Plant genome editing methods

Abstract

To provide a plant genome editing method with higher genome editing efficiency. [Solution] A method for editing the genome of a plant, comprising: (1) treating the meristematic tissue of a shoot capable of forming a plant with 5 to 50 mM boron compound; and (2) introducing a CRISPR / Cas system into the meristematic tissue subjected to the boron compound treatment in step (1) by particle bombardment.

Description

Technical Field

[0001] The present invention relates to a plant genome editing method, and more specifically, to a genome editing method wherein a CRISPR / Cas system is introduced into a meristem of a bud having shoot-forming ability such as a shoot apex by a particle bombardment method.

Background Art

[0002] Genome editing technologies have developed worldwide, and the development of genome-edited crops is accelerating. Under such circumstances, the present inventors have developed a crop genome editing technology "In Planta Particle Bombardment (iPB) method" (Patent Document 1). The iPB method is a genome editing technology that directly introduces a genome editing enzyme into a meristem such as a plant shoot apex, and in principle, can be applied to various crops without requiring tissue culture. However, the genome editing efficiency varies depending on the crop species and target gene. Therefore, further improvement of the efficiency is desired.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0004] The present invention has been made in view of the problems of the prior art, and an object thereof is to provide a plant genome editing method with higher genome editing efficiency.

Means for Solving the Problems

[0005] As a result of extensive studies to achieve the above object, the present inventors have found that genome editing efficiency is improved by treating plant shoot apex cells with boric acid before introducing a complex (RNP) of gRNA and Cas9 protein into the plant shoot apex cells by the iPB method, and have completed the present invention.

[0006] In other words, the present invention provides the following embodiments.

[0007] [1] A method for editing the genome of a plant, comprising the following steps (1) and (2). (1) A step of treating the meristematic tissue of a plant bud capable of forming shoots with a boron compound in a concentration of 5-50 mM. (2) A step of introducing the CRISPR / Cas system into the meristematic tissue by particle bombardment.

[0008] [2] The method according to [1], wherein the boron compound is boric acid.

[0009] [3] The method according to [1] or [2], wherein the time for treatment with the boron compound in step (1) is 12 to 36 hours.

[0010] [4] The method according to any one of [1] to [3], wherein the Cas protein constituting the CRISPR / Cas system is the Cas9 protein or the Cas12 protein.

[0011] [5] The method according to any one of [1] to [4], wherein the meristematic tissue is the shoot apex.

[0012] [6] A method for producing a genome-edited plant, further comprising the step of growing a meristematic tissue into which the CRISPR / Cas system has been introduced to obtain a plant body by the method described in any one of [1] to [5]. [Effects of the Invention]

[0013] According to the present invention, it becomes possible to perform plant genome editing more efficiently. Furthermore, it becomes possible to efficiently manufacture genome-edited plants. [Brief explanation of the drawing]

[0014] [Figure 1]This photograph shows the results of observing wheat seeds treated with boric acid (0, 10, 30, or 100 mM) after incubation (22°C, 1 week). [Figure 2] This is an electrophoresis image showing the results of genome editing analysis of the SD1 gene in plants obtained by introducing a CRISPR / Cas9 system targeting the SD1 gene using the iPB method, using the CAPS method (restriction enzyme: SalI). [Figure 3] This is an electrophoresis image showing the results of genome editing analysis of the AHG1 gene in plants obtained by introducing a CRISPR / Cas9 system targeting the AHG1 gene using the iPB method, using the CAPS method (restriction enzyme: MboI). [Figure 4] This graph shows the genome editing efficiency in plants obtained by introducing a CRISPR / Cas9 system targeting the SD1 gene using the iPB method. The genome editing efficiency shown on the vertical axis represents the ratio of the number of genome-edited individuals obtained by growing seed shoot apexes to the number of seed shoot apexes treated with the iPB method. The horizontal axis shows the boric acid concentration after treating the shoot apex for 24 hours before CRISPR / Cas9 system introduction using the iPB method. The number of tests and analysis samples for each condition were 6 tests and 215 analysis samples for the "boric acid concentration 0 mM" condition; and 4 tests and 144 analysis samples for the "boric acid concentration 15 mM" condition. In the figure, the genome editing efficiency is shown as the mean ± standard error of these values. [Figure 5] This graph shows the genome editing efficiency in plants obtained by introducing a CRISPR / Cas9 system targeting the AHG1 gene using the iPB method. The genome editing efficiency is the same as in Figure 4. The number of tests and analysis samples for each condition were as follows: for the condition "boric acid concentration 0 mM", there were 2 tests and 72 analysis samples; for the condition "boric acid concentration 15 mM", there were 5 tests and 180 analysis samples; and for the condition "boric acid concentration 30 mM", there were 5 tests and 180 analysis samples. In the figure, the genome editing efficiency is shown as the mean ± standard error of these values. [Modes for carrying out the invention]

[0015] The present invention relates to a plant genome editing method comprising the following steps (1) and (2), and as shown in the Examples described later, the method is particularly characterized by step (1). (1) a step of treating a meristem of a bud having shoot-forming ability of a plant with a 5 to 50 mM boron compound, (2) a step of introducing a CRISPR / Cas system into the meristem by a particle bombardment method.

[0016] <Plant> The genome editing method according to the present invention can be widely and generally applied to plants that produce seeds, plants that produce rhizomes, and plants that can be subjected to shoot apical culture. Therefore, the target plants of the present invention are seed plants including angiosperms and gymnosperms. Angiosperms include monocotyledons and dicotyledons.

[0017] The "monocotyledonous plant" may be of any type, and examples thereof include plants of the family Poaceae, Amaryllidaceae, Asparagaceae, Musaceae, Bromeliaceae, and Orchidaceae. Examples of the "Poaceae plant" include rice, wheat, barley, maize, oat, zoysia, sorghum, rye, foxtail millet, sugarcane and the like. Examples of the "Amaryllidaceae plant" include green onion and the like. Examples of the "Asparagaceae plant" include asparagus and the like. Examples of the "Musaceae plant" include banana and the like. Examples of the "Bromeliaceae plant" include pineapple and the like. Examples of the "Orchidaceae plant" include orchid and the like.

