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, unlocked nucleic acids (UNAs), or glycerol nucleic acids (GNAs).

[0043] In some embodiments, the dsRNA contains a non-nucleotide spacer between two consecutive nucleotides in the sense strand or between two consecutive nucleotides in the antisense strand (the non-nucleotide spacer may include a C3-C6 alkyl group).

[0044] In some embodiments, each chain has a nucleotide length of 30 or less. In some embodiments, at least one chain includes a 3' overhang of at least one nucleotide. In some embodiments, at least one chain includes a 3' overhang of at least two nucleotides. In some embodiments, at least one chain includes a 3' overhang of two nucleotides.

[0045] In some embodiments, the double-stranded region is 15 to 30 nucleotide pairs long. In some embodiments, the double-stranded region is 17 to 23 nucleotide pairs long. In some embodiments, the double-stranded region is 17 to 25 nucleotide pairs long. In some embodiments, the double-stranded region is 23 to 27 nucleotide pairs long. In some embodiments, the double-stranded region is 19 to 21 nucleotide pairs long. In some embodiments, the double-stranded region is 21 to 23 nucleotide pairs long. In some embodiments, each strand has 19 to 30 nucleotides. In some embodiments, each strand has 19 to 23 nucleotides. In some embodiments, each strand has 21 to 23 nucleotides.

[0046] In some embodiments, the drug comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. In some embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of a single chain. In some embodiments, the chain is an antisense chain. In some embodiments, the chain is a sense chain.

[0047] In some embodiments, the phosphorothioate or methylphosphonate nucleotide linkage is at the 5' end of one chain. In some embodiments, the chain is an antisense chain. In some embodiments, the chain is a sense chain.

[0048] In some embodiments, each of the 5' and 3' ends of a single chain contains a phosphorothioate or methylphosphonate internucleotide linkage. In some embodiments, the chain is an antisense chain.

[0049] In some embodiments, the base pair at one position of the 5' end of the double-stranded antisense strand is an AU base pair.

[0050] In some embodiments, the sense strand has a total of 21 nucleotides, and the antisense strand has a total of 23 nucleotides.

[0051] In some embodiments, one or more lipophilic moieties are conjugated to one or more internal positions on at least one chain. In some embodiments, one or more lipophilic moieties are conjugated to one or more internal positions on at least one chain via a linker or carrier.

[0052] In some embodiments, the internal positions include all positions except the two terminal positions from each end of at least one chain. In some embodiments, the internal positions include all positions except the three terminal positions from each end of at least one chain. In some embodiments, the internal positions exclude the cleavage region of the sense chain. In some embodiments, the internal positions include all positions except positions 9-12 counting from the 5' end of the sense chain. In some embodiments, the internal positions include all positions except positions 11-13 counting from the 3' end of the sense chain. In some embodiments, the internal positions exclude the cleavage region of the antisense chain. In some embodiments, the internal positions include all positions except positions 12-14 counting from the 5' end of the antisense chain. In some embodiments, the internal positions include all positions except positions 11-13 counting from the 3' end of the sense chain and positions 12-14 counting from the 5' end of the antisense chain.

[0053] In some embodiments, one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 4-8 and 13-18 in the sense chain and positions 6-10 and 15-18 in the antisense chain, counting from the 5' end of each chain. In some embodiments, one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 in the sense chain and positions 15 and 17 in the antisense chain, counting from the 5' end of each chain.

[0054] In some embodiments, the location within the double-stranded region excludes the sense strand cleavage region.

[0055] In some embodiments, the sense strand is 21 nucleotides long, the antisense strand is 23 nucleotides long, and the lipophilic portion is conjugated at position 21, 20, 15, 1, 7, 6, or 2 on the sense strand, or at position 16 on the antisense strand. In some embodiments, the lipophilic portion is conjugated at position 21, 20, 15, 1, or 7 on the sense strand. In some embodiments, the lipophilic portion is conjugated at position 21, 20, or 15 on the sense strand. In some embodiments, the lipophilic portion is conjugated at position 20 or 15 on the sense strand. In some embodiments, the lipophilic portion is conjugated at position 16 on the antisense strand. In some embodiments, the lipophilic portion is conjugated at position 6, counting from the 5' end of the sense strand.

[0056] In some embodiments, the lipophilic portion is an aliphatic compound, an alicyclic compound, or a polyalicyclic compound. In some embodiments, the lipophilic portion is selected from the group consisting of lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)litcholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In some embodiments, the lipophilic portion contains a saturated or unsaturated C4-C30 hydrocarbon chain and a suitable functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In some embodiments, the lipophilic portion contains saturated or unsaturated C6-C18 hydrocarbon chains. In some embodiments, the lipophilic portion contains saturated or unsaturated C16 hydrocarbon chains.

[0057] In some embodiments, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotides in an internal position or double-stranded region. In some embodiments, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanil, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridadinyl, tetrahydrofuranil, and dekalinyl; or an acyclic moiety based on a serinol skeleton or a diethanolamine skeleton.

[0058] In some embodiments, the lipophilic portion is conjugated to a double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfamide linkage, click reaction product, or carbamate.

[0059] In some embodiments, the lipophilic portion is conjugated to a nucleic acid base, a sugar portion, or an internucleoside linkage.

[0060] In some embodiments, the lipophilic moiety or targeted ligand is conjugated via a biocleavable linker selected from the group consisting of DNA, RNA, disulfides, amides, and functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, and mannose, as well as combinations thereof.

[0061] In some embodiments, the 3' end of the sense chain is protected via an end cap which is a cyclic group having an amine, and the cyclic group is selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanil, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridadinyl, tetrahydrofuranil, and dekalinyl.

[0062] In some embodiments, the dsRNA agent further comprises a targeted ligand, for example, a ligand that targets CNS tissue or liver tissue. In some embodiments, the CNS tissue is brain tissue or spinal cord tissue, for example, the dorsal root ganglia.

[0063] In some embodiments, the ligand is conjugated to the sense strand. In some embodiments, the ligand is conjugated to the 3' or 5' end of the sense strand. In some embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0064] In some embodiments, the ligand comprises N-acetylgalactosamine (GalNAc). In some embodiments, the targeted ligand comprises one or more GalNAc conjugates or one or more GalNAc derivatives. In some embodiments, the ligand is one or more GalNAc conjugates or one or more GalNAc derivatives attached by a monovalent linker or a divalent, trivalent, or tetravalent branched linker. In some embodiments, the ligand is

[0065] [ka] In some embodiments, the dsRNA agent is conjugated to a ligand as shown in the schematic diagram below.

[0066] [ka] [In the formula, X is either O or S]. In some embodiments, X is O.

[0067] In some embodiments, the dsRNA agent further includes a terminal chiral modification occurring at the first nucleotide linkage at the 3' end of the antisense strand, having a linked phosphorus atom in the Sp configuration; a terminal chiral modification occurring at the first nucleotide linkage at the 5' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; and a terminal chiral modification occurring at the first nucleotide linkage at the 5' end of the sense strand, having a linked phosphorus atom in either the Rp configuration or the Sp configuration.

[0068] In some embodiments, the dsRNA agent further includes terminal chiral modifications occurring at the first and second nucleotide linkages at the 3' end of the antisense strand, having a linked phosphorus atom in the Sp configuration; terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; and terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the sense strand, having a linked phosphorus atom in either the Rp or Sp configuration.

[0069] In some embodiments, the dsRNA agent further includes terminal chiral modifications occurring at the first, second, and third nucleotide linkages at the 3' end of the antisense strand, having a linked phosphorus atom in the Sp configuration; terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; and terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the sense strand, having a linked phosphorus atom in either the Rp or Sp configuration.

[0070] In some embodiments, the dsRNA agent further includes terminal chiral modifications occurring at the first and second nucleotide linkages at the 3' end of the antisense strand, having a linked phosphorus atom in the Sp configuration; terminal chiral modifications occurring at the third nucleotide linkage at the 3' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; and terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the sense strand, having a linked phosphorus atom in either the Rp or Sp configuration.

[0071] In some embodiments, the dsRNA agent further includes terminal chiral modifications occurring at the first and second nucleotide linkages at the 3' end of the antisense strand, having a linked phosphorus atom in the Sp configuration; terminal chiral modifications occurring at the first and second nucleotide linkages at the 5' end of the antisense strand, having a linked phosphorus atom in the Rp configuration; and terminal chiral modifications occurring at the first nucleotide linkage at the 5' end of the sense strand, having a linked phosphorus atom in either the Rp or Sp configuration.

[0072] In some embodiments, the dsRNA agent further comprises a phosphate or phosphate mimetic at the 5' end of the antisense strand. In some embodiments, the phosphate mimetic is a 5'-vinyl phosphonate (VP).

[0073] In some embodiments, the cells described herein, for example, human cells, were generated by a process that included contacting human cells with the dsRNA agent described herein.

[0074] In some embodiments, the pharmaceutical compositions described herein include a dsRNA agent and a lipid preparation.

[0075] In some embodiments (e.g., embodiments of the methods described herein), cells are within the scope. In some embodiments, the scope is human. In some embodiments, the level of SCN9A mRNA is inhibited by at least 50%. In some embodiments, the level of SCN9A protein is inhibited by at least 50%. In some embodiments, the expression of SCN9A is inhibited by at least 50%. In some embodiments, inhibiting the expression of SCN9A reduces the level of SCN9A protein in a biological sample derived from the scope (e.g., cerebrospinal fluid (CSF) sample or CNS biopsy sample) by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, inhibiting the expression of the SCN9A gene reduces the level of SCN9A mRNA in a biological sample derived from the scope (e.g., cerebrospinal fluid (CSF) sample or CNS biopsy sample) by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0076] In some embodiments, the subject has or has been diagnosed with an SCN9A-related disorder. In some embodiments, the subject meets at least one diagnostic criterion for an SCN9A-related disorder. In some embodiments, an SCN9A-related disorder is pain, such as chronic pain, such as inflammatory pain, neuropathic pain, pain hypersensitivity, pain hyposensitivity, analgesia, primary erythromelalgia (PE), paroxysmal severe pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections.

[0077] In some embodiments, the nerve cells or tissues are peripheral sensory neurons, such as peripheral sensory neurons of the dorsal root ganglia, or nociceptive neurons, such as A-delta fibers or C-type fibers.

[0078] In some embodiments, SCN9A-related disorders include pain, such as chronic pain. In some embodiments, chronic pain may be caused by or associated with conditions such as hyperalgesia, hypoalgesia, analgesia, primary erythromelalgia (PE), paroxysmal severe pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, or viral infection.

[0079] In some embodiments, the treatment includes improvement of at least one sign or symptom of impairment. In some embodiments, the at least one sign or symptom includes one or more measures of pain sensitivity, pain threshold, pain level, pain impairment level, presence, level, or activity of SCN9A (e.g., SCN9A gene, SCN9A mRNA, or SCN9A protein).

[0080] In some embodiments, SCN9A levels higher than a reference level indicate that the subject has pain, such as chronic pain, or pain-related disorder. In some embodiments, treatment includes preventing the progression of the disorder. In some embodiments, treatment includes one or more of (a) reducing pain, or (b) inhibiting or reducing the expression or activity of SCN9A.

[0081] In some embodiments, the treatment results in a mean reduction of at least 30% from baseline in SCN9A mRNA in the dorsal root ganglia. In some embodiments, the treatment results in a mean reduction of at least 60% from baseline in SCN9A mRNA in the dorsal root ganglia. In some embodiments, the treatment results in a mean reduction of at least 90% from baseline in SCN9A mRNA in the dorsal root ganglia.

[0082] In some embodiments, after treatment, the subject experiences knockdown for at least 8 weeks following a single dose of dsRNA, as assessed by SCN9A protein in cerebrospinal fluid (CSF) or CNS tissue, e.g., dorsal root ganglia. In some embodiments, the treatment results in knockdown for at least 12 weeks following a single dose of dsRNA, as assessed by SCN9A protein in cerebrospinal fluid (CSF) or CNS tissue, e.g., dorsal root ganglia. In some embodiments, the treatment results in knockdown for at least 16 weeks following a single dose of dsRNA, as assessed by SCN9A protein in cerebrospinal fluid (CSF) or CNS tissue, e.g., dorsal root ganglia.

[0083] In some embodiments, the subject is human.

[0084] In some embodiments, the dsRNA agent is administered in doses ranging from approximately 0.01 mg / kg to approximately 50 mg / kg.

[0085] In some embodiments, the dsRNA agent is administered intracranially or intrathecally to the subject.

[0086] In some embodiments, the dsRNA agent is administered to the subject intrathecally, intraventricularly, or intracerebrally.

[0087] In some embodiments, the methods described herein further include measuring the level of SCN9A (e.g., SCN9A gene, SCN9A mRNA, or SCN9A protein) in a subject. In some embodiments, measuring the level of SCN9A in a subject includes measuring the level of SCN9A protein in a biological sample obtained from the subject (e.g., cerebrospinal fluid (CSF) sample or CNS biopsy sample). In some embodiments, the methods described herein further include performing blood tests, imaging tests, or CNS biopsies or aqueous cerebrospinal fluid biopsies.

[0088] In some embodiments, the methods described herein for further measuring the level of SCN9A (e.g., SCN9A gene, SCN9A mRNA, or SCN9A protein) in a subject are performed before treatment with a dsRNA agent or pharmaceutical composition. In some embodiments, if it is determined that the subject has a level of SCN9A higher than a reference level, the dsRNA agent or pharmaceutical composition is administered to the subject. In some embodiments, measuring the level of SCN9A in the subject is performed after treatment with a dsRNA agent or pharmaceutical composition.

[0089] In some embodiments, the methods described herein further include treating the subject with a therapy suitable for the treatment or prevention of SCN9A-related disorders, for example, the therapy including nonsteroidal anti-inflammatory drugs (NSAIDs), acetaminophen, opioids, or corticosteroids, acupuncture, therapeutic massage, dorsal root ganglion stimulation, spinal cord stimulation, or topical analgesics. In some embodiments, the methods described herein further include administering to the subject additional agents suitable for the treatment or prevention of SCN9A-related disorders. In some embodiments, the additional agents include steroids or nonsteroidal anti-inflammatory drugs.

[0090] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0091] Details of various embodiments of this disclosure are set forth in the following description. Other features, purposes, and advantages of this disclosure will become apparent from the description and drawings and from the claims.

[0092] This patent or application file includes at least one drawing made in color. A copy of this patent or patent application publication containing the color drawing will be provided by the Patent Office upon request and payment of the necessary fees. [Brief explanation of the drawing]

[0093] [Figure 1-1]Figure 1A shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-795305, AD-1251249, AD-1251251, AD-1010663, AD-1251301, and AD-961179. Figure 1B shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-1251317, AD-1251318, AD-1251323, AD-1251325, AD-795634, and AD-1251363. Figure 1C shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-1251364, AD-1251373, AD-1251385, AD-1251391, and AD-795913. For each siRNA, "F" indicates a "2'-fluoro" modification, OMe indicates a methoxy group, GNA indicates glycol nucleic acid, "(A2p)" indicates adenosine 2'-phosphate, "(C2p)" indicates cytosine 2'-phosphate, "(G2p)" indicates guanosine 2'-phosphate, "DNA" indicates a DNA base, 2-C16 indicates a targeted ligand, and PS indicates a phosphorothioate linkage. Figures 1A to 1C disclose sequence numbers 5996 to 6029, respectively, in the order they appear. [Figure 1-2] Same as above. [Figure 1-3] Same as above. [Figure 2] Figure 2 is a graph showing the percentage of residual SCN9A messages in mice 14 days after treatment with the exemplary double helices shown on the X-axis (from left to right: PBS, AD-795305 (parent), AD-1251249, AD-1251251, AD-1010663 (parent), AD-1251301, AD-961179 (parent), AD-1251317, AD-1251318, AD-1251323, AD-1251325, AD-795634 (parent), AD-1251363, AD-1251364, AD-1251373, AD-1251385, and AD-1251391), compared to PBS. [Figure 3-1]Figure 3A shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-802471, AD-1251492, AD-961334, AD-1251279, and AD-1251284. Figure 3B shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-1251334, AD-1251377, AD-1251398, AD-1251399, AD-961188, and AD-1251274. Figures 3A and 3B disclose sequence numbers 6030 to 6051, respectively, in the order in which they appear. Figure 3C shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-796825, AD-1251411, AD-1251419, AD-797564, AD-1251428, and AD-1251434. Figure 3D shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-1010661, AD-795366, AD-795634, and AD-795913. For each siRNA, "F" is a "2'-fluoro" modification, OMe is a methoxy group, GNA refers to glycol nucleic acid, "(A2p)" refers to adenosine 2'-phosphate, "(C2p)" refers to cytosine 2'-phosphate, "(U2p)" refers to uracil 2'-phosphate, "(G2p)" refers to guanosine 2'-phosphate, "DNA" refers to a DNA base, 2-C16 refers to a targeted ligand, and PS refers to a phosphorothioate linkage. Figures 3C-3D disclose sequence numbers 6052-6071, in the order they appear. [Figure 3-2] Same as above. [Figure 3-3] Same as above. [Figure 3-4] Same as above. [Figure 4-1]Figures 4A–4C show a series of graphs representing the percentage of residual SCN9A messages compared to the start position in the target mRNA (NM_001365536.1) of the double-stranded sense strand, classified by those tested in Screening 1 and 2 (targeting ORF-1, ORF-2, and 3'UTR). Figure 4A shows the percentage of residual SCN9A messages including double strands tested at a final concentration of 0.1 nM. Figure 4B shows the percentage of residual SCN9A messages including double strands tested at a final concentration of 1 nM. Figure 4C shows the percentage of residual SCN9A messages including double strands tested at a final concentration of 10 nM. In Figures 4A-4C, Screening 1 consists of the following double-stranded sequences: AD-1010663.3, AD-1251301.1, AD-1251249.1, AD-1251251.1, AD-795305.3, AD-1251363.1, AD-1251364.1, AD-1251373.1, AD-795634.4, AD-1251385.1, AD-1251391.1, AD-1251317.1, AD-1251318.1, AD-1251323.1, AD-1251325.1, and AD-961179. Screening 2 included the following double-stranded compounds: AD-1251492.1, AD-1251279.1, AD-961334.3, AD-1251284.1, AD-1251334.1, AD-1251377.1, AD-1251398.1, AD-1251399.1, AD-1251274.2, AD-961188.3, ​​AD-1251411.1, AD-1251419.1, AD-796825.3, AD-1251428.1, AD-797564.4, and AD-1251434.1. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 5]Figure 5 shows exemplary double helix chains on the X-axis (from left to right: PBS, AD-1251492.2*, AD-961334.2 (parent), AD-1251279.2, PBS, AD-1251284.2*, AD-1251334.2*, AD-1251377.2*, AD-1251398.2*, AD-1251399.2*, AD-9 In mice 14 days after treatment with 61188.2 (parent), AD-1251274.2, PBS, AD-796825.2 (parent), AD-1251411.2, AD-1251419.2, AD-797564.3 (parent), AD-1251428.2, and AD-1251434.2, the residual SCN9A levels were compared to PBS in mice treated with these agents. This graph shows the percentage of the message. The graph is 3'UTR2(AD-1251492.2*, AD-961334.2(parent), AD-1251279.2), ORF1(AD-1251284.2*, AD-1251334.2*, AD-1251377.2*, AD-1251398.2*, AD-1251399.2* It is divided into sub-sections concerning those double helix proteins that target AD-961188.2 (parent), AD-1251274.2, and ORF2 (AD-796825.2 (parent), AD-1251411.2, AD-1251419.2, AD-797564.3 (parent), AD-1251428.2, AD-1251434.2). [Figure 6-1] Figure 6A shows the sequences and chemistry of exemplary SCN9A siRNAs, including AD-1251284, AD-961334, and AD-1251325. Figure 6A discloses sequence numbers 6072-6077, respectively, in order of appearance. Figure 6B shows the sequences and CNS chemistry of exemplary SCN9A double-stranded AD-1331352, AD-1209344, and AD-1331350. Figure 6B discloses sequence numbers 6078-6083, respectively, in order of appearance. [Figure 6-2] Same as above. [Modes for carrying out the invention]

[0094] iRNAs direct sequence-specific degradation of mRNA via a process known as RNA interference (RNAi). iRNAs for modulating (e.g., inhibiting) SCN9A expression and methods for using them are described herein. Compositions and methods for treating disorders associated with SCN9A expression, such as pain, such as acute or chronic pain (e.g., inflammatory (nociceptive), neuropathic pain, pain hypersensitivity, pain hyposensitivity, analgesia, primary erythromelalgia (PE), paroxysmal excruciating pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections).

[0095] Human SCN9A is a protein of approximately 226 kDa that is a voltage-gated sodium channel (Nav1.7 channel) that mediates voltage-gated sodium ion permeability of excitatory membranes and also plays a role in nociceptive signaling. These channels are preferentially expressed in peripheral sensory neurons of the dorsal root ganglia, which are involved in pain perception. Mutations in the SCN9A gene are associated with a predisposition to pain hypersensitivity or hyposensitivity. For example, gain-of-function mutations in the SCN9A gene may be the etiological basis for hereditary pain syndromes such as primary erythromelalgia (PE) and paroxysmal severe pain disorder (PEPD). Furthermore, loss-of-function mutations in the SCN9A gene can completely prevent otherwise healthy individuals from feeling any form of pain. While not intended to be limited by theory, it is possible that increased SCN9A expression levels may enhance pain sensitivity, while decreased SCN9A expression levels may reduce pain sensitivity, and that modulating SCN9A expression and Nav1.7 channel levels in peripheral sensory neurons of the dorsal root ganglia may provide effective pain management.

[0096] The following description discloses methods for preparing and using compositions containing iRNA for modulating (e.g., inhibiting) SCN9A expression, as well as compositions and methods for addressing disorders associated with SCN9A expression.

[0097] In some embodiments, the following are characterized herein: a pharmaceutical composition containing SCN9A iRNA and a pharmaceutically acceptable carrier; a method of using the composition to inhibit SCN9A expression; and a method of using the pharmaceutical composition to treat disorders associated with SCN9A expression (e.g., pain, e.g., chronic pain and / or pain-related disorders).

[0098] I. Definition For convenience, the meanings of certain terms and phrases used in this specification, the examples, and the appended claims are provided below. In the event of any apparent conflict between the use of a term in other parts of this specification and the definition provided in this section, the definition in this section shall prevail.

[0099] The term "approximately" means that, when referring to a number or numerical range, the number or numerical range referred to is an approximation within experimental variability (or aggregate experimental error), and therefore the number or numerical range may vary, for example, between 1% and 15% of the stated number or numerical range.

[0100] The terms "or more" and "at least" preceding a number or set of numbers are understood, where clear from the context, to include the number adjacent to the term "at least," and all subsequent numbers or integers that may logically be included. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For instance, "at least 17 nucleotides in a 20-nucleotide nucleic acid molecule" means that 17, 18, 19, or 20 nucleotides have the stated characteristic. It will be understood that when "at least" is present before a set of numbers or a range, "at least" can modify each of the numbers and ranges in the set.

[0101] As used herein, “or less” and “less than or equal to” are understood to include the value adjacent to the phrase and, where logically, any logically smaller value or integer up to zero. For example, a double helix with a mismatch for the target site of “2 or less nucleotides” has mismatches of 2, 1, or 0. It will be understood that when “less than or equal to” precedes a series of numbers or ranges, “less than or equal to” can modify each of the numbers or ranges in that series.

[0102] As used herein, “less than” is understood to include logically smaller values ​​or integers up to zero, where logically, and does not include values ​​adjacent to the phrase. For example, a double helix with a mismatch for the target site of “less than 3 nucleotides” has mismatches of 2, 1, or 0. Where “less than” precedes a series of numbers or ranges, it is understood that “less than” may modify each number in the series or range.

[0103] As used herein, “greater than” is understood to include logically larger values ​​or integers up to infinity, where logically, and not including values ​​adjacent to the phrase. For example, a double helix with mismatches for the target site of “greater than 3 nucleotides” would have 4, 5, 6, or more mismatches. When “greater than” precedes a series of numbers or a range, it is understood that “greater than” may modify each number in the series or range.

[0104] As used herein, “maximum” as in “maximum 10” is understood to include maximum 10 and 10, i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0105] The ranges provided herein are understood to include all individual integer values ​​and all subranges within those ranges.

[0106] The terms “activate,” “enhance,” “upregulate expression,” and “increase expression” refer, insofar as they refer to the SCN9A gene, to the extent that they refer to the SCN9A gene, in this specification, to the extent that they refer to the SCN9A gene, to the extent that they indicate at least partial activation of SCN9A gene expression, as indicated by an increase in the amount of SCN9A mRNA that can be isolated or detected from a first cell or group of cells that is substantially identical to a first cell or group of cells but has been treated to increase SCN9A gene expression compared to a second cell or group of cells that has not been treated in this manner (control cells).

