Synthetic mRNA lacking a poly-A tail or having a short adenine homopolymer, and methods of use and production thereof

Abstract

The present disclosure relates to mRNA molecules that include a positive-sense 3'-untranslated region (3'-UTR), a viral single-stranded RNA (+ssRNA), a coding sequence for a protein heterologous to the virus, and a 5'-untranslated region (5'-UTR). In particular, the present disclosure relates to mRNAs that encode a protein of interest but lack a poly(A) tail. Furthermore, the present disclosure relates to such mRNAs that allow for the addition of adenine homopolymers to their 3' ends.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application Nos. 63 / 586,985, filed September 29, 2023, 63 / 518,310, filed August 8, 2023, 63 / 502,030, filed May 12, 2023, and 63 / 484,969, filed February 14, 2023, all of which are incorporated by reference in their entireties. Reference to the Electronic Sequence Listing

[0002] The contents of the electronic sequence listing (699442001840SEQLIST.xml; size: 99,514 bytes; and creation date: February 13, 2024) are incorporated herein by reference in their entirety. Field

[0003] The present disclosure relates to mRNA molecules that include a positive-sense 3'-untranslated region (3'-UTR), a viral single-stranded RNA (+ssRNA), a coding sequence for a protein heterologous to the virus, and a 5'-untranslated region (5'-UTR). In particular, the present disclosure relates to mRNAs that encode a protein of interest but lack a poly(A) tail. Furthermore, the present disclosure relates to such mRNAs that allow for the addition of adenine homopolymers to their 3' ends. [Background technology]

[0004] background Synthetic messenger RNA (synRNA) is now frequently used in therapeutics and as a general tool in biomedical research. The basic structural components of mRNA include the 5'-Cap, 5'-UTR (5'-untranslated region), CDS (coding sequence), 3'-UTR (3'-untranslated region), and poly(A) tail (see, for example, Fang et al., 2022; Kowalski et al., 2019; Jackson et al., 2020; and Wadhwa et al., 2019). The poly(A) tail is a homopolymer of adenine (A) approximately 100–300 nucleotides in length. It is known that mRNAs with longer poly(A) tails are more stable and produce more protein (see, for example, Nicholson and Pasquinelli, 2019; and Fang et al., 2022). In addition, it has been shown that synRNAs lacking poly(A) tails are unsuitable for protein production ( Holtkamp et al., 2006 ).

[0005] For properly manufactured therapeutics, ensuring the identity and consistency of synRNA between manufacturing batches is crucial. To this end, one technical hurdle is ensuring that each synRNA molecule has the same sequence. Because synRNAs often exist as a mixture of mRNA molecules with different poly(A) lengths, the poly(A) tail is a particularly problematic region. This is particularly problematic for synRNAs encoding large proteins such as dystrophin, which have coding regions of over 11 kb.

[0006] Thus, there is a need in the art for tools for the production of translatable mRNA lacking poly(A) tails.

[0007] Furthermore, some methods for purifying synRNA use oligo(dT) columns that bind to the poly(A) tail of synRNA (Mencin et al., 2023). For this purpose, a short poly(A) tail consisting of 10–20 adenines is sufficient (Mencin et al., 2023). However, it is not known whether +ssRNA viral sequences tolerate the addition of short poly(A) tails, as some of these sequences lack a poly(A) tail in their natural form.

[0008] Thus, there is also a need in the art for tools for producing translatable mRNAs with short adenine homopolymers at the 3' end. Summary of the Invention

[0009] Quick Overview The present disclosure relates to mRNA molecules that include a positive-sense 3'-untranslated region (3'-UTR), a viral single-stranded RNA (+ssRNA), a coding sequence for a protein heterologous to the virus, and a 5'-untranslated region (5'-UTR). In particular, the present disclosure relates to mRNAs that encode a protein of interest but lack a poly(A) tail. Furthermore, the present disclosure relates to such mRNAs that allow for the addition of adenine homopolymers to their 3' ends. [Brief explanation of the drawings]

[0010] [Figures 1A-1E]Figures 1A-1E show the structure of the RNA molecules and the DNA template for their production. The synthetic mRNAs (synRNAs) are based on the 5' and 3' untranslated regions (UTRs) of Nodamura virus RNA genome 1 (NOV1, NCBI accession: NC_002690) and RNA genome 2 (NOV2, NCBI accession: NC_002691), respectively. Figure 1A shows a schematic diagram of the NOV1-EGFP synRNA (SEQ ID NO: 1), in which the CDS (coding sequence) of NOV1 RNA has been replaced with the coding sequence for enhanced green fluorescent protein (EGFP). Figure 1B shows a schematic diagram of the NOV2-EGFP synRNA (SEQ ID NO: 2), in which the CDS of NOV2 RNA has been replaced with the coding sequence for EGFP. Figure 1C shows a schematic diagram of the NOV2m synRNA (SEQ ID NO: 3), in which the CDS of NOV2 RNA has been replaced with a multiple cloning site (MCS). Figure ID shows a schematic diagram of the NOV2m-EGFP synRNA (SEQ ID NO: 4), in which the coding sequence for EGFP has been inserted into the MCS site of NOV2m RNA. Figure IE shows a schematic diagram of the plasmid DNA, which can be used as a template for synRNA production by in vitro transcription (IVT). The coding sequence for EGFP is set forth as SEQ ID NO: 5, and the coding sequence for an exemplary MCS is set forth as SEQ ID NO: 8.

[0011] [Figure 2A-2B]Figures 2A-2B show a comparison of EGFP expression between NOV1-EGFP synRNA and NOV2-EGFP synRNA in human neonatal dermal fibroblasts (HDFn). NOV1-EGFP synRNA and NOV2-EGFP synRNA were prepared by in vitro transcription driven by T7 RNA polymerase from plasmid DNA linearized with SapI restriction enzyme. 5'-Cap was incorporated using CleanCap AG (TriLink). Two versions of synRNA were prepared: one RNA was standard RNA without any nucleoside modifications (unmodified), and the other RNA was modified with 5-methylcytosine (5mC) and pseudouridine (Ψ). Approximately 0.5 μg of RNA was transfected into HDFn using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without B18R under standard culture conditions at 37°C (Figure 2A) and under low-temperature conditions at 33°C (Figure 2B). 12 hours after RNA transfection, phase contrast (left) and fluorescence (right) images were taken. Fluorescence images showed EGFP expression levels.

[0012] [Figure 3]Figure 3 shows a comparison of cytopathic effect (CPE) between NOV1-EGFP synRNA and NOV2-EGFP synRNA in human neonatal dermal fibroblasts (HDFn). NOV1-EGFP synRNA and NOV2-EGFP synRNA were prepared by in vitro transcription driven by T7 RNA polymerase from plasmid DNA linearized with SapI restriction enzyme. 5'-Cap was incorporated using CleanCap AG (TriLink). Two versions of RNA were prepared: one RNA was standard RNA without any nucleoside modifications (unmodified), and the other RNA was modified with 5-methylcytosine (5mC) and pseudouridine (Ψ). Approximately 0.5 μg of RNA was transfected into HDFn using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without B18R under standard culture conditions at 37°C and 33°C. Phase contrast images were taken 96 hours after RNA transfection.

[0013] [Figure 4A-4B]Figures 4A-4B compare the percentages of HDFn cells transfected with NOV2-EGFP synRNA (m1Ψ), NOV2m-EGFP synRNA (m1Ψ), or control-EGFP synRNA (5mC+Ψ). Approximately 1 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured under standard culture conditions at 37°C in the presence (B18R+; upper panel) or absence (B18R-; lower panel) of B18R, and EGFP expression levels (fluorescence intensity) were measured using a Moxi GO II (ORFLO) at 24, 96, and 185 hours after transfection. In Figure 4A, GFP-positive (+) cells are expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 or GFP > 300 (10x the threshold). Figure 4B provides representative phase-contrast and fluorescence images of NOV2-EGFP transfected cells and shows a flow cytometry dot plot with an EGFP gating box. These data were used to generate Figure 4A.

[0014] [Figures 5A-5C]Figures 5A-5C depict the structures of the DENVm and capless-DENVm RNA molecules, as well as the predicted secondary structure of the DENVm RNA, with the positions of mutated nucleotides indicated by arrows. The synthetic mRNA (synRNA) is based on the 5'- and 3'-untranslated regions (UTRs) of dengue virus 2 (DENV) (NC_001474.2; Kinney et al., 1997). Figure 5A shows a schematic diagram of the DENVm synRNA (SEQ ID NO: 11), in which the CDS (coding sequence) of the DENV RNA has been replaced with a multiple cloning site (MCS or m). Figure 5B shows a schematic diagram of the capless-DENVm synRNA (SEQ ID NO: 12), in which the 5'-Cap of the DENVm synRNA has been removed. Figure 5C shows a schematic diagram of the predicted secondary structure of the DENVm synRNA. Predictions were made using the RNAfold WebServer tool available from the website of the Institute for Theoretical Chemistry, University of Vienna (Reuter and Mathews, 2010). Four mutations were introduced to remove the two ATG start codons of DENV, upstream of the MCS, and to preserve the secondary structure.

[0015] [Figure 6] Figure 6 shows the percentage of GFP-positive HDFn cells transfected with DENVm-EGFP synRNA (U: unmodified) and DENVm-EGFP synRNA (m1Ψ). One microgram of each RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured under standard culture conditions at 30°C or 37°C in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured using Moxi GO II (ORFLO) on days 1 and 4 posttransfection. GFP-positive (+) cells were expressed as a percentage (%) of total viable cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10-fold the threshold), or GFP > 2000 (more than 66.7-fold the threshold).

[0016] [Figure 7] Figure 7 shows the percentage of GFP-positive HDFn cells transfected with capless-DENVm-EGFP synRNA (U: unmodified) and capless-DENVm-EGFP synRNA (m1Ψ). One microgram of each RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured under standard culture conditions at 30°C or 37°C in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured using Moxi GO II (ORFLO) on days 1 and 4 posttransfection. GFP-positive (+) cells were expressed as a percentage (%) of total viable cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10-fold the threshold), or GFP > 2000 (more than 66.7-fold the threshold).

[0017] [Figure 8] Figure 8 shows the percentage of GFP-positive HDFn cells transfected with DENVm-EGFP synRNA (U: unmodified) and DENVm-EGFP synRNA (m1Ψ). One microgram of each RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured under standard culture conditions at 33°C or 37°C in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured using a Moxi GO II (ORFLO) on days 1, 4, 8, and 11 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total viable cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10-fold the threshold), or GFP > 2000 (more than 66.7-fold the threshold).

[0018] [Figure 9]Figure 9 shows a schematic representation of the synRNA molecules of capless-BYDVm, capless-BYDV2m, capless-MNESVm, capless-TCVm, capless-PMVm, and capless-PEMV2m. These synRNAs lack either a 5'-Cap or a 3'-poly(A) tail. Capless-DENVm (also shown in Figure 5) is shown again here for comparison. The size (kb) of each synRNA molecule is also shown. Capless-BYDVm RNA (SEQ ID NO: 14) consists of the 5'-UTR and 3'-UTR of Barley yellow dwarf virus (BYDV:NC_004750.1) with an additional MCS. Capless-BYDV2 mRNA (SEQ ID NO: 16) consists of the 5'-UTR, BYDV-like translation element (BTE), and 3'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1) with an additional MCS. Capless-MNESV mRNA (SEQ ID NO: 18) consists of the 5'-UTR and 3'-UTR of Maize necrotic streak virus (MNESV: NC_007729.1) with an additional MCS. Capless-TCV mRNA (SEQ ID NO: 24) consists of the 5'-UTR and 3'-UTR of Turnip crinkle virus RNA (TCV: NC_003821.3) for the coat protein with an additional MCS. Capless-PMV mRNA (SEQ ID NO: 20) consists of the 5'-UTR and 3'-UTR of Panicum mosaic virus (PMV: U55002.1) with an additional MCS. Capless-PEMV2 mRNA (SEQ ID NO: 22) consists of the 5'-UTR and 3'-UTR of Pea Elevated Mosaic Virus-2 (PEMV2:NC_003853.1) with an additional MCS.

[0019] [Figure 10]Figure 10 shows a schematic representation of the synRNA molecules of BYDVm, BYDV2m, MNESVm, TCVm, PMVm, and PEMV2m. These synRNAs have a 5'-Cap but no 3'-poly(A) tail. The size (kb) of each synRNA molecule is also shown. BYDV mRNA (SEQ ID NO: 13) consists of the 5'-UTR and 3'-UTR of Barley Yellow Dwarf Virus (BYDV:NC_004750.1) with an additional 5'-Cap and MCS. BYDV2 mRNA (SEQ ID NO: 15) consists of the 5'-UTR, BYDV-like translation element (BTE), and 3'-UTR of Barley Yellow Dwarf Virus (BYDV:NC_004750.1) with an additional 5'-Cap and MCS. MNESV mRNA (SEQ ID NO: 17) consists of the 5'-UTR and 3'-UTR of Maize Necrotic Streak Virus (MNESV: NC_007729.1) with an additional 5'-Cap and MCS. TCV mRNA (SEQ ID NO: 23) consists of the 5'-UTR and 3'-UTR of Turnip Crinkle Virus RNA (TCV: NC_003821.3) for the coat protein with an additional 5'-Cap and MCS. PMV mRNA (SEQ ID NO: 19) consists of the 5'-UTR and 3'-UTR of Panicum Mosaic Virus (PMV: U55002.1) with an additional 5'-Cap and MCS. PEMV2 mRNA (SEQ ID NO: 21) consists of the 5'-UTR and 3'-UTR of Pea Elevated Mosaic Virus-2 (PEMV2: NC_003853.1) with an additional 5'-Cap and MCS.

[0020] [Figure 11]FIG. 11 shows the percentage of GFP-positive HDFn cells transfected with synRNAs bearing a 5′-Cap but lacking poly(A) and cultured at 33° C. in the presence of B18R. SynRNAs used were: poly(A)-less control-EGFP synRNA (m1Ψ), DENVm-EGFP (m1Ψ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (m1Ψ), NOV2-EGFP (m1Ψ), PEMV2m-EGFP (m1Ψ), PEMV2m-EGFP (Unm), PMVm-EGFP (m1Ψ), PMVm-EGFP (Unm), MNESVm-EGFP (m1Ψ), MNESVm-EGFP (Unm), BYDV2m-EGFP (m1Ψ), BYDV2m-EGFP (Unm), TCVm-EGFP (m1Ψ), TCVm-EGFP (Unm), BYDm-EGFP (m1Ψ), and BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0021] [Figure 12]FIG. 12 shows the percentage of GFP-positive HDFn cells transfected with synRNAs bearing a 5′-Cap but lacking poly(A) and cultured at 33° C. in the absence of B18R. SynRNAs used were: poly(A)-less control-EGFP synRNA (m1Ψ), DENVm-EGFP (m1Ψ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (m1Ψ), NOV2-EGFP (m1Ψ), PEMV2m-EGFP (m1Ψ), PEMV2m-EGFP (Unm), PMVm-EGFP (m1Ψ), PMVm-EGFP (Unm), MNESVm-EGFP (m1Ψ), MNESVm-EGFP (Unm), BYDV2m-EGFP (m1Ψ), BYDV2m-EGFP (Unm), TCVm-EGFP (m1Ψ), TCVm-EGFP (Unm), BYDm-EGFP (m1Ψ), and BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0022] [Figure 13]FIG. 13 shows the percentage of GFP-positive HDFn cells transfected with synRNAs bearing a 5′-Cap but lacking poly(A) and cultured at 37° C. in the presence of B18R. SynRNAs used were: poly(A)-less control-EGFP synRNA (m1Ψ), DENVm-EGFP (m1Ψ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (m1Ψ), NOV2-EGFP (m1Ψ), PEMV2m-EGFP (m1Ψ), PEMV2m-EGFP (Unm), PMVm-EGFP (m1Ψ), PMVm-EGFP (Unm), MNESVm-EGFP (m1Ψ), MNESVm-EGFP (Unm), BYDV2m-EGFP (m1Ψ), BYDV2m-EGFP (Unm), TCVm-EGFP (m1Ψ), TCVm-EGFP (Unm), BYDm-EGFP (m1Ψ), and BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0023] [Figure 14]FIG. 14 shows the percentage of GFP-positive HDFn cells transfected with synRNAs bearing a 5′-Cap but lacking poly(A) and cultured at 37° C. in the absence of B18R. SynRNAs used were: poly(A)-less control-EGFP synRNA (m1Ψ), DENVm-EGFP (m1Ψ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (m1Ψ), NOV2-EGFP (m1Ψ), PEMV2m-EGFP (m1Ψ), PEMV2m-EGFP (Unm), PMVm-EGFP (m1Ψ), PMVm-EGFP (Unm), MNESVm-EGFP (m1Ψ), MNESVm-EGFP (Unm), BYDV2m-EGFP (m1Ψ), BYDV2m-EGFP (Unm), TCVm-EGFP (m1Ψ), TCVm-EGFP (Unm), BYDm-EGFP (m1Ψ), and BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0024] [Figure 15] Figure 15 shows a summary of the data for TCVm-EGFP(Unm), TCVm-EGFP(mΨ), MNESVm-EGFP(Unm), MNESVm-EGFP(mΨ), and poly(A)-less control-EGFP synRNA(mΨ) shown in Figures 11, 12, 13, and 14. GFP-positive (+) cells were expressed as the percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (> 10-fold threshold), or GFP > 2000 (> 66.7-fold threshold).

[0025] [Figure 16]Figure 16 shows representative microscopic images from the experiments shown in Figures 11-15. Approximately 1.0 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without B18R under low-temperature conditions at 33°C (upper panel) and standard culture conditions at 37°C (lower panel). 24 hours after RNA transfection, phase-contrast (left) and fluorescent (right) images were taken. Fluorescent images showed EGFP expression levels.

[0026] [Figure 17] Figure 17 shows representative results of fluorescence-activated cell sorting (FACS) analysis comparing EGFP fluorescence intensity among poly(A)-less TCVm-EGFP mRNA (top), control-EGFP synRNA with a standard 120 poly(A) tail as described in Warren et al., 2010 (middle), and an untransfected control (bottom). Approximately 1.0 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with B18R under standard culture conditions at 37°C. Cells were harvested 16 hours after mRNA transfection and subjected to FACS analysis. Geometric mean fluorescence intensity (MFI) indicated that the translation efficiency of TCVm mRNA lacking a poly(A) tail was comparable to that of the reference mRNA.

