Method for designing probes for detecting gene mutations and probes designed thereby

Abstract

Numerous indels (insertions, deletions, or both) can be found in specific regions of a gene, and these mutations are often unique to each case; therefore, such mutations are detected using a single probe set. [Solution] A method for detecting mutations using the following probe set: Probe 1 hybridizes to region 1 on one strand of the PCR amplification product, and probe 2 hybridizes to region 2 on the other strand, which is different from region 1. In this case, probe 1 and probe 2 each hybridize to the wild-type sequence, and do not hybridize if there is a mutation in the corresponding region (region 1 for probe 1, region 2 for probe 2).

Description

[Technical Field]

[0001] The present invention relates to a method for designing a probe for detecting gene mutations and a probe designed thereby. [Background technology]

[0002] Cancer cells have specific gene mutations. Patent Document 1 describes a gene mutation detection kit that can detect the presence or absence of mutations in regions where gene mutations are concentrated, comprising: a probe that hybridizes to each of several independent, non-overlapping regions contained within the exon of a target gene when the base sequence of said region is wild-type; a labeling substance that indicates that each of the probes has hybridized to said region; and a primer pair designed to contain all of the said multiple regions in a single amplicon obtained by polymerase chain reaction.

[0003] A drop-off digital PCR (DPCR) assay has been developed that uses two probes on the same amplicon. In this method, the drop-off probe corresponds to the mutation hotspot, is complementary to the wild-type sequence, and does not hybridize to the mutant sequence (drops off). In contrast, the reference probe corresponds to a region close to the mutation site and hybridizes to both the amplicon containing the mutation and the wild-type amplicon. Non-patent document 1 proposes a double drop-off digital droplet PCR (DDO-ddPCR) assay for detecting and quantifying gene mutations in NPM1, IDH2, and NRAS, which can detect and quantify diverse mutations in two adjacent hotspot regions present in a gene. This method uses probes corresponding to two hotspots on a single amplicon. More specifically, it uses two drop-off probes that hybridize to the wild-type sequence but do not hybridize to sequences with base substitutions, insertions, or deletions. Furthermore, as an application of the method using two drop-off probes, Non-Patent Document 2 describes the use of a multiplex drop-off digital PCR (MDO-dPCR) assay, which combines amplification / ratio-based multiplexing with a drop-off / double drop-off strategy, for detecting mutations in PIK3CA.

[0004] Meanwhile, the present inventors have developed a probe / primer pair set suitable for detecting mutations in circulating tumor DNA (ctDNA) derived from tumor cells using dPCR (Patent Documents 2 and 3). [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] Japanese Patent Publication No. 2018-113898 [Patent Document 2] Japanese Patent Publication No. 6544783 (International Publication WO2020 / 026776) [Patent Document 3] International release WO2024 / 111057 [Non-patent literature]

[0006] [Non-Patent Document 1] The Journal of Molecular Diagnostics, 2021; 23(8):975-985 [Non-Patent Document 2] The Journal of Molecular Diagnostics, 2023; 25(6):388-402 [Overview of the project] [Problems that the invention aims to solve]

[0007] Typically, in PCR reactions aimed at detecting gene mutations, primers are shared between the wild-type and mutant sequences. Probes use two types of fluorescent substances, such as FAM and HEX. One probe is designed to hybridize to the wild-type sequence, and the other primer to hybridize to the mutant sequence. The presence or absence of the mutant sequence in the amplified product is determined by which probe binds to a specific region. In this case, one specific mutation can be detected per probe set. However, since a specific region of a gene may contain many indels (insertions, deletions, or both), and these mutations are often unique to each case, it is desirable to be able to detect such mutations with a single probe set. [Means for solving the problem]

[0008] The inventors attempted to design two probes using FAM and HEX, each hybridizing to the wild-type sequence in the first (upstream) and second (downstream) portions of the target region, respectively, but with different DNA strands. They also attempted to overlap portions of the regions to which these two probes hybridize (Figure 1a).

[0009] This unconventional design allows for the detection of multiple mutations with a single primer-probe set. For example, an amplicon with a mutation in a region complementary to the FAM probe will yield only the HEX signal, while an amplicon with a mutation in a region complementary to the HEX probe will yield only the FAM signal. On the other hand, an amplicon with a wild-type sequence will yield both FAM and HEX signals (Figure 1b).

[0010] Furthermore, if the area where the first probe hybridizes and the area where the second probe hybridizes do not overlap, even if insertions or duplications occur in the region between them or in their vicinity, both probes can hybridize, making detection and quantification impossible (Figure 2). However, if there are many insertions in the target region, this problem can be resolved by overlapping the HEX probe and the FAM probe.

[0011] The present invention provides the following: [1] A method for designing a probe set capable of detecting multiple mutations in a PCR amplification product, including the following: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and We designed a probe 2, which is the other chain and hybridizes to a region 2 different from region 1. In this method, probe 1 and probe 2 are designed to hybridize to the wild-type sequence, but not to hybridize if there is a mutation in the corresponding region (region 1 for probe 1, region 2 for probe 2). [2] The method according to 1, wherein region 1 and region 2 overlap. [3] The method according to 1 or 2, wherein the plurality of mutations are present in a region of 20 to 100 bases in length, 20 to 80 bases in length, or 20 to 50 bases in length. [4] The method according to any one of 1 to 3, comprising designing probe 3 that hybridizes to a region 3 different from regions 1 and 2 on one or the other strand of the PCR amplification product, in order to expand the region where detectable mutations are present. [5] The method according to any one of 1 to 4, wherein the region where a plurality of detectable mutations are present is any one region selected from exon 19 of the EGFR gene, exon 20 of the EGFR gene, the region from c.2290 to c.2340 of the ERBB2 gene, and the region from c.1611 to c.1632 of the JAK2 gene. [6] A method for detecting mutations using the following probe set: Probe 1 that hybridizes to region 1 on one strand of the PCR amplification product, and Probe 2 that hybridizes to region 2, which is different from region 1, on the other strand, wherein At this time, probe 1 and probe 2 each hybridize to the wild-type sequence, and hybridize when there is a mutation in the corresponding region (region 1 for probe 1, region 2 for probe 2). [7] The method according to 6, wherein region 1 and region 2 overlap. [8] The method according to 6 or 7, which does not use a reference probe. [9] The method according to any one of 1 to 8, which detects a mutation in circulating tumor DNA (ctDNA) derived from tumor cells from a subject.