[0107] In some embodiments, SCN9A gene expression is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% upon administration of iRNA as described herein. In some embodiments, SCN9A gene is activated by at least about 60%, 70%, or 80% upon administration of iRNA as characterized in this disclosure. In some embodiments, SCN9A gene expression is activated by at least about 85%, 90%, or 95%, or more, upon administration of iRNA as described herein. In some embodiments, SCN9A gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, or at least 1000-fold, compared to expression in untreated cells. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006 Proc. Natl. Acad. Sci. USA 103:17337-42, and in US2007 / 0111963 and US2005 / 226848, each of which is incorporated herein by reference.

[0108] The terms “silencing,” “inhibiting expression,” “downregulating expression,” and “suppressing expression,” insofar as they refer to the SCN9A gene, mean, in this specification, at least partial suppression of SCN9A expression, such as being assessed based on, for example, SCN9A mRNA expression, SCN9A protein expression, or another parameter functionally associated with SCN9A expression. For example, inhibition of SCN9A expression may be indicated by a reduction in the amount of SCN9A mRNA that can be isolated or detected in a first group of cells or cells in which SCN9A is transcribed and treated to inhibit SCN9A expression compared to a control. The control may be a second group of cells or cells (control cells) substantially identical to the first group of cells or cells, except that the second group of cells or cells has not been treated in the same way. The degree of inhibition is usually a percentage of the control level, for example,

[0109]

number

[0110] Alternatively, the degree of inhibition can be expressed in terms of a reduction in the amount of a parameter functionally associated with SCN9A expression, such as the protein encoded by the SCN9A gene. The reduction in a parameter functionally associated with SCN9A expression can similarly be expressed as a percentage of the control level. In principle, SCN9A silencing can be determined in any cell expressing SCN9A constitutively or by genome engineering by any suitable assay.

[0111] For example, in certain cases, SCN9A expression is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the iRNA disclosed herein. In some embodiments, SCN9A is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of the iRNA disclosed herein. In some embodiments, SCN9A is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of iRNA as described herein.

[0112] The terms "antisense strand" or "guide strand" refer to a strand of iRNA, such as dsRNA, that contains a region substantially complementary to the target sequence.

[0113] As used herein, the term “complementary region” refers to a region on an antisense chain that is substantially complementary to a sequence, for example, a target sequence as defined herein. A complementary region may not be sufficiently complementary to the target sequence; mismatches may be located in the interior or terminal regions of the molecule. In some embodiments, a complementary region may contain zero, one, or two mismatches.

[0114] The terms “sense strand” or “passenger strand,” as used herein, refer to a strand of iRNA containing a region that is substantially complementary to the antisense strand region as defined herein.

[0115] The terms “blunt” or “blunt-ended,” as used herein in relation to dsRNA, mean that there are no unpaired nucleotides or nucleotide analogs at any given end of the dsRNA; that is, there are no nucleotide overhangs. One or both ends of a dsRNA can be blunt. If both ends of a dsRNA are blunt, it is said to be blunt-ended. For clarity, a “blunt-ended” dsRNA is a dsRNA that is blunt at both ends, i.e., a dsRNA in which there are no nucleotide overhangs at either end of the molecule. In most cases, such a molecule will be double-stranded over its entire length.

[0116] Where used herein, unless otherwise specified, the term “complementary” means, as understood by those skilled in the art, the ability of an oligonucleotide or polynucleotide containing a first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a second nucleotide sequence to form a double helix under certain conditions, when used to describe a first nucleotide sequence in relation to a second nucleotide sequence. Such conditions may be, for example, “stringent conditions,” and stringent conditions could include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 12–16 hours, 50°C or 70°C, followed by washing. Other conditions may apply, such as physiologically relevant conditions that might be encountered inside living organisms. Those skilled in the art will be able to determine the set of conditions most appropriate for testing the complementarity of the two sequences, according to the final application of the hybridized nucleotides.

[0117] Complementary sequences within iRNA, for example, within dsRNA as described herein, include base pairings of an oligonucleotide or polynucleotide containing a first nucleotide sequence to an oligonucleotide or polynucleotide containing a second nucleotide sequence, over the full length of one or both nucleotide sequences. Such sequences may be referred to herein as “fully complementary” with respect to each other. However, where herein the first sequence is considered “substantially complementary” to the second sequence, the two sequences may be fully complementary, or they may form one or more, but generally five, four, three, or two or fewer, mismatched base pairs during hybridization, while maintaining their ability to hybridize under conditions best suited to their final use, e.g., inhibition of gene expression via the RISC pathway, in the case of double helixes of up to 30 base pairs. However, if two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs are not considered mismatches for the purpose of determining complementarity. For example, a dsRNA comprising one oligonucleotide of 21 nucleotides and another oligonucleotide of 23 nucleotides, wherein the longer oligonucleotide contains a 21-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, can still be considered "perfectly complementary" for the purposes described herein.

[0118] Complementary sequences, as used herein, may also include, or may be entirely formed from, base pairs formed from non-Watson-Crick base pairs and / or non-naturally modified nucleotides, provided that the above requirements regarding their ability to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:UWobble or Hoogsteen base pairings.

[0119] The terms “complementary,” “fully complementary,” and “substantially complementary” may be used herein in relation to base matching between two oligonucleotides or polynucleotides, for example, between the sense and antisense strands of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as understood from the context in which they are used.

[0120] As used herein, a polynucleotide that is "substantially complementary to at least a portion of" messenger RNA (mRNA) means a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., the mRNA encoding the SCN9A protein). For example, a polynucleotide is complementary to at least a portion of SCN9A mRNA if its sequence is substantially complementary to an uninterrupted portion of the mRNA encoding SCN9A. The term "complementarity" refers to the ability of nucleic acid bases of a first nucleic acid and a second nucleic acid to form pairs.

[0121] As used herein, the term “complementary region” means a region of one nucleotide sequence agent that is substantially complementary to the other sequence, as defined herein, e.g., the sense sequence region and the corresponding antisense sequence of a dsRNA, or the antisense strand and target sequence of an iRNA, e.g., the SCN9A nucleotide sequence. If the complementary region is not perfectly complementary to the target sequence, the mismatch may be in the internal or terminal region of the iRNA antisense strand. Generally, the most acceptable mismatch is within the terminal region, e.g., within 5, 4, 3, or 2 nucleotides of the 5' or 3' end of the iRNA agent.

[0122] When used herein, "contact" includes both direct and indirect contact with cells. For example, when a composition containing iRNA is administered to a subject (e.g., intrathecal, intracranial, intracerebral, or ventricular), cells within the subject can be brought into contact.

[0123] "Introduction into cells," when referring to iRNA, means facilitating or achieving uptake or absorption into cells. The absorption or uptake of iRNA may occur by spontaneously diffusive or active cellular processes, or by adjuvants or devices. The meaning of this term is not limited to cells in vitro; iRNA may also be "introduced into cells" that are part of a living organism. In such examples, introduction into cells includes delivery to the organism. For example, for in vivo delivery, iRNA may be injected into a tissue site or administered systemically. In vivo delivery may also be by β-glucan delivery systems, e.g., those described in U.S. Patents 5,032,401 and 5,607,677 and U.S. Patent Publication 2005 / 0281781, which are incorporated herein by reference in their entirety. In vitro introduction into cells includes methods known in the art, e.g., electroporation and lipofection. Further approaches are described below herein or are known in the art.

[0124] As used herein, “SCN9A expression-associated disorder,” “SCN9A expression-associated disease,” “SCN9A expression-associated pathological process,” “SCN9A-associated disorder,” and “SCN9A-associated disease” include any condition, disorder, or disease in which SCN9A expression is altered (e.g., decreased or increased relative to a reference level, e.g., a level characteristic of a non-disease subject). In some embodiments, SCN9A expression is decreased. In some embodiments, SCN9A expression is increased. In some embodiments, the decrease or increase in SCN9A expression is detectable in a tissue sample from the subject (e.g., in a cerebrospinal fluid (CSF) sample or a CNS biopsy sample). The decrease or increase can be evaluated relative to the level observed in the same individual prior to the onset of the disorder, or relative to another individual(s) without the disorder. The decrease or increase may be limited to a specific organ, tissue, or area of ​​the body (e.g., brain or spine). SCN9A-associated disorders include, but are not limited to, pain, e.g., chronic pain or pain-related disorders.

[0125] In this specification, “pain” includes acute pain and chronic pain. Chronic pain includes, but is not limited to, inflammatory (nociceptive) and neuropathic pain associated with disorders including cancer, arthritis, diabetes, trauma, and viral infections. It also includes, but is not limited to, pain from hereditary pain syndromes, including primary erythromelalgia (PE) and paroxysmal severe pain disorder (PEPD).

[0126] The terms “double-stranded RNA,” “dsRNA,” or “siRNA,” as used herein, refer to an iRNA containing an RNA molecule or molecular complex having a hybridized double-stranded region containing two substantially complementary, antiparallel nucleic acid strands called “sense” and “antisense” orientations with respect to the target RNA. The double-stranded region can be of any length, typically ranging from 9 to 36 base pairs, for example, 15 to 30 base pairs, and allows for the specific degradation of the desired target RNA, for example, by the RISC pathway. Considering double helix stretchers between 9 and 36 base pairs, a double helix stretcher can be any length within this range, e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 and not limited to, but also including 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18 It can be any sub-range of ~26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNAs produced in cells by processing with Dicer and similar enzymes are generally in the 19-22 base pair length range. One strand of the dsDNA double-stranded region contains a sequence that is substantially complementary to the target RNA. The two strands forming the double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be formed from two or more distinct RNA molecules.When a double-stranded region is formed from two strands of a single molecule, the molecule may have a double-stranded region (referred to herein as a “hairpin loop”) separated by nucleotides of a single strand between the 3' end of one strand forming the double-stranded structure and the 5' end of the other strand. The hairpin loop may contain at least one unpaired nucleotide, and in some embodiments, the hairpin loop may contain at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. When two substantially complementary strands of dsRNA are contained by separate RNA molecules, those molecules may be connected by covalent bonds, although this is not necessarily required. In some embodiments, the two strands are connected by covalent bonds by means other than a hairpin loop, and the connecting structure is a linker.

[0127] In some embodiments, the iRNA agent may be a "single-stranded siRNA" introduced into a cell or organism to inhibit a target mRNA. In some embodiments, the single-stranded RNA iRNA agent can bind to Argonaut 2, a RISC endonuclease, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15–30 nucleotides long and may be chemically modified. Designs and tests of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883–894, the entire contents of which are incorporated herein by reference. Any antisense nucleotide sequences described herein (e.g., sequences provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20) may be used as single-stranded siRNA as described herein, and may also be used as single-stranded siRNA that has been chemically modified, for example, by the method described herein, for example, Lima et al., (2012) Cell 150:883-894.

[0128] In some embodiments, RNA interference agents include single-stranded RNA that interacts with a target RNA sequence and directs the cleavage of the target RNA. Although not intended to be limited by theory, long double-stranded RNA introduced into cells is degraded into siRNA by a type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, processes dsRNA into short interference RNAs of 19-23 base pairs with a characteristic two-base 3' overhang [Bernstein, et al., (2001) Nature 409:363]. The siRNA is then incorporated into an RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA double helix, allowing a complementary antisense strand to induce target recognition [Nykanen, et al., (2001) Cell 107:309]. Upon binding to a suitable target mRNA, one or more endonucleases within RISC cleave the target to induce silencing [Elbashir, et al., (2001) Genes Dev. 15:188]. Therefore, in some embodiments, this disclosure relates to single-stranded RNA that facilitates the formation of a RISC complex to silence a target gene.

[0129] "G," "C," "A," "T," and "U" generally represent nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively. However, it will be understood that the terms "deoxyribonucleotide," "ribonucleotide," or "nucleotide" may also refer to modified nucleotides or substitute substitutions, as will be described in more detail below. Those skilled in the art are well aware that guanine, cytosine, adenine, and uracil can be replaced by other parts without substantially altering the base-pairing properties of oligonucleotides containing such substitutions. For example, but not limited to, nucleotides containing inosine as a base can base-pair with nucleotides containing adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine, or adenine can be substituted, for example, with nucleotides containing inosine in the nucleotide sequences of the dsRNAs featured in this disclosure. In another example, adenine and cytosine in either of the oligonucleotides can be substituted with guanine and uracil, respectively, to form G-UWobble base pairs with the target mRNA. Sequences containing such substitutions are suitable for the compositions and methods featured in this disclosure.

[0130] As used herein, the terms “iRNA,” “RNAi,” “iRNA agent,” or “RNAi agent” or “RNAi molecule” refer to agents containing RNA as defined herein that mediate targeted cleavage of RNA transcripts, for example, via the RNA-induced silencing complex (RISC) pathway. In some embodiments, iRNAs as described herein achieve, for example, inhibition of SCN9A expression in cells or mammals. Inhibition of SCN9A expression can be assessed based on a reduction in the level of SCN9A mRNA or a reduction in the level of SCN9A protein.

[0131] The term "linker" or "linking group" refers to an organic part that connects two parts of a compound, for example, by covalent bonding.

[0132] The term "lipophilic" or "lipophilic moiety" broadly refers to any compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is by the octanol-water partition coefficient logK. ow This is by which, in this case, K ow The octanol-water partition coefficient is the ratio of the concentration of a chemical in the octanol phase to the concentration of a chemical in the aqueous phase in a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it can also be predicted by using a coefficient derived from the structural components of the chemical, calculated using first-principles or empirical methods [see, for example, Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), whose entirety is incorporated herein by reference]. It provides a thermodynamic measure of a substance's tendency to prefer non-aqueous or oily environments rather than water (i.e., the hydrophilic / lipophilic balance). In principle, a chemical is logK ow If logK is greater than 0, it is lipophilic. Typically, the lipophilic portion is greater than 1, greater than 1.5, greater than 2, greater than 3, greater than 4, greater than 5, or greater than 10. ow It has, for example, the logK of 6-aminohexanol. ow It is expected to be approximately 0.7. Using the same method, the logK of cholesteryl N-(hexane-6-ol) carbamate can be obtained. ow It is expected to be 10.7.

[0133] The lipophilicity of a molecule can be altered with respect to the functional groups it possesses. For example, by adding a hydroxyl group or an amine group to the end of the lipophilic portion, the partition coefficient (e.g., logK) of the lipophilic portion can be changed. ow The value can be increased or decreased.

[0134] Alternatively, the hydrophobicity of a double-stranded RNAi agent conjugated to one or more lipophilic moieties can be measured by its protein-binding properties. For example, in certain embodiments, the unbound fraction of a plasma protein-binding assay for a double-stranded RNAi agent can be determined to be positively correlated with the relative hydrophobicity of the double-stranded RNAi agent, which may be positively correlated with the silencing activity of the double-stranded RNAi agent.

[0135] In some embodiments, the plasma protein binding assay to be determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol for this binding assay is described in detail, for example, PCT / US2019 / 031170. The hydrophobicity of the double-stranded RNAi agent, as measured by the fraction of unbound siRNA in the binding assay, is greater than 0.15, greater than 0.2, greater than 0.25, greater than 0.3, greater than 0.35, greater than 0.4, greater than 0.45, or greater than 0.5 in the case of enhanced in vivo delivery of siRNA.

[0136] Therefore, by conjugating the lipophilic portion to the internal position of the double-stranded RNAi agent, optimal hydrophobicity for enhanced in vivo delivery in siRNA is provided.

[0137] The term “lipid nanoparticle” or “LNP” refers to a vesicle containing a lipid layer that encapsulates a pharmaceutically active molecule, such as a nucleic acid molecule, such as an RNAi agent or a plasmid from which an RNAi agent is transcribed. LNPs are described, for example, in U.S. Patents 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0138] As used herein, the term “modulate expression” means at least partial “inhibition” or partial “activation” of gene expression (e.g., SCN9A gene) in cells treated with an iRNA composition as described herein, compared to the expression of the corresponding gene in control cells. Control cells include untreated cells or cells treated with untargeted control iRNA.

[0139] Those skilled in the art will recognize that the terms “RNA molecule” or “ribonucleic acid molecule” encompass not only RNA molecules as naturally expressed or found, but also RNA analogs and derivatives containing one or more ribonucleotides / ribonucleoside analogs or derivatives, as described herein or known in the art. Strictly speaking, “ribonucleoside” contains a nucleoside base and a ribose sugar, while “ribonucleotide” is a ribonucleoside having one, two, or three phosphate moieties or analogs thereof (e.g., phosphorothioates). However, the terms “ribonucleoside” and “ribonucleotide” can be considered equivalent when used herein. RNA can be modified in its nucleic acid base structure, its ribose structure, or its ribose-phosphate backbone structure, for example, as described below herein. However, molecules containing ribonucleoside analogs or derivatives must retain the ability to form double helixes. As an example without limitation, RNA molecules may also include, but are not limited to, at least one modified ribonucleoside, including 2'-O-methyl modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, locked nucleosides, debased nucleosides, acyclic nucleosides, glycol nucleotides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, nucleosides containing a phosphoramidate or a non-natural base, or any combination thereof. Alternatively, in combination, an RNA molecule may contain at least two modified ribonucleosides and up to three, four, five, six, seven, eight, nine, ten, fifteen, twenty, or more full-length dsRNA molecules. The modifications are not necessarily identical for each of these multiple modified ribonucleosides in the RNA molecule.In some embodiments, the modified RNAs considered for use in the methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required double-stranded structure and enable or mediate the specific degradation of target RNA by, for example, the RISC pathway. For clarity, it is understood that the term “iRNA” does not include naturally occurring double-stranded DNA molecules or 100% deoxynucleoside-containing DNA molecules.

[0140] In some embodiments, the modified ribonucleoside comprises a deoxyribonucleoside. In such examples, the iRNA agent may contain, for example, one or more deoxyribonucleosides including a deoxyribonucleoside overhang or one or more deoxyribonucleosides within the double-stranded portion of the dsRNA. In certain embodiments, the RNA molecule contains, for example, a percentage of deoxyribonucleosides of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) of deoxyribonucleosides in one or both strands.

[0141] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide protruding from the double-stranded structure of an iRNA, such as a dsRNA. For example, a nucleotide overhang exists if the 3' end of one strand of a dsRNA extends beyond the 5' end of the other strand, or vice versa. A dsRNA may contain an overhang of at least one nucleotide; or, an overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, or at least five nucleotides, or more. A nucleotide overhang may contain, or consist of, nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. An overhang may be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotides of an overhang may be located at the 5' end, the 3' end, or both of either the antisense strand or the sense strand of the dsRNA.

[0142] In some embodiments, the antisense strand of the dsRNA has 1 to 10 nucleotide overhangs at the 3' and / or 5' ends. In one embodiment, the sense strand of the dsRNA has 1 to 10 nucleotide overhangs at the 3' and / or 5' ends. In some embodiments, one or more nucleotides in the overhangs are replaced with nucleoside thiophosphates.

[0143] As used herein, “pharmaceutical composition” comprises a pharmacologically effective amount of a therapeutic agent (e.g., iRNA) and a pharmaceutically acceptable carrier. As used herein, “pharmacologically effective amount,” “therapeutably effective amount,” or simply “effective amount” means the amount of a drug (e.g., iRNA) that is effective in producing an intended pharmacological, therapeutic, or prophylactic outcome. For example, in a method of treating a disorder associated with SCN9A expression (e.g., pain, e.g., chronic pain or pain-related disorder), the effective amount includes an amount effective in reducing one or more symptoms associated with the disorder (e.g., an amount effective in (a) inhibiting pain, or (b) inhibiting or reducing SCN9A expression or activity) or an amount effective in reducing the risk of developing a condition associated with the disorder. For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, the therapeutically effective amount of a drug for treating a disease or disorder is the amount necessary to obtain at least a 10% reduction in that parameter. For example, a therapeutically effective dose of iRNA targeting SCN9A can reduce the level of SCN9A mRNA or SCN9A protein by any measurable amount, for example, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.

[0144] The term "pharmaceutically acceptable carrier" refers to a carrier for administering therapeutic drugs. Such carriers include, but are not limited to, physiological saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. This term specifically excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients, such as inactive diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inactive diluents include sodium carbonate and calcium, sodium phosphate and calcium, and lactose; corn starch and alginic acid are suitable disintegrants. Binders include starch and gelatin; lubricants, if present, are generally magnesium stearate, stearic acid, or talc. If necessary, tablets can be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The drugs contained in the drug formulations are further described below in this specification.

[0145] As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle. A SNALP represents a lipid vesicle coating the interior of a reduced aqueous solution containing a nucleic acid, such as iRNA or a plasmid from which iRNA is transcribed. SNALPs are described, for example, in U.S. Patent Application Publication Nos. 2006 / 0240093, 2007 / 0135372, and International Patent Application No. WO2009 / 082817. These applications are incorporated herein by reference in their entirety. In some embodiments, a SNALP is an SPLP. As used herein, the term “SPLP” refers to a nucleic acid-lipid particle containing plasmid DNA encapsulated within a lipid vesicle.

[0146] As used herein, the term “sequence-containing chain” means an oligonucleotide containing a chain of nucleotides described by a sequence as referred to using the standard nucleotide terminology.

[0147] When used herein, the “subject” to be treated according to the methods described herein includes humans or non-human animals, such as mammals. Mammals may be, for example, rodents (e.g., rats or mice) or primates (e.g., monkeys). In some embodiments, the subject is human.

[0148] "Subjects requiring it" include subjects who have, are suspected of having, or are at risk of developing SCN9A expression, e.g., overexpression, and associated disorders (e.g., pain, e.g., chronic pain or pain-related disorders). In some embodiments, subjects have, or are suspected of having, SCN9A expression or overexpression-related disorders. In some embodiments, subjects are at risk of developing SCN9A expression or overexpression-related disorders.

[0149] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, such as SCN9A, which contains mRNA, the product of RNA processing of the primary transcript. The target portion of the sequence will be long enough to act as a substrate for cleavage directed by iRNA at or near that portion. For example, target sequences are generally 9–36 nucleotides long, e.g., 15–30 nucleotides long, and include all sub-ranges in that range. As a non-limiting example, target sequences may be 15–30 nucleotides, 15–26 nucleotides, 15–23 nucleotides, 15–22 nucleotides, 15–21 nucleotides, 15–20 nucleotides, 15–19 nucleotides, 15–18 nucleotides, 15–17 nucleotides, 18–30 nucleotides, 18–26 nucleotides, 18–23 nucleotides, 18–22 nucleotides, 18–21 nucleotides, 18–20 nucleotides, 19–30 nucleotides, 19–26 nucleotides Rheotide may be 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.

[0150] As used herein, terms such as “therapeutically effective dose” and “preventively effective dose” refer to the amount that provides a therapeutic benefit in the treatment, prevention, or management of any disorder or pathological process associated with SCN9A expression (e.g., pain, e.g., chronic pain or pain-related disorder). The specific therapeutically effective dose will vary depending on factors known in the art, such as the type of disorder or pathological process, the patient’s medical history and age, the stage of the disorder or pathological process, and the administration of other therapies.

[0151] In connection with this disclosure, the terms “to treat,” “treatment,” etc., mean preventing, delaying, reducing, or mitigating at least one symptom associated with a disorder associated with SCN9A expression, or slowing or reversing the progression or predicted progression of such disorder. For example, when the methods featured herein are used to treat pain, e.g., chronic pain or pain-related disorder, they may help reduce or prevent one or more symptoms of pain, e.g., chronic pain, as described herein, or reduce the risk or severity of an associated condition. Thus, unless the context explicitly indicates otherwise, the terms “to treat,” “treatment,” etc., shall encompass the prevention, e.g., prevention, of disorders and / or symptoms of disorders associated with SCN9A expression. Treatment may also mean extending survival compared to predicted survival in the absence of treatment.

[0152] In relation to disease markers or symptoms, “lower” means any reduction, for example, a statistically or clinically significant reduction of the following levels. The reduction could be, for example, at least 10%, at least 20%, at least 30%, at least 40%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. The reduction can be lowered to a level that is considered within the normal range and acceptable for individuals without such impairment.

[0153] As used herein, "SCN9A" refers to the sodium channel voltage-gated alpha subunit IX gene ("SCN9A gene"), the corresponding mRNA ("SCN9A mRNA"), or the corresponding protein ("SCN9A protein"). The sequence of the human SCN9A mRNA transcript can be found in SEQ ID NO: 1 or SEQ ID NO: 4001. In the event of any discrepancy between the enumerated positions of the double helix presented herein and the alignment of the double helix to the enumerated sequences, the alignment of the double helix to the enumerated sequences shall prevail.

[0154] II. iRNA agents iRNA agents that modulate (e.g., inhibit) the expression of SCN9A are described herein.

