Composition for activating dendritic cells, method for producing fermented milk for activating dendritic cells, and composition for promoting salivary SIgA secretion.

Abstract

To provide a dendritic cell activation composition that is highly safe and can be easily consumed by many people. [Solution] The dendritic cell activation composition according to the present invention contains extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria. Here, the Lactobacillaceae lactic acid bacteria are preferably Lactobacillus species, more preferably Lactobacillus species having a 16S rRNA gene with 95% or more sequence identity with the base sequence of Sequence ID No. 1, even more preferably Lactobacillus delbrueckii subsp. bulgaricus, and particularly preferably Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

Description

[Technical Field]

[0001] This invention relates to a composition for activating dendritic cells. It also relates to a method for producing fermented milk for activating dendritic cells. Furthermore, this invention relates to a composition for promoting salivary SIgA secretion. [Background technology]

[0002] To date, drugs effective against diseases such as cancer, AIDS, and herpesvirus have been proposed (see, for example, Patent Documents 1, 2, and 3). Some of these drugs, when used in combination with dendritic cell activators in patients who need them, improve dendritic cell activity, thereby treating or alleviating the symptoms of the diseases listed above. Furthermore, it has been found that there is a close relationship between "dendritic cell activation" and "maintaining or improving health." Therefore, developing drugs that can activate dendritic cells is becoming increasingly important in today's society where health awareness is on the rise.

[0003] However, taking such drugs solely for the purpose of activating dendritic cells can have some side effects. Therefore, for example, in humans, they may not always be safe, especially for infants and the elderly. In other words, the people who can take such drugs are limited by their age and health condition. Therefore, there is a need for a dendritic cell activating composition that has fewer side effects than the aforementioned drugs and can be easily taken by a wide range of people regardless of age or other factors. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Special Publication No. 2003-502008 [Patent Document 2] Special Publication No. 2015-513401 [Patent Document 3] Special Publication No. 2021-531765 [Overview of the project] [Problems that the invention aims to solve]

[0005] The objective of this invention is to provide a dendritic cell activation composition that is highly safe and can be easily consumed. [Means for solving the problem]

[0006] To solve the above problems, the present inventors focused on extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria and investigated the effect of ingesting these extracellular polysaccharides on the activation of dendritic cells in humans and other subjects. As a result, they found that ingesting these extracellular polysaccharides in humans and other subjects can activate their dendritic cells, particularly plasmacytoid dendritic cells (pDCs) and conventional dendritic cells (cDCs), thus completing the present invention.

[0007] In other words, the present invention is as follows: (1) A composition for activating dendritic cells, comprising extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

[0008] (2) The dendritic cell activating composition described in (1), wherein the Lactobacillaceae lactic acid bacteria is a Lactobacillus genus lactic acid bacteria.

[0009] (3) The dendritic cell activation composition according to (2), wherein the Lactobacillus lactic acid bacteria is a Lactobacillus lactic acid bacterium having a 16S rRNA gene that has 95% or more sequence identity with the base sequence of Sequence ID No. 1 below. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0010] (4) The dendritic cell activating composition described in (2), wherein the Lactobacillus lactic acid bacterium is Lactobacillus delbrueckii subsp. bulgaricus.

[0011] (5) Lactobacillus delbrueckii subsp. bulgaricus is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741), the dendritic cell activation composition described in (4).

[0012] (6) A dendritic cell activating composition according to any one of (1) to (5), wherein the dendritic cells are plasmacytoid dendritic cells (pDCs).

[0013] (7) The composition for activating dendritic cells according to any one of (1) to (5), wherein the dendritic cells are conventional dendritic cells (cDC).

[0014] (8) The composition for activating dendritic cells according to (6), which increases the proportion of CD86-positive cells in plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

[0015] (9) The composition for activating dendritic cells according to (6), which increases the CD86 expression level of plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

[0016] (10) The composition for activating dendritic cells according to (6), which increases the HLA-DR expression level of plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

[0017] (11) The composition for activating dendritic cells according to (7), which increases the proportion of CD86-positive cells in conventional dendritic cells (cDC) in peripheral blood mononuclear cells (PBMC).

[0018] (12) The composition for activating dendritic cells according to any one of (1) to (11), further comprising bacterial cells of lactic acid bacteria of the Lactobacillaceae family.

[0019] (13) The composition for activating dendritic cells according to any one of (1) to (12), wherein the composition is fermented milk.

[0020] (14) A method for producing fermented milk for activating dendritic cells, comprising adding lactic acid bacteria of the Lactobacillaceae family that produce extracellular polysaccharides and Streptococcus thermophilus to a milk raw material, and fermenting the milk raw material.

[0021] (15) A method for producing fermented milk that activates dendritic cells of the target organism by adding Lactobacillaceae lactic acid bacteria that produce extracellular polysaccharides and Streptococcus thermophilus to a milk raw material and fermenting the milk raw material.

[0022] (16) A composition for promoting salivary SIgA secretion, comprising extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

[0023] (17) The composition for promoting salivary SIgA secretion according to (15), further comprising the cells of Lactobacillaceae lactic acid bacteria.

[0024] (18) A composition for promoting salivary SIgA secretion according to (16) or (17), which is due to dendritic cell activation.

[0025] Furthermore, the present invention also includes the following inventions. (19) A method for activating the dendritic cells of a subject in need of a composition containing extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

[0026] (20) Use of extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria that activate dendritic cells.

[0027] (21) Extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria, used as an active ingredient in a dendritic cell activating composition.

[0028] (22) Use of extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria for the manufacture of compositions that activate dendritic cells.

[0029] (23) A method for promoting SIgA secretion in the saliva of a subject in need of a composition containing extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

[0030] (24) Extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria, used as an active ingredient in a composition that promotes SIgA secretion in saliva.

[0031] (25) Use of extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria that promote SIgA secretion in the target saliva.

[0032] (26) Use of extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria for the production of a composition that promotes SIgA secretion in the saliva of a target.

[0033] (27) Use of extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria for the production of a dendritic cell activating composition that promotes SIgA secretion in the saliva of a target organism. [Effects of the Invention]

[0034] According to the present invention, a dendritic cell activation composition can be provided that is safer and easier to ingest than conventional methods. Furthermore, by administering this dendritic cell activation composition to a target that requires it, the dendritic cells of that target can be activated.

[0035] Incidentally, in recent years, upper respiratory tract infections (URTIs) have become one of the diseases that people commonly contract. Secretory immunoglobulin A (SIgA) in saliva is thought to act as an initial defense mechanism against URTIs. Therefore, it is known that a decrease in salivary SIgA secretion is associated with a higher incidence of URTIs. According to the present invention, it is possible to promote SIgA secretion in the saliva of subjects who ingest the above-mentioned salivary SIgA secretion promoting composition. Therefore, it is possible to reduce the incidence of URTIs in subjects who ingest the dendritic cell activation composition according to the present invention.

[0036] Based on the effects described above, the above-mentioned composition can maintain or improve the health of the subject who ingests it. [Brief explanation of the drawing]

[0037] [Figure 1] This graph shows the trend in the CD86 positivity rate of pDCs in the R-1 lactic acid bacteria intake group and the placebo intake group. [Figure 2] This graph shows the trend in the CD86 positivity rate of cDCs in the R-1 lactic acid bacteria intake group and the placebo intake group. [Figure 3] This graph shows the changes in salivary SIgA concentration in the R-1 lactic acid bacteria intake group and the placebo intake group. [Figure 4] This graph shows the expression level of CD86 in pDCs mediated by R1-EPS. [Figure 5] This graph shows the HLA-DR expression level of pDCs as determined by R1-EPS. [Modes for carrying out the invention]

[0038] The composition according to the embodiment of the present invention contains extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria and has the function of activating dendritic cells. Furthermore, the composition according to the embodiment of the present invention can promote SIgA secretion in saliva. It is preferable that this composition be fermented milk. The definitions of each term in the present invention will be described in detail below.

