Methods for detecting saccharifying yeast contaminants

The method and kit for detecting saccharifying yeast contaminants in brewed products are improved by using specific nucleic acid sequences, and their actual contribution to solving the technical problem.

JP2026502178APending Publication Date: 2026-01-21INVISIBLE SENTINEL INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025537000
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-15
Publication Date
2026-01-21

Smart Images

  • Figure 2026502178000001_ABST
    Figure 2026502178000001_ABST
Patent Text Reader

Abstract

The present embodiments relate to mixtures, methods, kits, and systems that allow for the detection of oligonucleotide molecules derived from Saccharomyces cerevisiae that are predictive of saccharifying yeasts in contaminated brewed products such as beer, independent of STA1 or STA2 genotype, and further relate to compositions and methods for predicting the spoilage potential of brewed products contaminated with saccharifying yeasts.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 477,051, filed December 23, 2022, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically and is incorporated herein by reference in its entirety. The Sequence Listing is provided as the file 02136WO-SequenceListing.xml, created on November 17, 2023, and is 7530 bytes in size.

[0003] FIELD OF THE INVENTION The present embodiments relate to compositions and methods, mixtures, kits, and systems for detecting saccharifying yeast strains independent of STA1 and STA2 genotypes, and their use for predicting the spoilage potential of brewed products potentially contaminated with saccharifying yeast. This application claims the benefit of U.S. Provisional Application No. 63 / 477,051, filed December 23, 2022, which is incorporated herein by reference in its entirety. [Background technology]

[0004] Background of the Invention Saccharifying wild yeast strains are a major cause of lost revenue in breweries; these beer spoilage organisms are commonly found as contaminants in spoiled brewed products that cannot be sold, such as over-fermented beer and beer with an alcohol by volume (ABV) exceeding legal limits, and in spoiled brewed products that must be recalled, such as re-fermented and packaged beer that poses a high risk of container rupture. It is difficult to distinguish saccharifying wild yeast strains from non-saccharifying strains. Current methods for detecting wild saccharifying yeast contamination rely on molecular detection assays targeting the yeast glucoamylase genes (STA1 and STA2). However, saccharifying strains of S. cerevisiae may lack the STA1 or STA2 genes, and STA1-positive yeast strains may lack saccharifying activity. There is a need in the art for a sensitive and reliable detection assay that can detect saccharifying yeast strains regardless of the yeast's STA1 and STA2 genotypes. The present embodiments address this need, as well as others. In some embodiments, the method allows for the detection of very low abundance saccharifying Saccharomyces cerevisiae strains when mixed with high abundance, more common brewer's yeast strains. Summary of the Invention

[0005] Summary of the Invention Embodiments herein relate to mixtures, methods, kits, and systems that enable the detection of Saccharomyces cerevisiae-derived oligonucleotide molecules that are predictive of yeasts that are saccharifying, independent of STA1 or STA2 genotype, in contaminated brewed products.

[0006] In one embodiment, the present invention is a method for detecting an organism containing a target nucleic acid molecule substantially homologous to the sequence of SEQ ID NO: 1, or a fragment thereof, or its complement, in a test sample. The method can include reacting the test sample with a first primer that specifically hybridizes to the target nucleic acid molecule and a second primer that specifically hybridizes to the target nucleic acid molecule under amplification conditions to generate an amplicon. In some embodiments, the first primer and the second primer are each independently 15 to 40 nucleotides in length. The method can further include detecting the presence or absence of the amplicon.

[0007] In one embodiment, the method may further comprise reacting the test sample with a probe that specifically binds to the target nucleic acid molecule bound by the first primer. In this embodiment, the detecting step may comprise detecting a signal from the probe indicating amplification. In some embodiments, the probe is labeled with a detectable label. In some embodiments, the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6. In some embodiments, the probe may comprise a sequence that is completely homologous to the sequence of SEQ ID NO:5, SEQ ID NO:6, or their complements.

[0008] In some embodiments, the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2. Additionally, the second primer may comprise a sequence that is substantially homologous to the sequence of SEQ ID NO: 3. Alternatively, the first primer may be completely homologous to the sequence of SEQ ID NO: 2, and the second primer may be completely homologous to the sequence of SEQ ID NO: 3.

[0009] In some embodiments, the presence of a detectable amplicon indicates a contaminant in the test sample.

[0010] In some embodiments, detection of the detectable amplicon indicates a positive spoilage potential of the test sample. In some embodiments, a positive spoilage potential indicates the presence of contaminating saccharifying wild yeast.

[0011] In some embodiments, the first primer and the second primer are configured to amplify a detectable amplicon, wherein the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof. In some embodiments, the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

[0012] In some embodiments, the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0013] In some embodiments, the method comprises detecting detectable amplicons using one or more of the following techniques: direct detection of a measurement of a physical property of the amplicon, for example, a measurement of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

[0014] In some embodiments, the method includes generating and detecting a second detectable amplicon. The second detectable amplicon may comprise a sequence of the STA1 gene or a sequence of the STA2 gene, a complement thereof, or a fragment thereof. In some embodiments, the method includes generating and detecting a second and a third detectable amplicon. The second detectable amplicon may comprise a sequence of the STA1 gene, a complement thereof, or a fragment thereof, and the third detectable amplicon may comprise a sequence of the STA2 gene, a complement thereof, or a fragment thereof.

[0015] In some embodiments, the method includes reacting the test sample in a reaction mixture in the absence of a primer that hybridizes to a sequence in the STA1 gene and in the absence of a primer that hybridizes to a sequence in the STA2 gene.

[0016] In some embodiments, the present disclosure is a method for detecting food or beverage contamination in a test sample derived from the food or beverage, the food or beverage containing a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, or its complement, or a fragment thereof. The method includes reacting the test sample with a first primer that specifically hybridizes to the target nucleic acid molecule and a second primer that specifically hybridizes to the target nucleic acid molecule under amplification conditions to produce an amplicon; and detecting the presence or absence of the amplicon.

[0017] In some embodiments, the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:3.

[0018] In some embodiments, the method further comprises reacting the test sample with a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6.

[0019] The present disclosure also includes kits. In some embodiments, the kits include a primer comprising a sequence substantially homologous to SEQ ID NO:2 or a fragment thereof; a primer comprising a sequence substantially complementary to SEQ ID NO:3 or a fragment thereof; deoxynucleotide triphosphate nucleotides; and a buffer. In some embodiments, the kits may also include a DNA polymerase.

[0020] In some embodiments, the kit may include a probe. In some embodiments, the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6. In some embodiments, the probe comprises a sequence that is completely homologous to or completely complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6. In some embodiments, the probe may be covalently linked to a detectable label. Similarly, in some embodiments, at least one of the primers may be covalently linked to a detectable label. The probe may also include a quencher configured to quench a signal from the detectable label. Such kits may or may not include a DNA polymerase.

[0021] The present disclosure also includes mixtures. The mixture may include a primer substantially homologous to SEQ ID NO:2; a primer substantially homologous to SEQ ID NO:3; deoxynucleotide triphosphate nucleotides; a DNA polymerase; a buffer; and a test sample suspected of having a nucleic acid substantially homologous to the sequence of SEQ ID NO:1, or a fragment thereof, or a complement thereof. In some embodiments, the mixture also includes a probe. In some embodiments, the probe is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6, or a fragment thereof. In some embodiments, the mixture further includes a primer that hybridizes to a gene encoding either or both of STA1 and STA2. In contrast, in some embodiments, no primers hybridize to a gene encoding either STA1 or STA2.

[0022] The present disclosure also includes systems, which in some embodiments may include at least one of the mixtures described herein and an instrument configured to perform an amplification assay on the at least one mixture.

[0023] In some embodiments, the system further includes at least one sample vessel. In some embodiments, the at least one mixture is contained in one of the at least one sample vessel. Some embodiments may also include a temperature control device.

[0024] The following is explained: A1. A method for detecting an organism containing a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof, in a test sample, comprising: reacting the test sample with a first primer that specifically hybridizes to the target nucleic acid molecule and a second primer that specifically hybridizes to the complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and Detecting the presence or absence of an amplicon A method comprising:

[0025] A2. The method of clause A1, further comprising reacting the test sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds, and wherein the detecting step comprises detecting a signal from the probe that indicates amplification.

[0026] A3. The method of clause A1, wherein the first primer and the second primer are each independently 15 to 40 nucleotides in length.

[0027] A4. The method of any one of clauses A1 to A3, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:3.

[0028] A5. The method of clause A1, wherein the first primer comprises a sequence that is completely homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence that is completely homologous to the sequence of SEQ ID NO:3.

[0029] A6. The method of clause A2, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6.

[0030] A7. The method of clause A2, wherein the probe comprises a sequence that is completely homologous to the sequence of SEQ ID NO: 5, SEQ ID NO: 6, or their complements.

[0031] A8. The method of clause A2, wherein the probe is labeled with a detectable label.

[0032] A9. The method of clause A1, wherein the presence of a detectable amplicon indicates a contaminant in the test sample.

[0033] A10. The method of clause A1, wherein detection of a detectable amplicon indicates a positive likelihood of spoilage.

[0034] A11. The method according to clause A10, wherein a positive spoilage potential indicates the presence of contaminating saccharifying wild yeast.

[0035] A12. The method of clause A1, wherein the first primer and the second primer are configured to amplify a detectable amplicon, and the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

[0036] A13. The method of clause A1, wherein the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

[0037] A14. The method of clause A1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0038] A15. The step of detecting a detectable amplicon comprises: direct detection of measurements of physical properties of the amplicon, e.g., measurements of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; complexing the amplicon with a detectable label and detecting the presence of the label; detecting a detectable signal from the reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; or detecting detectable signals from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; The method of clause A1, comprising one or more of the group consisting of:

[0039] A16. The method of clause A1, further comprising generating and detecting a second detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene or a sequence of the STA2 gene, a complement thereof, or a fragment thereof.

