Exon-skipping oligomers and oligomer conjugates for muscular dystrophy

Abstract

To provide antisense oligomers and antisense oligomer conjugates complementary to selected target sites in the human dystrophin gene for inducing exon 53 skipping. [Solution] In one embodiment, the Disclosure provides an antisense oligomer of 18 to 25 subunit lengths that can bind to a selected target to induce exon skipping in the human dystrophin gene, the antisense oligomer comprising a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site.

Description

[Technical Field]

[0001] Related applications This application claims priority under U.S. Provisional Application No. 62 / 685,064, filed on 14 June 2018. The entire teachings of the above application are incorporated by reference.

[0002] References to sequence listings submitted electronically via EFS-WEB The contents of the electronically filed sequence listing (name: 8165_53_WO00_SL.txt, size: 62,579 bytes, creation date: May 29, 2019) filed concurrently with this specification are incorporated herein by reference in their entirety.

[0003] This disclosure relates to novel antisense oligomers and antisense oligomer conjugates suitable for exon 53 skipping in the human dystrophin gene, as well as pharmaceutical compositions thereof. This disclosure also provides methods for inducing exon 53 skipping using novel antisense oligomers and antisense oligomer conjugates, methods for producing dystrophin in subjects having mutations in the dystrophin gene suitable for exon 53 skipping, and methods for treating subjects having mutations in the dystrophin gene suitable for exon 53 skipping. [Background technology]

[0004] Antisense technologies have been developed using various chemistry techniques to influence gene expression at different levels (transcription, splicing, stability, and translation). Most of the research focuses on the use of antisense compounds to modify or compensate for abnormal or disease-related genes in a wide range of indications. Antisense molecules are capable of inhibiting gene expression with specificity, and for this reason, much research effort on oligomers as gene expression modulators focuses on inhibiting the expression of a target gene or the function of its cis-acting element. Antisense oligomers are typically targeted at either the sense strand (e.g., mRNA) or, in the case of some viral RNA targets, the minus strand. To achieve the desired effect of specific gene downregulation, oligomers generally promote the breakdown of the target mRNA, block the translation of the mRNA, or block the function of the cis-acting RNA element, thereby effectively preventing either the de novo synthesis of the target protein or the replication of viral RNA.

[0005] However, such techniques are not useful when the objective is to upregulate the production of native proteins or to compensate for mutations that induce premature termination of translation, such as nonsense mutations or frameshift mutations. In these cases, the defective gene transcript should not be subjected to targeted degradation or steric inhibition, and therefore the chemical properties of the antisense oligomer should neither promote the breakdown of the target mRNA nor block translation.

[0006] In various genetic disorders, the effect of mutations on the final expression of a gene can be regulated through targeted exon skipping during the splicing process. The splicing process is directed by a complex, multi-component mechanism that brings adjacent exon-intron junctions in premRNA very close together and cleaves phosphodiester bonds at the intron ends, followed by the subsequent rearrangement of phosphodiester bonds between exons that are spliced ​​together. This complex and precise process is mediated by premRNA sequence motifs, which are relatively short, semi-conservative RNA segments, and various nuclear splicing factors involved in the splicing reaction then bind to these sequence motifs. By altering how the splicing mechanism reads or recognizes the motifs involved in premRNA processing, it is possible to create differently spliced ​​mRNA molecules. While it is recognized that the majority of human genes are selectively spliced ​​during normal gene expression, the mechanisms involved remain unidentified. Bennett et al. (U.S. Patent No. 6,210,892) describe the antisense regulation of wild-type cell mRNA processing using an antisense oligomer analog that does not induce RNAse H-mediated cleavage of target RNA. This is useful because it allows for the generation of alternatively spliced ​​mRNA lacking specific exons (e.g., as described by Sazani, Kole, et al. 2007 regarding the generation of soluble TNF superfamily acceptors lacking the transmembrane domain encoding exon).

[0007] When a normally functional protein is prematurely terminated due to a mutation therein, it has been shown that means for restoring partial functional protein production via antisense technology are possible through intervention during the splicing process, and it has also been shown that when exons associated with disease-causing mutations can be specifically deleted from some genes, truncated protein products that possess similar biological properties of the native protein or have sufficient biological activity to ameliorate the disease caused by the mutation associated with the exon can sometimes be produced (see, e.g., Sierakowska, Sambade et al. 1996, Wilton, Lloyd et al. 1999, van Deutekom, Bremmer-Bout et al. 2001, Lu, Mann et al. 2003, Aartsma-Rus, Janson et al. 2004). Kole et al. (U.S. Patent Nos. 5,627,274, 5,916,808, 5,976,879, and 5,665,593) disclose methods for counteracting aberrant splicing using modified antisense oligomer analogs that do not promote degradation of the target pre-mRNA. Bennett et al. (U.S. Patent No. 6,210,892) describe antisense modulation of wild-type cellular mRNA processing, which similarly employs antisense oligomer analogs that do not induce RNase H-mediated cleavage of target RNA.

[0008] The process of targeted exon skipping is likely to be particularly useful in long genes where many exons and introns are present, where there is redundancy in the genetic architecture of exons, or where a protein is capable of functioning without one or more specific exons. Efforts to redirect gene processing for the treatment of genetic diseases associated with truncations caused by mutations in various genes have focused on the use of antisense oligomers that bind to pre-mRNA at a position sufficiently close to an element to (1) completely or partially overlap with an element involved in the splicing process, or (2) interfere with the binding and function of splicing factors that normally mediate the specific splicing reaction occurring at that element.

[0009] Duchenne muscular dystrophy (DMD) is caused by a defect in the expression of the protein dystrophin. The gene encoding the protein contains 79 exons spread over more than 2 million nucleotides of DNA. Any exon mutation that changes the reading frame of an exon, introduces a stop codon, or is characterized by the shift of one or more exons or the duplication of one or more exons that is completely out of frame, can prevent the production of functional dystrophin and result in DMD.

[0010] It has been found that mutations, typically deletions of one or more exons, that result in the correct reading frame along the entire dystrophin transcript, such that translation of mRNA into protein is not prematurely terminated, give rise to Becker muscular dystrophy (BMD), a less severe form of muscular dystrophy. If the joining of upstream and downstream exons in the processing of a mutated dystrophin pre-mRNA maintains the correct reading frame of the gene, the result is an mRNA encoding a protein with a short internal deletion that retains some degree of activity, leading to a Becker phenotype.

[0011] For many years, it has been known that deletions of one or more exons that do not alter the reading frame of the dystrophin protein cause the BMD phenotype, while exon deletions that cause frameshifts cause DMD (Monaco, Bertelson et al. 1988). In general, dystrophin mutations, including point mutations and exon deletions that alter the reading frame and thus disrupt proper protein translation, result in DMD. It should also be noted that some BMD and DMD patients have exon deletions affecting multiple exons.

[0012] Regulation of mutant dystrophin premRNA splicing using antisense oligoribonucleotides has been reported both in vitro and in vivo (e.g., Matsuo, Masumura et al. 1991, Takeshima, Nishio et al. 1995, Pramono, Takeshima et al. 1996, Dunckley, Eperon et al. 1997; Dunckley, Manoharan et al. 1998, Wilton, Lloyd et al. See al. 1999, Mann, Honeyman et al. 2002, and Errington, Mann et al. 2003.

[0013] Antisense oligomers are specifically designed to induce DMD gene mutation skipping by targeting premRNA, typically specific regions of exons, thereby restoring these out-of-frame mutations in-frame and enabling the production of an internally shortened but functional dystrophin protein. Such antisense oligomers are known to be perfectly targeted within exons (so-called in-exon sequences) or at splice donor or splice acceptor junctions where exons cross over portions of introns.

[0014] The discovery and development of such antisense oligomers against DMD is a field of research in the past.These developments include (1) the University of Western Australia and Sarepta Therapeutics (assignee of this application): WO2006 / 000057, WO2010 / 048586, WO2011 / 057350, WO2014 / 100714, WO2014 / 153240, WO2014 / 153220, (2) Academisch Ziekenhuis Leiden / Prosensa Technologies (now BioMarin) Pharmaceutical): WO02 / 24906, WO2004 / 083432, WO2004 / 083446, WO2006 / 112705, WO2007 / 133105, WO2009 / 139630 , WO2009 / 054725, WO2010 / 050801, WO2010 / 050802, WO2010 / 123369, WO2013 / 112053, WO2014 / 007620, (3)Carolinas Medical Center:WO2012 / 109296, (4) Royal (4) JCR Pharmaceuticals and Matsuo: US6,653,466; JP2000-125448, for example, US6,653,467; JP2000-256547, for example, US6,727,355; WO2004 / 048570; (5) Nippon This includes developments from Shinyaku:WO2012 / 029986, WO2013 / 100190, WO2015 / 137409, WO2015 / 194520, and (6) Association Institut de Myologie / Universite Pierre et Marie Curie / Universitat Bern / Centre national de la Recherche Scientifique / Synthena AG:WO2010 / 115993, WO2013 / 053928.

[0015] The discovery and development of antisense oligomers conjugated to cell membrane-permeable peptides for DMD was also a research area (PCT Publication No. WO2010 / 048586, Wu, B. et al., The American Journal of Pathology, Vol.181(2):392-400, 2012, Wu, R. et al., Nucleic Acids Research, Vol.35(15):5182-5191, 2007, Mulders, S. et al., 19 th International Congress of the World Muscle Society,Poster Presentation Berlin,October 2014, Bestas,B.et al.,The Journal of Clinical Investigation,doi:10.1172 / JCI76175,2014, Jearawiriyapaisarn,N.et al.,Molecular Therapy,Vol.16(9):1624-1629,2008, Jearawiriyapaisarn,N.et al.,Cardiovascular Research,Vol.85:444-453,2010, Moulton,HMet al.,Biochemical Society Transactions,Vol.35(4):826-828,2007,Yin,H.et al.,Molecular Therapy,Vol.19(7):1295-1303,2011,Abes,R.et al.,J.Pept.Sci.,Vol.14:455-460,2008,Lebleu,B.et al.,Advanced Drug Delivery Reviews, Vol. 60:517-529, 2008, McClorey, G. et al., Gene Therapy, Vol. 13: 1373-1381, 2006, Alter, J. et al., Nature Medicine, Vol. 12(2): 175-177, 2006, and Youngblood, D. et al., American Chemical Society, Bioconjugate See Chem., 2007, 18(1), pp 50-60. The transport portion of cell membrane-permeable peptides (CPPs), such as arginine-rich peptides, may be effective in enhancing the intracellular transport of antisense oligomers conjugated to CPPs. Despite these efforts, there remains a need for improved antisense oligomers that target exon 53 and the corresponding pharmaceutical composition, which may be useful in treatment methods for dystrophin production and the management of DMD. [Prior art documents] [Patent Documents]

[0016] [Patent Document 1] U.S. Patent No. 6,210,892 [Patent Document 2] U.S. Patent No. 5,627,274 [Patent Document 3] U.S. Patent No. 5,916,808 [Patent Document 4] U.S. Patent No. 5,976,879 [Patent Document 5] U.S. Patent No. 5,665,593 [Patent Document 6] U.S. Patent No. 6,210,892 [Patent Document 7] International Publication No. 2006 / 000057 [Patent Document 8] International Publication No. 2010 / 048586 [Patent Document 9] International Publication No. 2011 / 057350 [Patent Document 10] International Publication No. 2014 / 100714 [Patent Document 11] International Publication No. 2014 / 153240 [Patent Document 12] International Publication No. 2014 / 153220 [Patent Document 13] International Publication No. 2002 / 024906 [Patent Document 14] International Publication No. 2004 / 083432 [Patent Document 15] International Publication No. 2004 / 083446 [Patent Document 16] International Publication No. 2006 / 112705 [Patent Document 17] International Publication No. 2007 / 133105 [Patent Document 18] International Publication No. 2009 / 139630 [Patent Document 19] International Publication No. 2009 / 054725 [Patent Document 20] International Publication No. 2010 / 050801 [Patent Document 21] International Publication No. 2010 / 050802 [Patent Document 22] International Publication No. 2010 / 123369 [Patent Document 23] International Publication No. 2013 / 112053 [Patent Document 24] International Publication No. 2014 / 007620 [Patent Document 25] International Publication No. 2012 / 109296 [Patent Document 26] U.S. Patent No. 8,084,601 [Patent Document 27] U.S. Patent Application Publication No. 2017 / 0204413 [Patent Document 28] U.S. Patent No. 6,653,466 [Patent Document 29] Japanese Patent Publication No. 2000-125448 [Patent Document 30] U.S. Patent No. 6,653,467 [Patent Document 31] Japanese Patent Publication No. 2000-256547 [Patent Document 32] U.S. Patent No. 6,727,355 [Patent Document 33] International Publication No. 2004 / 048570 [Patent Document 34] International Publication No. 2012 / 029986 [Patent Document 35] International Publication No. 2013 / 100190 [Patent Document 36] International Publication No. 2015 / 137409 [Patent Document 37] International Publication No. 2015 / 194520 [Patent Document 38] International Publication No. 2010 / 115993 [Patent Document 39] International Publication No. 2013 / 053928 [Non-patent literature]

[0017] [Non-Patent Document 1] Wu,B.et al.,The American Journal of Pathology,Vol.181(2):392-400,2012 [Non-Patent Document 2] Wu,R.et al.,Nucleic Acids Research,Vol.35(15):5182-5191,2007 [Non-licensed document 3] Mulders,S.et al.,19th International Congress of the World Muscle Society,Poster Presentation Berlin,October 2014

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

[0018] This disclosure provides antisense oligomers and antisense oligomer conjugates comprising an antisense oligomer moiety conjugated to a CPP. In one embodiment, this disclosure provides an antisense oligomer of 18 to 25 subunit lengths that can bind to a selected target to induce exon skipping in the human dystrophin gene, wherein the antisense oligomer comprises a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site.

[0019] In some embodiments, the Disclosure provides a 25-subunit length antisense oligomer that can bind to a selected target to induce exon skipping in the human dystrophin gene, the antisense oligomer comprising a sequence of bases complementary to the exon 53 target region of the dystrophin premRNA designated as the annealing site.

[0020] In another embodiment, this disclosure is, An antisense oligomer having a length of 18 to 25 subunits that can bind to a selected target to induce exon skipping in the human dystrophin gene, comprising a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site, The present invention provides an antisense oligomer conjugate comprising a cell membrane-permeable peptide (CPP) conjugated to an antisense oligomer by a linker moiety.

[0021] In some embodiments, the annealing region is selected from H53A(+23+47), H53A(+39+62), H53A(+36+69), and H53A(+45+62).

[0022] In various embodiments, this disclosure An antisense oligomer having a length of 25 subunits that can bind to a selected target to induce exon skipping in the human dystrophin gene, comprising a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site, The present invention provides an antisense oligomer conjugate comprising a cell membrane-permeable peptide (CPP) conjugated to an antisense oligomer by a linker moiety.

[0023] In some embodiments, the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0024] In some embodiments, the annealing area is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30- 06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A( -9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D( +24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-0) 9) Selected from the group consisting of H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0025] In some embodiments, the annealing area is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14 ), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H 53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 The group is selected from the following: 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0026] In some embodiments, the antisense oligomer has 20 to 23 subunits. In some embodiments, the bases of the antisense oligomer are linked to morpholino ring structures, which are linked by inter-subunit linkages containing phosphorus, where the morpholino nitrogen of one ring structure is linked to the 5' extra-ring carbon of an adjacent ring structure. In a particular embodiment, the cell membrane permeable peptide is 6 arginine units ("R6") (SEQ ID NO: 135), and the linker moiety is glycine. In some embodiments, the antisense oligomer contains a sequence of bases selected from SEQ ID NOs: 1 to 65. In various embodiments, the antisense oligomer contains a sequence of bases selected from SEQ ID NOs: 70 to 134.

[0027] In various embodiments, this disclosure relates to antisense oligomer conjugates that may conform to formula (I), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence. T is [ka] It is the part selected from, R 1 The present invention provides antisense oligomeric conjugates or pharmaceutically acceptable salts thereof, which are C1-C6 alkyl groups.

[0028] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, where the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0029] In some embodiments, the target sequence is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A (-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+0) 8), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A( -8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+ 23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), These exon 53 annealing sites are complementary to those selected from the group consisting of H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0030] In some embodiments, the targeting sequences are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-2 0+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15 +10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+1 5), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53 A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D( These exon 53 annealing sites are complementary to those selected from the group consisting of H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0031] In another embodiment, the present disclosure relates to an antisense oligomer conjugate of formula (IV), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence. T is [ka] It is the part selected from, R 1 However, it is a C1-C6 alkyl group, R 2 The present invention provides an antisense oligomeric conjugate or a pharmaceutically acceptable salt thereof, selected from H or acetyl.

[0032] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, where the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0033] In some embodiments, the target sequence is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A (-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+0) 8), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A( -8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+ 23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), These exon 53 annealing sites are complementary to those selected from the group consisting of H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0034] In some embodiments, the targeting sequences are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-2 0+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15 +10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+1 5), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53 A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D( These exon 53 annealing sites are complementary to those selected from the group consisting of H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0035] In another embodiment, the Disclosure provides a pharmaceutical composition comprising the antisense oligomer conjugate of the Disclosure and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is saline solution containing phosphate buffer. In another embodiment, the Disclosure provides a pharmaceutical composition comprising the antisense oligomer of the Disclosure and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is saline solution containing phosphate buffer.

[0036] In another embodiment, the Disclosure provides a method for treating Duchenne muscular dystrophy (DMD) in a subject requiring treatment, wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering the antisense oligomer conjugate of the Disclosure to the subject. The Disclosure also addresses the use of the antisense oligomer conjugate of the Disclosure in a subject requiring treatment for Duchenne muscular dystrophy (DMD), wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping.

[0037] In another embodiment, the Disclosure provides a method for treating Duchenne muscular dystrophy (DMD) in a subject requiring treatment, wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering the antisense oligomer of the Disclosure to the subject. The Disclosure also addresses the use of the antisense oligomer of the Disclosure in a subject requiring treatment for Duchenne muscular dystrophy (DMD) in the manufacture of a drug for treating Duchenne muscular dystrophy (DMD), wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping.

[0038] In another embodiment, the Disclosure provides a method for inducing dystrophin production by restoring the mRNA reading frame in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer conjugate of the Disclosure to the subject. In another embodiment, the Disclosure provides a method for removing exon 53 from dystrophin premRNA during mRNA processing in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer conjugate of the Disclosure to the subject. In another embodiment, the Disclosure provides a method for ligating exon 53 of dystrophin premRNA in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer conjugate of the Disclosure to the subject.

[0039] In another embodiment, the Disclosure provides a method for inducing dystrophin production by restoring the mRNA reading frame in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer of the Disclosure to the subject. In another embodiment, the Disclosure provides a method for removing exon 53 from dystrophin premRNA during mRNA processing in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer of the Disclosure to the subject. In another embodiment, the Disclosure provides a method for ligating exon 53 of dystrophin premRNA in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering the antisense oligomer of the Disclosure to the subject.

[0040] In another embodiment, the Disclosure provides antisense oligomer conjugates of the Disclosure herein for use in therapeutic use. In a particular embodiment, the Disclosure provides antisense oligomer conjugates of the Disclosure herein for use in the treatment of Duchenne muscular dystrophy. In a particular embodiment, the Disclosure provides antisense oligomer conjugates of the Disclosure herein for use in the manufacture of agents for therapeutic use. In a particular embodiment, the Disclosure provides antisense oligomer conjugates of the Disclosure herein for use in the manufacture of agents for the treatment of Duchenne muscular dystrophy.

[0041] In another embodiment, the Disclosure provides antisense oligomers of the Disclosure herein for use in therapeutic use. In a particular embodiment, the Disclosure provides antisense oligomers of the Disclosure for use in the treatment of Duchenne muscular dystrophy. In a particular embodiment, the Disclosure provides antisense oligomers of the Disclosure for use in the manufacture of agents for therapeutic use. In a particular embodiment, the Disclosure provides antisense oligomers of the Disclosure for use in the manufacture of agents for the treatment of Duchenne muscular dystrophy.

[0042] In another embodiment, the Disclosure also provides a kit for treating a subject in need of treatment for Duchenne muscular dystrophy (DMD), the subject having a mutation in the dystrophin gene suitable for exon 53 skipping, and the kit comprises the antisense oligomer conjugate of the Disclosure packaged in at least a suitable container, and instructions for its use.

[0043] In another embodiment, the Disclosure also provides a kit for treating a subject in need of treatment for Duchenne muscular dystrophy (DMD), the subject having a mutation in the dystrophin gene suitable for exon 53 skipping, and the kit comprises the antisense oligomer of the Disclosure packaged in at least a suitable container, and instructions for its use.