[0027] [Figure 18]Figure 18A shows representative bioluminescence images of luciferase assays in mice 1 or 2 days after intramuscular injection of 20 μg of synRNA-encoding luciferase (LUC2) with InvivoFectamine 3.0 (ThermoFisher). In Figure 18B, luciferase activity was assessed by quantification of the bioluminescence signal. TCVm and NOV2m RNAs were used as synRNA-encoding LUC2. Because a SapI restriction enzyme site exists in LUC2, the plasmid DNA was linearized with MluI (located immediately 3' to the SapI site). As a negative control, NOV2m-LUC synRNA generated after SapI linearization of the plasmid DNA (shown as a dotted line in Figure 18B) was used as a background signal. Two mouse strains, C57BL / 6 and BALB / c, were used. TCVm-LUC2(MluI) was highly translated in vivo, even though it lacked a poly(A) tail. Although the translation efficiency was lower than that of TCVm-LUC2, NOV2m-LUC2(MluI) also functioned, indicating that poly(A)-less synRNAs could be translated in both C57BL / 6 and BALB / c mouse strains.

[0028] [Figure 19]Figure 19 shows representative microscopic images from an experiment to test the effect of poly(A) tailing on the 3' end of a poly(A)-tailless mRNA. Poly(A)-less control EGFP synRNA (m1Ψ) and its tailed versions (20As, 30As, 60As, and 120As). The A120 version was identical to the synRNA described in Warren et al., 2010, except for the m1Ψ modification. NOV2m-EGFP (m1Ψ) and its adenine homopolymer-tagged versions (20As, 30As, 60As, and 120As). MNESVm-EGFP (nucleoside-unmodified) and its adenine homopolymer-tagged versions (20As, 30As, 60As, and 120As). TCVm-EGFP (m1Ψ) and its adenine homopolymer-tagged versions (20As, 30As, 60As, and 120As). Approximately 1.0 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at a low temperature of 33°C with (upper panel) or without (lower panel) B18R. Fluorescence images were taken 24 hours after RNA transfection. The fluorescence images showed EGFP expression levels.

[0029] [Figure 20] Figure 20 shows representative microscopic images of the experiment described in Figure 19, except that HDFn cells were cultured with (upper panel) or without (lower panel) B18R at standard temperature conditions of 37°C. Fluorescent images were taken 24 hours after RNA transfection. The fluorescent images showed EGFP expression levels.

[0030] [Figure 21]Figure 21 shows the percentage of GFP-positive HDFn cells in the experiment described in Figure 19. HDFn cells were cultured with (left panel) or without (right panel) B18R at a low temperature of 33°C. EGFP expression levels (fluorescence intensity) were measured using Moxi GO II (ORFLO) one day after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0031] [Figure 22] Figure 22 shows the percentage of GFP-positive HDFn cells in the experiment described in Figure 20. HDFn cells were cultured with (left panel) or without (right panel) B18R at standard temperature conditions of 37°C. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) one day after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0032] [Figure 23]Figure 23A shows a schematic diagram of the NOV2m-DMD-A28 synRNA, which encodes the full-length human dystrophin (DMD) protein (the coding region for the transcript variant Dp427m is shown as nucleotides 238 to 11295 in NCBI accession number NM_004006). The mRNA sequence of the NOV2m-DMD-A28 synRNA is set forth as SEQ ID NO: 42. Figure 23B shows the results of immunohistochemistry using an antibody against human DMD (MANDYS106, Millipore). Nuclei were visualized with 4',6-diamidino-2-phenylindole (DAPI). HDFn cells were transfected with the NOV2m-DMD-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with 250 ng / mL B18R (Sigma) at 37°C for 24 hours after synRNA transfection and then subjected to immunohistochemistry.

[0033] [Figure 24] Figure 24A shows a schematic diagram of the NOV2m-LUC-DMD-A28 synRNA, which encodes a fusion protein of luciferase (LUC) and full-length human dystrophin (DMD) protein (transcript variant Dp427m, NCBI accession number NM_004006). Figure 24B shows representative bioluminescence images of a luciferase assay in mice. Rep. 1 and Rep. 2 indicate replicates. Figure 24C shows luciferase activity assessed by a bioluminescence imaging system. Briefly, 20.0 μg of NOV2m-LUC-DMD-A28 synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer's protocol. The synRNA / LNP complex was injected directly into the muscle in the right thigh region of BALB / c mice (day 0). The following day (day 1), luciferase activity was observed by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ).

[0034] [Figure 25] Figure 25A shows a schematic diagram of the NOV2m-COL7A1-LUC-A28 synRNA, which encodes a fusion protein between the full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein (the coding region of COL7A1 is shown as nucleotides 64–8898 in NCBI accession number NM_000094) and the luciferase (LUC) gene. Figure 25B shows the results of immunohistochemistry using an antibody against human COL7A1 (MCA597GA, BioRad). Nuclei were visualized with DAPI. HDFn cells were transfected once (1x transfection) or three times (3x transfection) with the NOV2m-COL7A1-LUC-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with 250 ng / mL B18R (Sigma) at 37°C for 24 hours after synRNA transfection (1x transfection) or for 72 hours after the first synRNA transfection (3x transfection). Samples were then subjected to immunohistochemistry.

[0035] [Figure 26]Figure 26 shows the percentage of GFP-positive HDFn cells transfected with synRNAs in which a poly(A) tail was added to the 3' end of poly(A)-tailless mRNA. SynRNAs used were DENVm-EGFP (Unm: unmodified nucleoside) and its adenine homopolymer-added versions (20As, 30As, 60As, and 120As). Approximately 1.0 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without B18R under low-temperature conditions at 33°C or standard culture conditions at 37°C. EGFP expression levels (fluorescence intensity) were measured using a Moxi GO II (ORFLO) two days after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total live cells with a fluorescence intensity of GFP>30, GFP>300 (more than 10 times the threshold), or GFP>2000 (more than 66.7 times the threshold).

[0036] [Figure 27]Figure 27A shows a schematic diagram of the SARSVm synRNA molecule. The synRNA contains the 5'-Cap, 5'-UTR, and 3'-UTR of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2: NC_045512.2), a multiple cloning site (MCS), and a 50-adenine homopolymer. The nucleotide sequence of the SARSVm5'-UTR is set forth as SEQ ID NO: 37, and the nucleotide sequence of the SARSVm3'-UTR+50(A) is set forth as SEQ ID NO: 38. Figure 27B shows the percentage of GFP-positive HDFn cells transfected with SARSVm synRNA. Both nucleoside-unmodified native synRNA (Unm) and nucleoside-modified synRNA (mΨ) were tested. Approximately 1.0 μg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without B18R under low-temperature conditions at 33°C or standard culture conditions at 37°C. EGFP expression levels (fluorescence intensity) were measured using Moxi GO II (ORFLO) on day 1 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total viable cells with a fluorescence intensity of GFP > 30, GFP > 300 (more than 10 times the threshold), or GFP > 2000 (more than 66.7 times the threshold).

[0037] [Figure 28]Figure 28 shows the change in luciferase activity in BALB / c mice from days 1 to 8 after intramuscular injection of 20 μg each of NOV2m(A50)-LUC synRNA, NOV2m(A30)-LUC synRNA, DENVm(A50)-LUC synRNA, or DENVm(A30)-LUC synRNA. Both nucleoside-unmodified natural synRNA (Unm) and nucleoside-modified synRNA (m1Ψ) were tested. SynRNAs were complexed with Invivofectamine 3.0 (ThermoFisher) before intramuscular injection. Luciferase activity was assessed using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Mean ± SEM (n = 2) is plotted.

[0038] [Figure 29] Figure 29 shows the change in luciferase activity in BALB / c mice from days 1 to 13 after intradermal injection of 20 μg of modified or unmodified NOV2m(A50)-LUC synRNA, NOV2m(A30)-LUC synRNA, DENVm(A50)-LUC synRNA, or DENVm(A30)-LUC synRNA. SynRNA was dissolved in lactated Ringer's solution and delivered to the skin without transfection reagents or lipid nanoparticles (LNPs). To test the effect of chitosan oligosaccharide on gene expression, synRNA was injected intradermally with [chitosan(+)] or without [chitosan(-)] chitosan oligosaccharide (final concentration 1.5 μg / ml). Luciferase activity was assessed using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Mean ± SEM [n=2 for chitosan (-) condition, n=3 for chitosan (+) condition] is plotted.

[0039] [Figure 30]Figure 30A shows a schematic diagram of a synRNA encoding a type I collagen fusion protein that includes the coding regions of two COL1A1 proteins (each 1,464 amino acids in length) and one COL1A2 protein (1,366 amino acids in length) fused via nucleic acids encoding 2A self-cleaving peptides (e.g., T2A and E2A). The nucleotide sequence encoding an exemplary COL1A fusion protein is shown as SEQ ID NO: 39. Figure 30B shows a schematic diagram of a synRNA encoding an erythropoietin (EPO) fusion protein that includes the coding region of multiple copies of the EPO protein (193 amino acids in length) fused via nucleic acids encoding 2A self-cleaving peptides (e.g., F2A, T2A, E2A, and P2A). The nucleotide sequence encoding an exemplary EPO fusion protein is shown as SEQ ID NO: 40. Figure 30C shows a schematic diagram of a synRNA encoding the ribonucleoprotein telomerase, which is composed of a 5'-Cap, a 5'-UTR, a telomerase reverse transcriptase (TERT: 1132 amino acids) coding region for the protein component, a 3'-UTR, a ribozyme, a telomerase RNA (TERC: 451 nt) as the RNA component, a ribozyme, and a poly(A) tail. The nucleotide sequence of an exemplary TERT-TERC mRNA is shown in SEQ ID NO:41.

[0040] [Figure 31] Figure 31 shows the specific localization of full-length human dystrophin protein in mouse skeletal muscle 1 day after injection of 20 μg of NOV2m-DMD-A28 synRNA + Invivofectamine (BALB / c mice). Ab (MANDYS106) does not recognize mouse dystrophin but recognizes human dystrophin, while Ab (AB15277) recognizes both mouse and human DMD.

[0041] [Figure 32A-32B]Figures 32A-32B show muscle strength recovery in D2.mdx mutant mice after intramuscular injection of mRNA-DMD. Briefly, 20 μg of NOV2m-DMD-A28 synRNA or mRNA-LUC (luciferase: control) was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 μL. D2.mdx mutant mice (lacking mouse dystrophin protein) received three intramuscular injections of approximately 4 μg (12 μL) of NOV2m-DMD-A28 synRNA or mRNA-LUC in the ventral forearm and two intramuscular injections in the dorsal forearm using a 31G needle, for a total of 20 μg (in 60 μL) in each of the right and left forearms. Injections began at 11 weeks of age and continued weekly for a total of six injections. The final injection was administered at 16 weeks of age. Peak muscle strength of the forearm was measured using a grip strength scale (Harvard Apparatus). Measurements were performed twice, 30 minutes apart. Peak muscle strength was normalized by mouse body weight, and the average of the two measurements was used for analysis. Figure 32A shows peak muscle strength measured 1 week after the last injection (measured at week 17). The NOV2m-DMD-A28-injected group showed statistically significant (p<0.05) muscle strength recovery compared with the uninjected group (D2.mdx: control) and the mRNA-LUC (luciferase: control)-injected group (D2.mdx-LUC). There was no statistically significant difference between the D2.mdx-DMD group and the wild-type DBA / 2 group (control). Figure 32B shows muscle strength recovery in D2.mdx mutant mice (lacking dystrophin protein) following a single intramuscular injection of NOV2m-DMD-A28. Briefly, 20 μg of NOV2m-DMD-A28 synRNA was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 μL. D2.mdx mutant mice received a single intramuscular injection of approximately 4 μg (12 μL) of NOV2m-DMD-A28 using a 34G needle in three sites on the ventral forearm and two sites on the dorsal forearm: a total of 20 μg (in 60 μL) in each of the right and left forearms. Injections were performed at 18 weeks of age. Three weeks later, when the mice were 21 weeks of age, peak forearm muscle strength was measured using a grip strength scale (Harvard Apparatus). Measurements were performed twice, 30 minutes apart.Peak muscle strength was normalized by mouse body weight, and the average of two measurements was used for analysis. At 21 weeks, the NOV2m-DMD-A28 synRNA-injected group (n = 5) showed significant recovery in muscle strength, whereas the uninjected control group (n = 4) showed no recovery. DETAILED DESCRIPTION OF THE INVENTION

[0042] Detailed Description Typically, synthetic mRNA (synRNA) has the same sequence characteristics as cellular mRNA. That is, synRNA generally includes a 5'-Cap, a 5'-UTR, a CDS, a 3'-UTR, and a poly(A) tail. The present disclosure relates to methods for generating translatable synRNAs lacking a poly(A) tail. As described herein, synRNAs based on positive-sense single-stranded RNA (+ssRNA) viruses that naturally lack a poly(A) tail were engineered by removing the sequence encoding the viral RNA dosage-dependent RNA polymerase, thereby separating the translation function from the replication function of +ssRNA viruses. Expression cassettes based on these designs were inserted into plasmids, which can be used as templates for producing synRNAs suitable for in vitro and in vivo use. Such synRNAs can be generated by any method known in the art, including in vitro transcription of template DNA, chemical synthesis of RNA, and plasmid or viral expression vectors. Furthermore, synRNAs can be made with or without modified nucleosides. Additional genetic elements can be incorporated into synRNAs. In one embodiment, a synRNA contains a single CDS. In another embodiment, a synRNA contains multiple CDSs assembled by fusing two or more CDSs. In another embodiment, a synRNA contains multiple CDSs linked by an internal ribosome entry site (IRES). In a further embodiment, a synRNA contains multiple CDSs separated by nucleotides encoding a flexible linker (e.g., a glycine-serine linker). In another embodiment, a synRNA contains multiple CDSs separated by nucleotides encoding a 2A self-cleaving peptide (e.g., P2A, E2A, F2A, or T2A). General Techniques and Definitions

[0043] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0044] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless otherwise indicated. For example, "an" excipient includes one or more excipients.

[0045] As used herein, the phrase "comprising" is open-ended and indicates that such embodiments may include additional elements. In contrast, the phrase "consisting of" is closed and indicates that such embodiments do not include additional elements (except for trace impurities). The phrase "consisting essentially of" is part-closed and indicates that such embodiments may include additional elements that do not materially alter the basic characteristics of such embodiments.

[0046] As used herein with respect to a value, the term "about" encompasses 90% to 110% of that value (e.g., when used with respect to an RNA molecule, a length of about 500 nucleotides refers to an RNA molecule that is 450 to 550 nucleotides in length).

[0047] As used herein, the term "synthetic mRNA," abbreviated as "synRNA," refers to an mRNA molecule comprising at least a 5'-UTR (5'-untranslated region), a CDS (coding sequence), and a 3'-UTR (3'-untranslated region), wherein the CDS is heterologous to at least the 3'-UTR. As such, synRNAs are non-naturally occurring molecules.

[0048] The term "poly(A) tail," as used herein, refers to a stretch of at least 15 consecutive adenine nucleotides, typically present at the end of the 3'-UTR of an mRNA molecule. DNA encoding native mRNA molecules in mammalian cells does not contain adenine homopolymers at their 3'-end. Rather, adenines are added to the 3'-UTR by polyadenylate polymerase to form adenine homopolymers (i.e., poly(A) tails). The genomes of certain single-stranded, sense-positive (+ssRNA) viruses also lack adenine homopolymers at their 3'-ends. While the length of a poly(A) tail of a native mRNA molecule depends on the species of the cell in which it is produced, mammalian cells typically produce mRNA from genomic DNA with longer poly(A) tails (e.g., typically longer than 100 consecutive adenine nucleotides, e.g., about 75 to about 275 consecutive adenine nucleotides in length).

[0049] The terms "poly(A) tailless," "poly(A)-less," and the like, when used in reference to an mRNA molecule, refer to an mRNA molecule that does not contain a poly(A) tail as defined above. In some embodiments, an mRNA that lacks a poly(A) tail has about 10 or fewer consecutive adenine residues downstream of its 3'-UTR.

[0050] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues and are not limited to a particular length unless otherwise specified. A polypeptide can contain natural amino acid residues or a combination of natural and non-natural amino acid residues. The term also includes post-translational modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In some embodiments, a polypeptide can contain modifications relative to the native or naturally occurring sequence, so long as the protein maintains a desired activity (e.g., antigenicity).

[0051] The terms "coding sequence," "CDS," "open reading frame," and "ORF," as used herein with respect to a protein of interest, refer to a nucleotide sequence that encodes the protein of interest. Due to the degeneracy of the genetic code, several different nucleotide sequences can encode the same amino acid sequence.

[0052] As used herein, the terms "isolated" and "purified" refer to a material that is removed from at least one component with which it is naturally associated (e.g., removed from its original environment). The term "isolated," when used in reference to a recombinant protein, refers to a protein that has been removed from the culture medium of a host cell that produced the protein. In some embodiments, an isolated protein is at least 75%, 90%, 95%, 96%, 97%, 98%, or 99% pure as determined by HPLC.

[0053] An "effective amount" or "sufficient amount" of a substance is an amount sufficient to effect beneficial or desired results, including clinical results, and as such, "effective amount" depends on the context in which it is applied.

[0054] In this disclosure, the terms "individual" and "subject" refer to a mammal. "Mammals" include, but are not limited to, humans, non-human primates (e.g., monkeys), farm animals, sport animals, rodents (e.g., mice and rats), and pets (e.g., dogs and cats). In some preferred embodiments, the subject is a human subject.

[0055] As used herein with respect to a composition comprising mRNA encoding an antigen, the term "dose" refers to the measured portion taken (administered or administered) by a subject at any one time.

[0056] The relative terms "higher" and "lower" refer to a measurable increase or decrease, respectively, in a response or parameter when compared to otherwise identical conditions excluding the parameter of interest, or alternatively, when compared to another condition. For example, the phrases "higher levels of protein expression" and "stronger protein expression" refer to a level of protein expression resulting from contacting a cell with a composition of the present disclosure comprising an mRNA encoding a protein that is more than 1-fold, preferably 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold higher than the level of protein expression resulting from control conditions (e.g., administration of a comparator composition containing no mRNA or a control mRNA that does not encode a protein). The phrases "lower level of protein expression" and "weaker protein expression" refer to a level of protein expression resulting from a control condition (e.g., administration of a comparator composition that does not contain mRNA or that contains a control mRNA that does not encode a protein) that is less than 1-fold, preferably less than 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold lower than the level of protein expression resulting from administration of a composition of the present disclosure that contains an mRNA encoding the protein.