[10] A probe set capable of detecting a plurality of mutations in one PCR amplification product, consisting of the following: Probe 1 that hybridizes to region 1 on one strand of the PCR amplification product, and Probe 2 that hybridizes to region 2, which is different from region 1, on the other strand, wherein At this time, Probe 1 and Probe 2 each hybridize to the wild-type sequence, and do not hybridize when there is a mutation in the corresponding region (Probe 1 corresponds to Region 1, and Probe 2 corresponds to Region 2), Region 1 and Region 2 overlap with each other, A probe set selected from a mutation in exon 19 of the EGFR gene, a mutation in exon 20 of the EGFR gene, a mutation in the region from c.2290 to c.2340 of the ERBB2 gene, and a mutation in the region from c.1611 to c.1632 of the JAK2 gene, for detecting a mutation in the region in each of the genes.

[11] The probe set according to 10, for detecting a mutation in exon 19 of the EGFR gene or a mutation in exon 20 of the EGFR gene.

[12] The probe set according to 11, wherein Probes 1 and 2 are the oligonucleotide consisting of the sequence of SEQ ID NO: 3 and the oligonucleotide consisting of the sequence of SEQ ID NO: 4, or labeled products thereof.

Effects of the Invention

[0012] The same set of primers and probes can respond to multiple mutations. In addition, by overlapping the regions where the two probes hybridize, mutations can be detected even in regions with many insertion mutations. Furthermore, by combining a plurality of probes having different hybridization regions, the target region can be expanded.

Brief Description of the Drawings

[0013] [Figure 1]An example of a probe design for mutation detection. (a) The target region is divided into two, and the wild-type sequences of the positive and negative strands are targeted. (b) If there is any mutation in the target region, the probe will not be able to bind, and only one signal will be detected. In this configuration, in WT, both FAM and HEX signals are plotted in the region near the center ((b) left). This is because the two types of probes are mixed and PCR is performed on the same fraction. If only the FAM probe binds, it is plotted in the upper left region ((b) center), and if only the HEX probe binds, it is plotted in the lower right region ((b) right). [Figure 2] When a mutation detection design loses its quantitative accuracy, it can occur if an insertion occurs at the boundary between two probes, or if the sequence is preserved during extension due to duplication, causing the two probes to bind and emit a signal. Furthermore, if a deletion occurs at the boundary between two probes, the two probes can no longer bind, making it impossible to distinguish the result from one without a template. [Figure 3] An example of a mutation detection design that takes probe boundary insertions into account. By overlapping the HEX probe with FAM probe I, and FAM probe I with FAM probe II, it becomes possible to detect insertions that occur between probes. dPCR is performed using either FAM probe I or FAM probe II, but combining them expands the detection area. [Figure 4] An example of designing four types of probes. When targeting ERBB2, using four types of probes can cover the desired area. [Figure 5]Results of dPCR using probes targeting EGFR exon 20. (a) Patterns in which the HEX Probe could not bind due to mutations, using HEX Probe and FAM Probe II. Synthetic DNA with mutations in EGFR, c.2284-5_2290dup, p.A763_Y764insFQEA and DNA extracted from human cancer cells HCT116 with wild-type target region were used as templates. The annealing temperature was 64°C, and 1.5 mM EDTA and 0.75% DMSO were used as additives. (b) Patterns in which the FAM Probe II could not bind due to mutations, using HEX Probe and FAM Probe II. Synthetic DNA with mutations in EGFR, c.2311_2319dup, p.N771_H773dup and DNA extracted from human cancer cells HCT116 with wild-type target region were used as templates. The annealing temperature was 64°C, and 1.5 mM EDTA and 0.5% DMSO were used as additives. (c) Patterns in which FAM Probe I could not bind due to mutations were observed using HEX Probe and FAM Probe I. The templates used were synthetic DNA of EGFR, c.2303_2311dup, p.S768_D770dup and DNA extracted from human cancer cells HCT116 with wild-type target regions. The annealing temperature was 64°C, and 1.5 mM EDTA was used as an additive. [Figure 6]A primer / probe design concept for non-specific mutation detection. The design is suitable for frequently occurring insertion regions. Assay 1, a novel primer / probe set targeting exon 20 of the EGFR gene, exemplifies this. All probes are designed to hybridize to wild-type sequences. When targeting regions known to be highly insertional, designing the probes to overlap each other by approximately 14 bases ensures a sufficient variety of detectable mutations. Probe lengths should ideally be 25 bases or less to detect single-nucleotide substitutions. Each probe has a different wavelength and uses a fluorescent substance corresponding to the instrument being used. This allows for the detection of mutations in a relatively wide range of sequences, even in frequently occurring insertion regions, in a single assay. [Figure 7] Primer / probe design concept 2 for non-specific mutation detection. Design suitable for regions containing single nucleotide polymorphisms (SNPs). Assay 2 of a new primer / probe set sequence targeting exon 20 of the EGFR gene is an example. All probes are designed to hybridize to wild-type sequences. Probes are designed to overlap each other by 4-5 bases. If a frequently occurring SNP is present in the probe sequence, probes that hybridize to sequences with and without SNPs are mixed (Probe C and Probe C' in the figure). The probe length should preferably be 25 bases or less to detect single nucleotide substitutions. Each probe uses a different wavelength and a fluorescent substance corresponding to the instrument being used. This allows for the detection of mutations in a wide range of sequences in a single assay. [Figure 8]Primer-probe design concept 3 for non-specific mutation detection. This is the most basic design. This includes assay 1, a new primer-probe set sequence targeting exon 19 of the EGFR gene, and assay 3, a new primer-probe set sequence targeting exon 20 of the EGFR gene. All probes are designed to hybridize to the wild-type sequence. Probes are designed to overlap each other by 4-5 bases. Probe lengths should preferably be 25 bases or less to detect single base substitutions. Each probe uses a different wavelength and a fluorescent substance corresponding to the instrument being used. This allows for mutation detection in a wide range of sequences in a single assay. [Figure 9] Primer / probe design concept 4 for non-specific mutation detection. A design suitable for detecting mutations from narrow regions. Assay 2 of a new primer / probe set sequence targeting exon 19 of the EGFR gene is an example. All probes are designed to hybridize to the wild-type sequence. When targeting mutations within the range of Probe B and Probe C, Probe A is used to distinguish between double negatives of Probe B and Probe C and mutations that do not hybridize to both Probe B and Probe C. Probe A does not need to overlap with Probe B or Probe C. Probe B and Probe C are designed to overlap each other by 4-5 bases. The probe length should preferably be 25 bases or less to detect single base substitutions. Each probe should have a different wavelength and use a fluorescent substance corresponding to the instrument being used. [Figure 10]Comparison of nonspecific detection primers / probes for detecting EGFR exon 20 with conventional primers / probes. The change in the variant allele frequency (VAF) over time in the plasma of patients with the c.2290_2291insTCCAGGAAGCCT (SEQ ID NO: 9) mutation was measured by digital PCR using conventional primers / probes (which indicate the presence of a specific variant sequence by hybridizing with the variant sequence) and the primer / probe from Example 1 (Table 2). [Figure 11] An example of a case where Probe1 of assay 1 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the sequence EGFR, c.2235_2246delGGAATTAAGAGA (SEQ ID NO: 10) p.E746_E749del and DNA extracted from an arbitrary PBMC as templates. [Figure 12] An example of a case where Probe2 of assay 1 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the EGFR, 2282A>G, p.D761G sequence and DNA extracted from an arbitrary PBMC as templates. [Figure 13] An example of a case where Probe3 of assay 1 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the EGFR, 2282A>G, p.D761G sequence and DNA extracted from an arbitrary PBMC as templates. [Figure 14] An example of a case where Probe4 of assay 1 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the EGFR, c.2225T>C, p.V742A mutant sequence and DNA extracted from an arbitrary PBMC as templates. [Figure 15] An example of a case where Probe5 of assay 2 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the EGFR, c.2201A>G, p.V734G mutant sequence and DNA extracted from an arbitrary PBMC as templates. [Figure 16]An example of a case where Probe6 of assay 2 for detecting EGFR exon 19 does not hybridize. Digital PCR was performed using synthetic DNA with the EGFR, c.2204G>T, p.G735V mutant sequence and DNA extracted from an arbitrary PBMC as templates. [Modes for carrying out the invention]