[0155] In some embodiments, the iRNA agent activates SCN9A expression in cells or mammals.

[0156] In some embodiments, the iRNA agent comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of SCN9A in cells or in a subject (e.g., in mammals, e.g., in humans), wherein the dsRNA comprises an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed in SCN9A expression, the complementary region being 30 nucleotides or less in length, generally 19 to 24 nucleotides in length, and the dsRNA, upon contact with a cell expressing SCN9A, inhibits SCN9A expression by, for example, at least 10%, 20%, 30%, 40%, or 50%.

[0157] Modulation (e.g., inhibition) of SCN9A expression can be assayed, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods, for example, by Western blotting. SCN9A expression in cell cultures, for example, COS cells, ARPE-19 cells, hTERT RPE-1 cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cultured cells, or in biological samples obtained from subjects, can be assayed by measuring SCN9A mRNA levels by bDNA or TaqMan assays, or by measuring protein levels by immunofluorescence using Western blotting or flow cytometry techniques, for example.

[0158] A dsRNA typically contains two RNA strands that are sufficiently complementary to hybridize under the conditions in which the dsRNA is used to form a double-stranded structure. One strand of the dsRNA (the antisense strand) usually contains a complementary region that is substantially complementary and generally perfectly complementary to the target sequence obtained from the mRNA sequence formed during SCN9A expression. The other strand (the sense strand) usually contains a region complementary to the antisense strand, thereby allowing the two strands to hybridize to form a double-stranded structure when combined under favorable conditions. Generally, double-stranded structures are between 15 and 30 base pairs (inclusive), more commonly between 18 and 25 base pairs (inclusive), even more commonly between 19 and 24 base pairs (inclusive), and most commonly between 19 and 21 base pairs (inclusive). Similarly, the complementary region to the target sequence is between 15 and 30 nucleotides (inclusive of both ends), more generally between 18 and 25 nucleotides (inclusive of both ends), even more generally between 19 and 24 nucleotides (inclusive of both ends), and most commonly between 19 and 21 nucleotides (inclusive of both ends).

[0159] In some embodiments, the dsRNA is between 15 and 20 nucleotides long (inclusive), and in other embodiments, the dsRNA is between 25 and 30 nucleotides long (inclusive). As those skilled in the art will recognize, the targeted region of RNA targeted for cleavage will most often be a larger RNA molecule, often a part of an mRNA molecule. Where applicable, the “part” of the mRNA target is a contiguous sequence of mRNA targets long enough to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway). A dsRNA with a short double helix of 9 base pairs can, under certain circumstances, mediate RNA cleavage directed by RNAi. The target is most often at least 15 nucleotides long, e.g., 15–30 nucleotides long.

[0160] Those skilled in the art will recognize that the double-stranded region is the main functional portion of a dsRNA, e.g., a double-stranded region of 9–36, e.g., 15–30 base pairs. Therefore, in some embodiments, an RNA molecule or complex of RNA molecules having a double-stranded region of more than 30 base pairs, to the extent that it is processed to the functional double-strand of 15–30 base pairs, targeting the desired RNA for cleavage, is a dsRNA. Therefore, those skilled in the art will then recognize that in some embodiments, a miRNA is a dsRNA. In some embodiments, the dsRNA is not a naturally occurring miRNA. In some embodiments, an iRNA agent useful for targeting SCN9A expression is not generated in the target cell by cleaving a larger dsRNA.

[0161] dsRNAs as described herein may further comprise one or more single-stranded nucleotide overhangs. dsRNAs can be synthesized by standard methods known in the art, such as those discussed below, for example, by the use of automated DNA synthesizers, and are commercially available, for example, from Biosearch, Applied Biosystems, Inc.

[0162] In some embodiments, SCN9A is human SCN9A.

[0163] In a specific embodiment, the dsRNA includes a sense strand comprising or consisting of a sense sequence selected from the sense sequences provided in Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20, and an antisense strand comprising or consisting of an antisense sequence selected from the antisense sequences provided in Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20.

[0164] In some embodiments, the dsRNA comprises at least sense and antisense nucleotide sequences, wherein the sense strand is selected from sequences provided in Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20, and the corresponding antisense strand is selected from sequences provided in Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20.

[0165] In these embodiments, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the mRNA sequence produced by SCN9A expression. As such, the dsRNA comprises two oligonucleotides, one of which is described as a sense strand and the second oligonucleotide as a corresponding antisense strand. As described elsewhere in this specification and known in the art, the complementary sequences of the dsRNA can also be included as a self-complementary region of a single nucleic acid molecule, relative on separate oligonucleotides.

[0166] Those skilled in the art are well aware that dsRNAs with double-stranded structures between 20 and 23 base pairs, specifically 21 base pairs, have been found to be particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA double-stranded structures can be equally effective.

[0167] In the above embodiments, due to the nature of the oligonucleotide sequences provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 and 20, the dsRNA described herein may comprise at least one strand with a minimum length of 19 nucleotides. It can be reasonably predicted that shorter duplexes having one of the sequences of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 and 20 with only a small number of nucleotides subtracted from one or both ends will be similarly effective compared to the above dsRNA.

[0168] In some embodiments, the dsRNA has a subsequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides derived from one of the sequences of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20.

[0169] In some embodiments, the dsRNA has an antisense sequence comprising at least 15, 16, 17, 18 or 19 consecutive nucleotides of the antisense sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20, and a sense sequence comprising at least 15, 16, 17, 18 or 19 consecutive nucleotides of the corresponding sense sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20.

[0170] In some embodiments, the dsRNA comprises an antisense sequence comprising at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides of the antisense sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20, and a sense sequence comprising at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the corresponding sense sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20.

[0171] In some of such embodiments, the dsRNA comprises only a portion of the sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20, but is equally effective in inhibiting the level of SCN9A expression as a dsRNA comprising the full-length sequence provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18 or 20. In some embodiments, the dsRNA differs in its inhibition of the level of SCN9A expression by no more than 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50% inhibition compared to a dsRNA comprising the full sequence disclosed herein.

[0172] In some embodiments, the iRNAs listed in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20 reduce SCN9A protein or SCN9A mRNA levels in cells. In some embodiments, the cells are rodent cells (e.g., rat cells) or primate cells (e.g., cynomolgus monkey cells or human cells). In some embodiments, SCN9A protein or VEGF-F mRNA levels are reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the iRNAs Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, or 20 that inhibit SCN9A in human cells have a mismatch of 5, 4, 3, 2, or less than 1 with respect to the corresponding portion of human SCN9A. In some embodiments, the iRNAs Table 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20 that inhibit SCN9A in human cells do not have a mismatch with respect to the corresponding portion of human SCN9A.

[0173] iRNAs designed based on human sequences may be useful, for example, for inhibiting SCN9A in human cells for therapeutic purposes, or for example, for inhibiting SCN9A in rodent cells for characterizing SCN9A in rodent models.

[0174] In some embodiments, the iRNA described herein includes an antisense strand comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a portion of the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the iRNA described herein includes a sense strand comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches in a corresponding portion of the nucleotide sequence of SEQ ID NO: 1.

[0175] Human SCN9A mRNA may have the sequence of Sequence ID No. 1 provided herein. Human (Homo sapiens) sodium channel voltage-gated type IX alpha subunit (SCN9A), transcript variant 1, mRNA The inverse complement of Sequence ID No. 1 is provided herein as Sequence ID No. 2: Human SCN9A mRNA may have the sequence of Sequence ID No. 4001 provided herein. Human (Homo sapiens) sodium channel voltage-gated type IX alpha subunit (SCN9A), transcript variant 2, mRNA The reverse complement of Sequence ID No. 4001 is provided herein as Sequence ID No. 4002:

[0176] In some embodiments, the iRNA described herein comprises at least 15 consecutive nucleotides derived from one of the sequences provided in Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20, and may be coupled to an additional nucleotide sequence taken from a region adjacent to a selected sequence in SCN9A.

[0177] Target sequences are generally 15–30 nucleotides long, but there is a wide variation in the suitability of specific sequences within this range to direct the cleavage of any given target RNA. While the various software packages and guidelines described herein provide guidance for identifying the optimal target sequence for any given gene target, an empirical approach can also be taken in which a “window” or “mask” of a given size (21 nucleotides, for example) is placed literally or figuratively (including, e.g., in silico) on the target RNA sequence to identify sequences within a size range that can act as target sequences. By progressively shifting the sequence “window” one nucleotide upstream or downstream of the initial target sequence position, subsequent potential target sequences can be identified until a complete set of possible sequences for any given target size of selection is identified. This process, coupled with systematic synthesis and testing of identified sequences (using assays described herein or known in the art) to identify the sequences that best perform, can identify the RNA sequences that mediate the best inhibition of target gene expression when targeted with iRNA agents. Therefore, further optimization of inhibition efficiency is intended to be achieved by progressively "window walking" one nucleotide upstream or downstream of a given sequence, thereby identifying sequences with equivalent or better inhibitory characteristics.

[0178] Furthermore, for any sequence identified in Tables 2A, 4A, 5A, 6A, 13A, 14A, 15A, 16, 18, and 20, further optimization can be achieved by systematically adding or removing nucleotides to generate longer or shorter sequences, and by testing the sequences generated by walking the target RNA up or down a longer or shorter window from those sequences. Combining this approach to generating novel candidate targets with testing the efficacy of iRNAs based on those target sequences in inhibitory assays known in the art or described herein may lead to further improvements in inhibition efficiency. Furthermore, such optimized sequences can be modified, for example, by introducing modified nucleotides as described herein or known in the art, by adding or altering overhangs, or by other modifications known in the art and / or discussed herein to further optimize the molecule as an expression inhibitor (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting specific sites or cell types, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.).

[0179] In some embodiments, the Disclosure provides unmodified or unconjugated iRNAs, for example, Tables 2B, 4B, 5B, 6B, 13B, 14B, and 15B. In some embodiments, the RNAi agents of the Disclosure have nucleotide sequences such as those provided in any of Tables 2A, 4A, 5A, 6A, 13A, 14A, 15A, 16, 18, or 20, but lack one or more ligands or moieties shown in the tables. Ligands or moieties (e.g., lipophilic ligands or moieties) can be included in any of the positions provided herein.

[0180] iRNAs as described herein may contain one or more mismatches to the target sequence. In some embodiments, iRNAs as described herein contain three or fewer mismatches. In some embodiments, if the antisense strand of the iRNA contains a mismatch to the target sequence, the mismatched region is not located in the center of the complementary region. In some embodiments, if the antisense strand of the iRNA contains a mismatch to the target sequence, for a 23-nucleotide iRNA agent RNA strand complementary to the SCN9A region, the mismatch is restricted to, for example, within the last 5 nucleotides from the 5' or 3' end of the complementary region, and the RNA strand generally does not contain any mismatch within the central 13 nucleotides. Methods described herein or known in the art can be used to determine whether an iRNA containing a mismatch to the target sequence is effective in inhibiting SCN9A expression. Consideration of the effectiveness of iRNAs with mismatches in inhibiting SCN9A expression is important, especially when certain complementary regions in the SCN9A gene are known to have polymorphic sequence variations within the population.

[0181] In some embodiments, at least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. In some embodiments, the dsRNA having at least one nucleotide overhang has excellent inhibitory properties against its blunt-end counterpart. In some embodiments, the RNA of the iRNA (e.g., dsRNA) is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in this disclosure may be synthesized and / or modified by methods well established in the art, e.g., those described in "Current protocols in nucleic acid chemistry," Beaucage, SL et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, (a) terminal modifications, such as 5'-terminal modifications (phosphorylation, conjugation, reverse linking, etc.) and 3'-terminal modifications (conjugation, DNA nucleotides, reverse linking, etc.); (b) base modifications, such as replacement of stabilizing bases, destabilizing bases, or bases that form base pairs with partners in an expanded repertoire, base removal (debasing nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' or 4' position, or having acyclic sugars) or sugar replacements, as well as skeletal modifications including modification or replacement of phosphodiester bonds. Specific examples of RNA compounds useful in this disclosure include, but are not limited to, RNAs containing a modified skeleton or lacking natural internucleoside linkages. Among RNAs having a modified skeleton, those lacking a phosphorus atom in the skeleton are particularly noteworthy. For the purposes of this specification, sometimes, as referred to in the art, modified RNAs lacking a phosphorus atom in their internucleoside skeleton can also be considered oligonucleosides. In certain embodiments, the modified RNA has a phosphorus atom in its internucleoside skeleton.

[0182] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methylphosphonates, and other alkylphosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates having the usual 3'-5' linkage, their analogues with 2'-5' linkages, and those with reverse polarity where adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0183] Representative U.S. patents teaching the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patents 3,687,808, 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5, 286,717;5,321,131;5,399,676;5,405,939;5,453,496;5,455,233;5,466,677;5,476,925;5,519,126;5,536,821;5,541,316;5,550,111;5,563,253;5,571,799;5 ,587,361;5,625,050;6,028,188;6,124,445;6,160,109;6,169,170;6,172,209;6,239,265;6,277,603;6,326,199;6,346,614;6,444,423;6,531,590;6,534,639; Examples include 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Reissue Patent No. RE39464, each of which is incorporated herein by reference.

[0184] Modified RNA skeletons that do not contain phosphorus atoms have skeletons formed by short alkyl or cycloalkyl nucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl nucleoside linkages, or one or more short heteroatoms or heterocyclic nucleoside linkages. These include morpholino linkages (some formed from the sugar moiety of nucleosides), siloxane skeletons, sulfide, sulfoxide and sulfone skeletons, formacetyl and thioformacetyl skeletons, methyleneformacetyl and thioformacetyl skeletons, alkene-containing skeletons, sulfamate skeletons, methyleneimino and methylenehydrazino skeletons, sulfonate and sulfonamide skeletons, amide skeletons, and others having mixed N, O, S and CH2 component moieties.

[0185] Representative U.S. patents teaching the preparation of the above-mentioned oligonucleotides include, but are not limited to, U.S. Patents 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,64,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, and 5,470,967. Nos. 5,489,677, 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439 are examples of the aforementioned publications, each incorporated herein by reference.

[0186] In other RNA mimetics suitable for or intended for use in iRNA, both the sugar and nucleoside linkages, i.e., the backbone, of the nucleotide unit are replaced with novel groups. The base unit is maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimetic known to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleic acid bases are retained and directly or indirectly bonded to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds, but not limited to, include U.S. Patents 5,539,082, 5,714,331, and 5,719,262, each of which is incorporated herein by reference. Further teachings on PNA compounds can be found, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0187] Some embodiments featured in this disclosure include RNAs and heteroatom skeletons having a phosphorothioate backbone, in particular the --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2--[known as the methylene(methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2-- and oligonucleosides having an amide backbone as referenced in U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have a morpholino backbone structure as referenced in U.S. Patent No. 5,034,506. The natural phosphodiester backbone can be represented as OP(O)(OH)-OCH2-.

[0188] Modified RNA may also contain one or more substituted sugar moieties. iRNAs, e.g., dsRNAs, characterized herein may comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl, or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl are substituted or unsubstituted C1 to C 10 alkyl or C2 to C 10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, wherein n and m are from 1 to about 10. In other embodiments, the dsRNA comprises at the 2' position any of the following: C1 to C 10The modifications include lower alkyl groups, substituted lower alkyl groups, alkali groups, aralkyl groups, O-alkaryl or O-aralkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl groups, heterocycloalkaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleavage groups, reporter groups, interfering substances, groups for improving the pharmacokinetic properties of iRNA or groups for improving the pharmacokinetic properties of iRNA, and one of other substituents having similar properties. In some embodiments, the modifications include 2'-methoxyethoxy (2'-O-(2-methoxyethyl) or 2'-MOE, also known as 2'-O--CH2CH2OCH3) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy groups. Other exemplary modifications include the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH3)2.

[0189] In other embodiments, the iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) acyclic nucleotides (or nucleosides). In certain embodiments, the sense strand or antisense strand, or both the sense and antisense strands, contain fewer than 5 acyclic nucleotides per strand (e.g., 4, 3, 2 or 1 acyclic nucleotide per strand). One or more acyclic nucleotides can be found, for example, in the sense or antisense strand of the iRNA agent, or in the double-stranded region of both strands, or in both the 5' end, 3' end, or 5' and 3' ends of both strands. In some embodiments, one or more acyclic nucleotides are located at positions 1–8 on the sense or antisense strand, or on both. In some embodiments, one or more acyclic nucleotides are found in the antisense strand from the 5' end to positions 4–10 (e.g., positions 6–8). In some embodiments, one or more acyclic nucleotides are found in the 3' end overhangs of one or both of the iRNA agents.

[0190] As used herein, the term "acyclic nucleotide" or "acyclic nucleoside" refers to any nucleotide or nucleoside having an acyclic sugar, for example, acyclic ribose. Exemplary acyclic nucleotides or nucleosides include nucleobases, for example, naturally occurring or modified nucleobases (for example, nucleobases as described herein). In certain embodiments, a bond between any of the ribose carbons (C1, C2, C3, C4 or C5) is absent from the nucleotide, either independently or in combination. In some embodiments, the bond between the C2-C3 carbons of the ribose ring is absent, for example, an acyclic 2'-3'-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4 or C4-C5 is absent (for example, a 1'-2', 3'-4' or 4'-5'-seco nucleotide monomer). Exemplary acyclic nucleotides are disclosed in US 8,314,227, which is incorporated herein by reference in its entirety. For example, an acyclic nucleotide can comprise any of monomers D through J in Figures 1 through 2 of US 8,314,227. In some embodiments, the acyclic nucleotide comprises the following monomers:

[0191] [Chemical Formula] [wherein Base is a nucleobase, for example, a naturally occurring or modified nucleobase (for example, a nucleobase as described herein)] .

[0192] In certain embodiments, an acyclic nucleotide can be modified or derivatized, for example, by coupling the acyclic nucleotide to another moiety, for example, inter alia, a ligand (for example, GalNAc, a cholesterol ligand), an alkyl group, a polyamine, a sugar, or a polypeptide.

[0193] In other embodiments, the iRNA agent comprises one or more acyclic nucleotides and one or more LNAs (e.g., LNAs as described herein). For example, one or more acyclic nucleotides and / or one or more LNAs may be present in the sense strand, the antisense strand, or both. The number of acyclic nucleotides in one strand may be the same as or different from the number of LNAs in the opposite strand. In certain embodiments, the sense strand and / or antisense strand comprises fewer than five LNAs (e.g., four, three, two, or one LNA) located in the double-stranded region or the 3' overhang. In other embodiments, one or two LNAs are located in the double-stranded region or the 3' overhang of the sense strand. Alternatively, or in combination, the sense strand and / or antisense strand comprises fewer than five acyclic nucleotides (e.g., four, three, two, or one acyclic nucleotide) in the double-stranded region or the 3' overhang. In some embodiments, the sense strand of the iRNA agent contains one or two LNAs in the 3' overhang of the sense strand, and one or two acyclic nucleotides in the double-stranded region of the antisense strand of the iRNA agent (e.g., positions 4-10 (e.g., positions 6-8) from the 5' end of the antisense strand).

[0194] In other embodiments, the inclusion of one or more acyclic nucleotides (alone or in addition to one or more LNAs) in an iRNA agent results in one or more (or all of) of the following: (i) reduced off-target effects, (ii) reduced passenger strand involvement in RNAi, (iii) increased guide strand specificity to its target mRNA, (iv) reduced microRNA off-target effects, (v) increased stability, or (vi) increased resistance to degradation of the iRNA molecule.

[0195] Other modifications include 2'-methoxy (2'-OCH3), 2'-5-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications can also occur at other positions on the iRNA RNA, particularly on the 3' terminal nucleotide or at the 3' and 5' positions of the sugar in 2'-5' ligated dsRNA. iRNA may also have sugar mimetic moieties, such as a cyclobutyl moiety instead of a pentofuranosyl sugar. Representative U.S. patents teaching the preparation of such modified sugar structures include, but are not limited to, U.S. Patents 4,981,957, 5,118,800, 5,319,080, 5,359,044, 5,393,878, 5,446,137, 5,466,786, 5,514,785, 5,519,134, 5,567,811, and 5,576. Examples include Nos. 427, 5,591,722, 5,597,909, 5,610,300, 5,627,053, 5,639,873, 5,646,265, 5,658,873, 5,670,633 and 5,700,920, some of which are owned in common with this application, and each of these is incorporated herein by reference.

[0196] iRNA may also include modifications or substitutions of nucleic acid bases (often simply referred to as "bases" in the art). As used herein, “unmodified” or “natural” nucleic acid bases include the purine bases adenine (A) and guanine (G), the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid bases include other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, and 5-uracil. This includes (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and (anal) other 8-substituted adenines and guanines, 5-halo, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine (daazaadenine), as well as 3-deazaguanine and 3-deazaadenine.

[0197] Further modified nucleic acid bases include those disclosed in U.S. Patent No. 3,687,808, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008, The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Certain modified nucleic acid bases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in this disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitution has been shown to increase nucleic acid double-strand stability by 0.6–1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276–278), and is more specifically an exemplary base substitution when combined with 2'-O-methoxyethyl sugar modification.

[0198] Representative U.S. patents teaching the preparation of the above-mentioned modified nucleic acid bases and certain other modified nucleic acid bases, but not limited to, U.S. Patent Nos. 3,687,808, 4,845,205, 5,130,302, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, and 5, respectively, are incorporated herein by reference. U.S. Patent Nos. 587,469, 5,594,121, 5,596,091, 5,614,617, 5,681,941, 6,015,886, 6,147,200, 6,166,197, 6,222,025, 6,235,887, 6,380,368, 6,528,640, 6,639,062, 6,617,438, 7,045,610, 7,427,672, and 7,495,088, as well as U.S. Patent No. 5,750,692, which is similarly incorporated herein by reference.

[0199] The RNA of iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by bridging two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of a sugar ring, thereby forming a bicyclic ring structure. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring. Thus, in some embodiments, the agents of this disclosure may include one or more locked nucleic acids (LNAs) (also referred to herein as “locked nucleotides”). In some embodiments, the locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety includes an additional bridge connecting, for example, the 2' and 4' carbons. This structure efficiently “locks” the ribose into a 3'-end conformation. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects [Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447, Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843, Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193].

[0200] Examples of bicyclic nucleosides for use in the polynucleotides of this disclosure include, but are not limited to, nucleosides containing a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, one or more bicyclic nucleosides containing a 4'-to-2' bridge are used as antisense polynucleotide agents of this disclosure. Examples of such 4'-to-2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2'(LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2'(ENA), 4'-CH(CH3)-O-2' (also known as “restricted ethyl” or “cEt”) and 4'-CH(CH2OCH3)-O-2' (and its analogues, see, e.g., U.S. Patent No. 7,399,845), 4'-C(CH3)(CH3)-O-2' (and its analogues, see, e.g., U.S. Patent No. 8, See Patent Nos. 278,283), 4'-CH2-N(OCH3)-2' (and its analogues, e.g., see U.S. Patent No. 8,278,425), 4'-CH2-ON(CH3)-2' (e.g., see U.S. Patent Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2' (wherein R is H, C1-C12 alkyl or protecting group) (e.g., see U.S. Patent No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (e.g., Chattopadhyaya Examples include (see et al., J. Org. Chem., 2009, 74, 118-134) and 4'-CH2-C(-CH2)-2' (and its analogues, see, for example, U.S. Patent No. 8,278,426). The content of each of the foregoing is incorporated herein by reference for the methods provided herein. Representative U.S. patents teaching the preparation of locked nucleic acids include, but are not limited to, U.S. Patents No. 6,268,490, 6,670,461, 6,794,499, 6,998,484, 7,053,207, 7,084,125, 7,399,845 and 8,314,227, each of which is incorporated herein by reference in whole.Examples of LNAs, though not limited to them, include 2',4'-C methylene bicyclonucleotides (e.g., Wengel et al., International PCT 5 publication numbers WO00 / 66604 and WO99 / 14226).

[0201] For example, any of the aforementioned bicyclic nucleosides having one or more stereochemical sugar configurations, including α-L-ribofuranose and β-D-ribofuranose, can be prepared (see WO99 / 14226).

[0202] The RNAi agents of this disclosure can also be modified to include one or more restricted ethyl nucleotides. As used herein, “restricted ethyl nucleotide” or “cEt” is a locked nucleic acid containing a bicyclic sugar moiety including a 4'-CH(CH3)-0~2' bridge. In some embodiments, the restricted ethyl nucleotide is in the S conformation and is referred to herein as “S-cEt”.

[0203] The RNAi agents of this disclosure may also comprise one or more “conformation-restricted nucleotides” (“CRNs”). CRNs are nucleotide analogs having a linker connecting the C2' and C4' carbons of ribose, or the C3 and C5' carbons of ribose. CRNs lock the ribose ring into a stable conformation and increase hybridization affinity to mRNA. The linker is long enough to position the oxygen optimally for stability and affinity, resulting in less ribose ring puckering.