[0044] These and other purposes and features will be better understood when the following detailed description of this disclosure is read in conjunction with the drawings. In certain embodiments, for example, the following items are provided: (Item 1) Antisense oligomer conjugate of formula (I), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence. T is [ka] Selected from, R 1 However, it is a C1-C6 alkyl group, The aforementioned target sequences are H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25-01), H53A(-24 +01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A (-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A (-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+ 21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53 Antisense oligomer conjugates complementary to the exon 53 annealing site in dystrophin premRNA, selected from the group consisting of D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25). (Item 2) The aforementioned annealing areas are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H5 3A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53 A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A An antisense oligomer conjugate as described in item 1, selected from the group consisting of (-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24). (Item 3) The antisense oligomer conjugate described in item 1, wherein the targeting sequence is selected from the group consisting of sequence numbers 70 to 134. (Item 4) The antisense oligomer conjugate described in item 2, wherein the targeting sequence is selected from the group consisting of sequence numbers 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133. (Item 5) The antisense oligomer conjugate described in item 1, wherein each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I). (Item 6) Antisense oligomer conjugate of formula (III), [ka] or a pharmaceutically acceptable salt thereof, wherein each Nu is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25-01), H5 3A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+ 05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53 A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+1) 4), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+ 19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1 +24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H5 3D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16- 09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53 Antisense oligomer conjugates are nucleic acid bases that together form a targeting sequence complementary to the exon 53 annealing site in dystrophin premRNA, selected from the group consisting of D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25). (Item 7) The aforementioned annealing areas are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H5 3A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53 A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A Antisense oligomer conjugates as described in item 6, selected from the group consisting of (-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24). (Item 8) The antisense oligomer conjugate described in item 6, wherein the targeting sequence is selected from the group consisting of sequence numbers 70 to 134. (Item 9) The antisense oligomer conjugate described in item 7, wherein the targeting sequence is selected from the group consisting of sequence numbers 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133. (Item 10) Antisense oligomer of formula (IV), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence. T is [ka] It is the part selected from, R 1 However, it is a C1-C6 alkyl group, R 2 However, it is selected from H or acetyl, The target sequences are H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25-01), H53A(-2 4+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H5 3A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H 53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12) Antisense oligomers that are complementary to the exon 53 annealing site in dystrophin premRNA, selected from the group consisting of H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25). (Item 11) The aforementioned annealing areas are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H 53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H 53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H The antisense oligomers described in item 10, selected from the group consisting of 53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24). (Item 12) The antisense oligomer conjugate described in item 10, wherein the targeting sequence is selected from the group consisting of sequence numbers 70 to 134. (Item 13) The antisense oligomer conjugate described in item 11, wherein the targeting sequence is selected from the group consisting of sequence numbers 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133. (Item 14) T is [ka] The antisense oligomer described in item 10. (Item 15) Antisense oligomer of formula (V), [ka] or a pharmaceutically acceptable salt thereof, in the formula, R is selected from H or acetyl, Each Nu is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A (-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25-01), H53A(-24+01), H5 3A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H5 3A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D( +20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53 An antisense oligomer, which is a nucleic acid base selected from the group consisting of D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25), that together forms a targeting sequence complementary to the exon 53 annealing site in dystrophin premRNA. (Item 16) The aforementioned annealing areas are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+1 3), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H 53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13) The antisense oligomer described in item 15, selected from the group consisting of H53D(+7-18) and H53D(+1-24). (Item 17) The antisense oligomer conjugate described in item 15, wherein the targeting sequence is selected from the group consisting of sequence numbers 70 to 134. (Item 18) The antisense oligomer conjugate according to item 16, wherein the targeting sequence is selected from the group consisting of sequence numbers 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133. (Item 19) A pharmaceutical composition comprising an antisense oligomer conjugate as described in any one of items 1 to 17, or an antisense oligomer as described in any one of items 18 to 33, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. (Item 20) A method for treating a subject in need of treatment for Duchenne muscular dystrophy (DMD), wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering to the subject an antisense oligomer conjugate described in any one of items 1 to 9, or an antisense oligomer described in any one of items 10 to 16. (Item 21) A method for inducing dystrophin production by restoring the mRNA reading frame in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, comprising administering to the subject an antisense oligomer conjugate described in any one of items 1 to 9, or an antisense oligomer described in any one of items 10 to 16. (Item 22) A method for treating Duchenne muscular dystrophy (DMD) in a subject requiring treatment, wherein the subject has a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering to the subject the pharmaceutical composition described in item 19. (Item 23) A method for inducing dystrophin production by restoring the mRNA reading frame in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, comprising administering the pharmaceutical composition described in item 19 to the subject. (Item 24) A method for eliminating exon 53 from dystrophin premRNA during mRNA processing in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, comprising administering the pharmaceutical composition described in item 19 to the subject. (Item 25) A method for conjugating exon 53 of dystrophin premRNA to a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, comprising administering the pharmaceutical composition described in item 19 to the subject. [Brief explanation of the drawing]

[0045] [Figure 1] Sections of normal dystrophin premRNA and mature mRNA are shown. [Figure 2] This shows an example of abnormal dystrophin premRNA (DMD) and the resulting non-functional and unstable dystrophin section. [Figure 3] This shows eteplirsen, designed to skip exon 51, which is a recovery of premRNA "in-frame" reading. [Figure 4A] This image provides representative images of Western blot analysis measuring dystrophin protein in the quadriceps femoris muscle of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different time points [day 7 (5A), day 30 (5B), day 60 (5C), and day 90 (5D)]. [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above. [Figure 5] (Figure 5A) Line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the quadriceps femoris muscle of mdx mice over 90 days after injection, as determined by Western blot analysis. (Figure 5B) Line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the quadriceps femoris muscle of mdx mice over 90 days after injection, as determined by RT-PCR. [Figure 6A] This provides representative images of Western blot analysis measuring dystrophin protein in the diaphragm of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different time points [day 7 (7A), day 30 (7B), day 60 (7C), and day 90 (7D)]. [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 7] (Figure 7A) Line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the diaphragm of mdx mice over 90 days after injection, as determined by Western blot analysis. (Figure 7B) Line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the diaphragm of mdx mice over 90 days after injection, as determined by RT-PCR. [Figure 8A] This image provides representative images of Western blot analysis measuring dystrophin protein in the hearts of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different time points [day 7 (9A), day 30 (9B), day 60 (9C), and day 90 (9D)]. [Figure 8B] Same as above. [Figure 8C] Same as above. [Figure 8D] Same as above. [Figure 9] (Figure 9A) Line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the hearts of mdx mice over 90 days after injection, as determined by Western blot analysis. (Figure 9B) Line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the hearts of mdx mice over 90 days after injection, as determined by RT-PCR. [Figure 10] This provides immunohistochemical analysis showing dystrophin in the left quadriceps femoris muscle of mdx mice induced by PMO (PMO4225) or PPMO (PPMO4225). [Figure 11A] This is a representative image of Western blot analysis measuring dystrophin protein in the hearts of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 11B] Same as above. [Figure 12] This bar graph shows the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the hearts of mdx mice, determined by Western blot analysis 30 days after injection at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 13A] These are representative images of Western blot analysis measuring dystrophin protein in the diaphragm of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 13B] Same as above. [Figure 14] This bar graph shows the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the diaphragm of mdx mice, determined by Western blot analysis 30 days after injection at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 15A] This is a representative image of Western blot analysis measuring dystrophin protein in the quadriceps femoris muscle of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 15B] Same as above. [Figure 16] This bar graph shows the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the quadriceps femoris muscle of mdx mice, determined by Western blot analysis 30 days after injection at different doses: 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 17]This report provides immunohistochemical analysis showing dystrophin and laminin in the diaphragm and heart of mdx mice induced by PPMO (PPMO4225) compared to saline in mdx mice and wild-type mice. [Modes for carrying out the invention]

[0046] Embodiments of this disclosure generally relate to improved antisense oligomers and antisense oligomer conjugates, as well as methods of use thereof specifically designed to induce exon skipping in the human dystrophin gene. Dystrophin plays a crucial role in muscle function, and various muscle-related diseases are characterized by mutations in this gene. Therefore, in certain embodiments, the improved antisense oligomers and antisense oligomer conjugates described herein induce exon skipping in mutations of the human dystrophin gene, such as the mutant dystrophin gene found in Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD).

[0047] Abnormal mRNA splicing events caused by mutations result in these mutant human dystrophin genes either expressing a defective dystrophin protein or no measurable dystrophin at all, a condition that leads to various forms of muscular dystrophy. To address this condition, the antisense oligomers and antisense oligomer conjugates of this disclosure hybridize to selected regions of pre-processed mRNA of the mutant human dystrophin gene, inducing exon skipping and differential splicing in otherwise abnormally spliced ​​dystrophin mRNA, thereby enabling muscle cells to produce mRNA transcripts encoding a functional dystrophin protein. In certain embodiments, the resulting dystrophin protein is not necessarily the “wild-type” form of dystrophin, but rather a cleaved but functional form of dystrophin.

[0048] By increasing the levels of functional dystrophin protein in muscle cells, these and related embodiments are useful for the prevention and treatment of muscular dystrophy, particularly forms such as DMD and BMD, which are characterized by the expression of defective dystrophin protein due to abnormal mRNA splicing. The specific antisense oligomers and antisense oligomer conjugates described herein further provide improved dystrophin-exon specific targeting compared to other oligomers, thereby offering significant and practical advantages over alternative methods for treating the related forms of muscular dystrophy.

[0049] Therefore, this disclosure is, An antisense oligomer having a length of 18 to 25 subunits that can bind to a selected target to induce exon skipping in the human dystrophin gene, comprising a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site, This invention relates to an antisense oligomer conjugate comprising a cell membrane-permeable peptide (CPP) conjugated to an antisense oligomer by a linker moiety.

[0050] In some embodiments, the annealing region is selected from H53A(+23+47), H53A(+39+62), H53A(+36+69), and H53A(+45+62).

[0051] Therefore, this disclosure is, An antisense oligomer having a length of 25 subunits that can bind to a selected target to induce exon skipping in the human dystrophin gene, comprising a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site, This invention relates to an antisense oligomer conjugate comprising a cell membrane-permeable peptide (CPP) conjugated to an antisense oligomer by a linker moiety.

[0052] The disclosure also relates to a 25-subunit length antisense oligomer that can bind to a selected target to induce exon skipping in the human dystrophin gene, wherein the antisense oligomer comprises a sequence of bases complementary to the exon 53 target region of dystrophin premRNA designated as the annealing site.

[0053] In some embodiments, the annealing area is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30- 06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A( -9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D( +24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-0) 9) Selected from the group consisting of H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0054] In some embodiments, the annealing area is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14 ), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H 53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 The group is selected from the following: 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0055] In some embodiments, the bases of the antisense oligomer are linked to morpholino ring structures, which are linked by inter-subunit linkages containing phosphorus, where the morpholino nitrogen of one ring structure is linked to the 5' extra-ring carbon of an adjacent ring structure. In a particular embodiment, the cell membrane-permeable peptide is R6 (SEQ ID NO: 135), and the linker moiety is glycine.

[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this disclosure, but preferred methods and materials are described. For the purposes of this disclosure, the following terms are defined below:

[0057] I. definition "Approximately" means a quantity, level, value, number, frequency, percentage, dimension, size, volume, weight, or length that varies by approximately 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% relative to the standard quantity, level, value, number, frequency, percentage, dimension, size, volume, weight, or length.

[0058] As used herein, the term “alkyl” refers to saturated linear or branched hydrocarbons unless otherwise specified. In certain embodiments, alkyl groups are primary, secondary, or tertiary hydrocarbons. In certain embodiments, alkyl groups consist of 1 to 10 carbon atoms, i.e., C1 to C1 10 The alkyl group includes alkyl groups. In certain embodiments, the alkyl group includes 1 to 6 carbon atoms, i.e., C1 to C6 alkyl groups. In certain embodiments, the alkyl group is selected from the group consisting of methyl, CF3, CCl3, CFCl2, CF2Cl, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl, and 2,3-dimethylbutyl. The term includes halogenated alkyl groups, and includes both substituted and unsubstituted alkyl groups. In certain embodiments, the alkyl group is a fluorinated alkyl group. Non-limiting examples of parts in which the alkyl group may be substituted are known to those skilled in the art, for example, Greene, et al., incorporated herein by reference. As taught in al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991, the group consists of halogens (fluoro, chloro, bromo, or iodine), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acids, sulfates, phosphonic acids, phosphates, or phosphonates, which are either unprotected or, if necessary, protected.

[0059] When used herein in relation to subjects or patients, "suitable for exon 53 skipping" is intended to include subjects and patients having one or more mutations in the dystrophin gene that, without exon 53 skipping of the dystrophin premRNA, would cause the reading frame to go out of frame, thereby preventing translation of the premRNA and preventing the subject or patient from producing functional or semi-functional dystrophin. Examples of dystrophin gene mutations suitable for exon 53 skipping include, for example, exons 42-52, exons 45-52, exons 47-52, exons 48-52, exons 49-52, exons 50-52, or deletion of exon 52. Determining whether a patient has a dystrophin gene mutation suitable for exon skipping is well within the realm of those skilled in the art (e.g., Aartsma-Rus et al. (2009) Hum Mutat. 30:293-299, Gurvich et al., Hum Mutat. 2009; 30(4) 633-640, and Fletcher et al. (2010) Molecular Therapy See 18(6)1218-1223).

[0060] As used herein, the term “oligomer” refers to a sequence of subunits linked by an inter-subunit linkage. In certain examples, the term “oligomer” is used in relation to “antisense oligomer.” For an “antisense oligomer,” each subunit consists of (i) a ribose sugar or a derivative thereof, and (ii) nucleic acid bases bound thereto, so that the order of the base-paired portions forms a base sequence complementary to the target sequence in nucleic acid (typically RNA) by Watson-Crick base pairing, on the condition that neither the subunits, the inter-subunit linkage, nor both are naturally present, in order to form a nucleic acid:oligomer heteroduplex in the target sequence. In certain embodiments, the antisense oligomer is a PMO. In other embodiments, the antisense oligomer is a 2'-O-methylphosphorothioate. In other embodiments, the antisense oligomer of this disclosure is a cross-linked nucleic acid (BNA), such as a peptide nucleic acid (PNA), a locked nucleic acid (LNA), or a 2'-O,4'-C-ethylene cross-linked nucleic acid (ENA). Additional exemplary embodiments are described herein.

[0061] The terms “complementary” and “complementarity” refer to two or more oligomers (i.e., each containing a nucleic acid sequence) that are related to each other by the Watson-Crick base pairing rule. For example, the nucleic acid sequence “TGA(5'→3')” is complementary to the nucleic acid sequence “ACT(3'→5')”. Complementarity may be “partial,” meaning that not all nucleic acid bases in a given nucleic acid sequence are matched in the other nucleic acid sequence according to the base pairing rule. For example, in some embodiments, the complementarity between a given nucleic acid sequence and another nucleic acid sequence may be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Or, continuing the example, there may be “complete” or “perfect” (100%) complementarity between a given nucleic acid sequence and another nucleic acid sequence. The degree of complementarity between nucleic acid sequences has a significant effect on the efficiency and strength of hybridization between sequences.

[0062] The terms “effective dose” and “therapeutic effective dose” are used interchangeably herein and refer to the amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian subject as either a single dose or part of a series of doses, which is effective in producing the desired therapeutic effect. For antisense oligomers, this effect is typically brought about by inhibiting the translation or natural splice processing of a selected target sequence, or by producing a clinically significant amount of dystrophin (statistical significance).

[0063] In some embodiments, the effective dose is a composition containing at least 10 mg / kg or at least 20 mg / kg of antisense oligomers over a period of time to treat the subject. In some embodiments, the effective dose is a composition containing at least 20 mg / kg of antisense oligomers to increase the number of dystrophin-positive fibers in the subject to at least 20% of normal levels. In certain embodiments, the effective dose is a composition containing 10 mg / kg of antisense oligomers or, in at least in various embodiments, a 20 mg / kg annealing of a targeted sequence to stabilize, maintain, or improve walking distance in a patient, for example, from a 20% deficiency in a 6MWT compared to a healthy equivalent. In various embodiments, the effective dose is at least 10 mg / kg to about 30 mg / kg, at least 20 mg / kg to about 30 mg / kg, about 25 mg / kg to about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg. In some embodiments, the effective dose is about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, or about 50 mg / kg. In another embodiment, the effective dose is at least about 10 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg over at least 24 weeks, at least 36 weeks, or at least 48 weeks, thereby increasing the number of dystrophin-positive fibers in the subject to at least 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% of normal, stabilizing or improving walking distance in the patient from, for example, a 20% deficit in a 6MWT compared to a healthy equivalent. In some embodiments, the treatment increases the number of dystrophin-positive fibers in the patient to 20-60% or 30-50% of normal.

[0064] "Enhancing" or "increasing," or "increasing" or "stimulating" generally refers to the ability of any of the above-described antisense oligomers, antisense oligomer conjugates, or pharmaceutical compositions to produce or induce a greater physiological response (i.e., a downstream effect) in a cell or subject compared to the response caused by the absence of the antisense oligomer, the absence of the antisense oligomer conjugate, or the control compound. A greater physiological response may include, among other responses evident from the understanding in the art and the description herein, an increased expression of a functional form of the dystrophin protein or an increased dystrophin-related bioactivity in muscle tissue. Increases in muscle function may also be measured, including increases or improvements in muscle function of approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or up to 100%. The percentage of muscle fibers expressing functional dystrophin can also be measured, including increases in dystrophin expression of approximately 1%, 2%, 5%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of muscle fibers. For example, it has been shown that when 25-30% of fibers express dystrophin, an improvement of approximately 40% in muscle function can occur (e.g., DelloRusso et al, Proc Natl Academia). See Sci USA 99:12979-12984, 2002. The “increased” or “enhanced” amount is typically a “statistically significant” amount and may include increases of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 times or more (e.g., 500, 1000 times, and all integers and decimals greater than 1, including 1.5, 1.6, 1.7, 1.8, etc.) between the amount produced in the absence of the drug (without antisense oligomers or antisense oligomer conjugates) or by the control compound.

[0065] As used herein, terms such as “function” and “functionality” refer to biological, enzymatic, or therapeutic functions.

[0066] A “functional” dystrophin protein generally refers to a dystrophin protein that, compared to a “modified” or “deficient” form of the dystrophin protein present in a particular subject with DMD or BMD, possesses sufficient biological activity to reduce the progressive degradation of muscle tissue otherwise characteristic of muscular dystrophy. In certain embodiments, a functional dystrophin protein may have about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including all integers in between) of the in vitro or in vivo biological activity of wild-type dystrophin, as measured according to the usual art of the art. As an example, dystrophin-related activity in in vitro muscle culture can be measured according to myotube size, myofibrils organizing (or breaking down), contractile activity, and spontaneous clustering of acetylcholine acceptors (see, e.g., Brown et al., Journal of Cell Science. 112:209-216, 1999). Furthermore, animal models are valuable resources for studying the pathogenesis of diseases and provide a means for testing dystrophin-related activity. Two of the most widely used animal models in DMD research are the mdx mouse and the golden retriever muscular dystrophy (GRMD) dog, both of which are dystrophin-negative (see, e.g., Collins & Morgan, Int J Exp Pathol 84:165-172, 2003). These and other animal models can be used to measure the functional activity of various dystrophin proteins, including truncated dystrophins, such as forms produced after administration of certain exon-skipping antisense oligomers or antisense oligomer conjugates of this disclosure.

[0067] The term “mismatch” (singular or plural) refers to one or more nucleic acid bases (whether continuous or segregated) in the oligomeric nucleic acid sequence that do not match the target premRNA according to the base pairing rules. While complete complementarity is often desirable, some embodiments may include one or more mismatches with respect to the target premRNA, preferably 6, 5, 4, 3, 2, or 1. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomer or antisense oligomer conjugate of this disclosure includes variations in the nucleic acid sequence near internal terminal variations, which, if present, are typically within about 6, 5, 4, 3, 2, or 1 subunit at the 5' and / or 3' ends.

[0068] The terms "morpholino," "morpholino oligomer," and "PMO" refer to the following general structure: [ka] This invention relates to phosphorodiamidate morpholino oligomers, as shown in Figure 2 of Summerton, J., et al., Antisense & Nucleic Acid Drug Development, 7:187-195 (1997). The morpholino described herein includes all stereoisomers and tautomers of the general structure described above. The synthesis, structure, and binding properties of morpholino oligomers are described in detail in U.S. Patents 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063, 5,506,337, 8,076,476, and 8,299,206, all of which are incorporated herein by reference.

[0069] In certain embodiments, morpholino is conjugated with a “tail” portion at the 5' or 3' end of the oligomer to enhance its stability and / or solubility. An exemplary tail is: [ka] Includes.

[0070] In the example tail section shown above, "TEG" or "EG3" refers to the following tail section: [ka]

[0071] Of the example tail sections shown above, "GT" refers to the following tail section: [ka]

[0072] As used herein, the terms "-G-R6" (SEQ ID NO: 136) and "-G-R6-Ac" (SEQ ID NO: 136) are used interchangeably and refer to the peptide moiety conjugated to the antisense oligomer of this disclosure. In various embodiments, "G" represents a glycine residue conjugated to "R6" (SEQ ID NO: 135) by an amide bond, and each "R" represents an arginine residue conjugated together by an amide bond, so that "R6" (SEQ ID NO: 135) means six arginine residues (SEQ ID NO: 135) conjugated together by an amide bond. The arginine residues can have any configuration; for example, an arginine residue may be an L-arginine residue, a D-arginine residue, or a mixture of D-arginine and L-arginine residues. In certain embodiments, "-G-R6" (SEQ ID NO: 136) or "-G-R6-Ac" (SEQ ID NO: 136) is conjugated to the morpholine ring nitrogen of the most 3' morpholino subunit of the PMO antisense oligomer of the present disclosure. In some embodiments, "-G-R6" (SEQ ID NO: 136) or "-G-R6-Ac" (SEQ ID NO: 136) is conjugated to the 3' end of the antisense oligomer of the present disclosure and has the following formula: [ka]

[0073] The terms “nucleic acid base” (Nu), “base pairing site,” or “base” are used interchangeably to refer to purine or pyrimidine bases found in naturally occurring or “natural” DNA or RNA (e.g., uracil, thymine, adenine, cytosine, and guanine), as well as analogs of these naturally occurring purines and pyrimidines. These analogs can impart improved properties, such as binding affinity, to oligomers. Exemplary analogs include hypoxanthine (a base component of inosine), 2,6-diaminopurine, 5-methylcytosine, C5-propynyl-modified pyrimidine, and 10-(9-(aminoethoxy)phenoxadinyl) (G-clamp).

[0074] Further examples of base-pairing moieties include, but are not limited to, uracil, thymine, adenine, cytosine, guanine, and hypoxanthine (inosine) (each of which has an amino group protected by an acyl protecting group), pyrimidine analogs such as 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine, and pseudouracil, as well as other modified nucleic acid bases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being naturally occurring degradation products). Modified nucleic acid bases disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048; Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196; and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313 are also intended, and their contents are incorporated herein by reference.

[0075] Further examples of base-pairing moieties include, but are not limited to, expanded-size nucleic acid bases with one or more benzene rings attached. Nucleic acid base substitutions described in the Glen Research catalog (www.glenresearch.com), Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150, Kool, ET, Acc. Chem. Res., 2002, 35, 936-943, Benner SA, et al., Nat. Rev. Genet., 2005, 6, 553-543, Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733, and Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627 (their contents are incorporated herein by reference) are considered useful in antisense oligomers or antisense oligomer conjugates described herein. Examples of enlarged nucleic acid bases include those listed below, as well as their tautomers. [ka]

[0076] As used herein, the terms “parenteral administration” and “administered parenterally” mean a mode of administration other than intestinal and topical administration, usually by injection, and include, but are not limited to, injections and infusions of intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intraperitoneal, transtracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal regions.

[0077] Where used herein, a set of parentheses used within a structural formula indicates that the structural feature between the parentheses is repeated. In some embodiments, the parentheses used may be "[" and "]", and in certain embodiments, the parentheses used to indicate a repeating structural feature may be "(" and ")". In some embodiments, the number of repetitions of the structural feature between the parentheses is indicated by a number shown outside the parentheses, e.g., 2, 3, 4, 5, 6, 7, etc. In various embodiments, the number of repetitions of the structural feature between the parentheses is indicated by a variable shown outside the parentheses, such as "Z".

[0078] As used herein, linear or squiggly bonds attracted to a chiral carbon or phosphorus atom in a structural formula indicate that the stereochemistry of the chiral carbon or phosphorus is undefined and is intended to include all forms of the chiral center. Examples of such figures are shown below. [ka]

[0079] The phrase "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with the other components of the formulation and / or the object being treated.

[0080] As used herein, the term “pharmaceutically acceptable carrier” means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation aid. Some examples of materials that may serve as pharmaceutically acceptable carriers include, at the discretion of the formulation, sugars, e.g., lactose, glucose, sucrose; starches, e.g., corn starch and potato starch; cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, e.g., cocoa butter and suppository wax; oils, e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, etc. Leaf oil, corn oil, and soybean oil; glycols, e.g., propylene glycol esters, e.g., ethyl oleate and ethyl laurate; agar; buffers, e.g., magnesium hydroxide and aluminum hydroxide; arginine; pyrogenic substances removed distilled water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer; non-toxic compatible lubricants, e.g., sodium lauryl sulfate and magnesium stearate; colorants; release agents; coating agents; sweeteners; flavoring agents; fragrances; preservatives; and antioxidants.

[0081] The term “recovery” with respect to dystrophin synthesis or production generally refers to the production of dystrophin protein, including truncated dystrophin, in muscular dystrophy patients after treatment with the antisense oligomers or antisense oligomer conjugates described herein. In some embodiments, the treatment results in an increase of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including all integers in between) of novel dystrophin production in the patient. In some embodiments, the treatment increases the number of dystrophin-positive fibers in the subject to at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95%–100% of normal. In other embodiments, the treatment increases the number of dystrophin-positive fibers in the subject to about 20%–60% or about 30%–50% of normal. The percentage of dystrophin-positive fibers in a patient after treatment can be determined by muscle biopsy using known techniques. For example, the muscle biopsy may be taken from a suitable muscle, such as the biceps brachii, of the patient.