[0014] In the following description, the present invention may be described based on specific forms, embodiments, and examples, but unless otherwise specified, such descriptions also apply to other forms, embodiments, and examples.

[0015] In relation to the present invention, unless otherwise specified, the term "mutation" refers to a gene mutation, specifically a change in the base (sometimes called a nucleotide) sequence. Gene mutations include substitutions (>), deletions (del), insertions (ins), deletion-insertions (delins), duplications (dup), inversions (inv), and transformations (con).

[0016] With respect to the present invention, when describing gene mutations, we follow standard rules well known to those skilled in the art (https: / / varnomen.hgvs.org / recommendations / DNA / variant / duplication / , Hum Mutat 2016; 37: 564-569).

[0017] The amplification product refers to the DNA amplified by PCR, and is sometimes called an amplicon. The amplification product is usually double-stranded, and in the context of this invention, when referring to each strand of the double strand, it may be referred to as one strand and the other strand.

[0018] [Design method] As a first embodiment, the present invention provides a method for designing a probe set capable of detecting multiple mutations in one amplification product by PCR, including the following: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and We designed a probe 2, which is the other chain and hybridizes to a region 2 different from region 1. In this configuration, probe 1 and probe 2 are designed to hybridize to the wild-type sequence, but not to hybridize if there is a mutation in the corresponding region (region 1 for probe 1, and region 2 for probe 2).

[0019] Typically, in PCR reactions aimed at detecting gene mutations, primers are shared between wild-type and mutant sequences. Probes use two types of fluorescent substances, such as FAM and HEX. One probe is designed to hybridize to the wild-type sequence, and the other primer to the mutant sequence. The type of probe that binds to a specific region determines whether the amplified product contains the mutant sequence. In this case, one specific mutation can be detected per probe set. However, in the method of this embodiment, the two probes target the wild-type sequences of the first and second halves of the target region, respectively, allowing for the detection of multiple mutations with a single primer-probe. Many indels (insertions, deletions, or both) can be found in specific regions of a gene, and these mutations are often unique to each case. According to this embodiment, even such unique mutations can be addressed with a single probe set.

[0020] In this embodiment, the two probes bind to different DNA strands. Specifically, probe 1 hybridizes to region 1 on one strand of the amplification product, while probe 2 hybridizes to region 2 on the other strand, which is different from region 1. Therefore, regions 1 and 2 can overlap. If the region to which the first probe hybridizes and the region to which the second probe hybridizes do not overlap, even if insertions or duplications occur in or near the region between them, both probes can hybridize, making detection and quantification impossible. However, if there are many insertions in the target region, this problem can be solved by overlapping the first and second probes (Figure 2).

[0021] Furthermore, by designing multiple first-half and second-half probes, the detection area can be expanded. In one embodiment, multiple first-half or second-half probes are designed (Figure 3). The probes designed in multiples may be either first-half probes or second-half probes. For example, if you want to detect mutations in EGFR exon 20, one preferred embodiment is to provide multiple second-half probes (FAM), as shown in Figure 3. In another embodiment, multiple first-half and second-half probes are designed. For example, if you want to detect mutations in ERBB2, one preferred embodiment is to design four types of probes, as shown in Figure 4. Such designs can cover the target region.