[0018] ["Dicotyledonous plants" include, for example, Brassicaceae plants, Fabaceae plants, Solanaceae plants, Cucurbitaceae plants, Convolvulaceae plants, Rosaceae plants, Moraceae plants, Malvaceae plants, Asteraceae plants, Amaranthaceae plants, and Polygonaceae plants. Examples of "Brassicaceae plants" include Arabidopsis thaliana, Chinese cabbage, rapeseed, cabbage, cauliflower, radish and the like. Examples of "Fabaceae plants" include soybean, adzuki bean, common bean, pea, cowpea, alfalfa and the like. Examples of "Solanaceae plants" include tomato, eggplant, potato, tobacco, capsicum and the like. Examples of "Cucurbitaceae plants" include oriental melon, cucumber, melon, watermelon and the like. Examples of "Convolvulaceae plants" include morning glory, sweet potato (kansho), bindweed and the like. Examples of "Rosaceae plants" include rose, strawberry, apple and the like. Examples of "Moraceae plants" include mulberry, fig, rubber tree and the like. Examples of "Malvaceae plants" include cotton, kenaf and the like. Examples of "Asteraceae plants" include lettuce and the like. Examples of "Amaranthaceae plants" include sugar beet (sugar beet) and the like. Examples of "Polygonaceae plants" include buckwheat and the like.

[0019] ["Gymnosperms" include pine, cedar, ginkgo, cycad and the like.

[0020] <Meristem of bud having shoot-forming ability> In this invention, "shoot-forming ability" means the ability to elongate and unfold leaves and stems. An example of a shoot meristem having such ability is the shoot apex. "Shoot apex" means the growth point at the tip of the stem (shoot apical meristem), and the tissue consisting of the growth point and several leaf primordia that arise from the growth point. In this invention, only the hemispherical (dome-shaped) growth point from which the leaf primordia have been removed may be used as the shoot apex, or the shoot apex including the growth point and leaf primordia, or the plant tissue including the shoot apex may be used. By using only the growth point from which the leaf primordia have been removed, virus-free tissue can be obtained. Furthermore, in this specification, "germ cell lineage" is a general term for germ cells from primordial germ cells, which are the source of germ cells, to egg cells and sperm cells, which are the final products, and "L2 layer" means the second cell layer from the outside of the shoot apical meristem, and therein there are undifferentiated cells (also called germline cells) that are intended to differentiate into germ cells in the future. In the present invention, shoot apical stem cells that transition to the germline or cells present in the L2 layer (L2 cells) can be suitable targets for CRISPR / Cas system introduction.

[0021] In the present invention, the material used to obtain the shoot tip includes seeds, rhizomes, or terminal buds.

[0022] In the present invention, "seeds" refer to natural seeds obtained by cultivating (or culturing) plants under natural or near-natural conditions. "Natural seeds" are not limited to seeds obtained from fields in the wild, but also include seeds obtained from greenhouse cultivation and seeds obtained from tissue cultures such as in vitro seedlings. Seeds obtained from tissue culture (such as direct reprogramming) can also be used as seeds in the present invention, as long as a shoot apex can be obtained. Furthermore, in the present invention, artificial seeds are also included as seeds. Examples of such "artificial seeds" include those in which a regenerative part of a plant (such as an adventitious bud or adventitious embryo) is enclosed in an artificial membrane to form a capsule, and artificial seeds from which a transformable shoot apex can be obtained can be particularly used in the present invention. In addition, in the present invention, the shoot apex can be obtained from the embryo of the seed, and may be an immature embryo or a mature embryo, but a mature embryo is preferred. That is, among seeds, a mature seed can be more preferably used in the present invention. "Fully ripened seeds" refer to seeds that have completed the ripening process after pollination and are fully mature as seeds. In this invention, fully ripened seeds with a root length of 1 mm or less are more preferred.

[0023] In this invention, "rhizome" refers to a general term for underground stems, including tubers that are lumpy and have many buds, corms that are spherical and have a large terminal bud, and bulbs that are shortened stems with enlarged scale leaves attached to form a spherical shape. In this invention, the shoot apex can be obtained from the young bud of such a rhizome. Also in this invention, "terminal bud" refers to the bud at the tip of the stem. Furthermore, in this invention, the meristematic tissue capable of shoot formation can be obtained not only from the above-mentioned seeds, rhizomes, and terminal buds, but also from axillary buds (lateral buds), adventitious buds, etc.

[0024] In the present invention, there are no particular limitations on the method for obtaining meristematic tissue having shoot-forming ability from such material (buds), but for example, first, mature plant seeds are allowed to absorb water. Vernalization treatment may be performed before water absorption if necessary. Water absorption is carried out by soaking the seeds in water and incubating them. The water absorption temperature is preferably 15-25°C for wheat, barley, or rice, and preferably 25-35°C for corn or soybeans. The water may be changed once or more during this process. The water absorption period is preferably until the radicle begins to elongate or until new leaf primordia are formed, for example, in the case of wheat. Expressed as a water absorption time, it is less than 16 hours after water absorption, preferably 12 hours, depending on the dormant state of the seeds. This water absorption process softens the seeds, making it easier to expose the shoot apex. Next, the shoot apex of the embryo in the seeds that have absorbed water as described above is exposed. In the case of wheat, barley, rice, or corn, the shoot apex is exposed by removing the coleoptile and leaf primordia. In the case of soybeans, the shoot apex is exposed by removing the seed coat and cotyledons. In the case of potatoes, which are grown from underground stems, the shoot apex is exposed by sprouting from seed potatoes and removing the leaf primordia from the excised sprouts. In the case of apples, the shoot apex is exposed by removing the leaf primordia from the seed embryo or the excised apical or lateral bud. Any means of exposure that can remove the coleoptile and leaf primordia or seed coat and cotyledons under a stereomicroscope is acceptable, but examples include puncture tools such as needles with a diameter of about 0.2 mm, tweezers, pipettes, syringes, and cutting tools such as scalpels and cutters. Next, the endosperm and excess blastocyst are removed using a cutting tool such as a scalpel, and the embryo and blastocyst, including the exposed shoot apex, are placed on an agar plate with the shoot apex facing upwards. To obtain virus-free shoot apical ligaments, the scalpel may be replaced with a new, sterile one at the final stage of cutting the shoot apex. In this case, a virus-free plant can be obtained.