[0039] 1. Lactobacillaceae family lactic acid bacteria Lactobacillaceae lactic acid bacteria are classified according to the classifications described in Reference 4 below, unless otherwise specified.

[0040] Reference 4: Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858

[0041] Specifically, the Lactobacillaceae family includes the genera Lactobacillus, Paralactobacillus, Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacillus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, and Della The genera glioa, Liquorilactobacillus, Ligilactobacillus, Lactiplantibacillus, Furfurilactobacillus, Paucilactobacillus, Limosilactobacillus, Fructilactobacillus, Acetilactobacillus, Apilactobacillus, Levilactobacillus, Secundilactobacillus, Lentilactobacillus, and Pediococcus They are classified into 31 genera: Convivina, Leuconostoc, Fructobacillus, Oenococcus, and Weissella.Furthermore, in the embodiments of the present invention, it is preferable to include extracellular polysaccharides produced from the genus Lactobacillus.

[0042] 1-1. Lactobacillus genus lactic acid bacteria Sequence ID 1, shown in the following sequence listing, represents the sequence of the V1-V3 region of the 16S rRNA gene of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (corresponding to the nucleotide sequence from position 34 to 535 in the full-length sequence of the 16S rRNA gene) (sometimes referred to as the "nucleotide sequence"). The Lactobacillus lactic acid bacteria according to the embodiments of the present invention is a general term for all bacteria that have been taxonomically recognized as belonging to the genus Lactobacillus, and is not limited to bacterial species or strains. Lactobacillus lactic acid bacteria can be classified as either plant-derived or animal-derived depending on their origin, but in the present invention, either plant-derived or animal-derived lactic acid bacteria can be used. The strain of Lactobacillus lactic acid bacteria of the present invention is preferably one or more strains belonging to the Lactobacillus genus that can prepare fermented milk (e.g., yogurt) with a sufficient history of consumption. Such Lactobacillus lactic acid bacteria are preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 95% or more sequence identity with the base sequence of Sequence ID No. 1 (i.e., all or a characteristic part of the sequence of the 16S rRNA gene (V1 region, V2 region, V3 region, or all or part of the V1, V2, and V3 regions, or a part including the V1, V2, and V3 regions, etc.)), more preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 98% or more sequence identity with the base sequence of Sequence ID No. 1, and even more preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 99% or more sequence identity with the base sequence of Sequence ID No. 1.

[0043] (Sequence Listing) <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0044] In embodiments of the present invention, sequence identity refers, unless otherwise specified, to the ratio of matching bases shared between two sequences when they are optimally aligned. Analysis of base sequence identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. Specific methods for these analysis methods are also well known to those skilled in the art. Commercially available genetic information processing software may be used for calculating identity.

[0045] Additionally, strains possessing the same mycological properties as Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (hereinafter sometimes referred to as "this strain") can also be used. Its mycological properties are as follows:

[0046] (1) Morphological properties Cell shape: rod-shaped bacteria Mobility: None Presence or absence of spores: None Gram staining: Positive

[0047] (2) Growth status on the culture medium The bacterial strain was spread on a BL agar plate (Eiken Chemical) and incubated at 37°C for 48 hours using the steel wool method, resulting in the appearance of opaque, rough-type colonies.

[0048] (3)Physiological properties Nitrate reduction: Negative Indole production: Negative Gelatin liquefaction: Negative Catalase: Negative Attitude towards oxygen: facultative anaerobic D(-) lactic acid is produced from glucose via homolactic fermentation. Growth in BL liquid medium, which does not produce gas, is negative at 10°C and positive at 45°C. Arginine degradation: Negative Gas production from malic acid: Negative Degradability of various carbohydrates (positive +, negative -) Arabinose - Xylose - Ramnos - Ribose - Glucose + Mannose + Fructose + Galactose - Shoe Cloth - Maltose - Cellobios - Lactose + Trehalose - Meribios - Raffinose - Meletitose - Dextrin - Starch - Glycogen - Inulin - Mannitol - Sorbitol - Inositol - Esculin - Salicin -

[0049] (4) Polysaccharide productivity This strain is characterized by its polysaccharide production ability, producing extracellular polysaccharides composed of galactose and glucose, and containing phosphorus.

[0050] In addition to this strain, other Lactobacillus species of the Lactobacillus family that produce polysaccharides containing galactose and glucose as constituent sugars extracellularly include Lactiplantibacillus plantarum C88 (see Reference 5), Lactobacillus johnsonii strain 151 (see Reference 6), L. delbrueckii subsp. bulgaricus NCFB2074 (see Reference 7), Lacticaseibacillus casei CG11 (see Reference 8), Lacticaseibacillus rhamnosus E / N (see Reference 9), Lactobacillus fermentum TDS030603 (see Reference 10), and Lactobacillus gasseri FR4 (see Reference 11). In the embodiments of the present invention, the composition preferably contains an extracellular polysaccharide produced by Lactobacillaceae lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars extracellularly, more preferably contains an extracellular polysaccharide produced by Lactobacillaceae lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars extracellularly, and particularly preferably contains an extracellular polysaccharide produced by Lactobacillaceae lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars (preferably galactose and glucose as constituent sugars) and phosphorus extracellularly.

[0051] Reference 5: Zhang, L., Liu, C., Li, D., Zhao, Y., Zhang, X., Zeng, X., Yang, Z., Li, S., 2013. Antioxidant activity on exopolysaccharide isolated from Lactobacillus plantarum C88. Int. J. Biol. Macromol. 54, 270-275. Table 6:Gorska-Froczek, S., Sandstrom, C., Kenne, L., Paociak, M., Brzozowska, E., Strus, M., Heczko, P., Gamian, A., 2013. Structure and immunoreactivity of exopolysaccharide isolated from Lactobacillus johnsonii strain 151. Carbohydr. Res. 378 , 148–153 . Table 7:Harding, LP, Marshall, VM, Hernandez, Y., Gu, Y., Maqsood, M., Mclay, N., Laws, AP, 2005. Structural characterization of a highly branched exopolysaccharide produced by Lactobacillus delbrueckii ssp. bulgaricus NCFB2074. Carbohydr. Res. 340, 1107–1111. Table 8:JCMC Cerning, CMGC Renard, JF Thibault, C Bouillanne, M Landon, M Desmazeaud & L Topisirovic: Appl. Approx. Microbiol., 60, 3914 (1994). Introduction to 9:M. Polak-Berecka, A. Wasko, D. Szwajgier & A. Choma: Pol. J. Microbiol., 62, 181 (2013). Entertainment 10:K. Fukuda , T. Shi , K. Nagami , F. Leo , T. Nakamura , K. Yasuda , A. Senda , H. Motoshima & T. Urashima : Carbohydr. Polym., 79, 1040 (2010). Reference 11: International Journal of Biological Macromolecules, Volume 109, 1 April 2018, Pages 772-783.