[0204] Representative publications that teach the preparation of certain CRNs as described above include, but are not limited to, US2013 / 0190383 and WO2013 / 036868, the contents of which are incorporated herein by reference for the methods provided herein.

[0205] In some embodiments, the RNAi agents of this disclosure comprise one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA are unlocked acyclic nucleic acids in which any sugar bond has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompass monomers in which the bond between C1'-C4' (i.e., the carbon-oxygen-carbon bond of the covalent bond between the C1' and C4' carbons) has been removed. In another example, the C2'-C3' bond of the sugar (i.e., the carbon-carbon bond of the covalent bond between the C2' and C3' carbons) has been removed [see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039].

[0206] Representative U.S. publications teaching the preparation of UNAs include, but are not limited to, U.S. 8,314,227 and U.S. Patent Publications 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the contents of which are incorporated herein by reference for the methods provided herein.

[0207] In other embodiments, the iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) G-clamp nucleotides. G-clamp nucleotides are modified cytosine analogs in which the modification confers the ability to hydrogen bond to both the Watson-Crick and Hoogsteen faces of complementary guanine within the double helix; see, e.g., Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helix thermal stability and mismatch recognition when hybridized with a complementary oligonucleotide. Including such nucleotides in an iRNA molecule can result in enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands.

[0208] Potentially stabilizing modifications to the ends of RNA molecules include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyluridine-3”-phosphate, reverse base dT (idT), and others. The disclosure of these modifications can be found in PCT publication number WO2011 / 005861.

[0209] Other modifications of the RNAi agents of this disclosure include 5' phosphates or 5' phosphate mimics, for example, a 5' terminal phosphate or phosphate mimic on the antisense strand of the RNAi agent. Suitable phosphate mimics are disclosed, for example, for the methods provided herein in US2012 / 0157511, the contents of which are incorporated herein by reference.

[0210] iRNA motif In certain embodiments of this disclosure, the double-stranded RNAi agents of this disclosure include agents having chemical modifications such as those disclosed for methods provided herein in WO2013 / 075035, the contents of which are incorporated herein by reference. Excellent results can be obtained by introducing one or more motifs of three identical modifications on a triple nucleotide into the sense or antisense strand of the RNAi agent at or near the cleavage site, as shown herein and in WO2013 / 075035. In some embodiments, the sense and antisense strands of the RNAi agent may otherwise be fully modified. The introduction of these motifs disrupts the modification pattern of the sense or antisense strand, if present. The RNAi agent may be conjugated with a lipophilic moiety or ligand, for example, a C16 moiety or ligand on the sense strand. The RNAi agent may be modified, for example, with (S)-glycol nucleic acid (GNA) modification at one or more residues on the antisense strand. The resulting RNAi agents exhibit excellent gene silencing activity.

[0211] In some embodiments, the sense strand sequence is given by formula (I): 5'n p -N a -(XXX) i -N b -YYY -N b -(ZZZ) j -N a -n q 3' (I) [In the formula, i and j are independently either 0 or 1. p and q are each independently between 0 and 6. each N a Each independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two differently modified nucleotides. each N b Each independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides. each n p and n qThese independently represent overhang nucleotides, Nb and Y do not have the same modifications, and XXX, YYY, and ZZZ each independently represent one motif of three identical modifications on a sequence of three nucleotides. This can be represented by [formula]. In some embodiments, YYY are all 2'-F modified nucleotides.

[0212] In some embodiments, N a and / or N b This includes alternating modification patterns.

[0213] In some embodiments, the YYY motif occurs at or near the sense strand cleavage site. For example, if the RNAi agent has a double-stranded region of 17–23 nucleotides in length, the YYY motif may occur at or near the sense strand cleavage site (e.g., at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13), the number may start from the first nucleotide from the 5' end, or, as appropriate, the number may start from the first pair-formed nucleotide in the double-stranded region from the 5' end.

[0214] In some embodiments, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Therefore, the sense chain is given by the following formula: 5' n p -N a -YYY-N b -ZZZ-N a -n q 3' (Ib), 5' n p -N a -XXX-N b -YYY-N a -n q 3' (Ic), or 5' n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q3' (Id) It can be represented by [this].

[0215] If the sense chain is represented by formula (Ib), then N b This represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-5, 0-4, 0-2, or 0.

[0216] each N a These can independently represent oligonucleotide sequences containing 2-20, 2-15, or 2-10 modified nucleotides.

[0217] If the sense chain is expressed as equation (Ic), then N b This represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-5, 0-4, 0-2, or 0. a These may also independently represent oligonucleotide sequences containing 2–20, 2–15, or 2–10 modified nucleotides.

[0218] When the sense chain is expressed as formula (Id), each N b Independently, represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-5, 0-4, 0-2, or 0. In some embodiments, N b is 0, 1, 2, 3, 4, 5, or 6. a These can also independently represent oligonucleotide sequences containing 2-20, 2-15, or 2-10 modified nucleotides.

[0219] Each of X, Y, and Z may be the same as or different from the others.

[0220] In other embodiments, i is 0, j is 0, and the sense chain is given by: 5' n p -N a -YYY-N a -n q 3' (Ia) It can be represented by [this].

[0221] If the sense chain is represented by equation (Ia), then each N a These may independently contain oligonucleotide sequences comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0222] In some embodiments, the antisense strand sequence of RNAi is given by formula (II): 5' n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p ' 3' (II) [In the formula, k and l are independently either 0 or 1. p' and q' are each independently between 0 and 6. each N a ' independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two differently modified nucleotides. each N b 'Independently, this represents an oligonucleotide sequence containing 0 to 10 modified nucleotides, each n p 'and n q ' independently represents an overhang nucleotide, N b 'and Y' do not have the same modifier, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one of three identical modifications on a sequence of three nucleotides. It can be represented by [this].

[0223] In some embodiments, N a 'and / or N b ' includes alternating modification patterns.

[0224] The Y'Y'Y' motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a double-stranded region of 17 to 23 nucleotides in length, the Y'Y'Y' motif may occur at positions 9, 10, 11; positions 10, 11, 12; positions 11, 12, 13; positions 12, 13, 14; or positions 13, 14, 15 of the antisense strand, where counting starts from the first nucleotide at the 5' end, or alternatively, counting may optionally start from the first base-paired nucleotide in the double-stranded region at the 5' end. In some embodiments, the Y'Y'Y' motif occurs at positions 11, 12, 13.

[0225] In some embodiments, all nucleotides of the Y'Y'Y' motif are 2'-OMe modified nucleotides.

[0226] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0227] Accordingly, the antisense strand is represented by the following formula: 5' n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3' (IIb), 5' n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3' (IIc), or 5' n q’ -N a '- Z'Z'Z'-N b '-Y'Y'Y'-N b '- X'X'X'-N a '-n p’ 3' (IId) can be represented by

[0228] When the antisense strand is represented by formula (IIb), N b ’represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2 or 0 modified nucleotides. Each N a ' each independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15 or 2 to 10 modified nucleotides.

[0229] When the antisense strand is represented by formula (IId), each N b ' each independently represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2 or 0 modified nucleotides. Each N a ' each independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15 or 2 to 10 modified nucleotides. In some embodiments, N b is 0, 1, 2, 3, 4, 5 or 6.

[0230] In other embodiments, k is 0 and l is 0, and the antisense strand is of the following formula: 5' n p’ -N a’ -Y'Y'Y'- N a’ -n q’ 3' (Ia) can be represented by.

[0231] When the antisense strand is represented by formula (IIa), each N a ' each independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15 or 2 to 10 modified nucleotides.

[0232] Each of X', Y' and Z' may be the same as or different from each other.

[0233] Each nucleotide in the sense and antisense strands can be independently modified with LNA, HNA, CeNA, GNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide in the sense and antisense strands can be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' may, in particular, represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0234] In some embodiments, the sense strand of the RNAi agent may contain a YYY motif occurring at positions 9, 10, and 11 of the strand when the double-stranded region is 21nt, the number starting from the first nucleotide from the 5' end, or optionally starting from the first pair-formed nucleotide in the double-stranded region from the 5' end, where Y represents a 2'-F modification. The sense strand may further contain an XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region, where XXX and ZZZ independently represent a 2'-OMe modification or a 2'-F modification.

[0235] In some embodiments, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, and 13 of the strand, the number starting from the first nucleotide from the 5' end, or optionally starting from the first pair-formed nucleotide in the double-stranded region from the 5' end, where Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region, where X'X'X' and Z'Z'Z' independently represent a 2'-OMe modification or a 2'-F modification.

[0236] A sense strand represented by any one of the above equations (Ia), (Ib), (Ic), and (Id) forms a double helix with an antisense strand represented by any one of the above equations (IIa), (IIb), (IIc), and (IId).

[0237] Therefore, certain RNAi agents for use in the methods of this disclosure may include a sense strand and an antisense strand, each having 14 to 30 nucleotides, and the RNAi double helix is ​​represented by formula (III): Sense: 5' n p -N a -(XXX) i -N b - YYY -N b -(ZZZ) j -N a -n q 3' Antisense: 3' n p ’ -N a ’ -(X'X'X') k -N b ’ -Y'Y'Y'-N b ’ -(Z'Z'Z') l -N a ’ -n q ’ 5' (III) [In the formula, i, j, k, and l are each independently either 0 or 1. p, p', q, and q' are each independently between 0 and 6. each N a and N a ’ Each independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two differently modified nucleotides. each N b and N b ’ Each independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides. each n p ',n p , n q 'and n q Each of these may or may not be present, but they independently represent an overhang nucleotide. XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a single motif of three identical modifications on three consecutive nucleotides. It is represented by [this].

[0238] In some embodiments, i is 0 and j is 0, or i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 0, or both i and j are 1. In some embodiments, k is 0 and l is 0, or k is 1 and l is 0, k is 0 and l is 1, or both k and l are 0, or both k and l are 1.

[0239] An exemplary combination of sense and antisense strands that form an RNAi double helix is ​​given by the following formula: 5' n p - N a -YYY -N a -n q 3' 3' n p ’ -N a ’ -Y'Y'Y' -N a ’ n q ’ 5' (IIIa) 5' n p -N a -YYY -N b -ZZZ -N a -n q 3' 3' n p ’ -N a ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ n q ’ 5' (IIIb) 5' n p -N a - XXX -Nb -YYY - N a -n q 3' 3' n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N a ’ -n q ’ 5' (IIIc) 5' n p -N a -XXX -N b -YYY -N b - ZZZ -N a -n q 3' 3' n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ -n q ’ 5' (IIId) Includes.

[0240] When an RNAi agent is represented by formula (IIIa), each N a Each of these independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

[0241] When an RNAi agent is represented by formula (IIIb), each N b Each N independently represents an oligonucleotide sequence containing modified nucleotides 1-10, 1-7, 1-5, or 1-4. a Each of these independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

[0242] When an RNAi agent is represented by formula (IIIc), each N b , N b ' independently represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a Each of these independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

[0243] When an RNAi agent is represented by formula (IIId), each N b , N b ' independently represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a , N a ’ N independently represents oligonucleotide sequences containing 2-20, 2-15, or 2-10 modified nucleotides. a , N a ', N b and N b ’ Each of these independently includes alternating modification patterns.

[0244] In equations (III), (IIIa), (IIIb), (IIIc), and (IIId), X, Y, and Z may be identical or different from each other.

[0245] If the RNAi agent is represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), then at least one Y nucleotide can base pair with one of the Y' nucleotides. Alternatively, at least two Y nucleotides can base pair with the corresponding Y' nucleotides, or all three Y nucleotides can base pair with the corresponding Y' nucleotides.

[0246] If the RNAi agent is represented by formula (IIIb) or (IIId), then at least one Z nucleotide can form a base pair with one of the Z' nucleotides. Alternatively, at least two Z nucleotides can form base pairs with the corresponding Z' nucleotides, or all three Z nucleotides can form base pairs with the corresponding Z' nucleotides.

[0247] If the RNAi agent is represented by formula (IIIc) or (IIId), then at least one of the X nucleotides can form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides can form base pairs with the corresponding X' nucleotides, or all three of the X nucleotides can form base pairs with the corresponding X' nucleotides.

[0248] In some embodiments, modifications on the Y nucleotide differ from modifications on the Y' nucleotide, modifications on the Z nucleotide differ from modifications on the Z' nucleotide, and / or modifications on the X nucleotide differ from modifications on the X' nucleotide.

[0249] In some embodiments, when the RNAi agent is represented by formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0, and at least one np' is linked to an adjacent nucleotide by phosphorothioate linkage. The sense strand is conjugated to one or more moieties or ligands (e.g., one or more lipophilic moieties, optionally one or more C16 moieties or one or more GalNAc moieties) attached via a divalent or trivalent branched linker. In some embodiments, when the RNAi agent is represented by formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0, at least one np' is linked to an adjacent nucleotide by a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more moieties or ligands (e.g., one or more lipophilic moieties, optionally one or more C16 moieties or one or more GalNAc moieties) attached via a divalent or trivalent branched linker.

[0250] In some embodiments, when the RNAi agent is represented by formula (IIIa), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0, at least one np' is linked to an adjacent nucleotide by a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more moieties or ligands (e.g., one or more lipophilic moieties, optionally one or more C16 moieties) attached via a divalent or trivalent branched linker.

[0251] In some embodiments, the RNAi agent is a multimer containing at least two double helixes represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), the double helixes being linked by a linker. The linker may or may not be cleavable. The multimer may further contain ligands. Each double helix may target the same gene, or two different genes, or each double helix may target the same gene at two different target sites.

[0252] In some embodiments, the RNAi agent is a multimer containing 3, 4, 5, 6 or more double helixes represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), where the double helixes are linked by linkers. The linkers may or may not be cleavable. The multimer may further contain ligands. Each double helix may target the same gene, or two different genes, or each double helix may target the same gene at two different target sites.

[0253] In some embodiments, two RNAi agents represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be ligated together at their 5' ends, with one or both of their 3' ends conjugated to a ligand. Each agent may target the same gene, or two different genes, or each agent may target the same gene at two different target sites.

[0254] Various publications describe multimeric RNAi agents that may be used in the methods of this disclosure. Such publications include WO2007 / 091269, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887, and WO2011 / 031520, as well as US7858769, the contents of which are incorporated herein by reference for the methods provided herein. In certain embodiments, the RNAi agent of this disclosure may include a GalNAc ligand.

[0255] As described in more detail below, RNAi agents containing the conjugation of one or more carbohydrate moieties to the RNAi agent can optimize one or more properties of the RNAi agent. Often, the carbohydrate moiety is attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred herein to as a ribose-replaced modified subunit (RRMS). The cyclic carrier may be a carbocyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring structure, i.e., one or more ring atoms are heteroatoms, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring structure, or may contain two or more rings, e.g., a fused ring. The cyclic carrier may be a fully saturated ring structure, or may contain one or more double bonds.

[0256] Ligands can be attached to polynucleotides via a carrier. The carrier comprises (i) at least one “skeleton attachment site” or two “skeleton attachment sites” and (ii) at least one “tethering attachment site.” “Skeleton attachment site” means, as used herein, a functional group, e.g., a hydroxyl group, or generally, a bond available and suitable for the incorporation of the carrier into a skeleton, e.g., a phosphate or modified phosphate of ribonucleic acid, e.g., a sulfur-containing skeleton. “Tethering attachment site” (TAP) means, in some embodiments, a constituent ring atom of the cyclic carrier connecting a selected moiety, e.g., a carbon atom or heteroatom (separate from the atom providing the skeleton attachment sites). The moiety may be, for example, a carbohydrate, e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, and polysaccharides. The selected moiety may be connected to the cyclic carrier by an intervening tether. Thus, the cyclic carrier will often provide a bond suitable for the incorporation or tethering of another chemical entity, e.g., a ligand, into a constituent ring, e.g., containing a functional group, e.g., an amino group.

[0257] RNAi agents may be conjugated to ligands via a carrier, which may be a cyclic or acyclic group. In some embodiments, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridadinyl, tetrahydrofuryl, and decalin. In some embodiments, the acyclic group is selected from a selinol skeleton or a diethanolamine skeleton.

[0258] In certain specific embodiments, the RNAi agent for use in the method of the present disclosure is an agent selected from the group of agents listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20. These agents may further include a ligand. The ligand can be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the ligand can be conjugated to the sense strand, particularly to the 3' end of the sense strand.

[0259] iRNA conjugate The iRNA agents disclosed herein may be in the form of conjugates. The conjugates can be attached to any suitable position in the iRNA molecule, for example, to the 3' or 5' end of the sense or antisense strand. The conjugates may also be attached via linkers.

[0260] In some embodiments, the iRNA agents described herein are chemically linked to one or more ligands, parts, or conjugates, which may confer functionality by, for example, influencing (e.g., enhancing) the activity, cell distribution, or cell uptake of the iRNA. These include, but are not limited to, lipid parts such as cholesterol (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, for example, beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), fatty acid chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118, Kabanov et al., FEBS Lett., 1990, 259:327-330, Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654, Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett.Examples include the palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237) or the octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0261] In some embodiments, ligands alter the distribution, targeting, or lifespan of the iRNA agent into which they are incorporated. In some embodiments, ligands provide enhanced affinity to selected targets, such as molecules, cells or cell types, compartments, such as cellular or organ compartments, tissues, organs, or regions of the body, compared to species in which such ligands are absent. Conventional ligands do not participate in double-strand pairing in double-stranded nucleic acids.

[0262] Ligands can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.

[0263] Ligands may also include targeting groups, such as cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, or antibodies that bind to specific cell types, such as kidney cells. Targeting groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, biotin, or RGD peptides or RGD peptide mimetic compounds.

[0264] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyllin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithoglycerol Examples include oenic acid, O3-(oleoyl)colenic acid, dimethoxytrityl or phenoxazine, and peptide conjugates (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphoric acid, amino acids, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraaza macrocyclic molecules), dinitrophenyl, HRP, or AP.

[0265] Ligands can be proteins, such as glycoproteins or peptides, molecules or antibodies that have a specific affinity for a co-ligand, such as antibodies that bind to specific cell types, such as neurons. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose. Ligands can also be, for example, lipopolysaccharides, p38 MAP kinase activators, or NF-κB activators.

[0266] A ligand can be a substance, such as a drug, that can increase the uptake of an iRNA agent into a cell by disrupting the cytoskeleton of the cell, for example, by disrupting the microtubules, microfibrils and / or intermediate fibrils of the cell. A drug may be, for example, taxone, vincristine, vinblastine, cytochalasin, nocodazole, jasplaquinolide, latruncrine A, phalloidin, swinford A, indanosine, or myoserbine.

[0267] In some embodiments, ligands attached to iRNAs, as described herein, act as pharmacokinetic modulators (PK modulators). PK modulators include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, and vitamins. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, and biotin. Oligonucleotides containing several phosphorothioate linkages are also known to bind to serum proteins; therefore, short oligonucleotides, e.g., oligonucleotides of about 5, 10, 15, or 20 bases containing multiple phosphorothioate linkages in their backbone, are also suitable as ligands (e.g., as PK-modulating ligands) for this disclosure. Furthermore, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in embodiments described herein.

[0268] Oligonucleotides conjugated with the ligands of this disclosure can be synthesized using oligonucleotides having pendant-reactive functionality, for example, those derived from the attachment of linking molecules to the oligonucleotide (as described below). These reactive oligonucleotides can be directly reacted with commercially available ligands, synthetic ligands having any of the various protecting groups, or ligands having a linking portion attached thereto.

[0269] The oligonucleotides used in the conjugates of this disclosure can be conveniently and routinely prepared by known solid-phase synthesis techniques. Equipment for such synthesis is available from several vendors, including, for example, Applied Biosystems® (Foster City, California). Any other means for such synthesis known in the art may be used further or instead. Similar techniques are also known to be used to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.

[0270] In ligand molecules having ligand-conjugated oligonucleotides and sequence-specific linked nucleosides, the oligonucleotides and oligonucleosides can be assembled in a suitable DNA synthesizer using standard nucleotides or nucleoside precursors, nucleotides or nucleoside conjugate precursors already having a linking moiety, ligand-nucleotides or nucleoside conjugate precursors already having a ligand molecule, or non-nucleoside ligands having a building block.

[0271] When using nucleotide-conjugate precursors that already have a linking region, the synthesis of a sequence-specific linked nucleoside is typically completed, and then the ligand molecule reacts with the linking region to form a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of this disclosure are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates, in addition to commercially available and standard and non-standard phosphoramidites routinely used in oligonucleotide synthesis.

[0272] A. Lipophilic part In certain embodiments, the lipophilic moiety is an aliphatic compound such as an alicyclic compound, a cyclic compound, or a polycyclic compound such as a polyalicyclic compound, e.g., a steroid (e.g., a sterol) or a linear or branched aliphatic hydrocarbon. The lipophilic moiety may generally include a hydrocarbon chain that may be cyclic or acyclic. The hydrocarbon chain may include various substituents or one or more heteroatoms, e.g., oxygen or nitrogen atoms. Such lipophilic aliphatic moieties may include, but are not limited to, saturated or unsaturated C4-C4 compounds. 30 Hydrocarbons (for example, C6~C) 18 Hydrocarbons), saturated or unsaturated fatty acids, waxes (e.g., monohydric alcohol esters of fatty acids and fatty diamides), terpenes (e.g., C 10 Terpenes, C 15 Sesquiterpenes, C 20 Diterpenes, C 30 Triterpenes and C 40 It contains tetraterpenes and other polyalicyclic hydrocarbons. For example, the lipophilic portion is C4-C 30 Hydrocarbon chains (for example, C4~C 30 It may contain alkyl or alkenyl compounds. In some embodiments, the lipophilic portion is saturated or unsaturated C6-C6. 18 Hydrocarbon chains (for example, straight chain C6~C) 18 It contains alkyl or alkenyl compounds. In some embodiments, the lipophilic portion contains saturated or unsaturated C16 hydrocarbon chains (e.g., linear C16 alkyl or alkenyl compounds).

[0273] The lipophilic moiety can be attached to the RNAi agent by any method known in the art via a functional group already present in the lipophilic moiety or introduced into the RNAi agent, such as a hydroxyl group (e.g., -CO-CH2-OH). Examples of functional groups already present in the lipophilic moiety or introduced into the RNAi agent include, but are not limited to, hydroxyls, amines, carboxylic acids, sulfonates, phosphates, thiols, azides, and alkynes.

[0274] Conjugation of the RNAi agent and the lipophilic moiety may occur, for example, by the formation of an ether or carboxyl or carbamoyl ester bond between hydroxyl and an alkyl group R-, an alkanoyl group RCO-, or a substituted carbamoyl group RNHCO-. The alkyl group R may be cyclic (e.g., cyclohexyl) or acyclic (e.g., linear or branched and saturated or unsaturated). The alkyl group R may be butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, or octadecyl groups.

[0275] In some embodiments, the lipophilic moiety is conjugated to a double-stranded RNAi agent via a linker which is a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, click reaction product (e.g., triazole derived from azido-alkyne cyclization), or carbamate.

[0276] In other embodiments, the lipophilic portion is a steroid, such as a sterol. The steroid is a polycyclic compound containing a perhydro-1,2-cyclopentanophenanthrene ring structure. Steroids include, but are not limited to, bile acids (e.g., cholic acid, deoxycholic acid, and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone. "Cholesterol derivatives" refers to compounds derived from cholesterol, for example, by substitution, addition or removal of substituents.

[0277] In other embodiments, the lipophilic portion is the aromatic portion. In this context, the term “aromatic” broadly refers to monocyclic and polycyclic aromatic hydrocarbons. The aromatic group is a C6-C6 group containing 1-3 aromatic rings, which may be substituted as appropriate, but is not limited to the aromatic group. 14Examples include "aralkyl" or "arylalkyl" groups, and "heteroaryl" groups, which include an aryl group covalently bonded to an alkyl group, each of which may be independently substituted or unsubstituted as appropriate; and aryl moieties, which may be independently substituted or unsubstituted as appropriate. As used herein, the term "heteroaryl" refers to a group having 5 to 14 ring atoms, for example, 5, 6, 9, or 10 ring atoms; having 6, 10, or 14 π electrons shared in a cyclic array; and having 1 to about 3 heteroatoms selected from the group consisting of nitrogen (N), oxygen (O), and sulfur (S) in addition to carbon atoms.

[0278] As used herein, “substituted” alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic groups have 1 to about 4, 1 to about 3, or 1 or 2 nonhydrogen substituents. Suitable substituents, though not limited to, include halo, hydroxy, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, acylamino, alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl, alkanesulfonyl, allensulfonyl, alkanesulfonamide, allensulfonamide, aralkylsulfonamide, alkylcarbonyl, acyloxy, cyano, and ureido groups.