[0040] A17. The method of clause A1, further comprising generating and detecting a second and a third detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene and the third detectable amplicon comprises a sequence of the STA2 gene.

[0041] A18. The method according to clause A1, wherein there are no primers configured to amplify a sequence of the STA1 gene and there are no primers configured to amplify a sequence of the STA2 gene.

[0042] B1. 1. A method for detecting contaminants in a food or beverage comprising a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, or its complement, or a fragment thereof, comprising: reacting a test sample derived from a food or beverage with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to the complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and Detecting the presence or absence of an amplicon; A method comprising:

[0043] B2. The method of clause B1, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:3.

[0044] B3. The method of clause B2, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6.

[0045] C1. A primer comprising a sequence substantially homologous to SEQ ID NO:2 or a fragment thereof; and a primer comprising a sequence substantially homologous to SEQ ID NO: 3 or a fragment thereof; Includes a kit.

[0046] C2. The kit of clause C1, further comprising at least one of a DNA polymerase, a deoxynucleotide triphosphate nucleotide, and a buffer.

[0047] C3. The kit of either clause C1 or C2, further comprising a probe.

[0048] C4. The kit of clause C3, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:6.

[0049] C5. The kit of clause C3, wherein the probe is covalently linked to a detectable label.

[0050] C6. The kit of clause C5, wherein the probe also includes a quencher configured to quench a signal from the detectable label.

[0051] C7. The kit of clause C6, wherein at least one of the primers is covalently linked to a detectable label.

[0052] D1. a primer substantially homologous to SEQ ID NO:2; a primer substantially homologous to SEQ ID NO:3; Deoxynucleotide triphosphate nucleotides; DNA polymerase; buffer; and a test sample suspected of having a nucleic acid that is substantially homologous to the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; A mixture comprising:

[0053] D2. The mixture of clause D1, further comprising a probe.

[0054] D3. The mixture of clause D2, wherein the probe is substantially homologous to or substantially complementary to the sequence of SEQ ID NO: 5 or SEQ ID NO: 6, or a fragment thereof.

[0055] D4. The mixture of clause D1, further comprising a primer that hybridizes to a gene encoding either or both of STA1 and STA2.

[0056] D5. The mixture according to clause D1, wherein primers configured to amplify STA1 and STA2 are absent.

[0057] E1. at least one of the mixtures according to any one of clauses C1 to C5; and an instrument configured to perform an amplification assay on at least one mixture; Including, the system.

[0058] E2. The system of clause E1, further comprising at least one sample container.

[0059] E3. The system of clause E2, wherein each of the at least one mixture is contained in one of the at least one sample containers.

[0060] E4. The system of clause E3, further comprising at least one sample temperature control device. [Brief explanation of the drawings]

[0061] For the purpose of illustrating the embodiments, there is shown in the drawings exemplary embodiments, it being understood, however, that the embodiments are not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. [Figure 1] SEQ ID NO: 1 is shown, and the primers SEQ ID NO: 2 and SEQ ID NO: 3 and the probe SEQ ID NO: 5 are annotated. [Figure 2] An alignment diagram of the sequence of SEQ ID NO: 4 with the sequence of SEQ ID NO: 1 is shown, where the sequence of SEQ ID NO: 4 is underlined within the sequence of SEQ ID NO: 1. [Figure 3A] FIG. 1 is a schematic diagram showing the relationship between the presence of a predicted region (SEQ ID NO: 1) in the genome of a wild yeast strain, the predicted saccharification activity of all yeast in a brewed product sample, and the predicted spoilage potential in the brewed product sample. [Figure 3B] FIG. 1 is a schematic diagram showing the relationship between the presence of a predicted region (SEQ ID NO: 1) in the genome of a wild yeast strain, the predicted saccharification activity of all yeast in a brewed product sample, and the predicted spoilage potential in the brewed product sample. [Figure 3C] FIG. 1 is a schematic diagram showing the relationship between the presence of a predicted region (SEQ ID NO: 1) in the genome of a wild yeast strain, the predicted saccharification activity of all yeast in a brewed product sample, and the predicted spoilage potential in the brewed product sample. [Figure 4] FIG. 1 shows a block diagram of an exemplary embodiment of a thermal cycling system according to aspects of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0062] Detailed Description The present invention provides compositions and methods of use for detecting saccharifying strains of wild yeast in contaminated brewed products, wherein the detection of saccharifying strains of wild yeast is independent of the STA1 or STA2 genotype of the yeast. The present disclosure further provides compositions and methods of use for predicting the spoilage potential of brewed products contaminated with wild yeast.

[0063] Various compositions and methods are described in the embodiments herein. The embodiments can be combined with each other. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not limiting. All references cited herein are incorporated by reference in their entirety. Nothing herein should be construed as an admission that the subject matter is not entitled to antedate such disclosure by virtue of prior invention. The use of examples anywhere herein, including examples of any terms discussed herein, is illustrative only and in no way limits the scope and meaning of the disclosure or the exemplified terms. Likewise, the present disclosure is not limited to its preferred embodiments.

[0064] In order that the present disclosure may be more readily understood, certain terms are defined.

[0065] Unless otherwise defined, all technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed embodiments belong. Certain terms are explained below or elsewhere herein to provide additional guidance to the practitioner in describing the disclosed compositions and methods and how to use them. It will further be understood that the same thing can be said in more than one way. Accordingly, alternative language or synonyms may be used for one or more of the terms explained herein, and no special meaning is imparted depending on whether a term is explained or discussed in detail herein. Synonyms for certain terms are provided. The listing of one or more synonyms does not exclude the use of other synonyms.

[0066] Unless otherwise required by context, singular terms will include pluralities and plural terms will include the singular.

[0067] The articles "a," "an," and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "a sample" means one sample or more than one sample.

[0068] As used herein, the adverb "about" or "approximately" means that a numerical value is approximate and that small variations will not significantly affect the practice of the disclosed embodiments. When numerical limitations are used, unless the context dictates otherwise, "about" means that the numerical value may vary by ±5% while remaining within the range of the disclosed embodiments. Thus, about 100 means 95 to 105.

[0069] As used herein, the term "sample" refers to any fluid medium or liquid that may contain or is believed to contain a particular item (e.g., an analyte). In some embodiments, samples high in dissolved solids can be used without further processing. In some embodiments, samples with high solids (non-dissolved) can be analyzed using filters or used in combination with additional manual procedures. In some embodiments, the sample is unfiltered. In some embodiments, the sample is filtered. In some embodiments, the sample is purified. In some embodiments, the sample is unpurified. The sample can be a liquid, suspension, extracted or dissolved sample, or supercritical fluid. When using a sample in a flow device (vertical or lateral), the sample or sample extract must have or be imparted with some flow properties to allow it to flow through the devices and systems described herein. Examples of samples include, but are not limited to, food swabs, food extracts, food suspensions, food cultures, yeast cultures, amplification reactions, PCR reactions, etc. The sample may also be derived from another sample. For example, a PCR reaction can be performed on a nucleic acid mixture extracted, isolated, and / or purified from another sample (e.g., beer), and this PCR reaction would be considered a sample derived from another sample.

[0070] As used herein, the term "beverage" means a liquid for drinking. As used herein, the term "food" refers to a raw, cooked, or processed edible substance, ice, beverage, or ingredient used or intended to be used in whole or in part for human consumption. The term food includes food suspensions and food cultures. The terms "food suspension" and "food solution" are used interchangeably throughout this application and refer to a raw, cooked, or processed food that is in, placed in, or suspended in a solution. Non-limiting examples of food suspensions include fermented alcoholic beverages, malt beverages, brews, and beer. Food suspensions may be mixed, vortexed, or blended. Food suspensions may be filtered or unfiltered. As used herein, a "food culture" is a food sample that has been cultured under conditions that concentrate the sample. This process is also referred to as "concentration."

[0071] As used herein, the term "beer" refers to beer, ale, porter, stout, or other similar fermented beverage brewed or produced from all or part of malt or malt substitutes. The term beer includes packaged and unpackaged beer. This definition includes alcoholic and non-alcoholic beer.

[0072] The process of producing beer is called "brewing." As used herein, the term "brewing" refers to any process that can be used to produce beer. Brewing steps include, but are not limited to, malting, milling, mashing, lautering, boiling, fermentation, conditioning, filtering, and packaging. Malting and fermentation are important and necessary steps in brewing.

[0073] As used herein, the term "brew" refers to beer at any stage in the brewing process prior to packaging into a container that can hold the beer, such as a bottle or can. The term brew includes malt and fermented malt.

[0074] As used herein, the term "brewed product" includes any food, beverage, brewed alcohol, or beer produced during brewing.

[0075] The term "spoilage" as used herein refers to the process by which food becomes unfit for consumption. Spoilage of brewed products can include undesirable changes in taste, flavor, aroma, viscosity, body, aroma, smell, appearance, or the presence of components such as ethanol in excess of legal limits. Spoilage events can include over-fermentation and re-fermentation events.

[0076] The term "spoilers" refers to any microorganism that can cause food spoilage. Beer spoilage is any microorganism that can alter the flavor, aroma, or appearance of beer in a way that is deemed undesirable by the brewer, or that can cause beer spoilage. Non-limiting examples of beer spoilage include saccharifying strains of wild yeast, such as Saccharomyces cerevisiae var. diastaticus.