[0025] <CRISPR / Casシステム> In the present invention, the CRISPR / Cas system is introduced into the meristematic tissue of a shoot-forming plant bud using the particle bombardment method, and genome editing is introduced into the cells of the meristematic tissue (hereinafter, the meristematic tissue of a shoot-forming plant bud will also simply be referred to as "meristem").

[0026] Genome editing is a technique within the New Breeding Techniques (NBT) framework that uses site-specific nucleases to cut and modify specific genes (target genes) on the genome. More specifically, it includes methods such as using the CRISPR / Cas system to cut target genes and introduce mutations to disrupt those genes, or site-specific insertion and replacement of DNA fragments. Furthermore, genome editing allows for efficient site-specific insertion or replacement of DNA fragments by ligating homologous fragments to both sides of the cleavage sequence with fragments to be introduced into the target DNA fragment. In the case of gene disruption, some countries do not treat the resulting plants as genetically modified because it can disrupt only the targeted gene without leaving any trace of genetic recombination.

[0027] The CRISPR / Cas system uses the Cas protein, which is an RNA-guided nuclease (RGN), and guide RNA. By introducing this system into cells, the guide RNA binds to a target site, and the Cas protein induced at this binding site can cleave the DNA.

[0028] (Cas protein) In the present invention, the "Cas protein" is a CRISPER (clustered regularly interspaced short palindromic repeat)-related enzyme (nuclease), and may be a class 1 CRISPER-related enzyme (e.g., type I such as Cas3, type IV, type III such as Cas10), or a class 2 CRISPER-related enzyme (e.g., type II such as Cas9, type V such as Cas12 (Cas12a (Cpf1), Cas12b (C2c1), Cas12e (CasX), and Cas12f1), and type V such as Cas14, type VI such as Cas13), but is preferably a class 2 CRISPER-related enzyme, more preferably a type II or type V CRISPER-related enzyme, even more preferably Cas9 or Cas12, and particularly preferably Cas9. Examples of "Cas9 proteins" include Streptococcus pyogenes Cas9, Streptococcus pneumoniae Cas9, and S. thermophilus Cas9.

[0029] Typical amino acid and nucleotide sequences of Cas proteins are registered in publicly available databases, such as GenBank (http: / / www.ncbi.nlm.nih.gov), and these can be used in the present invention. For example, typical amino acid and nucleotide sequences of Cas9 protein derived from Streptococcus pyogenes are the sequences described in NCBI Reference Sequence:NP_269215 and NC_002737, respectively.

[0030] Furthermore, the Cas9 protein according to the present invention is not limited to proteins consisting of the typical amino acid sequence described above, but may also be its homolog, ortholog, mutant, or partial peptide, as long as it has the activity to form a complex with guide RNA and cleave target DNA. "Homolog" and "ortholog" include, for example, proteins consisting of amino acid sequences that have 85% or more, preferably 90% or more, and more preferably 95% or more (e.g., 96% or more, 97% or more, 98% or more, 99% or more) identity with the amino acid sequence of the target Cas protein (e.g., the amino acid sequence described in NP_269215). Sequence identity can be evaluated by the numerical value calculated using BLAST, etc. (e.g., default i.e., initial parameters). "Mutants" include proteins consisting of amino acid sequences in which one or more amino acids are substituted, deleted, added, or inserted from the amino acid sequence of the native Cas9 protein (e.g., the amino acid sequence described in NP_269215), and which have endonuclease activity. Here, "multiple" means, for example, 2 to 150, preferably 2 to 100, more preferably 2 to 50 (e.g., 2 to 30, 2 to 10, 2 to 5, 2 to 3, 2). An example of a mutant is a Cas protein in which the recognition specificity of PAM has been modified by introducing mutations into specific amino acid residues. Techniques for modifying the recognition specificity of PAM in Cas proteins are well known (Benjamin, P. et al., Nature 523, 481-485 (2015), Hirano, S. et al., Molecular Cell 61, 886-894 (2016)). Alternatively, a D10A mutant of Cas9, which is known to function as a nickase (a DNA-cutting enzyme that inserts a nick into only one DNA strand), may also be used.

[0031] The Cas protein according to the present invention may be given a nuclear localization signal. This promotes localization to the nucleus within the cell, resulting in efficient genome editing within the nucleus. Furthermore, by adding an organelle localization signal, efficient genome editing within organelles (intracellular organelles such as chloroplasts and mitochondria) becomes possible.

[0032] Those skilled in the art can express the Cas protein according to the present invention as a recombinant protein by loading the DNA encoding the Cas protein onto a suitable vector and introducing it into host cells such as E. coli, animal cells, insect cells, or plant cells, or into a cell-free protein synthesis system (e.g., reticulocyte extract, wheat germ extract). Furthermore, the recombinant protein expressed in host cells, etc., can be purified by known peptide purification methods. In addition, the Cas protein according to the present invention can also be prepared by chemical synthesis using a commercially available polypeptide synthesizer based on its amino acid sequence.

[0033] (Guide RNA) The Cas protein is guided to the target region of the target gene by forming a complex with guide RNA, and its endonuclease activity cleaves the target site within the target region, resulting in genome editing. The "guide RNA" according to the present invention is an RNA that contains a nucleotide sequence that interacts with the Cas protein (hereinafter also referred to as the "Cas interaction sequence") and a nucleotide sequence that is complementary to the nucleotide sequence of the target region (hereinafter also referred to as the "targeting sequence").