[0052] The extracellular polysaccharide according to the embodiment of the present invention is preferably produced from Lactobacillus lactic acid bacteria, more preferably from Lactobacillus delbrueckii, even more preferably from Lactobacillus delbrueckii subsp. bulgaricus, and particularly preferably from Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (deposit number: FERM BP-10741) lactic acid bacteria (i.e., OLL1073R-1 strain).

[0053] Furthermore, the extracellular polysaccharide referred to herein is not particularly limited as long as it has the desired effect, but it is preferable that it is produced by fermenting raw milk (preferably a raw material containing milk as defined in the Ministerial Ordinance on Milk, etc.) with the lactic acid bacteria described above. The extracellular polysaccharide used in the embodiments of the present invention may be one type or a combination of two or more types. Furthermore, it is preferable that this extracellular polysaccharide contains phosphorylated polysaccharide. Furthermore, this extracellular polysaccharide may also contain non-phosphorylated polysaccharide, but it is preferable that the non-phosphorylated polysaccharide does not contain sulfated polysaccharide.

[0054] Furthermore, "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1" is deposited with the Patent Organism Depository Center of the National Institute of Advanced Industrial Science and Technology (AIST) under deposit number FERM BP-10741 (deposit date: November 29, 2006).

[0055] 2. Dendritic cells Dendritic cells are one type of cell found in peripheral blood mononuclear cells (PBMCs), and are broadly classified into classical dendritic cells (conventional dendritic cells, cDCs) and plasmacytoid dendritic cells (pDCs). The compositions according to the embodiments of the present invention activate cDCs and pDCs, as described in the examples below. CD86 and HLA-DR are known as indicators (activation markers) to confirm the activation of cDCs and pDCs. The degree of activation of cDCs or pDCs can be confirmed by checking the positive rate or expression level of CD86, or the expression level of HLA-DR, in cDCs or pDCs. The positive rate or expression level of CD86 and the expression level of HLA-DR can be confirmed by the methods described in the examples below.

[0056] 3. Secretory immunoglobulin A (SIgA) Secretory immunoglobulin A (SIgA) is primarily found in mucosal secretions such as saliva, respiratory secretions, tears, and breast milk. SIgA exhibits various activities, including virus neutralization, bacterial agglutination, prevention of bacterial adhesion to mucosal epithelial cells, and binding to various food allergens. These activities allow SIgA to inhibit the invasion of pathogenic microorganisms into the mucous membranes, and it is known to be particularly effective against upper respiratory tract infections (URTIs). Therefore, promoting SIgA secretion in saliva can reduce the incidence of URTIs.

[0057] 4. Composition Furthermore, the term "composition" as used herein includes preparations such as liquid foods, pharmaceuticals, supplements, and food additives, as well as food and beverages (excluding plants and animals themselves) and food and beverage compositions (including processed food and beverages), and other substances that can be ingested by animals (including humans). Food and beverages may also include fermented milk (yogurt).

[0058] As described above, the composition according to the embodiment of the present invention contains extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria. Extracellular polysaccharides are a type of metabolite produced by the culture and fermentation of these lactic acid bacteria. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (deposit number: FERM BP-10741) (hereinafter sometimes referred to as "R-1 lactic acid bacteria"), a lactic acid bacterium of the genus Lactobacillus, is known to produce extracellular polysaccharides (hereinafter, extracellular polysaccharides are sometimes referred to as "EPS," and in particular, extracellular polysaccharides produced from R-1 lactic acid bacteria are sometimes referred to as "R1-EPS") during its culture, and the composition according to the embodiment of the present invention contains these extracellular polysaccharides as an active ingredient. In the compositions according to embodiments of the present invention, the lower limit of the daily intake of these extracellular polysaccharides is 10 μg, preferably 15 μg, more preferably 25 μg, even more preferably 100 μg, even more preferably 200 μg, particularly preferably 500 μg, even more preferably 1.0 mg, even more preferably 2.0 mg, and even more preferably 3.0 mg. The upper limit is not particularly limited, but for example, it is 200 mg, preferably 100 mg, more preferably 70 mg, even more preferably 30 mg, even more preferably 8.0 mg, and particularly preferably 5.0 mg. In the compositions according to embodiments of the present invention, the range of the daily intake of the extracellular polysaccharides can be freely set by combining the above upper and lower limits.

[0059] In the production of the composition of the present invention, the stage of incorporating the extracellular polysaccharide can be appropriately selected. The stage of incorporation is not particularly limited as long as the properties of the extracellular polysaccharide are not significantly impaired. For example, a culture containing extracellular polysaccharide obtained by culturing Lactobacillaceae lactic acid bacteria that produce extracellular polysaccharides, or a crude or purified product thereof, can be mixed with the raw materials and incorporated.

[0060] The composition according to the embodiment of the present invention may include not only the bacterial cells themselves, but also those derived from bacterial cells such as disrupted bacterial cell products. When the composition according to the embodiment of the present invention is used as a composition for activating dendritic cells, the effective amount (intake) of lactic acid bacteria for a human per day is preferably 1×10 5 cells or more and 5×10 10 cells or less, more preferably 1×10 6 cells or more and 5×10 10 cells or less, even more preferably 1×10 7 cells or more and 5×10 10 cells or less, still more preferably 2×10 7 cells or more and 1×10 9 cells or less, particularly preferably 2×10 7 cells or more and 3×10 8 cells or less. It is desirable that the lactic acid bacteria according to the embodiment of the present invention may be viable bacteria or dead bacteria, and are preferably viable bacteria. In addition, these upper limit values and lower limit values can be freely combined.

[0061] In addition, when the composition according to the embodiment of the present invention is used as a composition for promoting SIgA secretion in saliva, the effective amount (intake) of lactic acid bacteria for a human per day is preferably 1×10 5 cells or more and 5×10 10 cells or less, more preferably 1×10 6 cells or more and 5×10 10 cells or less, even more preferably 1×10 7 cells or more and 5×10 10 cells or less, still more preferably 2×10 7 cells or more and 1×10 9 cells or less, particularly preferably 2×10 7 cells or more and 3×10 8 cells or less. It is desirable that the lactic acid bacteria according to the embodiment of the present invention may be viable bacteria or dead bacteria, and are preferably viable bacteria.

[0062] Furthermore, commercially available products containing the lactic acid bacteria in the embodiments of the present invention may be used for convenience. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (accession number: FERM BP-10741) can be isolated from "Meiji Probio Yogurt R-1" sold by Meiji Co., Ltd. When Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 in the embodiments of the present invention is ingested together with other ingestible components, there are no restrictions on the other ingestible components, but dairy components are preferably used, for example. Dairy components refer to milk (animal milk) itself or compositions containing milk components derived from processed milk. This includes all components containing milk components, such as raw milk (cow's milk, etc.), reconstituted milk (powdered milk, cream, butter), fermented milk (yogurt, cheese), and dairy preparations (whey, casein, lactose, whey minerals, permeate), and their origin and form are not particularly limited.

[0063] When the compositions according to the embodiments of the present invention are used for dendritic cell activation, from the viewpoint of enhancing the dendritic cell activation effect, it is preferable to ingest them continuously for one day or more, more preferably for three days or more, more preferably for one week or more, more preferably for two weeks or more, even more preferably for three weeks or more, even more preferably for six weeks or more, even more preferably for eight weeks or more, even more preferably for twelve weeks or more, even more preferably for sixteen weeks or more, and particularly preferably for twenty weeks or more.