[0077] As used herein, the term "malt" refers to a product made from grains that is used as a fermentation basis for beverages and foods. Malt typically contains maltose. Malt may also contain starch and non-starch polysaccharides, such as dextrins.

[0078] As used herein, the term "diastase" refers to any enzyme from the group of glycosidases that can convert starch or polysaccharides into fermentable sugars, typically maltose. Non-limiting examples of diastases include amylases, such as α-amylase and β-amylase.

[0079] The terms "glucoamylase" and "amyloglucosidase" are used interchangeably throughout this application and refer to any maltase capable of further digesting starch and non-starch polysaccharides (including, but not limited to, dextrins) into glucose. Non-limiting examples of glucoamylases include yeast glucoamylase S1 (STA1) and yeast glucoamylase S2 (STA2).

[0080] As used herein, the term "malt enzymes" refers to any mixture of enzymes used during the conversion of grain to malt. Malt enzymes can include glycosidases, e.g., β-glucanases, and diastases, e.g., α-amylase and β-amylase. As used herein, the term "malt enzymes" specifically excludes maltase and glucoamylase.

[0081] As used herein, the term "malting" refers to the process of converting grain into malt.

[0082] As used herein, the term "desirable yeast" refers to any yeast that is intentionally added during the brewing process. As used herein, the term "wild yeast" refers to any yeast species or strain that is not intentionally added during brewing.

[0083] As used herein, the term "fermentation degree" refers to the percentage of fermentable sugars that are converted to alcohol and CO2 during brewing or after packaging of the brewed product. As used herein, "low attenuation degree" refers to a fermentation degree of less than 72%. As used herein, "moderate attenuation degree" refers to a fermentation degree between 72% and 77%. As used herein, "high attenuation degree" refers to a fermentation degree of greater than 77%. A brewed product that does not reach the desired attenuation degree is said to be "under-fermented." As used herein, the term "over-fermented" refers to a fermentation degree greater than that desired for the brewed product.

[0084] As used herein, the term "refermented" refers to a brewed product that has been fermented after filtration and / or packaging.

[0085] The term "saccharifying activity" refers to the activity of diastase, particularly diastase used during the brewing process. Examples of enzymes that contribute to saccharifying activity include, but are not limited to, malt enzymes and endogenous yeast enzymes. As used herein, the term "saccharifying power" specifically refers to the activity of diastase in malt enzymes. As used herein, the term "saccharifying capacity" refers to the ability of yeast to add active diastase to a brewed product. Unless otherwise defined by context, "saccharifying activity" as used herein refers to the sum of the saccharifying power and saccharifying capacity of malt enzymes and endogenous yeast enzymes present in a brewed product, including malt, brewed alcohol, or packaged beer. Both desirable and wild yeast strains can contribute to the saccharifying activity of a brewed product.

[0086] As used herein, the term "high saccharifying activity" refers to saccharifying activity that results in a fermentability of greater than 77% in the brewed product. Similarly, as used herein, "low saccharifying activity" refers to saccharifying activity that results in a fermentability of less than 72% in the brewed product. The term "moderate saccharifying activity" refers to saccharifying activity that results in a fermentability of between 72% and 77% in the brewed product. Thus, high saccharifying activity leads to high fermentability, and low saccharifying activity leads to low fermentability.

[0087] As used herein, "saccharifying yeast" and "saccharifying strain" are used interchangeably throughout this application and refer to any wild yeast strain with high saccharifying activity that may be added to brewed products by contamination. A yeast with high saccharifying activity is one that has the potential to significantly increase the saccharifying activity of a brewed product beyond the desired saccharifying activity.

[0088] As used herein, the terms "detecting" or "detection" are used in the broadest sense to include the qualitative and / or quantitative determination of an analyte.

[0089] As used herein, the term "analyte" refers to a substance that is measured in an analytical procedure. Non-limiting examples of analytes include RNA, DNA, nucleic acid molecules encoded by cells, synthetic nucleic acid molecules, and amplification products (e.g., amplicons).

[0090] As used herein, an "amplicon" is an amplification product. An amplicon can be generated by amplifying a nucleic acid sequence from a test sample. An amplicon can include, but is not limited to, a PCR product.

[0091] As used herein, "PCR product" refers to any product produced as a result of a PCR reaction.

[0092] Without wishing to be bound by theory, amplicons can be generated by amplifying nucleic acid molecules in many ways, and the amplicons can be detected in many ways. Non-limiting examples of DNA amplification reactions include polymerase chain reaction (PCR), isothermal amplification, ligase chain reaction (LCR), and rolling circle replication (RCR). Non-limiting examples of PCR reactions include emulsion PCR, real-time PCR (RT-PCR), multiplex PCR, long-range PCR, single-cell PCR, fast cycling PCR, methylation-specific PCR (MSP), hot-start PCR, high-fidelity PCR, rapid amplification polymorphism DNA analysis (RAPD), rapid amplification of cDNA ends (RACE), in situ PCR, differential display PCR, and bridge PCR (bPCR) amplification. Non-limiting examples of isothermal reactions include isothermal amplification, loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), thermophilic helicase-dependent amplification (tHDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), self-sustaining sequence reaction (3SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and bridge amplification.

[0093] The amplicons can be detected after amplification, for example, by DNA gel, lateral flow detection device, or vertical flow detection device. Alternatively, the predicted region, or a fragment thereof, or its complement, can be amplified, and the resulting amplicons can be detected in real time or after amplification. In one embodiment, positive amplification of DNA can be monitored in real time using dsDNA binding dyes such as SYBR Green or EvaGreen®.

[0094] As used herein, "target nucleic acid" or grammatical equivalents thereof can refer to a nucleic acid molecule or sequence that is desired to be identified, detected, hybridized, sequenced, analyzed and / or further manipulated.

[0095] As used herein, the term "probe" is defined as a detectable, illustratively partially single-stranded, and often completely single-stranded, polynucleotide, e.g., an oligonucleotide, capable of specifically hybridizing to a target nucleic acid.

[0096] As used herein, "specifically hybridize" means that a probe, primer, or oligonucleotide recognizes and physically interacts (i.e., base pairs with) a substantially complementary nucleic acid (e.g., a sample nucleic acid) under high stringency conditions, but does not substantially base pair with other nucleic acids. "High stringency conditions" refer to conditions configured to allow identification of a target nucleic acid sequence. Such conditions typically occur at about T minus 5°C (5° below the T of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences with at least 80% sequence identity. In some embodiments, this can mean at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[0097] As used herein, a "substantially complementary" nucleic acid means that the nucleic acid specifically hybridizes to a designated sequence. As used herein, "substantially homologous" means that the nucleic acid specifically hybridizes to the complement of the designated sequence.

[0098] The STA1 and STA2 genes of yeast encode glucoamylase S1 and glucoamylase S2, which are extracellular enzymes capable of uncontrollably hydrolyzing and releasing glucose one unit at a time from the non-reducing ends of polysaccharides such as starch, dextrins, oligonucleotides, and dinucleotides. As used herein, "S. cerevisiae var. diastaticus" and "S. diastaticus" are used interchangeably to refer to any variant of Saccharomyces cerevisiae possessing the STA1 and / or STA2 genes. As used herein, "STA1+ yeast" refers to any Saccharomyces yeast or non-Saccharomyces yeast possessing the STA1 gene. As used herein, "STA2+ yeast" refers to any Saccharomyces yeast or non-Saccharomyces yeast possessing the STA2 gene. As used herein, "STA1- / STA2- yeast" refers to any Saccharomyces yeast or non-Saccharomyces yeast that lacks both the STA1 and STA2 genes.

[0099] Yeast strains possessing the STA1 and / or STA2 genes are often saccharifying yeasts. Phenotypic studies evaluating the saccharifying ability of wild-type S. cerevisiae strains have shown that strains possessing STA1 or STA2 exhibit higher levels of fermentation and beer spoilage compared to desirable S. cerevisiae strains. Currently, breweries rely on molecular detection assays targeting the STA1 or STA2 genes to detect the presence of saccharifying wild-type yeast strains in brewed product samples and predict the potential for spoilage. However, some saccharifying yeasts lack the STA1 and STA2 genes, and some STA1 or STA2 strains of S. cerevisiae var. diastaticus completely lack saccharifying ability (Krogergus et al., 2019).

[0100] Previously unannotated DNA sequences within the Saccharomyces cerevisiae genome were identified as predictive of saccharification activity and beer spoilage in both STA1+ and STA1- strains. The unannotated genomic region was identified within a large region of chromosome 7, encompassing the sequence of SEQ ID NO:1. ACGCGAGAATACTAAGCCCAAGCCTCTCCAAATTGATTTCCTTTTGGTACTGAAAGACTTAGTATCAACCTCAAAAAGTTGAAATTTCTGTAGATAAATATGCAGATGACATGAAGTACCCAGTTCTTTTGTGAATATGGAAGTAGTTTTCTTTCAAATCGTTATTAATATTTCCTCTGCCCTCTTCACCTTATAGCTTTAGGAAACACTACTCTATTCATATTCAACTAAAAAAGTAGTATATTTCCTTCCGTTAGAATTGTGGTACAAACCAGCGCAATATAAACCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATATCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACTTCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTGTTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATACCAATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTCAATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAATGGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTAACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGACAAATGTTCTATTGAAAAAGTGATGTCCTCTGAAGAGTAAAGGCACTATGGGGCGTTGCAACTAAAGGAGATATTAGATTCATCAAAAGTGAGATTTTTTCATAAAACATGAGTCTATATCAGGTGAAACAGTTTGAGGCAGCCTTAATATGGAACTGAAAAAGCAAAATCAAAGGCAAAAGTTTCTCATATATATATGGCATTGTTGATCACCCAGTGC (SEQ ID NO: 1).