[0022] In one embodiment, the design is suitable for frequently occurring insertion regions (Figure 6). When targeting regions known to be concentrated with insertions, designing the probes to overlap each other by approximately 14 bases ensures a variety of detectable mutations. The probe length should preferably be 25 bases or less to detect single base substitutions. Each probe has a different wavelength, and a fluorescent substance corresponding to the instrument used is employed. This makes it possible to detect mutations in a relatively wide range of sequences, even in frequently occurring insertion regions, in a single assay. An example of such a design is assay 1 in Example 4, which targets exon 20 of the EGFR gene.

[0023] In another embodiment, the design is adapted to regions where single nucleotide polymorphisms (SNPs) exist (Figure 7). The probes are designed to overlap each other by 4 to 5 bases. If a frequently occurring SNP is present in the probe sequence, probes that hybridize to sequences with and without SNPs are mixed (Probe C and Probe C' in Figure 7). The probe length should preferably be 25 bases or less to enable detection of single nucleotide substitutions. Each probe uses a different wavelength and a fluorescent substance corresponding to the instrument being used. This makes it possible to detect mutations in a wide range of sequences in a single assay. An example of such a design is assay 2 in Example 4, which targets exon 20 of the EGFR gene.

[0024] In another embodiment, a design suitable for covering a wide area is used (Figure 8). Probes are designed to overlap each other by 4 to 5 bases. The probe length should preferably be 25 bases or less to detect single base substitutions. Each probe uses a different wavelength and a fluorescent substance corresponding to the instrument being used. This makes it possible to detect mutations in a wide range of sequences in a single assay. Examples of such designs include assay 3 targeting exon 20 of the EGFR gene in Example 4, and assay 1 targeting exon 19 of the EGFR gene in Example 5. Note that two fluorescent dyes are used as probes in the example shown in Figure 4, and four fluorescent dyes are used in the example shown in Figure 8. Some digital PCR instruments may only support up to two colors, in which case the design shown in the example in Figure 4 is suitable. On the other hand, when using a digital PCR instrument that supports four or more colors, the design shown in the example in Figure 8, which allows for the examination of a wide area at once, is superior.

[0025] In another embodiment, the design is suitable for detecting mutations from a narrow region (Figure 9). In Figure 9, when targeting the detection of mutations within the range of Probe B and Probe C, Probe A is used to distinguish a mutation that does not hybridize with both Probe B and Probe C from a double negative of Probe B and Probe C. Probe A does not need to overlap with Probe B or Probe C. Probe B and Probe C are designed to overlap each other by 4 to 5 bases. The probe length should preferably be 25 bases or less to detect single base substitutions. Each probe uses a different wavelength and a fluorescent substance corresponding to the instrument being used. An example of such a design is assay 2 targeting exon 19 of the EGFR gene in Example 5.

[0026] According to this embodiment, probes can be designed to detect multiple mutations present in regions of 20-100 nucleotides, 20-80 nucleotides, or 20-50 nucleotides in length. Furthermore, to expand the region where detectable mutations exist, probe 3 can be designed to hybridize to a region 3 different from regions 1 and 2 on one or the other strand of the PCR amplification product.

[0027] On the other hand, in this embodiment, the design is such that there are no deletions spanning both regions where the two probes bind. If deletions are anticipated, it is preferable to design the system so that there are no deletions in either or both regions where the two probes bind.

[0028] The design method of this embodiment is particularly suitable for detecting mutations in regions where many mutations are concentrated within a specific range. This embodiment can be applied to any region without particular limitations.

[0029] Specific regions to which the design method of this embodiment is applied include the area around exon 19 of the EGFR gene (SEQ ID NO: 41), the area around exon 20 of the EGFR gene (SEQ ID NO: 6), the region from c.2290 to c.2340 of the ERBB2 gene (SEQ ID NO: 7), and the region from c.1611 to c.1632 of the JAK2 gene (SEQ ID NO: 8).

[0030] [Methods for detecting mutations] As a second embodiment, the present invention provides a method for detecting mutations using the following probe set: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and The other chain, a probe 2 that hybridizes to a region 2 different from region 1, In this case, probe 1 and probe 2 each hybridize to the wild-type sequence, and hybridize if there is a mutation in the corresponding region (region 1 for probe 1, and region 2 for probe 2).

[0031] Region 1 and Region 2 can overlap, as explained in the design method.

[0032] In the method of this embodiment, a reference probe is not required. In conventional drop-off digital PCR (DPCR) assays that use two probes on the same amplicon, a drop-off probe is used that corresponds to the mutation hotspot, is complementary to the wild-type sequence, and does not hybridize to the mutant sequence, along with a reference probe that corresponds to a region close to the mutation site and hybridizes to both the mutated amplicon and the wild-type amplicon. In the method of this embodiment, both probes are used for mutation detection, and the assay can be performed without using a probe that corresponds to a reference probe.

[0033] The method of this embodiment is particularly suitable for detecting mutations in circulating tumor DNA (ctDNA) derived from tumor cells in subjects.

[0034] [Primer set, probe primer] As a third embodiment, the present invention provides a probe set capable of detecting multiple mutations in one amplification product by PCR, comprising the following: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and The other chain, a probe 2 that hybridizes to a region 2 different from region 1, In this case, probe 1 and probe 2 will hybridize to the wild-type sequence, but will not hybridize if there is a mutation in the corresponding region (region 1 for probe 1, region 2 for probe 2). Region 1 and Region 2 overlap, A probe set for detecting mutations in one of the following regions selected from exon 19 of the EGFR gene, exon 20 of the EGFR gene, the region from c.2290 to c.2340 of the ERBB2 gene, and the region from c.1611 to c.1632 of the JAK2 gene.

[0035] The probe set of this embodiment is particularly suitable for detecting mutations in regions where many mutations are concentrated within a specific range.

[0036] In one embodiment, the probe set is for detecting mutations in exon 20 of the EGFR gene. In this embodiment, probes 1 and 2 are oligonucleotides consisting of the sequence of SEQ ID NO: 3 and SEQ ID NO: 4, or labeled products thereof.

[0037] The probe set includes probes for detecting sequences that do not have the desired mutation (wild type).