[0057] As used herein, "percent (%) amino acid sequence identity," "percent identity," and "sequence identity," when used in reference to an amino acid sequence (reference polypeptide sequence), are defined as the percentage of amino acid residues in a candidate sequence (e.g., an antigen of interest) that are identical to amino acid residues in the reference polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment to determine percent amino acid sequence identity can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the entire length of the sequences being compared.

[0058] Amino acid substitutions can involve substituting one amino acid in a polypeptide for another. Amino acid substitutions can be introduced into an antigen of interest and the products screened for a desired activity, e.g., increased stability and / or immunogenicity.

[0059] Amino acids generally share the following common side chain properties: (1) Hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) Neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) Acidic: Asp, Glu; (4) Basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) Aromatic: Trp, Tyr, Phe, can be grouped according to:

[0060] Conservative amino acid substitutions involve exchanging a member of one of these classes for another member of the same class, while non-conservative amino acid substitutions involve exchanging a member of one of these classes for a member of another class.

[0061] As used herein, the term "excipient" refers to a compound present in a composition containing an active ingredient (e.g., an mRNA encoding a protein of interest). Pharmaceutically acceptable excipients are inert pharmaceutical agents and may include, for example, solvents, bulking agents, buffers, tonicity agents, and preservatives (Pramanick et al., Pharma Times, 45:65-77, 2013). In some embodiments, the compositions of the present disclosure include an excipient that functions as one or more of a solvent, bulking agent, buffer, and tonicity agent (e.g., sodium chloride in saline can function as both an aqueous vehicle and a tonicity agent). I. Synthetic mRNA (synRNA)

[0062] To establish synRNA as a biologic with a well-manufactured CMC (chemistry, manufacturing, and quality control), it is important to ensure the identity of the synRNA and its consistency between manufactured batches. One technical hurdle involves ensuring that synRNA molecules in a batch have identical sequences. A particularly problematic portion of synRNA is the poly(A) tail, a homopolymer that typically contains more than 100 adenine (A) nucleotides. Essentially, all eukaryotic mRNAs contain poly(A) tracts at their 3' ends. A mixture of synRNAs with different poly(A) tail lengths is not ideal as a therapeutic agent.

[0063] Three methods are commonly used to add a poly(A) tail to the 3' end of a synRNA. One method for adding a poly(A) tail involves the use of poly(A) polymerase. However, the length of the poly(A) tail cannot be controlled using this method (Holtkamp et al., 2006).

[0064] Another method is to add a poly(A) tract by tail-PCR using primers containing a long stretch of thymine (T) nucleotides at their 5' ends. The PCR product is then used as a template for in vitro transcription (IVT) of synRNA using T7-, T3-, or SP6-RNA polymerase (Warren et al., 2010). This method allows the addition of a 120 poly(A) stretch at the 3' end of the synRNA (Warren et al., 2010). The drawbacks of this method include: (1) the difficulty of ensuring that PCR products have identical sequences; (2) the difficulty of scaling up the production of PCR products; and (3) the difficulty of PCR-amplifying long coding sequences.

[0065] Another method involves incorporating a poly(A) stretch into plasmid DNA, which can then be used as template DNA for in vitro transcription (IVT) of synRNA using T7-, T3-, or SP6-RNA polymerase after linearizing the plasmid DNA by restriction enzyme digestion. This method is suitable for scale-up and maintaining sequence identity during amplification in E. coli. Thus, it overcomes the drawbacks of tail-PCR. However, one major limitation of this method is that homopolymers within the plasmid DNA are typically unstable during amplification in E. coli and are therefore frequently cleaved. This limits the size of the poly(A) tail to a shorter length than desired. To overcome this problem, segmented poly(A) tails are used. Segmented poly(A) tails create relatively short poly(A) stretches (e.g., approximately 50 nucleotides) connected by non-poly(A) linkers (Trepotec et al., 2019). However, this technique does not guarantee the integrity of the synRNA, especially since the coding sequence for a large protein of interest increases the size of the plasmid DNA, and the inclusion of long adenine homopolymers results in large plasmids that are less stable than smaller plasmids.

[0066] These problems are solved by the present disclosure through the design of synRNA molecules that lack a poly(A) tail at their 3' end. Given the critical importance of the poly(A) tail for mRNA stability and protein production, eliminating the poly(A) tail from synRNA is counter to common sense. Indeed, there are many scientific publications demonstrating the lack of protein production from mRNAs lacking a poly(A) tail (see, e.g., Holtkamp et al., 2006).

[0067] During the development of this disclosure, natural examples of functional mRNA lacking a poly(A) tail were considered. Examples of poly(A) tailless mRNA are the chromosomes of several positive-sense, single-stranded RNA (+ssRNA) viruses. Replication of +ssRNA viruses requires a virus-specific RNA-dependent RNA polymerase (RdRp). However, RNA genomes are usually delivered to cells without the RdRp protein. Therefore, the RNA genome must first be translated to produce RdRp using the host cell's translation machinery. Therefore, many +ssRNA viral chromosomes resemble host cell mRNAs in that they contain a 5'-Cap, a 5'-untranslated region (5'-UTR), a coding sequence (CDS), a 3'-UTR, and a poly(A) tail. The CDS of a +ssRNA viral genome must contain an open reading frame for the RdRp. Once translated, the RdRp replicates the +ssRNA genome, thereby allowing the 5'-UTR, 3'-UTR, and other RNA genome sequences to play important roles not only in translation but also in replication. By removing the CDS of the RdRp from the +ssRNA viral genome and thereby separating the translation function from the replication function of the +ssRNA, in principle, any +ssRNA virus can be converted into a non-replicating synRNA platform.

[0068] Interestingly, some +ssRNA viruses do not have poly(A) tails. Examples of +ssRNA virus families that lack poly(A) tails include, but are not limited to, the Nodaviridae (Sahul Hameed et al., 2019), Flaviridae (Simmonds et al., 2017), and Tetraviridae (Dorrington et al., 2009). The Flaviviridae family includes, but is not limited to, Flaviviruses (e.g., yellow fever virus, dengue virus, Zika virus, Japanese encephalitis virus, West Nile virus, and tick-borne encephalitis virus), Pestiviruses (e.g., bovine viral diarrhea virus and classical swine fever virus), Hepaciviruses (e.g., hepatitis C virus), and Pegiviruses.

[0069] Furthermore, some +ssRNA viruses, primarily targeting plants, do not even have a 5'-Cap structure. Therefore, these +ssRNA viruses are 5'-Cap-less and poly(A) tail-less (Nicholson and White 2011). These +ssRNA viruses utilize a mechanism called 3'-cap-independent translation enhancer (3'-CITE), which can be classified into six major classes. Examples of +ssRNA viruses lacking both a 5'-Cap and a 3'-poly(A) tail include, but are not limited to, Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea enation mosaic virus-2 (PEMV2), and Turnip crinkle virus (TCV).

[0070] Thus, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 3'-UTR is a viral 3'-UTR or a fragment thereof, optionally wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to the virus and replaces the viral open reading frame, and the virus is a positive-sense, single-stranded RNA (+ssRNA) virus whose genome (or chromosome) lacks a poly(A) tail. In some embodiments, the +ssRNA virus is a member of a viral family selected from the group consisting of Nodaviridae, Flaviviridae, and Tetraviridae. In some embodiments, the +ssRNA virus is selected from plant viruses lacking both a 5'-Cap and a 3'-poly(A) tail, such as barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), panicum mosaic virus (PMV), pea ridged mosaic virus-2 (PEMV2), and turnip crinkle virus (TCV). However, the translation efficiency of 5'-capless +ssRNA has been found to be significantly lower in human cells. Therefore, in some embodiments, a cap structure is artificially added to the 5' end of these synRNAs. In some embodiments, a defined length of adenine homopolymer is added to the 3' end of these synRNAs (synthetic poly(A) tail). Ideally, the synthetic poly(A) tail is of a defined length and shared by multiple synRNAs prepared by in vitro transcription. The uniformity of the length and sequence of the 3' adenine homopolymer is beneficial for synRNA purification and characterization of pharmaceutical compositions containing synRNAs. II. Chromosomes of Nodaviridae

[0071] The Nodaviridae family includes, but is not limited to, Nodamura virus (RNA1 [AF174533 = NC_002690], RNA2 [AF174534 = NC_002691]) and Flock House virus (RNA1 [X77156 = NC_004146], RNA2 [X15959 = NC_004144]). Genetic elements of Nodamura virus (NOV) (Newman 1975) were utilized as a platform for the production of poly(A)-tailless synRNAs described in Examples 1-5. However, RNA fragments of other +ssRNA viruses lacking poly(A) tails can also be utilized to produce poly(A)-tailless synRNAs.

[0072] Nodamura virus (NOV) is a bipartite RNA virus with two RNA chromosomes: RNA1 encodes the RNA-dependent RNA polymerase (RdRp); RNA2 encodes the capsid protein (Hameed 2019). Both NOV1 and NOV2 contain a 5'-Cap, 5'-UTR, CDS, and 3'-UTR, but no poly(A) tail (Hameed 2019). Previously, it was shown that the stem-loop structure of the 3'-UTR is essential for NOV replication (Rosskopf, 2010). However, it has not been investigated whether the 5'-Cap, 5'-UTR, and 3'-UTR alone are sufficient to drive efficient translation of the CDS, especially the exogenous CDS.

[0073] We first tested whether NOV1 and NOV2 could be used as platforms for poly(A)-less synRNAs. The CDSs of NOV1 and NOV2 were replaced with EGFP coding sequences to generate NOV1-EGFP RNA (SEQ ID NO: 1) and NOV2-EGFP RNA (SEQ ID NO: 2). RNAs were generated by IVT using T7 RNA polymerase and a plasmid DNA template linearized with SapI restriction enzyme (Example 1). The exemplary plasmid DNA template contained a T7 promoter; however, other promoters may be used to drive transcription (e.g., T3, SP6, etc.). The exemplary synRNA included a 5'-Cap added using CleanCap-AG (TriLink). Even so, other methods may be used to add a 5'-Cap in IVT RNAs. While naturally occurring NOV RNAs lack any nucleoside modifications, we produced both native (unmodified) and modified versions with 5mC and Ψ.

[0074] NOV1-EGFP RNA and NOV2-EGFP RNA were transfected into human fibroblasts, and viability and EGFP expression were monitored by microscopy. Both the NOV1 and NOV2 untranslated regions were found to be suitable for producing translatable synRNAs lacking poly(A) tails (Example 2). Interestingly, NOV2 synRNA resulted in stronger EGFP protein expression than NOV1. This was surprising, since the NOV1 chromosome encodes the RdRp used to replicate both the NOV1 and NOV2 RNA chromosomes, and therefore, one might expect NOV1 to perform better than NOV2 in terms of early protein expression. However, the actual results were opposite. Although it was known that the 3'-terminal stem-loop structure of the NOV2 3'-UTR is essential for NOV2 RNA replication (Rosskopf et al., 2010), the role of the NOV2 3'-UTR for translation had not been reported.

[0075] Unmodified NOV1 RNA and NOV2 RNA were found to be cytotoxic (Example 2). Numerous dead cells were observed after transfection of human fibroblasts with unmodified NOV1 RNA and unmodified NOV2 RNA. The addition of recombinant B18R protein, known to suppress innate immunity by counteracting type I interferon (IFN), was tested as a means to reduce cytotoxicity. B18R was found to alleviate the cytotoxicity caused by transfection of cells with NOV1 RNA and NOV2 RNA to some extent and under certain conditions, but B18R did not completely alleviate the cytotoxicity. Nucleoside modifications by replacing cytosine with 5mC and uridine with Ψ (5mC + Ψ) reduced the cytotoxicity of NOV1 and NOV2 synRNAs (Example 2). Naturally occurring NOV1 RNA and NOV2 RNA do not contain nucleoside modifications. Therefore, it was surprising that artificial modifications of nucleosides substantially reduced the cytotoxicity of NOV1 and NOV2 RNA.

[0076] To test whether other nucleoside modifications are compatible with NOV2 RNA translation, human fibroblasts were transfected with NOV2-EGFP synRNA modified with 5mC+Ψ, 5moU, m1Ψ, or Ψ. Viability and EGFP protein expression were monitored by microscopy (Example 3). As observed in Example 2, unmodified NOV2 synRNA was cytotoxic, and cytotoxicity was at least partially alleviated by specific nucleoside modifications. Among the modifications tested, 5mC+Ψ and m1Ψ resulted in the strongest levels of EGFP expression, but other modifications were also somewhat effective in alleviating cytotoxicity (Example 3).

[0077] We found that NOV1 synRNA and NOV2 synRNA were translatable at both 37°C and 33°C, although expression was slightly stronger at 37°C than at 33°C (Examples 2 and 3). Previous NOV studies had been performed at 28°C, 31°C, and 34°C (Ball et al., 1992; Johnson 2003). The optimum temperature for NOV replication is around 28°C, and viral replication is greatly reduced at 37°C (Johnson 2003). Therefore, we expected higher levels of NOV1 synRNA and NOV2 synRNA when transfected cells were cultured at 33°C rather than 37°C. Therefore, it was surprising to find that NOV1 and NOV2 synRNAs were equally or better translated when transfected cells were cultured at 37°C than at 33°C.

[0078] To further develop the NOV2 RNA as a poly(A)-less synRNA platform, we tested the effect of additional nucleotides surrounding the ATG start and stop codons on the translation of the CDS. To this end, and to facilitate cloning of plasmid DNA templates for IVT of additional synRNAs, a multiple cloning site (MSS) was inserted immediately upstream of the ATG start codon and extended to the end of the STOP codon (Example 4). In this way, the ATG-STOP portion of the native NOV2 synRNA sequence was removed. This construct is called NOV2m. An exemplary nucleic acid fragment inserted into the multiple cloning site of NOV2m includes a Kozak consensus sequence, an ATG start codon, an EGFP coding sequence, and a STOP codon. EGFP from the NOV2m-EGFP RNA was translated as well as EGFP from NOV2-EGFP (Examples 4 and 5). Thus, NOV2m is an important tool that simplifies the cloning of any CDS into the multiple cloning site of plasmid DNA, which serves as a template for the production of synRNA lacking a poly(A) tail.

[0079] EGFP protein expression from poly(A)-less NOV2m-EGFP synRNA was then compared to a control-EGFP synRNA containing a 120-nucleotide poly(A) tail (Example 5). The expression level of EGFP from NOV2m synRNA, lacking a poly(A) tail, was found to be comparable to that from a control-EGFP synRNA containing a 120-nucleotide poly(A) tail.

[0080] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 3'-UTR is Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof, or Nodamura virus RNA1 3'-UTR or a fragment thereof, optionally wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to NOV2 or NOV1 and replaces the open reading frame of the Nodamura virus capsid protein or the Nodamura virus RNA-dependent RNA polymerase (RdRp) open reading frame of NOV2. III. Chromosomes of Flaviviridae

[0081] The Flaviviridae family includes, but is not limited to, flaviviruses (e.g., yellow fever virus, dengue virus, Zika virus, Japanese encephalitis virus, West Nile virus, and tick-borne encephalitis virus), pestiviruses (e.g., bovine viral diarrhea virus and classical swine fever virus), hepaciviruses (e.g., hepatitis C virus), and pegiviruses.

[0082] As an exemplary example, genetic elements of dengue virus 2 (DENV) (NC_001474.2; Kinney et al., 1997) were utilized as a platform for the production of poly(A) tailless synRNAs as described in Example 6. However, RNA fragments of other +ssRNA viruses lacking poly(A) tails can also be utilized for the production of poly(A) tailless synRNAs.

[0083] Dengue virus (DENV) is a nonsegmented +ssRNA virus with an 11 kb single-stranded RNA genome modified at the 5' end with a cap-1 structure for canonical cellular translation. The 3' end of the RNA genome does not carry a poly(A) tail. Instead, it forms a loop structure. Interestingly, a cap-independent mechanism of translation has also been described for DENV (Mazeaud et al., 2018). Therefore, we tested both Cap1 (Figure 5A) and Capless (Figure 5B) versions of DENV RNA (Example 6).

[0084] It is known that DENV RNA is circularized by complementary sequences located in both the 5'-UTR (encompassing the sequence downstream of the ATG start codon) and the 3'-UTR (Mazeaud et al., 2018). To create a DENV-based synRNA construct that allows the insertion of a foreign CDS starting from the ATG up to the stop codon, we introduced two mutations that change AUG to AUC at two positions (Figure 5C). These mutations remove the two ATG start codons upstream of the multiple cloning site. To maintain the circular structure of the DENV-based synRNA, we introduced two corresponding mutations in the 3'-UTR (CAU to GAU; GAC to CAC) (Figure 5C).

[0085] The final DENV-based synRNA construct (designated DENVm RNA) contains a 5'-Cap1, a 5'-UTR (mutation), a multiple cloning site (MCS), and a 3'-UTR (mutation), but no poly(A) (SEQ ID NO: 11). The RNA was generated by IVT using T7 RNA polymerase and a plasmid DNA template linearized with SapI restriction enzyme (Example 6). The exemplary plasmid DNA template contained a T7 promoter; however, other promoters may be used to drive transcription (e.g., T3, SP6, etc.). The exemplary synRNA included a 5'-Cap added using CleanCap-AG (TriLink). Even so, other methods may be used to add a 5'-Cap in IVT RNA. Other Caps, such as Cap0, Cap2, etc., can also be used. As mentioned above, a capless version (designated Capless-DENVm RNA) was also generated, which begins with a GGG sequence (SEQ ID NO: 12). Both the native version (unmodified, Unm) and a version modified with mΨ were produced. Other modified nucleosides can also be used. To test protein production, EGFP was cloned into the MCS.

[0086] DENVm-EGFP RNA and Capless-DENVm-EGFP RNA were transfected into human fibroblasts, and EGFP expression was observed by microscopy and the Moxi Go II cell analyzer (Examples 7 and 8).

[0087] Under all four culture conditions (30°C or 37°C; B18R+ or B18R-), DENVm synRNA was able to produce protein—EGFP in this example (Examples 7 and 8; Figure 6). In contrast, the capless version—Capless-DENVm—produced very low levels of protein (Figure 7), suggesting that the 5'-Cap is required for efficient translation from DENVm RNA.