[0101] As used herein, the terms "nucleic acid," "nucleic acid molecule," and "nucleotide" are consistent with their usage in the art and are intended to include naturally occurring species or functional analogs thereof. Nucleic acids are composed of one or more nucleotides and include oligonucleotides, polynucleotides, and the like. As used herein, "polynucleotide," "nucleic acid molecule," and "nucleic acid" may be used interchangeably and refer to polymeric forms of nucleotides of any length, such as ribonucleotides or deoxyribonucleotides. As used herein, "oligonucleotide" refers to a single-stranded multimer of nucleotides of about 2 to 200 nucleotides, up to 500 nucleotides in length, illustratively about 15 to about 40 nucleotides, about 16 to about 25 nucleotides, about 18 to about 22 nucleotides, about 26 to about 34 nucleotides, or about 28 to about 32 nucleotides in length, e.g., 18, 19, 20, 21, or 22 nucleotides in the case of a primer, and 28, 29, 30, 31, or 32 nucleotides in the case of a probe. Oligonucleotides may be synthetic or enzymatically produced. An example of a nucleic acid molecule is DNA, which can contain deoxyribonucleotides or modified deoxyribonucleotides. As used herein, the term "nucleotide" is also intended to encompass nucleotide analogs, which are a type of nucleotide that contains modified nucleic acid bases, sugars, and / or phosphate moieties compared to naturally occurring nucleotides.

[0102] In some embodiments, a first primer is provided that specifically hybridizes to SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, a second primer is provided that specifically hybridizes to SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, the first primer and the second primer have a nucleotide sequence of about 150 to 800, about 150 to 700, about 150 to 600, about 150 to 500, about 200 to 1000, about 200 to 900, about 200 to 800, about 200 to 700, about 200 to 600, about 200 to 500, about 500 to 1000, about 500 to 900, about 500 to 800, or about It is configured to amplify a fragment of SEQ ID NO: 1 or its complement that is 500 to 700, about 500 to 600, about 600 to 1000, about 600 to 900, about 600 to 800, about 600 to 700, about 700 to 1000, about 700 to 900, about 700 to 800, about 800 to 1000, about 800 to 900, or about 900 to 1000 nucleotides in length. In some embodiments, the first primer and the second primer have a nucleotide sequence of about 40 to 200, about 40 to 150, about 40 to 100, about 200 to 450, about 250 to 500, about 250 to 450, about 300 to 500, about 300 to 450, about 350 to 500, about 350 to 450, about 400 to 500, about 400 to 450, about 400 to 425, about 400 to 420, about 405 to 45 ... and is configured to amplify a fragment of SEQ ID NO: 1 or its complement that is about 25, 410-430, 400-415, 405-420, 410-425, 405-415, 410-420, 410-415, 300-800, 300-700, 300-600, 400-800, 400-700, or 400-600 nucleotides in length.

[0103] In some embodiments, the primer has the sequence of SEQ ID NO:2: CCCTGATTGCCTCATGCGA (SEQ ID NO: 2), or substantially homologous to its complement.

[0104] In some embodiments, the primer has the sequence of SEQ ID NO:3: TCAAGCGCGTTCAAACCG (SEQ ID NO: 3), or substantially homologous to its complement.

[0105] In some embodiments, the probe has the sequence of SEQ ID NO:5: CGTAAAAGCTTGTTCAAACCGGCACTCA (SEQ ID NO: 5) is substantially homologous to

[0106] In some embodiments, the probe has the sequence of SEQ ID NO:6: CTCAATTTACTAGCGTTCATTTCACTTAG (SEQ ID NO: 6) is substantially homologous to

[0107] In some embodiments, the probe comprises a detectable label covalently attached to the probe. Non-limiting examples of detectable labels include 1,5-IAEDANS; 1,8-ANS; 2'-chloro-7'phenyl-1,4-dichloro-6-carboxyfluorescein (VIC); 3(4)-carboxyfluorescein dipivalate NHS ester; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide phosphoramidite; 3(4)-carboxyfluorescein dipivaloyl-N-succinimidyl ester; 4-methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-carboxynaphthofluorescein; 5-carboxyfluorescein dipivalate; 5-carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-carboxyfluorescein); 5-HAT (hydroxytryptamine); 5-hydroxytryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-carboxytetramethylrhodamine); 6-carboxyfluorescein (6-FAM); 6-carboxyfluorescein dipivalate; 6-carboxynaphthofluorescein; 6-carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-amino-4-methylcoumarin; 7-aminoactinomycin D (7-AAD); 7-hydroxy-4-methylcoumarin; 9-amino-6-chloro-2-methoxyacridine; ABQ; ABY; Acid Fuchsin; ACMA (9-amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavine; Acriflavine Feulgen SITSA; Alexa Fluor 350; Alexa Fluor 405; Alexa Fluor 430; Alexa Fluor 488; Alexa Fluor 500; Alexa Fluor 514; Alexa Fluor 532; Alexa Fluor 546; Alexa Fluor 555; Alexa Fluor 568; Alexa Fluor 594; Alexa Fluor 610; Alexa Fluor 633;Alexa Fluor 635; Alizarin Complexone; Alizarin Red; AMC; AMCA-S; AMCA (aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Aminomethylcoumarin (AMCA); Aniline Blue; Anthrosyl Stearate; APTRA-BTC; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7GLL; Atab Lin;ATTO390;ATTO425;ATTO465;ATTO488;ATTO495;ATTO520;ATTO532;ATTO550;ATTO565;ATTO590;ATM594;ATTO610; ATTO611X;ATTO620;ATTO633;ATTO635;ATTO647;ATTO647N;ATTO655;ATTO680;ATTO700;ATTO725;ATTO740;ATTO-TAG CBQCA; ATTO-TAG FQ; Auramine; Aurophosphine G; Aurophosphine; BAO9 (Bisaminophenyloxadiazole); BCECF (High pH); BCECF (Low pH); Berberine Sulfate; Bimane; Bisbenzamide; Bisbenzimide (Hoechst); Bis-BTC; Brancofol FFG; Brancofol SV; BOBO-1; BOBO-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy Fl; Bodipy FL ATP; Bodipy Fl-ceramide; Bodipy R6G; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X; SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO-1; BO-PRO-3; Brilliant Sulfoflavin FF; BTC; BTC-5N; Calcein; Calcein Blue; Calcium Crimson; CAL Fluor Gold 540;CAL Fluor Orange 560; CAL Fluor Red 590; CAL Fluor Red 610; CAL Fluor 635; Calcium Green; Calcium Green-1 Ca2+ dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White White); Carboxyfluorescein diacetate; Carboxyfluorescein diacetate succinimidyl ester; Carboxyfluorescein dipivalate succinimidyl ester; Carboxyfluorescein succinimidyl ester (CFSE); Carboxy-X-rhodamine (5-ROX); Cascade Blue; Cascade Yellow; Catecholamines; CCF2 (GeneBlazer); CFDA; Chromomycin A; Chromomycin A; CL-NERF; CMFDA; Coumarin phalloidin; CPM methylcoumarin; CTC; CTC formazan; Cy2; Cy3.1 8; Cy3.5; Cy3; Cy5.1 8; Cyclic AMP Fluorosensor (FiCRhR); Dabsyl; Dansyl; Dansylamine; Dansylcadaverine; Dansyl chloride; Dansyl DHPE; Dansyl fluoride; DAPI; Dapoxil; Dapoxil 2; Dapoxil 3'DCFDA; DCFH (Dichlorodihydrofluorescein diacetate); DDAO; DHR (Dihydrorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); DiA (4-di-16-ASP); Dichlorodihydrofluorescein Dichlorodiacetic acid (DCFH); DiD-lipophilic tracer; DiD (DiIC18(5)); DIDS; dihydrorhodamine 123 (DHR); DiI (DiIC18(3)); dinitrophenol; DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); dipivaloyl-3(4)-(N-(6'-hydroxyhexyl))-carboxamide; DM-NERF (high pH); DNP; dopamine; DTAF; DY-630-NHS; DY-635-NHS; DyLight 405; DyLight 488; DyLight 549; DyLight 633;DyLight 649;DyLight 680;DyLight 800; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium bromide; Ethidium homodimer-1 (EthD-1); Euchrysin; EukoLight; Europium(III) chloride; Fast Blue; FDA; Feulgen (pararosaniline); FIF (formaldehyde-induced fluorescence); FITC; Furazo Orange; Fluo-3; Fluo-4; Fluorescein (FITC); Fluorescein amidite (FAM); Fluorescein diacetate; Fluorescein diacetate 6-Isothiocyanate; Fluorescein Dipivaloylamidite; Fluorescein Phosphoramidite; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluoro-Ruby; Fluoro-X; FM1-43; FM4-46; Fura Red (High pH); Fura Red / Fluo-3; Fura-2; Fura-2 / BCECF; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow SGF; GeneBlazer (CCF2); Gloxalic Acid; Granular Blue blue); Hematoporphyrin; HEX; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; Hydroxycoumarin; Hydroxystilbamidine (Fluorogold); Hydroxytryptamine; Indo-1; High Calcium; Indo-1; Low Calcium; Indodicarbocyanine (DiD); Indotricarbocyanine (DiR); IntraWhite Cf; JC-1; JOE; JO-JO-1; JO-PRO-1; JUN; LaserPro; Laurodan; LDS751 (DNA); LDS751 (RNA); Leukophor PAF; Leukophor SF; Leukophor WS; Lissamine rhodamine; Lissamine rhodamine B; Calcein / ethidium homodimer; LOLO-1; LO-PRO-1; Lucifer Yellow; Lysotracker Blue; Lysotracker Blue-White; Lysotracker Green; Lysotracker Red; Lysotracker Yellow; Lysosensor Blue; Lysosensor Green; Lysosensor Yellow / Blue; Mag Green; Magdala Red (Phloxine B); Magufla Red;Magufla-2; Magufla-5; Mag-Indo-1; Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxillon Brilliant Flavin 10 GFF; Maxillon Brilliant Flavin 8 GFF; Merocyanine; Methoxycoumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mithramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD-amine; Nile Red; Nitrobenzoxazidol; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant Flavin EBG; Oregon Green; Oregon Green 488-X; Oregon Green; Oregon Green 488; Oregon Green 500; Oregon Green 514; Pacific Blue; Pararosaniline (Feulgen); PBFI; Phloxine B (Magdala Red); Phorwite AR (Phorwite AR); Holwight BKL; Holwight Rev; Holwight RPA; Phosphine 3R; PKH26 (Sigma); PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primulin; Procion Yellow; Propidium iodide (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrosalvian Flavin 7GF; QSY7; Quinacrine Mustard; Resorufin; RH414; Rhodamine-2 (Rhod-2); Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5GLD; Rhodamine 6G; Rhodamine B; Rhodamine B200 ; Rhodamine B Extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine phallicidin; Rhodamine phalloidin; Rhodamine Red; Rhodamine WT; Rose Bengal; S65A; S65C; S65L; S65T; SBFI; Serotonin; Cebron Brilliant Red 2B; Cebron Brilliant Red 4G; Cebron Brilliant Red B; Cebron Orange; Cebron Yellow L; SITS; SITS (primulin); SITS (stilbene isothiosulfonic acid); SNAFL calcein; SNAFL-1; SNAFL-2; SNARF calcein; SNARF1; Sodium Green;Spectrum Aqua; Spectrum Green; Spectrum Orange; Spectrum Red; SPQ (6-methoxy-N-(3-sulfopropyl)quinolinium); Stilbene; Sulforhodamine B can C; Sulforhodamine Extra; SUN; SYBR Green; SYTO11; SYTO12; SYTO13; SYTO14; SYTO15; SYTO16; SYTO17; SYTO18; SYTO20; SYTO21; SYTO22; SYTO23; SYTO24; SYTO25; SYTO40; SYTO41; SYTO42; SYTO43; SYTO44; SYTO45; SYTO59; SYTO60; SYTO61; SYTO62; SYTO63; SYTO64; SYTO80; SYTO81; SYTO82; SYTO83; SYTO84; SYTO85; SYTOX Blue; SYTOX Green; S Examples of suitable dyes include YTOX Orange; TAMARA; tetracycline; tetrachlorofluorescein (TET); tetramethylrhodamine (TAMRA); Texas Red; Texas Red X conjugate; thiadicarbocyanine (DiSC3); thiazine red R; thiazole orange; thioflavin 5; thioflavin S; thioflavin TCN; thiolite; thiozole orange; Tinopol CBS (calcofluor white); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TRITC (tetramethylrhodamine isothiocyanate); True Blue; TruRed; Ultralight; Uranine B; Uvitex SFC; WW781; X-rhodamine; XRITC; xylene orange; Y66F; Y66H; Y66W; Yamica yellow; YO-PRO-1; YO-PRO-3; YOYO-1 or YOYO-3; or any combination thereof. ;