[0038] The set may also include a primer pair for performing a PCR reaction. Primers are used to amplify the portion of the nucleic acid in the sample that contains the desired mutation, and typically consist of a forward primer corresponding to the positive strand and a reverse primer corresponding to the negative strand.

[0039] (Design of probes and / or primers) Probes and / or primers can be designed in various ways to analyze mutations in nucleic acids in samples taken from subjects, but it is preferable that they be designed to analyze ctDNA present in the subject's blood. This is because analyzing ctDNA in the blood allows for systemic tracking of tumor-specific mutant DNA. Furthermore, it is easy to perform analysis over a long period with minimal burden on the patient after treatment, and it is expected that an increase in "tumor mass in the body" after treatment can be detected early, allowing for a rapid transition to second-line treatment. The analysis includes detection, quantification, etc. Subjects include cancer patients, individuals suspected of having cancer, etc.

[0040] From the perspective of analyzing ctDNA, probes and / or primers are designed to analyze a low proportion of mutant sequences (sometimes called mutant sequences) in the presence of a large excess of wild-type sequences (non-mutant sequences, sometimes called reference sequences). This is because in cancer diagnosis, the blood concentration of ctDNA (the ratio of mutant sequences to non-mutant sequences; sometimes called allele frequency) is often less than 1%, making highly sensitive analysis desirable. An example of such a highly sensitive analytical method is dPCR.

[0041] dPCR (Vogelstein and Kinzler, Proc. Natl. Acad. USA, 96, 9236-9241, 1999) is an evolution of the conventional PCR method that can directly quantify the amount of target nucleic acid. dPCR is suitable for detecting minute amounts of mutations when used in combination with enrichment procedures. In dPCR, the DNA sample is diluted to a single reaction unit, so the starting material in each PCR reaction is either wild type or mutant. Enrichment is performed from a single molecule, and thousands of parallel enrichment reactions are carried out simultaneously. After performing numerous PCR reactions from the same starting material, the mutant molecule is isolated and detected. After PCR amplification, the absolute amount of nucleic acid can be calculated by counting the chamber containing the final PCR product. Various dPCR-based systems suitable for use in this invention are commercially available. The basic methodology of dPCR is described, for example, in Sykes et al., Biotechniques 13 (3): 444-449, 1992.

[0042] From the perspective of analyzing ctDNA, it is preferable that probes and / or primers are designed to amplify relatively short nucleic acid fragments as target sequences and detect the desired mutations. The size of amplification products in typical PCR is 100-150 bp, which can be problematic due to reduced sensitivity and accuracy. To improve analytical performance, it is considered important to make the size of the amplification product as short as possible (Antonov J, et.al. Lab Invest. 2005 Aug;85(8):1040-50, Kong H, et.al. Sci Rep. 2014 Nov 28;4:7246, Florent Mouliere et.al. PLOS ONE September 2011 Volume 6 Issue 9 e23418).

[0043] For example, methods have been developed that allow analysis using relatively short amplification products, such as amplification products of 70 bp or less, by incorporating modified nucleotides into the oligonucleotides of primers and probes. Primers and probes for such methods are available at Hypercool Primer & Probe. TM It is known as (Nippon Gene Research Institute Co., Ltd., 1-5-2 Nakano, Miyagino-ku, Sendai City), and the design method for it has been made public (http: / / ngrl.co.jp / wp / wp-content / uploads / 2015 / 01 / eb3607d6c1eb4174f10bb3bde67844fe.pdf). In this embodiment, Hypercool Primer & Probe TM When designing primers and probes using the method, the amplification product may be longer than in the usual case using the method. This is because, in this embodiment, probe 1 hybridizes to region 1 of one strand of the amplification product, and probe 2 hybridizes to region 2 of the other strand, which is different from region 1, resulting in a relatively long region on the amplification product to which the probes hybridize. Hypercool Primer & Probe TM When designing primers and probes without using a method, longer amplification products may be required.

[0044] For detecting low proportions of mutant sequences in the presence of a large excess of non-mutant sequences, see, for example, Japanese Patent Publication No. 2010-535031. This technique is based on a protocol in which the reaction mixture is treated at a temperature lower than the critical denaturation temperature or the melting temperature Tm of the non-mutant sequence.

[0045] In one preferred embodiment, the oligonucleotide includes a modified base (sometimes referred to as a modified nucleotide). The modified bases include diaminopurine analogs (e.g., 2'-O-methyl-2,6-diaminopurine), uracil, peptide nucleic acid analogs, biotin-modified analogs, fluorophore-modified analogs, inosine, 7-deazaguanine, 2'-deoxy-2'-fluoro-β-D-arabinonucleotide (2'F-ANA) nucleotide, locked nucleic acids (LNAs, nucleic acids containing LNA-modified nucleosides / nucleotides), ENAs: 2'-O,4'-C-ethylene-bridged nucleic acids, etc. These modifications can increase the difference in Tm between matched or mismatched bases, enabling highly accurate analysis.

[0046] Particularly preferred examples of modified bases are 2-amino-deoxyadenosine (2aA, 2-amino-2'-deoxyadenosine) and 5-methyl-deoxycytidine (5mC, 5-methyl-2'-deoxycytidine). Particularly preferred LAN-introduced nucleotides include 2'-O,4'-C-methylene nucleoside, more specifically 2'-O,4'-C-methylene-thymidine; 2'-O,4'-C-methylene-cytidine; 2'-O,4'-C-methylene-adenosine; and 2'-O,4'-C-methylene-guanosine (Koshkin et al. LNA (Locked Nucleic Acids): Synthesis of the Adenine, Cytosine, Guanine, 5-Methylcytosine, Thymine and Uracil Bicyclonucleoside Monomers, Oligomerisation, and Unprecedented Nucleic Acid Recognition. Tetrahedron 1998, 54(14), 3607-3630). https: / / doi.org / 10.1016 / S0040-4020(98)00094-5, Kumar et al. The First Analogues of LNA (Locked Nucleic Acids): Phosphorothioate-LNA and 2'-Thio-LNA. Bioorganic & Medicinal Chemistry Letters 1998, 8(16), 2219-2222. https: / / doi.org / 10.1016 / S0960-894X(98)00366-7).