[0082] Analysis of the percentage of positive dystrophin fibers may be performed before and / or after treatment, or at any point throughout the treatment process. In some embodiments, the post-treatment biopsy is taken from the muscle opposite to the pre-treatment biopsy. Pre- and post-treatment dystrophin expression analysis may be performed using a suitable dystrophin assay. In some embodiments, immunohistochemical detection is performed on tissue sections from muscle biopsies using an antibody that is a marker of dystrophin, such as a monoclonal or polyclonal antibody. For example, the MANDYS106 antibody, a highly sensitive marker of dystrophin, may be used. Any suitable secondary antibody may be used.

[0083] In some embodiments, the percentage of dystrophin-positive fibers is calculated by dividing the number of positive fibers by the total number of fibers counted. A normal muscle sample has 100% dystrophin-positive fibers. Therefore, the percentage of dystrophin-positive fibers can be expressed as the percentage of normal. To control for the presence of trace levels of dystrophin in pre-treatment muscle and reverse-mutated fibers, a baseline may be established using pre-treatment muscle sections from the patient when counting dystrophin-positive fibers in post-treatment muscle. This can be used as a threshold for counting dystrophin-positive fibers in post-treatment muscle sections from that patient. In other embodiments, antibody-stained tissue sections are analyzed using Bioquant Image Analysis software. It can also be used for dystrophin quantification using (Corporation, Nashville, TN). The total intensity of the dystrophin fluorescence signal can be reported as the percentage of normal. In addition, the percentage of dystrophin-positive fibers can be determined using Western blot analysis with monoclonal or polyclonal anti-dystrophin antibodies. For example, the anti-dystrophin antibody NCL-Dys1 from Leica Biosystems can be used. The percentage of dystrophin-positive fibers can also be analyzed by determining the expression of sarcoglycan complexes (β,γ) and / or components of the neuronal NOS.

[0084] In some embodiments, treatment with the antisense oligomers or antisense oligomer conjugates of this disclosure delays or reduces progressive respiratory muscle dysfunction and / or failure in DMD patients that would be expected without treatment. In some embodiments, treatment with the antisense oligomers or antisense oligomer conjugates of this disclosure may reduce or eliminate the need for ventilatory support that would be expected without treatment. In some embodiments, measurements of respiratory function to track the course of the disease, as well as to evaluate possible therapeutic interventions, include maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP), and forced vital capacity (FVC). MIP and MEP are sensitivity measures of respiratory muscle strength, measuring the pressure levels that a person can generate during inhalation and exhalation, respectively. MIP is a measure of diaphragmatic muscle weakness.

[0085] In some embodiments, MEP may decrease before changes in other pulmonary function tests, including MIP and FVC. In certain embodiments, MEP may be an early indicator of respiratory dysfunction. In certain embodiments, FVC may be used to measure the total volume of air expelled during forced exhalation after maximal inspiration. In DMD patients, FVC increases in conjunction with physical growth until the early teens. However, as growth slows or deteriorates due to disease progression and muscle weakness progresses, vital capacity enters a decline phase, decreasing at an average rate of about 8–8.5 percent per year after 10–12 years of age. In certain embodiments, predicted MIP percent (MIP adjusted for body weight), predicted MEP percent (MEP is annual The age-adjusted and predicted FVC percentages (FVC adjusted for age and height) are supporting analyses.

[0086] As used herein, the terms “subject” and “patient” include any animal exhibiting or at risk of exhibiting a condition that can be treated with the antisense oligomer or antisense oligomer conjugate of this disclosure, such as a subject (or patient) having or being at risk of having DMD or BMD, or any of the symptoms associated with these conditions (e.g., loss of muscle fibers). Suitable subjects (or patients) include laboratory animals (such as mice, rats, rabbits, or guinea pigs), livestock, and domestic animals or pets (such as cats or dogs). Non-human primates and preferably human patients (or subjects) are also included. Methods for producing dystrophin in a subject (or patient) having a mutation in the dystrophin gene suitable for exon 51 skipping are also included.

[0087] As used herein, the terms “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” mean the direct administration of a compound, drug, or other substance into the central nervous system, thereby entering the patient’s system and being subject to metabolism and other similar processes, such as subcutaneous administration.

[0088] The term "targeted sequence" refers to the sequence of nucleic acid bases of an oligomer that is complementary to the sequence of nucleotides in the target premRNA. In some embodiments of this disclosure, the sequence of nucleotides in the target premRNA is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(- 30-06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53 A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H5 3A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+2 3-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D This is an exon 53 annealing site in dystrophin premRNA selected from the group consisting of (+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0089] In some embodiments of this disclosure, the sequence of nucleotides in the target premRNA is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+ 04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H 53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(- 10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53 A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20- 05) is an exon 53 annealing site in dystrophin premRNA selected from the group consisting of H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24). Further embodiments are described throughout this disclosure.

[0090] A “treatment” of an object (e.g., a mammal such as a human) or cells is any type of intervention used in an attempt to alter the natural course of the object or cells. Treatments include, but are not limited to, the administration of oligomers or their pharmaceutical compositions, and may be performed prophylactically or after the onset of a pathological event or contact with a pathogen. Treatments include any desired effect on the symptoms or pathology of a disease or condition associated with the dystrophin protein, and may include, for example, a minimal change or improvement in one or more measurable markers of the disease or condition being treated. They also include “prophylactic” treatments that may aim to slow the rate of progression of the disease or condition being treated, delay the onset of the disease or condition, or reduce the severity of its onset. “Treatment” or “prevention” does not necessarily imply the complete eradication, cure, or prevention of the disease or condition or its associated symptoms.

[0091] In some embodiments, treatment with the antisense oligomer or antisense oligomer conjugate of this disclosure increases novel dystrophin production, delays disease progression, delays or reduces ambulation, reduces muscle inflammation, reduces muscle damage, improves muscle function, reduces loss of lung function, and / or enhances muscle regeneration, compared to what would be expected without treatment. In some embodiments, the treatment maintains, delays, or slows disease progression. In some embodiments, the treatment maintains walking or reduces ambulation. In some embodiments, the treatment maintains lung function or reduces loss of lung function. In some embodiments, the treatment maintains or increases the patient's stable walking distance, as measured, for example, by a 6-minute walk test (6MWT). In some embodiments, the treatment maintains or reduces the time it takes to walk / run 10 meters (i.e., a 10-meter walk / run test). In some embodiments, the treatment maintains or reduces the time it takes to stand up from a supine position (i.e., an orthostatic test). In some embodiments, the treatment maintains or reduces the time it takes to climb four standard steps (a four-step climb test). In some embodiments, the treatment maintains or reduces muscle inflammation in the patient, as measured, for example, by MRI (e.g., MRI of the leg muscles). In some embodiments, MRI measures T2 and / or fat fractions to identify muscle degeneration. MRI can identify changes in muscle structure and composition caused by inflammation, edema, muscle injury, and fat infiltration.

[0092] In some embodiments, treatment with an antisense oligomer or antisense oligomer conjugate of the present disclosure increases novel dystrophin production and delays or reduces predicted loss of ambulation without treatment. For example, the treatment may stabilize, maintain, improve, or increase walking ability (e.g., stabilization of walking) in a subject. In some embodiments, the treatment maintains or increases a patient's stable walking distance, as measured, for example, by the 6-Minute Walk Test (6MWT) described by McDonald et al. (Muscle Nerve, 2010; 42:966-74 (incorporated herein by reference)). The change in 6-Minute Walk Distance (6MWD) can be expressed as an absolute value, a rate of change, or a change in % predicted value. In some embodiments, the treatment maintains or improves a stable walking distance in the 6MWT from a 20% deficit in the subject as compared to healthy peers. The performance of DMD patients in the 6MWT compared to the typical performance of healthy peers can be determined by calculating the % predicted value. For example, % predicted 6MWD can be calculated for males using the following equation: 196.72 + (39.81 × age) - (1.36 × age 2 ) + (132.28 × height in meters). For females, % predicted 6MWD can be calculated using the following equation: 188.61 + (51.50 × age) - (1.86 × age 2 ) + (86.10 × height in meters) (Henricson et al. PLoS Curr., 2012, version 2 (incorporated herein by reference)). In some embodiments, treatment with an antisense oligomer increases the stable walking distance in a patient by more than 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or 50 meters from baseline (including all integers therebetween).

[0093] Loss of muscle function in DMD patients can occur against a background of normal childhood growth and development. Indeed, children with DMD may show an increase in walking distance during a 6MWT over approximately one year, despite progressive muscle impairment. In some embodiments, 6MWD from DMD patients is compared to existing standard data from typically developing controls as well as from age- and sex-matched subjects. In some embodiments, normal growth and development can be described using age- and height-based equations fitted to standard data. Using such equations, 6MWD in DMD patients can be converted to percentage-predicted (%-predicted) values. In certain embodiments, analysis of %-predicted 6MWD data may represent a way of describing normal growth and development and show that the increase in function at a young age (e.g., under 7 years) represents stability rather than improvement in ability in DMD patients (Henricson et al. PLoS Curr., 2012, version 2 (incorporated herein by reference)).

[0094] To distinguish between different antisense molecules, a nomenclature system for antisense molecules was proposed and published (see Mann et al., (2002) J Gen Med 4, 644-654). This nomenclature was particularly important when testing several slightly different antisense molecules, all directed towards the same target region, as shown below: H#A / D(x:y) The first letter indicates the species (e.g., H: human, M: mouse, C: dog). "#" indicates the target dystrophin exon number. "A / D" indicates the acceptor or donor splice site at the start and end of the exon, respectively. (xy) represents the annealing coordinates, and "-" or "+" indicates the intron or exon sequence, respectively. For example, A(-6+18) indicates the last 6 bases of the intron preceding the target exon and the first 18 bases of the target exon. The nearest splice site becomes the acceptor, so "A" precedes these coordinates. The annealing coordinates at the donor splice site can be described as D(+2-18), where the last 2 exon bases and the first 18 intron bases correspond to the annealing site of the antisense molecule. The entire exon annealing coordinate system is represented by A(+65+85), that is, the region between the 65th and 85th nucleotides from the starting point of that exon.

[0095] II. Antisense oligomers A. Antisense oligomers and antisense oligomer conjugates designed to induce exon 53 skipping In certain embodiments, the antisense oligomer or antisense oligomer conjugate of this disclosure is complementary to the exon 53 target region of the dystrophin gene and induces exon 53 skipping. In particular, this disclosure relates to antisense oligomers and antisense oligomer conjugates complementary to the exon 53 target region of dystrophin premRNA designated as an annealing site. In some embodiments, the annealing site is described herein.

[0096] The antisense oligomers and antisense oligomer conjugates of this disclosure target dystrophin premRNA and induce exon 53 skipping, thereby being excluded or skipped from mature spliced ​​mRNA transcripts. By skipping exon 53, the disrupted reading frame is restored to an in-frame mutation. While DMD comprises various genetic subtypes, the antisense oligomers and antisense oligomer conjugates of this disclosure are specifically designed to skip exon 53 of dystrophin premRNA. DMD mutations suitable for exon 53 skipping include a subgroup (8%) of DMD patients.

[0097] The nucleic acid base sequence of an antisense oligomer or antisense oligomer conjugate that induces exon 53 skipping is designed to be complementary to a specific target sequence within exon 53 of dystrophin premRNA. In some embodiments, the antisense oligomer of the antisense oligomer or antisense oligomer conjugate is a PMO, where each morpholino ring of the PMO is ligated to a nucleic acid base, including, for example, the nucleic acid bases found in DNA (adenine, cytosine, guanine, and thymine).

[0098] B. Characteristics of Oligomer Chemicals The antisense oligomers and antisense oligomer conjugates of this disclosure can utilize a variety of antisense oligomeric chemicals. Examples of oligomeric chemicals include, but are not limited to, morpholino oligomers, phosphorothioate-modified oligomers, 2'-O-methyl-modified oligomers, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorothioate oligomers, 2'-O-MOE-modified oligomers, 2'-fluoro-modified oligomers, 2'-O,4'C-ethylene-bridged nucleic acids (ENAs), tricyclo-DNA, tricyclo-DNA phosphorothioate subunits, and 2'-O-[2-(N-methylcarbamoyl)ethyl]-modified oligomers (including any combination of the above). A 2'-O-Me-phosphorothioate skeleton can be generated by combining phosphorothioate and 2'-O-Me-modified chemicals. See, for example, PCT Publications WO / 2013 / 112053 and WO / 2009 / 008725 (these in their entirety are incorporated herein by reference). Exemplary embodiments of the oligomeric chemicals of this disclosure are further described below.

[0099] 1. Peptide nucleic acid (PNA) Peptide nucleic acids (PNAs) are DNA analogs whose backbone is structurally isomorphic to the deoxyribose backbone and consists of N-(2-aminoethyl)glycine units to which pyrimidine or purine bases are bound. PNAs containing natural pyrimidines and purine bases hybridize to complementary oligomers according to the Watson-Crick base pairing rule, mimicking DNA in terms of base pair recognition (Egholm, Buchardt et al. 1993). The PNA backbone is formed by peptide bonds rather than phosphodiester bonds, making it well-suited for antisense applications (see structures below). The backbone is uncharged, resulting in PNA / DNA or PNA / RNA double strands that exhibit superior thermal stability. PNAs are not recognized by nucleases or proteases. Non-limiting examples of PNAs are shown below. [ka]

[0100] Despite fundamental structural changes from its natural structure, PNA is capable of sequence-specific binding to DNA or RNA in a helical form. Features of PNA include high binding affinity to complementary DNA or RNA, destabilization caused by single-base mismatches, resistance to nucleases and proteases, salt-independent hybridization with DNA or RNA, and triple-strand formation with homopurine DNA. PANAGENE® has developed its proprietary Bts PNA monomer (Bts; benzothiazole-2-sulfonyl group) and proprietary oligomerization process. PNA oligomerization using Bts PNA monomer consists of repeated cycles of deprotection, coupling, and capping. PNA can be produced synthetically using any technique known in the art. For example, see U.S. Patent Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006, and 7,179,896. Also, for the preparation of PNA, see U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Further teachings on PNA compounds can be found in Nielsen et al., Science, 254:1497-1500, 1991. Each of the above is incorporated in whole by reference.

[0101] 2. Locked Nucleic Acid (LNA) Antisense oligomers and antisense oligomer conjugates may also contain a “locked nucleic acid” subunit (LNA). “LNA” is a member of a class of modifications called crosslinked nucleic acids (BNA). BNA is characterized by a covalent bond that locks the ribose ring's conformation to a C30-endo (northern) sugar packer. In the case of LNA, the crosslink consists of a methylene group between the 2'-O and 4'-C positions. LNA enhances the pre-organization and base stacking of the backbone, thereby improving hybridization and thermal stability.

[0102] The structure of LNA can be found, for example, in Wengel, et al., Chemical Communications (1998) 455, Koshkin et al., Tetrahedron (1998) 54:3607, Jesper Wengel, Accounts of Chem. Research (1999) 32:301, Obika, et al. al., Tetrahedron Letters (1997) 38:8735, Obika, et al., Tetrahedron Letters (1998) 39:5401, and Obika, et al., Bioorganic Medicinal These can be seen in Chemistry (2008) 16:9230, and by reference, the entirety of these is incorporated herein. Non-restrictive examples of LNAs are given below. [ka]

[0103] The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more LNAs. In some cases, the antisense oligomers and antisense oligomer conjugates may be composed entirely of LNAs. Methods for the synthesis of individual LNA nucleoside subunits and their incorporation into oligomers are described, for example, in U.S. Patents 7,572,582, 7,569,575, 7,084,125, 7,060,809, 7,053,207, 7,034,133, 6,794,499, and 6,670,461, each of which is incorporated in whole by reference. Typical inter-subunit linkers include phosphodiester moieties and phosphorothioate moieties. Alternatively, non-phosphorus-containing linkers may be used. Further embodiments include an LNA-containing antisense oligomer or antisense oligomer conjugate, where each LNA subunit is separated by a DNA subunit. A particular antisense oligomer or antisense oligomer conjugate consists of alternating LNA and DNA subunits, with a phosphorothioate acting as the inter-subunit linker.

[0104] 2'O,4'C-ethylene-bridged nucleic acids (ENAs) are another member of the BNA class. A non-restrictive example is shown below. [ka]

[0105] ENA oligomers and their preparations are described in Obika et al., Tetrahedron Lett (1997) 38(50):8735, which is incorporated herein by reference in its entirety. The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more ENA subunits.

[0106] 3. Unlocked Nucleic Acids (UNAs) Antisense oligomers and antisense oligomer conjugates may also contain “unlocked nucleic acid” (UNA) subunits. UNA and UNA oligomers are analogs of RNA in which the C2'-C3' bond of the subunit is cleaved. While LNAs are structurally restricted (with respect to DNA and RNA), UNA are highly flexible. UNA are disclosed, for example, in WO2016 / 070166. Non-limiting examples of UNA are given below. [ka]

[0107] Typical inter-subunit linkers include phosphodiester and phosphorothioate moieties. Alternatively, non-phosphorus-containing linkers may be used.

[0108] 4. Phosphothioate A "phosphorothioate" (or S-oligo) is a variant of normal DNA in which one of the non-crosslinking oxygen atoms is replaced by sulfur. Non-specific examples of phosphorothioates are shown below. [ka]

[0109] Sulfidation of internucleotide bonds reduces the action of endo and exonucleases, including 5'-to-3' and 3'-to-5' DNA POL1 exonuclease, nucleases S1 and P1, RNase, serum nuclease, and snake venom phosphodiesterase. Phosphothioates are produced by two main pathways: the action of a solution of elemental sulfur in carbon disulfide on hydrogen phosphonate, or the sulfidation of triestite phosphate with either tetraethylthiuram disulfide (TETD) or 3H-1,2-benzoditiol-3-one 1,1-dioxide (BDTD) (see, e.g., J. Org. Chem. 55, 4693-4699, 1990 (the whole of which is incorporated herein by reference)). The latter method avoids the insolubility of elemental sulfur in most organic solvents and the toxicity issues of carbon disulfide. The TETD and BDTD methods also yield phosphorothioates of higher purity.

[0110] 5. Tricliclo-DNA and tricyclo-phosphorothioate subunits Tricyclo-DNA (tc-DNA) is a class of constrained DNA analogs in which each nucleotide is modified by the introduction of a cyclopropane ring to limit the steric flexibility of the backbone and optimize the shape of the backbone at a twist angle γ. Homobase adenine and thymine-containing tc-DNA forms highly stable AT base pairs with complementary RNA. Tricyclo-DNA and its synthesis are described in International Patent Application Publication WO2010 / 115993, which is incorporated herein by reference in its entirety. The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more tricyclo-DNA subunits. In some cases, the antisense oligomer or antisense oligomer conjugate may consist entirely of tricyclo-DNA subunits.

[0111] The tricyclo-phosphorothioate subunit is a tricyclo-DNA subunit having a linkage between phosphorothioate subunits. The tricyclo-phosphorothioate subunit and its synthesis are described in International Patent Application Publication WO2013 / 053928, which is incorporated herein by reference in its entirety. The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more tricyclo-DNA subunits. In some cases, the antisense oligomers and antisense oligomer conjugates may consist entirely of tricyclo-DNA subunits. Non-limiting examples of tricyclo-DNA / tricyclo-phosphothioate are shown below. [ka]

[0112] 6. 2'-O-methyl, 2'-O-MOE, and 2'-F oligomers The "2'-O-Me oligomer" molecule has a methyl group at the 2'-OH residue of a ribose molecule. 2'-O-Me-RNA exhibits the same (or similar) behavior as DNA but is protected from nuclease degradation. 2'-O-Me-RNA can also be combined with phosphorothioate oligomers (PTOs) for further stabilization. 2'O-Me oligomers (phosphodiesters or phosphothioates) can be synthesized according to common techniques in the art (see, e.g., Yoo et al., Nucleic Acids Res. 32:2008-16, 2004 (which is incorporated herein by reference in its entirety)). Non-limiting examples of 2'O-Me oligomers are shown below. [ka]

[0113] 2'-O-methoxyethyl oligomers (2'-O MOEs) have a methoxyethyl group at the 2'-OH residue of a ribose molecule and were discussed in Martin et al., Helv. Chim. Acta, 78, 486-504, 1995, which is incorporated herein by reference in its entirety. Non-limiting examples of 2'O MOE subunits are shown below. [ka]

[0114] 2'-Fluoro(2'-F) oligomers have a fluorescent radical at the 2' position instead of the 2'OH group. Non-restrictive examples of 2'-F oligomers are shown below. [ka] The 2'-fluorooligomers are further described in WO2004 / 043977, which is incorporated herein by reference in its entirety.

[0115] 2'-O-methyl, 2'-O-MOE, and 2'-F oligomers may also contain one or more phosphorothioate (PS) linkages, as illustrated below. [ka]

[0116] Furthermore, the 2'-O-methyl, 2'-O-MOE, and 2'-F oligomers may contain inter-PS subunit linkages throughout the oligomer, for example, as shown below for the 2'-O-methyl PS oligomer drisapersen. [ka]

[0117] Alternatively, the 2'-O-methyl, 2'-O-MOE, and / or 2'-F oligomers may contain PS linkages at the oligomer's terminus, as shown below. [ka] During the ceremony, R is CH2CH2OCH3 (methoxyethyl or MOE), x, y, and z represent the number of nucleotides contained within the specified 5'-wing, central gap, and 3'-wing regions, respectively.

[0118] The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more 2'O-methyl, 2'O-MOE, and 2'-F subunits and may utilize any of the subunit linkages described herein. In some cases, the antisense oligomers or antisense oligomer conjugates of this disclosure may consist entirely of 2'-O-methyl, 2'O-MOE, or 2'-F subunits. One embodiment of the antisense oligomers or antisense oligomer conjugates of this disclosure consists entirely of a 2'O-methyl subunit.

[0119] 7.2'-O-[2-(N-methylcarbamoyl)ethyl]oligomer (MCE) MCE is another example of a 2'O modified ribonucleoside useful in the antisense oligomers and antisense oligomer conjugates of this disclosure, where the 2'OH is derivatized to a 2-(N-methylcarbamoyl)ethyl moiety to enhance nuclease resistance. Non-limiting examples of MCE oligomers are shown below. [ka] MCE and its synthesis are discussed in Yamada et al., J. Org. Chem. (2011) 76(9):3042-53, which is incorporated herein by reference in its entirety. The antisense oligomers and antisense oligomer conjugates of this disclosure may incorporate one or more MCE subunits.

[0120] 8. Stereospecific oligomers Stereospecific oligomers are those in which the stereochemistry of each phosphorus-containing linkage is fixed by a synthetic method that produces substantially sterically pure oligomers. Non-limiting examples of stereospecific oligomers are shown below. [ka]

[0121] In the above example, each phosphorus in the oligomer has the same stereochemistry. Further examples include the above oligomers. For example, LNA, ENA, tricyclo-DNA, MCE, 2'-O-methyl, 2'-O-MOE, 2'-F, and morpholino-based oligomers can be prepared using stereospecific phosphorus-containing internucleoside linkages, such as phosphorothioates, phosphodiesters, phosphoramidates, phosphorodiamidates, or other phosphorus-containing internucleoside linkages. Stereospecific oligomers, preparation methods, chiral controlled synthesis, chiral design, and chiral auxiliaries for use in the preparation of such oligomers are, for example, WO2017192664, WO2017192679, WO2017062862, WO2017015575, WO2017015555, WO2015107425, WO2015108048, This is detailed in WO2015108046, WO2015108047, WO2012039448, WO2010064146, WO2011034072, WO2014010250, WO2014012081, WO20130127858, and WO2011005761, each of which is incorporated herein by reference in its entirety.