[0108] In some embodiments, the probe further comprises a quencher of the detectable label, wherein the quencher of the detectable label is covalently attached to the probe. In some embodiments, the quencher is selected from the group consisting of BBQ-650, BHQ-1, BHQ-2, BHQ-3, Black Hole Quencher (BHQ), Dabcyl, Eclipse, IBFQ, Iowa Black, TAMARA, TAMRA, ZEN, or ZEN Iowa Black, or any combination thereof. However, it should be understood that these are non-limiting examples of quenchers.

[0109] In some embodiments, quenching of the detectable label ceases following hydrolysis of a covalent bond within the reporter nucleic acid molecule, where a first hydrolysis product comprises the detectable label and a second hydrolysis product comprises a quencher of the detectable label; the detectable label and the quencher are separated; or the hydrolysis prevents the quencher molecule from quenching the detectable signal.

[0110] In some embodiments, the probes or amplicons may be detected using dsDNA binding dyes or by other methods known in the art.

[0111] In some embodiments, a complex is provided comprising a target nucleic acid molecule and a probe, wherein the target nucleic acid molecule is substantially complementary to SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and the probe specifically binds to the target.

[0112] In some embodiments, the target nucleic acid molecule, or a fragment thereof, or a complement thereof, is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, the target nucleic acid molecule, or a fragment thereof, or a complement thereof, is substantially homologous to SEQ ID NO: 4: CCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATATCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACTTCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTGTTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAA TGTATACCAATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTCAATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAATGGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTAACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGA (SEQ ID NO: 4), or a fragment thereof, or a complement thereof. In some embodiments, SEQ ID NO:4 is the amplicon resulting from amplification of SEQ ID NO:1, illustratively when the primers are SEQ ID NO:2 and SEQ ID NO:3.

[0113] In some embodiments, the probe specifically hybridizes to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

[0114] In some embodiments, an oligonucleotide molecule is provided, the oligonucleotide molecule comprising the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof, or the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof, wherein the oligonucleotide molecule is detectable by direct or indirect detection. In some embodiments, the oligonucleotide molecule is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof. In some embodiments, the oligonucleotide molecule is unlabeled. In some embodiments, the oligonucleotide molecule is labeled with a detectable label. In some embodiments, the oligonucleotide molecule is a PCR product.

[0115] In some embodiments, compositions, such as amplification reaction mixtures, are provided that include primers described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer, to which a target nucleic acid can be added. In some embodiments, compositions, such as amplification reaction mixtures, are provided that include primers described herein; a probe described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer. In some embodiments, compositions, such as amplification reaction mixtures, are provided that include a composition described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer.

[0116] In some embodiments, the deoxynucleoside triphosphate nucleotides (dNTPs) comprise a mixture of dATP, dCTP, dGTP, and dTTP. In some embodiments, the dNTPs further comprise deoxyuridine triphosphate (dUTP) in combination with uracil DNA glycosylase (UDG) pretreatment as a strategy to prevent carryover PCR contamination. In some embodiments, the dNTPs comprise a mixture of dATP, dCTP, dGTP, and dUTP. In some embodiments, the dUTP is modified. In some embodiments, the dUTP is aminoallyl-dUTP, fluorescein-12-dUTP, 5-bromo-dUTP, or biotin-11-dUTP. Other natural or unnatural dNTPs may also be used.

[0117] In some embodiments, the polymerase is derived from Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu polymerase), Thermococcus litoralis (Wind or Tli polymerase or Vent polymerase), or Thermus thermophilus (Tth polymerase). In some embodiments, the polymerase is specifically modified for the incorporation of uracil. In some embodiments, the polymerase is specifically modified for the incorporation of modified dNTPs.

[0118] In some embodiments, the buffer comprises Tris-HCl, potassium chloride (KCl), and magnesium chloride (MgCl). In some embodiments, the buffer comprises Tris-HCl, ammonium sulfate ((NH)SO), and magnesium chloride (MgCl).

[0119] In some embodiments, the composition further comprises a test sample. In some embodiments, the test sample comprises a brewery product such as malt, fermented malt, fermented alcoholic beverage, malt beverage, or beer. In some embodiments, the test sample comprises a solid suspension. In some embodiments, the test sample comprises yeast cells. In some embodiments, the test sample comprises a yeast slurry. In some embodiments, the test sample comprises yeast cells separated from a solid suspension. In some embodiments, the test sample comprises lysed yeast cells. In some embodiments, the test sample comprises genomic DNA from yeast cells. In some embodiments, the test sample comprises digested genomic DNA from yeast cells.

[0120] In some embodiments, the composition further comprises a genomic-free oligonucleotide molecule. In some embodiments, the genomic-free oligonucleotide molecule is a PCR product. In some embodiments, the genomic-free oligonucleotide molecule is substantially homologous to SEQ ID NO: 1, a fragment thereof, or a complement thereof, or SEQ ID NO: 4, a fragment thereof, or a complement thereof.

[0121] In some embodiments, the detectable amplicon is a PCR product. In some embodiments, the detectable amplicon is an RT-PCR product.

[0122] In some embodiments, a primer capable of specifically binding to SEQ ID NO: 1 is provided, the primer comprising a 3' end with a free hydroxyl group. In some embodiments, the primer comprises, consists of, or consists essentially of a portion of the sequence of SEQ ID NO: 1, or a complement thereof. In some embodiments, the primer comprises the sequence of SEQ ID NO: 2, or a fragment thereof, or a complement thereof. In some embodiments, the primer comprises the sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof. In some embodiments, one or both of the primers further comprises a detectable moiety attached to the 5' end of the primer.

[0123] In some embodiments, a container is provided that contains a composition as described herein. In some embodiments, the container is a tube, a plate, a reaction vessel, or the like.

[0124] How to use In some embodiments, methods are provided for detecting a nucleic acid molecule having the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof, or a variant thereof.