[0047] Oligonucleotides may also contain mismatched or unmatched bases. Those skilled in nucleic acid technology can determine double-strand stability by considering numerous variables, such as the length of the oligonucleotide, its base composition and sequence, ionic strength, and the content of mismatched bases. The stability of a nucleic acid double-strand can be expressed by its melting temperature (sometimes called denaturation temperature) Tm.

[0048] Introducing locked nucleic acids to oligonucleotides improves the affinity of complementary sequences and increases the melting temperature by several steps (Braasch, DA and DR Corey, Chem. Biol. (2001), 8:1-7). Locked nucleic acids refer to a class of nucleotide analogs that are sterically restricted (see, e.g., WO99 / 14226, Koshkin, AA, et al., Tetrahedron (1998), 54: 3607-3630, and Obika, S. et al., Tetrahedron Lett. (1998), 39: 5401-5404).

[0049] The probe may be modified near its ends to facilitate analysis. Fluorescent substances can be used for modification. Examples of fluorescent substances include 6FAM (sometimes simply referred to as FAM), HEX, and Tide Fluor. TM 1. ATTO 390, ATTO 425, LC(registered trademark) 480, Cyan 500, ATTO 465, ATTO 488, Tide Fluor TM 2, ATTO 495, ATTO 514, ATTO 520, TET, JOE, CAL Fluor 540, Yakima Yellow, ATTO 532, ATTO Rho6G, LC (registered trademark) Yellow555, CAL Fluor 560, ATTO 542, Quasar (registered trademark) 570, Cy3, ATTO 550, TAMRA, Tide Fluor TM3, ATTO 565, ATTO Rho3B, ROX, ATTO Rho11, ATTO Rho12, Cy3.5, ATTO Thio12, ATTO Rho101, LC® Red610, CAL Fluor 610, Tide Fluor TM 4, ATTO 590, TexasRed (SR101), ATTO 594, ATTO Rho13, ATTO 610, LC® Red670, ATTO 620, LC® Red640, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, Quasar® 670, Tide Fluor TM 5, Cy5, ATTO 655, ATTO Oxa12, ATTO 665, Tide Fluor TM 6, Cy5.5, ATTO 680, LC® Red705, Quasar® 705, ATTO 700, ATTO 725, ATTO 740, Tide Fluor TM 7, Tide Fluor TM 8, and the like. By using different fluorescent substances for the probe for wild type and the probe for mutant, simultaneous analysis of each becomes possible.

[0050] The probe may also be modified with a quenching substance (sometimes referred to as a quencher) near its terminus. Examples of the quenching substance include Dabcyl, BHQ-0®, BHQ-1®, BHQ-2®, BHQ-3®, TQ TM 1, TQ TM 2, TQ TM 3, TQ TM 4, TQ TM 5, TQ TM 6, TQ TM 7, TAMRA, ATTO540Q, ATTO 575Q, ATTO 580Q, ATTO 612Q, and BBQ-650®.

[0051] The probe may also be modified with a fluorescent substance near one end and a quenching substance near the other end. Such probes can be suitably used in the TaqMan method. The TaqMan method is a PCR method that uses an oligonucleotide probe that specifically binds to a target sequence in addition to a primer pair, wherein the probe comprises a fluorescent dye (reporter) and a quenching group (quencher), and during the PCR extension reaction, the probe is cleaved by the 5'→3' exonuclease activity of DNA polymerase (e.g., Taq polymerase), and the fluorescence becomes detectable as the distance between the fluorescent dye and the quenching group increases.

[0052] (Specific examples of probes and / or primers) In one embodiment, the probe and / or primer consist of the following sequence.

[0053] [Table 1]

[0054] Examples of other probe and / or primer sets include sets of probes and / or primers consisting of the sequences of SEQ ID NOs. 11-16, 17-23, 24-29, 30-35, and 36-40, as described in the Examples. The adenine and cytosine in the probe and primer sequences may be modified. Specific examples of primers and probes containing modified bases are provided in the Examples section of this specification.

[0055] The primers and probes described above are suitably used for digital PCR (dPCR). dPCR can be performed on the same scale as conventional dPCR methods. The amounts of primers and probes used for dPCR can be appropriately determined by those skilled in the art, but for example, per dPCR chip, nucleic acids can be used in the range of 0.5 to 50 ng, primers in the range of 0.02 to 2.0 μM, and probes in the range of 0.01 to 1.0 μM. Therefore, when the library is configured as an assembly of tubed probes and / or primers, where each probe and / or primer for detecting each mutation is stored in a separate container, such as a tube, the typical concentrations in each tube may be 450 to 3600 nM for primers, preferably 500 to 2000 nM, more preferably 600 to 1200 nM, for example 900 nM, and 10 to 1000 nM for probes, preferably 50 to 500 nM, more preferably 100 to 300 nM, for example 250 nM. In relation to the present invention, when referring to the concentration of a primer or probe, unless otherwise specified, it refers to the concentration of one type of primer or one type of probe.

[0056] In dPCR, the system composition, in addition to the amounts of nucleic acid, primers, and probes, may include four types of dNTPs, buffers, salts, surfactants, and enzymes that catalyze the chain elongation reaction, as will be apparent to those skilled in the art.

[0057] The probe-primer of this embodiment can also be used in methods for the early detection and diagnosis of cancer.

[0058] The present invention will be described in more detail below with reference to examples, but the present invention is not limited in any way by these examples. [Examples]

[0059] [Example 1: Primer and probe set for detecting mutations in EGFR exon 20] The following primers and probes were synthesized, and dPCR was performed to detect mutations in EGFR exon 20.

[0060] [Table 2]

[0061] In the above probe sequences, lowercase letters indicate modified bases (5-methyl-2'-deoxycytidine or 2-amino-2'-deoxyadenosine). The same applies to the following examples.