[0088] Interestingly, DENVm synRNAs possess a number of unique features not typically found in standard synRNAs. First, unlike other synRNAs, DENVm synRNAs exhibit stronger protein production in their native form, i.e., unmodified nucleosides, than in their nucleoside-modified forms (Figure 6). It is also noteworthy that, unlike other synRNAs, particularly the unmodified form, protein production was not affected by the presence or absence of B18R (Figure 6). It is also unusual that DENVm-EGFP (unmodified) synRNAs exhibited stronger expression on day 4 compared to day 1, as synRNAs generally exhibit strong expression on day 1 (Figure 6), which gradually weakened over time. However, even in this case, expression subsequently declined over time and became very low by day 11, suggesting that day 4 was the peak expression timing.

[0089] Thus, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 5'-UTR and 3'-UTR are dengue virus 5'-UTR and 3'-UTR. DENV2m synRNA offers unique features that distinguish it from commonly used synRNA platforms: notably, protein production from DENV2m synRNA is stronger in the native, unmodified form than in the modified nucleoside form. This may be particularly useful for applications requiring nucleoside-unmodified synRNA. Examples include, but are not limited to, vaccines and ribonucleoprotein applications. IV. Plant Virus Chromosomes

[0090] Unlike +ssRNA viruses that infect insects and vertebrates, plant +ssRNA viruses lack either a 5'-Cap structure or a poly(A) tail (Nicholson and White 2011). Therefore, these plant +ssRNA genetic elements are an interesting alternative to conventionally used synRNAs. However, it is essentially unknown whether plant viral genetic elements, such as 5'-UTRs and 3'-UTRs, are functional in mammalian cells, especially human cells.

[0091] To test these plant +ssRNA viruses as platforms for therapeutic applications of synRNA, we used a mechanism called a 3'-cap-independent translation enhancer (3'-CITE) as a guide. 3'-CITEs are classified into six major classes (Nicholson and White 2011). These 3'-CITEs are located in the 3'-UTR of +ssRNA viruses and function to help position the 3' end of the RNA near the 5' end. This circularization of mRNA is necessary for efficient mRNA translation and protein production. In mammalian cells, this circularization of mRNA is mediated by a protein-protein interaction between eIF4e, which binds to the 5'-Cap structure, and poly(A)-binding protein, which binds to the 3'-poly(A) sequence. Plant +ssRNA viruses achieve this circularization without a 5'-Cap or 3'-poly(A) sequence. We selected five different plant + ssRNA viruses, generated synRNA constructs (Examples 9, 11), and tested EGFP expression in human fibroblasts (Examples 10, 12, 13, 14, 15).

[0092] Barley yellow dwarf virus (BYDV:NC_004750.1) folds into a compact cruciform RNA secondary structure and contains a 3' CITE, termed a BYDV-like translation element (BTE). We tested four different variations of BYDV-based synRNAs. BYDV mRNA (SEQ ID NO: 13) contains a 5'-Cap1, 5'-UTR, MCS, and 3'-UTR (without BTE), but no poly(A). Capless-BYDV mRNA (SEQ ID NO: 14) lacks a 5'-Cap, contains a 5'-UTR, MCS, and 3'-UTR (without BTE), but no poly(A). These two RNAs do not contain the BTE motif. BYDV2 mRNA (SEQ ID NO: 15) contains a 5'-Cap1, 5'-UTR, MCS, BTE (addition), and 3'-UTR, but no poly(A). Capless BYDV2 mRNA (SEQ ID NO: 16) lacks a 5'-Cap and contains a 5'-UTR, MCS, BTE (addition), and 3'-UTR, but does not contain poly(A).

[0093] Maize necrotic streak virus (MNESV: NC_007729.1) contains a 3' CITE folded into a type I RNA secondary structure (ISS). We tested two different variations of MNESV-based synRNAs. MNESV mRNA (SEQ ID NO: 17) contains a 5'-Cap1, 5'-UTR, MCS, and 3'-UTR but no poly(A). Capless-MNESV mRNA (SEQ ID NO: 18) lacks a 5'-Cap and contains a 5'-UTR, MCS, and 3'-UTR but no poly(A).

[0094] Panicum mosaic virus (PMV:U55002.1) folds into a T-shaped RNA secondary structure and contains a 3' CITE, termed a PMV-like translation element (PTE). We tested two different variations of PMV-based synRNAs. PMV mRNA (SEQ ID NO: 19) contains a 5'-Cap1, 5'-UTR, MCS, and 3'-UTR but no poly(A). Capless-PMV mRNA (SEQ ID NO: 20) lacks a 5'-Cap and contains a 5'-UTR, MCS, and 3'-UTR but no poly(A).

[0095] Pea bulge mosaic virus-2 (PEMV2:NC_003853.1) contains a 3' CITE, called a PTE, similar to PMV. We tested two different variations of PEMV2-based synRNAs. PEMV2 mRNA (SEQ ID NO:21) contains a 5'-Cap1, 5'-UTR, MCS, and 3'-UTR but no poly(A). Capless-PEMV2 mRNA (SEQ ID NO:22) lacks a 5'-Cap and contains a 5'-UTR, MCS, and 3'-UTR but no poly(A).

[0096] Turnip crinkle virus (TCV:X05193.1) contains a 3' CITE folded into a complex T-shaped structure (TSS) (similar to tRNA). Because the subgenomic sequence encoding the coat protein is more highly expressed than the genomic sequence, we used the subgenomic coat protein sequence, Turnip crinkle virus RNA (TCV:NC_003821.3). We tested two different variations of TCV-based synRNAs. TCV mRNA (SEQ ID NO:23) contains a 5'-Cap1, 5'-UTR, MCS, and 3'-UTR but no poly(A). Capless-TCV mRNA (SEQ ID NO:24) lacks the 5'-Cap and contains a 5'-UTR, MCS, and 3'-UTR but no poly(A).

[0097] First, capless versions of plant virus-based synRNAs were tested in human fibroblasts. These were capless-BYDV mRNA, capless-BYDV2 mRNA, capless-MNESV mRNA, capless-PMV mRNA, capless-PEMV2 mRNA, and capless-TCV mRNA. To test protein production, EGFP was cloned into the MCS. RNA was generated by IVT using T7 RNA polymerase and a plasmid DNA template linearized with SapI restriction enzyme (Example 9). The exemplary plasmid DNA template contained a T7 promoter; however, other promoters may be used to drive transcription (e.g., T3, SP6, etc.). Naturally occurring plant virus RNAs do not appear to have any nucleoside modifications, so both native (unmodified) and m1Ψ-modified versions were tested. Other modified nucleosides may also be used.

[0098] The results showed that the translation efficiency of 5'-Capless +ssRNA was significantly lower than that in human cells (Example 10).

[0099] Next, 5'-Cap1-added versions of plant virus-based synRNAs were tested in human fibroblasts. These +ssRNA viruses do not actually have a 5'-Cap structure. These are BYDV mRNA, BYDV2 mRNA, MNESV mRNA, PMV mRNA, PEMV2 mRNA, and TCV mRNA. To test protein production, EGFP was cloned into the MCS. RNA was produced by IVT using T7 RNA polymerase and a plasmid DNA template linearized with SapI restriction enzyme (Example 11). The exemplary plasmid DNA template contained a T7 promoter; however, other promoters may be used to drive transcription (e.g., T3, SP6, etc.). Although naturally occurring plant virus RNAs do not appear to have any nucleoside modifications, both native (unmodified) and m1Ψ-modified versions were tested. Other modified nucleosides may also be used.

[0100] To our surprise, the artificially added 5'-Cap1 dramatically enhanced translation efficiency under all four culture conditions (37°C or 33°C; B18R+ or B18R-) (Examples 12-15; Figures 11, 12, 13, and 14). Protein expression levels were significantly higher than those of the poly(A)-less control-EGFP synRNA (5'-Cap1, m1Ψ-modified), which showed almost no EGFP expression (Figures 11, 12, 13, and 14). For some plant virus-based synRNAs, protein expression levels were significantly higher than those produced by DENVm, NOV2, and NOV2m. TCVm and MNESVm are two notable examples (Figure 15).

[0101] Because its characteristics are similar to standard synRNAs except for the lack of a 3'-poly(A) tail, TCVm can be used as a poly(A)-less version of commonly used synRNAs: the nucleoside-modified version (m1Ψ) showed significantly higher protein expression than the unmodified version (Figures 15 and 16); protein expression was not affected by the presence or absence of B18R; expression was high on day 1 and decreased over time, but expression was relatively maintained up to day 4; and expression was observed at both 33°C and 37°C (Figure 15).

[0102] In contrast, MNESVm may represent a new type of synRNA: in addition to its unique feature of being poly(A) tailless, it exhibited much higher expression in its unmodified form than in its modified form (Figures 15 and 16). This expression pattern differs from that observed with commonly used synRNAs, but is similar to that of DENVm synRNA. Expression from unmodified MNESVm was not significantly affected by the presence or absence of B18R. Expression was strong on day 1, and the expression was relatively well maintained through day 4 (Figure 15). These unique features are useful for applications such as vaccines and ribonucleoproteins.

[0103] Thus, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 5'-UTR and 3'-UTR are plant ssRNA virus 5'-UTRs or 3'-UTRs. These new types of synRNAs lack poly(A) tails and thus offer advantages in terms of ease of production and CMC. They also provide high protein expression with some additional unique features (clearly demonstrated in the cases of TCVm and MNESVm). V. SynRNA Delivery and Efficient Protein Expression In Vivo

[0104] To further test whether the poly(A)-less synRNA of the present disclosure is translatable in vivo, we used commercially available lipid nanoparticles (LNPs) to prepare synRNA / LNP complexes. Of course, any mRNA delivery system, including but not limited to other LNPs, dendrimers, micelles, and polyethyleneimine-based polymers, is suitable for use with the synRNA of the present disclosure. Naked synRNA (lacking LNPs or other polymers) can also be delivered to cells in vivo. Furthermore, synRNA can be delivered to cells in vivo by electroporation or other mechanical methods.

[0105] It is well documented that synRNA can be delivered systemically by intravenous infusion or direct injection into specific organs, by inhalation, and other related methods. As a representative example, synRNA encoding the luciferase gene was injected into skeletal muscle.

[0106] We used the TCVm and NOV2m platforms to develop representative poly(A)-less synRNAs. The luciferase gene was cloned into the NdeI-NotI site of the multiple cloning site of these vectors, and synRNAs were produced by IVT after linearizing the vectors with MluI restriction enzyme. As described in Example 14, TCVm-LUC2(MluI) was translated at high levels in vivo even without a poly(A) tail (Figure 18A). NOV2m-LUC2(MluI) also worked, but the translation efficiency was lower than that of TCVm-LUC2 (Figure 18B). These poly(A)-less synRNAs were translatable in both C57BL / 6 and BALB / c mouse strains, demonstrating that poly(A)-less synRNAs are suitable for protein production in any mouse strain. Furthermore, given the fact that Poly(A)-less synRNAs are translatable in human fibroblasts in vitro, it is expected that Poly(A)-less synRNAs will be translatable in other cell and tissue types, as well as in other mammalian species, in vitro and in vivo.

[0107] Thus, the present disclosure provides RNA molecules that function in vitro and in vivo without a poly(A) tail. VI. Addition of short adenine homopolymers

[0108] During synRNA production, some purification methods use oligo(dT) columns that bind to the poly(A) tail of the synRNA (Mencin et al., 2023). If the poly(A) tail is sufficiently short, it can accommodate synRNAs with long coding sequences (CDS). This suggests the addition of short adenine homopolymers (synthetic poly(A) tails) to the 3' ends of the +ssRNA viral sequences described herein. However, since these sequences lack poly(A) tails in their native form, it is unknown whether the unique 3' ends of +ssRNA viruses tolerate the addition of adenine homopolymers. Therefore, we systematically tested whether the poly(A)-less synRNA platform described herein can accommodate short stretches of adenine nucleotides.

[0109] We created five sets of synRNAs (A0, A20, A30, A60, and A120) from four different constructs (control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP). A0 is the original poly(A)-less synRNA. A20 refers to the addition of 20 adenines to the 3' end of the poly(A)-less synRNA. Similarly, A30, A60, and A120 refer to the addition of 30, 60, and 120 adenines to the 3' end of the poly(A)-less synRNA, respectively. A poly(A) tail of approximately 120 adenines is the standard poly(A) tail length (Warren et al., 2010). First, DNA templates were generated by tail-PCR using primers containing 0, 20, 30, 60, and 120 thymine (T) nucleotides according to the protocol of Mandal and Rossi (2013). These DNA templates were used in IVT to produce synRNAs. The control synRNA (A120) was the same synRNA as previously described (Warren et al., 2010; Mandal and Rossi, 2013), except for the presence of a nucleoside modification using m1Ψ instead of 5mC / Ψ. The 3'-UTR of the control synRNA was hemoglobin alpha, adult chain 1 (Hba-a1). NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP were as described previously. Based on the results shown above, NOV2m-EGFP and TCVm-EGFP were modified with mΨ because they performed better than the unmodified versions. Meanwhile, MNESVm-EGFP was used in its unmodified form (Unm) because it performed better than the nucleoside-modified form (mΨ) in the experiments described in the previous section. All synRNAs were transfected into HDFn cells and cultured with or without B18R at 33°C or 37°C for 24 hours.

[0110] The control synRNAs showed the expected expression patterns. A0 and A20 showed no or very low translation (Figures 19, 20, 21, 22). Starting with A30, translation efficiency gradually increased to A60 and A120. The control synRNAs performed well with or without B18R at both 33°C and 37°C (Figures 19, 20, 21, 22).

[0111] NOV2m synRNA showed expression from A0 (Figures 19, 20, 21, 22). Translation efficiency was enhanced by adding A20 homopolymers and further enhanced by adding A30, A60, and A120 homopolymers. NOV2m synRNA worked well with or without B18R at both 33°C and 37°C (Figures 19, 20, 21, 22).

[0112] TCVm synRNA showed strong expression from A0 (Figures 19, 20, 21, and 22). Interestingly, the addition of the A20 homopolymer reduced translation efficiency from A0, and it was only increased to the A0 level by adding adenine homopolymers longer than A30. The translation efficiency of TCVm synRNA was not significantly affected by temperature (33°C or 37°C) or the presence or absence of B18R (Figures 19, 20, 21, and 22).

[0113] MNESVm(Unm) synRNA showed strong expression from A0 (Figures 19, 20, 21, and 22). Similar to TCVm synRNA, the addition of A20 and A30 homopolymers reduced translation efficiency from A0, and it was increased to the A0 level only by adding adenine homopolymers longer than A60. The translation efficiency of MNESVm synRNA was not significantly affected by temperature (33°C or 37°C) or the presence or absence of B18R (Figures 19, 20, 21, and 22).

[0114] Among the four constructs tested (control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP), NOV2m synRNA showed the best expression levels using any length of adenine homopolymer, i.e., A20, A30, A60, or A120 (Figures 19, 20, 21, and 22). Notably, even with the standard A120 homopolymer, NOV2m synRNA performed much better than control synRNA, TCVm synRNA, and MNESVm synRNA. SynRNAs are most frequently used under natural in vivo conditions (i.e., at body temperature of 37°C and in the absence of B18R). Under these conditions, NOV2m synRNAs with A20 or A30 showed expression levels equal to or even better than control synRNA with the standard A120 homopolymer, given the desired short adenine homopolymer length (Figure 22).

[0115] Thus, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR) followed by a short adenine homopolymer, wherein the 5'-UTR and 3'-UTR are derived from a +ssRNA virus. These new types of synRNAs with the short 3' adenine homopolymer are suitable for high-level protein expression and, at the same time, facilitate production and purification using an oligo(dT) column. VII. Addition of short adenine homopolymers to DENVm

[0116] We also generated five sets of synRNAs (A0, A20, A30, A60, and A120) from the DENVm plasmid (Example 19). A0 is the original poly(A)-less synRNA. A20 refers to the addition of 20 adenines to the 3' end of the poly(A)-less synRNA. Similarly, A30, A60, and A120 refer to the addition of 30, 60, and 120 adenines to the 3' end of the poly(A)-less synRNA, respectively. First, DNA templates were generated by tail-PCR using primers containing 0, 20, 30, 60, and 120 thymine (T) nucleotides according to the protocol of Mandal and Rossi (2013). These DNA templates were used in IVT to produce synRNAs. DENVm-EGFP was used in its unmodified form (Unm) because it performed better than the nucleoside-modified form (mΨ) in the experiments described in the previous section. All synRNAs were transfected into HDFn cells and cultured with or without B18R at 33°C or 37°C for 24 h.

[0117] DENVm synRNA (Umn) showed expression from A0 in vitro. Translation efficiency was enhanced by adding A20 poly(A) and further enhanced by adding A30, A60, and A120. The translation efficiency of DENVm synRNA (Unm) was not significantly affected by temperature (33°C or 37°C) or the presence of B18R (Figure 26).

[0118] Thus, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), followed by a short adenine homopolymer, wherein the 5'-UTR and 3'-UTR are derived from dengue virus. Although dengue viruses do not have a polyA at their 3' end in their native state, this finding demonstrates that these new types of synRNAs containing short adenine homopolymers can be used to express proteins of interest at high levels while also offering advantages in terms of production and purification, if necessary, by use of an oligo(dT) column. VIII. Coronavirus Chromosome

[0119] The +ssRNA viral genome of coronaviruses is 27-32 kb in size, making it the largest of all RNA viral genomes. It has a cap structure at the 5' end and a poly(A) at the 3' end. In this sense, unlike the +ssRNA viral genomes used previously, the +ssRNA genome of coronaviruses is similar to mammalian mRNAs. However, the length of the poly(A) in coronavirus RNA is relatively short, starting at approximately 45 nucleotides immediately after viral entry and ending at approximately 64 nucleotides (Wu et al., 2023).

[0120] To test whether the 5'-UTR, 3'-UTR, and short poly(A) fragments from coronaviruses can be used to express heterologous proteins, we constructed a plasmid vector carrying a T7 promoter followed by DNA encoding SARSV mRNA (5'-UTR, MCS, 3'-UTR, and 50 adenines), as shown in Figure 27A. The 5'-UTR and 3'-UTR were obtained from SARS-CoV-2 (GenBank: NC_045512.2) (Example 20). The nucleotide sequence of the 5'-UTR of SARSVm is set forth as SEQ ID NO: 37, and that of the 3'-UTR and 50 adenine homopolymer is set forth as SEQ ID NO: 38. After cloning EGFP into the MCS, synRNA was in vitro transcribed using Cap1 (TriLink) with or without m1Ψ modification. GFP expression from SARSVm was tested by transfecting SARSm(A50)-EGFP into HDFn cells and culturing the cells at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for 24 hours. As shown in Figure 27B, SARSVm can efficiently express EGFP when the mRNA is modified with m1Ψ. Interestingly, when the mRNA is in its unmodified form (its native form), expression is very weak. This indicates that the 5'-UTR and 3'-UTR of coronaviruses, along with their superior nucleoside-modified (i.e., artificial) forms, can be used as synRNA platforms.