[0279] In some embodiments, the lipophilic moiety is an aralkyl group, for example, a 2-arylpropanoyl moiety. The structural features of the aralkyl group are selected so that the lipophilic moiety binds to at least one protein in vivo. In certain embodiments, the structural features of the aralkyl group are selected so that the lipophilic moiety binds to a serum, vascular, or cellular protein. In certain embodiments, the structural features of the aralkyl group facilitate binding to albumin, immunoglobulin, lipoprotein, α-2-macroglobulin (macroglubulin), or α-1-glycoprotein.

[0280] In certain embodiments, the ligand is naproxene or a structural derivative of naproxene. Procedures for the synthesis of naproxene can be found in their entirety in U.S. Patents 3,904,682 and 4,009,197, which are incorporated herein by reference. Naproxene has the chemical name (S)-6-methoxy-α-methyl-2-naphthaleneacetic acid and its structure is as follows:

[0281] [ka]

[0282] In certain embodiments, the ligand is ibuprofen or a structural derivative of ibuprofen. Procedures for the synthesis of ibuprofen can be found in US3,228,831, which is incorporated herein by reference for the method provided herein. The structure of ibuprofen is as follows:

[0283] [ka]

[0284] Further exemplary aralkyl groups are exemplified in US7,626,014, which is incorporated herein by reference for the methods provided herein.

[0285] In other embodiments, suitable lipophilic moieties include lipids, cholesterol, retinoic acid, cholic acid, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, ibuprofen, naproxen, dimethoxytrityl, or phenoxazine.

[0286] In certain embodiments, more than one lipophilic moiety can be incorporated into a double-stranded RNAi agent, particularly when the lipophilic moiety has low lipophilicity or hydrophobicity. In some embodiments, two or more lipophilic moieties are incorporated into the same strand of the double-stranded RNAi agent. In some embodiments, each strand of the double-stranded RNAi agent has one or more incorporated lipophilic moieties. In some embodiments, two or more lipophilic moieties are incorporated at the same position (i.e., the same nucleic acid base, the same sugar moiety, or the same nucleoside linkage) in the double-stranded RNAi agent. This can be achieved, for example, by conjugating two or more lipophilic moieties via a carrier, or by conjugating two or more lipophilic moieties via a branched linker, or by conjugating two or more lipophilic moieties using one or more linkers that sequentially link the lipophilic moieties.

[0287] The lipophilic portion can be conjugated to the RNAi agent by direct attachment to the ribosaccharide of the RNAi agent. Alternatively, the lipophilic portion can be conjugated to the double-stranded RNAi agent via a linker or carrier.

[0288] In certain embodiments, the lipophilic portion can be conjugated to an RNAi agent via one or more linkers (tethers).

[0289] In some embodiments, the lipophilic moiety is conjugated to a double-stranded RNAi agent via a linker which is a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, click reaction product (e.g., triazole derived from azido-alkyne cyclization), or carbamate.

[0290] B. Lipid conjugates In some embodiments, the ligand is a lipid or lipid-based molecule. Such lipids or lipid-based molecules can typically bind to serum proteins, such as human serum albumin (HSA). HSA-binding ligands enable the vascular distribution of the conjugate to target tissues. For example, the target tissue may be the central nervous system (CNS), such as the brain and / or spinal cord, such as the dorsal root ganglia. Other molecules that can bind to HSA can also be used as ligands. For example, neproxin or aspirin can be used. Lipids or lipid-based ligands can be used to (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport into target cells or cell membranes, and / or (c) modulate binding to serum proteins, such as HSA.

[0291] Lipid-based ligands can be used to modulate, for example, control (e.g., inhibit) the binding of conjugates to target tissues. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidneys and therefore less likely to be eliminated from the body. Lipids or lipid-based ligands that do not bind less strongly to HSA can be used to target conjugates to the kidneys.

[0292] In some embodiments, lipid-based ligands bind to HSA. For example, the ligand can bind to HSA with sufficient affinity, resulting in enhanced distribution of the conjugate to non-renal tissue. However, the affinity is usually not strong enough to reverse the HSA-ligand binding.

[0293] In some embodiments, lipid-based ligands may bind weakly to HSA or not at all, resulting in enhanced distribution of the conjugate to the kidney. Other moieties that target kidney cells can be used instead of, or in addition to, the lipid-based ligand.

[0294] In other embodiments, the ligand is a portion taken up by target cells, e.g., proliferating cells, e.g., a vitamin. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., malignant or non-malignant species, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low-density lipoprotein (LDL) are also included.

[0295] Cell permeabilizing agent In other embodiments, the ligand is a cell permeabilizer, such as a helix cell permeabilizer. In some embodiments, these cell permeabilizers are amphiphilic. Exemplary cell permeabilizers include peptides, such as tat or antennopedia. If the agent is a peptide, it may be modified, including peptidyl mimetic, inverted isomers, non-peptide or pseudopeptide linkages, and the use of D-amino acids. The helix agent is usually an α-helix agent and may have lipophilic and oleophobic phases.

[0296] Ligands can be peptides or peptidomimetic molecules. Peptidomimetic molecules (also referred to herein as oligopeptidomimetic molecules) are molecules that can fold into a defined three-dimensional structure similar to that of natural peptides. The attachment of peptides and peptidomimetic molecules to iRNA agents can affect the pharmacokinetic distribution of the iRNA, for example, by enhancing cell recognition and absorption. The peptide or peptidomimetic moiety may be about 5 to 50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0297] Peptides or peptidomimetic molecules can be, for example, cell-penetrating peptides, cationic peptides, amphiphilic peptides, or hydrophobic peptides (e.g., mainly composed of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, a restricting peptide, or a cross-linked peptide. Alternatively, the peptide moiety may contain a hydrophobic membrane-transfer sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF with the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 3699). A hydrophobic MTS containing an RFGF analog (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 3700)) can also be a targeting moiety. The peptide moiety can be a "delivery" peptide capable of carrying large polar molecules, including peptides, oligonucleotides, and proteins, across the cell membrane. For example, sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3701)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 3702)) have been found to be functionalizable as delivery peptides. Peptides or peptidomimetic molecules can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or 1-bead-1-compound (OBOC) combinatorial libraries (Lam et al., Nature, 354:82-84, 1991). Typically, peptides or peptidomimetic molecules tethered to dsRNA agents via integrated monomer units include cell-targeting peptides, such as arginine-glycine-aspartate (RGD) peptides or RGD mimics. The peptide moiety can range in length from approximately 5 to 40 amino acids. The peptide moiety may have structural modifications that increase stability or direct conformational properties, for example. Any of the structural modifications described below are available.

[0298] The RGD peptides for use in the compositions and methods of this disclosure may be linear or cyclic, and may be modified to facilitate targeting of specific tissues, for example, by glycosylation or methylation. RGD-containing peptides and peptidomimetics may comprise D-amino acids and synthetic RGD mimics. In addition to RGD, other parts that target integrin ligands may be used. In some embodiments, the ligand conjugate targets PECAM-1 or VEGF.

[0299] The RGD peptide portion can be used to target specific cell types, such as tumor cells, e.g., endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate the targeting of dsRNA agents to tumors in various other tissues, including the lungs, kidneys, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, RGD peptides facilitate the targeting of iRNA agents to the kidneys. RGD peptides can be linear or cyclic and can be modified to facilitate targeting to specific tissues, for example, by glycosylation or methylation. For example, glycosylated RGD peptides can target iRNA agents to α V It can be delivered to tumor cells that express β3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

[0300] A "cell-permeable peptide" is capable of permeating cells, such as microbial cells, such as bacterial or fungal cells, or mammalian cells, such as human cells. Microbial cell-permeable peptides may be, for example, α-helix linear peptides (e.g., LL-37 or seropin P1), disulfide bond-containing peptides (e.g., α-defensin, β-defensin, or bactenesin), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidine). Cell-permeable peptides may also contain nuclear localization signals (NLS). For example, a cell-permeable peptide may be a bifid amphiphilic peptide such as MPG derived from the fusion peptide domain of the NLS of HIV-1 gp41 and SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0301] Carbohydrate conjugates and ligands In some embodiments of the compositions and methods of this disclosure, the iRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated iRNAs are advantageous for in vivo delivery of nucleic acids and compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” means a compound that is either a carbohydrate itself, or a compound having a carbohydrate moiety composed of one or more monosaccharide units, each having at least six carbon atoms (which may be linear, branched, or cyclic), with each carbon atom bonded to an oxygen, nitrogen, or sulfur atom, respectively. Typical carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units) and polysaccharides, such as starch, glycogen, cellulose, and polysaccharide gum. Examples of specific monosaccharides include sugars with C5 or more (e.g., C5, C6, C7, or C8), while examples of disaccharides and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0302] In certain embodiments, the compositions and methods of the Disclosure include a C16 ligand. In exemplary embodiments, the C16 ligand of the Disclosure has the following structure (as illustrated herein for uracil bases, but attachment of the C16 ligand is intended to be to any nucleotide presenting a base (such as C, G, A, etc.) or any other modification as presented herein, as long as 2' ribo-attachment is maintained), and is attached to the 2' position of the ribo within the thus modified residue:

[0303] [ka]

[0304] As shown above, the C16 ligand-modified residue exhibits a linear alkyl group at the 2'-ribo position of the modified exemplary residue (uracil in this specification).

[0305] In exemplary embodiments, the C16 ligand of this disclosure can be conjugated to a ribonucleotide residue having the following structure (having any other modifications as presented herein, as long as the 2' ribo attachment is maintained), and is attached to the 2' position of the ribo within the thus modified residue:

[0306] [ka] [In the formula, * [where B is a nucleic acid base or nucleic acid base analogue, for example, here B is adenine, guanine, cytosine, thymine, or uracil].

[0307] In some embodiments, the carbohydrate conjugate of the RNAi agent of this disclosure further comprises one or more additional ligands, such as, but not limited to, a PK modulator or a cell-permeable peptide.

[0308] Further carbohydrate conjugates (and linkers) suitable for use in this disclosure include those described in WO2014 / 179620 and WO2014 / 179627, which are incorporated herein by reference.

[0309] In certain embodiments, the compositions and methods of the Disclosure include 5'-vinylphosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, the 5'-vinylphosphonate modified nucleotide of the Disclosure is of the formula:

[0310] [ka] [In the formula, X is either O or S; R is hydrogen, hydroxyl, methoxy, fluoro, or C1-20 alkoxy (e.g., methoxy or n-hexadecyloxy); R5' is =C(H)-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in an E or Z configuration (e.g., an E configuration); and B is a nucleic acid base or a modified nucleic acid base, where B may be adenine, guanine, cytosine, thymine, or uracil. The vinyl phosphonate of the Disclosure may be attached to either the antisense or sense strand of the dsRNA of the Disclosure. In certain embodiments, the vinyl phosphonate of the Disclosure may be attached to the antisense strand of the dsRNA at its 5' end, as appropriate.

[0311] Vinyl phosphate modifications are also intended for the compositions and methods of this disclosure. An exemplary vinyl phosphonate structure is:

[0312] [ka] (For example, this includes the aforementioned structure in which R5' is = C(H)-OP(O)(OH)2 and the double bond between the C5' carbon and R5' is in an E or Z configuration (e.g., an E configuration).)

[0313] In some embodiments, the carbohydrate conjugate contains a monosaccharide. In some embodiments, the monosaccharide is N-acetylgalactosamine (GalNAc). GalNAc conjugates comprising one or more N-acetylgalactosamine (GalNAc) derivatives are described, for example, in U.S. Patent No. 8,106,022, the entirety of which is incorporated herein by reference. In some embodiments, the GalNAc conjugate acts as a ligand that targets iRNA to specific cells. In some embodiments, the GalNAc conjugate targets iRNA to liver cells, for example, by acting as a ligand for the asialoclycoprotein receptor in liver cells (e.g., hepatocytes).

[0314] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives can be attached via a linker, for example, a divalent or trivalent branched linker. In some embodiments, the GalNAc conjugate is conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (for example, to the 3' end of the sense strand) via a linker, for example, a linker as described herein.

[0315] In some embodiments, the GalNAc conjugate is as follows:

[0316] [ka]

[0317] In some embodiments, the RNAi agent is represented by the following schematic diagram where X is O or S: [ka] As shown, it attaches to the carbohydrate conjugate via a linker.

[0318] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1, as shown below:

[0319] [ka]

[0320] In some embodiments, the carbohydrate conjugate for use in the compositions and methods of this disclosure is selected from the group consisting of:

[0321] [ka] [ka] [ka] [ka] [ka]

[0322] Other representative carbohydrate conjugates for use in the embodiments described herein, but not limited to, include the following:

[0323] [ka] In the formula, either X or Y is an oligonucleotide, and the other is hydrogen.

[0324] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands, such as, but not limited to, PK modulators or cell-permeable peptides.

[0325] In some embodiments, the iRNAs of the Disclosure are conjugated to a carbohydrate via a linker. Not limited to, but including, iRNA-carbohydrate conjugates having linkers of the compositions and methods of the Disclosure, when one of X or Y is an oligonucleotide and the other is hydrogen, the following are examples:

[0326] [ka] [ka]

[0327] E. Thermal destabilization modification In certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating a thermal destabilization modification within the seed region of the antisense strand (i.e., positions 2–9 at the 5' end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been found that dsRNAs having an antisense strand containing at least one double-strand thermal destabilization modification within the first nine nucleotide positions counting from the 5' end of the antisense strand exhibit reduced off-target gene silencing activity. Therefore, in some embodiments, the antisense strand contains at least one (e.g., 1, 2, 3, 4, 5 or more) double-strand thermal destabilization modification within the first nine nucleotide positions of the 5' region of the antisense strand. In some embodiments, one or more double-strand thermal destabilization modifications are located within positions 2–9 or 4–8 from the 5' end of the antisense strand. In some further embodiments, the double-strand thermal destabilization modification(s) are located at positions 6, 7, or 8 from the 5' end of the antisense strand. In some further embodiments, the double-strand thermal destabilization modification is located at position 7 from the 5' end of the antisense strand. The term “thermal destabilization modification” includes modifications(s) that would result in a dsRNA with a lower overall melting temperature (Tm) (e.g., 1, 2, 3, or 4 degrees lower than the Tm of a dsRNA without such modifications(s). In some embodiments, the double-strand thermal destabilization modification is located at positions 2, 3, 4, 5, or 9 from the 5' end of the antisense strand.

[0328] Examples of thermal destabilization modifications, though not limited to these, include debasing modifications, mismatches with opposing nucleotides on opposing chains, and sugar modifications, such as 2'-deoxy modifications or acyclic nucleotides, such as unlocked nucleic acids (UNAs) or glycol nucleic acids (GNAs).

[0329] Examples of debase modification include, but are not limited to, the following:

[0330] [ka] [In the formula, R = H, Me, Et or OMe; R' = H, Me, Et or OMe; R” = H, Me, Et or OMe]

[0331] [ka] [In the formula, B is a modified or unmodified nucleic acid base.] These are some examples.

[0332] Examples of sugar modifications include, but are not limited to, the following:

[0333] [ka] [In the formula, B is a modified or unmodified nucleic acid base.] These are some examples.

[0334] In some embodiments, the thermal destabilization modification of the double chain is as follows: [ka] [In the formula, B is a modified or unmodified nucleic acid base, and each asterisk in the structure represents either R, S, or racemic.] It is selected from the group consisting of the following.

[0335] The term "acyclic nucleotide" refers to any nucleotide having an acyclic ribose sugar in which, for example, one of the bonds between ribose carbons (e.g., C1'-C2', C2'-C3', C3'-C4', C4'-O4', or C1'-O4') is absent, or at least one of the ribose carbons or oxygen atoms (e.g., C1', C2', C3', C4', or O4') is absent independently or in combination in the nucleotide. In some embodiments, an acyclic nucleotide is,

[0336] [ka] [In the formula, B is a modified or unmodified nucleic acid base, and R 1 and R 2 R3 is independently H, halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar. The term "UNA" refers to an unlocked acyclic nucleic acid in which one of the sugar bonds has been removed to form an unlocked "sugar" residue. In one example, UNA also encompasses monomers in which the bond between C1'-C4' has been removed (i.e., the carbon-oxygen-carbon bond of the covalent bond between the C1' and C4' carbons). In another example, the C2'-C3' bond of the sugar (i.e., the carbon-carbon bond of the covalent bond between the C2' and C3' carbons) has been removed [see Mikhailov et al., Tetrahedron Letters, 26 (17): 2059 (1985) and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), whose entirety is incorporated herein by reference]. Acyclic derivatives offer greater skeletal flexibility without affecting Watson-Crick pair formation. Acyclic nucleotides can be linked via 2'-5' or 3'-5' ligatures.

[0337] The term "GNA" refers to glycol nucleic acids, which are polymers similar to DNA or RNA, but differ in the composition of their "backbone" in that it consists of repeating glycerol units linked by phosphodiester bonds.

[0338] [ka]

[0339] Double-strand thermal destabilization modifications can be a mismatch (i.e., a non-complementary base pair) between a thermally destabilized nucleotide and an opposing nucleotide in the opposing strand within the dsRNA double-strand. Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or combinations thereof. Other mismatch base pair formations known in the art are also suitable for the present invention. Mismatches can occur between nucleotides that are either naturally occurring or modified nucleotides; that is, mismatch base pair formation can occur between nucleic acid bases derived from each nucleotide independently of modifications on the ribose sugar of the nucleotides. In certain embodiments, the dsRNA molecule contains at least one nucleic acid base in mismatch pair formation, for example, a 2'-deoxynucleotide, which is located in the sense strand.

[0340] In some embodiments, thermal destabilization modification of the double helix in the seed region of the antisense strand results in a nucleotide whose WHC bond with the complementary base on the target mRNA is impaired, for example: [ka] Includes.

[0341] More examples of debasalized nucleotides, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications are described in detail in WO2011 / 133876, which is incorporated herein by reference in its entirety.

[0342] Thermal destabilization modifications may also include universal base and phosphate modifications in which the ability to form hydrogen bonds with opposing bases is reduced or lost.

[0343] In some embodiments, thermal destabilization modifications of the double helix include nucleotides with non-canonical bases, for example, but not limited to, nucleic acid base modifications in which the ability to form hydrogen bonds with bases in the opposing strand is impaired or completely lost. These nucleic acid base modifications have been evaluated for destabilization of the central region of the dsRNA double helix, as described in WO2010 / 0011895, which is incorporated herein by reference in its entirety. Exemplary nucleic acid base modifications include:

[0344] [ka] There is.

[0345] In some embodiments, the thermal destabilization modification of the double helix in the seed region of the antisense strand involves one or more α-nucleotides complementary to the base on the target mRNA, for example:

[0346] [ka] [In the formula, R is H, OH, OCH3, F, NH2, NHMe, NMe2, or O-alkyl] It includes.

[0347] As an example of phosphate modifications known to reduce the thermal stability of dsRNA double helix compared to natural phosphodiester bonds:

[0348] [ka] There is.

[0349] The alkyl group of the R group can be C1-C6 alkyl. Specific examples of alkyl groups of the R group, though not limited to these, include methyl, ethyl, propyl, isopropyl, butyl, pentyl, and hexyl.

[0350] As those skilled in the art will recognize, given that the functional roles of nucleic acid bases define the specificity of the RNAi agents of this disclosure, nucleic acid base modifications can be carried out in various ways as described herein, for example, to enhance on-target effects against off-target effects, or to introduce destabilizing modifications into the RNAi agents of this disclosure. However, the range of modifications available and generally present on the RNAi agents of this disclosure tends to be greater with respect to non-nucleonucleotide modifications, such as modifications to the sugar groups or phosphate backbone of polyribonucleotides. Such modifications are described in more detail in other sections of this disclosure and are explicitly intended for the RNAi agents of this disclosure having either natural nucleic acid bases or modified nucleic acid bases, as described above or elsewhere herein.

[0351] In addition to the antisense strand containing thermal destabilization modifications, the dsRNA may also contain one or more stabilization modifications. For example, the dsRNA may contain at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) stabilization modifications. While not limiting, all stabilization modifications may be present on one of the strands. In some embodiments, both the sense and antisense strands contain at least two stabilization modifications. Stabilization modifications can occur on any nucleotide of the sense or antisense strand. For example, a stabilization modification may occur on any nucleotide on the sense or antisense strand, each stabilization modification may occur in an alternating pattern on the sense or antisense strand, or both the sense or antisense strand may contain stabilization modifications in an alternating pattern. The alternating pattern of stabilization modifications on the sense strand may be identical or different to that on the antisense strand, and the alternating pattern of stabilization modifications on the sense strand may have a shift compared to the alternating pattern of stabilization modifications on the antisense strand.

[0352] In some embodiments, the antisense chain includes at least two stabilizing modifications (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more). However, the stabilizing modifications in the antisense chain may be located at any position.

[0353] In some embodiments, the antisense chain includes stabilization modifications at positions 2, 6, 8, 9, 14, and 16 from the 5' end. In some other embodiments, the antisense chain includes stabilization modifications at positions 2, 6, 14, and 16 from the 5' end. In some other embodiments, the antisense chain includes stabilization modifications at positions 2, 14, and 16 from the 5' end.

[0354] In some embodiments, the antisense strand includes at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification may be a nucleotide at the 5' or 3' end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand includes stabilizing modifications at each of the 5' and 3' ends of the destabilizing modification, i.e., at positions -1 and +1 from the position of the destabilizing modification.

[0355] In some embodiments, the antisense chain includes at least two stabilizing modifications at the 3' end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.

[0356] In some embodiments, the sense chain includes at least two stabilization modifications (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more). Stabilization modifications in the sense chain may be located at any position, but are not limited to these. In some embodiments, the sense chain includes stabilization modifications at positions 7, 10, and 11 from the 5' end. In some other embodiments, the sense chain includes stabilization modifications at positions 7, 9, 10, and 11 from the 5' end. In some embodiments, the sense chain includes stabilization modifications at positions opposite or complementary to positions 11, 12, and 15 of the antisense chain, counting from the 5' end of the antisense chain. In some other embodiments, the sense chain includes stabilization modifications at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense chain, counting from the 5' end of the antisense chain. In some embodiments, the sense chain includes blocks of two, three, or four stabilization modifications.

[0357] In some embodiments, the sense chain does not contain stabilizing modifications in positions that counteract or complement the thermal destabilizing modifications of the double chain in the antisense chain.

[0358] Examples of thermal stabilization modifications include, but are not limited to, 2'-fluoro modifications. Other examples of thermal stabilization modifications include, but are not limited to, LNA.

[0359] In some embodiments, the dsRNA of this disclosure contains at least four (e.g., 4, 5, 6, 7, 8, 9, 10 or more) 2'-fluoronucleotides. Not limited to, all 2'-fluoronucleotides may be present in one of the strands. In some embodiments, both the sense and antisense strands contain at least two 2'-fluoronucleotides. 2'-fluoro modifications may occur on any nucleotide of the sense or antisense strand. For example, a 2'-fluoro modification may occur on any nucleotide on the sense or antisense strand, each 2'-fluoro modification may occur in an alternating pattern on the sense or antisense strand, or both the sense or antisense strand may contain 2'-fluoro modifications in an alternating pattern. The alternating pattern of 2'-fluoro modifications on the sense strand may be identical or different to that on the antisense strand, and the alternating pattern of 2'-fluoro modifications on the sense strand may have a shift compared to the alternating pattern of 2'-fluoro modifications on the antisense strand.

[0360] In some embodiments, the antisense chain contains at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-fluoronucleotides. While not limiting, 2'-fluoro modifications in the antisense chain can be located at any position. In some embodiments, the antisense contains 2'-fluoronucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5' end. In some other embodiments, the antisense contains 2'-fluoronucleotides at positions 2, 6, 14, and 16 from the 5' end. In yet another embodiment, the antisense contains 2'-fluoronucleotides at positions 2, 14, and 16 from the 5' end.

[0361] In some embodiments, the antisense strand includes at least one 2'-fluoronucleotide adjacent to the destabilization modification. For example, the 2'-fluoronucleotide may be at the 5' or 3' end of the destabilization modification, i.e., at position -1 or +1 from the position of the destabilization modification. In some embodiments, the antisense strand includes 2'-fluoronucleotides at each of the 5' and 3' ends of the destabilization modification, i.e., at positions -1 and +1 from the position of the destabilization modification.

[0362] In some embodiments, the antisense strand includes at least two 2'-fluoronucleotides at the 3' end of the destabilization modification, i.e., at positions +1 and +2 from the position of the destabilization modification.