[0122] Stereospecific oligomers are R P or S PThe arrangement may have inter-phosphorus nucleoside linkages. Chiral phosphorus-containing linkages whose stereoconfiguration is controlled are referred to as "stereopure," and chiral phosphorus-containing linkages whose stereoconfiguration is not controlled are referred to as "stereoirregular." In certain embodiments, the oligomers of the present disclosure include a plurality of stereopure and stereoirregular linkages, and the oligomers obtained thereby have stereopure subunits at predetermined positions of the oligomer. Examples of the positions of stereopure subunits are provided in International Patent Application Publication WO2017 / 062862A2 in Figures 7A and 7B. In one embodiment, all chiral phosphorus-containing linkages in the oligomer are stereoirregular. In one embodiment, all chiral phosphorus-containing linkages in the oligomer are stereopure.

[0123] In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, all n of the chiral phosphorus-containing linkages in the oligomer are sterically irregular. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, all n of the chiral phosphorus-containing linkages in the oligomer are sterically pure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 10% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are sterically pure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 20% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are sterically pure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 30% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are sterically pure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 40% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 50% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 60% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 70% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure. In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 80% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure.In one embodiment of an oligomer having n (where n is an integer greater than or equal to 1) chiral phosphorus-containing linkages, at least 90% (rounded to the nearest integer) of the n phosphorus-containing linkages in the oligomer are stereopure.

[0124] In one embodiment of an oligomer having n chiral phosphate-containing linkages (where n is an integer greater than or equal to 1), the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least two consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least three consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least four consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least five consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least six consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R PIt contains at least seven consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least eight consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least nine consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 10 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 11 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 12 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 13 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R PIt contains at least 14 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 15 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 16 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 17 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 18 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 19 consecutive stereopure phosphorus-containing linkages of any of the following: In one embodiment of an oligomer having n (where n is an integer of 1 or more) chiral phosphorus-containing linkages, the oligomer has the same stereoconfiguration (i.e., S P or R P It contains at least 20 continuous stereopure phosphorus-containing linkages of any of the following:

[0125] 9. Morpholinooligomers An exemplary embodiment of this disclosure has the following general structure: [ka] and relates to phosphorodiamidate morpholino oligomers as described in Figure 2 of Summerton, J., et al., Antisense & Nucleic Acid Drug Development, 7:187-195 (1997). The morpholinos described herein are intended to include all stereoisomers and tautomers of the general structure described above. The synthesis, structure, and binding properties of morpholino oligomers are detailed in U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063, 5,506,337, 8,076,476, and 8,299,206, all of which are incorporated herein by reference.

[0126] In certain specific embodiments, the morpholino is conjugated to a "tail" moiety at the 5' or 3' end of the oligomer to enhance its stability and / or solubility. Exemplary tails include

Chemical Formula

[0127] In various embodiments, the antisense oligomer conjugates of the present disclosure conform to Formula (I),

Chemical Formula

Chemical Formula

[0128] In some embodiments, the targeting sequences are H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25 -01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53 A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H 53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53 D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11) The targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA selected from the group consisting of H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 1 to 65. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 70 to 134.

[0129] In some embodiments, the targeting sequences are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05) ), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H 53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A (-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53 It is complementary to the exon 53 annealing site in dystrophin premRNA selected from the group consisting of D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0130] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 12-14, 16-31, 33-35, 39-46, 48, 49, 52, 53, 58, and 64.

[0131] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133.

[0132] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-23+15).

[0133] In some embodiments, the annealing region is selected from the group consisting of H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(11+14), and H53A(-10+15).

[0134] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 18 to 31. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 87 to 100.

[0135] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-16+16). In some embodiments, the annealing site is selected from the group consisting of H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), and H53A(-9+16). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 49-56. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 115-125.

[0136] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-8+20). In some embodiments, the annealing site is selected from the group consisting of H53A(-8+17), H53A(-7+18), H53A(-6+19), and H53A(-5+20). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 33 to 36. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 102 to 105.

[0137] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+23-09). In some embodiments, the annealing site is selected from the group consisting of H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), and H53D(+16-09). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 41-49. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 110-118.

[0138] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+22-15). In some embodiments, the annealing site is selected from the group consisting of H53D(+22-03), H53D(+20-05), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 43, 45, and 50-55. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 112, 114, and 119-124.

[0139] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, either within intron 52, extending to the exon 53 acceptor splice site, extending to the exon 53 donor splice site, or within intron 53.

[0140] In some embodiments, the targeting sequence is located within intron 52 and is complementary to the exon 53 annealing site in dystrophin premRNA, specifically within H53A(-100-01). In some embodiments, the annealing site is selected from the group consisting of H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), and H53A(-25-01). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 1 to 16. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 70 to 85.

[0141] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, located within intron 52 and within H53A(-45-01). In some embodiments, the annealing site is selected from H53A(-45-21), H53A(-40-16), H53A(-35-11), and H53A(-25-01). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 12-14 and 16. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 81-83 and 85. In some embodiments, the annealing site is H53A(-35-11). In some embodiments, the targeting sequence is SEQ ID NO. 14. In some embodiments, the targeting sequence is SEQ ID NO. 83.

[0142] In some embodiments, the targeting sequence extends to the exon 53 acceptor splice site and is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-24+24). In some embodiments, the annealing site is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H The sequence is selected from 53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), and H53A(-1+24). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 17 to 40. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 86 to 109. In some embodiments, the annealing area is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+ 10) The sequence is selected from H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), and H53A(-1+24). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 17-31, 33-36, 39, and 40. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 86-100, 102-105, 108, and 109.

[0143] In some embodiments, the targeting sequence extends to the exon 53 donor splice site and is complementary to the exon 53 annealing site in the dystrophin pre-mRNA located within H53D(+24-24). In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), and H53D(+1-24). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 41 to 64. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 110 to 133. In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+7-18), H53D(+2-23), and H53D(+1-24). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 41 to 46, 48, 49, 51 to 55, 58, 63, and 64. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 110 to 115, 117, 118, 120 to 124, 127, 132, and 133.

[0144] In some embodiments, the targeting sequence extends to the exon 53 donor splice site and is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+22-15). In some embodiments, the annealing site is selected from H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 43 to 55. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 112 to 124.

[0145] In some embodiments, the targeting sequence is located within intron 53 and is complementary to the exon 53 annealing site in the dystrophin premRNA designated as H53D(-1-25). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NO: 66. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NO: 135.

[0146] In various embodiments, T is [ka] That is the case.

[0147] In various embodiments, R 1 These are CF3, CCl3, CFCl2, CF2Cl, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl, or 2,3-dimethylbutyl.

[0148] In some embodiments, the antisense oligomer conjugate of formula (I) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the .6HCl salt.

[0149] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0150] In various embodiments, T is [ka] The target sequence is selected from the following: [Table 1-1] [Table 1-2] Each X is independently thymine (T) or uracil (U). In some embodiments, each X is independently T.

[0151] In various embodiments, T is [ka] The target sequence is selected from the following: [Table 2-1] [Table 2-2]

[0152] In some embodiments, including several embodiments of formula (I), the antisense oligomer conjugate of the present disclosure conforms to formula (II), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence complementary to the exon 53 annealing site in dystrophin premRNA.

[0153] In some embodiments, the annealing area is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30- 06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A( -9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D( +24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-0) 9) Selected from the group consisting of H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0154] In some embodiments, the annealing area is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14 ), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H 53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 The group is selected from the following: 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0155] In some embodiments, the annealing region is located within H53A(-23+15). In some embodiments, the annealing region is selected from the group consisting of H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(11+14), and H53A(-10+15).

[0156] In some embodiments, the annealing region is located within H53A(-16+16). In some embodiments, the annealing region is selected from the group consisting of H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), and H53A(-9+16).

[0157] In some embodiments, the annealing region is located within H53A(-8+20). In some embodiments, the annealing region is selected from the group consisting of H53A(-8+17), H53A(-7+18), H53A(-6+19), and H53A(-5+20).

[0158] In some embodiments, the annealing region is located within H53D(+23-09). In some embodiments, the annealing region is selected from the group consisting of H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), and H53D(+16-09).

[0159] In some embodiments, the annealing region is located within H53D(+22-15). In some embodiments, the annealing region is selected from the group consisting of H53D(+22-03), H53D(+20-05), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0160] In some embodiments, the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0161] In some embodiments, the annealing site is located within intron 52 and within H53A(-100-01). In some embodiments, the annealing site is selected from the group consisting of H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), and H53A(-25-01).

[0162] In some embodiments, the annealing site is located within intron 52 and within H53A(-45-01). In some embodiments, the annealing site is selected from H53A(-45-21), H53A(-40-16), H53A(-35-11), and H53A(-25-01). In some embodiments, the annealing site is H53A(-35-11).

[0163] In some embodiments, the annealing region extends to the exon 53 acceptor splice region and is located within H53A(-24+24). In some embodiments, the annealing region is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H The following are selected: 53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), and H53A(-1+24). In some embodiments, the annealing area is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+ 10) Selected from H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), and H53A(-1+24).

[0164] In some embodiments, the annealing area extends to the Exon 53 donor splice site and is located within H53D(+24-24). In some embodiments, the annealing area is H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H The following are selected: 53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), and H53D(+1-24). In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+7-18), H53D(+2-23), and H53D(+1-24).

[0165] In some embodiments, the annealing site extends to the Exon 53 donor splice site and is located within H53D(+22-15). In some embodiments, the annealing site is selected from H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0166] In some embodiments, the annealing site is located within intron 53 and is designated as H53D(-1-25).

[0167] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0168] In various embodiments, the targeting sequence is selected from the following: [Table 3-1] [Table 3-2] Here, A is [ka] And C is [ka] And G is [ka] And X is [ka] In a particular embodiment, each X is independently [ka] That is the case.

[0169] In various embodiments, the targeting sequence is selected from the following: [Table 4-1] [Table 4-2] Here, A is [ka] And C is [ka] And G is [ka] And T is [ka] That is the case.

[0170] In some embodiments, the antisense oligomer conjugate of formula (II) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the .6HCl salt.

[0171] In some embodiments, including several embodiments of formula (II), the antisense oligomer conjugate of the present disclosure conforms to formula (III) or [ka] or a pharmaceutically acceptable salt thereof, in the formula, Z is an integer between 16 and 23. Each Nu is a nucleic acid base that, together, forms a target sequence complementary to the exon 53 annealing site in dystrophin premRNA.

[0172] In some embodiments, the annealing area is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30- 06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A( -9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D( +24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-0) 9) Selected from the group consisting of H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0173] In some embodiments, the annealing area is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14 ), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H 53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 The group is selected from the following: 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0174] In some embodiments, the annealing region is located within H53A(-23+15). In some embodiments, the annealing region is selected from the group consisting of H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(11+14), and H53A(-10+15).

[0175] In some embodiments, the annealing region is located within H53A(-16+16). In some embodiments, the annealing region is selected from the group consisting of H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), and H53A(-9+16).

[0176] In some embodiments, the annealing region is located within H53A(-8+20). In some embodiments, the annealing region is selected from the group consisting of H53A(-8+17), H53A(-7+18), H53A(-6+19), and H53A(-5+20).

[0177] In some embodiments, the annealing region is located within H53D(+23-09). In some embodiments, the annealing region is selected from the group consisting of H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), and H53D(+16-09).

[0178] In some embodiments, the annealing region is located within H53D(+22-15). In some embodiments, the annealing region is selected from the group consisting of H53D(+22-03), H53D(+20-05), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0179] In some embodiments, the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0180] In some embodiments, the annealing site is located within intron 52 and within H53A(-100-01). In some embodiments, the annealing site is selected from the group consisting of H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), and H53A(-25-01).

[0181] In some embodiments, the annealing site is located within intron 52 and within H53A(-45-01). In some embodiments, the annealing site is selected from H53A(-45-21), H53A(-40-16), H53A(-35-11), and H53A(-25-01). In some embodiments, the annealing site is H53A(-35-11).

[0182] In some embodiments, the annealing region extends to the exon 53 acceptor splice region and is located within H53A(-24+24). In some embodiments, the annealing region is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H The following are selected: 53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), and H53A(-1+24). In some embodiments, the annealing area is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+ 10) Selected from H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), and H53A(-1+24).

[0183] In some embodiments, the annealing area extends to the Exon 53 donor splice site and is located within H53D(+24-24). In some embodiments, the annealing area is H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H The following are selected: 53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), and H53D(+1-24). In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+7-18), H53D(+2-23), and H53D(+1-24).

[0184] In some embodiments, the annealing site extends to the Exon 53 donor splice site and is located within H53D(+22-15). In some embodiments, the annealing site is selected from H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0185] In some embodiments, the annealing site is located within intron 53 and is designated as H53D(-1-25).

[0186] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0187] In various embodiments, the targeting sequence is selected from the following: [Table 5-1] [Table 5-2] Here, A is [ka] And C is [ka] And G is [ka] And X is [ka] In a particular embodiment, each X is independently [ka] That is the case.

[0188] In various embodiments, the targeting sequence is selected from the following: [Table 6-1] [Table 6-2] Here, A is [ka] And C is [ka] And G is [ka] And T is [ka] That is the case.

[0189] In various embodiments, the antisense oligomers of this disclosure conform to formula (IV), [ka] or a pharmaceutically acceptable salt thereof, in the formula, Each Nu is a nucleic acid base that, together, forms a target sequence. T is [ka] It is the part selected from, R 1 However, it is a C1-C6 alkyl group, R 2 However, it is selected from H or acetyl, The target sequence is complementary to the exon 53 annealing site in dystrophin premRNA.

[0190] In some embodiments, the targeting sequences are H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), H53A(-25 -01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53 A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H 53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53 D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11) The targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA selected from the group consisting of H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 1 to 65. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 70 to 134.

[0191] In some embodiments, the targeting sequences are H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05) ), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H 53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A (-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53 It is complementary to the exon 53 annealing site in dystrophin premRNA selected from the group consisting of D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0192] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 12-14, 16-31, 33-35, 39-46, 48, 49, 52, 53, 58, and 64.

[0193] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 81-83, 85-100, 102-104, 108-115, 117, 118, 121, 122, 127, and 133.

[0194] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-23+15).

[0195] In some embodiments, the annealing region is selected from the group consisting of H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(11+14), and H53A(-10+15).

[0196] In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 18 to 31. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 87 to 100.

[0197] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-16+16). In some embodiments, the annealing site is selected from the group consisting of H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), and H53A(-9+16). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 49-56. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 115-125.

[0198] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-8+20). In some embodiments, the annealing site is selected from the group consisting of H53A(-8+17), H53A(-7+18), H53A(-6+19), and H53A(-5+20). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 33 to 36. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 102 to 105.

[0199] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+23-09). In some embodiments, the annealing site is selected from the group consisting of H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), and H53D(+16-09). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 41-49. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 110-118.

[0200] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+22-15). In some embodiments, the annealing site is selected from the group consisting of H53D(+22-03), H53D(+20-05), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 43, 45, and 50-55. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 112, 114, and 119-124.

[0201] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, either within intron 52, extending to the exon 53 acceptor splice site, extending to the exon 53 donor splice site, or within intron 53.

[0202] In some embodiments, the targeting sequence is located within intron 52 and is complementary to the exon 53 annealing site in dystrophin premRNA, specifically within H53A(-100-01). In some embodiments, the annealing site is selected from the group consisting of H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), and H53A(-25-01). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 1 to 16. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 70 to 85.

[0203] In some embodiments, the targeting sequence is complementary to the exon 53 annealing site in dystrophin premRNA, located within intron 52 and within H53A(-45-01). In some embodiments, the annealing site is selected from H53A(-45-21), H53A(-40-16), H53A(-35-11), and H53A(-25-01). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 12-14 and 16. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 81-83 and 85. In some embodiments, the annealing site is H53A(-35-11). In some embodiments, the targeting sequence is SEQ ID NO. 14. In some embodiments, the targeting sequence is SEQ ID NO. 83.

[0204] In some embodiments, the targeting sequence extends to the exon 53 acceptor splice site and is complementary to the exon 53 annealing site in the dystrophin premRNA within H53A(-24+24). In some embodiments, the annealing site is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H The sequence is selected from 53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), and H53A(-1+24). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 17 to 40. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 86 to 109. In some embodiments, the annealing area is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+ 10) The sequence is selected from H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), and H53A(-1+24). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 17-31, 33-36, 39, and 40. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 86-100, 102-105, 108, and 109.

[0205] In some embodiments, the targeting sequence extends to the exon 53 donor splice site and is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+24-24). In some embodiments, the annealing site is H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H The sequence is selected from 53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), and H53D(+1-24). In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 41 to 64. In some embodiments, the targeting sequence is selected from the group consisting of sequence numbers 110 to 133. In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+7-18), H53D(+2-23), and H53D(+1-24). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 41-46, 48, 49, 51-55, 58, 63, and 64. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs: 110-115, 117, 118, 120-124, 127, 132, and 133.

[0206] In some embodiments, the targeting sequence extends to the exon 53 donor splice site and is complementary to the exon 53 annealing site in the dystrophin premRNA within H53D(+22-15). In some embodiments, the annealing site is selected from H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 43 to 55. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NOs. 112 to 124.

[0207] In some embodiments, the targeting sequence is located within intron 53 and is complementary to the exon 53 annealing site in the dystrophin premRNA designated as H53D(-1-25). In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NO: 66. In some embodiments, the targeting sequence is selected from the group consisting of SEQ ID NO: 135.

[0208] In various embodiments, T is [ka] That is the case.

[0209] In various embodiments, R 1 These are CF3, CCl3, CFCl2, CF2Cl, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl, or 2,3-dimethylbutyl.

[0210] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0211] In various embodiments, T is [ka] The target sequence is selected from the following: [Table 7-1] [Table 7-2] Each X is independently thymine (T) or uracil (U). In some embodiments, each X is independently T.

[0212] In various embodiments, T is [ka] The target sequence is selected from the following: [Table 8-1] [Table 8-2]

[0213] For example, in some embodiments, including some embodiments of formula (IV), the antisense oligomer of the present disclosure conforms to formula (V) or [ka] or a pharmaceutically acceptable salt thereof, in the formula, R is selected from H or acetyl, Each Nu is a nucleic acid base that, together, forms a target sequence complementary to the exon 53 annealing site in dystrophin premRNA.

[0214] In some embodiments, the annealing area is H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30- 06), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A( -9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), H53A(-1+24), H53D( +24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-0) 9) Selected from the group consisting of H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), H53D(+1-24), and H53D(-01-25).

[0215] In some embodiments, the annealing area is H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-25-01), H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14 ), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H 53A(-2+23), H53A(-1+24), H53D(+24-01), H53D(+23-02), H53D(+22-03), H5 The group is selected from the following: 3D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+13-12), H53D(+12-13), H53D(+7-18), and H53D(+1-24).

[0216] In some embodiments, the annealing region is located within H53A(-23+15). In some embodiments, the annealing region is selected from the group consisting of H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(11+14), and H53A(-10+15).

[0217] In some embodiments, the annealing region is located within H53A(-16+16). In some embodiments, the annealing region is selected from the group consisting of H53A(-16+09), H53A(-15+10), H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), and H53A(-9+16).

[0218] In some embodiments, the annealing region is located within H53A(-8+20). In some embodiments, the annealing region is selected from the group consisting of H53A(-8+17), H53A(-7+18), H53A(-6+19), and H53A(-5+20).

[0219] In some embodiments, the annealing region is located within H53D(+23-09). In some embodiments, the annealing region is selected from the group consisting of H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), and H53D(+16-09).

[0220] In some embodiments, the annealing region is located within H53D(+22-15). In some embodiments, the annealing region is selected from the group consisting of H53D(+22-03), H53D(+20-05), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0221] In some embodiments, the annealing site is located within intron 52, extends to the exon 53 acceptor splice site, extends to the exon 53 donor splice site, or is located within intron 53.

[0222] In some embodiments, the annealing site is located within intron 52 and within H53A(-100-01). In some embodiments, the annealing site is selected from the group consisting of H53A(-100-76), H53A(-95-71), H53A(-90-66), H53A(-85-61), H53A(-80-56), H53A(-75-51), H53A(-70-46), H53A(-65-41), H53A(-60-36), H53A(-55-31), H53A(-50-26), H53A(-45-21), H53A(-40-16), H53A(-35-11), H53A(-30-06), and H53A(-25-01).

[0223] In some embodiments, the annealing site is located within intron 52 and within H53A(-45-01). In some embodiments, the annealing site is selected from H53A(-45-21), H53A(-40-16), H53A(-35-11), and H53A(-25-01). In some embodiments, the annealing site is H53A(-35-11).

[0224] In some embodiments, the annealing region extends to the exon 53 acceptor splice region and is located within H53A(-24+24). In some embodiments, the annealing region is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+10), H53A(-14+11), H The following are selected: 53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-9+16), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-4+21), H53A(-3+22), H53A(-2+23), and H53A(-1+24). In some embodiments, the annealing area is H53A(-24+01), H53A(-23+02), H53A(-22+03), H53A(-21+04), H53A(-20+05), H53A(-19+06), H53A(-18+07), H53A(-17+08), H53A(-16+09), H53A(-15+ 10) Selected from H53A(-14+11), H53A(-13+12), H53A(-12+13), H53A(-11+14), H53A(-10+15), H53A(-8+17), H53A(-7+18), H53A(-6+19), H53A(-5+20), H53A(-2+23), and H53A(-1+24).

[0225] In some embodiments, the annealing area extends to the Exon 53 donor splice site and is located within H53D(+24-24). In some embodiments, the annealing area is H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H The following are selected: 53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+9-16), H53D(+8-17), H53D(+7-18), H53D(+6-19), H53D(+5-20), H53D(+4-21), H53D(+3-22), H53D(+2-23), and H53D(+1-24). In some embodiments, the annealing site is selected from H53D(+24-01), H53D(+23-02), H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+17-08), H53D(+16-09), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), H53D(+10-15), H53D(+7-18), H53D(+2-23), and H53D(+1-24).

[0226] In some embodiments, the annealing site extends to the Exon 53 donor splice site and is located within H53D(+22-15). In some embodiments, the annealing site is selected from H53D(+22-03), H53D(+21-04), H53D(+20-05), H53D(+19-06), H53D(+18-07), H53D(+17-08), H53D(+16-09), H53D(+15-10), H53D(+14-11), H53D(+13-12), H53D(+12-13), H53D(+11-14), and H53D(+10-15).

[0227] In some embodiments, the annealing site is located within intron 53 and is designated as H53D(-1-25).

[0228] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0229] In various embodiments, the targeting sequence is selected from the following: [Table 9-1] [Table 9-2] Here, A is [ka] And C is [ka] And G is [ka] And X is [ka] In a particular embodiment, each X is independently [ka] That is the case.

[0230] In various embodiments, the targeting sequence is selected from the following: [Table 10-1] [Table 10-2] Here, A is [ka] And C is [ka] And G is [ka] And T is [ka] That is the case.

[0231] 10. Nucleic acid base modification and substitution In certain embodiments, the antisense oligomers or antisense oligomer conjugates of the present disclosure consist of RNA nucleic acid bases and DNA nucleic acid bases (often simply referred to as “bases” in the art). RNA bases are commonly known as adenine (A), uracil (U), cytosine (C), and guanine (G). DNA bases are commonly known as adenine (A), thymine (T), cytosine (C), and guanine (G). In various embodiments, the antisense oligomers or antisense oligomer conjugates of the present disclosure consist of cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0232] In certain embodiments, one or more RNA or DNA bases in an oligomer may be modified or substituted with bases other than RNA or DNA bases. Oligomers containing modified or substituted bases include oligomers in which one or more of the most commonly found purine or pyrimidine bases in nucleic acids are substituted with less common or unnatural bases.

[0233] Purine bases contain a pyrimidine ring fused to an imidazole ring, as described by the following general formula. [ka] Adenine and guanine are the two most commonly found purine nucleic acid bases. Other naturally occurring purines include N 6 -methyladenine, N 2 -Methylguanine, hypoxanthine, and 7-methylguanine are examples, but are not limited to these.