[0121] We also tested the addition of longer adenine homopolymers to the native poly(A) tail of SARS-CoV-2 mRNA. To this end, we constructed a plasmid vector carrying a T7 promoter and DNA encoding SARSVm100 (5'-UTR, MCS, 3'-UTR, and 100 adenines) with the 5'-UTR and 3'-UTR obtained from SARS-CoV-2 (GenBank: NC_045512.2). This mRNA is designated SARSVm100. After cloning EGFP into the MCS, synRNA was in vitro transcribed using Cap1 (TriLink) with or without the m1Ψ modification. Compared to SARSVm, further enhancement of EGFP expression was observed only with the m1Ψ-modified form of SARSVm100.

[0122] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR) followed by an adenine homopolymer, wherein the 5'-UTR and 3'-UTR are derived from an ssRNA virus (which naturally has an adenine homopolymer at their 3' ends). IX. Chromosomes of the Togaviridae

[0123] The +ssRNA genome of the Togaviridae family is 9.7 to 11.8 kb and contains a 5'-Cap and a 3' poly(A). The Togaviridae family includes the alphaviruses, which are widely used as self-replicating RNAs (self-amplifying RNAs, replicons), and includes Venezuelan Equine Encephalitis Virus, Semliki Forest Virus, Sindbis Virus, and Chikungunya Virus. The natural poly(A) length of these viruses is short, typically within the range of about 25 to about 35 nucleotides.

[0124] To test whether the 5'-UTR, 3'-UTR, and short poly(A) from a togavirus can be used to express heterologous proteins, we constructed a plasmid vector carrying a T7 promoter followed by DNA encoding VEEV mRNA (5'-UTR, MCS, 3'-UTR, and 30 adenines). The 5'-UTR and 3'-UTR were obtained from Venezuelan equine encephalitis virus (Genbank: L014442.2). This mRNA is now called VEEVm. After cloning EGFP into the MCS, synRNA was in vitro transcribed using Cap1 (CleanCap AU, TriLink) with or without the m1Ψ modification. VEEVm can efficiently express EGFP when the mRNA is modified with m1Ψ.

[0125] We also tested the addition of longer adenine homopolymers to the native poly(A) tail of VEEV. To this end, we constructed a plasmid vector carrying a T7 promoter followed by DNA encoding VEEVm100 RNA (5'-UTR, MCS, 3'-UTR, and 100 adenines) with the 5'-UTR and 3'-UTR derived from Venezuelan equine encephalitis virus (Genbank: L014442.2). This mRNA was designated VEEVm100. After cloning EGFP into the MCS, synRNA was in vitro transcribed using Cap1 (TriLink) with or without the m1Ψ modification. Compared to VEEVm, further enhancement of EGFP expression was observed only with the m1Ψ-modified form of VEEVm100. X. In vivo expression of luciferase from NOV2m(A50) and DENVm(A50) in muscle

[0126] We focused on mRNAs with an additional homopolymeric adenine to test the in vivo expression of +ssRNA virus-based synRNAs. We selected NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) for testing in skeletal muscle (Example 21).

[0127] For intramuscular injection, synRNA-LUC (luciferase) was complexed with lipid nanoparticles (LNPs) Invivofectamine 3.0 (ThermoFisher) according to the manufacturer's protocol. The synRNA-LUC / LNP complex was injected directly into the muscle of BALB / c mice. Luciferase expression was monitored using a bioluminescence imaging system.

[0128] We demonstrated that luciferase was efficiently expressed in muscle from all four mRNAs: NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) (Figure 28). The 50-adenine homopolymer RNA resulted in somewhat higher levels of luciferase expression than the 30-adenine homopolymer RNA. Nucleoside modifications helped to enhance translation efficiency in muscle for NOV2m but not for DENVm. XI. In vivo expression of luciferase from NOV2m(A50) and DENVm(A50) in skin

[0129] We also examined the in vivo expression of NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) in the skin (Example 21).

[0130] For intradermal injection, we previously demonstrated that naked c-srRNA (controllably self-replicating RNA) dissolved in lactated Ringer's solution (i.e., without transfection reagents or LNPs) can efficiently produce protein (see U.S. Patent No. 11,421,248 to Ko). We also demonstrated that the addition of chitosan oligosaccharides increases protein expression (see WO 2022 / 266511 and WO 2023 / 034881 to Elixirgen Therapeutics, Inc.). Here, we evaluated the expression of luciferase from NOV2m and DENVm in the skin after intradermal administration of naked mRNA in the presence and absence of chitosan.

[0131] Approximately 20.0 μg of each synRNA was dissolved in 60 μL of lactated Ringer's solution with or without chitosan oligosaccharide (molecular weight ≦5 kDa, ≧75% deacetylated; Heppe Medical Chitosan GmbH: product number 44009). The final concentration of chitosan oligosaccharide was 1.5 μg / ml. Luciferase expression was monitored using a bioluminescence imaging system.

[0132] We demonstrated that luciferase was efficiently expressed in skin from NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) (Figure 29). SynRNAs with longer 50-adenine homopolymers performed better than synRNAs with shorter 30-adenine homopolymers for both NOV2m and DENVm. Nucleoside modifications helped enhance translation efficiency in skin for NOV2m but not for DENVm. For DENVm, unmodified synRNA (Unm) performed better than modified synRNA (m1Ψ). We demonstrated that, overall, DENVm(A50), whether modified or unmodified, performed well and was slightly superior to NOV2m(A50). Interestingly, administration of synRNA in a composition containing chitosan oligosaccharide dramatically enhanced luciferase expression in all conditions tested: NOV2m(m1Ψ), NOV2m(Unm), DENVm(m1Ψ), and DENVm(Unm). Overall, we demonstrated that DENVm(A50), whether modified or unmodified, performed well and was somewhat superior to NOV2m(A50), even with nucleoside modifications. XII. Using synRNA Technology to Express Large Proteins

[0133] The technology disclosed herein makes it possible to produce synRNAs encoding large proteins. Generally, synRNAs cannot accommodate the coding sequences of large proteins. For example, the synRNA encoding the cystic fibrosis transmembrane conductance regulator (CFTR), which is 1,480 amino acids long, is the largest protein currently being tested in clinical trials (Vavilis et al. 2023). Because CFTR and many other large proteins are candidates for protein replacement therapy, it is desirable to use a synRNA platform for their production.

[0134] Mutational deficiency of the dystrophin (DMD) protein causes Duchenne muscular dystrophy. The 3,685 amino acid-long DMD protein is another target for protein replacement therapy. However, due to its large protein size, current clinical trials using adeno-associated virus (AAV) vectors use a truncated version of DMD (microdystrophin). As a result of the developments of the present disclosure, it is now possible to produce synRNA encoding the full-length human DMD protein and successfully express the DMD protein in vitro (Example 16; Figures 23A and 23B) and in vivo (Example 17; Figures 24A, 24B, and 24C). While the examples herein use DMD sequences from public databases (e.g., NCBI), codon-optimized or truncated DMD sequences can also be used.

[0135] In Example 17, we also used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. However, in this example only, the synRNA encoded a fusion protein of luciferase (LUC) and full-length human dystrophin (DMD) protein (transcript variant Dp427m, NCBI accession number NM_004006). When the 13.0-kb-long NOV2m-LUC-DMD-A28 synRNA was injected into skeletal muscle, it produced the fusion protein, which was detected by in vivo luciferase assay (Figures 24B and 24C). This indicates that a very large protein was successfully expressed in vivo from a +ssRNA virus-based synRNA.

[0136] We also demonstrated the production of human dystrophin protein in mouse skeletal muscle by immunohistochemistry. In Example 22, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues, which encoded only full-length human dystrophin protein (not the LUC-DMD fusion protein). When the 11.3 kb long NOV2m-DMD-A28 synRNA was injected into skeletal muscle, it produced dystrophin protein, which was detected by immunohistochemistry. Muscle sections from the injection site were stained with an anti-human DMD antibody (MANDYS106) (which recognizes human dystrophin but not mouse dystrophin). Untreated muscles showed no staining, but muscles injected with NOV2m-DMD-A28 synRNA showed the production and appropriate localization of human dystrophin protein (Figure 31, upper panel). In addition, muscle sections stained with anti-mouse DMD antibody (AB15277), which recognizes both mouse and human dystrophin proteins, showed appropriate localization of mouse and human dystrophin proteins (Figure 31, lower panel). Higher magnification images of immunostaining results from the same experiment also showed appropriate localization of full-length human dystrophin protein in mouse skeletal muscle.

[0137] Importantly, we have successfully demonstrated herein functional recovery of skeletal muscle in mutant mice lacking mouse dystrophin protein as a result of intramuscular injection of NOV2m-DMD-A28 synRNA (Example 23). The nucleotide sequence of NOV2m-DMD-A28 synRNA is set forth as SEQ ID NO: 42. mdx D2.mdx mice, also known as / J mice, are a well-known animal model of Duchenne muscular dystrophy because they recapitulate the muscle pathology characteristic of human DMD (Coley, et al. 2016, Hammers, et al. 2020). DBA / 2 mice (wild-type) are often used as controls. In Example 23, D2.mdx mutant and wild-type DBA / 2 mice received three intramuscular injections of synRNA in the ventral forearm and two intramuscular injections in the dorsal forearm. One week after six weekly injections, peak forearm muscle strength was measured using a grip strength scale. The NOV2m-DMD-A28 synRNA-injected group showed statistically significant (*p<0.05) recovery of muscle strength compared to the uninjected group (D2.mdx) and the control mRNA-LUC-injected group (D2.mdx-LUC) (Figure 32A). There was no statistically significant difference between the D2.mdx-DMD and wild-type DBA / 2 groups. There were no safety concerns related to the administration of NOV2m-DMD-A28 synRNA in the NOV2m-DMD-A28 synRNA-injected group. These results demonstrate that another large protein was successfully expressed in vivo from a +ssRNA viral-based synRNA.

[0138] Furthermore, we demonstrated that a single intramuscular injection of NOV2m-DMD-A28 synRNA resulted in the restoration of muscle strength in D2.mdx mutant mice (Figure 32B). This result indicates that not only does a single NOV2m-DMD-A28 synRNA injection restore muscle strength in D2.mdx mutant mice, but also that the heterologous DMD protein is stable and maintained in cells at the injection site for at least 3 weeks.

[0139] Mutational deficiency of type VII collagen alpha-1 (VII) chain (COL7A1) protein causes epidermolysis bullosa. Type VII collagen is a homotrimer of COL7A1 proteins, each of which is 2,944 amino acids in length. The disclosed technology enabled the production of synRNA encoding full-length human COL7A1 protein and successful expression of COL7A1 protein in vitro (Figure 25B) and in vivo. In the examples herein, COL7A1 sequences from public databases (e.g., NCBI) were used; however, codon-optimized or truncated COL7A1 sequences can also be used.

[0140] Deficiency of von Willebrand factor (vWF) due to mutation causes a blood clotting disorder called von Willebrand disease. vWF is 2,813 amino acids long. The technology disclosed herein has made it possible to produce synRNA encoding the full-length human VWF protein. In the examples herein, VWF sequences from public databases (e.g., NCBI) were used, but codon-optimized or truncated VWF sequences can also be used.

[0141] Many diseases are caused by a lack or loss of function of proteins, which are potential targets for protein replacement therapy using synRNA. On the other hand, overproduction or abnormal production of proteins causes other types of diseases. SynRNAs encoding dominant-negative forms of these proteins are potential treatments for these diseases. One of the hurdles to applying synRNAs to such therapies is the size of the proteins, as pathogenic genes are often large proteins.

[0142] For example, according to the UniProt database, over 200 human proteins longer than 2,000 amino acids (>6,000 nucleotide coding region) are involved in human disease. These genes include, but are not limited to, the following: ABCA1, ABCA12, ABCA2, ABCA4, ABCA7, ACACA, ACAN, ADGRV1, AGRN, AKAP9, ALMS1, ANK2, ANK3, ANKRD11, ANKRD17, APC, APC2, APOB, ARID1A, ARID1B, ASH1L, ASPM, ASXL3, ATM, ATR, ATRX, BDP1, BLTP1, BPTF, BRCA2, C2CD3, CACNA1A, CACNA1B, CACNA1C, CACNA1D, CACNA1E, CACNA1G, CACNA1H, CACNA1I, CAD, CCDC88C, CDH23, CELSR1, CENPE, CENPF, CEP250, CEP290, CFAP47, CHD3, CHD6, CHD7, CHD8, CIT, CNOT1, CNTRL, COL12A1, COL6A3, COL6A5, COL7A1, CPLANE1, CREBBP, CUBN, DCHS1, DMBT1, DMD, DMXL2, DNAH1, DN AH10, DNAH11, DNAH17, DNAH2, DNAH5, DNAH8, DNAH9, DNAJC13, DNHD1, DOCK3, DOCK6, DOCK7, DOCK8, DSP, DST, DYNC1H1, DYNC2H1, DYSF, EP30 0, EPG5, EYS, F5, F8, FANCM, FAT2, FAT4, FBN1, FBN2, FLG, FLG2, FLNA, FLNB, FLNC, FN1, FRAS1, FREM1, FREM2, FRYL, FSIP2, GPR179, HCFC1, HE RC1, HERC2, HIVEP2, HMCN1, HSPG2, HTT, HUWE1, HYDIN, IGSF10, INTS1, ITPR1, ITPR2, ITPR3, KAT6A, KAT6B, KMT2A, KMT2B, KMT2C, KMT2D, KN L1, LAMA1, LAMA2, LAMA3, LAMA5, LOXHD1, LRBA, LRP1, LRP2, LRRK1, LRRK2, LYST, MACF1, MAP1B, MED12, MED12L, MED13, MED13L, MEGF8, MPDZ,MTOR、MUC5B、MXRA5、MYO15A、MYO18B、MYO7A、MYO9A、MYO9B、MYOF、NAV3、NBAS、NBEA、NBEAL2、NEB、NF1、 NIN、NIPBL、NOTCH1、NOTCH2、NOTCH3、NSD1、NUP205、NUP214、OBSCN、OTOG、OTOGL、PCLO、PCM1、PCNT、PDE 4DIP、PI4KA、PIEZO1、PIEZO2、PIKFYVE、PKD1、PKD1L1、PKHD1、PLCE1、PLEC、POLE、POLQ、PRKDC、PRPF8、P RR12、PTPRQ、RALGAPA1、RANBP2、RELN、RNF213、ROS1、RP1、RP1L1、RTTN、RYR1、RYR2、SACS、SCN1A、SCN2A SCN3A, SCN5A, SETD2, SETX, SMCHD1, SNRNP200, SON, SORL1, SPAG17, SPEG, SPEN, SPG11, SPTA1, SPTAN1, SPTB, SPTBN1, SPTBN2, SPTBN4, SRCAP, SVIL, SYNE1, SYNE2, SZT2, TECTA, TENM3, TENM4, TET1, TET2, T EX15、TG、TNC、TNXB、TPR、TRIO、TRIOBP、TRPM6、TRRAP、TTN、UNC80、USH2A、USP9X、USP9Y、VCAN、VPS13A、 VPS13B、VPS13C、VPS13D、VWF、WDFY3、WNK1、ZFHX2、ZFHX4、ZFYVE26、ZNF292、ZNF407、ZNF462、ZNF469。、

[0143] Additionally, according to the UniProt database, over 300 human proteins between 1,333 and 1,999 amino acids in length (3,999-5,997 nucleotide coding regions) have been implicated in human diseases, including, but not limited to, the following genes: A2ML1, ABCA3, ABCC1, ABCC2, ABCC6, ABCC8, ABCC9, ADAMTS13, ADCY10, ADGRL1, AFDN, AGL, AHDC1, ALK, ALPK3, ALS2, ANAPC1, ANK1, ANKRD26, ARFGEF1, ARFGEF2, ARHGAP31, ARHGEF10, ARHGEF12, ARHGEF18, ARID2, ASXL1, and ASXL2. 2, ATP7A, ATP7B, BAZ1B, BCL9, BCOR, BCORL1, BICRA, BLM, BRCA1, BRD4, BRWD3, C2CD6, C3, C4A, C4B, C4ORF54, C5, CACNA1F, CACNA1S, CAMS AP2, CAMTA1, CARMIL2, CC2D2A, CCDC88A, CDC42BPB, CDK12, CDK13, CDK5RAP2, CENPJ, CEP152, CEP164, CFAP43, CFAP44, CFAP65, CFAP74, C FTR, CHD1, CHD2, CHD4, CHD5, CIC, CLTC, CNTNAP1, CNTNAP2, COL11A1, COL11A2, COL17A1, COL18A1, COL1A1, COL1A2, COL27A1, COL2A1, CO L3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, CPAMD8, CPS1, CPSF1, CRB1, CUL7, CUX1, CUX2, DCC, DEPDC5, DIC ER1, DLEC1, DNMBP, DNMT1, DOCK2, DUOX2, EIF2AK4, EIF4G1, ELP1, EPRS1, ERBB3, ERCC6, ERCC6L2, EXPH5, ​​FANCA, FANCD2, FHOD3, FLT1, FLT 4, FMN2, FOCAD, FYCO1, GEMIN5, GLI2, GLI3, GREB1L, GRIN2A, GRIN2B, GRIN2D, HECW2, HFM1, IFT140, IFT172, IGF1R, IGSF1, INSR, IQSEC2,ITGB4、KANK1、KATNIP、KDM3B、KDM5A、KDM5B、KDM5C、KDM6A、KDM6B、KDR、KIA A0586、KIAA1549、KIDINS220、KIF14、KIF15、KIF1A、KIF1B、KIF21A、KIF26A 、KIF7、KMT2E、LAMA4、LAMB1、LAMB2、LAMC3、LCT、LRP4、LRP5、LRP6、LRPPRC、 LTBP1、LTBP2、LTBP4、MADD、MAGI2、MAP3K1、MAPK8IP3、MAPKBP1、MAST1、MBD 5、MCM3AP、MED23、MET、MIA2、MIA3、MLH3、MSH6、MST1R、MYH10、MYH11、MYH14 、MYH2、MYH3、MYH6、MYH7、MYH8、MYH9、MYLK、MYO3A、MYO5A、MYO5B、NALCN、NC APD2、NCAPD3、NCOA1、NCOA2、NEXMIF、NFASC、NHS、NLRP1、NPHP3、NPHP4、NRX N1、NSD2、NSD3、NUP155、NUP160、NUP188、NUP98、OBSL1、OTOF、PALLD、PAPPA2 、PARD3、PBRM1、PCDH11Y、PCDH15、PHIP、PIK3C2A、PLCH1、PLEKHG2、PLXNA1、 PNPLA6、POGZ、POLA1、POLR1A、POLR2A、POLR3A、PRG4、PRX、PTCH1、PTPN23、P TPRF、PXDN、QRICH2、RAB3GAP2、RAI1、RAPGEF2、RERE、RIC1、RIMS1、RIMS2、R OBO2、ROBO3、RUSC2、SAMD9、SAMD9L、SBF1、SBF2、SCAPER、SCN10A、SCN11A、SC N4A、SCN8A、SCN9A、SCRIB、SETBP1、SETD1A、SETD1B、SETD5、SHANK2、SHANK3 、SHOC1、SHROOM4、SI、SIPA1L3、SKIC3、SLX4、SMARCA2、SMARCA4、SOS1、SOS2 SPEF2, STRC, SYCP2, SYNGAP1, SYNJ1, TAF1, TANC2, TCF20, TCHH, TCOF1, TDRD9, TECPR2, TET3, TEX14, THADA, THOC2, THSD7A, TIAM1, TMEM94, TNIK, TNRTNRC6A, TNRC6B, TOGARAM1, TONSL, TOP2B, TP53BP1, TRIP11, TRIP12, TRPM1, TRPM3, TRPM7, TSC2, T UBGCP6, UBR1, USP6, WDR19, WDR62, WDR81, WRN, XDH, YEATS2, ZMYM2, ZMYM3, ZNF142, ZNF335, ZNFX1. , XIII. Use of synRNA Technology for Large Fusion Proteins or Multiple Protein Subunits