[0034] The guide RNA for the CRISPR-Cas system according to the present invention may be a single-molecule guide RNA (sgRNA) containing crRNA and tracrRNA, or a bi-molecule guide RNA consisting of a crRNA fragment and a tracrRNA fragment.

[0035] The targeting sequence in crRNA is typically a nucleotide sequence consisting of 12 to 50 nucleotides, preferably 17 to 30 nucleotides, and more preferably 17 to 25 nucleotides, selected to target a region adjacent to the PAM (proto-spacer adjacent motif) sequence. The crRNA further contains a nucleotide sequence on its 3' end that can interact (hybridize) with tracrRNA. On the other hand, the tracrRNA contains a nucleotide sequence on its 5' end that can interact (hybridize) with some of the nucleotide sequences of the crRNA. The double-stranded RNA formed by the interaction of these nucleotide sequences interacts with the Cas protein.

[0036] There are no particular restrictions on the "target gene" whose genome editing is induced by the guide RNA, and it may be any gene (DNA that codes for any protein, etc.). Examples include genes related to carbohydrate metabolism, lipid metabolism, production of useful substances (pharmaceuticals, enzymes, pigments, aromatic compounds, etc.), plant growth control (promotion / inhibition), flowering control, disease and pest resistance (insect damage resistance, nematode, fungal and bacterial disease resistance, viral disease resistance, etc.), environmental stress (low temperature, high temperature, drought, salt, photodamage, ultraviolet light) resistance, transporter-related genes, milling, bread-making, and noodle-making characteristics-related genes, and recombinant enzyme-related genes. Furthermore, the target gene according to the present invention may be DNA that does not code for any protein, etc. (non-coding DNA). In addition, in the present invention, the number of target genes or target regions to be subjected to genome editing is usually one, but it may be multiple. That is, in the present invention, multiple types of guide RNA may be introduced into the meristematic tissue.

[0037] The guide RNA according to the present invention can also be prepared by those skilled in the art by chemically synthesizing it using a commercially available polynucleotide synthesizer based on its nucleotide sequence. Alternatively, it can be prepared using an in vitro transcription system (for example, a transcription system using phage RNA polymerase (T7 / T3 / SP6)).

[0038] In the present invention, the CRISPR / Cas system is preferably introduced into the meristematic tissue in the form of a complex (RNP) of Cas protein and guide RNA, as shown in the examples described later. However, the Cas protein may be introduced into the meristematic tissue in its protein form, or it may be introduced into the meristematic tissue in the form of nucleotides (DNA, RNA) encoding the Cas protein, and the protein may be expressed within the cells. Similarly, the guide RNA may be introduced into the meristematic tissue in its RNA form, or it may be introduced into the meristematic tissue in the form of DNA encoding the guide RNA, and the RNA may be expressed within the cells. In such cases, the Cas protein and guide RNA form a complex within the cells of the introduced meristematic tissue, and genome editing occurs.

[0039] More specifically, the nucleotide encoding the Cas protein and the DNA encoding the guide RNA are typically expressed in the form of an expression vector encoding the Cas protein and / or guide RNA. When an expression vector is used, it includes one or more regulatory elements that are operationally bound to the target DNA to be expressed (the DNA encoding the Cas protein and / or guide RNA). Here, "operationally bound" means that the target DNA is expressibly bound to the regulatory element. Examples of "regulatory elements" include promoters, enhancers, insulators, and terminators.

[0040] A "promoter" does not have to be of plant origin, as long as it is DNA that functions within a plant or plant cell and constitutively expresses the protein, or can induce expression in a specific plant tissue or at a specific developmental stage. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2-35S omega promoter, the nopaline synthase gene promoter (Pnos), the maize-derived ubiquitin promoter, the rice-derived actin promoter, the tobacco-derived PR protein promoter, the ADH promoter, and the RuBisco promoter. Translation efficiency can be increased by using sequences that enhance translation activity, such as the omega sequence of the tobacco mosaic virus. Furthermore, by inserting an internal ribosome entry site (IRES) 3' downstream of the promoter and 5' upstream of the translation initiation codon as the translation initiation region, proteins can be translated from multiple coding regions. In addition, polIII-type promoters such as the U6 promoter are preferably used as promoters for expressing DNA encoding short RNAs such as guide RNA. Furthermore, by using organelle-specific promoters (promoters expressed only in each organelle), efficient genome editing within each organelle becomes possible.

[0041] The "terminator" can be any sequence that can terminate the transcription of a gene transcribed by the promoter and has a poly-A addition signal. Examples include the nopaline synthase (NOS) gene terminator, the octopin synthase (OCS) gene terminator, and the CaMV35S terminator.

[0042] Furthermore, the expression vector according to the present invention may also contain other sequences. Examples of such other sequences include "marker genes" to confirm whether or not they have been introduced into plant cells. Examples include fluorescent protein genes, luminescent enzyme genes, chromogenic enzyme genes, drug resistance genes, plant hormone biosynthesis genes, replication promoter genes, and cell death suppressor genes. Specific examples of fluorescent protein genes include red fluorescent protein genes such as the DsRed gene and RFP gene, GFP (green fluorescent protein) gene, YFP (yellow fluorescent protein) gene, and aequorin gene. Specific examples of luminescent enzyme genes include the luciferase gene. Specific examples of chromogenic enzyme genes include the β-glucuronidase (GUS) gene, β-galactosidase gene, alkaline phosphatase gene, and SEAP gene. Examples of drug resistance genes include the kanamycin resistance (NPTII) gene, hygromycin resistance (HPT) gene, tetracycline resistance gene, ampicillin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, methotrexate resistance gene (dihydrofolate reductase gene), herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (mutant ALS gene (acetobutyrate synthase gene))). Examples of plant hormone biosynthesis genes include the ipt gene, iaaM gene, iaaH gene, and rol (ro1A, rolB, rolC) gene. Examples of genes that promote somatic embryo formation include the WSU gene, BBM gene, AGL15 gene, and Lec1 gene. Examples of replication-promoting factor genes include the APS gene and ct-ars1 gene. Examples of cell death suppression genes include the ACCd gene, Bax-I gene, and NaGH gene. However, according to the present invention, it is possible to create genome-edited plants without introducing such marker genes.