[0234] Pyrimidine bases contain a six-membered pyrimidine ring, as described by the following general formula. [ka] Cytosine, uracil, and thymine are the most commonly found pyrimidine bases in nucleic acids. Other naturally occurring pyrimidines include, but are not limited to, 5-methylcytosine, 5-hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the oligomers described herein contain a thymine base instead of uracil.

[0235] Other suitable bases include 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g., 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or its derivatives;N 2 -Cyclopentylguanine (cPent-G), N 2 -Cyclopentyl-2-aminopurine (cPent-AP), and N 2Examples include, but are not limited to, cPent-G, cPent-AP, and Pr-AP; as well as degenerate or universal bases such as 2,6-difluorotoluene, or non-existent bases such as debase sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G, and Super T can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences), which is fully incorporated herein by reference. cPent-G, cPent-AP, and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al. J.Am.Chem.Soc. 2011, 133, 9200). Pseudouracil is a naturally occurring isomerized version of uracil, mediated by a C-glycoside rather than the usual N-glycoside in uridine. Pseudouridine-containing synthetic mRNA may have an improved safety profile compared to uridine-containing mPvNA (WO2009127230, which is incorporated herein by reference in its entirety).

[0236] Certain nucleic acid bases are particularly useful for increasing the binding affinity of the antisense oligomers or antisense oligomer conjugates of this disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine). 5-methylcytosine substitution has been shown to increase the stability of nucleic acid double helix by 0.6–1.2°C and is currently a preferred base substitution, more specifically when combined with 2'-O-methoxyethyl sugar modification. Additional exemplary modified nucleic acid bases include those in which at least one hydrogen atom of the nucleic acid base is replaced by fluorine.

[0237] 11. Pharmacologically acceptable salts of antisense oligomeric conjugates Certain embodiments of the antisense oligomers and antisense oligomer conjugates described herein may contain basic functional groups such as amino or alkylamino, and thus can form pharmaceutically acceptable salts with pharmaceutically acceptable acids. In this regard, the term “pharmaceutically acceptable salt” refers to relatively non-toxic inorganic and organic acid addition salts of the antisense oligomers or antisense oligomer conjugates of the present disclosure. These salts can be prepared in situ in a dosage vehicle or dosage form manufacturing process, or by reacting the purified antisense oligomers or antisense oligomer conjugates of the present disclosure separately with a suitable organic or inorganic acid in their free base form, and then isolating the salts thus formed during subsequent purification. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and lauryl sulfonate. (For example, Berge et al.) See al. (1977) “Pharmaceutical Salts”, J. Pharm. Sci. 66:1-19).

[0238] pharmaceutically acceptable salts of the subject antisense oligomer or antisense oligomer conjugate include conventional nontoxic salts or quaternary ammonium salts of the antisense oligomer or antisense oligomer conjugate, for example, from nontoxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid; as well as salts prepared from organic acids, such as acetic acid, propionic acid, succinic acid, glycol, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid (salicyclic), sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, and isothionic acid.

[0239] In certain embodiments, the antisense oligomers or antisense oligomer conjugates of the present disclosure may contain one or more acidic functional groups, and thus can form pharmaceutically acceptable salts with pharmaceutically acceptable bases. In these cases, the term “pharmaceutically acceptable salt” refers to relatively non-toxic inorganic and organic base addition salts of the antisense oligomers or antisense oligomer conjugates of the present disclosure. These salts may similarly be prepared in situ in a dosage vehicle or dosage form manufacturing process, or they may be prepared by separately reacting the purified antisense oligomers or antisense oligomer conjugates in their free acid form with a suitable base, such as a pharmaceutically acceptable metal cation hydroxide, carbonate, or bicarbonate, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine. Typical alkali or alkaline earth salts include lithium, sodium, potassium, calcium, magnesium, and aluminum salts. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, and piperazine. (See, for example, Berge et al. above).

[0240] III. Formulation and mode of administration In certain embodiments, the Disclosure provides formulations or pharmaceutical compositions suitable for therapeutic delivery of antisense oligomers or antisense oligomer conjugates described herein. Accordingly, in certain embodiments, the Disclosure provides pharmaceutically acceptable compositions comprising one or more of the antisense oligomers or antisense oligomer conjugates described herein in a therapeutically effective amount, formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents. While it is possible to administer the antisense oligomers or antisense oligomer conjugates of the Disclosure alone, it is preferable to administer the antisense oligomers or antisense oligomer conjugates as a pharmaceutical formulation (composition). In one embodiment, the antisense oligomer or antisense oligomer conjugate of the formulation conforms to formula (III).

[0241] Methods for delivering nucleic acid molecules applicable to the antisense oligomers or antisense oligomer conjugates of this disclosure are described, for example, in Akhtar et al., 1992, Trends Cell Bio., 2:139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, CRC Press, and Sullivan et al., PCT WO94 / 02595. These and other protocols may be used for the delivery of substantially any nucleic acid molecule, including the antisense oligomers and antisense oligomer conjugates of this disclosure.

[0242] The pharmaceutical compositions of this disclosure may be specifically formulated for administration in solid or liquid form, and include: (1) oral administration, e.g., immersion solutions (aqueous or nonaqueous solutions or suspensions), tablets (oral, sublingual, or systemically absorbed), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, e.g., as sterile solutions or suspensions or sustained-release formulations, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; (3) topical application, e.g., as creams, ointments, or controlled-release patches or sprays applied to the skin; (4) intravaginal or rectal administration, e.g., as pessaries, creams, or foams; (5) sublingual; (6) intraocular; (7) transdermal; or (8) transnasal.

[0243] Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, e.g., lactose, glucose, and sucrose; (2) starches, e.g., corn starch and potato starch; (3) cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, e.g., cocoa butter and suppository waxes; (9) oils, e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, e.g., pro (11) Pyrene glycol, polyols, e.g., glycerin, sorbitol, mannitol, and polyethylene glycol, (12) esters, e.g., ethyl oleate and ethyl laurate, (13) agar, (14) buffers, e.g., magnesium hydroxide and aluminum hydroxide, (15) arginine, (16) pyrogenic substances removed distilled water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffer, (21) polyesters, polycarbonates, and / or polyanhydrides, and (22) other non-toxic, suitable substances used in pharmaceutical formulations.

[0244] Additional, non-limiting examples of drugs suitable for formulations using antisense oligomers or antisense oligomer conjugates of this disclosure include: PEG-conjugated nucleic acids; phospholipid-conjugated nucleic acids; nucleic acids containing lipophilic moieties; phosphorothioates; P-glycoprotein inhibitors (such as Pluronic P85) that can enhance drug entry into various tissues; biodegradable polymers, e.g., poly(D,L-lactide-coglycolide) microspheres for sustained-release delivery after implantation (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58) Alkermes, Inc. Cambridge, Mass.; and loaded nanoparticles, e.g., those made of polybutylcyanoacrylate (which can deliver drugs across the blood-brain barrier and alter neuronal uptake mechanisms) (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).

[0245] This disclosure also features the use of compositions comprising surface-modified liposomes containing poly(ethylene glycol) ("PEG") lipids (PEG-modified, branched, and unbranched, or combinations thereof, or long-circulating liposomes or stealth liposomes). The antisense oligomers and antisense oligomer conjugates of this disclosure may also comprise covalently bound PEG molecules of various molecular weights. These formulations provide methods for increasing drug accumulation in target tissues. This class of drug carriers resist opsonization and elimination by mononuclear cell phagocytic systems (MPS or RES), thereby enabling prolonged blood circulation time and enhanced tissue exposure of the encapsulated drug (Lasic et al.). (al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to selectively accumulate in tumors, possibly by capture in hematopoietic and angiogenic target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). Long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA compared to conventional cationic liposomes, which are known to accumulate particularly in MPS tissues (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International PCT Publication WO96 / 10391; Ansell et al., International PCT Publication WO96 / 10390; Holland et al., International PCT Publication WO96 / 10392). Furthermore, long-circulating liposomes are more likely to protect drugs from nuclease degradation to a greater extent than cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.

[0246] In further embodiments, the Disclosure includes antisense oligomer pharmaceutical compositions and antisense oligomer conjugate pharmaceutical compositions prepared for delivery, such as those described in U.S. Patents 6,692,911, 7,163,695, and 7,070,807. In this regard, in one embodiment, the Disclosure provides an antisense oligomer or antisense oligomer conjugate of the Disclosure in a composition comprising any of the above-described lysine and histidine (HK) copolymers, either alone or in combination with PEG (e.g., branched or unbranched PEG, or a mixture of both), in combination with PEG and a targeted moiety, or in combination with a crosslinking agent (as described in U.S. Patents 7,163,695, 7,070,807, and 6,692,911). In certain embodiments, the disclosure provides antisense oligomers or antisense oligomer conjugates in pharmaceutical compositions comprising gluconate-modified polyhistidine or gluconyl polyhistidine / transferrin-polylysine. Those skilled in the art will also recognize that amino acids having properties similar to His and Lys may be substituted in the composition.

[0247] Wetting agents, emulsifiers, and lubricants (such as sodium lauryl sulfate and magnesium stearate), colorants, release agents, coating agents, sweeteners, flavoring agents, fragrances, preservatives, and antioxidants may also be present in the composition.

[0248] Examples of pharmaceutically acceptable antioxidants include (1) water-soluble antioxidants, such as ascorbic acid, cysteine ​​hydrochloride, sodium bicarbonate, sodium metabisulfite, and sodium sulfite; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and alpha-tocopherol; and (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid.

[0249] The formulations of this disclosure include formulations suitable for oral, nasal, topical (including oral and sublingual), rectal, vaginal, and / or parenteral administration. The formulations may be conveniently presented in unit dosage forms and may be prepared by any method well known in the art of pharmaceuticals. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form varies depending on the subject being treated and the specific mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form is generally the amount of the active ingredient that produces the therapeutic effect. Generally, this amount is in the range of about 0.1 percent to about 99 percent of the active ingredient, preferably about 5 percent to about 70 percent, and most preferably about 10 percent to about 30 percent.

[0250] In certain embodiments, the formulations of the present disclosure comprise an excipient selected from cyclodextrin, cellulose, liposomes, micelle-forming agents, such as bile acids, and polymer carriers, such as polyesters and polyanhydrides, and an antisense oligomer or antisense oligomer conjugate of the present disclosure. In one embodiment, the antisense oligomer or antisense oligomer conjugate of the formulation conforms to formula (V) or formula (III), respectively. In certain embodiments, the formulations make the antisense oligomer or antisense oligomer conjugate of the present disclosure orally bioavailable.

[0251] Methods for preparing these formulations or pharmaceutical compositions include the step of associating the antisense oligomer or antisense oligomer conjugate of the present disclosure with a carrier and optionally one or more minor components. Generally, formulations are prepared by homogeneously and closely associating the antisense oligomer or antisense oligomer conjugate of the present disclosure with a liquid carrier, a micronized solid carrier, or both, and then, if necessary, shaping the product.

[0252] Formulations of the present disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (flavored base, usually sucrose and acacia or tragacanth), powders, granules, or solutions or suspensions in aqueous or non-aqueous solutions, or liquid emulsions of oil in water or water in oil, or as elixirs or syrups, or as flavored tablets (inert base, e.g., gelatin and glycerin, or sucrose and acacia) and / or mouthwashes, each containing a predetermined amount of the antisense oligomer or antisense oligomer conjugate of the present disclosure as an active ingredient. The antisense oligomer or antisense oligomer conjugate of the present disclosure may also be administered as boluses, licks, or pastes.

[0253] In solid dosage forms of the present disclosure for oral administration (capsules, tablets, pills, sugars, powders, granules, trucci, etc.), the active ingredient may be mixed with sodium citrate or dicalcium phosphate and / or one or more pharmaceutically acceptable carriers, such as: (1) fillers or bulking agents, e.g., starch, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) humectants, e.g., glycerol; (4) disintegrants, e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates. (1) , and sodium carbonate, (5) dissolution retarders, e.g., paraffin, (6) absorption enhancers, e.g., quaternary ammonium compounds and surfactants, e.g., poloxamer and sodium lauryl sulfate, (7) wetting agents, e.g., cetyl alcohol, glycerol monostearate, nonionic surfactants, (8) absorbents, e.g., kaolin and bentonite clay, (9) lubricants, e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof, (10) colorants, and (11) release control agents, e.g., crospovidone or ethylcellulose. In the case of capsules, tablets, and pills, the pharmaceutical composition may also contain buffers. Similar types of solid pharmaceutical compositions may also be used as fillers in soft and hard-shelled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0254] Tablets may be prepared by compression or molding with one or more adjuncts as optional. Compressed tablets may be prepared using binders (e.g., gelatin or hydroxypropyl methylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked carboxymethylcellulose sodium), surfactants, or dispersants. Molded tablets may be prepared by molding a mixture of powder compounds moistened with an inert liquid diluent using a suitable machine.

[0255] Tablets and other solid dosage forms of the pharmaceutical compositions of this disclosure, such as sugars, capsules, pills, and granules, may optionally be obtained or prepared using coatings and shells, such as enteric coatings and other coatings known in pharmaceutical formulation technology. They may also be formulated to provide sustained or controlled release of the active ingredient therein, for example, by using hydroxypropyl methylcellulose in various proportions to provide a desired release profile, other polymer matrices, liposomes, and / or microspheres. They may also be formulated for rapid release, such as by lyophilization. They may be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating a sterilizer in the form of a sterile solid pharmaceutical composition that can be dissolved in sterile water immediately before use, or some other sterile injection medium. These pharmaceutical compositions may also optionally contain opacifying agents, and they may have compositions that release only the active ingredient(s) or preferentially, in a delayed manner, to a specific part of the gastrointestinal tract. Examples of embedding compositions that may be used include polymer substances and waxes. The active ingredient may also be in the form of microcapsules, which, where appropriate, contain one or more of the excipients described above.

[0256] Liquid dosage forms for oral administration of antisense oligomers or antisense oligomer conjugates of the present disclosure include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage forms may contain, for example, water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and mixtures thereof, which are commonly used in the art.

[0257] In addition to inert diluents, oral pharmaceutical compositions may also include adjuvants such as humectants, emulsifiers and suspending agents, sweeteners, flavoring agents, colorants, fragrances, and preservatives.

[0258] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth, and mixtures thereof.

[0259] Formulations for rectal or vaginal administration may be presented as suppositories, which may be prepared by mixing one or more compounds of the present disclosure with one or more suitable non-irritating excipients or carriers, for example, cocoa butter, polyethylene glycol, suppository wax, or salicylates, which are solid at room temperature but liquid at body temperature, and thus dissolve in the rectum or vaginal cavity, releasing the active compound.

[0260] The formulations or dosage forms for topical or transdermal administration of oligomers provided herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. Active antisense oligomers and antisense oligomer conjugates may be mixed under sterile conditions with pharmaceutically acceptable carriers and any preservatives, buffers, or propellants as required. Ointments, pastes, creams, and gels may contain excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof, in addition to the active compounds of this disclosure.

[0261] The powders and sprays may contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powders, or mixtures thereof, in addition to the antisense oligomer or antisense oligomer conjugate of the present disclosure. The sprays may further contain conventional propellants such as chlorofluorohydrocarbons, as well as volatile unsubstituted hydrocarbons such as butane and propane.

[0262] Transdermal patches have the further advantage of providing controlled delivery of the antisense oligomer or antisense oligomer conjugate of the present disclosure into the body. Such dosage forms may be made by dissolving or dispersing the oligomer in a suitable medium. Absorption enhancers may also be used to increase the flow of the drug across the skin. The rate of such flow may be controlled by providing a rate-controlled membrane or by dispersing the drug in a polymer matrix or gel, among other methods known in the art.

[0263] Pharmaceutical compositions suitable for parenteral administration may include one or more antisense oligomers or antisense oligomer conjugates of the Disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous aqueous solutions, dispersions, suspensions or emulsions, or sterile powders that can be reconstituted into sterile injectable solutions or dispersions immediately before use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostatic agents, solutes that make the formulation isotonic with the blood of the intended recipient, or suspending agents or thickeners. Examples of suitable aqueous and non-aqueous carriers that may be used in the pharmaceutical compositions of the Disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Adequate fluidity may be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In one embodiment, the antisense oligomer or antisense oligomer conjugate of the pharmaceutical composition conforms to formula (V) or formula (III), respectively.

[0264] Furthermore, these pharmaceutical compositions may contain adjuvants such as preservatives, humectants, emulsifiers, and dispersants. Prevention of microbial action against the subject antisense oligomer or antisense oligomer conjugate can be ensured by including various antimicrobial and antifungal agents, such as parabens, chlorobutanol, and phenolsorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride in the composition. In addition, sustained absorption of injectable dosage forms can be achieved by including absorption-delaying agents such as aluminum monostearate and gelatin.

[0265] In some cases, it is desirable to delay the absorption of a drug from subcutaneous or intramuscular injection in order to prolong its effects. This can be achieved, in particular, by the use of a liquid suspension of a crystalline or amorphous material with poor water solubility, among the methods known in the art. The absorption rate of the drug then depends on its dissolution rate, which may depend on the crystal size and crystalline form. Alternatively, delaying the absorption of a parenterally administered drug form can be achieved by dissolving or suspending the drug in an oil vehicle.

[0266] Depot formulations for injection can be prepared by forming a microcapsule matrix of the subject's antisense oligomer or antisense oligomer conjugate in a biodegradable polymer such as polylactide-polyglycolide. The rate of oligomer release can be controlled depending on the ratio of oligomer to polymer and the properties of the specific polymer used. Examples of other biodegradable polymers include poly(orthoester) and poly(anhydride). Depot formulations for injection can also be prepared by encapsulating the drug in liposomes or microemulsions compatible with body tissues.

[0267] When the antisense oligomers or antisense oligomer conjugates of this disclosure are administered to humans and animals as pharmaceuticals, they may be administered on their own or as part of a pharmaceutical composition containing 0.1 to 99% (more preferably 10 to 30%) of the antisense oligomer or antisense oligomer conjugate in combination with, for example, a pharmaceutically acceptable carrier.

[0268] The formulations or preparations of this disclosure may be administered orally, parenterally, topically, or rectally. They are typically administered in a form suitable for each route of administration. For example, they may be administered as tablets or capsules, by injection, inhalation, eye drops, ointment, suppository, or intravenous drip, topically as a lotion or ointment, or rectally as a suppository.

[0269] Regardless of the route of administration selected, the antisense oligomers and antisense oligomer conjugates of the present disclosure, and / or the pharmaceutical compositions of the present disclosure, which can be used in an appropriate hydrated form, can be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dose levels of the active ingredients in the pharmaceutical compositions of the present disclosure may be varied to obtain an amount of the active ingredient that is effective in achieving a desired therapeutic response for a particular patient, composition, and mode of administration without exhibiting unacceptable toxicity to the patient.

[0270] The selected dosage level depends on a variety of factors, including the activity of the specific antisense oligomer or antisense oligomer conjugate used in this disclosure, or its ester, salt, or amide; the route of administration; the time of administration; the excretion or metabolic rate of the specific oligomer used; the rate and extent of absorption; the duration of treatment; other drugs, compounds, and / or materials used in combination with the specific oligomer used; the age, sex, weight, condition, overall health status, and medical history of the patient being treated, as well as similar factors well known in the medical technology.

[0271] A physician or veterinarian with ordinary art in the art can easily determine and prescribe the effective amount of the required pharmaceutical composition. For example, a physician or veterinarian can start with a dose of the antisense oligomer or antisense oligomer conjugate used in the pharmaceutical composition at a level lower than the level required to achieve the desired therapeutic effect, and gradually increase the dose until the desired effect is achieved. Generally, a preferred daily dose of the antisense oligomer or antisense oligomer conjugate of the disclosure is the amount of antisense oligomer or antisense oligomer conjugate that is the minimum effective dose to produce a therapeutic effect. Such an effective dose generally depends on the factors described herein. Generally, oral, intravenous, intraventricular, and subcutaneous doses of the antisense oligomer or antisense oligomer conjugate of the disclosure for a patient are in the range of about 0.0001 to about 100 mg per kilogram of body weight per day when used for the indicated effect.

[0272] In some embodiments, the antisense oligomers and antisense oligomer conjugates of this disclosure are generally administered in doses of about 10–160 mg / kg or 20–160 mg / kg. In some cases, doses greater than 160 mg / kg may be required. In some embodiments, intravenous doses are about 0.5 mg–160 mg / kg. In some embodiments, the antisense oligomers or antisense oligomer conjugates are administered in doses of about 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, or 10 mg / kg. In some embodiments, the antisense oligomer or antisense oligomer conjugate is approximately 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg It is administered in doses of 10 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, and 160 mg / kg (including all integers in between). In some embodiments, the oligomer is administered at 10 mg / kg. In some embodiments, the oligomer is administered at a dose of 20 mg / kg.In some embodiments, the oligomer is administered at 30 mg / kg. In some embodiments, the oligomer is administered at 40 mg / kg. In some embodiments, the oligomer is administered at 60 mg / kg. In some embodiments, the oligomer is administered at 80 mg / kg. In some embodiments, the oligomer is administered at 160 mg / kg. In some embodiments, the oligomer is administered at 50 mg / kg.

[0273] In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered in doses of approximately 10–160 mg / kg or 20–160 mg / kg. In some embodiments, the dose of the antisense oligomer conjugate of formula (III) for intravenous administration is approximately 0.5 mg–160 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered in doses of approximately 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, or 10 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is present in concentrations of approximately 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, It is administered in doses of 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, and 160 mg / kg (including all integers in between).In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 10 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 20 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 30 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 40 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 60 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 80 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 160 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) or the antisense oligomer of formula (V) is administered at 50 mg / kg.

[0274] If necessary, the effective daily dose of the active compound may be administered as 2, 3, 4, 5, 6 or more partial doses, optionally administered separately in unit dosage forms at appropriate intervals throughout the day. In certain circumstances, the dose is once daily. In certain embodiments, the dose is once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, if necessary, to maintain the desired expression of the functional dystrophin protein. In certain embodiments, the dose is once every two weeks or more. In some embodiments, the dose is once every two weeks. In various embodiments, the dose is once a month or more. In certain embodiments, the dose is once a month.

[0275] In various embodiments, the antisense oligomer conjugate is administered weekly at 10 mg / kg. In various embodiments, the antisense oligomer conjugate is administered weekly at 20 mg / kg. In various embodiments, the antisense oligomer conjugate is administered weekly at 30 mg / kg. In various embodiments, the antisense oligomer conjugate is administered weekly at 40 mg / kg. In some embodiments, the antisense oligomer conjugate is administered weekly at 60 mg / kg. In some embodiments, the antisense oligomer conjugate is administered weekly at 80 mg / kg. In some embodiments, the antisense oligomer conjugate is administered weekly at 100 mg / kg. In some embodiments, the antisense oligomer conjugate is administered weekly at 160 mg / kg. As used herein, "weekly" is understood to have the generally accepted meaning in the art of weekly doses.

[0276] In various embodiments, the antisense oligomer is administered weekly at 10 mg / kg. In various embodiments, the antisense oligomer is administered weekly at 20 mg / kg. In various embodiments, the antisense oligomer is administered weekly at 30 mg / kg. In various embodiments, the antisense oligomer is administered weekly at 40 mg / kg. In some embodiments, the antisense oligomer is administered weekly at 60 mg / kg. In some embodiments, the antisense oligomer is administered weekly at 80 mg / kg. In some embodiments, the antisense oligomer is administered weekly at 100 mg / kg. In some embodiments, the antisense oligomer is administered weekly at 160 mg / kg. As used herein, "weekly" is understood to have the generally accepted meaning in the art of "once a week".