[0144] The technology disclosed herein makes it possible to produce synRNAs encoding large fusion proteins (Figures 24 and 25). Proteins often function as complexes (formed intracellularly) composed of multiple protein subunits. Therefore, it is essential that all protein subunits of a protein complex be expressed within the same cell. If subunit proteins are encoded by separate synRNAs, they may not be delivered to the same cell. Therefore, it is desirable to encode each protein subunit in the same synRNA. This can be achieved by creating a single fusion protein, in which each protein coding region is fused via a 2A self-cleaving peptide. Alternatively, the coding sequences for the protein subunits can be connected via an internal ribosome entry site (IRES). Regardless of the connecting element used, the size of a fusion protein or a synRNA encoding multiple protein subunits will be large. The technology disclosed herein is suitable for use with long coding regions (e.g., large cargo spaces) to enable the production of fusion proteins and polyprotein complexes within host cells.

[0145] One example of a large polyprotein complex is type I collagen, which accounts for 70% of the total collagen in the human body. Mutational deficiency of type I collagen causes a disease known as osteogenesis imperfecta. Type I collagen is a heterotrimer composed of two COL1A1 proteins (1,464 amino acids in length) and one COL1A2 protein (1,366 amino acids in length). To achieve a 2:1 stoichiometry, two COL1A1 coding sequences and one COL1A2 coding sequence are fused via a nucleic acid encoding a 2A self-cleaving peptide, resulting in a synRNA over 13 kb in length (encoding a 4,338 amino acid fusion protein) (Figure 30A). While such constructs pose significant challenges for conventional RNA technology, the disclosed synRNAs (lacking a poly(A) tail or having a short 3' adenine homopolymer) facilitate the expression of this large fusion protein from a single synRNA molecule.

[0146] Some fusion proteins may be composed of multiple copies of the same protein, increasing the number of proteins produced from a single synRNA. Alternatively, multiple copies of the coding region for the same protein can be linked via an IRES in a single synRNA. One example is erythropoietin (EPO), which is 193 amino acids in length. The disclosed technology (e.g., synRNA lacking a poly(A) tail or synRNA with a short 3' adenine homopolymer) facilitates the expression of multiple EPO proteins in a single synRNA, resulting in the production of more EPO proteins from a single synRNA in vivo (Figure 30B). XIV. Use of synRNA Technology to Express Ribonucleoproteins

[0147] Ribonucleoproteins function by forming a complex between a protein and its partner RNA. One example of a ribonucleoprotein is telomerase, which is composed of telomerase reverse transcriptase (TERT) as a protein component and telomerase RNA (TERC) as an RNA component. Another example is the CRISPR / Cas9 genome editing tool, which is composed of Cas9 as a protein component and a single guide RNA (sgRNA) as an RNA component. Other genome editing tools, such as Cas12a, Cas13, and "prime editing," are also based on ribonucleoproteins. Ribonucleoproteins also include, but are not limited to, ribosomes, vault ribonucleoproteins, RNase P, hnRNPs, and small nuclear RNPs (snRNPs).

[0148] Therapeutic applications of ribonucleoproteins require the delivery of protein and RNA in the same cell. Since proteins are expressed in cells by introducing synRNA, it is desirable that both the protein and RNA are encoded in the same synRNA. The RNA element can be cleaved by flanking it with a self-cleaving ribozyme RNA sequence or a target sequence for a ribozyme, such as RNase III, RNase P, or RNase Z, or a Cas protein, such as Cas12a. However, cleavage of the synRNA cleaves the 5'-Cap and / or 3'-poly(A) from the synRNA coding sequence, resulting in loss of protein production.

[0149] This problem is solved by the disclosed technology (synRNA lacking a poly(A) tail or a short 3' adenine homopolymer). A typical design for such synRNAs consists of a 5'-Cap, a 5'-UTR, a CDS (encoding the protein portion), a 3'-UTR, ribozyme(s), an RNA portion, and either the absence or a short adenine homopolymer. For example, a single synRNA encodes both TERT (the protein portion) and TERC (the RNA portion) (Figure 30C). After delivery of the synRNA into a cell, a ribozyme cleaves the synRNA, generating two RNA molecules: a protein-producing portion (5'-Cap, 5'-UTR, CDS, 3'-UTR) and an RNA portion. Although the protein-producing portion lacks a poly(A) tail, it remains suitable for protein production, and it binds to the RNA portion to form a protein / RNA complex (ribonucleoprotein). The RNA moiety includes, but is not limited to, TERC, sgRNA, crRNA, microRNA, and shRNA. The technology of the present disclosure provides synRNAs with large cargo spaces, which can accommodate both large protein coding sequences and large RNAs (or RNA repeats). XV. ENUMBER OF EMBODIMENTS 1. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR is Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof, or Nodamura virus RNA1 (NOV1) 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; The RNA molecule, wherein the CDS is heterologous to NOV2 or NOV1 and replaces the Nodamura virus capsid protein open reading frame or the Nodamura virus RNA-dependent RNA polymerase (RdRp) open reading frame of NOV2. 2. The RNA molecule of embodiment 1, wherein the 3'-UTR is NOV2 3'-UTR. 3. The RNA molecule of embodiment 2, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 10. 4. The RNA molecule of embodiment 1, wherein the 3'-UTR is NOV1 3'-UTR. 5. The RNA molecule of embodiment 4, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 7. 6. The following: (i) the nucleotide sequence of SEQ ID NO: 6 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 7 as the 3'-UTR; or (i) the nucleotide sequence of SEQ ID NO: 9 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 10 as the 3'-UTR; 2. The RNA molecule of embodiment 1, comprising: 7. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces at least a portion of the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus whose genome lacks a poly(A) tail. 8. The RNA molecule of embodiment 7, wherein the virus is a member of a viral family selected from the group consisting of Nodaviridae, Flaviviridae, and Tetraviridae. 9. The RNA molecule of embodiment 8, wherein the virus is a member of the Nodaviridae family. 10. The RNA molecule of embodiment 9, wherein the virus is Nodamura virus or Flock House virus. 11. The RNA molecule of embodiment 8, wherein the virus is a member of the Flaviviridae family. 12. The RNA molecule of embodiment 11, wherein the virus is a dengue virus. 13. The RNA molecule of embodiment 7, wherein the virus is a plant virus. 14. The RNA molecule of embodiment 13, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV). 15. An RNA molecule described in any one of embodiments 1 to 14, comprising at least one modified nucleoside. 16. The RNA molecule of embodiment 15, wherein the at least one modified nucleoside comprises "5mC+Ψ", "m1Ψ", "5moU", or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC+Ψ". 17. An RNA molecule described in any one of embodiments 1 to 16, wherein the at least one CDS comprises two or more CDSs for two or more different proteins. 18. The RNA molecule of embodiment 17, wherein the two or more CDSs are operably linked to form a fusion protein comprising two or more different proteins. 19. The RNA molecule of embodiment 17, wherein the two or more CDSs are separated from each other by an internal ribosome entry site (IRES). 20. The RNA molecule described in embodiment 17, wherein the two or more CDSs are separated from each other by a flexible linker or nucleotides encoding a 2A self-cleaving peptide. 21. The RNA molecule of any one of embodiments 1 to 20, wherein the RNA molecule comprises a heterologous adenine homopolymer at its 3' end of about 60 nucleotides or less in length, optionally wherein the heterologous adenine homopolymer is 20 to 60 nucleotides in length. 22. An RNA molecule described in any one of embodiments 1 to 20, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein. 23. A DNA template for an RNA molecule according to any one of embodiments 1 to 22, optionally wherein a first restriction enzyme site(s) is / are present between the 5'-UTR and at least one coding region, and a second restriction enzyme site(s) is / are present between the at least one coding region and the 3'-UTR. 24. A plasmid comprising the DNA template of embodiment 23, wherein the plasmid comprises a promoter upstream of the 5'UTR. 25. A host cell comprising the plasmid described in embodiment 24. 26. A recombinant virus comprising an RNA molecule described in any one of embodiments 1 to 22. 27. A method for expressing a protein, the method comprising contacting a mammalian cell with an RNA molecule described in any one of embodiments 1 to 22. 28. The method of embodiment 27, wherein said contacting is in vitro. 29. The method of embodiment 27, wherein the contacting is in vivo. 30. The method of any one of embodiments 27 to 29, wherein the contacting is performed in the presence of a B18R protein. 31. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, a 3'-untranslated region (3'-UTR), and an adenine homopolymer, wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS and adenine homopolymer are heterologous to the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus lacking its genomic poly(A) tail. 32. The RNA molecule of embodiment 31, wherein the adenine homopolymer is about 60 nucleotides or less in length. 33. The RNA molecule of embodiment 32, wherein the adenine homopolymer is 20 to 60 nucleotides in length. 34. The RNA molecule of embodiment 31, wherein the virus is a member of a viral family selected from the group consisting of Nodaviridae, Flaviviridae, and Tetraviridae. 35. The RNA molecule of embodiment 31, wherein the virus is a member of the Nodaviridae family. 36. The RNA molecule of embodiment 35, wherein the virus is Nodamura virus or Flock House virus. 37. The RNA molecule of embodiment 31, wherein the virus is a member of the Flaviviridae family. 38. The RNA molecule described in embodiment 37, wherein the virus is a dengue virus. 39. The RNA molecule of embodiment 31, wherein the virus is a plant virus. 40. The RNA molecule of embodiment 39, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV). 41. An RNA molecule described in any one of embodiments 31 to 40, comprising at least one modified nucleoside. 42. The RNA molecule of embodiment 41, wherein the at least one modified nucleoside comprises "5mC+Ψ", "m1Ψ", "5moU", or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC+Ψ". 43. An RNA molecule described in any one of embodiments 31 to 42, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein. 44. The RNA molecule of embodiment 31, wherein the adenine homopolymer is from about 60 nucleotides to about 120 nucleotides in length. 45. An RNA molecule comprising, from 5' to 3': a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces at least the open reading frame of the viral RNA-dependent RNA polymerase; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus. 46. ​​The RNA molecule of embodiment 45, wherein the RNA molecule further comprises an adenine homopolymer 15 to 200 nucleotides in length downstream of the 3'-UTR. 47. The RNA molecule described in embodiment 46, wherein the virus is a member of the coronavirus family. 48. The RNA molecule of embodiment 47, wherein the virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). 49. An RNA molecule comprising, from 5' to 3': a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; The CDS encodes a full-length human dystrophin or a full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein and replaces at least a portion of the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus. 50. An RNA molecule described in embodiment 49, wherein the viral genome lacks a poly(A) tail. 51. The RNA molecule of embodiment 50, further comprising a heterologous adenine homopolymer at its 3' end, optionally wherein the adenine homopolymer is 20 to 60 nucleotides in length. 52. The RNA molecule described in embodiment 49, wherein the viral genome comprises a poly(A) tail and the RNA molecule further comprises a poly(A) tail. 53. The RNA molecule of embodiment 52, further comprising a heterologous adenine homopolymer at the 3' end of the poly(A) tail, optionally wherein the poly(A) tail and the heterologous adenine homopolymer together are 20 to 120 nucleotides in length. 54. An RNA molecule comprising, from 5' to 3': a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a 5'-UTR of a dengue virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of a dengue virus or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; and The RNA molecule, wherein the CDS is heterologous to the dengue virus and replaces the open reading frame of the dengue virus so that a portion of the open reading frame that interacts with the complementary sequence of the 3'-UTR to form a circular three-dimensional structure remains within the RNA molecule. 55. An RNA molecule described in embodiment 54, wherein the first start codon of the portion of the open reading frame remaining in the RNA molecule is mutated (so that it does not initiate translation of the first corresponding genomic sequence), and the first corresponding site of the 3'-UTR (which interacts with the first start codon to form a circular conformation) is mutated (so that the mutated first start codon remains complementary to the first corresponding site of the mutated 3'-UTR to form a circular conformation). 56. The RNA molecule of embodiment 55, wherein the second start codon of the portion of the open reading frame remaining in the RNA molecule is mutated (so that it does not initiate translation of the second corresponding genomic sequence), and the second corresponding portion of the 3'-UTR (which interacts with the second start codon to form a circular conformation) is mutated (so that the mutated second start codon remains complementary to the second corresponding portion of the mutated 3'-UTR to form a circular conformation). 57. An RNA molecule described in any one of embodiments 54 to 56, further comprising a 5'-cap. 58. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:25 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:25; and (ii) The RNA molecule of any one of embodiments 54 to 57, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 26. 59. An RNA molecule described in any one of embodiments 54 to 58, further comprising a homopolymer of adenine downstream of the 3'-UTR. 60. The RNA molecule of embodiment 59, wherein the adenine homopolymer is about 30 to about 60 nucleotides in length. 61. An RNA molecule comprising, from 5' to 3': a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a plant viral 5'-UTR or a fragment thereof, and the 3'-UTR is a plant viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the plant virus and replaces at least a portion of the open reading frame of the plant virus; the virus is a positive-sense, single-stranded RNA (+ssRNA) virus whose genome lacks a poly(A) tail; and The RNA molecule, wherein the 3'-UTR contains a 3'-cap-independent translation enhancer (3'-CITE). 62. The RNA molecule of embodiment 61, further comprising a 5'-cap that is heterologous to the plant virus. 63. An RNA molecule described in embodiment 61 or embodiment 62, further comprising an adenine homopolymer heterologous to the plant virus. 64. The RNA molecule of embodiment 63, wherein the adenine homopolymer is about 30 to about 60 nucleotides in length. 65. An RNA molecule described in any one of embodiments 61 to 64, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV). 66. An RNA molecule described in any one of embodiments 61 to 64, wherein the 3'-CITE is a BYDV-like translation element (BTE), a PMV-like translation element (PTE), an I-type secondary structure (ISS) or a T-type structure (TSS). 67. An RNA molecule described in embodiment 66, wherein the 3'-CITE is BTE. 68. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:27 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:27; and (ii) The RNA molecule of embodiment 67, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 28. 69. An RNA molecule described in embodiment 66, wherein the 3'-CITE is a PTE. 70. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:29 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:29; and (ii) The RNA molecule of embodiment 69, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 30. 71. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 31; and (ii) The RNA molecule of embodiment 69, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 32 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 32. 72. An RNA molecule described in embodiment 66, wherein the 3'-CITE is an ISS. 73. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 33 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 33; and (ii) The RNA molecule of embodiment 72, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 34 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 34. 74. An RNA molecule described in embodiment 66, wherein the 3'-CITE is a TSS. 75. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 35; and (ii) The RNA molecule of embodiment 74, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 36. 76. An RNA molecule comprising, from 5' to 3': a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a viral 5'-UTR or a fragment thereof, and the 3'-UTR is a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus. 77. An RNA molecule described in embodiment 76, wherein the viral 3'-UTR comprises a heterologous adenine homopolymer downstream of the homologous adenine homopolymer of the virus. 78. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 37; and (ii) The RNA molecule of embodiment 77, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 38. 79. The RNA molecule described in embodiment 76, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1). 80. The RNA molecule of embodiment 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 39. 81. The RNA molecule described in embodiment 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 40 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 40. 82. The RNA molecule of embodiment 76, comprising the nucleotide sequence of SEQ ID NO: 41 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 41. 83. An RNA molecule described in any one of embodiments 76 to 82, wherein the 5'-UTR and 3'-UTR form a circular three-dimensional structure. 84. From 5' to 3': An RNA molecule comprising a viral 5'-untranslated region (5'-UTR), a multiple cloning site (MCS), and a viral 3'-untranslated region (3'-UTR), wherein: The above RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus and the MCS is 18 to 60 nucleotides in length. 85. The RNA molecule of embodiment 84, wherein the MCS comprises the nucleotide sequence of SEQ ID NO: 8. 86. The RNA molecule of embodiment 84, comprising the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 3. 87. The RNA molecule of embodiment 84, comprising a nucleotide sequence selected from SEQ ID NOs: 11 to 24, or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to a nucleotide sequence selected from SEQ ID NOs: 11 to 24. 88. An RNA molecule described in any one of embodiments 84 to 87, further comprising at least one coding sequence (CDS) for at least one protein located within the MCS or replacing a portion of the MCS. 89. A DNA template for an RNA molecule described in any one of embodiments 31 to 88. 90. The DNA template of embodiment 89, wherein a first restriction enzyme site(s) is / are present between the 5'-UTR and at least one coding region, and a second restriction enzyme site(s) is / are present between the at least one coding region and the 3'-UTR. 91. A plasmid comprising the DNA template described in embodiment 90, wherein the plasmid comprises a promoter upstream of the 5'UTR. 92. A host cell comprising the plasmid described in embodiment 91. 93. A recombinant virus comprising an RNA molecule described in any one of embodiments 31 to 88. 94. A method for expressing a protein, comprising contacting a mammalian cell with an RNA molecule described in any one of embodiments 31 to 88. 95. The method of embodiment 94, wherein the contacting is in vitro. 96. The method of embodiment 94, wherein the contacting is in vivo. 97. The method of any one of embodiments 94-96, wherein the contacting is carried out in the presence of B18R protein. [Example]