[0064] Furthermore, when the compositions according to the embodiments of the present invention are used as compositions for promoting SIgA secretion in saliva, from the viewpoint of enhancing the effect of promoting SIgA secretion in saliva, it is preferable to ingest them continuously for 5 days or more, more preferably for 1 week or more, even more preferably for 2 weeks or more, even more preferably for 4 weeks or more, even more preferably for 5 weeks or more, even more preferably for 8 weeks or more, even more preferably for 12 weeks or more, even more preferably for 16 weeks or more, and particularly preferably for 20 weeks or more.

[0065] The compositions according to embodiments of the present invention may be in the form of single-serving unit packaging, and each unit packaging may also contain an effective extracellular polysaccharide.

[0066] For example, it is preferable that the active ingredient, extracellular polysaccharide, be included in each unit package so that it is ingested in the range of 1 μg / g to 1000 μg / g, more preferably in the range of 10 μg / g to 800 μg / g, even more preferably in the range of 50 μg / g to 500 μg / g, even more preferably in the range of 100 μg / g to 500 μg / g, and even more preferably in the range of 200 μg / g to 400 μg / g, and 250 μg / g to 350 μg / g. Note that these upper and lower limits can be freely combined.

[0067] When packaging a composition according to an embodiment of the present invention per unit package, known packaging can be used. For example, there are no particular limitations, such as paper, plastic, glass, nylon, stainless steel, aluminum, iron, copper, silver, or bamboo. However, considering that lactic acid bacteria are facultative anaerobic bacteria, it is preferable to use a form that does not come into contact with air or oxygen. For example, it is preferable to include a step in the manufacturing process or packaging process of the composition according to the embodiment of the present invention to eliminate the possibility of contact with oxygen, and it is preferable to select a packaging material that does not allow oxygen to permeate into the packaging during storage after packaging.

[0068] The compositions according to embodiments of the present invention are not particularly limited in terms of the route of intake, but are preferably taken orally. Furthermore, the form in which the compositions are taken orally is not particularly limited, but it is particularly preferred that they be taken orally as "fermented milk".

[0069] Furthermore, the form of intake of the composition according to the embodiments of the present invention is not limited to the "fermented milk" described above, but may also be, for example, chocolate, jelly, ice cream, frozen dessert, beverage, chewable tablet, tablet, gummy, cheese, spread, health food (nutrient functional food, food for specified health uses, nutritional supplement, functional food, supplement, etc.), pharmaceutical, quasi-drug, etc. Also, in the present invention, "functional food" includes health foods to which a health claim based on the food standards of Codex Alimentarius (FAO / WHO Joint Food Standards Committee) applies.

[0070] 5. Fermented milk As described above, the compositions according to the embodiments of the present invention are preferably consumed as "fermented milk." Fermented milk according to the embodiments of the present invention refers to milk (animal milk) that has been fermented, as described above, and includes, but is not limited to, "fermented milk," "lactic acid bacteria beverage," "milk beverage," and "natural cheese" as defined in the Ministerial Ordinance on Standards for Ingredients of Milk and Dairy Products (Milk and Dairy Products Ordinance). For example, fermented milk refers to, but is not limited to, "fermented milk" as defined in the Milk and Dairy Products Ordinance, that is, milk such as raw milk, cow's milk, special milk, raw goat's milk, pasteurized goat's milk, raw sheep's milk, adjusted milk, low-fat milk, non-fat milk, and processed milk, or milk containing an equivalent or greater amount of non-fat milk solids, which is fermented with lactic acid bacteria or yeast and made into a solid (hard type), paste (soft type), or liquid (drink type), or frozen, or the same.

[0071] The fermented milk according to the embodiments of the present invention can be produced by mixing a culture containing extracellular polysaccharides, its crude or refined product, with raw materials or fermented milk after fermentation. Alternatively, the fermented milk according to the embodiments of the present invention can also be produced by adding lactic acid bacteria that produce extracellular polysaccharides as a starter to raw milk and fermenting it to induce the production of extracellular polysaccharides from the lactic acid bacteria. These fermented milks contain extracellular polysaccharides.

[0072] In the fermented milk according to the embodiment of the present invention, the range of non-fat milk solids concentration is preferably, for example, 4.0% by mass or more and 12.0% by mass or less, more preferably 6.0% by mass or more and 10.0% by mass or less, and even more preferably 7.0% by mass or more and 9.0% by mass or less. Furthermore, the milk fat concentration is preferably, for example, 0.2% by mass or more and 4.0% by mass or less, more preferably 0.3% by mass or more and 3.0% by mass or less, and even more preferably 0.4% by mass or more and 2.0% by mass or less.

[0073] A typical example of fermented milk is yogurt. The international standard defined by the Food and Agriculture Organization of the United Nations (FAO) / World Health Organization (WHO) also defines "yogurt" as "a product made from milk and dairy products such as skim milk powder by the lactic acid fermentation of both Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus bacteria, in which a large amount of the aforementioned two bacteria survive in the final product." In the present invention, "yogurt" encompasses the yogurt defined by the FAO / WHO. This yogurt includes, for example, plain yogurt, hard yogurt (set-type yogurt), soft yogurt, and drinkable yogurt. As for the yogurt according to the embodiment of the present invention, hard yogurt is particularly preferred from the viewpoint of satiety and texture. Furthermore, if the target is elderly, hard yogurt is particularly preferred from the viewpoint of preventing aspiration.

[0074] An example of a method for preparing fermented milk according to an embodiment of the present invention is "a method in which raw milk is sterilized and cooled, a lactic acid bacteria starter containing the above-mentioned lactic acid bacteria is added to the raw milk, and the raw milk containing the lactic acid bacteria starter is fermented at a fermentation temperature and for a fermentation time such that a predetermined lactic acid acidity is achieved." Extracellular polysaccharides are produced by Lactobacillaceae lactic acid bacteria during fermentation. In this method, the lactic acid acidity is, for example, 0.6 to 1.2. Preferably, the lactic acid acidity is 0.6 to 0.8. The fermentation temperature is, for example, 40 to 45°C. The fermentation time is, for example, 2 to 12 hours. Preferably, the fermentation time is 3 to 8 hours.

[0075] From the viewpoint of production efficiency and palatability, it is preferable to use Streptococcus genus lactic acid bacteria or Streptococcus thermophilus as a lactic acid bacteria starter in combination with Lactobacillaceae lactic acid bacteria. Furthermore, if the Lactobacillaceae lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (deposit number: FERM BP-10741), it is more preferable that the Thermophilus bacteria be Streptococcus thermophilus 1131 or Streptococcus thermophilus OLS3059. Streptococcus thermophilus OLS3059 is deposited with the Patent Organism Depository Center of the National Institute of Advanced Industrial Science and Technology (AIST) under deposit number FERM BP-10740 (deposit date: November 29, 2006). Streptococcus thermophilus 1131 can be obtained from Meiji Bulgaria Yogurt "LB81 (registered trademark)" manufactured by Meiji Co., Ltd.

[0076] Furthermore, lactic acid bacteria other than Lactobacillaceae and Streptococcus species, as well as fermentation microorganisms such as bifidobacteria and yeast, may be added as a lactic acid bacteria starter or for the purpose of imparting functionality, or they may not be included.

[0077] The fermented milk according to the embodiment of the present invention can be easily consumed. Furthermore, fermented milk has a long history of safe consumption and is free from concerns about side effects, so consumers can consume it with peace of mind.