[0277] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every other week. As used herein, every other week is understood to have the generally accepted meaning in the art of every two weeks.

[0278] In various embodiments, the antisense oligomer is administered every other week at a dose of 10 mg / kg. In various embodiments, the antisense oligomer is administered every other week at a dose of 20 mg / kg. In various embodiments, the antisense oligomer is administered every other week at a dose of 30 mg / kg. In various embodiments, the antisense oligomer is administered every other week at a dose of 40 mg / kg. In some embodiments, the antisense oligomer is administered every other week at a dose of 60 mg / kg. In some embodiments, the antisense oligomer is administered every other week at a dose of 80 mg / kg. In some embodiments, the antisense oligomer is administered every other week at a dose of 100 mg / kg. In some embodiments, the antisense oligomer is administered every other week at a dose of 160 mg / kg. As used herein, every other week is understood to have the generally accepted meaning in the art of every two weeks.

[0279] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every three weeks. As used herein, "every three weeks" is understood to have the generally accepted meaning in the art of once every three weeks.

[0280] In various embodiments, the antisense oligomer is administered at 10 mg / kg every three weeks. In various embodiments, the antisense oligomer is administered at 20 mg / kg every three weeks. In various embodiments, the antisense oligomer is administered at 30 mg / kg every three weeks. In various embodiments, the antisense oligomer is administered at 40 mg / kg every three weeks. In some embodiments, the antisense oligomer is administered at 60 mg / kg every three weeks. In some embodiments, the antisense oligomer is administered at 80 mg / kg every three weeks. In some embodiments, the antisense oligomer is administered at 100 mg / kg every three weeks. In some embodiments, the antisense oligomer is administered at 160 mg / kg every three weeks. As used herein, "every three weeks" is understood to have the generally accepted meaning in the art of once every three weeks.

[0281] In various embodiments, the antisense oligomer conjugate is administered monthly at a dose of 10 mg / kg. In various embodiments, the antisense oligomer conjugate is administered monthly at a dose of 20 mg / kg. In various embodiments, the antisense oligomer conjugate is administered monthly at a dose of 30 mg / kg. In various embodiments, the antisense oligomer conjugate is administered monthly at a dose of 40 mg / kg. In some embodiments, the antisense oligomer conjugate is administered monthly at a dose of 60 mg / kg. In some embodiments, the antisense oligomer conjugate is administered monthly at a dose of 80 mg / kg. In some embodiments, the antisense oligomer conjugate is administered monthly at a dose of 100 mg / kg. In some embodiments, the antisense oligomer conjugate is administered monthly at a dose of 160 mg / kg. As used herein, "monthly" is understood to have the generally accepted meaning in the art of monthly doses.

[0282] In various embodiments, the antisense oligomer is administered monthly at a dose of 10 mg / kg. In various embodiments, the antisense oligomer is administered monthly at a dose of 20 mg / kg. In various embodiments, the antisense oligomer is administered monthly at a dose of 30 mg / kg. In various embodiments, the antisense oligomer is administered monthly at a dose of 40 mg / kg. In some embodiments, the antisense oligomer is administered monthly at a dose of 60 mg / kg. In some embodiments, the antisense oligomer is administered monthly at a dose of 80 mg / kg. In some embodiments, the antisense oligomer is administered monthly at a dose of 100 mg / kg. In some embodiments, the antisense oligomer is administered monthly at a dose of 160 mg / kg. As used herein, "monthly" is understood to have the generally accepted meaning in the art of monthly doses.

[0283] As understood in the art, weekly, bi-weekly, every three weeks, or monthly administration may be one or more doses or partial doses, as considered herein.

[0284] Nucleic acid molecules, antisense oligomers, and antisense oligomer conjugates described herein can be administered to cells by various methods known to those skilled in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, as described herein and known in the art. In certain embodiments, microemulsification techniques may be used to improve the bioavailability of lipophilic (water-insoluble) pharmaceuticals. Examples include Trimetrine (Dordunoo, SK, et al., Drug Development and Industrial Pharmacy, 17(12), 1685-1713, 1991) and REV 5901 (Sheen, PC, et al., J Pharm Sci 80(7), 712-714, 1991). Among its advantages, microemulsification offers enhanced bioavailability by preferentially inducing absorption into the lymphatic system instead of the circulatory system, thereby bypassing the liver and preventing the breakdown of compounds in the hepatobiliary circulation.

[0285] In one aspect of the disclosure, the formulation comprises micelles formed from oligomers provided herein and at least one amphiphilic carrier having an average diameter of less than about 100 nm for the micelles. A more preferred embodiment provides micelles having an average diameter of less than about 50 nm, and an even more preferred embodiment provides micelles having an average diameter of less than about 30 nm or even less than 20 nm.

[0286] While all suitable amphiphilic carriers are considered, currently preferred carriers are generally those that are generally recognized as generally safe (GRAS) and capable of both solubilizing the antisense oligomer or antisense oligomer conjugate of this disclosure, and microemulsifying the solution in a later stage when it comes into contact with a complex aqueous phase (such as that found in the human gastrointestinal tract). Amphiphilic components that meet these requirements typically have an HLB (hydrophilic-lipophilic balance) value of 2–20, and their structures contain linear aliphatic radicals in the C–6 to C–20 range. Examples include polyethylene glycolated fatty acid glycerides and polyethylene glycol.

[0287] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycolated fatty acid glycers, for example, those obtained from various fully or partially hydrogenated vegetable oils. Such oils may advantageously consist of tri-, di-, and mono-fatty acid glycers, as well as di- and mono-poly(ethylene glycol) esters of the corresponding fatty acids. Particularly preferred fatty acid compositions include 4-10% capric acid, 3-9% capric acid, 40-50% lauric acid, 14-24% myristic acid, 4-14% palmitic acid, and 5-15% stearic acid. Another useful class of amphiphilic carriers includes partially esterified sorbitan and / or sorbitol having saturated or monounsaturated fatty acids (SPAN® series) or corresponding ethoxylated analogs (TWEEN® series).

[0288] Commercially available amphiphilic carriers, including the Gelucire series, Labrafil, Labrasol, or Lauroglycol (all manufactured and distributed by Gattefosse Corporation, Saint Priest, France), PEG-mono-oleic acid, PEG-dioleic acid, PEG-mono-lauric acid and dilauric acid, lecithin, and polysorbate 80 (manufactured and distributed by many companies in the United States and around the world), may be particularly useful.

[0289] In certain embodiments, delivery may occur by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., to introduce the pharmaceutical compositions of the Disclosure into suitable host cells. In particular, the pharmaceutical compositions of the Disclosure may be formulated for delivery encapsulated in any of the lipid particles, liposomes, vesicles, nanospheres, nanoparticles, or the like. The formulation and use of such delivery vehicles may be carried out using known and prior art.

[0290] Hydrophilic polymers suitable for use in this disclosure are those that are readily water-soluble, can covalently bond to vesicle-forming lipids, and are tolerable in vivo without toxic effects (i.e., biocompatible). Suitable polymers include poly(ethylene glycol) (PEG), polylactic acid (also called polylactide), polyglycolic acid (also called polyglycolide), polylactic acid-polyglycolic acid copolymers, and polyvinyl alcohol. In certain embodiments, the polymer has a weight-average molecular weight of about 100 or 120 daltons to a maximum of about 5,000 or 10,000 daltons, or about 300 daltons to about 5,000 daltons. In other embodiments, the polymer is poly(ethylene glycol) having a weight-average molecular weight of about 100 to about 5,000 daltons, or about 300 to about 5,000 daltons. In certain embodiments, the polymer is poly(ethylene glycol) having a weight-average molecular weight of about 750 daltons, e.g., PEG(750). A polymer can also be defined by the number of monomers it contains, and preferred embodiments of this disclosure utilize polymers of at least about three monomers, such PEG polymers consisting of three monomers having a molecular weight of about 132 daltons.

[0291] Other hydrophilic polymers suitable for use in this disclosure include polyvinylpyrrolidone, polymethoxazolines, polyethyloxazolines, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, and derivatized cellulose, such as hydroxymethylcellulose or hydroxyethylcellulose.

[0292] In certain embodiments, the formulations of the present disclosure include biocompatible polymers selected from the group consisting of polyamides, polycarbonates, polyalkylenes, acrylic and methacrylic ester polymers, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and their copolymers, cellulose, polypropylene, polyethylene, polystyrene, lactic acid and glycolic acid polymers, polyanhydrides, poly(ortho)esters, poly(butic acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0293] Cyclodextrins are cyclic oligosaccharides consisting of 6, 7, or 8 glucose units, denoted by the Greek letters α, β, or γ, respectively. The glucose units are linked by α-1,4-glucosidic bonds. As a result of the chair conformation of the sugar units, all secondary hydroxyl groups (at C-2 and C-3) are located on one side of the ring, while all primary hydroxyl groups at C-6 are located on the other side. Consequently, the outer surface is hydrophilic, making cyclodextrins water-soluble. In contrast, the cavities of cyclodextrins are hydrophobic because they are covered by hydrogen atoms at C-3 and C-5 and by ether-like oxygen. These matrices allow for complex formation with a variety of relatively hydrophobic compounds, including steroid compounds such as 17α-estradiol (see, e.g., van Uden et al. Plant Cell Tiss. Org. Cult. 38:1-3-113 (1994)). Complex formation occurs through van der Waals interactions and hydrogen bonding. For a general review of the chemical properties of cyclodextrins, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994).

[0294] The physicochemical properties of cyclodextrin derivatives depend heavily on the type and degree of substitution. For example, their water solubility ranges from insoluble (e.g., triacetyl-beta-cyclodextrin) to 147% soluble (w / v) (G-2-beta-cyclodextrin). Furthermore, they are soluble in many organic solvents. The properties of cyclodextrins allow for control of the solubility of various pharmaceutical components by increasing or decreasing their solubility.

[0295] Numerous cyclodextrins and methods for their preparation are described. For example, Parmeter(I) et al. (US Patent No. 3,453,259) and Gramera et al. (US Patent No. 3,459,731) describe electroneutral cyclodextrins. Other derivatives include cationic cyclodextrins [Parmeter(II), US Patent No. 3,453,257], insoluble crosslinked cyclodextrins (Solms, US Patent No. 3,420,788), and anionic cyclodextrins [Parmeter(III), US Patent No. 3,426,011]. Among the anionic cyclodextrin derivatives, carboxylic acids, phosphorous acids, phosphino acids, phosphonic acids, phosphoric acids, thiophosphonic acids, thiosulfinic acids, and sulfonic acids are added to the parent cyclodextrin [Parmeter(III), see above]. Furthermore, sulfoalkyl ether cyclodextrin derivatives have been described by Stella et al. (U.S. Patent No. 5,134,127).

[0296] Liposomes consist of at least one lipid bilayer membrane surrounding an aqueous internal compartment. Liposomes can be characterized by membrane type and size. Small single-lamellar vesicles (SUVs) have a single membrane and are typically in the range of 0.02–0.05 μm in diameter, while large single-lamellar vesicles (LUVSs) are typically larger than 0.05 μm. Oligolamellar large vesicles and multilamellar vesicles have multiple, usually concentric, membrane layers and are typically larger than 0.1 μm. Liposomes with several non-concentric membranes, i.e., several smaller vesicles contained within a larger vesicle, are called multivesicle vesicles.

[0297] One aspect of the present disclosure relates to a formulation comprising liposomes containing an antisense oligomer or antisense oligomer conjugate of the present disclosure, wherein the liposome membrane is formulated to provide liposomes with increased carrying capacity. Alternatively, or in addition, the antisense oligomer or antisense oligomer conjugate of the present disclosure may be contained within the liposome bilayer of the liposome or adsorbed thereon. The antisense oligomer or antisense oligomer conjugate of the present disclosure may aggregate with a lipid surfactant and be supported within the internal space of the liposome. In these cases, the liposome membrane is formulated to resist the disintegration effect of the active agent-surfactant aggregate.

[0298] According to one embodiment of the present disclosure, the lipid bilayer of the liposome contains lipids derivatized with poly(ethylene glycol) (PEG), thereby allowing the PEG chains to extend from the inner surface of the lipid bilayer into the internal space encapsulated by the liposome, and also from the outside of the lipid bilayer to the surrounding environment.

[0299] The active agents contained within the liposomes of this disclosure are in a solubilized form. Aggregates of surfactants and active agents (such as emulsions or micelles containing the active agent of interest) can be confined within the internal space of the liposomes according to this disclosure. The surfactant acts to disperse and solubilize the active agent and can be selected from any suitable aliphatic, alicyclic, or aromatic surfactant, including but not limited to biocompatible lysophosphatidylcholine (LPG) of various chain lengths (e.g., about C14 to about C20). Polymerized lipids such as PEG-lipids can also be used for micelle formation, as they act to inhibit micelle / membrane fusion, and the addition of polymers to the surfactant molecule reduces the CMC of the surfactant, thus aiding micelle formation. Surfactants having a CMO in the micromolar range are preferred, and higher CMC surfactants can be used to prepare micelles confined within the liposomes of this disclosure.

[0300] The liposomes according to this disclosure may be prepared by any of the various techniques known in the art. See, for example, U.S. Patent No. 4,235,871, Published PCT Application WO96 / 14057, New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pages 33-104, and Lasic DD, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, the liposomes according to this disclosure may be prepared by diffusing lipids derivatized with a hydrophilic polymer into pre-formed liposomes at a lipid concentration corresponding to the final molar percent of the desired derivatized lipid in the liposomes, for example, by exposing pre-formed liposomes to micelles composed of lipid graft polymers. Liposomes containing hydrophilic polymers may also be formed by homogenization, lipid field hydration, or extrusion techniques, as known in the art.

[0301] In another exemplary formulation procedure, the active agent is first dispersed by ultrasonic treatment in lysophosphatidylcholine or other low-CMC surfactants (including polymer-grafted lipids) that readily solubilize hydrophobic molecules. The resulting micelle suspension of the active agent is then used to rehydrate a dry lipid sample containing a suitable molar percentage of polymer-grafted lipids or cholesterol. The lipid and active agent suspensions are then formed into liposomes using extrusion techniques known in the art, and the resulting liposomes are separated from the unencapsulated solution by standard column separation.

[0302] In one aspect of this disclosure, liposomes are prepared to have substantially uniform size within a selected size range. One effective sizing method involves extruding an aqueous suspension of liposomes through a series of polycarbonate membranes having a selected uniform pore size, where the pore size of the membranes is approximately equivalent to the maximum size of liposomes resulting from the extrusion through the membrane. See, for example, U.S. Patent No. 4,737,323 (April 12, 1988). In certain embodiments, reagents such as DharmaFECT® and Lipofectamine® may be used to introduce polynucleotides or proteins into cells.

[0303] The release characteristics of the formulations of this disclosure depend on the encapsulation material, the concentration of the encapsulated drug, and the presence of release modifiers. For example, release can be manipulated to be pH-dependent by using pH-sensitive coatings that release only at low pH, such as in the stomach, or high pH, ​​such as in the intestines. Enteric coatings can be used to prevent release until after passing through the stomach. Multiple coatings or mixtures of cyanamide encapsulated in different materials can be used to obtain initial release in the stomach followed by later release in the intestines. Release can also be manipulated by including salts or pore-forming agents, which can increase water uptake or drug release by diffusion from the capsule. Excipients that modify the solubility of the drug can also be used to control the release rate. Agents that enhance matrix degradation or release from the matrix can also be incorporated. They can be added to the drug, added as a separate phase (i.e., as microparticles), or co-dissolved in the polymer phase depending on the compound. In most cases, the amount should be 0.1–30 percent (w / w polymer). Types of degradation accelerators include inorganic salts such as ammonium sulfate and ammonium chloride; organic acids such as citric acid, benzoic acid, and ascorbic acid; inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide; organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine; and surfactants such as Tween® and Pluronic®. Pore-forming agents (i.e., water-soluble compounds such as inorganic salts and sugars) that add microstructure to the matrix are added as microparticles. The range is typically 1 to 30 percent (w / w polymer).

[0304] Furthermore, uptake can also be manipulated by altering the residence time of particles in the intestines. This can be achieved, for example, by coating the particles with a mucosal adhesive polymer or by selecting such a polymer as an encapsulation material. Examples include most polymers having free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (as used herein, polyacrylate refers to polymers containing acrylate groups as well as modified acrylate groups such as cyanoacrylate and methacrylate).

[0305] Antisense oligomers or antisense oligomer conjugates may be formulated to be contained within surgical or medical devices or implants, or adapted to be released thereby. In certain embodiments, implants may be coated with antisense oligomers or antisense oligomer conjugates, or otherwise treated. For example, implants may be coated with the pharmaceutical compositions of this disclosure using hydrogels or other polymers such as biocompatible and / or biodegradable polymers (i.e., compositions may be adapted for use with medical devices using hydrogels or other polymers). Polymers and copolymers for drug-coating medical devices are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prostheses, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter-defibrillators, IV needles, bone-setting and bone-forming devices, such as pins, screws, plates, and other devices, and artificial tissue matrices for wound healing.

[0306] In addition to the methods provided herein, antisense oligomers and antisense oligomer conjugates for use according to this disclosure may be formulated, by analogy with other pharmaceuticals, for administration in any convenient manner for use in human or veterinary medicine. Antisense oligomers and antisense oligomer conjugates, as well as their corresponding formulations, may be administered alone or in combination with other therapeutic strategies in the treatment of muscular dystrophy, such as myoblast transplantation, stem cell therapy, administration of aminoglycoside antibiotics, proteasome inhibitors, and upregulation therapies (e.g., upregulation of eutrophin, an autosomal paralog of dystrophin).

[0307] In some embodiments, additional therapeutic agents may be administered before, simultaneously with, or after the administration of the antisense oligomer or antisense oligomer conjugate of this disclosure. For example, the antisense oligomer and antisense oligomer conjugate may be administered in combination with a steroid and / or antibiotic. In certain embodiments, the antisense oligomer or antisense oligomer conjugate is administered to a patient receiving background steroid therapy (e.g., intermittent or long-term / continuous background steroid therapy). For example, in some embodiments, the patient has been treated with a corticosteroid prior to the administration of the antisense oligomer and continues to receive steroid therapy. In some embodiments, the steroid is a glucocorticoid or prednisone.

[0308] The described routes of administration are intended for guidance only, as those skilled in the art can easily determine the optimal route of administration and any dosage for any particular animal and condition. Multiple approaches have been attempted to introduce novel functional genetic material into cells, both in vitro and in vivo (Friedmann (1989) Science, 244:1275-1280). These approaches include incorporating modified genes into retroviruses (Friedmann (1989) above, Rosenberg (1991) Cancer Research 51(18), suppl.:5074S-5079S), incorporating them into non-retroviral vectors (e.g., adeno-associated virus vectors) (Rosenfeld, et al. (1992) Cell, 68:143-155, Rosenfeld, et al. (1991) Science, 252:431-434), or delivering transgenes linked to heterologous promoter-enhancer elements via liposomes (Friedmann (1989) above, Brigham, et al. (1989) Am.J.Med.Sci., 298:278-281, Nabel, et al. (1990) Science, 249:1285-1288, Hazinski, et al. This includes ligand-specific binding, binding to cationic transport systems (Wu and Wu (1988) J. Biol. Chem., 263:14621-14624), or the use of naked DNA or expression vectors (Nabel et al. (1990), Wolff et al. (1990) Science, 247:1465-1468). Direct injection of transgenes into tissues results only in local expression (Rosenfeld (1992) above, Rosenfeld et al. (1991) above, Brigham et al. (1989) above, Nabel (1990) above, and Hazinski et al. (1991) above).Brigham et al. (Am.J.Med.Sci.(1989)298:278-281 and Clinical Research(1991)39 (abstract)) have only reported in vivo transfection of mouse lungs after either intravenous or intratracheal administration of DNA liposome complexes. One example of a review of human gene therapy procedures is Anderson, Science(1992)256:808-813.

[0309] In further embodiments, the pharmaceutical compositions of the Disclosure may be administered co-administered in the manner of the Disclosure, either in the same formulation or a different formulation, as provided in Han et al., Nat.Comms. 7, 10981 (2016) (which is incorporated herein by reference in its entirety). In some embodiments, the pharmaceutical compositions of the Disclosure may contain 5% hexose carbohydrate. For example, the pharmaceutical compositions of the Disclosure may contain 5% glucose, 5% fructose, or 5% mannose. In certain embodiments, the pharmaceutical compositions of the Disclosure may contain 2.5% glucose and 2.5% fructose. In some embodiments, the pharmaceutical compositions of the present disclosure may contain carbohydrates selected from arabinose present in 5% by volume, glucose present in 5% by volume, sorbitol present in 5% by volume, galactose present in 5% by volume, fructose present in 5% by volume, xylitol present in 5% by volume, mannose present in 5% by volume, combinations of glucose and fructose present in 2.5% by volume, and combinations of glucose present in 5.7% by volume, fructose present in 2.86% by volume, and xylitol present in 1.4% by volume.

[0310] IV. How to use Recovery of the dystrophin reading frame using exon skipping Potential therapeutic approaches to treating DMD caused by out-of-frame mutations in the dystrophin gene are suggested by the milder form of dystrophin disorder known as BMD, caused by in-frame mutations. The ability to convert out-of-frame mutations to in-frame mutations is hypothetically to preserve the mRNA reading frame and produce a shortened but functional dystrophin protein internally. The antisense oligomers and antisense oligomer conjugates of this disclosure were designed to achieve this.

[0311] Hybridization of the PMO at the target premRNA sequence prevents the formation of the premRNA splicing complex and causes the deletion of exon 53 from the mature mRNA. The structure and conformation of the antisense oligomer and antisense oligomer conjugate present disclosure enable sequence-specific base pairing to complementary sequences. By a similar mechanism, for example, eteplirsene, a PMO designed to skip exon 51 of dystrophin premRNA, enables sequence-specific base pairing to the complementary sequence contained in exon 51 of dystrophin premRNA.

[0312] Normal dystrophin mRNA containing all 79 exons produces normal dystrophin protein. Figure 1 shows a small division of dystrophin premRNA and mature mRNA from exon 47 to exon 53. The shape of each exon indicates how codons are split between exons. Notably, one codon consists of three nucleotides. Rectangular exons begin and end with a complete codon. Arrow-shaped exons begin with a complete codon but end with a split codon containing only nucleotide #1 of the codon. Nucleotides #2 and #3 of this codon are contained in a subsequent exon that begins with a chevron shape.

[0313] Dystrophin mRNA that has lost an entire exon from the dystrophin gene typically results in DMD. The diagram in Figure 2 shows a type of gene mutation known to result in DMD (deletion of exon 50). Because exon 49 ends with a complete codon and exon 51 begins with the second nucleotide of the codon, the reading frame after exon 49 is shifted, resulting in an out-of-frame mRNA reading frame and the incorporation of incorrect amino acids downstream of the mutation. Subsequently, the absence of a functional C-terminal dystroglycan-binding domain leads to the production of an unstable dystrophin protein.

[0314] Eteprirsen skips exon 51, restoring the mRNA reading frame. Since exon 49 ends with a complete codon and exon 52 begins with the first nucleotide of the codon, deletion of exon 51 restores the reading frame, resulting in the production of an internally shortened dystrophin protein with an intact dystroglycan binding site, similar to an "in-frame" BMD mutation (Figure 3).