[0043] The expression vector according to the present invention is not particularly limited as long as the sequence it contains can be expressed in the introduced plant cells. For example, it can take the form of various vectors such as the pAL series (pAL51, pAL156, etc.), the pUC series (pUC18, pUC19, pUC9, etc.), the pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), the pPZP series, the pSMA series, the intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), and tobacco mosaic virus (TMV). However, it is preferable that the expression vector can stably express the encoding Cas protein and / or guide RNA without being incorporated into the host genome.

[0044] In the present invention, when introducing Cas protein and / or guide RNA into a meristematic tissue using such an expression vector, the expression vector encoding the Cas protein and the expression vector encoding the guide RNA may be separate and independent, or they may be a single expression vector (for example, they may take the form of an all-in-one vector).

[0045] Furthermore, the expression vector according to the present invention can be prepared by methods known to those skilled in the art. For example, it can be prepared by cleaving purified target DNA with an appropriate restriction enzyme and ligating it to a multi-cloning site or the like of an appropriate vector that forms the backbone. Alternatively, the target DNA may be inserted into an intermediate vector by double cross-over recombination, and the expression vector according to the present invention can also be prepared using methods such as LR, in-fusion cloning, and TA cloning. Moreover, the nucleotide sequences arranged in the expression vector according to the present invention may be optimized to codons suited to the plant cells into which they are introduced in order to efficiently express their translation products in those cells.

[0046] <Particle Bombard Link Method> The "particle bombardment method" according to the present invention is also called the particle gun method, gene gun method, microparticle gun method, microparticle injection method, or particle delivery method, and refers to a method of introducing microparticles (microcarriers) coated with the CRISPR / Cas system (hereinafter also simply referred to as "the system") into the cells of the meristematic tissue of a shoot-forming bud of a target plant by high-speed injection.

[0047] The material of the "fine particles" coated by the system is not particularly limited, and fine particles (metal fine particles) made of metals such as gold, tungsten, or magnetic particles (such as triiron tetroxide) can be used. Among these, gold particles are preferred. The particle size (diameter) of such fine particles is not particularly limited, but for example, it is 0.3 μm or more and 1.5 μm or less, with a lower limit of 0.4 μm or more, even more preferably 0.5 μm or more, and particularly preferably 0.6 μm. The upper limit of the particle size is more preferably 1.4 μm or less, even more preferably 1.3 μm or less, even more preferably 1.2 μm or less, particularly preferably 1.1 μm or less, and most preferably 1.0 μm or less.

[0048] The microparticles coated with the aforementioned system are typically prepared by washing and sterilizing the microparticles, adding the microparticles and the system while stirring to coat the microparticles with the system, and then washing with ethanol or a buffer solution (such as phosphate-buffered saline (PBS), rCutsmart buffer (manufactured by New England Biolabs (NEB)), etc.). During the stirring process, a substance that provides a positive charge to resolve the three-dimensional structure of the expression vector, etc. (e.g., polyamines such as spermidine) or a substance that promotes the adhesion of the introduced material to the microparticles or the precipitation of the microparticles (e.g., salts such as calcium chloride) can be added to coat the microparticles more efficiently.

[0049] The microparticles coated with the above system are applied as uniformly as possible to a macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench. When the system uses protein-coated microparticles, it is preferable to use a hydrophilic macrocarrier film. The "hydrophilic macrocarrier film" may be made by attaching a hydrophilic film to the macrocarrier film or by applying a hydrophilic coating. Methods for hydrophilizing the film include methods using surfactants, photocatalysts, and hydrophilic polymers. Examples of hydrophilic polymers used in the above methods include polymers of hydrophilic monomers such as polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyethyl methacrylate, 3-sulfopropyl methacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethaneammonium.

[0050] Then, the macrocarrier film and the plate on which the meristematic tissue is placed are set up in the particle gun device, and high-pressure gas is fired from the gas accelerating tube towards the macrocarrier film. The macrocarrier film is stopped by the stopping plate, but the fine particles pass through the stopping plate and penetrate the meristematic tissue placed below the stopping plate, and the system is introduced.

[0051] The "gas" emitted at high pressure is preferably an inert gas, such as helium gas. The gas pressure is preferably 1,100 to 1,600 psi, more preferably 1,200 to 1,500 psi. The optimal gas pressure can be determined appropriately through transient expression experiments or other means, depending on the type of system, the distance to the target meristematic tissue, etc.

[0052] The distance between the stopping plate and the target meristematic tissue depends on the particle size of the microparticles, but is preferably 9 cm or less, more preferably 8 cm or less, even more preferably 7 cm or less, and particularly preferably 6 cm or less. The lower limit of the distance is preferably 2 cm or more, more preferably 3 cm or more, and even more preferably 4 cm or more. The target distance can be appropriately determined by transient expression experiments or other means, depending on the type of microparticles, particle size, gas pressure, etc.

[0053] In the present invention, the number of times microparticles are injected into the meristematic tissue is preferably two or more, more preferably three or more, and more preferably four or more. The upper limit of the number of times microparticles are injected into the meristematic tissue is preferably 20 or less, more preferably 15 or less, and even more preferably 10 or less. The optimal number of injections can be appropriately determined by transient expression experiments or the like.

[0054] <Treatment with boron compounds> As shown in the examples described below, the present invention makes it possible to improve genome editing efficiency by treating the meristematic tissue of shoot-forming buds with a boron compound before subjecting it to the particle bombardment method described above.