[0125] In some embodiments, the methods described herein involve detecting an analyte in a test sample. In some embodiments, the test sample comprises a brewery product. In some embodiments, the test sample comprises malt, fermented malt, fermented alcoholic beverage, malt beverage, or beer. In some embodiments, the test sample comprises a suspension of yeast cells. In some embodiments, the test sample comprises a suspension of yeast cells in a centrifugable container. In some embodiments, the test sample comprises yeast cells separated from a suspension of yeast cells. In some embodiments, the test sample comprises a pellet of yeast cells separated from a suspension of yeast cells by centrifugation, and the supernatant is decanted from the pellet. In some embodiments, the test sample comprises yeast cells and a lysis buffer. In some embodiments, the test sample comprises yeast cells whose cell walls have been lysed. In some embodiments, the test sample comprises genomic DNA from lysed yeast cells. In some embodiments, the test sample comprises genomic DNA from lysed yeast cells and a DNA digestion buffer. In some embodiments, the sample is derived from another sample. For example, a PCR reaction can be performed on a nucleic acid mixture extracted, isolated, and / or purified from another sample (e.g., beer). The PCR reaction may be a sample derived from another sample.

[0126] In some embodiments, primers are provided to either or both of the STA1 and STA2 genes, as known in the art. Primers to STA1 and / or STA2 can be provided in the same reaction mixture as the primers described herein for detecting SEQ ID NO:1 in a single multiplex reaction, or primers to STA1 and / or STA2 can be provided to be run in separate reaction chambers.

[0127] In some embodiments, primers described herein for detecting SEQ ID NO:1 are provided for use without primers for STA1 and / or STA2. In such embodiments, a method can include determining that a sample of yeast is a saccharifying yeast without determining the STA1 or STA2 status of the sample.

[0128] Although the present disclosure has been described in considerable detail with reference to certain preferred embodiments, other versions are possible. Therefore, the spirit and scope of the appended claims should not be limited to the description and preferred versions contained herein. Next, embodiments will be described with reference to the following examples. These examples are provided for illustrative purposes only, and the embodiments should not be construed as being limited to these examples in any way, but rather as encompassing any variations that become apparent as a result of the teachings provided herein. Those skilled in the art will readily recognize a variety of non-critical parameters that can be changed or modified to yield essentially similar results.

[0129] kit In some embodiments, kits for use in the methods described herein are provided. The kits may include a detection device described herein, a sample collection device, a buffer container, instructions, a positive control, a negative control, or any combination thereof. With respect to kits, a positive control is a sample known to contain an analyte that can be detected by the device present in the kit. In contrast, a negative control would not contain an analyte that can be detected by the kit. The kit may also include instructions for use.

[0130] system In some embodiments, systems are provided for use with the methods described herein. The systems may include kits or mixtures as described above, along with equipment for performing the assays. In at least one embodiment, the system shown in FIG. 4 may include at least one PCR reaction mixture contained in a sample vessel 714. In certain embodiments, the sample vessel 714 may include a PCR reaction mixture configured to allow and / or amplify a template nucleic acid. Certain exemplary embodiments may also include at least one sample block or chamber 716 configured to receive the at least one sample vessel 714. The sample vessel 714 may include any plurality of sample vessels in individual, strip, plate, or other formats, illustratively provided as or received by the sample block or chamber 716.

[0131] One or more embodiments may also include at least one sample temperature controller 718 and / or 720 configured to manipulate and / or adjust the temperature of the sample. Such a sample temperature controller may be configured to raise, lower, and / or maintain the temperature of the sample. In one example, the sample controller 718 is a heating system and the sample controller 720 is a cooling system. Exemplary sample temperature controllers include, but are not limited to, heating and / or cooling blocks, heating elements, exchangers, coils, radiators, refrigerators, filaments, Peltier elements, forced air blowers, handlers, vents, distributors, compressors, condensers, water baths, ice baths, flames and / or other forms of combustion or combustible heat, hot packs, cold packs, dry ice, dry ice baths, liquid nitrogen, microwaves and / or other wave-emitting devices, cooling means, heating means, means for otherwise manipulating the temperature of the sample, and / or other suitable devices configured to raise, lower, and / or maintain the temperature of the sample.

[0132] The exemplary PCR system 700 also includes an optical system 710 configured to detect the amount of fluorescence emitted by the sample 714 (or portions or reagents thereof). Such an optical system 710 may include one or more fluorescence channels, as known in the art, and may detect fluorescence from multiple samples simultaneously or individually.

[0133] At least one embodiment of the PCR system may further include a CPU 706 programmed or configured to operate, control, execute, or otherwise proceed with the heating system 718 and the cooling system 720, for example, to thermocycle the PCR reaction mixture while the optical system 710 collects the fluorescent signal. The CPU 706 may then generate an amplification curve, a melt curve, or any combination, which may or may not be printed, displayed or displayed on the screen of the user terminal 704, or output in any other manner. Optionally, based on the amplification curve and / or the melt curve, a positive, negative, or other call may be output, for example, on the screen of the user terminal 704. Optionally, only a call is output, for example, one call for each target tested.

[0134] The CPU 706 can include a program memory, a microcontroller or microprocessor (MP), random access memory (RAM), and input / output (I / O) circuitry, all interconnected via an address / data bus. The program memory can include an operating system such as Microsoft Windows®, OS X®, Linux®, or Unix®. In some embodiments, the CPU 706 can include or be otherwise communicatively connected to a database or other data storage mechanism (e.g., one or more hard disk drives, optical storage drives, solid-state storage devices, etc.). The database can include data such as melting curves, annealing temperatures, denaturation temperatures, and other data necessary for generating and analyzing melting curves. The CPU 706 can include multiple microprocessors, multiple RAMs, multiple program memories, and multiple different types of I / O circuitry. The CPU 706 can implement the RAM and program memory as, for example, semiconductor memory, magnetically readable memory, and / or optically readable memory.

[0135] The microprocessor may be adapted and configured to execute, in addition to other software applications, any one or more of a plurality of software applications and / or any one or more of a plurality of software routines present in the program memory. One of the plurality of routines may include a thermocycling routine, which may include providing control signals to a heating system 718 and a cooling system 720 to heat and cool, respectively, the sample 714 according to a two-stage PCR protocol. Another of the plurality of routines may include a fluorescence routine, which may include providing control signals to an optical system 710 to emit a fluorescent signal and detect the amount of fluorescence scattered by the sample 714. Yet another of the plurality of routines may include a sample calling routine, which may include acquiring fluorescence data (temperature, fluorescence pair) from the optical system 710 during an intra-cycle temperature adjustment segment for each of the N cycles, generating a composite melting curve by combining the fluorescence data from each of the N cycles during the respective intra-cycle temperature adjustment segment, analyzing the composite melting curve to make a positive or negative call, and displaying an indication of the composite melting curve, individual melting curves, and / or the call on the user terminal 704.

[0136] In some embodiments, the CPU 706 can communicate with the user terminal 704, heating system 718, cooling system 720, optical system 710, and sample block 716 via communications network 722-732 via wired or wireless signals, and in some cases via intervening wireless or wired devices, which may be wireless routers, wireless repeaters, cell phone provider base stations, etc. The communications network can be a wireless communications network, such as a fourth- or third-generation cellular network (4G or 3G, respectively), a Wi-Fi network (802.11 standard), a WiMAX network, a wide area network (WAN), a local area network (LAN), or the Internet. Additionally, the communications network can be a dedicated network, a secure public Internet, a virtual private network, and / or other types of networks, such as dedicated access lines, regular telephone lines, satellite links, or combinations thereof. When the communications network comprises the Internet, data communications may occur over the communications network via Internet communications protocols. Additionally, the communications network can be a wired network, with data communications occurring via Ethernet or universal serial bus (USB) connections.

[0137] In some embodiments, CPU 706 may be included within user terminal 704. In other embodiments, CPU 706 may communicate with user terminal 704 via a wired or wireless connection (e.g., as a remote server) and display individual melt curves, composite melt curves, calls, etc. on user terminal 704. In addition to CPU 706 or another CPU similar to CPU 706, user terminal 704 may include a user interface, a communications unit, and user input devices such as a "soft" keyboard displayed on the user interface of user terminal 704, an external hardware keyboard (e.g., a Bluetooth keyboard) communicating via a wired or wireless connection, an external mouse, or other suitable user input device. [Example]

[0138] Example Various aspects of the present disclosure will now be described with reference to the following non-limiting examples.

[0139] Example 1: Identification of predictive DNA regions for glycosylation activity in Saccharomyces cerevisiae. The goal of this study was to identify previously unidentified DNA sequences within the Saccharomyces cerevisiae genome that predict saccharification activity and beer spoilage.

[0140] The genomes of 81 Saccharomyces cerevisiae strains were screened for unique sequences that could be used as predictors of saccharification activity and spoilage potential. Thirty-two of these strains were sequenced by short-read sequencing using the Illumina HiSeq platform. Long-read sequencing was provided by Cornell University. High-quality genome assemblies were generated using both long- and short-read sequencing data.

[0141] Saccharomyces cerevisiae strains included both STA1-positive and STA1-negative phenotypes. Phenotypic activity was assessed by pH monitoring as a readout for maltodextrin-supported growth. This method was described by Burns et al. (2021) as a functional assessment of saccharification risk. Using the phenotypic data, two strains (STA1+ and STA-) were established as foreground and background controls, respectively.

[0142] The Bionumerics PCR plugin was used to screen for potential candidates correlated with glycosylation activity. A total of 600 consensus output sequences were recovered from this screening. These sequences were compared to a sequence read database created from all sequenced OYL strains using the Basic Local Alignment Search Tool (BLAST). Potential candidates were identified using a similarity matrix containing the resulting hits, %IDs, and correlation with phenotypic data.