[0315] The feasibility of improving the DMD phenotype using exon skipping to restore the dystrophin mRNA open reading frame is supported in non-clinical studies. Numerous studies in animal models of DMD dystrophy have shown that recovery of dystrophin by exon skipping results in a definite improvement in muscle strength and function (Sharp 2011, Yokota 2009, Wu 2008, Wu 2011, Barton-Davis 1999, Goyenvalle 2004, Gregorevic 2006, Yue 2006, Welch 2007, Kawano 2008, Reay 2008, van Putten 2012). A compelling example of this is obtained from a study comparing dystrophin levels after exon skipping (using PMO) therapy with muscle function in the same tissue. In dystrophy mdx mice, the tibialis anterior (TA) muscle treated with mouse-specific PMO maintained approximately 75% of its maximum tolerance after stress-induced contraction, compared to only about 25% of the contralateral TA muscle in the untreated mouse (p<0.05) (Sharp 2011). In another study, three dystrophy CXMD dogs received exon skipping therapy using PMO specificity for their gene mutation at 2–5 months of age, once weekly for 5–7 weeks or every other week for 22 weeks. After exon skipping therapy, all three dogs showed widespread systemic expression of dystrophin in skeletal muscle, as well as maintenance or improvement in gait (15m running test) compared to baseline. In contrast, untreated CXMD dogs of the same age showed a significant decline in gait throughout the study (Yokota 2009).

[0316] In both mdx mice expressing the entire human DMD transcript and humanized DMD (hDMD) mouse models, PMO was shown to have more exon skipping activity at equimolar concentrations than phosphorothioate (Heemskirk 2009). In vitro experiments using reverse transcription polymerase chain reaction (RT-PCR) and Western blotting (WB) in normal human skeletal muscle cells or muscle cells from DMD patients with different mutations suitable for exon 51 skipping identified eteplirsene (PMO) as a potent inducer of exon 51 skipping. Eteprirsene-induced exon 51 skipping has been confirmed in vivo in the hDMD mouse model (Arechavala-Gomeza 2007).

[0317] Clinical outcomes to analyze the effects of antisense oligomers or antisense oligomer conjugates that are complementary to the target region of exon 53 of human dystrophin premRNA and induce exon 53 skipping include the percentage of dystrophin-positive fibers (PDPFs), 6-minute walk test (6MWT), inability to walk (LOA), Northstar gait assessment (NSAA), pulmonary function tests (PFT), ability to stand up (from supine position) without external support, de novo dystrophin production, and other functional measures.

[0318] In some embodiments, the Disclosure provides a method for producing dystrophin in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering an antisense oligomer conjugate or a pharmaceutically acceptable salt thereof to the subject, as described herein. In certain embodiments, the Disclosure provides a method for restoring the mRNA reading frame and inducing dystrophin protein production in a subject having Duchenne muscular dystrophy (DMD) having a mutation in the dystrophin gene suitable for exon 53 skipping. Protein production may be measured by reverse transcription polymerase chain reaction (RT-PCR), Western blot analysis, or immunohistochemistry (IHC).

[0319] In some embodiments, the Disclosure provides a method for producing dystrophin in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, the method comprising administering an antisense oligomer or a pharmaceutically acceptable salt thereof to the subject, as described herein. In certain embodiments, the Disclosure provides a method for restoring the mRNA reading frame and inducing dystrophin protein production in a subject having Duchenne muscular dystrophy (DMD) having a mutation in the dystrophin gene suitable for exon 53 skipping. Protein production may be measured by reverse transcription polymerase chain reaction (RT-PCR), Western blot analysis, or immunohistochemistry (IHC).

[0320] In some embodiments, the Disclosure provides a method for treating DMD in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering an antisense oligomer conjugate or a pharmaceutically acceptable salt thereof to the subject, as described herein.

[0321] In some embodiments, the present disclosure provides a method for treating DMD in a subject having a mutation in the dystrophin gene suitable for exon 53 skipping, and the method comprises administering an antisense oligomer or a pharmaceutically acceptable salt thereof to the subject, as described herein.

[0322] In various embodiments, the treatment is measured by delaying disease progression. In some embodiments, the treatment is measured by maintaining walking ability in the subject or reducing walking inability in the subject. In some embodiments, walking is measured using a 6-minute walk test (6MWT). In certain embodiments, walking is measured using the Northstart Walk Assessment (NSAA).

[0323] In some embodiments, the Disclosure provides a method for maintaining or reducing lung function loss in a subject having DMD, wherein the subject has a mutation in the DMD gene suitable for exon 53 skipping, and the method comprises administering an antisense oligomer conjugate or a pharmaceutically acceptable salt thereof to the subject, as described herein.

[0324] In some embodiments, the Disclosure provides a method for maintaining or reducing lung function loss in a subject having DMD, wherein the subject has a mutation in the DMD gene suitable for exon 53 skipping, and the method comprises administering an antisense oligomer or a pharmaceutically acceptable salt thereof to the subject, as described herein.

[0325] In some embodiments, lung function is measured as maximum expiratory pressure (MEP). In certain embodiments, lung function is measured as maximum inspiratory pressure (MIP). In some embodiments, lung function is measured as forced vital capacity (FVC).

[0326] In further embodiments, the pharmaceutical compositions of the Disclosure may be co-administered in the manner of the Disclosure, either in the same formulation or a different formulation, as provided in Han et al., Nat.Comms. 7, 10981 (2016) (which is incorporated herein by reference in its entirety). In some embodiments, the pharmaceutical compositions of the Disclosure may be co-administered with 5% hexose carbohydrate. For example, the pharmaceutical compositions of the Disclosure may be co-administered with 5% glucose, 5% fructose, or 5% mannose. In certain embodiments, the pharmaceutical compositions of the Disclosure may be co-administered with 2.5% glucose and 2.5% fructose. In some embodiments, the pharmaceutical compositions of the present disclosure may be administered co-administered with carbohydrates selected from arabinose present in 5% by volume, glucose present in 5% by volume, sorbitol present in 5% by volume, galactose present in 5% by volume, fructose present in 5% by volume, xylitol present in 5% by volume, mannose present in 5% by volume, combinations of glucose and fructose present in 2.5% by volume, and combinations of glucose present in 5.7% by volume, fructose present in 2.86% by volume, and xylitol present in 1.4% by volume.

[0327] In various embodiments, the antisense oligomer or antisense oligomer conjugate of the present disclosure is administered concurrently with a therapeutically effective amount of a nonsteroidal anti-inflammatory compound. In some embodiments, the nonsteroidal anti-inflammatory compound is an NF-κB inhibitor. For example, in some embodiments, the NF-κB inhibitor may be CAT-1004 or a pharmaceutically acceptable salt thereof. In various embodiments, the NF-κB inhibitor may be a conjugate of salicylate and DHA. In some embodiments, the NF-κB inhibitor is CAT-1041 or a pharmaceutically acceptable salt thereof. In certain embodiments, the NF-κB inhibitor is a conjugate of salicylate and EPA. In various embodiments, the NF-κB inhibitor is [ka] or a pharmaceutically acceptable salt thereof.

[0328] In some embodiments, the nonsteroidal anti-inflammatory compound is a TGF-β inhibitor. For example, in a particular embodiment, the TGF-β inhibitor is HT-100.

[0329] In certain embodiments, antisense oligomers or antisense oligomer conjugates described herein are described for use in therapy. In certain embodiments, antisense oligomers or antisense oligomer conjugates described herein are described for use in the treatment of Duchenne muscular dystrophy. In certain embodiments, antisense oligomers or antisense oligomer conjugates described herein are described for use in the manufacture of agents for use in therapy. In certain embodiments, antisense oligomers or antisense oligomer conjugates described herein are described for use in the manufacture of agents for the treatment of Duchenne muscular dystrophy.

[0330] V. kit This disclosure also provides a kit for the treatment of patients with genetic disorders, the kit comprising at least an antisense molecule (e.g., an antisense oligomer or antisense oligomer conjugate as described herein), packaged in a suitable container, along with instructions for its use. The kit may also include peripheral reagents such as buffers and stabilizers. Those skilled in the art will understand that the applications of the above method have a wide range of applications for identifying antisense molecules suitable for use in the treatment of many other diseases. In one embodiment, the kit comprises an antisense oligomer conjugate according to formula (III). In one embodiment, the kit comprises an antisense oligomer according to formula (V). [Examples]

[0331] While the above disclosure has been described in some detail by examples and embodiments for the purpose of clarifying understanding, it will be readily apparent to those skilled in the art, based on the teachings of this disclosure, that certain changes and modifications can be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided for illustrative purposes only and are not limiting. Those skilled in the art will readily recognize a variety of non-essential parameters that can be changed or modified to produce substantially similar results.

[0332] material and method Cell and tissue culture processing conditions Exon skipping was measured using differentiated human muscle cells (ZenBio, Inc.). Specifically, myoblasts (ZenBio, Inc., SKB-F) were grown to 80-90% confluence in growth medium (SKB-M, ZenBio, Inc.) at 37°C and 5% CO2. Differentiation was initiated by replacing the growth medium with differentiation medium (SKM-D, ZenBio, Inc.). To assay exon 53 skipping, 1 × 10⁶ cells were used. 4 Individual differentiated cells were seeded in a 24-well plate, and 1 mL of differentiation medium (SKM-D, ZenBio, Inc.) containing various concentrations of PMO or PPMO was added to each well. The cells were incubated for 96 hours.

[0333] Western blot analysis For Western blot analysis, tissues were homogenized in 133 μL of buffer using homogenization buffer (4% SDS, 4M urea, 125 mM Tris-HCl (pH 6.8)) in proportions of tissue sections approximately 5 mm in diameter and 9–18 × 20 μm in size. Corresponding lysates were collected and subjected to protein quantification using the RC DC protein assay kit (BioRad catalog no. 500-0122) according to the manufacturer's instructions. Tissue extract samples were diluted 1:10 with homogenization buffer to fall within the range of the BSA standard curve. Samples were prepared using 25 μL of protein lysate, 7 μL of NuPAGE LDS sample buffer (Life Technologies catalog no. NP0008, Carlsbad, California, USA), and 3 μL of NuPAGE reducing agent (10x) (Life Technologies catalog no. NP0004) to prepare 35 μL of sample containing the desired amount of protein. After heating the protein sample at 95°C for 5 minutes, the sample was centrifuged and the supernatant was loaded onto a NuPAGE Novex 10-well, 1 mm, mini 3-8% polyacrylamide tris-acetate gel (Life Technologies catalog no. EA0375) with a total protein load of up to 50 μg per lane. The gel was electrophoresed at 150 volts at room temperature until the dye surface leached out of the gel. The resulting protein gel was transferred to a PVDF membrane (Life Technologies catalog no. LC2007) at 30 volts for 75 minutes at room temperature using NuPAGE transfer buffer (Life Technologies NP006-1), 10% methanol, and 0.1% NuPAGE antioxidant (Life Technologies NP0005).

[0334] After protein transfer, the PVDF membrane was immersed in TTBS buffer (1X TBS (Amresco catalog no. J640-4L), 0.1% (v / v) tween(registered trademark)-20). The membrane was transferred to blocking buffer (5% (w / v) nonfat-dried milk in TTBS (Lab Scientific catalog no. M0841)) and immersed overnight at 4°C with gentle agitation. After blocking, the membrane was incubated at room temperature for 60 minutes in DYS1 (Leica catalog no. NCL-DYS1) diluted 1:20 with blocking buffer, or at room temperature for 20 minutes in anti-α-actinin antibody (Sigma-Aldrich catalog no. NA931V) diluted 1:100,000 with blocking buffer, followed by six washes (5 minutes each in TTBS). Anti-mouse IgG conjugated with horseradish peroxidase (GE Healthcare catalog no. NA931V) was diluted 1:40,000 with blocking buffer and added to the membrane for 45 minutes (DYS1) or 15 minutes (α-actinin), followed by six washes. The films were exposed to gel and developed accordingly using the ECL Prime Western Detection Kit (GE Healthcare catalog no. RPN2232). The developed films were scanned and analyzed using ImageQuant TL Plus software (version 8.1), and linear regression analysis was performed using Graphpad software.

[0335] Each Western blot gel contains four or five dystrophin standard curves prepared using total protein, spiked onto DMD tissue (e.g., mdx mouse quadriceps, diaphragm, or smooth muscle (GI)) extracts, extracted from normal tissue (mouse quadriceps, diaphragm, or heart) diluted to, for example, 64%, 16%, 4%, 1%, and 0.25% (see, e.g., Figures 5A and 5B). Standard curve samples were processed as described above. Dystrophin protein levels were determined as a percentage (%WT) of wild-type dystrophin levels by comparing the dystrophin band intensity to the gel standard curves.

[0336] RT-PCR analysis For RT-PCR analysis, RNA was isolated from cells using the Illustra GE spin kit according to the manufacturer's protocol. RNA concentration and purity were determined using NanoDrop. Exon 53 skipping was measured by RT-PCR using a forward primer binding to the exon 51 / 52 junction and 54 SEQ ID NO: 138 (5'-CATCAAGCAGAAGGCAACAA-3') and a reverse primer binding to the exon 51 / 52 junction and 54 SEQ ID NO: 139 (5'-GAAGTTTCAGGGCCAAGTCA-3'). Skipped exon 53 resulted in a 201 bp amplicon, while non-skipped exon 53 resulted in a 413 bp amplicon. Mouse exon 23 skipping was measured by RT-PCR using forward primer SEQ ID NO: 140 (5'-CACATCTTTGATGGTGTGAGG-3') and reverse primer SEQ ID NO: 141 (5'-CAACTTCAGCCATCCATTTCTG-3').

[0337] After subjecting the RNA to RT-PCR, the samples were analyzed using a Caliper instrument employing gel capillary electrophoresis. The exon skipping rate was calculated using the following equation: (area under the curve of skipped bands) / (sum of areas under the curve of skipped and non-skipped bands) × 100.

[0338] Immunohistochemical test: Dystrophin staining: Dystrophin was detected using 10-micron frozen tissue sections of mouse quadriceps femoris muscle with a primary antibody against dystrophin in 10% goat serum + 1% BSA in PBS (dilution 1:250, rabbit, Abcam, catalog number ab15277) and a secondary antibody against Alexa-Fluoro 488 goat anti-rabbit in 10% goat serum + 1% BSA (dilution 1:1000).

[0339] Preparation of morpholino subunits [ka] Referring to Scheme 1, B represents a base-pairing moiety, and the morpholino subunit may be prepared from the corresponding ribonucleoside (1) as shown. The morpholino subunit (2) may optionally be protected by reaction with a suitable protecting group precursor, e.g., trityl chloride. The 3' protecting group is generally removed during solid oligomer synthesis, as described in more detail below. The base-pairing moiety can be suitably protected for solid-phase oligomer synthesis. Suitable protecting groups include benzoyl for adenine and cytosine, phenylacetyl for guanine, and pivaloyloxymethyl for hypoxanthine (I). The pivaloyloxymethyl group can be introduced at the N1 position of the hypoxanthine heterocyclic base. Unprotected hypoxanthine subunits may be used, but the yield in the activation reaction is much better when the base is protected. Other suitable protecting groups include those disclosed in U.S. Patent No. 8,076,476, which is incorporated herein by reference in whole.

[0340] The reaction of activated phosphorus compounds 4 and 3 yields a morpholino subunit having the desired linkage moiety 5.

[0341] The compound of structure 4 can be prepared using various methods known to those skilled in the art. The coupling with the morpholino moiety then proceeds as outlined above.

[0342] Compounds of structure 5 can be used in solid-phase oligomer synthesis to prepare oligomers containing inter-subunit linkages. Such methods are well known in the art. Briefly, compounds of structure 5 may be modified at the 5' end to contain a linker to a solid support. Once supported, the protecting group of 5 (e.g., trityl at the 3' end) is removed, and the free amine reacts with the activated phosphorus moiety of a second compound of structure 5. This sequence is repeated until an oligo of the desired length is obtained. The protecting group at the 3' end may be removed or left intact if 3' modification is desired. The oligo can be removed from the solid support by various methods or by exemplary treatments using a base to cleave the linkage to the solid support.

[0343] The preparation of morpholino oligomers in the general and specific morpholino oligomers of this disclosure will be described in more detail in the examples.

[0344] Preparation of morpholino oligomers The preparation of the compounds in this disclosure is carried out according to Scheme 2 using the following protocol.

[0345] [ka] [ka] Preparation of tritylpiperazinephenylcarbamate 35: A chilled suspension of compound 11 in dichloromethane (6 mL / g 11) was mixed with a solution of potassium carbonate in water (3.2 equivalents) (4 mL / g potassium carbonate). To this two-phase mixture, a solution of phenyl chloroformate in dichloromethane (1.03 equivalents) (2 g / g phenyl chloroformate) was slowly added. The reaction mixture was heated to 20°C. At the completion of the reaction (1-2 hours), the layers were separated. The organic layer was washed with water and dried on anhydrous potassium carbonate. Product 35 was isolated by crystallization from acetonitrile.

[0346] Preparation of carbamate alcohol 36: Sodium hydride (1.2 equivalents) was suspended in 1-methyl-2-pyrrolidinone (32 mL / g sodium hydride). Triethylene glycol (10.0 equivalents) and compound 35 (1.0 equivalent) were added to this suspension. The resulting slurry was heated to 95°C. At the completion of the reaction (1-2 hours), the mixture was cooled to 20°C. 30% dichloromethane / methyl tert-butyl ether (v:v) and water were added to this mixture. The product-containing organic layer was successively washed with aqueous NaOH, aqueous succinic acid, and saturated aqueous sodium chloride. Product 36 was isolated by crystallization from dichloromethane / methyl tert-butyl ether / heptane.

[0347] Preparation of tellic acid 37: To a solution of compound 36 in tetrahydrofuran (7 mL / g 36), succinic anhydride (2.0 equivalents) and DMAP (0.5 equivalents) were added. The mixture was heated to 50°C. Upon completion of the reaction (5 hours), the mixture was cooled to 20°C and adjusted to pH 8.5 with aqueous NaHCO3. Methyl tert-butyl ether was added, and the product was extracted into the aqueous layer. Dichloromethane was added, and the mixture was adjusted to pH 3 with aqueous citric acid. The product-containing organic layer was washed with a mixture of pH=3 citrate buffer and saturated aqueous sodium chloride. This dichloromethane solution of 37 was used without isolation in the preparation of compound 38.

[0348] Preparation of compound 38: To a solution of compound 37, N-hydroxy-5-norbornene-2,3-dicarboxylic acid imide (HONB) (1.02 equivalents), 4-dimethylaminopyridine (DMAP) (0.34 equivalents), and then 1-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) (1.1 equivalents) were added. The mixture was heated to 55°C. Upon completion of the reaction (4-5 hours), the mixture was cooled to 20°C and washed sequentially with 1:1 0.2 M citric acid / brine and brine. The dichloromethane solution underwent solvent exchange to acetone, and then to N,N-dimethylformamide, and the product was isolated by precipitation from acetone / N,N-dimethylformamide to saturated aqueous sodium chloride. The crude product was reslurried several times in water to remove residual N,N-dimethylformamide and salts.

[0349] PMO synthesis method A: Use of disulfide anchors The introduction of the activated "tail" into the anchor-loading resin was carried out in dimethylimidazolidinone (DMI) using a procedure used for incorporating subunits during solid-phase synthesis.

[0350] [ka] This procedure was carried out in a silane-treated jacketed peptide tank (ChemGlass, NJ, USA) using coarse porous (40-60 μm) glass frit, an overhead stirrer, and a Teflon® three-way stopcock, allowing N2 to foam through the frit or vacuum extraction.

[0351] The resin treatment / washing step in the following procedure consists of two basic operations: resin fluidization or a stirred-bed reactor and solvent / solution extraction. For resin fluidization, a stopcock was positioned to allow N2 to flow upward through the frit, the specified resin treatment / wash was added to the reactor, and the resin was permeated and completely moistened. Mixing was then started and the resin slurry was mixed for a specified time. For solvent / solution extraction, mixing and N2 flow were stopped, a vacuum pump was started, and then a stopcock was positioned to allow the resin treatment / wash to be discharged as waste. Unless otherwise specified, the resin treatment / washing volume was always 15 mL / g of resin.

[0352] 75 g, 1 equivalent, Polymer Labs, UK, part number 1464-X799) aminomethyl polystyrene resin (100-200 mesh; loaded at approximately 1.0 mmol / g based on nitrogen purging) was added to a silane-treated jacketed peptide tank, and 1-methyl-2-pyrrolidinone (NMP; 20 mL / g resin) was added, and the resin was swollen while being mixed for 1-2 hours. After draining the swelling solvent, the resin was washed with dichloromethane (2 × 1-2 min), 5% diisopropylethylamine in 25% isopropanol / dichloromethane (2 × 3-4 min), and dichloromethane (2 × 1-2 min). After draining the final wash, the resin was treated with a solution of disulfide anchor 34 in 1-methyl-2-pyrrolidinone (0.17 M; 15 mL / g resin, approximately 2.5 equivalents), and the resin / reagent mixture was heated at 45°C for 60 hours. Upon completion of the reaction, heating was stopped, the anchor solution was drained, and the resin was washed with 1-methyl-2-pyrrolidinone (4 × 3-4 min) and dichloromethane (6 × 1-2 min). The resin was treated with a solution of 10% (v / v) diethyl dicarbonate in dichloromethane (16 mL / g, 2 × 5-6 min), and then washed with dichloromethane (6 × 1-2 min). Resin 39 was dried under a flow of N2 for 1-3 hours, and then under vacuum until it reached a constant weight (±2%). Yield: 110-150% of the original resin weight.

[0353] Determination of aminomethylpolystyrene-disulfide resin loading: The amount of resin to be loaded (number of potentially available reaction sites) is determined by a spectroscopic assay of the number of triphenylmethyl (trityl) groups per gram of resin.

[0354] Transfer a known weight of dry resin (25 ± 3 mg) to a silane-treated 25 mL volumetric flask and add approximately 5 mL of 2% (v / v) trifluoroacetic acid in dichloromethane. Gently swirl the contents to mix and let stand for 30 minutes. The volume will increase to a maximum of 25 mL with further 2% (v / v) trifluoroacetic acid in dichloromethane, and the contents will be completely mixed. Using a positive displacement pipette, transfer an aliquot of the trityl-containing solution (500 μL) to a 10 mL volumetric flask and adjust its volume to 10 mL with methanesulfonic acid.

[0355] The trityl cation content in the final solution is measured by UV absorbance at 431.7 nm. The resin load is determined in terms of trityl groups (μmol / g) per gram of resin, using appropriate volume, dilution, dissipation coefficient (ε: 41 μmol-1 cm-1), and resin weight. The assay is performed in sets of three, and the average load is calculated.

[0356] In this embodiment, the resin loading procedure provides a loading volume of approximately 500 μmol / g to the resin. When the disulfide anchor integration step is performed at room temperature for 24 hours, a loading volume of 300-400 μmol / g is obtained.

[0357] Tail loading: The tails can be introduced into the solid support using the same settings and volumes as for the preparation of the aminomethylpolystyrene-disulfide resin. The anchor-loaded resin was first deprotected under acidic conditions to neutralize the material obtained before coupling. In the coupling step, instead of the disulfide anchor solution, a solution of 38 (0.2M) in DMI containing 4-ethylmorpholine (NEM, 0.4M) was used. After 2 hours at 45°C, resin 39 was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and once with DCM. Solutions of benzoic anhydride (0.4M) and NEM (0.4M) were added to the resin. After 25 minutes, the reactor jacket was cooled to room temperature and the resin was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and eight times with DCM. Resin 40 was filtered and dried under high vacuum. The loading of resin 40 is defined as the loading amount of the original aminomethyl polystyrene-disulfide resin 39 used in the tail loading.