[0055] In the present invention, "boron compound" means a compound containing a BOH group (boronic acid group) or a salt thereof, and is not particularly limited as long as it can improve genome editing efficiency; it may be either an inorganic boron compound or an organic boron compound. Examples of inorganic boron compounds include boric acid, metaboric acid, and polyboric acid. Examples of organic boron compounds include phenylboric acid, 1,4-phenylenediboronic acid, and m-aminophenylboronic acid. There are no particular limitations on salts of boron compounds, but examples include alkali metal salts such as sodium salts.

[0056] There are no particular restrictions on the "concentration" of the boron compound used when processing meristematic tissue, as long as it improves genome editing efficiency. Those skilled in the art can adjust the appropriate concentration of the boron compound depending on the type of plant, the type of meristematic tissue, the type of gene targeted in genome editing, etc. For example, it is 5 to 50 mM, preferably 5 to 40 mM, more preferably 5 to 30 mM, even more preferably 10 to 30 mM, more preferably 15 to 30 mM, or more preferably 10 to 20 mM. If the concentration of the boron compound is below the lower limit, it tends to be difficult to improve genome editing efficiency, while if it exceeds the upper limit, it tends to suppress growth such as germination. In this invention, the concentration of boric acid is the actual measured value or calculated value rounded to the nearest whole number. In this invention, only one type of boron compound may be used, or two or more types may be used in combination, but when multiple types of boron compounds are used, the concentration is the sum of the two values.

[0057] In the present invention, treatment with a boron compound is carried out by conventional culture. "Culture" includes not only cultures involving the proliferation and / or growth of meristematic tissue cells, but also cultures for maintaining the properties or survival of meristematic tissue (maintenance cultures). Such cultures can be carried out, for example, by placing meristematic tissue on a plant tissue culture medium. The "plant tissue culture medium" is not particularly limited as long as it can culture the tissue of the target plant, but examples include Murashige-Skoog (MS) medium, Gamborg B5 medium, Thu (N6) medium, or modified versions of these basic media. The medium may be a liquid medium or a solid medium (a medium solidified with agar, gellan gum, or gellan light, etc.).

[0058] Furthermore, treatment with boron compounds can also be carried out by contacting the tissue with an aqueous solution of the boron compound. For example, this can be done by placing the meristematic tissue on a paper-like or fibrous carrier containing an aqueous solution of the boron compound (for example, a Kimwipe moistened with an aqueous solution of the boron compound), or on a solidified aqueous solution of the boron compound.

[0059] The "treatment time" with the boron compound is not particularly limited as long as it is possible to improve the genome editing efficiency, but for example, it is 12 to 36 hours, preferably 18 to 30 hours, more preferably 20 to 26 hours, and even more preferably 24 hours. Similarly, there are no particular limitations on the "temperature" during treatment, and those skilled in the art can adjust it as appropriate depending on the type of plant, the type of meristematic tissue, the type of gene targeted in genome editing, etc., but for example, 22 to 25°C is used.

[0060] In the present invention, treatment with such a boron compound may be performed at least before particle bombardment treatment, but it may also be performed after particle bombardment treatment. In this case, the treatment conditions (boron compound and its concentration, treatment time, culture medium, etc.) may be the same before and after particle bombardment treatment, or they may be different as appropriate.

[0061] Furthermore, treatment with boron compounds may be performed on organs containing meristematic tissue (for example, seeds, rhizomes, apical buds, etc., which are materials from which shoot apex is obtained). More specifically, for example, seeds may be subjected to the above treatment, and then the shoot apex may be exposed and subjected to the particle bombardment method described above.

[0062] <Method for manufacturing genome-edited plants> In this invention, genome-edited plants (plant bodies) can be produced by growing meristematic tissue into which the CRISPR / Cas system has been introduced using the method described above.

[0063] Such "growth" methods are not particularly limited as long as a plant body can be obtained, and those skilled in the art can appropriately adopt known methods according to the type of plant or meristematic tissue being targeted. For example, as described above, meristematic tissue into which the CRISPR / Cas system has been introduced can be cultured on a solid medium for several weeks (e.g., 2 weeks to 1 month) and then transplanted into soil to grow into a plant body.

[0064] Genome-edited plants can be obtained by growing them in a culture medium without applying selective pressure from drugs (i.e., without antibiotics). However, if a drug resistance gene is used as a marker gene as described above, the cells of the meristematic tissue into which the CRISPR / Cas system has been introduced can be selectively cultured by culturing them in a culture medium containing the drug corresponding to that gene. When selection is performed using drugs, as described above, the marker gene can be stored in an expression vector encoding the Cas protein and / or guide RNA, thereby introducing the marker gene into the meristematic tissue cells simultaneously with the CRISPR / Cas system. Alternatively, selection can also be performed using drugs by separately preparing an expression vector encoding the marker gene, mixing it with the expression vector encoding the Cas protein and / or guide RNA, and introducing the mixture into the meristematic tissue cells. As an example of a selective agent suitable for culturing meristematic tissue, sulfonylurea herbicides (such as chlorosulfuron) are known.

[0065] Furthermore, when nucleotides such as expression vectors are introduced, they may be incorporated into the genome of meristematic cells. In addition, off-target effects can occur in genome editing, leading to the introduction of nonspecific mutations. Such mutations introduced into genomic DNA other than the target gene can be removed by self-pollination or backcrossing to produce offspring.

[0066] Furthermore, the selection of plants in which the target gene has been genome-edited can be carried out by those skilled in the art using methods known to the art. Examples of such known methods include DNA sequencing (next-generation sequencing, etc.), PCR (RT-PCR), CAPS, microarray analysis, Southern blotting, and Northern blotting. Using such nucleotide detection methods, it is possible to determine whether or not a mutation has been introduced by genome editing by comparing the sequence or length of the target gene or its transcript before and after the introduction of the mutation, and based on this determination, it is possible to select plants in which the target gene has been genome-edited. In addition to such nucleotide detection methods, selection can also be made by comparing the presence or size of the protein expressed from the target gene before and after the introduction of the mutation. Examples of such protein detection methods include immunostaining of plant fragments, ELISA, RIA, dot immunohistochemistry assay, and Western blotting. Furthermore, the genome editing efficiency can be calculated, for example, from the number of meristematic tissues subjected to the method of the present invention and the number of plants determined to have been genome-edited by the method. In this invention, "high genome editing efficiency" means, for example, that it is higher than the genome editing efficiency when the genome is not treated with a boron compound.