[0150] Abbreviations: +ssRNA (positive-sense single-stranded RNA); 3'-UTR (3'-untranslated region); 5'-UTR (5'-untranslated region); 5mC+Ψ (5-methylcytosine and pseudouridine); 5moU (5-methoxyuridine); B18R (vaccinia virus-encoded receptor protein); BTE (BYDV-like translation element); BYDV (barley yellow dwarf virus); CDS (coding sequence); COL1A (type I collagen α chain); COL7A1 (type VII collagen α-1 chain); DAPI (4',6-diamidino-2-phenylindole). DENV (dengue virus); DMD (dystrophin); EGFP (enhanced green fluorescent protein); EPO (erythropoietin); GOI (gene of interest); GS linker (glycine serine linker); HDFn (human dermal fibroblast, neonatal); IRES (internal ribosome entry site); IVT (in vitro transcription); kb (kilobase); LUC (luciferase); m1Ψ (N1-methylpseudouridine); MCS (multiple cloning site); MNESV (maize necrotic streak virus); NOV (Nodamura virus); NOV RNA1 (NOV1); NOV RNA2 (NOV2); ORF (open reading frame); PCR (polymerase chain reaction); PEMV2 (pea elevated mosaic virus-2); PMV (panicum mosaic virus); PTE (PMV-like translation element); Ψ (pseudouridine); synRNA (synthetic mRNA); RdRp (RNA-dependent RNA polymerase); TCV (turnip crinkle virus); Unm (unmodified). Example 1. Production of NOV1-EGFP, NOV2-EGFP, NOV2m, and NOV2m-EGFP synRNAs

[0151] This example describes the construction of plasmid DNA and its use for the production of synRNA. Nodamura virus (NOV) contains a bipartite + ssRNA genome, RNA1 (NOV1) and RNA2 (NOV2). Both RNA1 and RNA2 have a 5'-Cap but no poly(A) tail at their 3' ends. RNA1 encodes the RNA-dependent RNA polymerase (RdRp), and RNA2 encodes the capsid protein. As a proof-of-concept, the open reading frames of NOV1 and NOV2 were replaced with the open reading frame (ORF) of a gene of interest (GOI). Materials and Methods

[0152] Design of NOV RNA and construction of template plasmid DNA. The NOV1 RNA genome sequence (NC_002690) and NOV2 RNA genome sequence genome 2 (NCBI accession: NOV2, NC_002691) were used as starting sequences. The open reading frames of NOV1 and NOV2 (from the start codon to the stop codon) were replaced with the coding sequence for enhanced green fluorescent protein (EGFP) (Figure 1A, Figure 1B). To facilitate the cloning of various genes into the NOV2 expression cassette in plasmid DNA, the ORF of NOV2 was replaced with a multiple cloning site sequence. This expression cassette was named NOV2m (Figure 1C). NOV2m-EGFP was produced by cloning EGFP using the Kozak consensus sequence at the AscI-NotI site (Figure 1D). Exemplary plasmid DNA for the production of NOV1-GOI mRNA, NOV2-GOI mRNA, and NOV2m-GOI mRNA is shown in Figure 1E. A T7 RNA polymerase promoter sequence was added to the 5' end of NOV1 and NOV2 to facilitate in vitro transcription (IVT). A 5'-Cap can be added to mRNA using standard methods. However, for convenience, a 5'-Cap (Cap1) was added using CleanCap AG (Henderson 2021; TriLink). This allowed for the insertion of nucleotides (A) immediately downstream of the T7 promoter. At the 3' end, a SapI restriction enzyme site was added to create the same 3'-terminal sequence present in the NOV1 and NOV2 RNA fragments.

[0153] Preparation of synthetic RNA by in vitro transcription. Plasmid DNA was linearized with SapI restriction enzyme and used as template DNA for in vitro transcription (IVT), which was performed using the MEGAscript T7 Kit (ThermoFisher Scientific) according to the manufacturer's instructions. 5'-Cap was incorporated using CleanCap AG (TriLink). RNA with modified nucleosides was prepared according to the manufacturer's instructions. Five versions of RNA were prepared: a reference RNA without any nucleoside modifications (unmodified), RNA modified with 5-methylcytosine and pseudouridine (5mC+Ψ), RNA modified with N1-methylpseudouridine (m1Ψ), RNA modified with 5-methoxyuridine (5moU), and RNA modified with pseudouridine (Ψ). result

[0154] Schematics of the successfully produced synRNAs are shown in Figures 1A, 1B, 1C, and 1D. The RNA sequences of these constructs are set forth as SEQ ID NOs: 1-4. Example 2. EGFP protein expression from NOV1 mRNA and NOV2 mRNA

[0155] This example describes the transfection of human fibroblasts with synRNAs in which the open reading frames (start to stop) of NOV1 and NOV2 were replaced with the coding sequence for enhanced green fluorescent protein (EGFP). The viability of transfected cells and the expression of EGFP protein from the transfected cells are also described. Materials and Methods

[0156] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0157] Transfection of NOV1-EGFP synRNA and NOV2-EGFP synRNA into HDFn cells. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The following day, cells were transfected with 0.5 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). Four different synRNAs were used: NOV1-EGFP synRNA (unmodified), NOV1-EGFP synRNA (modified with 5mC and Ψ), NOV2-EGFP synRNA (unmodified), and NOV2-EGFP synRNA (modified with 5mC and Ψ). HDFn cells were cultured at 37°C or 33°C with or without 250 ng / mL recombinant B18R (Sigma). B18R is a vaccinia virus protein that functions as a decoy receptor for type I interferon. B18R binds human interferon alpha and enhances cell viability during RNA transfection.

[0158] Cell viability and EGFP expression. Phase contrast (left) and fluorescence (right) images were taken 12 hours after RNA transfection (Figure 2A, Figure 2B). Fluorescence images showed EGFP expression levels. Phase contrast images were taken 96 hours after RNA transfection (Figure 3). Results and Conclusions

[0159] EGFP protein expression was detected by fluorescence microscopy in both NOV1-EGFP mRNA-transfected cells and NOV2-EGFP mRNA-transfected cells at 37°C (standard cell culture conditions) (Figure 2A) and 33°C (low-temperature conditions) (Figure 2B). Both mRNAs lack poly(A) tails. As a result, the synRNAs are translatable despite their lack of poly(A) sequences.

[0160] NOV is known to function optimally at temperatures around 30° C., with little or no functionality at 37° C. Therefore, the stronger EGFP expression at 37° C. (FIG. 2A) than at 33° C. (FIG. 2B) was surprising.

[0161] Interestingly, stronger EGFP expression was observed in cells transfected with NOV2-EGFP mRNA than in cells transfected with NOV1-EGFP mRNA (Fig. 2A and 2B). Both the 5'-UTR and 3'-UTR sequences of NOV2 differ from those of NOV1. This indicates that the efficiency of protein translation from mRNA lacking a poly(A) sequence depends on the 5'-UTR and / or 3'-UTR sequences.

[0162] Phase-contrast images showed that both NOV1-EGFP synRNA and NOV2-EGFP synRNA were toxic to transfected cells (i.e., cytopathic effects), as evidenced by the presence of dead cells (Figures 2A, 2B, and 3). The cytopathic effects were reduced in cells transfected with nucleoside-modified NOV1-EGFP synRNA and NOV2-EGFP synRNA (Figures 2A, 2B, and 3). The cytopathic effects of unmodified synRNA were attenuated when transfected cells were cultured in the presence of B18R (Figures 2A, 2B, and 3). Interestingly, naturally occurring NOV RNA lacks nucleoside modifications.

[0163] In summary, the 5'-UTR and 3'-UTR of NOV1 and NOV2 can be used as components of poly(A)-less synRNAs for the expression of proteins of interest in transfected cells. NOV2 (5'-UTR, 3'-UTR) works better than NOV1 (5'-UTR, 3'-UTR). Unmodified NOV1 and NOV2 mRNAs are cytotoxic. Nucleoside modification (5mC+Ψ) mitigates the cytotoxicity of NOV1- and NOV2-based mRNAs. The presence of B18R in the culture medium mitigates the cytotoxicity of the mRNAs to some extent. Although slightly higher expression levels were observed at 37°C than at 33°C, NOV1 and NOV2 mRNAs are translatable at both 37°C and 33°C. Example 3: Effect of nucleoside modifications on NOV2-EGFP expression

[0164] This example describes the transfection of human fibroblasts with nucleoside-modified NOV2-EGFP synRNA. The viability of the transfected cells, as well as the expression of EGFP protein from the transfected cells, are also described. Materials and Methods

[0165] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0166] Transfection of NOV2-EGFP synRNA into HDFn cells. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The following day, cells were transfected with 0.5 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). Five different synRNAs were used: NOV2-EGFP synRNA (unmodified), NOV2-EGFP synRNA (modified with 5mC and Ψ), NOV2-EGFP synRNA (modified with m1Ψ), NOV2-EGFP synRNA (modified with 5mU), and NOV2-EGFP synRNA (modified with Ψ). HDFn cells were cultured at 37°C or 33°C with or without 250 ng / mL B18R (Sigma).

[0167] Cell viability and EGFP expression. Phase contrast and fluorescence images were taken 24 hours after RNA transfection. Results and Conclusions

[0168] EGFP protein expression was detected in all cells transfected with modified NOV2-EGFP synRNA when cultured at 37°C (standard cell culture conditions) and 33°C (low-temperature conditions). As shown in Table 3-1, synRNA containing N1-methylpseudouridine (m1Ψ) showed the strongest protein expression, followed by synRNA containing 5-methylcytosine and pseudouridine (5mC+Ψ). Modification with 5mU or Ψ The expression was weaker than that of 5mC+Ψ. Table 3-1. Effects of culture conditions and nucleotide modifications [Table 1]

[0169] The results of Example 3 were consistent with those of Example 2. Modified NOV2-EGFP expression was slightly stronger when transfected cells were cultured at 37°C than when they were cultured at 33°C. Based on phase-contrast images taken under the same conditions as in Table 3-1, unmodified NOV2 synRNA was more cytotoxic than modified NOV2 synRNA. B18R was able to alleviate the cytotoxicity of unmodified NOV2 synRNA to some extent when transfected cells were cultured at 37°C.

[0170] In summary, the 5'-UTR and 3'-UTR of NOV2 can be used as building blocks for poly(A)-less synRNAs. NOV2 synRNAs lacking nucleotide modifications are cytotoxic. Nucleoside modifications alleviate the cytotoxicity of NOV2 mRNA. The presence of B18R in the culture medium of transfected cells partially alleviates the cytotoxicity of many NOV2 synRNAs when the cells are cultured at 37°C. Protein production was somewhat higher when transfected cells were cultured at 37°C than when they were cultured at 33°C. Example 4. Inclusion of a multiple cloning site in NOV2-based synRNAs

[0171] This example describes the testing of a NOV2-based synRNA in which the coding sequence for EGFP was inserted into the multiple cloning site (MSS) located between the 5'-UTR and 3'-UTR of NOV2. This NOV2-based synRNA was designated NOV2m (m for multiple cloning site). It can be used to produce mRNA containing any ORF (encoding any protein of interest) in the absence of a poly(A) sequence. Materials and Methods

[0172] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0173] Transfection of NOV2-EGFP synRNA and NOV2m-EGFP synRNA into HDFn. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of NOV2-EGFP synRNA (m1Ψ-modified) or NOV2m-EGFP (m1Ψ-modified) synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 37°C or 30°C with or without 250 ng / mL B18R (Sigma).

[0174] Cell viability and EGFP expression. Phase contrast and fluorescence images were taken 17, 24, and 42 hours after RNA transfection. Results and Conclusions

[0175] EGFP protein expression was detected in cells transfected with both NOV2-EGFP(m1Ψ) synRNA and NOV2m-EGFP(m1Ψ) synRNA when cultured at 37°C in the presence or absence of B18R (Table 4-1). Strong EGFP expression was observed for at least 42 hours after synRNA transfection. The presence of B18R slightly enhanced overall expression, but the m1Ψ modification alone was sufficient for EGFP protein expression.

[0176] EGFP protein expression was detected in cells transfected with both NOV2-EGFP(m1Ψ) synRNA and NOV2m-EGFP(m1Ψ) synRNA when cultured at 30°C in the presence or absence of B18R (Table 4-1). Strong expression was observed for at least 42 hours after synRNA transfection, but expression was stronger at 37°C than at 30°C. The presence of B18R slightly enhanced overall expression, but the m1Ψ modification alone was sufficient to strongly express the protein. Table 4-1. Culture conditions and effects of the multiple cloning site [Table 2]

[0177] In summary, insertion of a multiple cloning site (MSS) between the 5'-UTR and 3'-UTR of NOV2 did not prevent protein translation from NOV2-based synRNA. Plasmids containing the NOV2m sequence facilitate cloning of coding sequences of interest into the multiple cloning site for in vitro transcription of synRNA lacking a poly(A) tail. The inclusion of modified nucleosides alleviates the cytotoxicity of NOV2m synRNA, based on phase-contrast images taken under the same conditions as in Table 3-1. The presence of B18R in the culture medium of transfected cells enhances protein expression from synRNA containing modified nucleotides to some extent. Protein production was somewhat higher when transfected cells were cultured at 37°C than when cultured at 30°C. Protein production from NOV2m synRNA continued for more than 42 hours after transfection. Example 5. Stronger and larger protein expression from NOV2 RNA and NOV2m-RNA

[0178] This example describes a comparison of EGFP expression from cells transfected with NOV2 and NOV2m synRNAs relative to cells transfected with a control synRNA with a standard 120 poly(A) tail. Materials and Methods

[0179] Production of control-EGFP synRNA by in vitro transcription. Control-EGFP synRNA encoding EGFP was used as a control. Control-EGFP synRNA was generated using 5-methylcytosine and pseudouridine (5mC+Ψ) modifications according to published protocols (Warren et al., 2010; Mandall and Rossi, 2013). A poly(A) tail of 120 consecutive adenines was added to the 3' end by tail-PCR (Warren et al., 2010; Mandall and Rossi, 2013). The 3'-UTR sequence of the control-EGFP synRNA is identical to that of mouse hemoglobin α, adult chain 1 (Hba-a1), mRNA (NM_008218.2).

[0180] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0181] Transfection of NOV2-EGFP synRNA, NOV2m-EGFP synRNA, and synRNA-EGFP into HDFn. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of NOV2-EGFP synRNA (m1Ψ-modified), NOV2m-EGFP synRNA (m1Ψ-modified), or synRNA-EGFP (5mC+Ψ-modified) using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 37°C with or without 250 ng / mL B18R (Sigma).

[0182] Cell viability and EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at 24, 96, and 185 hours after transfection. GFP-positive (+) cells were expressed as a percentage of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells or GFP > 300 for strong GFP+ cells. Results and Conclusions

[0183] EGFP protein expression was detected in cells transfected with both NOV2-EGFP(m1Ψ) synRNA and NOV2m-EGFP(m1Ψ) synRNA when the transfected cells were cultured at 37°C or 30°C in the presence or absence of B18R (Figure 4A, Figure 4B, Table 5-1). At 24 hours posttransfection, almost all cells expressed GFP (GFP > 30) in the presence or absence of B18R. Approximately 60% to 80% of GFP+ cells showed high levels of GFP expression (GFP > 300). For both NOV2-EGFP synRNA and NOV2m-EGFP synRNA, GFP expression continued for 185 hours (8 days) (Figure 4A, Figure 4B, Table 5-1).

[0184] As expected, GFP was also expressed by cells transfected with the control-EGFP synRNA (which included a 120 A poly(A) tail) (Figure 4A, Table 5-1). However, expression from the poly(A)-tailed synRNA was much weaker than that from the NOV2 and NOV2m synRNAs (without a poly(A) tail) (Figure 4A, Table 5-1; at 96 h posttransfection).

[0185] In summary, protein production from NOV2 and NOV2m synRNAs continues for more than 185 hours after transfection. Poly(A)-less NOV2 and NOV2m synRNAs show comparable or even superior protein expression to the control-EGFP synRNA with 120 A poly(A). Table 5-1. Culture conditions and effects of poly(A) tail [Table 3] Example 6. Production of DENVm-EGFP synRNA and Capless-DENVm-EGFP synRNA

[0186] This example describes the construction of plasmid DNA and its use for synRNA production. Dengue virus (DENV) is a nonsegmented, single-stranded RNA virus with an 11 kb genome modified at the 5' end with a cap-1 structure for canonical cellular translation. The 3' end of the RNA genome does not carry a poly(A) tail; rather, it forms a loop structure. Interestingly, a cap-independent mechanism of translation has also been described for DENV (Mazeaud et al., 2018). Therefore, we tested both Cap1 and capless versions of DENV RNA. Materials and Methods

[0187] DENVm synRNA design and template plasmid DNA structure. The genome sequence of Dengue virus 2 (DENV) (NC_001474.2; Kinney et al., 1997) was used as the starting sequence. Although the DENV RNA genome appears simple, consisting of a 5'-UTR, a single CDS, and a 3'-UTR, we anticipated that a simple strategy of replacing the CDS with a multiple cloning site sequence to clone a foreign CDS would not work. For the DENV RNA genome to function properly, it is known that DENV RNA must be circularized by complementary sequences located in both the 5'-UTR (including the sequence downstream of the ATG start codon) and the 3'-UTR (Mazeaud et al., 2018). Therefore, we reasoned that the N-terminal portion of the CDS must be maintained within the synRNA structure. To create a DENV-based synRNA construct that allows insertion of a foreign CDS starting from the ATG up to the stop codon, we introduced two mutations, changing AUG to AUC at two positions (Figure 5B). These mutations removed the two ATG start codons upstream of the multiple cloning site. However, the introduction of these two mutations disrupted the complementary sequence between these sequences and the corresponding sequences in the 3'-UTR. To maintain the circular structure of the DENV-based synRNA, we also introduced two corresponding mutations (CAU → GAU; GAC → CAC) in the 3'-UTR (Figure 5B).