[0363] In some embodiments, the sense strand contains at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-fluoronucleotides. While not limiting, 2'-fluoro modifications in the sense strand can be present at any position. In some embodiments, the antisense strand contains 2'-fluoronucleotides at positions 7, 10, and 11 from the 5' end. In some other embodiments, the sense strand contains 2'-fluoronucleotides at positions 7, 9, 10, and 11 from the 5' end. In some embodiments, the sense strand contains 2'-fluoronucleotides at positions opposite or complementary to positions 11, 12, and 15 of the antisense strand, counting from the 5' end of the antisense strand. In some other embodiments, the sense strand contains 2'-fluoronucleotides at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5' end of the antisense strand. In some embodiments, the sense strand contains blocks of 2, 3, or 4 2'-fluoronucleotides.

[0364] In some embodiments, the sense strand does not contain a 2'-fluoronucleotide in a position that counteracts or complements the thermal destabilization modification of the double helix in the antisense strand.

[0365] In some embodiments, the dsRNA molecule of the present disclosure comprises a sense strand of 21 nucleotides (nt) and an antisense strand of 23 nucleotides (nt), wherein the antisense strand contains at least one thermally destabilized nucleotide, the at least one thermally destabilized nucleotide occurring in the seed region of the antisense strand (i.e., at position 2-9 at the 5' end of the antisense strand), one end of the dsRNA is blunt, the other end contains a 2nt overhang, and the dsRNA further has at least one of the following features (e.g., 1, 2, 3, 4, 5, 6, or all of 7): Possible: (i) the antisense strand contains 2, 3, 4, 5, or 6 2'-fluoro modifications; (ii) the antisense strand contains 1, 2, 3, 4, or 5 phosphorothioate nucleotide interlinks; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand contains 2, 3, 4, or 5 2'-fluoro modifications; (v) the sense strand contains 1, 2, 3, 4, or 5 phosphorothioate nucleotide interlinks; (vi) the dsRNA contains at least 4 2'-fluoro modifications; and (vii) the dsRNA has a blunt end at the 5' end of the antisense strand. In some embodiments, the 2nt overhang is at the 3' end of the antisense.

[0366] In some embodiments, any nucleotide in the sense and antisense strands of a dsRNA molecule may be modified. Each nucleotide may be modified with the same or different modifications, which may include alterations of one or more unbound phosphate oxygens, or one or more bound phosphate oxygens, alterations of the 2' hydroxyl group on the ribose sugar components, large-scale substitution of the phosphate moiety with a "dephospho" linker, modifications or substitutions of naturally occurring bases, and substitutions or modifications of the ribose-phosphate backbone.

[0367] Since nucleic acids are polymers of subunits, many modifications occur at repeating positions within the nucleic acid, for example, modifications of bases or phosphate moieties or unbound oxygen atoms of phosphate moieties. In some cases, modifications occur at all target positions in the nucleic acid, but often they do not. For example, modifications may occur only at the 3' or 5' end, or only in the terminal region, for example, at the terminal nucleotides of the strand, or at the last 2, 3, 4, 5, or 10 nucleotides. Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in the double-stranded regions of RNA, or only in the single-stranded regions of RNA. For example, phosphorothioate modifications at unbound oxygen atoms may occur only at one or both ends, or only in the terminal region, for example, at the terminal nucleotides of the strand, or at the last 2, 3, 4, 5, or 10 nucleotides, or in both double-stranded and single-stranded regions, especially at the ends. The 5' end or both ends may be phosphorylated.

[0368] For example, it may be possible to enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide substitutes in single-stranded overhangs, e.g., in the 5' or 3' overhang, or both. For example, it may be desirable to include purine nucleotides in the overhang. In some embodiments, all or some of the bases in the 3' or 5' overhang may be modified, for example, with modifications described herein. Modifications may include, for example, the use of 2'-position modification of ribose sugar in modifications known in the art, e.g., the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro(2'-F) or 2'-O-methyl modified in place of ribosaccharides in nucleic acid bases, and modifications at phosphate groups, e.g., phosphorothioate modifications. The overhang does not need to be homologous to the target sequence.

[0369] In some embodiments, each residue in the sense and antisense chains is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, or 2'-fluoro. The chains may contain two or more modifications. In some embodiments, each residue in the sense and antisense chains is independently modified with 2'-O-methyl or 2'-fluoro. Again, it should be understood that these modifications are in addition to at least one thermal destabilization modification of the double helix present in the antisense chain.

[0370] At least two distinct modifications are typically present on the sense and antisense strands. These two modifications may include 2'-deoxy, 2'-O-methyl, or 2'-fluoro modifications, acyclic nucleotides, etc. In some embodiments, the sense and antisense strands each contain two distinctly modified nucleotides selected from 2'-O-methyl or 2'-deoxy. In some embodiments, each residue in the sense and antisense strands is independently modified with 2'-O-methyl nucleotide, 2'-deoxy nucleotide, 2'-deoxy-2'-fluoro nucleotide, 2'-ON-methylacetamide (2'-O-NMA) nucleotide, 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleotide, 2'-O-aminopropyl (2'-O-AP) nucleotide, or 2'-ala-F nucleotide. Again, it should be understood that these modifications are in addition to at least one thermal destabilization modification of the double helix present in the antisense strand.

[0371] In some embodiments, the dsRNA molecules of this disclosure include alternating pattern modifications, particularly in the B1, B2, B3, B1', B2', B3', and B4' regions. The terms “alternating motif” or “alternating pattern,” as used herein, refer to a motif having one or more modifications, each modification occurring in alternating nucleotides on a single strand. Alternating nucleotides may refer to one every other nucleotide, one every three nucleotides, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif may be “ABABABABABAB…”, “AABBAABBAABB…”, “AABAABAABAAB…”, “AAABAAABAAAB…”, “AABBBAAABBB…”, or “ABCABCABCABC…”.

[0372] The types of modifications contained within an alternating motif may be identical or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, then the alternating turns, i.e., the modifications on every other nucleotide, may be identical, but each of the sense or antisense strands may be selected from several possible modifications within the alternating motif, such as "ABABAB…", "ACACAC…", "BDBDBD…", or "CDCDCD…".

[0373] In some embodiments, the dsRNA molecules of this disclosure include a modification pattern of alternating motifs on the sense strand that is shifted relative to the modification pattern of alternating motifs on the antisense strand. The shift may be such that modified groups of nucleotides on the sense strand correspond to differently modified groups of nucleotides on the antisense strand, and vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA double helix, the alternating motifs on the sense strand may begin with "ABABAB" from 5'-3' of the strand, and the alternating motifs on the antisense strand may begin with "BABABA" from 3'-5' of the strand in the double helix region. As another example, the alternating motifs on the sense strand may begin with "AABBAABB" from 5'-3' of the strand, and the alternating motifs on the antisense strand may begin with "BBAABBAA" at 3'-5' of the strand in the double helix region, resulting in a complete or partial shift of the modification patterns between the sense and antisense strands.

[0374] The dsRNA molecules of this disclosure may further include at least one phosphorothioate or methylphosphonate internucleotide ligation. Phosphothioate or methylphosphonate internucleotide ligation modifications may occur at any position on the chain, on the sense strand, the antisense strand, or on any nucleotide of both. For example, an internucleotide ligation modification may occur on any nucleotide on the sense strand or the antisense strand, each internucleotide ligation modification may occur in an alternating pattern on the sense strand or the antisense strand, or the sense strand or the antisense strand may contain both internucleotide ligation modifications in an alternating pattern. The alternating pattern of internucleotide ligation modifications on the sense strand may be identical or different to that on the antisense strand, and the alternating pattern of internucleotide ligation modifications on the sense strand may have a shift relative to the alternating pattern of internucleotide ligation modifications on the antisense strand.

[0375] In some embodiments, the dsRNA molecule includes phosphorothioate or methylphosphonate internucleotide ligation modifications within the overhang region. For example, the overhang region includes two nucleotides having a phosphorothioate or methylphosphonate internucleotide ligation between the two nucleotides. The internucleotide ligation modifications may also be made to ligate the overhang nucleotides to the terminal pair-forming nucleotides in the double-stranded region. For example, at least two, three, four, or all of the overhang nucleotides may be ligated by phosphorothioate or methylphosphonate internucleotide ligations, and there may be further phosphorothioate or methylphosphonate internucleotide ligations that ligate the overhang nucleotides to the pair-forming nucleotides adjacent to the overhang nucleotides. For example, there may be at least two phosphorothioate internucleotide ligations between three terminal nucleotides, where two of the three nucleotides are overhang nucleotides and the third is the pair-forming nucleotide adjacent to the overhang nucleotide. In some embodiments, these three terminal nucleotides may be the 3' end of the antisense strand.

[0376] In some embodiments, the sense strand of a dsRNA molecule comprises 1 to 10 blocks of 2 to 10 phosphorothioate or methylphosphonate nucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate nucleotide links, one of which is positioned at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide links, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate links.

[0377] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate nucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate nucleotide links, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide links, and an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate links.

[0378] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate linkage.

[0379] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate linkage.

[0380] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate linkage.

[0381] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate internucleotide links, separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate linkage.

[0382] In some embodiments, the antisense strand of a dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide links, separated by one, two, three, four, five, six, seven, or eight phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate links.

[0383] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide links, separated by one, two, three, four, five, or six phosphate nucleotide interlinks, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide interlinks, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate links.

[0384] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate nucleotide links, separated by one, two, three, or four phosphate nucleotide links, one of which is positioned at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate nucleotide links, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate links.

[0385] In some embodiments, the dsRNA molecules of this disclosure further include one or more phosphorothioate or methylphosphonate internucleotide ligation modifications within the terminal positions 1 to 10 of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be ligated by phosphorothioate or methylphosphonate internucleotide ligations at one or both ends of the sense or antisense strand.

[0386] In some embodiments, the dsRNA molecules of this disclosure further include one or more phosphorothioate or methylphosphonate nucleotide ligation modifications within positions 1-10 of the internal region of each duplex of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be ligated by phosphorothioate-methylphosphonate ligations at positions 8-16 of the duplex region, counting from the 5' end of the sense strand. The dsRNA molecules may further include one or more phosphorothioate or methylphosphonate nucleotide ligation modifications within the terminal positions 1-10.

[0387] In some embodiments, the dsRNA molecule of the present disclosure further comprises 1 to 5 phosphorothioate or methylphosphonate nucleotide ligation modifications within positions 1 to 5 of the sense strand and 1 to 5 phosphorothioate or methylphosphonate nucleotide ligation modifications within positions 18 to 23 (counting from the 5' end), as well as 1 to 5 phosphorothioate or methylphosphonate nucleotide ligation modifications within positions 1 and 2 of the antisense strand and 1 to 5 within positions 18 to 23 (counting from the 5' end).

[0388] In some embodiments, the dsRNA molecule of the present disclosure further comprises one phosphorothioate nucleotide ligation modification within positions 1-5 of the sense strand and one phosphorothioate or methylphosphonate nucleotide ligation modification within positions 18-23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand and two phosphorothioate or methylphosphonate nucleotide ligation modifications within positions 18-23 (counting from the 5' end).

[0389] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1–5 of the sense strand and one phosphorothioate nucleotide ligation modification within positions 18–23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications within positions 18–23 (counting from the 5' end).

[0390] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1-5 of the sense strand and two phosphorothioate nucleotide ligation modifications within positions 18-23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications within positions 18-23 (counting from the 5' end).

[0391] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1–5 of the sense strand and two phosphorothioate nucleotide ligation modifications within positions 18–23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand and one phosphorothioate nucleotide ligation modification within positions 18–23 (counting from the 5' end).

[0392] In some embodiments, the dsRNA molecule of the present disclosure further comprises one phosphorothioate nucleotide ligation modification within positions 1-5 of the sense strand and one phosphorothioate nucleotide ligation modification within positions 18-23 (counting from the 5' end), as well as two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications within positions 18-23 (counting from the 5' end).

[0393] In some embodiments, the dsRNA molecule of the present disclosure further comprises one phosphorothioate nucleotide ligation modification within positions 1–5 of the sense strand and one within positions 18–23 (counting from the 5' end), as well as two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and one phosphorothioate nucleotide ligation modification within positions 18–23 (counting from the 5' end).

[0394] In some embodiments, the dsRNA molecule of the present disclosure further includes one phosphorothioate nucleotide ligation modification (counting from the 5' end) within positions 1–5 of the sense strand, and two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand, and one phosphorothioate nucleotide ligation modification (counting from the 5' end) within positions 18–23.

[0395] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications (counting from the 5' end) within positions 1–5 of the sense strand, one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand, and two phosphorothioate nucleotide ligation modifications (counting from the 5' end) within positions 18–23.

[0396] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1–5 of the sense strand and one within positions 18–23 (counting from the 5' end), as well as two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and one within positions 18–23 (counting from the 5' end).

[0397] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1-5 of the sense strand and one phosphorothioate nucleotide ligation modification within positions 18-23 (counting from the 5' end), as well as two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications within positions 18-23 (counting from the 5' end).

[0398] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications within positions 1–5 of the sense strand and one phosphorothioate nucleotide ligation modification within positions 18–23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications within positions 18–23 (counting from the 5' end).

[0399] In some embodiments, the dsRNA molecule of the present disclosure further includes two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the sense strand and two phosphorothioate nucleotide ligation modifications at positions 20 and 21 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at position 1 of the antisense strand and one at position 21 (counting from the 5' end).

[0400] In some embodiments, the dsRNA molecule of the present disclosure further comprises one phosphorothioate nucleotide ligation modification at position 1 of the sense strand and one phosphorothioate nucleotide ligation modification at position 21 (counting from the 5' end), and two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications at positions 20 and 21 (counting from the 5' end).

[0401] In some embodiments, the dsRNA molecule of the present disclosure further comprises two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the sense strand and two phosphorothioate nucleotide ligation modifications at positions 21 and 22 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at position 1 of the antisense strand and one phosphorothioate nucleotide ligation modification at position 21 (counting from the 5' end).

[0402] In some embodiments, the dsRNA molecule of the present disclosure further comprises one phosphorothioate nucleotide ligation modification at position 1 of the sense strand and one phosphorothioate nucleotide ligation modification at position 21 (counting from the 5' end), and two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications at positions 21 and 22 (counting from the 5' end).

[0403] In some embodiments, the dsRNA molecule of the present disclosure further includes two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the sense strand and two phosphorothioate nucleotide ligation modifications at positions 22 and 23 (counting from the 5' end), as well as one phosphorothioate nucleotide ligation modification at position 1 of the antisense strand and one phosphorothioate nucleotide ligation modification at position 21 (counting from the 5' end).

[0404] In some embodiments, the dsRNA molecule of the present disclosure further includes one phosphorothioate nucleotide ligation modification at position 1 of the sense strand and one phosphorothioate nucleotide ligation modification at position 21 (counting from the 5' end), and two phosphorothioate nucleotide ligation modifications at positions 1 and 2 of the antisense strand and two phosphorothioate nucleotide ligation modifications at positions 23 and 23 (counting from the 5' end).

[0405] In some embodiments, the compounds of the present disclosure include a pattern of skeletal chiral centers. In some embodiments, the general pattern of skeletal chiral centers includes at least five nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least six nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least seven nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least eight nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least nine nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least ten nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least eleven nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least twelve nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of skeletal chiral centers includes at least thirteen nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 14 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 15 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 16 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 17 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 18 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 19 nucleotide linkages in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes 8 or fewer nucleotide linkages in the Rp configuration.In some embodiments, the general pattern of the skeletal chiral center includes seven or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes six or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes five or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes four or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes three or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes two or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes one or fewer nucleotide linkages in the Rp configuration. In some embodiments, the general pattern of the skeletal chiral center includes eight or fewer non-chiral nucleotide linkages (phosphodiesters are an example, not limited to this). In some embodiments, the general pattern of the skeletal chiral center includes seven or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes six or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes five or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes four or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes three or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes two or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes one or fewer non-chiral nucleotide linkages. In some embodiments, the general pattern of the skeletal chiral center includes at least 10 nucleotide linkages and eight or fewer non-chiral nucleotide linkages in the Sp configuration.In some embodiments, the general pattern of the skeletal chiral center includes at least 11 internucleotide links and 7 or fewer non-chiral internucleotide links in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 12 internucleotide links and 6 or fewer non-chiral internucleotide links in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 13 internucleotide links and 6 or fewer non-chiral internucleotide links in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 14 internucleotide links and 5 or fewer non-chiral internucleotide links in the Sp configuration. In some embodiments, the general pattern of the skeletal chiral center includes at least 15 internucleotide links and 4 or fewer non-chiral internucleotide links in the Sp configuration. In some embodiments, the internucleotide links in the Sp configuration may be continuous or not. In some embodiments, the internucleotide links in the Rp configuration may be continuous or not. In some embodiments, the non-chiral internucleotide links may be continuous or not.

[0406] In some embodiments, the compounds of the Disclosure include blocks that are stereochemical blocks. In some embodiments, a block is an Rp block in that each nucleotide linkage in the block is Rp. In some embodiments, a 5'-block is an Rp block. In some embodiments, a 3'-block is an Rp block. In some embodiments, a block is an Sp block in that each nucleotide linkage in the block is Sp. In some embodiments, a 5'-block is an Sp block. In some embodiments, a 3'-block is an Sp block. In some embodiments, the oligonucleotides provided include both Rp and Sp blocks. In some embodiments, the oligonucleotides provided include one or more Rp but do not include Sp blocks. In some embodiments, the oligonucleotides provided include one or more Sp but do not include Rp blocks. In some embodiments, the oligonucleotides provided include one or more PO blocks in which each nucleotide linkage is a native phosphate linkage.

[0407] In some embodiments, the compounds of the present disclosure include a 5'-block in which each sugar moiety is an Sp block containing a 2'-F modification. In some embodiments, the 5'-block is an Sp block in which each nucleotide linkage is a modified nucleotide linkage and each sugar moiety is an Sp block containing a 2'-F modification. In some embodiments, the 5'-block is an Sp block in which each nucleotide linkage is a phosphorothioate linkage and each sugar moiety is an Sp block containing a 2'-F modification. In some embodiments, the 5'-block contains four or more nucleoside units. In some embodiments, the 5'-block contains five or more nucleoside units. In some embodiments, the 5'-block contains six or more nucleoside units. In some embodiments, the 5'-block contains seven or more nucleoside units. In some embodiments, the 3'-block is an Sp block in which each sugar moiety is an Sp block containing a 2'-F modification. In some embodiments, the 3'-block is an Sp block in which each nucleotide linkage is a modified nucleotide linkage and each sugar moiety is an Sp block containing a 2'-F modification. In some embodiments, the 3'-block is an Sp block in which each nucleotide linkage is a phosphorothioate linkage and each sugar moiety contains a 2'-F modification. In some embodiments, the 3'-block contains four or more nucleoside units. In some embodiments, the 3'-block contains five or more nucleoside units. In some embodiments, the 3'-block contains six or more nucleoside units. In some embodiments, the 3'-block contains seven or more nucleoside units.

[0408] In some embodiments, the compounds of the Disclosure comprise a nucleoside of a certain type in the region, or an oligonucleotide followed by a specific type of internucleotide linkage, such as a native phosphate linkage, a modified internucleotide linkage, an Rp chiral internucleotide linkage, an Sp chiral internucleotide linkage, and the like. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by a native phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by a native phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by a native phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by a native phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by a natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.

[0409] In some embodiments, the dsRNA molecules of this disclosure include double-stranded mismatches(s) or combinations thereof with respect to the target. Mismatches may occur in overhang regions or double-stranded regions. Base pairs can be ranked based on their tendency to promote dissociation or fusion (e.g., by the free energy of association or dissociation of a particular pairing, the simplest approach being to examine pairs on a basis of individual pairs, although the following adjacency analysis or similar analysis may also be used). In terms of promoting dissociation: A:U is preferred over G:C, G:U is preferred over G:C, and I:C is preferred over G:C (I = inosine). Mismatches, e.g., non-canonical pairing or non-canonical pairing (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairing, and pairing involving universal bases is preferred over canonical pairing.

[0410] In some embodiments, the dsRNA molecule of the present disclosure includes at least one of the first 1, 2, 3, 4, or 5 base pairs in the double-stranded region from the 5' end of the antisense strand, which can be independently selected from the group of A:U, G:U, I:C, and mismatch pairs, e.g., non-canonical pairing or pairing other than canonical pairing or pairing including universal bases, in order to facilitate the dissociation of the antisense strand at the 5' end of the double helix.

[0411] In some embodiments, the nucleotide at position 1 in the double-strand region from the 5' end of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs in the double-strand region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the double-strand region from the 5' end of the antisense strand is an AU base pair.

[0412] It has been found that introducing a 4'-modified or 5'-modified nucleotide to the 3' end of a phosphodiester (PO), phosphorothioate (PS), or phosphorodithioate (PS2) linkage of a dinucleotide at any position on a single-stranded or double-stranded oligonucleotide exerts a steric effect on the nucleotide linkage, thereby protecting and stabilizing it from nucleases.

[0413] In some embodiments, a 5'-modified nucleoside is introduced at the 3' end of a dinucleotide at any position in a single-stranded or double-stranded siRNA. For example, a 5'-alkylated nucleoside can be introduced at the 3' end of a dinucleotide at any position in a single-stranded or double-stranded siRNA. The alkyl group at the 5' position of the ribose sugar can be a racemic mixture or a chiralally pure R or S isomer. An exemplary 5'-alkylated nucleoside is the 5'-methyl nucleoside. The 5'-methyl can be either a racemic mixture or a chirally pure R or S isomer.

[0414] In some embodiments, a 4'-modified nucleoside is introduced at the 3' end of a dinucleotide at any position in a single-stranded or double-stranded siRNA. For example, a 4'-alkylated nucleoside can be introduced at the 3' end of a dinucleotide at any position in a single-stranded or double-stranded siRNA. The alkyl group at the 5' position of the ribose sugar can be racemic or a chiralally pure R or S isomer. An exemplary 4'-alkylated nucleoside is the 4'-methyl nucleoside, which can be either racemic or a chirally pure R or S isomer. Alternatively, a 4'-O-alkylated nucleoside can be introduced at the 3' end of a dinucleotide at any position in a single-stranded or double-stranded siRNA. The 4'-O-alkyl of the ribose sugar can be racemic or a chirally pure R or S isomer. An exemplary 4'-O-alkylated nucleoside is the 4'-O-methyl nucleoside. The 4'-O-methyl nucleoside can be either a racemic mixture or a chiralally pure R or S isomer.

[0415] In some embodiments, a 5'-alkylated nucleoside is introduced at any position on the sense or antisense strand of the dsRNA, and such modification maintains or improves the potency of the dsRNA. The 5'-alkyl can be either a racemic mixture or a chiralally pure R or S isomer. An exemplary 5'-alkylated nucleoside is the 5'-methyl nucleoside. The 5'-methyl can be either a racemic mixture or a chirally pure R or S isomer.

[0416] In some embodiments, a 4'-alkylated nucleoside is introduced at any position on the sense or antisense strand of the dsRNA, and such modification maintains or improves the potency of the dsRNA. The 4'-alkyl can be either a racemic or a chiralally pure R or S isomer. An exemplary 4'-alkylated nucleoside is the 4'-methyl nucleoside. The 4'-methyl can be either a racemic or a chirally pure R or S isomer.

[0417] In some embodiments, the 4'-O-alkylated nucleoside is introduced at any position on the sense or antisense strand of the dsRNA, and such modification maintains or improves the potency of the dsRNA. The 5'-alkyl can be either racemic or a chiralally pure R or S isomer. An exemplary 4'-O-alkylated nucleoside is the 4'-O-methyl nucleoside. The 4'-O-methyl can be either racemic or a chirally pure R or S isomer.

[0418] In some embodiments, the dsRNA molecules of this disclosure may include a 2'-5' ligation (having 2'-H, 2'-OH, and 2'-OMe, and being P=O or P=S). For example, the 2'-5' ligation modification can be used to promote nuclease resistance, to inhibit the binding of sense to the antisense strand, or to avoid sense strand activation by RISC at the 5' end of the sense strand.

[0419] In other embodiments, the dsRNA molecules of this disclosure may contain L-sugars (e.g., L-ribose, L-arabinose having 2'-H, 2'-OH, and 2'-OMe). For example, these L-sugar modifications can be used to promote nuclease resistance, to inhibit the binding of sense to the antisense strand, or to avoid sense strand activation by RISC at the 5' end of the sense strand.

[0420] Multimeric siRNAs have been described in various publications, all of which can be used in conjunction with the dsRNAs of this disclosure. Such publications include WO2007 / 091269, US7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887, and WO2011 / 031520, which are incorporated in their entirety herein.