[0067] Using the above method, it is possible to create plants in which the target gene has been genome-edited. Initially, the E0 generation (E1 generation) grown from meristematic tissue such as the shoot apex will be a chimeric state with a mixture of genome-edited cells and wild-type cells. However, this chimeric state can be resolved by obtaining progeny through selection with the above-mentioned drugs, backcrossing, or by utilizing branch mutations. The plants thus produced will then stably express the traits of the genome-edited gene, or the expression of the target gene will be suppressed, and these traits will be normally inherited (transmitted) to the progeny. In other words, once a plant consisting solely of genome-edited somatic cells (an individual in which the chimeric state has been resolved) is obtained, it is possible to obtain offspring from this plant through sexual or asexual reproduction. Furthermore, it is possible to obtain reproductive materials (e.g., seeds, fruits, cuttings, plants, callus, protoplasts, etc.) from this plant, its offspring, or clones, and mass-produce the plant based on these materials.

[0068] Furthermore, the method of the present invention described above corresponds to an implanted genome editing method. An implanted genome editing method is generally a genome editing method that does not involve tissue culture operations, and is a method in which cells at the growth point of a plant are genome edited while the plant is still growing. In the method of the present invention, it is also possible to include only the tissue culture step of obtaining a plant body through the culture of the meristematic tissue of a bud that has the ability to form a shoot, and to omit other tissue culture steps.

[0069] Furthermore, as described above, in the present invention, even if genome editing is performed using an expression vector, it is not necessarily required to integrate it into the genome to obtain a stable transformant. Genome editing can be performed by transiently expressing the Cas protein and / or guide RNA. Genome editing can also be performed by introducing the Cas protein and guide RNA into cells. Therefore, genome-edited plants produced by the method of the present invention may not be genetically modified organisms. [Examples]

[0070] The present invention will be described more specifically below based on examples, but the present invention is not limited to the following examples.

[0071] (Example) Study on the boric acid sensitivity of wheat seeds The sensitivity of wheat seeds to boric acid was evaluated. More specifically, mature seeds of the wheat variety Yumeshihou were first immersed in undiluted bleach and shaken at room temperature for 15 minutes. The seeds were then rinsed three times with tap water, followed by three more rinses with RO water. These seeds were then placed on Kimwipes in a plastic petri dish moistened with sterile water containing 0, 10, 30, or 100 mM boric acid. The seeds were then incubated in light at 22°C for one week, and their condition was observed.

[0072] As a result, as shown in Figure 1, although growth inhibition was observed in proportion to the boric acid concentration, germination was confirmed in the 0-30 mM test plots. On the other hand, in the 100 mM boric acid concentration plot, slight elongation of the leaf sheath was observed, but germination did not occur. Therefore, the iPB method described below was to be applied to boric acid concentrations of 30 mM or less.

[0073] (Example 1) Introduction of RNP into boric acid-treated wheat seeds by iPB method Wheat seed shoot apex was treated with boric acid using the method described below, and RNP was introduced using the iPB method.

[0074] 1. Preparation of fully ripened seeds Fully matured wheat seeds of the Yumeshihou variety were immersed in undiluted bleach and shaken at room temperature for 15 minutes. They were then rinsed three times with tap water and three times with RO water, and placed on Kimtowels in a plastic petri dish moistened with sterile water. Finally, they were incubated overnight at 22°C to allow the seeds to absorb water.

[0075] 2. Exposure of the seed apex Under a stereomicroscope, the seed coat was removed from the embryo portion of the water-absorbing seeds, and the sheath leaves, first leaflet, and second leaflet were removed using a nanopass needle to expose the shoot apical meristem. Next, the embryos were extracted from the endosperm and placed in plastic petri dishes containing MS maltose medium (MS inorganic salts, MS vitamins, 30 g / L maltose, 7 g / L gellan gum, pH 5.8) supplemented with 0, 15, or 30 mM boric acid (32 to 36 embryos per dish). The embryos were then incubated at 22°C for 24 hours.

[0076] Table 1 below shows the content of MS inorganic salts (trace elements, macroelements) and MS vitamins in the aforementioned MS maltose medium. As shown in the table, the MS medium already contains 6.2 mg / L (0.1 mM) of boric acid. Therefore, strictly speaking, the boric acid concentration in MS medium to which 0, 15, or 30 mM boric acid has been added will be 0.1 mM, 15.1 mM, or 30.1 mM, respectively. However, in this example and figure, the boric acid concentration in such medium is shown as a value rounded to the nearest whole number.

[0077] [Table 1]

[0078] 3. Target gene / gRNA We selected either the SD1 (semidwarf 1) gene or the AHG1 (ABA-hypersensitive germination 1) gene as the target gene for genome editing. The target sequences for these genes are as follows: Target sequence in the wheat SD1 gene: GGGCTGGAGGTCCTCGTCGA (Sequence ID: 1) Target sequence within the wheat AHG1 gene: GGACGAGATGGCGCGGATCA (Sequence ID: 2).