[0078] By packaging the fermented milk according to the embodiment of the present invention in an appropriate amount for a single serving, it becomes possible to consume the fermented milk according to the embodiment of the present invention appropriately and easily, which is preferable from the standpoint of usability. Although the appropriate amount for a single serving varies from person to person, in the case of fermented milk with a non-fat milk solids content of 8.0% by mass, it is preferable that the amount per serving is in the range of 10 mL to 1000 mL, more preferably in the range of 30 mL to 500 mL, even more preferably in the range of 50 mL to 200 mL, and preferably 80 mL to 120 mL. Alternatively, it is preferable that the amount per serving is in the range of 10 g to 1000 g, more preferably in the range of 30 g to 500 g, more preferably in the range of 50 g to 200 g, more preferably in the range of 80 g to 150 g, and even more preferably in the range of 100 g to 120 g.

[0079] In embodiments of the present invention, the "individual packaging form" encompasses all forms, such as common packaging forms including containers with lids, bottles with caps, individual bags, pouches, and tubes. In embodiments of the present invention, the uses of the fermented milk according to the embodiments of the present invention can be clearly indicated by including a description of the uses, effects, and methods of consumption of the fermented milk according to the embodiments of the present invention in each individual package, or in a package including multiple individual packages, and / or by enclosing a document containing such a description, and / or by displaying a separate pamphlet or other document containing such a description.

[0080] The fermented milk according to the embodiment of the present invention is preferably consumed continuously for 3 days or more, preferably for 5 days or more, preferably for 1 week or more, preferably for 2 weeks or more, preferably for 4 weeks or more, more preferably for 6 weeks or more, even more preferably for 8 weeks or more, even more preferably for 10 weeks or more, even more preferably for 12 weeks or more, even more preferably for 24 weeks or more, and particularly preferably for 36 weeks or more, from the viewpoint of enhancing the dendritic cell activation effect. The fermented milk according to the embodiment of the present invention has a sufficient history of safe consumption and can be consumed safely, so there is no particular upper limit on the period of consumption, and it can be continued indefinitely. However, if an upper limit is to be set, it would be, for example, 60 weeks or less. This upper limit may also be, for example, 120 weeks or less, 100 weeks or less, or 80 weeks or less. Oral intake is preferred as the method of consumption.

[0081] Furthermore, the fermented milk according to the embodiment of the present invention is preferably consumed continuously for 5 days or more, more preferably for 1 week or more, even more preferably for 2 weeks or more, even more preferably for 4 weeks or more, even more preferably for 5 weeks or more, even more preferably for 8 weeks or more, even more preferably for 12 weeks or more, even more preferably for 16 weeks or more, and particularly preferably for 20 weeks or more, from the viewpoint of enhancing the effect of promoting SIgA secretion in saliva.

[0082] Incidentally, it is preferable to display a description of the composition according to the embodiment of the present invention, such as its use, efficacy, function, type of active ingredient, and method of use. The term "display" as used herein includes all displays that inform consumers of the above-mentioned effects. This display only needs to be one that can evoke or infer the above-mentioned content, and may include all displays regardless of the purpose of the display, the content of the display, or the object or medium on which it is displayed. Specifically, the term "display" as used herein includes displaying the above-mentioned explanation on the product packaging or container, displaying or distributing the above-mentioned explanation on advertisements, price lists or transaction documents related to the product, providing information containing these by electromagnetic means (such as the internet), and sales talk. The term "display" as used herein also includes displays that recommend the consumption of the composition according to the embodiment of the present invention for a specific target, so-called "notifications (including notifications from meal management apps, nutrition management apps, healthcare apps, etc.)."

[0083] Products packaged with a composition according to an embodiment of the present invention preferably bear labels such as, for example, "activates dendritic cells," "maintains dendritic cell activity," "reduces the risk of decreased dendritic cell activity," "acts on dendritic cells," "easily activates dendritic cells," "easily maintains dendritic cell activity," "for dendritic cell activation," "for maintaining dendritic cell activity," and "activates dendritic cells, the command center of the immune system." A duration such as "temporary" or "long-term" may be added to the beginning of each of these statements as appropriate.

[0084] Furthermore, it is preferable that products packaged with a composition according to an embodiment of the present invention may be labeled with phrases such as "promotes SIgA secretion in saliva," "easily promotes SIgA secretion in saliva," or "for promoting SIgA secretion in saliva," in addition to the examples described above.

[0085] Furthermore, the wording used to display such information is not limited to the examples given above; any wording that has a similar meaning is acceptable.

[0086] Furthermore, the above-mentioned compositions can also be made into foods for special dietary uses, complete nutritional foods, nutritional supplements, foods for specified health uses, foods with functional claims, processed foods, etc.

[0087] In embodiments of the present invention, the composition may contain other ingestible components, various additives, pharmaceutical raw materials, etc., as components other than lactic acid bacteria.

[0088] Furthermore, the fermented milk described above can also be made into special-use foods, complete nutritional foods, nutritional supplements, foods for specified health uses, foods with functional claims, processed foods, etc. It can also be incorporated into compositions of beverages other than drinkable yogurt, liquid foods, etc. Additionally, it can be used after drying, concentration, or other processing.

[0089] The compositions or fermented milk according to embodiments of the present invention are suitable for ingestion or administration to subjects for whom dendritic cell activation is desirable. There are no particular limitations on the subjects referred to herein, but if we were to give specific examples, they would include subjects who wish to maintain their health, subjects who are aware of having a weak constitution, subjects who are aware of nonspecific symptoms, and subjects who wish to obtain the effect of dendritic cell activation (including healthy individuals and sick individuals).

[0090] The present invention will be described in more detail below based on examples. These examples are not intended to limit the present invention. [Examples]

[0091] In this example, two validations were conducted: (A) a randomized, placebo-controlled, double-blind, parallel-group comparative study, and (B) an evaluation study of pDC activity using human peripheral blood mononuclear cells.

[0092] (A) Randomized, placebo-controlled, double-blind, parallel-group comparative trial 1. About the test food and the control food (1) Test food As the test food, we used yogurt containing Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 (FERM BP-10741) (hereinafter sometimes referred to as "R-1 lactic acid bacteria") (cup-type yogurt with a net content of 112g per serving).

[0093] The R-1 lactic acid bacteria-containing yogurt, which was the test food, was manufactured by fermenting raw milk, skim milk powder, sugar, stevia, raw water, and dairy ingredients containing R-1 lactic acid bacteria with Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 and Streptococcus thermophilus OLS3059 (accession number: FERM BP-10740). The nutritional components of the yogurt were 89kcal of energy, 3.9g of protein, 3.4g of fat, and 10.8g of carbohydrates. The R1-EPS content of the test food was 3.3mg or more. Furthermore, the number of R-1 lactic acid bacteria and the total number of lactic acid bacteria in the test food were measured by pour plate culture and confirmed to be within the standard range for fermented milk set by the Ministry of Health, Labour and Welfare. In addition, the test food contained 1.0 × 10⁶ R-1 lactic acid bacteria. 6 It must contain cfu / g or more, and Streptococcus thermophilus OLS3059 (hereinafter sometimes referred to as "OLS3059 strain") in a quantity of 1.0 × 10 7 It was confirmed that the sample contained more than cfu / g. In addition, the number of R-1 lactic acid bacteria and OLS3059 strains in the test food was confirmed by direct microscopy, and each was found to be 2.0 × 10⁶. 7 It was found that the cell count was ≥ cells / g. The presence of EPS in the R-1 lactic acid bacteria-containing yogurt, the test food, was confirmed by the phenol-sulfuric acid method. Streptococcus thermophilus OLS3059 (accession number: FERM BP-10740) was used to satisfy the requirements for yogurt in the Codex standard and to promote yogurt fermentation.