[0421] In some embodiments, the dsRNA molecules of this disclosure are 5' phosphorylated or contain a phosphoryl analog at the 5' prime terminus. The 5' phosphate modification includes those compatible with RISC-mediated gene silencing. Suitable modifications include 5'-monophosphate ((HO)2(O)PO-5'), 5'-diphosphate ((HO)2(O)POP(HO)(O)-O-5'), 5'-triphosphate ((HO)2(O)PO-(HO)(O)POP(HO)(O)-O-5'), and 5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO)(O)PO -(HO)(O)POP(HO)(O)-O-5'), 5'-adenosine cap (Appp) and any modified or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'), 5'-monothiophosphate (phosphorothioate, (HO)2(S)PO-5'), 5'-monoditithiophosphate (phosphorodithioate, (HO)(HS) Examples include (S)PO-5'), 5'-phosphorothiolate ((HO)2(O)PS-5'), any further combination of oxygen / sulfur-substituted monophosphates, diphosphates and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidites ((HO)2(O)P-NH-5', (HO)(NH2)(O)PO-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-, 5'-alkenylphosphonates (i.e., vinyl, substituted vinyl), (OH)2(O)P-5'-CH2-), and 5'-alkyletherphosphonates (R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g., RP(OH)(O)-O-5'-). For example, the modification can be placed within the antisense strand of a dsRNA molecule.

[0422] Linker In some embodiments, the conjugates or ligands described herein can be attached to iRNA oligonucleotides using a variety of linkers, which may or may not be cleavable.

[0423] Linkers are typically directly bonded or composed of atoms such as oxygen or sulfur, units such as NR8, C(O), C(O)NH, SO, SO2, SO2NH, or not, but one or more methylene groups may be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylal Quinnyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylal Kenyl, alkyl heteroarylalkynyl, alkenyl heteroarylalkyl, alkenyl heteroarylalkenyl, alkenyl heteroarylalkynyl, alkenyl heteroarylalkynyl, alkynyl heteroarylalkyl, alkynyl heteroarylalkenyl, alkynyl heteroarylalkynyl, alkyl heterocyclylalkyl, alkyl heterocyclylalkenyl, alkyl heterocyclylalkynyl (alkylhererocyclylalkynyl), alkenyl heterocyclylalkyl, alkenyl heterocyclylalkenyl, alkenyl heterocyclylalkynyl, alkynyl heterocyclylalkynyl, alkynyl heterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkyl heteroaryl, alkenyl heteroaryl, alkynyl heteroaryl (alkynylhereroaryl), R8 is hydrogen, acyl, aliphatic or substituted aliphatic, and includes a chain of atoms such as substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic, etc.In some embodiments, the linker has approximately 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7 to 17, 8 to 17, 6 to 16, 7 to 16, or 8 to 16 atoms.

[0424] In some embodiments, the dsRNA of this disclosure is conjugated to a bivalent or trivalent branched linker selected from the group of structures represented by any of formulas (XXXI) to (XXXIV):

[0425] [ka] [In the formula, q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C each independently represent a number from 0 to 20 for each occurrence, and the repeating units may be the same or different. P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C Each occurrence is independently of the following: non-existent, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH, or CH2O. Q 2A Q 2B Q 3A Q 3B Q 4A Q 4B Q 5A Q 5B Q 5C Each occurrence is independently of whether it is a non-existent alkylene, a substituted alkylene, and one or more methylenes, O, S, S(O), SO2, N(R)N ), C(R')=C(R''), C≡C or C(O) may interrupt or terminate by one or more of these. R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C For each occurrence, independently, the non-existent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R) a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] or heterocycline, L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C R represents a ligand, that is, independently for each occurrence, a monosaccharide (e.g., GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. a [H is an amino acid side chain.]

[0426] Those of formula (XXXV): [ka] Trivalent conjugated GalNAc derivatives such as these are particularly useful for use with RNAi agents to inhibit the expression of target genes. [In the formula, L 5A , L 5B and L 5C This represents a monosaccharide, for example, a GalNAc derivative.

[0427] Examples of suitable divalent and trivalent branched linker groups for conjugating GalNAc derivatives include, but are not limited to, the structures listed above, such as formulas II, VII, XI, X, and XIII.

[0428] A cleavable linker is one that is sufficiently stable outside the cell but, upon entering the target cell, is cleaved, releasing the two parts held together by the linker. In some embodiments, the cleavable linker is cleaved at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or more, or at least about 100 times faster in the target cell or under a first reference condition (which may be selected to mimic or represent intracellular conditions) than in the target blood or under a second reference condition (which may be selected to mimic or represent conditions found in blood or serum).

[0429] Cleavable linking groups are susceptible to the influence of cleavage agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleavage agents are more common or found at higher levels or activity inside cells than in serum or blood. Examples of such degrading agents include redox agents selected for specific substrates or those without substrate specificity, including reducing agents such as mercaptans present in cells that can degrade redox-cleavable linking groups by oxidase or reductase or reduction, esterases, endosomes, or agents that can create an acidic environment, such as those that result in a pH of 5 or less, general acids, peptidases (which may be substrate-specific), and enzymes that can hydrolyze or degrade acid-cleavable linking groups by acting as phosphatases.

[0430] Cleavable linking groups, such as disulfide bonds, can be susceptible to pH changes. While human serum has a pH of 7.4, the average intracellular pH is slightly lower, ranging from approximately 7.1 to 7.3. Endosomes have a more acidic pH in the range of 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers may have cleavable linking groups that are cleaved at a suitable pH, thereby releasing cationic lipids from ligands into desired compartments within the cell.

[0431] The linker may contain cleavable linking groups that can be cleaved by specific enzymes. The types of cleavable linking groups incorporated into the linker may vary depending on the cells to be targeted.

[0432] Generally, the suitability of a candidate cleavable linker can be evaluated by testing the ability of a degrading agent (or condition) to cleave the candidate linker. It would also be desirable to test the candidate cleavable linker for its ability to resist cleavage in blood or in contact with other non-target tissues. Thus, the relative sensitivity to cleavage between the first and second conditions can be determined, with the first being selected to exhibit cleavage in target cells and the second being selected to exhibit cleavage in other tissues or biological fluids, such as blood or serum. Evaluations can be carried out in cell-free systems, in cells, in cell cultures, in organs or tissue cultures, or in whole animals. It may be useful to perform initial evaluations in cell-free or culture conditions and confirm them with further evaluations in whole animals. In some embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0433] Redox-cleavable linking groups In some embodiments, the cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of a reductively cleavable linking group is a disulfide linking group (-SS-). To determine whether a candidate cleavable linking group is a suitable “reductively cleavable linking group” or whether it is suitable for use with, for example, a particular iRNA moiety and a particular targeting agent, one can turn to the methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the rate of cleavage that would be observed in cells, e.g., target cells. Candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In some cases, candidate compounds are cleaved up to about 10% in blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions selected to mimic intracellular media compared to conditions selected to mimic extracellular media.

[0434] Phosphate-based cleavable linking groups In some embodiments, the cleavable linker includes a phosphate-based cleavable linking group. The phosphate-based cleavable linking group is cleaved by agents that decompose or hydrolyze the phosphate group. Examples of agents that cleave phosphate groups in cells include enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, -OP(S)(Rk)-S- [wherein Rk may be a C1-C20 alkyl, a C1-C20 haloalkyl, a C6-C10 aryl, or a C7-C12 aralkyl, independently for each occurrence]. In some embodiments, the phosphate-based linking group may be -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-O-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, or -OP(S)(H)-S-. In some embodiments, the phosphate-based linking group is -OP(O)(OH)-O-. These candidates can be evaluated using a method similar to that described above.

[0435] Acid-cleavable linking groups In some embodiments, the cleavable linker includes an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable linking group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or lower), or by a drug such as an enzyme that can act as a general acid. In cells, certain low-pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for acid-cleavable linking groups. Examples of acid-cleavable linking groups, but not limited to them, include hydrazones, esters, and amino acid esters. Acid-cleavable groups may have the general formula -C=NN-, C(O)O, or -OC(O). In some embodiments, the carbon bonded to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group, such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.

[0436] Ester-based cleavable linking groups In some embodiments, the cleavable linker includes an ester-based cleavable linking group. This ester-based linking group is cleaved by enzymes such as esterases and amidases in the cell. Examples of ester-based cleavable linking groups, but not limited to them, include esters of alkylene, alkenylene, and alkynylene groups. Ester-cleavable linking groups have the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.

[0437] Peptide-based cleavable linking groups In some embodiments, the cleavable linker includes a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. The peptide-based cleavable linking group is a peptide bond formed between amino acids, resulting in oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not contain an amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene, or alkylene. A peptide bond is a special type of amide bond formed between amino acids, resulting in peptides and proteins. The peptide-based cleavable group is generally limited to peptide bonds (i.e., amide bonds) formed between amino acids, resulting in peptides and proteins, and does not include the entire amide functional group. The peptide-based cleavable linking group has the general formula -NHCHRAC(O)NHCHRBC(O)- (wherein RA and RB are the R groups of two adjacent amino acids). These candidates can be evaluated using methods similar to those described above.

[0438] Representative U.S. patents teaching the preparation of RNA conjugates include, but are not limited to, U.S. Patents 4,828,979, 4,948,882, 5,218,105, 5,525,465, 5,541,313, 5,545,730, 5,552,538, 5,578,717, 5,580,731, 5,591,584, 5,109,124, 5,118,802, 5,138,045, 5,414,077, and 5,486,603, 5,512,439, 5,578,718, 5,608,046, 4,587,044, 4,605,735, 4,667,025, 4,762,779, 4,789,737, 4,824,941, 4,835,263, 4,876,335, 4,904,582, 4,958,013, 5,082,830, 5,112,963, 5,214,136, 5,082,830, 5,112,963, 5,214,136, 5,245,022, 5,254,469, 5,258,506, 5,262,536, 5,272,250, 5,292,873, 5,317,098, No. 5,371,241, No. 5,391,723, No. 5,416,203, No. 5,451,463, No. 5,510,475, No. 5,512,667, No. 5,514,785, No. 5,565,552, No. 5,567,810, No. Examples include Nos. 5,574,142, 5,585,481, 5,587,371, 5,595,726, 5,597,696, 5,599,923, 5,599,928, and Nos. 5,688,941, 6,294,664, 6,320,017, 6,576,752, 6,783,931, 6,900,297, 7,037,646, and 8,106,022, the entire contents of each of these are incorporated herein by reference.

[0439] It is not necessary for all positions in a given compound to be uniformly modified; in fact, two or more of the modifications can be incorporated into a single compound, or even into a single nucleoside within an iRNA. This disclosure also includes iRNA compounds that are chimeric compounds.

[0440] In relation to this disclosure, “chimeric” iRNA compound or “chimeric” means an iRNA compound, e.g., a dsRNA, that contains two or more chemically distinct regions, each composed of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region in which the RNA is modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to a target nucleic acid. Further regions of the iRNA can act as substrates for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. For example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double-stranded hybrid. Thus, activation of RNase H results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, compared to phosphorothioate deoxy dsRNAs that hybridize to the same target region, it is often possible to obtain results that can be compared with shorter iRNAs when chimeric dsRNAs are used. Cleavage of RNA targets can be routinely detected by gel electrophoresis and, if necessary, by relevant nucleic acid hybridization techniques known in the art.

[0441] In certain cases, the RNA of an iRNA can be modified with non-ligand groups. Several non-ligand molecules have been conjugated to iRNAs to enhance their activity, cell distribution, or cell uptake, and procedures for carrying out such conjugations are available in the scientific literature. These non-ligand portions include lipid portions such as cholesterol [Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61, Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553], cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioethers, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306, Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), fatty acid chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111, Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651, Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969) or adamantane acetate (Manoharan et al.These included (Tetrahedron Lett., 1995, 36:3651), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative U.S. patents teaching the preparation of such RNA conjugates are listed above. A typical conjugation protocol involves the synthesis of RNA having aminolinkers at one or more positions in its sequence. The amino group then reacts with the conjugated molecule using an appropriate coupling or activating reagent. The conjugation reaction can be performed while the RNA is still bound to a solid support or after the RNA has been cleaved in solution. Purification of the RNA conjugate by HPLC usually yields a pure conjugate.

[0442] iRNA delivery The delivery of iRNA to a target requiring it can be achieved in several different ways. In vivo delivery can be carried out directly by administering a composition containing iRNA, such as dsRNA, to the target. Alternatively, delivery can be carried out indirectly by administering one or more vectors that encode iRNA and induce its expression. These alternatives are further described below.

[0443] Direct delivery In general, any method for delivering nucleic acid molecules can be adapted to the use of iRNA [for example, Akhtar S. and Julian RL., (1992) Trends Cell. Biol., which is incorporated herein in its entirety by reference]. See 2(5):139-144 and WO94 / 02595. However, there are three important factors to consider for the successful delivery of iRNA molecules in vivo: (1) the biological stability of the delivered molecule, (2) prevention of nonspecific effects, and (3) accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, e.g., direct injection or transplantation into tissue (e.g., the spine) or local administration of a preparation. Local administration to the treatment site maximizes the local concentration of the drug, limits exposure of the drug to systemic tissues that may be harmed or degraded by the drug, and allows for a lower total dose of the iRNA molecule administered. Several studies have shown successful knockdown of gene products when iRNA is administered locally. For example, intraocular delivery of VEGF dsRNA by intravitreal injection in cynomolgus monkeys [Tolentino, MJ. et al., (2004) Retina Both direct injection of dsRNA into mice [24:132-138] and subretinal injection in mice [Reich, SJ. et al. (2003) Mol. Vis. 9:210-216] have been shown to prevent neovascularization in experimental models of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA into mice can reduce tumor volume [Pille, J. et al. (2005) Mol. Ther. 11:267-274] and prolong the survival of mice with tumors [Kim, WJ. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523].RNA interference can be administered to the CNS by direct injection [Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, PH. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, GT., et al. (2004) Neuroscience 129:521-528; Thakker, ER., et al. (2004) Proc. Natl. Acad. Sci. USA 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602] and to the lungs by intranasal administration [Howard, KA. et al., (2006) Mol. Ther. [14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55], success has also been demonstrated by local delivery. When iRNA is administered systemically for the treatment of a disease, the RNA can be modified, or instead, it can be delivered using a drug delivery system; both methods function to prevent the rapid degradation of dsRNA by endonucleases and exonucleases in vivo.

[0444] Modification of RNA or pharmaceutical carriers can also enable the targeting of iRNA compositions to target tissues and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to other groups, such as lipid or carbohydrate groups as described herein. Such conjugates can be used to target iRNA to specific cells, such as liver cells. For example, GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to specific cells, such as liver cells.

[0445] iRNA molecules can also be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, systemic injection of iRNA derived to ApoB conjugated to a lipophilic cholesterol moiety into mice resulted in knockdown of apoB mRNA in both the liver and jejunum [Soutschek, J. et al., (2004) Nature 432:173-178]. Conjugation of iRNA to aptamers has been shown to inhibit tumor growth and mediate tumor reduction in a mouse model of prostate cancer [McNamara, JO. et al., (2006) Nat. Biotechnol. 24:1005-1015]. In alternative embodiments, iRNA can be delivered using drug delivery systems, such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of negatively charged iRNA molecules and enhance interactions with negatively charged cell membranes, thereby enabling efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can bind to iRNA or be induced to form vesicles or micelles that encapsulate iRNA [see, for example, Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116]. Vesicle or micelle formation further prevents the degradation of iRNA when administered systemically. Methods for preparing and administering cationic iRNA complexes are well within the capabilities of those skilled in the art [see, for example, Sorensen, DR., et al. (2003) J. Mol. Biol 327:761-766; Verma, UN. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety].Some non-limiting examples of drug delivery systems useful for systemic iRNA delivery include DOTAP [Sorensen, DR., et al (2003), supra; Verma, UN. et al., (2003), supra], oligofectamine, "solid nucleic acid lipid particles" [Zimmermann, TS. et al., (2006) Nature 441:111-114], cardiolipin [Chien, PY. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091], and polyethylenemine [Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol.]. Examples include iRNA

[71659] , Arg-Gly-Asp(RGD) peptide [Liu, S. (2006) Mol. Pharm. 3:472-487], and polyamidoamine [Tomalia, DA. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804]. In some embodiments, the iRNA forms a complex with cyclodextrin for systemic administration. Methods of administration and pharmaceutical compositions of iRNA and cyclodextrin can be found in U.S. Patent No. 7,427,605, which is incorporated herein by reference in whole.

[0446] iRNA encoded by a vector In some embodiments, the iRNA targeting SCN9A may be expressed from a transcript unit inserted into a DNA or RNA vector [see, for example, Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO00 / 22113, Conrad, International PCT Publication No. WO 00 / 22114, and Conrad, U.S. Patent No. 6,054,299]. Expression may be transient (from a few hours to several weeks) or persistent (from several weeks to several months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, and they may be integrated or non-integrated vectors. The introduced gene can also be constructed to allow it to be inherited as an extrachromosomal plasmid [Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995)92:1292].

[0447] Individual strands (one or more) of iRNA can be transcribed from a promoter on an expression vector. If two separate strands are expressed to produce, for example, dsRNA, two separate expression vectors can be co-introduced into target cells (e.g., by transfection or infection). Alternatively, each individual strand of dsRNA can be transcribed by a promoter both located on the same expression plasmid. In some embodiments, dsRNA is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

[0448] iRNA expression vectors are typically DNA plasmids or viral vectors. Recombinant constructs for the expression of iRNAs described herein can be generated using expression vectors compatible with eukaryotic cells, for example, vertebrate cells. Eukaryotic cell expression vectors are known in the art and are available from several commercial sources. Such vectors typically contain restriction sites convenient for the insertion of desired nucleic acid segments. Delivery of iRNA expression vectors can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells explanted from a patient and subsequent reintroduction into the patient, or by any other means that enable introduction into desired target cells.

[0449] iRNA expression plasmids can be transfected into target cells as complexes with cationic lipid carriers (e.g., oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdown targeting different regions of the target RNA over a period of one week or longer are also envisioned in this disclosure. The success of vector introduction into host cells can be monitored using various known methods. For example, transient transfections can be signaled using a reporter such as a fluorescent marker, e.g., green fluorescent protein (GFP). Stable transfection of cells in ex vivo can be ensured using markers that provide transfected cells with resistance to specific environmental factors (e.g., antibiotics and drugs), e.g., hygromycin B resistance.

[0450] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, e.g., lentivirus vectors, Moloney's mouse leukemia virus, etc., but are not limited to these; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) vesicular virus vectors, e.g., orthopox, e.g., vaccine virus vectors or tripox, e.g., canarypox or fowlpox; and (j) helper-dependent or gutless adenoviruses. Replication-deficient viruses may also be advantageous. Different vectors may or may not be incorporated into the cell genome. The construct may, if desired, contain a viral sequence for transfection. Alternatively, the construct may be incorporated into episomal replication-capable vectors, e.g., EPV and EBV vectors. Constructs for the recombinant expression of iRNA will generally require regulatory elements, such as promoters and enhancers, to ensure iRNA expression in target cells. Other aspects of vectors and constructs to consider are further described below.

[0451] A vector useful for iRNA delivery will contain regulatory elements (promoters, enhancers, etc.) sufficient for iRNA expression in the desired target cells or tissues. These regulatory elements can be selected to provide either constitutive or regulated / inducible expression.

[0452] iRNA expression can be precisely regulated, for example, by using inducible regulatory sequences that are sensitive to certain physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for managing dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, dimerizing chemical inducers, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art will be able to select an appropriate regulatory / promoter sequence based on the intended use of the iRNA transgene.

[0453] In specific embodiments, viral vectors containing a nucleic acid sequence encoding iRNA can be used. For example, retroviral vectors can be used [see Miller et al., Meth. Enzymol. 217:581-599 (1993)]. These retroviral vectors contain the components necessary for the correct packaging of the viral genome and its integration into host cell DNA. The nucleic acid sequence encoding iRNA is cloned into one or more vectors, which facilitates the delivery of the nucleic acid to the patient. Further details regarding retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy include: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors intended for use include, for example, HIV-based vectors described in U.S. Patents 6,143,520, 5,665,557, and 5,981,276, which are incorporated herein by reference.

[0454] Adenoviruses are also intended for use in iRNA delivery. Adenoviruses are a particularly attractive vehicle for delivering genes to, for example, respiratory epithelium. Adenoviruses spontaneously infect respiratory epithelium, where they cause mild illness. Other targets for adenovirus-based delivery systems include the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) outline adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors for introducing genes into rhesus monkey respiratory epithelium. Other examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94 / 12649; and Wang, et al., Gene Therapy 2:775-783 (1995). AV vectors suitable for expressing the iRNAs featured in this disclosure, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0455] The use of adeno-associated virus (AAV) vectors is also being considered [Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No. 5,436,146]. In some embodiments, the iRNA can be expressed as two distinct, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, a U6 or H1 RNA promoter or a cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNAs featured in this disclosure, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher KJ et al. (1996), J. Virol., 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; International Patent Application No. WO94 / 13788; and International Patent Application No. WO93 / 24641, the full contents of which are incorporated herein by reference.

[0456] Other common viral vectors include poxviruses, such as vaccinia viruses, such as attenuated vaccinia, such as modified virus Ankara (MVA) or NYVAC, and tripox, such as fowlpox or canary pox.

[0457] The tropism of a viral vector can be modified by pseudotyping the vector with envelope proteins or other surface antigens derived from other viruses, or by substituting different viral capsid proteins as needed. For example, lentiviral vectors can be pseudotyped with surface proteins derived from vesicular stomatitis virus (VSV), rabies, Ebola, Mocola, etc. AAV vectors can be constructed to target different cells by manipulating them to express different capsid protein serotypes; see, for example, Rabinowitz JE et al. (2002), J Virol 76:791-801, the full disclosure of which is incorporated herein by reference.

[0458] A vector-based drug may contain the vector in an acceptable diluent, or it may contain a delayed-release matrix in which the gene delivery medium is embedded, or, if a complete gene delivery vector can be generated intact from recombinant cells, such as a retroviral vector, the drug may contain one or more cells that generate a gene delivery system.

[0459] III. Pharmaceutical composition containing iRNA In some embodiments, this disclosure provides pharmaceutical compositions containing an iRNA as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing iRNA are useful for treating diseases or disorders associated with the expression or activity of SCN9A (e.g., pain, e.g., chronic pain or pain-related disorders). Such pharmaceutical compositions are formulated based on the mode of delivery. In some embodiments, the composition can be formulated for local delivery, for example, by CNS delivery (which may also be by injection into the brain or spine by continuous pump infusion, e.g., intrathecal, intracranial, intracerebral, ventricular, epidural, or intraganglionic injection routes). In other embodiments, the composition can be formulated for systemic administration via parenteral delivery, for example, by intravenous (IV), intramuscular (IM), or subcutaneous (subQ) delivery. In some embodiments, the compositions provided herein (e.g., compositions containing a GalNAc conjugate or LNP formulation) are formulated for intravenous delivery.

[0460] The pharmaceutical compositions featured herein are administered in doses sufficient to inhibit SCN9A expression. Generally, suitable doses of iRNA range from 0.01 to 200.0 milligrams per kilogram of recipient body weight per day, typically ranging from 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered in single doses of 0.05 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, or 50 mg / kg.

[0461] In some embodiments, the repeated-dose regimen may include regular, therapeutic doses of the RNAi agent, for example, once a month to once every six months. In certain embodiments, the RNAi agent is administered approximately once a quarter (i.e., once every three months) to twice a year.

[0462] After the initial treatment regimen (e.g., loading dose), the treatment may be administered at a reduced frequency.

[0463] In other embodiments, the pharmaceutical composition may be administered once daily, or the iRNA may be administered at appropriate intervals throughout the day in two, three or more partial doses, or further by serial infusion or sustained-release formulation. In this case, the amount of iRNA contained in each partial dose must be reasonably small to achieve the total daily dose. Dosage units may also be formulated for delivery over several days, for example, using conventional sustained-release formulations that provide sustained release of iRNA over a period of several days. Sustained-release formulations are known in the art and are particularly useful for drug delivery at specific sites, such as when used with the drugs of this disclosure. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0464] The effect of a single dose on SCN9A levels may be long-lasting, and as a result, subsequent doses may be administered at intervals of 3, 4, or 5 days or less, or at intervals of 1, 2, 3, 4, 12, 24, or 36 weeks or less.

[0465] Those skilled in the art will understand that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the subject's overall health and / or age, and other pre-existing conditions, may influence the dose and timing required to effectively treat the subject. Furthermore, treatment of the subject with a therapeutically effective dose of the composition may consist of a single treatment or a series of treatments. Estimation of the effective dose and in vivo half-life of individual iRNAs encompassed by this disclosure can be performed using conventional methodologies based on in vivo studies using suitable animal models.

[0466] Using a suitable animal model, such as a mouse or cynomolgus monkey, or an animal containing a transgene expressing human SCN9A, the therapeutically effective dose and / or effective dosage regimen of SCN9A siRNA can be determined.