[0062] In addition to the forward primer, reverse primer, and probe 1 (HEX probe in the table above), select and use either probe 2 (FAM probe I in the table above) or probe 3 (FAM probe II in the table above).

[0063] The target sequence around EGFR exon 20 is shown below. The region to which the primers bind is enclosed in a box. The region to which the HEX probe (which binds to the complementary sequence of the sequence below) binds is shown in light gray, the region to which FAM Probe I binds is underlined, and the region to which FAM Probe II binds is shown in dark gray.

[0064] [ka]

[0065] For digital PCR (dPCR), we used the BioRad QX200 Droplet Digital PCR system. The PCR conditions were as follows:

[0066] [Table 3]

[0067] The synthesized primer-probe mixture was adjusted to the following concentrations, temporarily stored (-20°C), and used in the experiment.

[0068] [Table 4]

[0069] The composition of the PCR reaction solution is as follows:

[0070] [Table 5]

[0071] As templates, we used synthetic DNA with the EGFR, c.2284-5_2290dup, p.A763_Y764insFQEA mutation, synthetic DNA with the EGFR, c.2311_2319dup, p.N771_H773dup mutation, and DNA extracted from human cancer cells HCT116 with a wild-type target region.

[0072] (Example 1-a) Using HEX Probe and FAM Probe II, we used a mutation that does not hybridize with HEX Probe (a population in which only FAM from probe 3 is detected) as a template. Specifically, we used synthetic DNA with the EGFR, c.2284-5_2290dup, p.A763_Y764insFQEA mutation and DNA extracted from human cancer cells HCT116 with a wild-type target region as templates.

[0073] The results are shown in Figure 5(a). The results show patterns in which the HEX Probe could not bind due to mutations.

[0074] (Example 1-b) HEX Probe and FAM Probe II were used, with mutations that FAM Probe II does not hybridize being used as templates. Specifically, synthetic DNA of EGFR, c.2311_2319dup, p.N771_H773dup and DNA extracted from human cancer cells HCT116 with wild-type target regions were used as templates.

[0075] The results are shown in Figure 5(b). The results show a pattern where FAM Probe II could not bind due to the mutation.

[0076] (Example 1-c) HEX Probe and FAM Probe I were used, with mutations that FAM Probe I does not hybridize being used as templates. Specifically, synthetic DNA of EGFR, c.2303_2311dup, p.S768_D770dup and DNA extracted from human cancer cells HCT116 with wild-type target regions were used as templates.

[0077] The results are shown in Figure 5(c). The results show a pattern where FAM Probe I could not bind due to the mutation.

[0078] (Example 1-d) A comparison was made between nonspecific detection primers / probes for detecting EGFR exon 20 and conventional primers / probes. Specifically, the time-course change in the variant allele frequency (VAF) in the plasma of patients with the c.2290_2291insTCCAGGAAGCCT (SEQ ID NO: 9) mutation was performed using digital PCR with conventional primers / probes (which indicate the presence of a specific variant sequence by hybridizing with the variant sequence) and the primers / probes of this example (Table 2).

[0079] The results are shown in Figure 10.

[0080] [Example 2: Primer-probe set for detecting mutations in ERBB2] ERBB2, c.2290 to c.2340 (p.E770 to p.P780)

[0081] GATTACAGGTGTGAGCCACCGTGCCCGGCCTAATCTTTGTATTTTTAGTAGAGACAGGGTTTTCACCATGTTGTCCAGGCTGGTACTTTGAGCCTTCACAGGCTGTGGGCCATGGCTGTGGTTTGTGATGGTTGGGAGGCTGTGGTGTTTGGGGGTGTGTGGTCTCCCATACCCTCTCAGCGTACCCTTGTCCCAGGAAG CATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACACAGCTTATGCCCTATGGCTGCCTCTTAGACCATGTCCGGGAAAACCGCGGACGCCTGGGCTCCCAGGACCTGCTGAACTGGTGTATGCAGATTGCCAAGGTATGCACCTGGGCTCT(SEQ ID NO:7)

[0082] [Example 3: Primer-probe set for detecting mutations in JAK2] JAK2, c. 1611 to c. 1632 (p. F537 to p. D544)

[0083] AAGCATTTCTTATACGTAGAACACATTTCATTTTACTCCTCTTTGGAGCAATTCATACTTTCAGTGTATTTTGAAGTGATATATATGTATTTTTTTTTCAGATAAATCAAACCTTCTAGTCTTCAGAACGAATGGTGTTTCTGATGTACCAACCTCACCAACATTACAGAGGCCTACTCATATGAACCAAATGGTGTTTCACAAAATCAGA AATGAAGATTTGATATTTGTAAGTCATTAGATACTCATTACTGTCTTTTTTGTCCTTTTAAAACAACATCTGTTTTCTTGATTTACATTCATGTGACATTGGAATTATTTTGTTATATACAAATTTAGTTGTGATTTAAATATTTTTCTTATGAAAAATATGCCAACCTTGTGTTAGATGTTAGCAAAATTAATTATCTTAATTATCCT(SEQ ID NO:8)

[0084] [Example 4: Novel primer-probe set for detecting mutations in EGFR exon 20]

[0085] [Table 6]

[0086] In the probe sequences shown above, lowercase letters indicate modified bases. Since Probe7 is a region containing frequently occurring single nucleotide polymorphisms, two types are used in combination. The base "R" indicates a mixed base of G (guanine) and A (adenine).

[0087] Compared to the original application, the probe length is shorter, and theoretically, the sensitivity to single-nucleotide substitution mutations is increased. Furthermore, while the original application had a detectable range of c.2284-2325 within exon 20 of the EGFR gene, using the two sets described above makes it possible to detect gene mutations in the range of c.2284-2395.