[0094] (2) Control food As a control food (placebo), an acidic milk was used that did not contain lactic acid bacteria, but was made by adding thickeners, flavorings, and lactic acid to the same ingredients as the test food to achieve equivalent flavor, physical properties, acidity, and nutritional content.

[0095] The control food (placebo), acidic milk, was prepared by adding thickeners, flavorings, and lactic acid to raw milk, skim milk powder, sugar, stevia, raw water, and milk ingredients (same ingredients as the test food) that did not contain R-1 lactic acid bacteria, to achieve the same flavor, physical properties, acidity, and nutritional components as the test food. Since the control food (placebo) is acidic milk with the above composition, it is clear that it does not contain EPS. Furthermore, it was confirmed that the control food (placebo) was coliform-negative and had a total bacterial count of 10 cfu / g or less.

[0096] Furthermore, it was confirmed by a third party not directly involved in the study that the test food and the control food (placebo) were indistinguishable.

[0097] (3) Packaging The products were packaged in plain white paper cups (with barriers) sealed with aluminum lids.

[0098] (4) Safety The test food and control food were manufactured using the following raw materials, and their safety was deemed to be unquestionable.

[0099] 1. Test food (a) Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 (FERM BP-10741) is a bacterial strain used in "Meiji Probio Yogurt R-1 (registered trademark)," which has been on the market since 2009. Yogurt containing this strain has a proven track record of sales since its launch in 2009, and no serious side effects attributed to this product have been reported in the past.

[0100] (b) Other raw materials and food additives Raw milk, skim milk powder, sugar, and stevia are used as commonly available food ingredients and food additives, in compliance with the usage standards stipulated by the Food Sanitation Act.

[0101] 2. Control food (placebo) (a) Acidic milk The thickeners, flavorings, and lactic acid used are those commonly available in food products and food additives, and are used in compliance with the usage standards stipulated by the Food Sanitation Act.

[0102] (b) Other raw materials and food additives Raw milk, skim milk powder, sugar, and stevia are used as commonly available food ingredients and food additives, in compliance with the usage standards stipulated by the Food Sanitation Act.

[0103] (5) How to save The test foods were stored by refrigeration at 10°C or below.

[0104] 2. Details of this exam As described above, this study was conducted as a randomized, placebo-controlled, double-blind, parallel-group comparative trial. The purpose of this study was to obtain data on dendritic cell activation in subjects before (week 0), 2 weeks after ingestion, and 4 weeks after ingestion of the test food, as well as data on the promotion of salivary SIgA secretion. Data on dendritic cell activation was obtained by testing the CD86 positivity rate of pDCs and cDCs. In addition, this study also evaluated the promotion of salivary SIgA secretion. The conditions of this study are described in detail below.

[0105] (1) Subjects Healthy Japanese men and women aged 35 to under 60 at the time of obtaining consent were selected as subjects according to the following criteria. In addition, the results of a screening test (hereinafter referred to as the "SCR test") conducted on 224 candidate subjects were given full consideration in the selection of subjects. The SCR test included a questionnaire on selection and exclusion criteria, measurement of blood pressure and pulse rate, measurement of height and weight, a medical interview by a physician, hematological tests, blood biochemistry tests, and infectious disease tests to determine health status.

[0106] The selection and exclusion criteria for participants were as follows:

[0107] <Selection Criteria> a) Those who have received a full explanation of the purpose and content of this examination, have the capacity to give consent, fully understand it, and apply of their own free will, and who have given written consent to participate. b) Those who selected "tired" once or more in question 26 of the "POMS2" section of the SCR test, AND selected a value of 3 or less for question 9 of the "SF-36v2" section, "Did you feel tired?" (i.e., those who feel tired). <Exclusion criteria> a) Individuals suffering from serious illnesses such as diabetes, kidney or liver disease, heart disease, thyroid disease, adrenal disease, or other metabolic diseases, those currently undergoing treatment, or those with a history of such illnesses. b) Individuals with chronic diseases who regularly take medication. c) Individuals with a history or current medical history of drug addiction or alcohol addiction. d) Individuals who have been regularly using (3 or more days a week) yogurt, lactic acid bacteria beverages or other lactic acid bacteria-containing foods, foods for specified health uses, nutritional functional foods, health foods, or supplements for the past month or more. e) Individuals whose normal alcohol consumption exceeds 1000 mL of beer (5% alcohol equivalent) per day (equivalent to 40 g of alcohol). f) Those who cannot abstain from alcohol for one day prior to each SCR test. g) Those who selected 1 in question 9 of the SF-36v2 SCR test, "A) Were you full of energy?" (i.e., those who were full of energy) h) Those who smoke i) Anyone who has visited a medical institution due to hay fever within the past year, or who plans to take prescription medication for the treatment or prevention of hay fever during the examination period. j) Individuals with digestive diseases affecting digestion and absorption, or a history of digestive surgery. k) Those who have dental or oral problems involving bleeding and are expected to have these symptoms persist until the end of the exam period. l) Those who wish to receive the influenza vaccine during the examination period m) Individuals whose hemoglobin levels in the blood test performed for SCR testing are 12 g / dL or less for men and 11 g / dL or less for women. n) Individuals who test positive in infectious disease tests performed as part of SCR testing. o) Pregnant individuals, those planning or hoping to become pregnant during the exam period, and those who are breastfeeding. p) People who are prone to diarrhea after consuming dairy products q) Persons who have declared that they have food allergies r) Individuals who have participated in other clinical trials or monitoring studies within one month prior to the SCR test, or who have plans or wishes to participate in other clinical trials or monitoring studies during the study period. s) Other persons whom the principal investigator deems unsuitable as research subjects.

[0108] (2) Assignment and blinding of subjects For this study, the allocation of participants to the test food intake group was performed by the allocation supervisor, who referred to a list of 110 registered healthy adults selected as subjects, stratified them by age and sex, and then randomly allocated them to either the R-1 lactic acid bacteria intake group (55 participants) or the placebo intake group (55 participants). During this process, care was taken to ensure that factors such as "fatigue and stress levels (POMS, SF-36 scores)," "presence or absence of night shift work," and "presence or absence of exercise habits," as assessed by the SCR test conducted before the start of the study, were as equal as possible between the groups. Furthermore, a person responsible for managing the test food (different from the allocation supervisor), who was not directly involved in the study, assigned unique numbers (test food identification numbers) to the test food and placebo, created a test food identification sheet listing the combinations of test food and test food identification numbers, sealed it, and stored it. The allocation supervisor arbitrarily assigned test food identification numbers to each group, created an allocation decision document listing the combinations of test food identification numbers and subject numbers, sealed it, and stored it. The tables containing the allocation results, the test food identification tables, and the allocation decision documents were kept strictly confidential by the allocation supervisor, the test food allocation supervisor, and the test food management supervisor, without being disclosed to any third party until the key was opened, thus maintaining blindness.