[0358] Solid-phase synthesis: Morphorino oligomers were prepared on a Gilson AMS-422 Automated Peptide Synthesizer in a 2 mL Gilson polypropylene reaction column (part number 3980270). An aluminum block with a water flow channel was placed around the column when it was placed on the synthesizer. Alternatively, the AMS-422 was used by adding reagent / washing solution, holding for the specified time, and emptying the column using vacuum.

[0359] For oligomers with a maximum subunit length of approximately 25 units, aminomethylpolystyrene disulfide resins with a resin loading of close to 500 μmol / g are preferred. For larger oligomers, aminomethylpolystyrene disulfide resins with a resin loading of 300-400 μmol / g are preferred. If molecules with a 5'-tail are desired, the tail-loaded resin is selected according to the same loading guidelines.

[0360] The following reagent solutions were prepared: Detritylated solution: 4:1 dichloromethane / 10% cyanoacetic acid (w / v) in acetonitrile Neutralization solution: 5% diisopropylethylamine in 3:1 dichloromethane / isopropanol, and Coupling solution: 0.18 M (or 0.24 M for oligomers grown longer than 20 subunits) activated morpholino subunits of the desired base and linkage type in 1,3-dimethylimidazolidinone, and 0.4 M ethylmorpholine.

[0361] Dichloromethane (DCM) was used as a transition wash to separate the washing of different reagent solutions.

[0362] On the synthesizer, with the block set to 42°C, 2 mL of 1-methyl-2-pyrrolidinene was identified into each column containing 30 mg of aminomethylpolystyrene-disulfide resin (or tail resin), and left at room temperature for 30 minutes. After washing twice with 2 mL of dichloromethane, the following synthesis cycle was used. [Table 25]

[0363] The sequence of each oligomer was programmed into the synthesizer so that each column would receive the appropriate coupling solution (A, C, G, T, I) in the appropriate sequence. When the oligomers in the column had completed the integration of their final subunits, the column was removed from the block and 0.89M The final cycle was performed manually using a coupling solution consisting of 4-methoxytriphenylmethyl chloride (0.32 M in DMI) containing 4-ethylmorpholine.

[0364] Cleavage from the resin and removal of bases and backbone protecting groups: After methoxytritylation, the resin was washed eight times with 2 mL of 1-methyl-2-pyrrolidinone. 1 mL of cleavage solution consisting of 0.1 M 1,4-dithiothreitol (DTT) and 0.73 M triethylamine in 1-methyl-2-pyrrolidinone was added, the column was capped, and left at room temperature for 30 minutes. The solution was then drained into a 12 mL Wheaton vial. The greatly shrunk resin was washed twice with 300 μL of cleavage solution. 4.0 mL of concentrated aqueous ammonia (stored at -20°C) was added to the solution, the vial was tightly capped (with a Teflon® liner screw cap), and the mixture was swirled to mix the solution. The vial was placed in a 45°C oven for 16–24 hours to induce cleavage of bases and backbone protecting groups.

[0365] Purification of crude product: The ammoniacement solution in the vial was removed from the oven and allowed to cool to room temperature. The solution was diluted with 20 mL of 0.28% aqueous ammonia and passed through a 2.5 × 10 cm column containing Macroprep HQ resin (BioRad). The methoxytrityl-containing peak was eluted using a salt gradient (A: 0.28% ammonia, B: 1 M sodium chloride in 0.28% ammonia, 0–100% B over 60 minutes). The combined fractions were pooled and further processed according to the desired product.

[0366] Demethoxytritylation of morpholino oligomers: The pooled fraction from Macrorep purification was treated with 1 M H3PO4 to reduce the pH to 2.5. After the initial mixing, the sample was left at room temperature for 4 minutes, during which time it was neutralized to pH 10-11 with 2.8% ammonia / water. The product was purified by solid-phase extraction (SPE).

[0367] SPE column packing and preparation: Pack a 20 mL frit column (BioRad Econo-Pac Chromatography Columns (732-1011)) with Amberchrome CG-300M (Rohm and Haas; Philadelphia, PA) (3 mL), and rinse the resin with 3 mL of the following: 0.28% NH4OH / 80% acetonitrile; 0.5 M NaOH / 20% ethanol; water; 50 mM H3PO4 / 80% acetonitrile; water; 0.5 M NaOH / 20% ethanol; water; 0.28% NH4OH.

[0368] SPE purification: The solution from demethoxytritylation was loaded onto the column, and the resin was rinsed three times with 3-6 mL of 0.28% aqueous ammonia. A Wheaton vial (12 mL) was placed below the column, and the product was eluted by washing twice with 2 mL of 45% acetonitrile in 0.28% aqueous ammonia water.

[0369] Product Isolation: The solution was frozen in dry ice, and the vial was placed in a freeze-dryer to obtain a fluffy white powder. The sample was dissolved in water and filtered using a syringe through a 0.22 micron filter (Pall Life Sciences, Acrodisc 25 mm syringe filter with a 0.2 micron HT Tuffryn membrane). The optical density (OD) was measured using a UV spectrophotometer to determine the OD units of the present oligomers, and the sample for analysis was dispensed. The solution was then returned to a Wheaton vial for freeze-drying.

[0370] Analysis of morpholino oligomers by MALDI: MALDI-TOF mass spectrometry was used to determine the composition of fractions in the purified product and to provide evidence of oligomer identity (molecular weight). Samples were experimented on after dilution using solutions of 3,5-dimethoxy-4-hydroxycinnamic acid (sinapic acid), 3,4,5-trihydroxyacetophenone (THAP), or alpha-cyano-4-hydroxycinnamic acid (HCCA) as a matrix. [Table 5-3]

[0371] CPP conjugation (Sequences 136 and 136 disclosed below) [ka] Analytical procedure: Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS) was recorded on a Bruker Autoflex™ Speed ​​using a synapic acid (SA) matrix. SCX-HPLC was performed on a Thermo Dionex UltiMate 3000 system with a 3000 diode array detector and a ProPac™ SCX-20 column (250 × 4 mm) at a flow rate of 1.0 mL / min (pH=2, column temperature 30°C). Mobile phases were A (25% acetonitrile in water containing 24 mM H3PO4) and B (25% acetonitrile in water containing 1 M KCl and 24 mM H3PO4). Gradient elution was used: 0 min, 35% B; 2 min, 35% B; 22 min, 80% B; 25 min, 80% B; 25.1 min, 35% B; 30 min, 35% B.

[0372] PMO-A (1.82g, 0.177 mmol, newly dried by freeze-drying for 2 days, as shown in the table below) [ka] (In the formula, each Nu from 1 to 25 and from 5' to 3' is (Sequence ID 142)) [Table 12]

[0373] A mixture of Ac-L-Arg-L-Arg-L-Arg-L-Arg-L-Arg-Gly-OH (SEQ ID NO: 136) hexatrifluoroacetate (614.7 mg, 0.354 mmol) and 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexatrifluorophosphate (HATU, 134.4 mg, 0.354 mmol) was mixed with dimethyl sulfoxide (DMSO, 20 mL). The mixture was stirred at room temperature for 3 minutes, and then N,N-diisopropylethylamine (DIPEA, 68.5 mg, 0.530 mmol) was added. After 5 minutes, the turbid mixture became a clear solution. The reaction was monitored by SCX-HPLC. After 2 hours, 20 mL of 10% ammonium hydroxide solution (2.8% NH3) was added. The mixture was stirred at room temperature for a further 2 hours. The reaction was terminated by adding 400 mL of water. Trifluoroethanol (2.0 mL) was added to the solution.

[0374] The solution was divided into two parts, and each part was purified using a WCX column (10 g of resin per column). Each WCX column was first washed with 20% acetonitrile (v / v) in water to remove the PMO#1 starting material. When MALDI-TOF mass spectrometry showed the absence of a PMO#1 signal, washing (225 mL per column) was stopped. Then, each column was washed with water (100 mL per column). The desired product, PPMO#1, was eluted with 2.0 M guanidine HCl (140 mL per column). The purified PPMO#1 solutions were pooled together and then divided into two parts, each desalted using an SPE column (10 g of resin per column).

[0375] The SPE columns were first washed with 1.0 M NaCl aqueous solution (100 mL per column) to produce PPMO#1 hexahydrochloride. Next, each SPE column was washed with water (200 mL per column). The final desalted PPMO#1 was eluted with 50% acetonitrile in water (v / v, 150 mL per column). The acetonitrile was removed by efflux under reduced pressure. The resulting aqueous solution was freeze-dried to obtain the desired conjugate PPMO#1 hexahydrochloride (1.93 g, yield 94.5%).

[0376] Example 3: In vitro skipping of exon 53 (RD cells) PMO compounds targeting human dystrophin (DMD) exon 53, as listed in the table below, were synthesized according to the method described above, and their DMD exon 53 skipping properties were evaluated in human myoblasts. [Table 13-1] [Table 13-2]

[0377] Specifically, primary human myoblasts were cultured using standard techniques. Lyophilized PMO was resuspended in nuclease-free water, and the PMO solution was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific) to verify the molar concentration. A 5 μm concentration of PMO was delivered to myoblasts using nucleoporosis according to the manufacturer's instructions and the P3 kit (Lonza), and incubated overnight in a 37°C, 5% CO2 incubator before RNA extraction.

[0378] RNA was extracted from PMO or PPMO-treated cells using GE Healthcare's RNAspin 96-well RNA isolation kit and subjected to RT-PCR using standard techniques with primers targeting human DMD exons 51 / 52 junction and 54 (forward primer: (SEQ ID NO: 138): CATCAAGCAGAAGGCAACAA, reverse primer: (SEQ ID NO: 139): GAAGTTTCAGGGCCAAGTCA).

[0379] Skipping was measured using the Caliper LabChip bioanalyzer, and the exon skipping percentage (i.e., the band intensity of the exon-skipped product relative to the full-length PCR product) was calculated using the following formula: [Exon 53 skipped product / (total of exon 53 skipped product and product that is not exon 53 skipped) * 100]. The results for the percentage of Exon-53 skipping are shown in the table below. [Table 14]

[0380] Example 4: In vitro exon 53 skipping (myotubes) Example 4A: 40 μm PPMO PPMO compounds targeting human dystrophin (DMD) exon 53, as described in the table below, were prepared according to the above method and evaluated for DMD exon 53 skipping in healthy human myotubes. [Table 15-1] [Table 15-2]

[0381] Specifically, differentiated human primary myotubes were cultured using standard techniques. Lyophilized PPMO was resuspended in nuclease-free water, and the PPMO solution was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific) to verify its molar concentration. PPMO was added to myotube cell medium at a 40 μm level in SKM-M medium (Zen-Bio, Inc.). After 96 hours of incubation, myoblasts were washed with PBS and lysed with RA1 lysis buffer in the Illustrated GE RNAspin 96 kit (catalog no. 25-055-75, GE Healthcare Bio-Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40 μL of RNase-free water was used to elute the RNA.

[0382] To determine exon 53 skipping, a two-step endpoint RT-PCR was performed. Specifically, 11 microliters of total RNA were first reverse transcribed to cDNA using a SuperScript IV First-strand synthesis kit (catalog number 18091200, Invitrogen) with a random hexamer according to the manufacturer's instructions. PCR was performed by adding 9 μL of cDNA to Platinum Taq DNA polymerase PCR Supermix High Fidelity (catalog number 12532024, Invitrogen) using primers targeting the human DMD exon 51 / 52 junction and 54 (forward primer: (SEQ ID NO: 138): CATCAAGCAGAAGGCAACAA; reverse primer: (SEQ ID NO: 139): GAAGTTTCAGGGCCAAGTCA). PCR amplification was performed using a BioRad CFX96 real-time thermocycler with the program shown in the table below. Expression of skipped or non-skipped PCR products was evaluated by loading 32 μL of PCR product onto a LabChip GX system using the DNA High Sensitivity Reagent kit (CLS760672, Perkin Elmer). The percentage of DMD exon 53 skipping was calculated as the percentage of the molar concentration (nmol / L) of the exon 53 skipped band (201 bp) compared to the total molar concentration of the skipped (201 bp) and non-skipped (413 bp) bands. [Table 16]

[0383] The results for the percentage of Exon-53 skipping are shown in the table below. [Table 17]

[0384] Example 4B: Dose response of PPMO at 2.5 μm, 5 μm, 10 μm, and 20 μm The PPMO compounds from Example 4A were evaluated for DMD exon 53 skipping in healthy human myotubes at 2.5 μm, 5 μm, 10 μm, and 20 μm concentrations. Specifically, differentiated primary human myotubes were cultured using standard techniques. Lyophilized PPMO was resuspended in nuclease-free water, and the PPMO solution was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific) to verify the molar concentration. PPMO was added to myotube cell medium in SKM-M medium (Zen-Bio, Inc.) at 2.5 μm, 5 μm, 10 μm, and 20 μm concentrations. After 96 hours of incubation, myoblasts were washed with PBS and Illustrated using the GE RNAspin 96 kit (catalog no. 25-055-75, GE Healthcare). The RNA was lysed with RA1 lysis buffer (from Bio-Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40 μL of RNase-free water was used to elute the RNA.

[0385] To determine exon 53 skipping, a two-step endpoint RT-PCR was performed. Specifically, 11 microliters of total RNA were first reverse transcribed to cDNA using a SuperScript IV First-strand synthesis kit (catalog number 18091200, Invitrogen) with a random hexamer according to the manufacturer's instructions. PCR was performed by adding 9 μL of cDNA to Platinum Taq DNA polymerase PCR Supermix High Fidelity (catalog number 12532024, Invitrogen) using primers targeting the human DMD exon 51 / 52 junction and 54 (forward primer: (SEQ ID NO: 138): CATCAAGCAGAAGGCAACAA; reverse primer: (SEQ ID NO: 139): GAAGTTTCAGGGCCAAGTCA). PCR amplification was performed using a BioRad CFX96 real-time thermocycler with the program shown in the table of Example 4A. Expression of skipped or non-skipped PCR products was evaluated by loading 32 μL of PCR product onto a LabChip GX system using the DNA High Sensitivity Reagent kit (CLS760672, Perkin Elmer). The percentage of DMD exon 53 skipping was calculated as the percentage of the molar concentration (nmol / L) of the exon 53 skipped band (201 bp) compared to the total molar concentration of the skipped (201 bp) and non-skipped (413 bp) bands.

[0386] The results for the percentage of Exon-53 skipping are shown in the table below. [Table 18]

[0387] Example 5: MDX mouse study The mdx mouse is a commonly recognized and well-characterized animal model for Duchenne muscular dystrophy (DMD), which involves a mutation in exon 23 of the dystrophin gene. The M23D antisense sequence (SEQ ID NO: 137) is known to induce exon 23 skipping and restore functional dystrophin expression. Six-to-seven-week-old MDX mice were given a single intra-tail vein injection of either PPMO4225 or PMO4225, as shown in the table below, at a dose of 40 mg / kg or with saline. [Table 19]

[0388] Treated mice were sacrificed 7, 30, 60, and 90 days after a single injection (n=6 per group). The diaphragm, heart, and right quadriceps femoris muscle were treated for Western blot analysis to measure dystrophin protein production and RT-PCR analysis to measure the rate of exon skipping, while the left quadriceps femoris muscle was treated for immunohistochemistry and H / E staining as described above.

[0389] Dystrophin protein recovery was quantified by Western blotting, and the percentage of exon 23 skipping was measured by RT-PCR as described above.

[0390] The results of RT-PCR and Western blot are shown in Figures 4A–9B and the table below. Surprisingly, PPMO4225 induced significantly higher and more sustained levels of dystrophin recovery and exon 23 skipping compared to PMO4225, with the highest levels occurring at 30 days post-injection. Even more surprisingly, PPMO4225 increased intracardiac dystrophin levels when PMO4225 did not. No intracardiac dystrophin or exon skipping was observed with PMO4225 at any time point. [Table 20] [Table 21]

[0391] The results of immunohistochemical testing are shown in Figure 10. Here, PPMO4225 restores dystrophin throughout the quadriceps femoris muscle, but 4225 results in a "patchy" expression pattern. The uniform distribution of dystrophin after PPMO4225 treatment indicates that broad targeting of skeletal muscle is achievable. PPMO4225 has significantly improved delivery than PMO4225 in vivo.

[0392] Example 6: MDX mouse dose-response study Six-to-seven-week-old MDX mice were given a single intra-tail vein injection of either PPMO4225 or PMO4225 at doses of 40 mg / kg, 80 mg / kg, or 120 mg / kg (n=6 per group).

[0393] The treated mice were sacrificed 30 days after injection. The diaphragm, quadriceps femoris, and heart were treated for Western blot analysis, and dystrophin protein production was measured based on the above Western blot protocol (e.g., used in Example 5) with the following modifications. [Table 22]

[0394] The percentage of dystrophin protein recovery as wild-type is shown in the following table and Figures 11-16. [Table 23]

[0395] Surprisingly, the data show that a single dose of PPMO4225 increases dystrophin levels in a dose-dependent manner in mdx mice to a significantly and substantially greater extent than PMO4225 alone.

[0396] Example 7: MDX mouse IHC study of the diaphragm and heart Six-to-seven-week-old MDX mice were given a single intravein injection of PPMO4225 at a dose of 80 mg / kg or in saline, while six-to-seven-week-old wild-type mice were given a single injection of saline. The treated mdx mice, saline-treated mdx mice, and wild-type mice were sacrificed 30 days after the single injection (n=4 per group). The results of immunohistochemical analysis are shown in Figure 17. Here, the results show a uniform increase in dystrophin in the tissues of mdx mice treated with PPMO4225, which is associated with the morbidity and mortality of DMD. *********************

[0397] All publications and patent applications cited herein are incorporated herein by reference as if each individual publication or patent application were directed to be incorporated by reference specifically and individually. References Aartsma-Rus, A., AAJanson, et al. (2004). “Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense.” Am J Hum Genet 74(1):83-92. Abes, R., et al. (2008). “Arginine-rich cell penetrating peptides:design, structure-activity, and applications to alter pre-mRNA splicing by steric-block oligonucleotides.” J Pept.Sci. 14:455-460. Alter, J., et al. (2006). of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology.” Nat.Med. 12(2):175-177. Bestas,B.,et al.(2014).“Splice-correcting ligonucleotides restore BTK function in X-linked agammaglobulinemia model.” J. Clin. Invest. Cirak S.,V.Arechavala-Gomeza,et al.(2011).“Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment:an open-label,phase 2,dose-escalation study.” Lancet 378(9791):595-605. Dunckley,M.G.,I.C.Eperon,et al.(1997).“Modulation of splicing in the DMD gene by antisense oligoribonucleotides.” Nucleosides & Nucleotides 16(7-9):1665-1668. Dunckley,M.G.,M.Manoharan,et al.(1998).“Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides.” Hum Mol Genet 7(7):1083-90. Errington,S.J.,C.J.Mann,et al.(2003).“Target selection for antisense oligonucleotide induced exon skipping in the dystrophin gene.” J Gene Med 5(6):518-27. Goemans,N.M.,M.Tulinius,et al.(2011).“Systemic Administration of PRO051 in Duchenne’s Muscular Dystrophy.” N Engl J Med . Jearawiriyapaisarn,N.,H.M.Moulton,et al.(2008).“Sustained Dystrophin Expression Induced by Peptide-conjugated Morpholino Oligomers in the Muscles of mdx Mice.” Mol Ther . Jearawiriyapaisarn,N.,et al.(2010).“Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers.” Cardiovascular Research 85:444-453. Kinali,M.,V.Arechavala-Gomeza,et al.(2009).“Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy:a single-blind,placebo-controlled,dose-escalation,proof-of-concept study.” Lancet Neurol 8(10):918-28. Leblue,B.,et al.(2008).“Cell penetrating peptide conjugates of steric block oligonucleotides.” Adv.Drug Deliv.Rev. 60:517-529. Lu,Q.L.,C.J.Mann,et al.(2003).“Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse.” Nat Med 9(8):1009-14. Mann,C.J.,K.Honeyman,et al.(2002).“Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy.” J Gene Med 4(6):644-54. Marshall,N.B.,S.K.Oda,et al.(2007).“Arginine-rich cell-penetrating peptides facilitate delivery of antisense oligomers into murine leukocytes and alter pre-mRNA splicing.” Journal of Immunological Methods 325(1-2):114-126. Matsuo,M.,T.Masumura,et al.(1991).“Exon skipping during splicing of dystrophin mRNA precursor due to an intraexon deletion in the dystrophin gene of Duchenne muscular dystrophy kobe.” J Clin Invest 87(6):2127-31. McClory,G.,et al.(2006).“Antisense oligonucleotide-induced exon skipping restored dystrophin expression in vitro in a canine model of DMD.” Tre Therapy 13:1373-1381. Monaco,A.P.,C.J.Bertelson,et al.(1988).“An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus.” Genomics 2(1):90-5. Moulton,H.M.,(2007).“Cell-penetrating peptide-morpholino conjugates alter pre-mRNA splicing of DMD(Duchenne muscular dystrophy)and inhibit murine coronavirus replication in vivo.” Biochem.Society Trans 35(4):826-828. Pramono,Z.A.,Y.Takeshima,et al.(1996).“Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence.” Biochemist Biophys Res Commun 226(2):445-9. Sazani,P.,R.Kole,et al.(2007).Splice switching oligomers for the TNF superfamily receptors and their use in treatment of disease. PCT WO2007058894 ,University of North Carolina Sierakowska,H.,M.J.Sambade,et al.(1996).“Repair of thalassemic human beta-globin mRNA in mammalian cells by antisense oligonucleotides.” Proc Natl Acad Sci USA 93(23):12840-4. Summerton,J.and D.Weller(1997).“Morpholino antisense oligomers:design,preparation,and properties.” Antisense Nucleic Acid Drug Dev 7(3):187-95. Takeshima,Y.,H.Nishio,et al.(1995).“Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe.” J Clin Invest 95(2):515-20. van Deutekom,J.C.,M.Bremmer-Bout,et al.(2001).“Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells.” Hum Mol Genet 10(15):1547-54. van Deutekom,J.C.,A.A.Janson,et al.(2007).“Local dystrophin restoration with antisense oligonucleotide PRO051.” N Engl J Med 357(26):2677-86. Wilton,S.D.,A.M.Fall,et al.(2007).“Antisense oligonucleotide-induced exon skipping across the human dystrophin gene transcript.” Mol Ther 15(7):1288-96. Wilton,S.D.,F.Lloyd,et al.(1999).“Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides.” Neuromuscular Disord 9(5):330-8. Wu,B.,H.M.Moulton,et al.(2008).“Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer.” Proc Natl Acad Sci USA 105(39):14814-9. Wu,B.,et al.(2012).“Long-term rescue of dystrophin expression and improvement in muscle pathology and function in dystrophic mdx mice by peptide-conjugated morpholino.” The Am.J. Pathol. 181(2):392-400. Wu,P.,et al.(2007)“Cell-penetrating peptides as transporters for morpholino oligomers:effects of amino acid composition on intracellular delivery and cytotoxicity.” Nucleic Acids Research 35(15):5182-5191. Yin,H.,H.M.Moulton,et al.(2008).“Cell-penetrating peptide-conjugated antisense oligonucleotides restore systemic muscle and cardiac dystrophin expression and function.” Hum Mol Genet 17(24):3909-18. Yin,H.,et al.(2011).“Pip5 transduction peptides direct high efficiency oligonucleotide-mediated dystrophin exon skipping in heart and phenotypic correction in mdx mice.” Ther 19(7):1295-1303. Youngblood,D.,et al.(2006).“Stability of cell-penetrating peptide- morpholino oligomer conjugates in human serum and in cells.” Am.Chem.Soc. Table 24-1 Table 24-2 Table 24-3

Claims

[Claim 1] The object, method, or system described herein and in the drawings.

Images