[0088] [Example 5: A novel primer-probe set targeting EGFR exon 19]

[0089] [Table 7]

[0090] In the above probe sequence, the bases marked with a + on the left represent LNA-introduced nucleotides (2'-O,4'-C-methylene nucleoside, more specifically +T: 2'-O,4'-C-methylene-thymidine; +C: 2'-O,4'-C-methylene-cytidine; +A: 2'-O,4'-C-methylene-adenosine; +G: 2'-O,4'-C-methylene-guanosine). In the above probe sequence, lowercase letters indicate modified bases. Using the two sets described above, it becomes possible to detect gene mutations across the entire range of exon 19 of the EGFR gene. Probe7 is designed to hybridize into the intron region and does not directly detect mutations.

[0091] The target sequence around EGFR exon 19 is as follows:

[0092] TGTGATTCGTGGAGCCCAACAGCTGCAGGGCTGCGGGGGCGTCACAGCCCCCAGCAATATCAGCCTTAGGTGCGGCTCCACAGCCCCAGTGTCCCTCACCTTCGGGGTGCATCGCTGGTAACATC CACCCAGATCACTGGGCAGCATGTGGCACCATCTCACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG GAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCTCAGGCCCACCTTTTCTCATGTCTGGCAGCTGCTC TGCTCTAGACCCTGCTCATCTCCACATCCTAAATGTTCACTTTCTATGTCTTTCCCTTTCTAGCTCTAGTGGGTATAACTCCCTCCCCTTAGAGACAGCACTGGCCTCTCCCATGCTGGTAT(SEQ ID NO:41)

[0093] (Example 5a: Example where Probe1 of assay 1 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA with the sequence EGFR, c.2235_2246delGGAATTAAGAGA (SEQ ID NO: 10) p.E746_E749del and DNA extracted from arbitrary PBMCs as templates. The conditions for these experiments were the same as in Example 1.

[0094] The results are shown in Figure 11. Probe1 modified with FAM showed a pattern in which it did not hybridize due to the mutation.

[0095] (Example 5-b: Example where Probe2 of assay 1 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA containing the EGFR, 2282A>G, p.D761G sequence and DNA extracted from arbitrary PBMCs as templates.

[0096] The results are shown in Figure 12. Probe2 modified with HEX showed a pattern in which it did not hybridize due to the mutation.

[0097] (Example 5-c: Example where Probe3 of assay 1 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA containing the EGFR, 2282A>G, p.D761G sequence and DNA extracted from arbitrary PBMCs as templates.

[0098] The results are shown in Figure 13. Probe3 modified with ATTO550 showed a pattern in which it did not hybridize due to the mutation.

[0099] (Example 5-d: Example where Probe4 of assay 1 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA containing the EGFR, c.2225T>C, p.V742A mutant sequence and DNA extracted from arbitrary PBMCs as templates.

[0100] The results are shown in Figure 14. Probe4 modified with Cy5 showed a pattern in which it did not hybridize due to the mutation.

[0101] (Example 5-e: Example where Probe 5 of assay 2 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA containing the EGFR, c.2201A>G, p.V734G mutant sequences and DNA extracted from arbitrary PBMCs as templates.

[0102] The results are shown in Figure 15. Probe5 modified with FAM showed a pattern in which it did not hybridize due to mutation.

[0103] (Example 5-f: Example where Probe6 of assay 2 for detecting EGFR exon 19 does not hybridize) Digital PCR was performed using synthetic DNA containing the EGFR, c.2204G>T, p.G735V mutant sequence and DNA extracted from arbitrary PBMCs as templates.

[0104] The results are shown in Figure 16. Probe6 modified with HEX showed a pattern in which it did not hybridize due to the mutation.

Claims

1. A method for designing a probe set capable of detecting multiple mutations in a single PCR amplification product, including the following: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and We designed a probe 2, which is the other chain and hybridizes to a region 2 different from region 1. In this method, probe 1 and probe 2 are designed to hybridize to the wild-type sequence, but not to hybridize if there is a mutation in the corresponding region (region 1 for probe 1, region 2 for probe 2).

2. The method according to claim 1, wherein region 1 and region 2 overlap.

3. The method according to claim 1, wherein multiple mutations are present in a region of 20 to 100 base pairs in length.

4. The method according to claim 1, comprising designing a probe 3 that hybridizes to a region 3 different from regions 1 and 2 of one or the other strand of a PCR amplification product in order to expand the region in which a detectable mutation exists.

5. The method according to any one of claims 1 to 4, wherein the region containing multiple detectable mutations is selected from exon 19 of the EGFR gene, exon 20 of the EGFR gene, the region from c.2290 to c.2340 of the ERBB2 gene, and the region from c.1611 to c.1632 of the JAK2 gene, and is one of these regions.

6. A method for detecting mutations using the following probe set: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and The other chain, a probe 2 that hybridizes to a region 2 different from region 1, In this case, probe 1 and probe 2 will hybridize to the wild-type sequence, but will not hybridize if there is a mutation in the corresponding region (region 1 for probe 1, and region 2 for probe 2).

7. The method of claim 6, wherein region 1 and region 2 overlap.

8. The method according to claim 6, wherein a reference probe is not used.

9. The method according to any one of claims 6 to 8, for detecting mutations in circulating tumor DNA (ctDNA) derived from tumor cells of a subject.

10. A probe set capable of detecting multiple mutations in a single PCR amplification product, consisting of the following: A probe 1 that hybridizes to region 1 of one strand of the PCR amplification product, and The other chain, a probe 2 that hybridizes to a region 2 different from region 1, In this case, probe 1 and probe 2 will hybridize to the wild-type sequence, but will not hybridize if there is a mutation in the corresponding region (region 1 for probe 1, and region 2 for probe 2). Region 1 and Region 2 overlap, A probe set selected from mutations in exon 19 of the EGFR gene, exon 20 of the EGFR gene, the region from c.2290 to c.2340 of the ERBB2 gene, and the region from c.1611 to c.1632 of the JAK2 gene, for detecting regional mutations in each of these genes.

11. A probe set according to claim 10 for detecting mutations in exon 19 or exon 20 of the EGFR gene.

12. The probe set according to claim 11, wherein probes 1 and 2 are oligonucleotides consisting of the sequence of sequence number 3 and oligonucleotides consisting of the sequence of sequence number 4, or labeled products thereof.

Images