[0467] In some embodiments, the iRNA compounds described herein may be delivered to target specific tissues, such as the CNS (e.g., brain or spinal cord tissue, such as the cerebral cortex, cerebellum, dorsal root ganglia, substantia nigra, cerebellar dentate nucleus, globus pallidus, striatum, brainstem, thalamus, subthalamic nucleus, red nucleus, and pontine nuclei, cranial nerve nuclei, and anterior horn; as well as the Clark column of the spinal cord, cervical vertebrae, lumbar vertebrae, or thoracic spinal cord).

[0468] This disclosure also includes pharmaceutical compositions and formulations comprising iRNA compounds characterized herein. The pharmaceutical compositions of this disclosure may be administered in several ways, depending on whether topical or systemic treatment is desired and the area to be treated. Administration may be local (e.g., by intrathecal, intraventricular, intracranial, epidural, or ganglion injection), topical (e.g., oral and sublingual administration), oral, intravitreous, percutaneous, respiratory (aerosol), nasal, rectal, or parenteral. Parenteral administration may include intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, subcutaneous (e.g., by an implanted device), or intracranial (e.g., intraparenchymal, subarachnoid, or intraventricular administration).

[0469] In some embodiments, administration is by bolus injection. In some embodiments, administration is by depot injection. Depot injection allows for the continuous release of the RNAi agent over a long period of time. Therefore, depot injection can reduce the frequency of administration required to obtain the desired effect, such as the desired inhibition of SCN9A, or a therapeutic or prophylactic effect. In some embodiments, administration is by pump. The pump may be an external pump or a surgically implantable pump. In other embodiments, the pump is an infusion pump. The infusion pump may be used for intracranial, intravenous, or epidural infusion. In certain embodiments, the pump is a surgically implantable pump that delivers the RNAi agent to the CNS.

[0470] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, solutions, and powders. Conventional pharmaceutical carriers, aqueous, powdery, or oily bases, thickeners, etc., may be necessary or desirable. Coated condoms, gloves, etc., may also be useful. Suitable topical formulations include those in which the iRNA characterized in this disclosure is a mixture with a topical delivery agent, such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidylethanolamine DOPE, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNAs featured in this disclosure may be encapsulated within liposomes or may form complexes with liposomes, particularly cationic liposomes. Alternatively, the iRNAs may complex with lipids, particularly cationic lipids. Suitable fatty acids and esters, but not limited to, include arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaproate, tricaproate, monoolein, dilaurin, glyceryl 1-monocaproate, 1-dodecyl azacycloheptana-2-one, acylcarnitine, acylcholine, or C 1~20 Examples include alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, deglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0471] Liposome formulations Aside from microemulsions, which have been studied and used for drug formulation, there are numerous other organized surfactant structures. These include monolayers, micelles, dilayers, and vesicles. Vesicles, such as liposomes, have attracted considerable interest from a drug delivery perspective due to the specificity and duration of action they offer. As used in this disclosure, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in two spherical layers (one or more).

[0472] Liposomes are monolayer or multilayer vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes are not efficiently able to fuse with the cell wall but are taken up by macrophages in vivo.

[0473] To penetrate intact mammalian skin, lipid vesicles must pass through a series of micropores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use highly deformable liposomes capable of passing through such micropores.

[0474] Further advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can encapsulate a variety of water- and lipid-soluble drugs; and liposomes can protect encapsulated drugs within their internal compartments from metabolism and degradation [Rosoff in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245]. Important considerations in the preparation of liposomal formulations include the charge of the lipid surface, the size of the vesicles, and the amount of water in the liposomes.

[0475] Liposomes are useful for the transport and delivery of active ingredients to the site of action. Because the liposome membrane is structurally similar to biological membranes, when liposomes are applied to tissue, they begin to merge with the cell membrane. As the merging of liposomes and cells progresses, the contents of the liposome flow into the cell, where the active drug can act.

[0476] Liposome formulations have been the focus of extensive research as a delivery method for many drugs. There is growing evidence that liposomes offer advantages over other formulations for topical administration. These advantages include higher systemic absorption of the administered drug and reduced associated side effects, increased accumulation of the administered drug at the desired target, and the ability to deliver a wide range of drugs, both hydrophilic and hydrophobic, into the skin.

[0477] Several reports have detailed the ability of liposomes to deliver drugs containing high molecular weight DNA into the skin. Analgesics, antibodies, hormones, and compounds containing high molecular weight DNA have been administered to the skin. The majority of applications have consequently targeted the upper epidermis.

[0478] Liposomes are classified into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form a stable complex. The positively charged DNA / liposome complex binds to the negatively charged cell surface and is internalized into an endosome. Due to the acidic pH within the endosome, the liposome ruptures, releasing its contents into the cytoplasm [Wang et al. (1987) Biochem. Biophys. Res. Commun., 1987, 147:980-985].

[0479] Liposomes are either pH-sensitive or negatively charged, and they capture DNA rather than complex it with them. Since both DNA and lipids are similarly charged, repulsion occurs rather than complex formation. Nevertheless, some DNA is captured into the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding thymidine kinase genes to a cell monolayer in culture. Exogenous gene expression was detected in the target gene [Zhou et al. Journal of Controlled Release, 1992, 19:269-274].

[0480] One of the main types of liposome compositions contains phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions can be formed from, for example, dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, while anionic fusion liposomes are mainly formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC), such as soy PC and egg PC. Yet another type is formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0481] Several studies have evaluated the topical delivery of liposomal drug formulations to the skin. Application of interferon-containing liposomes to guinea pig skin resulted in a reduction in cutaneous herpes scores, while delivery of interferon by other means (e.g., as a solution or emulsion) was ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Furthermore, additional studies have tested the efficacy of interferon administered as part of a liposomal formulation compared to administration using an aqueous system, concluding that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0482] Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, have also been investigated to determine their usefulness in drug delivery to the skin. Nonionic liposome formulations containing Novasome® I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome® II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine-A into the dermis of mouse skin. The results showed that such nonionic liposome systems are effective in promoting the accumulation of cyclosporine-A in different layers of the skin [Hu et al., STPPharma. Sci., 1994, 4, 6, 466].

[0483] Liposomes also include “stereostabilized” liposomes, and as used herein, this term means liposomes that, when incorporated into liposomes, result in an enhanced circulating lifespan compared to liposomes lacking such specialized lipids. An example of a stereostabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome contains (A) one or more glycolipids, e.g., monosialoganglioside G M1 (B): containing, or (B): derivatized by one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. While we do not wish to be bound by any particular theory, in the art, at least in the case of sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivativeized lipids, the enhanced circulating half-life of these sterically stabilized liposomes is thought to be due to reduced intracellular uptake by the reticuloendothelial system (RES) [Allen et al., FEBS Letters, 1987, 223:42; Wu et al., Cancer Research, 1993, 53, 3765].

[0484] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. [Ann. NY Acad. Sci., 1987, 507, 64] reported on the ability of monosialoganglioside GM1, galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. These findings are described by Gabizon et al. [Proc. Natl. Acad. Sci. USA, 1988, 85, 6949]. U.S. Patent No. 4,837,028 and WO88 / 04924 (both by Allen et al.) disclose liposomes containing (1) sphingomyelin and (2) ganglioside GM1 or galactocerebroside sulfate. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimiristoylphosphatidylcholine are disclosed in WO97 / 13499 (Lim et al.).

[0485] Numerous liposomes containing lipids derivatized with one or more hydrophilic polymers and methods for preparing them are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described the use of 2C, a nonionic surfactant. 1215GLiposomes containing a PEG portion have been described. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with high molecular weight glycols results in a significantly enhanced blood half-life. Synthetic phospholipids modified by the attachment of carboxyl groups of polyalkylene glycools (e.g., PEG) have been described by Sears (US Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes containing phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have a significantly increased blood circulating half-life. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended these observations to other PEG-derivative phospholipids, such as DSPE-PEG formed from combinations of disteloylphosphatidylethanolamine (DSPE) and PEG. Liposomes having a covalently bonded PEG moiety on their outer surface are described in Fisher's European Patent Nos. EP0445131B1 and WO90 / 04384. Liposome compositions containing PE derivatized with 1 to 20 mol percent of PEG and methods of use thereof are described by Woodle et al. (U.S. Patents 5,013,556 and 5,356,633) and Martin et al. (U.S. Patent No. 5,213,804 and European Patent No. EP0496813B1). Liposomes containing several other lipid-polymer conjugates are disclosed in WO91 / 05545 and U.S. Patent No. 5,225,212 (both by Martin et al.), and in WO94 / 20073 (Zalipsky et al.). Liposomes containing PEG-modified ceramide lipids are described in WO96 / 10391 (Choi et al.).U.S. Patent No. 5,540,935 (Miyazaki et al.) and U.S. Patent No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized at a functional portion on their surface.

[0486] Several liposomes containing nucleic acids are known in the art. Thierry et al.'s WO96 / 40062 discloses a method for encapsulating high molecular weight nucleic acids in liposomes. Tagawa et al.'s U.S. Patent No. 5,264,221 discloses protein-bound liposomes, and it is determined that the contents of such liposomes may contain dsRNA. Rahman et al.'s U.S. Patent No. 5,665,710 describes a specific method for encapsulating oligodeoxynucleotides in liposomes. Love et al.'s WO97 / 04787 discloses liposomes containing dsRNA targeted to the raf gene.

[0487] Transfersomes are another type of liposome, highly deformable lipid aggregates, and an attractive candidate for drug delivery systems. Because they are highly deformable, transfersomes can be described as lipid droplets, as they can easily penetrate through pores smaller than those of lipid droplets. Transfersomes adapt to the environment in which they are used; for example, they are self-optimal (adaptable to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmentation, and are often autoloading. To construct transfersomes, surface edge activators, usually surfactants, can be added to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been found to be as effective as subcutaneous injection of a serum albumin-containing solution.

[0488] Surfactants find broad applications in formulations such as emulsions (including microemulsions) and liposomes. The most common method for classifying and grading the properties of the many different types of natural and synthetic surfactants is by using the hydrophilic / lipophilic balance (HLB). The properties of the hydrophilic group (also known as the "head") provide the most useful means for categorizing the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0489] When surfactant molecules are not ionized, they are classified as nonionic surfactants. Nonionic surfactants have found wide applications in pharmaceuticals and cosmetic products and can be used in a wide range of pH values. Generally, their HLB values ​​range from 2 to about 18, depending on their structure. Examples of nonionic surfactants include nonionic esters, such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as aliphatic alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, also belong to this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

[0490] Surfactants are classified as anionic if the surfactant molecule retains a negative charge when dissolved or dispersed in water. Examples of anionic surfactants include carboxylates (e.g., soaps), acyl lactylates, acylamides of amino acids, esters of sulfuric acid (e.g., alkyl sulfates and ethoxylated alkyl sulfates), sulfonates (e.g., acetylbenzenesulfonate), acyl isethionates, acyl taurates, and sulfosuccinates and phosphates. The most common members of the anionic surfactant class are alkyl sulfates and soaps.

[0491] A surfactant is classified as cationic if its molecules retain a positive charge when dissolved or dispersed in water. Examples of cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used members of this class.

[0492] A surfactant is classified as amphoteric if its molecule has the ability to retain either a positive or negative charge. Examples of amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phosphatides.

[0493] The use of surfactants in pharmaceuticals, formulations, and emulsions is outlined (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0494] nucleic acid lipid particles In some embodiments, the SCN9A dsRNA featured in this disclosure is sufficiently encapsulated in a lipid formulation to form SPLPs, pSPLPs, SNALPs, or other nucleic acid-lipid particles. SNALPs and SPLPs typically comprise cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALPs and SPLPs are highly useful for systemic administration because they exhibit an extended circulating lifetime after intravenous injection (iv) and accumulate at distal sites (e.g., sites physically separated from the administration site). SPLPs include “pSPLPs,” which comprise encapsulated condensant-nucleic acid complexes, as detailed in PCT publication number WO00 / 03683. The particles of this disclosure typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, when nucleic acids are present in the nucleic acid-lipid particles of this disclosure, they are resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patents 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO96 / 40964.

[0495] In some embodiments, the ratio of lipids to drugs (mass / mass ratio) (e.g., the ratio of lipids to dsRNA) may be in the range of approximately 1:1 to approximately 50:1, approximately 1:1 to approximately 25:1, approximately 3:1 to approximately 15:1, approximately 4:1 to approximately 10:1, approximately 5:1 to approximately 9:1, or approximately 6:1 to approximately 9:1.

[0496] Cationic lipids include, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilenoleyloxy-N,N-dimethylaminopropane (DLinDMA), l,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), and 1,2-dilenoleyl Lucarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilenoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilenoleyloxy-3-trimethylaminopropane chloride (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride (DLin-TAP.Cl).Cl), 1,2-dilenoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ) or 3-(N,N-dilenoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilenoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilenoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or similar thereof The cationic lipids may be (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazine-1-yl)ethylazandiyl)didodecane-2-ol (Tech G1) or mixtures thereof. Cationic lipids may constitute about 20 mol% to about 50 mol% or about 40 mol% of the total lipids present in the particles. .

[0497] In some embodiments, the compound 2,2-dilenoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilenoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed on 23 October 2008, and is incorporated herein by reference.

[0498] In some embodiments, the lipid-siRNA particles contain 40% 2,2-dilenoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, 10% DSPC, 40% cholesterol, and 10% PEG-C-DOMG (mol percent), and have a particle size of 63.0 ± 20 nm and an siRNA / lipid ratio of 0.027.

[0499] Noncationic lipids may be anionic or neutral lipids, but are not limited to these. Examples include disteroylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), and palmitoyloleoylphosphatidylethanolamine (P This includes OPE, dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), disteloyl-phosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), cholesterol, or mixtures thereof. Noncationic lipids may constitute about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% if cholesterol is included, of the total lipids present in the particles.

[0500] Conjugated lipids that inhibit particle aggregation may include, for example, polyethylene glycol (PEG)-lipids containing, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof. PEG-DAA conjugates may include, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C8). The amount of conjugated lipids preventing particle aggregation may be 0 mol% to about 20 mol% or about 2 mol% of the total lipids present in the particles.

[0501] In some embodiments, the nucleic acid-lipid particles further contain, for example, about 10 mol% to about 60 mol% or about 48 mol% of the total lipids present in the particles, which is cholesterol.

[0502] In some embodiments, the iRNA is formulated in lipid nanoparticles (LNPs).

[0503] LNP01 In some embodiments, lipid-dsRNA nanoparticles (e.g., LNP01 particles) can be prepared using the lipidoid ND98·4HCl (MW 1487) (see U.S. Patent Application No. 12 / 056,230, filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-ceramide C16 (Avanti Polar Lipids). Each preservation solution in ethanol can be prepared ...

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium channel voltage-gated IX-type alpha subunit (SCN9A), wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, and the antisense strand is as shown in Table 2A, 2B, 4A, 4B, 5A, 5B, 6A A double-stranded ribonucleic acid (dsRNA) agent comprising a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches from one of the antisense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20, wherein the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having 0, 1, 2, or 3 mismatches from one of the sense sequences listed in any one of Tables 2A, 2B, 4A, 4B, 5A, 5B, 6A, 6B, 13A, 13B, 14A, 14B, 15A, 15B, 16, 18, and 20 corresponding to the antisense sequence.

2. The dsRNA agent according to claim 1, wherein the sense strand portion is a portion within nucleotides 581-601, 760-780, or 8498-8518 of SEQ ID NO: 4001.

3. The dsRNA agent according to claim 1 or 2, wherein the sense strand portion is a portion of the sense strand derived from a double helix selected from AD-1251284 (UGUCGAGUACACUUUUACUGA (SEQ ID NO: 4827)), AD-961334 (CAACACAATUTCUUCUUAGCA (SEQ ID NO: 5026)), or AD-1251325 (AAAACAAUCUUCCGUUUCAAA (SEQ ID NO: 4822)).

4. The dsRNA agent according to any one of claims 1 to 3, wherein the sense strand portion is a sense strand selected from the sense strands of AD-1251284 (UGUCGAGUACACUUUUACUGA (SEQ ID NO: 4827)), AD-961334 (CAACACAATUTCUUCUUAGCA (SEQ ID NO: 5026)), or AD-1251325 (AAAACAAUCUUCCGUUUCAAA (SEQ ID NO: 4822)).

5. The dsRNA according to any one of claims 1 to 4, wherein the portion of the antisense strand is a portion of the antisense strand derived from a double helix selected from AD-1251284 (UCAGTAAAAGUGUACTCGACAUU (SEQ ID NO: 5093)), AD-961334 (UGCUAAGAAGAAATUGUGUUGUU (SEQ ID NO: 5292)), or AD-1251325 (UUUGAAACGGAAGAUUGUUUUCC (SEQ ID NO: 5088)).

6. The dsRNA according to any one of claims 1 to 5, wherein the portion of the antisense strand is an antisense strand selected from the antisense strands of AD-1251284 (UCAGTAAAAGUGUACTCGACAUU (SEQ ID NO: 5093)), AD-961334 (UGCUAAGAAGAAATUGUGUUGUU (SEQ ID NO: 5292)), or AD-1251325 (UUUGAAACGGAAGAUUGUUUUCC (SEQ ID NO: 5088)).

7. The dsRNA according to any one of claims 1 to 6, wherein the sense strand and antisense strand comprise nucleotide sequences of a double-stranded pair formed from AD-1251284 (SEQ ID NOs. 4827 and 5093), AD-961334 (SEQ ID NOs. 5026 and 5292), or AD-1251325 (SEQ ID NOs. 4822 and 5088).

8. The dsRNA agent according to any one of claims 1 to 7, wherein the antisense strand comprises a nucleotide sequence of an antisense sequence listed in Table 16, and the sense strand comprises a nucleotide sequence of a sense sequence listed in Table 16 that corresponds to the antisense sequence.

9. A dsRNA agent according to any one of claims 1 to 8, wherein the agent is AD-1251284, AD-961334, AD-1251325, AD-1331352, AD-1209344, or AD-1331350.

10. A dsRNA agent according to any one of claims 1 to 9, wherein at least one of the sense strand and the antisense strand is conjugated to one or more lipophilic moieties.

11. The dsRNA agent according to claim 10, wherein the lipophilic portion is conjugated via a linker or carrier.

12. The dsRNA agent according to claim 10 or 11, wherein one or more lipophilic moieties are conjugated at one or more internal positions on at least one strand.

13. The dsRNA agent according to claim 12, wherein one or more lipophilic moieties are conjugated at one or more internal positions on at least one strand via a linker or carrier.

14. The dsRNA agent according to any one of claims 10 to 13, wherein the lipophilic portion is an aliphatic, alicyclic, or polyalicyclic compound.

15. The dsRNA agent according to claim 14, wherein the lipophilic portion contains a saturated or unsaturated C16 hydrocarbon chain.

16. A dsRNA agent according to any one of claims 10 to 15, conjugated via a carrier that replaces one or more nucleotides in a lipophilic region, an internal position, or a double-stranded region.

17. The dsRNA agent according to any one of claims 10 to 15, wherein the lipophilic portion is conjugated to a double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfamide linkage, click reaction product, or carbamate.

18. A double-stranded iRNA agent according to any one of claims 10 to 16, wherein the lipophilic portion is conjugated to a nucleic acid base, a sugar portion, or an internucleoside linkage.

19. A dsRNA agent according to any one of the above claims, comprising at least one modified nucleotide.

20. The dsRNA agent according to claim 19, wherein five or fewer nucleotides of the sense strand and five or fewer nucleotides of the antisense strand are unmodified nucleotides.

21. The dsRNA agent according to claim 19, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand are modified.

22. At least one of the modified nucleotides is selected from the group consisting of deoxy-nucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramides, nucleotides containing unnatural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a phosphorothioate group, nucleotides containing a methylphosphonate group, nucleotides containing a 5'-phosphate, nucleotides containing a 5'-phosphate mimetic, glycol-modified nucleotides, and 2-O-(N-methylacetamide)-modified nucleotides and combinations thereof, as described in any one of claims 19 to 21.

23. A dsRNA agent according to any one of the above claims, wherein at least one strand comprises a 3' overhang of at least two nucleotides.

24. A dsRNA agent according to any one of the above claims, wherein the double-stranded region is 15 to 30 nucleotide pairs long.

25. The dsRNA agent according to claim 24, wherein the double-stranded region has a length of 17 to 23 nucleotide pairs.

26. A dsRNA agent according to any one of the above claims, wherein each chain has 19 to 30 nucleotides.

27. A dsRNA agent according to any one of the above claims, comprising at least one phosphorothioate or methylphosphonate nucleotide linkage.

28. A dsRNA agent according to any one of claims 10 to 27, further comprising a targeted ligand, for example, a ligand that targets CNS tissue.

29. The dsRNA agent according to claim 28, wherein the targeted ligand is a ligand that targets CNS tissue.

30. The dsRNA agent according to claim 29, wherein the CNS tissue is brain tissue or spinal cord tissue.

31. A dsRNA agent according to any one of the above claims, further comprising a phosphate or phosphate mimic at the 5' end of the antisense strand.

32. The dsRNA agent according to claim 31, wherein the phosphate mimic is 5'-vinyl phosphonate (VP).

33. (i) The sense strand includes the sequence and all modifications of SEQ ID NO: 4029, and the antisense strand includes the sequence and all modifications of SEQ ID NO: 4295, (ii) The sense strand includes the sequence and all modifications of sequence number 4228, and the antisense strand includes the sequence and all modifications of sequence number 4494. (iii) The sense strand includes the sequence and all modifications of sequence number 5339, and the antisense strand includes the sequence and all modifications of sequence number 5355. (iv) The sense strand contains the sequence and all modifications of SEQ ID NO: 5800, and the antisense strand contains the sequence and all modifications of SEQ ID NO: 5801. (v) The sense strand contains the sequence and all modifications of SEQ ID NO: 5526, and the antisense strand contains the sequence and all modifications of SEQ ID NO: 5681, or (vi) The sense strand includes the sequence and all modifications of SEQ ID NO: 5542, and the antisense strand includes the sequence and all modifications of SEQ ID NO: 5697. The dsRNA according to any one of the above claims.

34. Cells containing the dsRNA agent according to any one of claims 1 to 33.

35. A pharmaceutical composition for inhibiting the expression of SCN9A, comprising a dsRNA agent according to any one of claims 1 to 33.

36. A method for inhibiting SCN9A expression in cells, (a) Contacting cells with a dsRNA agent according to any one of claims 1 to 33 or a pharmaceutical composition according to claim 35, and (b) Maintain the cells generated in step (a) for a sufficient time to reduce the levels of SCN9A mRNA, SCN9A protein, or both SCN9A mRNA and protein, thereby inhibiting SCN9A expression in the cells. A method that includes this.

37. The method according to claim 36, wherein the cells are located within the target area.

38. The method according to claim 37, wherein the subject is a human.

39. The method according to claim 38, wherein the subject is diagnosed with SCN9A-related disorders, such as pain, such as chronic pain, such as inflammatory pain, neuropathic pain, pain hypersensitivity, pain hyposensitivity, primary erythromelalgia (PE), paroxysmal excruciating pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infection.

40. A method for treating a subject having or diagnosed with an SCN9A-related disorder, comprising administering to the subject a therapeutically effective amount of a dsRNA agent according to any one of claims 1 to 33 or a pharmaceutical composition according to claim 35, thereby treating the disorder.

41. The method according to claim 40, wherein the SCN9A-related disorder is pain, for example, chronic pain.

42. The method according to claim 40, wherein the SCN9A-related disorder is chronic pain.

43. The method according to claim 41 or 42, wherein the chronic pain is related to one or more disorders from the group consisting of pain hypersensitivity, pain hyposensitivity, analgesia, primary erythromelalgia (PE), paroxysmal severe pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), or pain associated with cancer, arthritis, diabetes, trauma or viral infection.

44. The method according to any one of claims 40 to 43, wherein the treatment comprises improvement of at least one sign or symptom of the disorder.

45. The method according to any one of claims 40 to 44, wherein the treatment comprises (a) reducing pain, or (b) inhibiting or reducing the expression or activity of SCN9A.

46. The method according to any one of claims 37 to 45, wherein the dsRNA agent is administered intracranially or intrathecally to a subject.

47. The method according to claim 44, wherein the dsRNA agent is administered to the target intrathecally, intraventricularly, or intracerebrally.

48. The method according to any one of claims 37 to 47, further comprising administering to the subject an additional agent or therapy suitable for the treatment or prevention of SCN9A-related disorders [e.g., a nonsteroidal anti-inflammatory drug (NSAID), acetaminophen, opioids, or corticosteroids, acupuncture, therapeutic massage, dorsal root ganglion stimulation, spinal cord stimulation, or topical analgesics].

Images