[0109] (3) Background of the subjects As described above, SCR testing was performed on 224 candidate subjects who gave their consent. Of these, 89 were deemed unsuitable based on the selection and exclusion criteria, and 10 withdrew from the study. From the remaining 125, 110 were selected as subjects for this study and randomly assigned to either the R-1 lactic acid bacteria intake group or the placebo intake group, with 55 subjects in each group. During the study period, one subject withdrew from each group, leaving 54 subjects in each group to complete the study. The intake rate of R-1 lactic acid bacteria-containing yogurt or acidic milk (hereinafter, these two foods may be collectively referred to as "test foods") among the subjects who completed the study was 99.9 ± 0.1% in both groups. Four subjects in the R-1 lactic acid bacteria intake group and one subject in the placebo intake group were excluded from the analysis because the principal investigator determined that their use of nonsteroidal anti-inflammatory drugs or synthetic corticosteroids would affect the evaluation of efficacy. The following describes the missing data. In one participant in the R-1 lactic acid bacteria intake group, blood was found in the saliva sample collected at the 2-week follow-up examination. Therefore, the values ​​for SIgA concentration and secretion rate in the saliva at the 2-week follow-up examination were recorded as missing data. In addition, in one participant in the placebo intake group, blood and saliva samples could not be collected due to the participant's circumstances. Therefore, the values ​​for dendritic cell activity, SIgA concentration, and secretion rate in the saliva at the 4-week follow-up examination were recorded as missing data. Furthermore, in one participant in the placebo intake group, the value for dendritic cell activity was recorded at the 4-week follow-up examination due to an insufficient number of PBMCs.

[0110] (4) Method of intake Participants in the R-1 lactic acid bacteria intake group consumed yogurt containing R-1 lactic acid bacteria, while participants in the placebo intake group consumed one serving (112g / serving) of acidic milk daily for four weeks (participants were free to choose the time to consume the test food). However, participants did not consume the test food on the day of the examination, but only after the examination was completed.

[0111] (5) Evaluation Method Dendritic cell (pDC and cDC) activation was evaluated by testing the CD86 positivity rate of pDCs and cDCs. In addition to these evaluations, the promotion of salivary SIgA secretion was also evaluated. During the study period, the consumption of yogurt and lactic acid bacteria beverages other than the test food was prohibited. Furthermore, the consumption of supplements and health foods that could potentially affect this study was prohibited in principle. In addition, participants were instructed not to make significant changes to their existing diet and exercise habits. Participants were also required to record in a diary any medications they took during the study period. Furthermore, alcohol consumption was prohibited from the morning of the day before the test until the end of the test on the day of the test. On the day before the SCR test, dinner was to be finished by 9 p.m. in principle, and fasting was required until the end of the test the following day (drinking water was permitted until one hour before the scheduled SCR test time). Treatment of teeth and mouth ulcers was to be refrained from from one week before the start of test food intake (week 0), and the 2-week and 4-week tests until the end of the test on the day of the test. Participants were instructed to brush their teeth after dinner and before bedtime on the day they started consuming the test food (week 0), at 2 weeks later, and the day before the 4-week test. On the day they started consuming the test food (week 0), at 2 weeks later, and on the day of the 4-week test, they were instructed to brush their teeth after breakfast and to refrain from eating or drinking anything other than water until the end of the test. They were also instructed to brush their teeth if they skipped breakfast.

[0112] (b) Evaluation of CD86 positivity rate in dendritic cells (pDCs and cDCs) At each test, blood was collected from subjects using BD Vacutainer CPT® mononuclear cell isolation tubes (manufactured by Becton Dickinson Japan (BD) Co., Ltd. (hereinafter sometimes referred to as "BD")) on the first day of intake of the test food (week 0), at 2 weeks, and at 4 weeks, and PBMCs were isolated from the blood. Subsequently, the isolated PBMCs were suspended using CELLBANKER 1plus® (manufactured by Nippon Zenyaku Kogyo Co., Ltd.) and stored at -80°C until the day of measurement of dendritic cell activity. The PBMC suspension, which had been stored and frozen at -80°C, was thawed, washed with PBS (FACS buffer) containing 2% fetal calf serum (FCS), and then blocked with Human BD Fc Block® (manufactured by BD Biosciences) to obtain evaluation samples. Subsequently, the evaluation samples were stained by adding the following cell stains: FVD780 (eBiosciense®) (Thermo Fisher SCIENTIFIC), Anti-Lineage Cocktail 1 (containing CD3, CD14, CD16, CD19, CD20, CD56) FITC (BD Biosciences), Anti-HLA-DR APC (BD Biosciences), Anti-CD11c BV421 (BD Biosciences), Anti-CD123 BV510 (BD Biosciences), Anti-CD304 PE (BioLegend), and Anti-CD86 PE-Cy7® (BD Biosciences), and incubating them in the dark at room temperature for 20 minutes. Subsequently, the stained evaluation samples were washed with FACS buffer, placed in 5 mL polypropylene tubes (Beckman Coulter) using Fixation / Permeabilization solution (BD Biosciences), and incubated at 2-8°C for 20 minutes to fix the evaluation samples. Measurements were then performed using a high-end clinical flow cytometer, Navios 3L 10C (Beckman Coulter).At this time, cells that satisfy the conditions of being negative for Lineage Cocktail 1, positive for HLA-DR, negative for CD11c, positive for CD123, and positive for CD304 were defined as "pDCs." Similarly, cells that satisfy the conditions of being negative for Lineage Cocktail 1, positive for HLA-DR, positive for CD11c, and negative for CD123 were defined as "cDCs." Cells that were positive for FVD780 were considered dead cells and were excluded from the analysis. Subsequently, the CD86 positivity rate of pDCs and cDCs was analyzed using the flow cytometry software Kaluza (manufactured by Beckman Coulter) as an activation index. The above analysis was performed at Japan Biotherapy Institute Co., Ltd.

[0113] Regarding the CD86 positivity rate of pDCs, the test value at the start of intake of the test food (week 0) was 21.2±1.4% in the R-1 lactic acid bacteria intake group and 21.9±1.1% in the placebo intake group. The ratio of change from the test value at the start of intake of the test food (week 0) (the value obtained by dividing the test value at 2 weeks and 4 weeks after the start of intake of the test food by the test value at the start of intake of the test food (week 0)) was 1.20±0.08 at 2 weeks after the start of intake of the test food in the R-1 lactic acid bacteria intake group and 1.23±0.11 at 4 weeks after the start of intake of the test food. In the placebo intake group, the ratio of change at 2 weeks and 4 weeks was 1.04±0.07 and 1.02±0.06, respectively. This revealed that the CD86 positivity rate of pDCs in the R-1 lactic acid bacteria intake group was significantly higher than in the placebo intake group (P=0.047, see Figure 1).

[0114] Regarding the CD86 positivity rate of cDCs, the test values ​​at the start of intake of the test food (week 0) were 41.2±3.0% in the R-1 lactic acid bacteria intake group and 44.1±2.8% in the placebo intake group. The ratio of change from the test value at the start of intake of the test food (week 0) (the value obtained by dividing the test values ​​at 2 weeks and 4 weeks after the start of intake of the test food by the test value at the start of intake of the test food (week 0)) was 1.10±0.05 at 2 weeks after the start of intake of the test food in the R-1 lactic acid bacteria intake group and 1.07±0.05 at 4 weeks after the start of intake of the test food. In the placebo intake group, the ratio of change at 2 weeks and 4 weeks was 0.98±0.02 and 0.99±0.03, respectively. This revealed that the CD86 positivity rate of pDCs in the R-1 lactic acid bacteria intake group was significantly higher than in the placebo intake group (P=0.049, see Figure 2).

[0115] (c) Evaluation of the promotion of SIgA secretion in saliva On the first day of intake of the test food (week 0), at 2 weeks later, and at 4 weeks later, subjects were instructed to hold a sponge attached to Salivet (Zalstat) in their mouths for 2 minutes while seated, allowing their saliva to soak into the sponge. The sponge was then placed in a special container, and the subjects' saliva was collected by centrifugation. The SIgA concentration in the saliva was then measured. The SIgA concentration was measured at Yanaihara Laboratory Co., Ltd. Using this method, data regarding the promotion of SIgA secretion in saliva was obtained.