[0143] An in silico screening of the 600 output sequences was performed in Geneious to find potential targets for primer design and validation. One target was an unannotated genomic region within a large region of chromosome 7 containing the sequence of SEQ ID NO: 1: ACGCGAGAATACTAAGCCCAAGCCTCTCCAAATTGATTTCCTTTTGGTACTGAAAGACTTAGTATCAACCTCAAAAAGTTGAAATTTCTGTAGATAAATATGCAGATGACATGAAGTACCCAGTTCTTTTGTGAATATGGAAGTAGTTTTCTTTCAAATCGTTATTAATATTTCCTCTGCCCTCTTCACCTTATAGCTTTAGGAAACACTACTCTATTCATATTCAACTAAAAAAGTAGTATATTTCCTTCCGTTAGAATTGTGGTACAAACCAGCGCAATATAAACCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATATCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACTTCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTGTTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATACCAATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTCAATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAATGGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTAACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGACAAATGTTCTATTGAAAAAGTGATGTCCTCTGAAGAGTAAAGGCACTATGGGGCGTTGCAACTAAAGGAGATATTAGATTCATCAAAAGTGAGATTTTTTCATAAAACATGAGTCTATATCAGGTGAAACAGTTTGAGGCAGCCTTAATATGGAACTGAAAAAGCAAAATCAAAGGCAAAAGTTTCTCATATATATATGGCATTGTTGATCACCCAGTGC (SEQ ID NO: 1).

[0144] Phenotypic and genotypic data are summarized in Table 1. Strains with high glycation risk are designated POS(+) and strains with low glycation risk are designated NEG(-). OYL strain 52 was identified as having a low potential glycation risk, a STA1 positive (+) genotype, and a presumptive negative (-) genotype for the sequence of SEQ ID NO: 1. OYL strain 56 was identified as having a high potential glycation risk, a STA1 negative (-) genotype, and a presumptive positive (+) genotype for the sequence of SEQ ID NO: 1. OYL strain 56 was identified as having a moderate potential glycation risk, a STA1 positive (+) genotype, and a presumptive positive (+) genotype for the sequence of SEQ ID NO: 1.

[0145] TIFF2026502178000002.tif248170TIFF2026502178000003.tif249170TIFF2026502178000004.tif76170

[0146] Primer pairs were designed for the target, tested for glycosylation activity, and compared with phenotypic data. To aid in primer design, predicted open reading frames (ORFs) within the target sequence were identified (Figure 1). For example, a primer pair was designed for SEQ ID NO: 1. The primer pair consisted of a first primer with the sequence of SEQ ID NO: 2: CCCTGATTGCCTCATGCGA (SEQ ID NO: 2), and a second primer having the sequence of SEQ ID NO: 3: TCAAGCGCGTTCAAACCG (SEQ ID NO: 3) It was composed of:

[0147] The predicted amplicon of the primer pair for SEQ ID NO: 1 is the sequence of SEQ ID NO: 4: CCCTGATTGCCTCATGCGAGACTTTCAGTAACATCAATCTCCATACATATCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACTTCAACTTTTTTTATCCTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTGTTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATACCAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTCAATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGTAAATTGGTAAATGGACAGACCGTGTTCCATCTCAAAGTTACTACTCACAAACGCTAATCAAGAACTAACTGTCGAAGTAATTAGCGGTTTTGAACGGCTTGA(sequence number 4), including.

[0148] As shown in Figures 3A-3C, unannotated genomic regions containing the sequences SEQ ID NO:1 or SEQ ID NO:4 were found to be predictive of saccharification activity in Saccharomyces cerevisiae. The predicted regions (SEQ ID NO:1 or SEQ ID NO:4) were only observed in saccharifying strains of S. cerevisiae. Because saccharification activity in yeast predicts a high potential for beer spoilage, the presence of contaminating yeast containing the sequences SEQ ID NO:1 or SEQ ID NO:4 in a beer sample predicts a high potential for beer spoilage. Such contaminating yeast are predicted to significantly affect the concentrations of starch, maltose, dextrin, glucose, ethanol, and CO2 compared to uncontaminated beer samples. In other words, if the predicted region for saccharification activity (SEQ ID NO:1 or SEQ ID NO:4) is absent from the contaminating yeast, beer spoilage is unlikely to occur. In contrast, if contaminating yeast containing the sequences SEQ ID NO:1 or SEQ ID NO:4 in the genome is present in beer, the contaminated beer is predicted to have significantly increased starch, maltose, dextrin, glucose, ethanol, and CO2 compared to uncontaminated beer samples. In other words, if the predicted region for saccharification activity (SEQ ID NO: 1 or SEQ ID NO: 4) is present in the contaminating yeast, the contaminated beer will likely support the contaminating yeast culture, which will likely spoil the beer. Saccharification activity in the contaminating yeast can significantly increase the concentrations of maltose and glucose in the beer, promoting fermentation activity. Fermentation activity can cause the beer to over-ferment during brewing or re-ferment after brewing and packaging, resulting in container rupture. Fermentation activity can increase the ethanol concentration in the beer beyond legal limits.

[0149] Interestingly, the unannotated genomic region containing the sequence of SEQ ID NO: 1 proved to have superior predictability for saccharification activity compared to that of STA1. For example, STA1(+) and non-saccharifier isolates were found to lack the predicted region (SEQ ID NO: 1), while STA1(-) saccharifiers were found to have the predicted region (SEQ ID NO: 1) within their genomes. In other words, the predicted region (SEQ ID NO: 1) was found only in saccharifiers, regardless of STA genotype. While most known saccharifiers possess STA1, not all saccharifiers possess STA1. Without being bound by theory, the predicted region (SEQ ID NO: 1) may encode a third glucoamylase, a transcript or protein that regulates the expression of a third glucoamylase, or a transcript or protein that regulates the activity of a third glucoamylase.

[0150] Next, probes were designed targeting SEQ ID NO: 1. The first probe was designed to target the sequence SEQ ID NO: 5: CGTAAAAGCTTGTTCAAACCGGCACTCA (SEQ ID NO: 5) The nucleic acid molecule contained the following:

[0151] The second probe has the sequence of SEQ ID NO:6: CTCAATTTACTAGCGTTCATTTCACTTAG (SEQ ID NO: 6) The nucleic acid molecule contained the following:

[0152] The probe may be labeled with a fluorophore and a quencher. In this embodiment, one of the first probe and the second probe is used in a single reaction.

[0153] Examples of primers consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, and probe of SEQ ID NO: 5 and their binding sites are shown in FIG.

[0154] The predicted region (SEQ ID NO: 1) or a fragment thereof can be detected using several detection methods, including real-time PCR. In one example, the fragment of SEQ ID NO: 1 can be SEQ ID NO: 4.

[0155] Sample preparation methods vary depending on the type of sample.

[0156] The sample can also be a yeast colony. For sample preparation, a colony is picked and transferred to a container containing dH2O. For negative controls, dH2O is used. The contents are mixed by pipetting the sample up and down or by vortexing. The colony resuspension is transferred to a tube containing PCR reagents. The PCR tube is opened only to add the sample and is then quickly closed to avoid cross-contamination between tubes. Samples from yeast colony resuspensions do not require DNA restriction digestion.

[0157] The sample can be beer. For sample preparation, the beer-containing sample is centrifuged, and the supernatant is carefully decanted without disturbing the pellet. The pellet is resuspended in buffer, and the sample is mixed until no pellet is visible. The dissolved sample is transferred to a tube containing reagents for DNA restriction digestion that can fit into a PCR tube holder. The PCR tube holder is placed in a thermocycler. For best results, the tube is briefly centrifuged before transferring to the thermocycler. A DNA restriction digest program is run on the thermocycler. Once the digestion program is complete, the digestion tube is immediately removed from the PCR machine. Immediately after the digestion step, the sample is transferred from the top third of the digestion tube to a tube containing PCR reagents. The target DNA is present as a solution in the upper part of the tube.

[0158] The sample can be concentrated beer. To concentrate the beer, in one exemplary embodiment, the beer is incubated with growth medium at +30°C / +35°C for 46-50 hours. The sample is centrifuged, and the supernatant is carefully decanted without disturbing the pellet. The pellet is resuspended in buffer by pipetting until no pellet is visible. For sample preparation, the sample containing concentrated beer is centrifuged, and the supernatant is carefully decanted without disturbing the pellet. The pellet is resuspended in buffer, and the sample is mixed until no pellet is visible. The dissolved sample is transferred to a tube containing reagents for DNA restriction digestion that fits into a PCR tube holder. The PCR tube holder is placed in a thermocycler. For best results, the tube is briefly centrifuged before transferring to the thermocycler. A DNA restriction digest program is run on the thermocycler. Once the digestion program is complete, the digestion tube is immediately removed from the PCR instrument. Immediately after the digestion step, the sample is transferred from the top third of the digestion tube to a tube containing PCR reagents. The target DNA is present as a solution in the upper part of the tube.

[0159] The sample can be hazy beer. Alternatively, the sample can be an FV / yeast slurry. For sample preparation, samples containing either the hazy beer or the FV / yeast slurry are centrifuged, and the supernatant is carefully decanted without disturbing the pellet. The pellet is resuspended in buffer, and the sample is mixed until the pellet is no longer visible. The dissolved sample is transferred to a tube containing reagents for DNA restriction digestion that can fit into a PCR tube holder. The PCR tube holder is placed in a thermocycler. For best results, the tube is briefly centrifuged before transferring to the thermocycler. A DNA restriction digest program is run on the thermocycler. Once the digestion program is complete, the digestion tube is immediately removed from the PCR instrument. The sample is transferred to a 5 μM filter column tube in a column collection tube, and the sample is briefly centrifuged. The filter column is removed, and the sample is collected from the bottom of the column collection tube and transferred to a tube containing PCR reagents.

[0160] It should be understood that the above sample preparation methods are exemplary only, and that other sample preparation methods are within the scope of this disclosure.