[0079] 4. Coating of gold particles with RNP To 50 μg of a solution of Cas9 protein derived from Streptococcus pyogenes, 20 μg of single-stranded RNA (IDT Corporation, product name: Alt-R CRISPR-Cas9 sgRNA) in which the crRNA sequence containing the target sequence and the tracrRNA sequence were linked was added and incubated at 37°C for 5 minutes to form a complex (RNP) between the Cas9 protein and these RNAs. To the above mixture, 2 μL of rCutsmart buffer (NEB Corporation) and 0.8 μL of RNase inhibitor (Takara Bio Corporation) were added, and then sterile Milli-Q water was added to adjust the volume to 20 μL. After standing at room temperature for 10 minutes, 1 / 4 volume of Transit LT1 (Mirus Bio Corporation) was added and mixed. Next, 25 μL of gold particles (InBio Gold, product name: Spherical Gold Particles, particle size 0.6 μm) suspended in sterile Milli-Q water to a density of 40 mg / mL was added and mixed, and the mixture was left to stand on ice for 10 minutes. Subsequently, the mixture was subjected to spin-down (6000 rpm for 5 seconds), the supernatant was removed, and 26 μL of sterile Milli-Q water was added. The gold particle suspension was then stirred in an ultrasonic cleaner, and 6 μL of this mixture was uniformly applied to a 1 cm square hydrophilic film (3M) attached to the center of the macrocarrier, so that it had a diameter of approximately 1 cm. This was then used in the particle bombardment method described below (for four macrocarriers).

[0080] 5. Particle bombardment method Under the following conditions, RNP-coated gold particles were introduced into the shoot apex by particle bombardment. Device: PDS-1000 / He (Bio-Rad Corporation) Driving pressure: 1300 psi Driving distance: Approximately 6cm Number of attempts: 4 After introduction, the plants were incubated in darkness at 22°C for 24 hours. Then, they were transplanted into new MS maltose medium (boric acid concentration: 0.1 mM) and cultured at 22°C under continuous light for 2 weeks. Furthermore, they were transplanted into potting soil and cultivated at 22°C under long-day conditions (16 hours light / 8 hours dark) until the 5th leaf emerged (approximately 20 days).

[0081] 6. Extraction of genomic DNA The fifth leaf (3 mm in diameter) was added to 100 μL of DNA extraction buffer (0.1 M Tris-HCl (pH 9.5), 1 M KCl, 10 mM EDTA) and subjected to grinding using a multi-bead shocker (Yasui Kikai) at 2000 rpm for 10 seconds. Then, 10 μL was taken from this mixture, incubated at 95°C for 10 minutes, and subsequently diluted with 40 μL of sterile Milli-Q.

[0082] 7. Detection of Mutations (PCR) PCR was performed using the following primer set to amplify the region containing the target sequence within the SD1 gene. The PCR composition is shown in Table 2. 230429SD1target2 F:CGGACAGCAGCTCCATCATG(Sequence ID:3) 230429SD1target2 R:GGTGTCGCCGATGTTGATGA(Sequence ID: 4).

[0083] [Table 2]

[0084] PCR targeting the SD1 gene was performed by amplifying the gene at 94°C for 2 minutes, followed by 30 cycles of amplification at 98°C for 10 seconds, 60°C for 30 seconds, and 68°C for 8 seconds.

[0085] PCR was performed using the following primer set to amplify the region containing the target sequence within the AHG1 gene. The PCR composition is shown in Table 3. 211007AHG1Ex3Univ-F:GACCGGCCGGACGAGATGGC(Sequence ID: 5) 211007AHG1Ex3Univ-R:TACCTAGCGCTCGGGACATGGC(Sequence ID: 6).

[0086] [Table 3]

[0087] PCR targeting the AHG1 gene was performed by repeating the amplification reaction 30 times: 2 minutes at 94°C, followed by 10 seconds at 98°C, 20 seconds at 67°C, and 3 seconds at 68°C.

[0088] (CAPS processing) The PCR amplification products prepared as described above were subjected to restriction enzyme treatment under the following conditions, and then electrophoresis was performed using a MultiNA microchip electrophoresis system (Shimadzu Corporation).

[0089] [Table 4]

[0090] [Table 5]

[0091] In the CAPS treatment described above, wild-type PCR amplification products are cleaved, but PCR amplification products with introduced mutations are not digested by restriction enzymes. Therefore, any PCR amplification products found to be undigested were determined to have had mutations introduced (Figures 2 and 3). The genome editing efficiency was then calculated using the number of treated seed shoot apex as the denominator and the number of individuals determined to have had the mutations introduced as the numerator.

[0092] As is clear from the results shown in Figures 4 and 5, treating the seed apex with boric acid before RNP introduction improved genome editing efficiency. On the other hand, although not shown in the figures, treating the seed apex with boric acid only after RNP introduction did not improve genome editing efficiency in analyses targeting the SD1 gene.

[0093] Based on the above, it is suggested that in order to improve genome editing efficiency by treating with boron compounds such as boric acid, it is necessary to treat the target tissue with boric acid at least before RNP introduction. [Industrial applicability]

[0094] As explained above, the present invention makes it possible to perform plant genome editing more efficiently. Conventional techniques require advanced culture systems such as protoplasts. Therefore, it is difficult to apply the technology to many crops, and since genome-edited plants are developed through genetic modification technology, they are unsuitable for developing crops that are socially acceptable. On the other hand, the present invention makes it possible to perform genome editing with higher efficiency without the need for culture or genetic modification technology.

[0095] Therefore, the present invention is useful, for example, in crop breeding, production of useful substances, variety improvement, and functional analysis of target genes.

Claims

1. A method for editing the genome of a plant, comprising the following steps (1) and (2). (1) A step of treating the meristematic tissue of a plant bud capable of forming shoots with a boron compound in a concentration of 5 to 50 mM. (2) A step of introducing the CRISPR / Cas system into the meristematic tissue by particle bombardment.

2. The method according to claim 1, wherein the boron compound is boric acid.

3. The method according to claim 1, wherein the time for treatment with the boron compound in step (1) is 12 to 36 hours.

4. The method according to claim 1, wherein the Cas protein constituting the CRISPR / Cas system is Cas9 protein or Cas12 protein.

5. The method according to any one of claims 1 to 4, wherein the meristematic tissue is the shoot apex.

6. A method for producing a genome-edited plant, further comprising the step of growing a meristematic tissue into which the CRISPR / Cas system has been introduced to obtain a plant body by the method according to any one of claims 1 to 4.

Images