[0116] Regarding salivary SIgA concentration, the test value at the start of intake of the test food (week 0) was 95.0 ± 5.5 μg / mL in the R-1 lactic acid bacteria intake group. The test value in the placebo intake group was 97.0 ± 7.3 μg / mL. The change from the test value at the start of intake of the test food (week 0) (the value obtained by subtracting the test value at the start of intake of the test food (week 0) from the test value at 2 weeks and 4 weeks after the start of intake of the test food) was 8.3 ± 5.4 at 2 weeks after the start of intake of the test food in the R-1 lactic acid bacteria intake group. The change at 4 weeks after the start of intake of the test food was 8.0 ± 4.7. The change at 2 weeks and 4 weeks in the placebo intake group was 5.3 ± 4.7 and -6.6 ± 4.7, respectively. This suggests that the values ​​obtained from the R-1 lactic acid bacteria intake group were significantly higher than those of the placebo group in the test four weeks after the start of intake of the test food (P=0.031, see Figure 3).

[0117] 3. Conclusion The results of the above randomized, placebo-controlled, double-blind, parallel-group comparative study suggest that ingesting the test food according to the embodiment of the present invention can activate human pDCs and cDCs. This suggests that a composition containing the extracellular polysaccharide of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (accession number: FERM BP-10741) as an active ingredient can activate dendritic cells. Furthermore, in this study, not only was pDC and cDC (dendritic cell) activation observed in the R-1 lactic acid bacteria ingested, but an increase in salivary SIgA concentration was also observed. This suggests that ingesting a composition containing the extracellular polysaccharide of OLL1073R-1 can activate pDCs and cDCs and increase salivary SIgA levels.

[0118] (B) Evaluation of pDC activity using human peripheral blood mononuclear cells PBMC was placed in a 48-well microwell plate (Iwaki) in 1 x 10⁶ units. 6Cells were suspended in 250 μL of medium per well and seeded. Subsequently, 250 μL of medium containing R1-EPS at concentrations of 50, 100, 200, and 400 μg / mL, 250 μL of medium containing 2 μM of CpG-A DNA (ODN2216) (Hycult Biotech) as a Positive Control, and 250 μL of medium as a Negative Control were added to the same well plate, and each cell in the well plate was cultured at 37°C under 5% CO2 for 24 hours. After that, each culture was collected in a 96-well V-bottom microwell plate, washed twice with PBS (FACS buf.) containing 2% FCS, and the solutions containing each culture were centrifuged at 1300 rpm for 3 minutes at 4°C. The supernatant obtained from the centrifugation was removed, and Human BD Fc Block® (BD) was added to the remaining precipitate and allowed to stand at room temperature for 10 minutes. Subsequently, the following cell staining dyes were added to the precipitate: FVD780 (eBiosciense), Anti-Human Lineage Cocktail 1 (CD3, CD14, CD16, CD19, CD20, CD56) FITC (BD), Anti-HLA-DR APC (BD), Anti-CD11c BV421 (BD), Anti-CD123 BV510 (BD), Anti-CD304 PE (BD), and Anti-CD86 PE-Cy7 (BD). The samples were incubated at 4°C for 30 minutes in the dark to obtain stained evaluation samples. Next, the evaluation samples were washed twice with FACS buf., and Fixation and Permeabilization Solution (BD) was added. The samples were then fixed by incubation at 2-8°C for 20 minutes. Subsequently, the precipitate was washed twice with 1× Permeabilization buffer (BD), resuspended in FACS buffer, and measured using BD FACSVerse (BD). Cells that were "Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, and CD304 positive" were defined as "pDCs," and the expression intensity (Mean fluorescence intensity, MFI) of CD86 and HLA-DR was analyzed.The PBMC was purchased from Precision for Medicine. The culture medium used was RPMI 1640 (Gibco) (Thermo Fisher SCIENTIFIC) supplemented with 10% FCS (BioWest) and 1% Penicillin-Streptomycin (Gibco) (Thermo Fisher SCIENTIFIC).

[0119] The above analysis revealed that R1-EPS increased the expression levels of CD86 and HLA-DR, which are activation markers for pDCs (see Figures 4 and 5). These expression levels also increased in CpG-A DNA, a positive control (see Figures 4 and 5). These results clearly indicate that R1-EPS increases the expression levels of CD86 and HLA-DR in pDCs. [Industrial applicability]

[0120] The composition according to the present invention can activate dendritic cells. In addition, it can promote the secretion of SIgA in saliva. Therefore, ingesting the composition according to the present invention can contribute to maintaining or improving the health of humans and other animals. [Accession Number]

[0121] FERM BP-10741 FERM BP-10740

Claims

1. A dendritic cell activation composition containing extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

2. The dendritic cell activation composition according to claim 1, wherein the Lactobacillaceae lactic acid bacteria is a Lactobacillus lactic acid bacterium.

3. The aforementioned Lactobacillus lactic acid bacteria are Lactobacillus lactic acid bacteria that possess a 16S rRNA gene having 95% or more sequence identity with the nucleotide sequence of Sequence ID No. 1 below. The dendritic cell activation composition according to claim 2. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

4. The aforementioned Lactobacillus lactic acid bacterium is Lactobacillus delbrueckii subsp. bulgaricus. The dendritic cell activation composition according to claim 2.

5. The aforementioned Lactobacillus delbrueckii subspecies bulgaricus is Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 (FERM BP-10741). The dendritic cell activation composition according to claim 4.

6. The dendritic cells are plasmacytoid dendritic cells (pDCs). The dendritic cell activation composition according to claim 1.

7. The dendritic cells are conventional dendritic cells (cDCs). The dendritic cell activation composition according to claim 1.

8. To increase the proportion of CD86-positive cells among plasmacytoid dendritic cells (pDCs) in peripheral blood mononuclear cells (PBMCs), The dendritic cell activation composition according to claim 6.

9. To increase the CD86 expression level of plasmacytoid dendritic cells (pDCs) in peripheral blood mononuclear cells (PBMCs), The dendritic cell activation composition according to claim 6.

10. To increase the HLA-DR expression level of plasmacytoid dendritic cells (pDCs) in peripheral blood mononuclear cells (PBMCs), The dendritic cell activation composition according to claim 6.

11. To increase the proportion of CD86-positive cells among conventional dendritic cells (cDCs) in peripheral blood mononuclear cells (PBMCs), The dendritic cell activation composition according to claim 7.

12. The dendritic cell activating composition according to claim 1, further comprising the bacterial cells of the Lactobacillaceae family lactic acid bacteria.

13. The aforementioned composition is fermented milk. The dendritic cell activation composition according to claim 1.

14. Lactobacillaceae lactic acid bacteria that produce extracellular polysaccharides and Streptococcus thermophilus are added to a milk raw material, and the milk raw material is fermented. A method for producing fermented milk for dendritic cell activation.

15. A composition for promoting salivary SIgA secretion, containing extracellular polysaccharides produced from Lactobacillaceae lactic acid bacteria.

16. The above-mentioned Lactobacillaceae lactic acid bacteria further contain the bacterial cells, The composition for promoting salivary SIgA secretion according to claim 15.

17. A composition for promoting salivary SIgA secretion according to claim 16, which is achieved by dendritic cell activation.

Images