[0161] The target nucleic acid molecule can then be amplified, for example, by PCR, which can be RT-PCR.

[0162] In one illustrative example, after sample preparation, the sample is transferred to a tube, well, or other container containing PCR reagents. After sample addition, the tube may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1-0.5 μM of a primer having the sequence of SEQ ID NO:2; 0.1-0.5 μM of a primer having the complement of the sequence of SEQ ID NO:3; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM of a probe having the sequence of SEQ ID NO:5 or SEQ ID NO:6; and PCR buffer. An example in which the probe has SEQ ID NO:5 is shown in Figure 1. Alternatively, to detect multiple analytes, a tube can contain, for example, 10 ng of template DNA (200 pg / μL); 0.1-0.5 μM of a primer having the sequence of SEQ ID NO:2; 0.1-0.5 μM of a primer having a complement to the sequence of SEQ ID NO:3; 0.1-0.5 μM of a forward primer targeting STA1 and / or STA2; 0.1-0.5 μM of a reverse primer targeting STA1 and / or STA2; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM of a probe having the sequence of SEQ ID NO:5 or SEQ ID NO:6; a probe for STA1 and / or STA2; and a PCR buffer. Helper oligonucleotides or a second probe can also be added. Alternatively, a dye, such as SYBR Green, can be used instead of the probe.

[0163] In this example, DNA amplification is accomplished using PCR. Multiplex protocols may be used. An exemplary protocol is 35-40 cycles of 94°C x 1 min, 58.1°C x 2 min, and 72°C x 3 min, followed by a 4°C hold. Once the run is complete, the results are analyzed. Color compensation is applied to eliminate signal crosstalk. Ct / Cp values ​​are calculated.

[0164] Amplification curves have a characteristic shape, with an initial induction phase, an exponential amplification phase, and a final plateau phase. The final plateau phase represents a decrease in reaction efficiency as reagents are consumed and may not be reached in reactions containing low concentrations of target organisms. Amplification curves that deviate from the characteristic shape should be interpreted with caution. For each amplification reaction, the cycle at which the fluorescent signal exceeds background fluorescence is determined and is called the "threshold cycle" (Ct) or "crossing point" (Cp), depending on the instrument. Ct / Cp will occur at an early cycle in samples containing high levels of target organisms and will be delayed in reactions containing low levels of target organisms. Real-time PCR and / or post-PCR melting can be used to detect single amplicons.

[0165] Depending on the detection method used, the presence of an amplification curve indicates the presence of an amplicon in the sample. The presence of an amplicon having a sequence substantially homologous to the sequence of SEQ ID NO: 4 indicates a sample that is positive for Saccharomyces cerevisiae. High Ct / Cp values ​​(e.g., ≥ 38) may indicate a false positive. Negative and positive controls can be used to confirm the functionality of the assay. Samples can also be re-run with a higher concentration of template DNA. Putative positive samples can be confirmed by microbiological plating and colony PCR.

[0166] Target nucleic acid molecules can be amplified by PCR, for example, according to the following method. After sample preparation, the sample is transferred to a tube containing PCR reagents. After addition of the sample (illustratively 5 μL, but other amounts can be used), the tube may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 2; 0.1 to 0.5 μM of a primer having the complement of the sequence of SEQ ID NO: 3; deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP, each at 200 μM); DNA polymerase (0.05 units / μL Taq); and PCR buffer. Alternatively, to detect multiple analytes, the tube can contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 2; 0.1 to 0.5 μM of a primer having a complement to the sequence of SEQ ID NO: 3; 0.1 to 0.5 μM of a forward primer targeting STA1 and / or STA2; 0.1 to 0.5 μM of a reverse primer targeting STA1 and / or STA2; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); and PCR buffer.

[0167] DNA amplification is achieved using PCR, for example, using the following protocol: 94°C x 1 min, 58.1°C x 2 min, and 72°C x 3 min, repeated 25-30 times; then hold at 4°C.

[0168] Although the present invention has been described and exemplified in sufficient detail to enable those skilled in the art to make and use the same, various alternatives, modifications, and improvements will become apparent without departing from the spirit and scope of the invention. The examples provided herein are representative of preferred embodiments, are illustrative, and are not intended to limit the scope of the invention. Modifications and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention, which is defined by the claims. It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. All patents and publications mentioned in this specification are indicative of the level of ordinary skill in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0169] The invention illustratively described herein can suitably be practiced in the absence of any elements or limitations not specifically disclosed herein. The terms and expressions used are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions to exclude equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claimed invention. Thus, while the present invention has been specifically disclosed by preferred embodiments and optional features, it will be understood that those skilled in the art may make modifications and variations of the concepts disclosed herein, and that such modifications and variations are deemed to be within the scope of the invention as defined by the appended claims.

[0170] Other embodiments are set forth in the following claims.

[0171] References Krogerus, K., et al. Appl Microbiol Biotechnol 103, 7597-7615 (2019). Burns et al.J Am Society of Brewing Chemists 79,167-180(2021).

Claims

1. 1. A method for detecting an organism containing a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO:1, or a fragment thereof, or a complement thereof, in a test sample, comprising: a. reacting a test sample with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to the complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and b. Detecting the presence or absence of an amplicon A method comprising:

2. 10. The method of claim 1, further comprising reacting the test sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds, and wherein the detecting step comprises detecting a signal from the probe that indicates amplification.

3. 2. The method of claim 1, wherein the first primer and the second primer are each independently 15 to 40 nucleotides in length.

4. 4. The method of claim 1, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 2, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

3.

5. 2. The method of claim 1, wherein the first primer comprises a sequence that is completely homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence that is completely homologous to the sequence of SEQ ID NO:

3.

6. 3. The method of claim 2, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:

6.

7. 3. The method of claim 2, wherein the probe comprises a sequence that is completely homologous to the sequence of SEQ ID NO: 5, SEQ ID NO: 6, or their complements.

8. The method of claim 2, wherein the probe is labeled with a detectable label.

9. 10. The method of claim 1, wherein the presence of a detectable amplicon indicates a contaminant in the test sample.

10. The method of claim 1 , wherein detection of the detectable amplicon indicates a positive risk of spoilage.

11. 11. The method of claim 10, wherein a positive spoilage potential indicates the presence of contaminating saccharifying wild yeast.

12. 2. The method of claim 1, wherein the first primer and the second primer are configured to amplify a detectable amplicon, and the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

13. 2. The method of claim 1, wherein the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.

14. 10. The method of claim 1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

15. Detecting the detectable amplicon comprises: a. Direct detection of a measurement of a physical property of the amplicon, for example, measurement of UV absorbance at 260 nm; b. isolating the amplicon; c. sequencing the amplicon; d. staining the amplicon with a dye and detecting the dye; e. conjugating the amplicon to a detectable label and detecting the presence of the label; f. detecting a detectable signal from the reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; or g. Detecting detectable signals from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

10. The method of claim 1, comprising one or more of the group consisting of:

16. The method of claim 1, further comprising generating and detecting a second detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene or a sequence of the STA2 gene, a complement thereof, or a fragment thereof.

17. The method of claim 1, further comprising generating and detecting a second and a third detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene and the third detectable amplicon comprises a sequence of the STA2 gene.

18. 2. The method of claim 1, wherein there are no primers configured to amplify a sequence of the STA1 gene and there are no primers configured to amplify a sequence of the STA2 gene.

19. 1. A method for detecting contaminants in a food or beverage comprising a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, or its complement, or a fragment thereof, comprising: a. reacting a test sample derived from a food or beverage with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to the complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and b. Detecting the presence or absence of an amplicon A method comprising:

20. 20. The method of claim 19, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:2, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

3.

21. 21. The method of claim 20, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:

6.

22. a. a primer comprising a sequence substantially homologous to SEQ ID NO:2 or a fragment thereof; and b. A primer comprising a sequence substantially homologous to SEQ ID NO:3 or a fragment thereof. Includes a kit.

23. 23. The kit of claim 22, further comprising at least one of a DNA polymerase, deoxynucleotide triphosphate nucleotides, and a buffer.

24. 24. The kit of claim 22 or 23, further comprising a probe.

25. 25. The kit of claim 24, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:5 or SEQ ID NO:

6.

26. 25. The kit of claim 24, wherein the probe is covalently bound to a detectable label.

27. 27. The kit of claim 26, wherein the probe also comprises a quencher configured to quench a signal from the detectable label.

28. 23. The kit of claim 22, wherein at least one of the primers is covalently linked to a detectable label.

29. a. a primer substantially homologous to SEQ ID NO:2; b. a primer substantially homologous to SEQ ID NO:3; c. deoxynucleotide triphosphate nucleotides; d. DNA polymerase; e. a buffer; and f. A test sample suspected of having a nucleic acid that is substantially homologous to the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof. A mixture comprising:

30. 30. The mixture of claim 29, further comprising a probe.

31. 31. The mixture of claim 30, wherein the probe is substantially homologous to or substantially complementary to the sequence of SEQ ID NO: 5 or SEQ ID NO: 6 or a fragment thereof.

32. 30. The mixture of claim 29, further comprising a primer that hybridizes to a gene encoding either or both of STA1 and STA2.

33. 30. The mixture of claim 29, wherein primers configured to amplify STA1 and STA2 are absent.

34. a. at least one mixture according to any one of claims 30 to 34; and b. an instrument configured to perform an amplification assay on said at least one mixture; Including, the system.

35. 35. The system of claim 34, further comprising at least one sample vessel.

36. 36. The system of claim 35, wherein each of the at least one mixture is contained in a respective one of the at least one sample vessels.

37. 37. The system of claim 36, further comprising at least one sample temperature control device.