[0188] The final DENV-based synRNA construct (designated DENVm synRNA) contained 5'-Cap1, 5'-UTR (mutated), multiple cloning site (MCS), and 3'-UTR (mutated), but no poly(A) (SEQ ID NO: 11). The RNA was generated by IVT using T7 RNA polymerase and a plasmid DNA template linearized with SapI restriction enzyme.

[0189] An exemplary plasmid DNA for the production of DENVm synRNA contains a T7 RNA polymerase promoter sequence for in vitro transcription (IVT) reactions. A 5'-Cap can be added to the mRNA using standard methods. However, for convenience, a 5'-Cap (Cap1) was added using CleanCap AG (Henderson 2021; TriLink). This allowed for the insertion of nucleotides (A) immediately downstream of the T7 promoter. Any 5'-Cap (e.g., Cap0, Cap1, or Cap2) can be added to the 5' end of the DENVm synRNA. At the 3' end, a SapI restriction enzyme site was added to create the same 3'-terminal sequence as present in the ENV RNA genome. To test protein production, EGFP was cloned into the MCS.

[0190] Design of Capless-DENVm synRNA and structure of template plasmid DNA. Because a cap-independent mechanism of translation has also been described for DENV (Mazeaud et al., 2018), we constructed a plasmid DNA with a standard T7 RNA polymerase promoter that produces the same DENVm synRNA but lacks the 5'-Cap, which we named Capless-DENVm synRNA (SEQ ID NO: 12).

[0191] Production of DENVm-EGFP synRNA by in vitro transcription. Plasmid DNA was linearized with SapI restriction enzyme and used as template DNA for in vitro transcription (IVT), which was performed using the MEGAscript T7 Kit (ThermoFisher Scientific) according to the manufacturer's instructions. A 5'-Cap was incorporated using CleanCap AG (TriLink). Two versions of RNA were prepared: a reference RNA containing no nucleoside modifications (unmodified or UNM) and an RNA modified with N1-methylpseudouridine (m1Ψ). Results and Conclusions

[0192] Schematics of the successfully produced DENVm-EGFP synRNA are shown in Figures 5A, 5B, and 5C. The RNA sequence of DENVm-MCS is set forth as SEQ ID NO: 11, and the RNA sequence of Capless-DENVm is set forth as SEQ ID NO: 12. Example 7. EGFP protein expression from DENVm synRNA and capless-DENVm synRNA

[0193] This example describes a comparison of EGFP expression from cells transfected with DENVm-EGFP synRNA and Capless-DENVm-EGFP synRNA. Materials and Methods

[0194] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0195] Transfection of DENVm-EGFP synRNA and Capless-DENVm-EGFP synRNA into HDFn. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 30°C or 37°C with or without 250 ng / mL B18R (Sigma).

[0196] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0197] EGFP protein expression was detected in cells transfected with both DENVm-EGFP synRNA (unmodified) and DENVm-EGFP synRNA (m1Ψ) when the transfected cells were cultured at 37°C or 30°C in the presence or absence of B18R (Fig. 6).

[0198] Interestingly, under all four culture conditions (30°C or 37°C; B18R+ or B18R-), DENVm-EGFP synRNA (unmodified) showed stronger EGFP expression than DENVm-EGFP synRNA (m1Ψ) (Figure 6). This is a unique feature of DENVm synRNA, as it is well known that synRNAs with modified nucleosides typically show stronger protein expression than unmodified synRNAs.

[0199] It is also unusual that DENVm-EGFP synRNA (unmodified) showed stronger expression on day 4 compared to day 1, since synRNAs generally show strong expression on day 1, which gradually weakens over time (Figure 6).

[0200] It is also interesting to note that EGFP expression was not significantly affected by the presence or absence of B18R (FIG. 6).

[0201] In contrast to the 5'-Cap+ versions, the capless versions of both DENVm-EGFP synRNA (unmodified) and DENVm-EGFP synRNA(m1Ψ) produced very low levels of EGFP (Figure 7). This result suggests that, although a cap-independent mechanism of translation has previously been described for DENV (Mazeaud et al., 2018), the 5'-Cap is required for efficient translation from DENVm RNA, as is the case in their native state.

[0202] In summary, DENVm synRNA offers unique features that distinguish it from commonly used synRNA platforms: notably, protein production from DENVm synRNA is stronger in the native, unmodified form than in the modified nucleoside form. Example 8. EGFP protein expression from DENVm synRNA over long-term cell culture

[0203] This example describes long-term EGFP expression from DENVm-EGFP synRNA. Materials and Methods

[0204] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0205] Transfection of DENVm-EGFP synRNA (unmodified) and DENVm-EGFP synRNA (m1Ψ-modified) into HDFn. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The following day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for up to 11 days after synRNA transfection.

[0206] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at various time points after transfection. GFP-positive (+) cells were expressed as a percentage of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0207] Interestingly, consistent with Example 7, DENVm-EGFP synRNA (unmodified) showed stronger EGFP expression than DENVm-EGFP synRNA (m1Ψ) under all four culture conditions (33°C or 37°C; B18R+ or B18R−) (Figure 8). EGFP expression was not significantly affected by the presence or absence of B18R (Figure 8). At 33°C, EGFP expression increased from days 1 to 4 but continued to decrease over time, reaching a very low level on day 11 (Dy 11). However, at 37°C, EGFP expression began at a high level on day 1 and gradually decreased over time (Figure 8).

[0208] In summary, this experiment demonstrates that DENVm functions as a unique synRNA platform, which may be particularly useful in applications requiring nucleoside-unmodified synRNAs. Example 9. Production of cap-less plant + ssRNA virus-based synRNA

[0209] This example describes the construction of plasmid DNA and its use for the production of synRNAs based on plant-infecting +ssRNA viruses. Unlike +ssRNA viruses that infect insects and vertebrates, plant-infecting +ssRNA viruses lack a 5'-Cap structure or a poly(A) tail. We selected five different plant +ssRNA viruses and generated synRNA constructs. These plant +ssRNAs lack a 5'-Cap, which led us to first test capless versions of the synRNAs. Materials and Methods

[0210] Design of plant + ssRNA virus-based synRNA and structure of template plasmid DNA.

[0211] The Capless-BYDVm synRNA (SEQ ID NO: 14) consists of the 5'-UTR, multiple cloning site (MCS), and 3'-UTR (without BTE) of Barley Yellow Dwarf Virus (BYDV:NC_004750.1). The BTE sequence element folds into a compact cruciform RNA secondary structure and is a 3'-CITE termed the BYDV-like translation element (BTE).

[0212] Capless-BYDV2 mRNA (SEQ ID NO: 16) contains the 5'-UTR, MCS, BTE (additional) sequence, and 3'-UTR of barley yellow dwarf virus (BYDV:NC_004750.1).

[0213] Capless-MNESV mRNA (SEQ ID NO: 18) contains the 5'-UTR, MCS, and 3'-UTR of Maize Necrotic Streak Virus (MNESV: NC_007729.1).

[0214] Capless PMV mRNA (SEQ ID NO: 20) contains the 5'-UTR, MCS, and 3'-UTR of Panicum mosaic virus (PMV:U55002.1).

[0215] Capless-PEMV2 mRNA (SEQ ID NO: 22) contains the 5'-UTR, MCS, and 3'-UTR of Pea Epiphytic Mosaic Virus-2 (PEMV2:NC_003853.1).

[0216] Capless TCV mRNA (SEQ ID NO: 24) contains the 5'-UTR, MCS, and 3'-UTR of turnip crinkle virus RNA (TCV:NC_003821.3) for the coat protein.

[0217] An exemplary plasmid DNA for the production of plant ssRNA virus-based synRNA contains a T7 RNA polymerase promoter sequence for the in vitro transcription (IVT) reaction.

[0218] Preparation of synRNA by in vitro transcription. Plasmid DNA was linearized with SapI restriction enzyme and used as template DNA for in vitro transcription (IVT), which was performed using the MEGAscript T7 Kit (ThermoFisher Scientific) according to the manufacturer's instructions. 5'-Cap was incorporated using CleanCap AG (TriLink). RNA with modified nucleosides was prepared according to the manufacturer's instructions. Two versions of RNA were prepared: a reference RNA without any nucleoside modifications (unmodified, UNM, or U) and an RNA modified with N1-methylpseudouridine (m1Ψ or M). Results and Conclusions

[0219] A schematic diagram of the successfully produced synRNAs is shown in Figure 9. The RNA sequences of these constructs are set forth as SEQ ID NOs: 14, 16, 18, 20, 22, and 24. Example 10. EGFP protein expression from capless plants + ssRNA virus-based synRNA

[0220] This example describes EGFP expression from a plant +ssRNA virus-based synRNA encoding EGFP. Materials and Methods

[0221] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0222] Transfection of capless-BYDm, capless-MNESVm, capless-PMVm, capless-TCVm, capless-PEMV2m, and capless-BYDV2m synRNAs encoding unmodified and m1Ψ-modified EGFP into HDFn. 3 x 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for up to 5 days after transfection.

[0223] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at various time points after transfection. GFP-positive (+) cells were expressed as a percentage of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0224] Although some synRNAs showed very low EGFP expression (e.g., Capless-PMVm, Capless-BYDVm, and Capless-BYDV2m), essentially no EGFP expression was detected in all four culture conditions (30°C or 37°C; B18R+ or B18R-) regardless of unmodified or modified nucleosides (Table 10-1). Table 10-1. EGFP expression from capless plants + ssRNA virus-based synRNAs [Table 4-1] [Table 4-2] [Table 4-3]

[0225] In summary, this experiment demonstrates that the capless version of the plant + ssRNA virus-based synRNA does not express EGFP. Example 11. Production of plant + ssRNA virus-based synRNA with a 5'-Cap

[0226] This example describes the construction of plasmid DNA and its use for the production of synRNAs based on plant-infecting +ssRNA viruses. Unlike +ssRNA viruses that infect insects and vertebrates, plant-infecting +ssRNA viruses lack a 5'-Cap structure or a poly(A) tail. We artificially added a 5'-Cap (Cap1) to the 5' end of the synRNA. We selected five different plant +ssRNA viruses and generated synRNA constructs. Materials and Methods

[0227] Design of plant + ssRNA virus-based synRNA with a 5'-Cap and structure of template plasmid DNA.

[0228] The BYDVm synRNA (SEQ ID NO: 13) consists of the 5'-Cap (Cap1), 5'-UTR, multiple cloning site (MCS), and 3'-UTR (without BTE) of Barley Yellow Dwarf Virus (BYDV:NC_004750.1). The BTE sequence element folds into a compact cruciform RNA secondary structure and is called the BYDV-like translation element (BTE).

[0229] BYDV2 mRNA (SEQ ID NO: 15) contains the 5'-Cap (Cap1), 5'-UTR, MCS, BTE sequence (addition), and 3'-UTR of barley yellow dwarf virus (BYDV:NC_004750.1).

[0230] MNESV mRNA (SEQ ID NO: 17) contains the 5'-Cap (Cap1), 5'-UTR, MCS, and 3'-UTR of Maize Necrotic Streak Virus (MNESV:NC_007729.1).

[0231] PMV mRNA (SEQ ID NO: 19) contains the 5'-Cap (Cap1), 5'-UTR, MCS, and 3'-UTR of Panicum mosaic virus (PMV:U55002.1).

[0232] PEMV2 mRNA (SEQ ID NO: 21) contains the 5'-Cap (Cap1), 5'-UTR, MCS, and 3'-UTR of Pea ridge mosaic virus-2 (PEMV2:NC_003853.1).

[0233] TCV mRNA (SEQ ID NO: 23) contains the 5'-Cap (Cap1), 5'-UTR, MCS, and 3'-UTR of turnip crinkle virus RNA (TCV:NC_003821.3) for the coat protein.

[0234] An exemplary plasmid DNA for the production of plant +ssRNA virus-based synRNA contains a T7 RNA polymerase promoter sequence for in vitro transcription (IVT) reactions. A 5'-Cap can be added to the mRNA using standard methods. However, for convenience, a 5'-Cap (Cap1) was added using CleanCap AG (Henderson 2021; TriLink). This was made possible by inserting the A nucleotide immediately downstream of the T7 promoter. Any 5'-Cap (e.g., Cap0, Cap1, or Cap2) can be added to the 5' end of the synRNA. At the 3' end, a SapI restriction enzyme site was added to create the same 3'-terminal sequence as present in the +ssRNA virus RNA genome. To test protein production, EGFP was cloned into the MCS.

[0235] Preparation of synRNA by in vitro transcription. Plasmid DNA was linearized with SapI restriction enzyme and used as template DNA for in vitro transcription (IVT), which was performed using the MEGAscript T7 Kit (ThermoFisher Scientific) according to the manufacturer's instructions. 5'-Cap was incorporated using CleanCap AG (TriLink). RNA with modified nucleosides was prepared according to the manufacturer's instructions. Two versions of RNA were prepared: a reference RNA without any nucleoside modifications (unmodified, UNM, or U) and an RNA modified with N1-methylpseudouridine (m1Ψ or M). Results and Conclusions

[0236] A schematic diagram of the successfully produced synRNAs is shown in Figure 10. The RNA sequences of these constructs are set forth as SEQ ID NOs: 13, 15, 17, 19, 21, 23. Example 12. EGFP expression from plant + ssRNA virus-based synRNA with 5'-Cap

[0237] This example describes EGFP expression from a plant +ssRNA virus-based synRNA (with 5'-Cap) encoding EGFP. Materials and Methods

[0238] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0239] Transfection of BYDVm, MNESVm, PMVm, TCVm, PEMV2m, and BYDV2m synRNAs encoding unmodified and m1Ψ-modified EGFP into HDFn. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for up to 4 days after transfection.

[0240] Transfection of DENVm-EGFP synRNA (unmodified), DENVm-EGFP synRNA (m1Ψ-modified), NOV2-EGFP synRNA (m1Ψ-modified), and NOV2m-EGFP synRNA (m1Ψ-modified) into HDFn. These four synRNAs were used for comparison purposes.

[0241] Transfection of poly(A)-less control-EGFP synRNA (m1Ψ-modified) into HDFn. For comparison purposes, this control synRNA-EGFP was generated according to published protocols (Warren et al., 2010; Mandall and Rossi, 2013). The 3'-UTR sequence of synRNA-EGFP is identical to that of mouse hemoglobin α, adult chain 1 (Hba-a1), mRNA (NM_008218.2). The RNA was generated with m1Ψ-modified nucleoside. Instead of adding a poly(A) tail of 120 consecutive adenine nucleotides to the 3' end, no poly(A) was added to this poly(A)-less synRNA-EGFP by tail-PCR.

[0242] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on days 1 and 4 after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0243] As expected, the poly(A)-less control-EGFP synRNA (modified with 5'-Cap1, m1Ψ) showed almost no EGFP expression in all four culture conditions (33°C or 37°C; B18R+ or B18R-) on days 1 and 4 (Figures 11, 12, 13, and 14).

[0244] As expected, DENVm-EGFP (unmodified), DENVm-EGFP (modified with m1Ψ), NOV2-EGFP (modified with m1Ψ), and NOV2m-EGFP (modified with m1Ψ) showed strong EGFP expression under all four culture conditions (33°C or 37°C; B18R+ or B18R-) on days 1 and 4 (Figures 11, 12, 13, and 14).

[0245] To our surprise, plant + ssRNA virus-based synRNAs with 5'-Cap (both nucleoside-unmodified and m1Ψ-modified) showed strong EGFP expression under all four culture conditions (33°C or 37°C; B18R+ or B18R-) on days 1 and 4. In particular, TCVm and MNESVm showed much stronger EGFP expression than the others, including DENVm-EGFP, NOV2-EGFP, and NOV2m-EGFP (Figures 11, 12, 13, and 14).

[0246] TCVm showed characteristics similar to standard synRNA: the nucleoside-modified version (m1Ψ) showed much higher EGFP expression than the unmodified version (Figures 15 and 16); EGFP expression was not affected by the presence of B18R; expression was high at day 1 and decreased over time, but was relatively maintained up to day 4; and expression was observed at both 33°C and 37°C (Figure 15).

[0247] Interestingly, MNESVm showed much higher expression in the nucleoside-unmodified form than in the nucleoside-modified form (Figures 15 and 16). This expression pattern is similar to that of DENVm synRNA but differs from that observed with commonly used synRNAs. Expression from unmodified MNESVm was not significantly affected by the presence of B18R. Expression was strong on day 1 and was relatively well maintained through day 4 (Figure 15).

[0248] In summary, plant ssRNA virus-based synRNAs can be used as poly(A)-less synRNAs when 5'-capped. In particular, TCVm and MNESVm can drive very high expression of GOIs. Example 13. Comparison of EGFP protein expression from poly(A)-less TCVm and control synRNA with a 120 poly(A) tail

[0249] This example describes fluorescence-activated cell sorting (FACS) analysis comparing EGFP fluorescence intensity between poly(A)-less TCVm-EGFP mRNA, a control-EGFP synRNA with a standard 120 poly(A) tail, and a non-transfected control. Materials and Methods

[0250] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0251] Preparation and transfection of TCVm-EGFP and control-EGFP synRNA with a 120-kD poly(A) tail. TCVm-EGFP (5'-capped, no poly(A)) was prepared as described in Example 12. Control-EGFP synRNA (5'-capped, 120-kD poly(A)) was generated according to published protocols (Warren et al., 2010; Mandall and Rossi, 2013). The 3'-UTR sequence of the control-EGFP synRNA was identical to that of mouse hemoglobin alpha, adult chain 1 (Hba-a1) mRNA (NM_008218.2), and a 120-kD poly(A) tail was added using tail-PCR. 3 x 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with 250 ng / mL B18R (Sigma) at 37°C for 16 hours after synRNA transfection and then harvested for FACS analysis.

[0252] FACS analysis: FACS analysis was performed by standard methods: cells were gated by forward scatter (FSC) and side scatter (SSC), and then the geometric mean of fluorescence intensity (MFI) was calculated. Results and Conclusions

[0253] TCVm-EGFP and control-EGFP showed GFP intensities of 4,794 (MFI) and 6,076 (MFI), respectively (Figure 17). The results indicate that the translation efficiency of TCVm synRNA, lacking a poly(A) tail, is comparable to that of control-EGFP synRNA, which has a standard 120 poly(A) tail.

[0254] In summary, TCVm, a plant + ssRNA virus-based synRNA, when 5'-Capped, can be used as a poly(A)-less synRNA and drive very high expression of GOIs. Example 14. In vivo protein expression from Poly(A)-less + ssRNA virus-based synRNA with 5'-Cap

[0255] This example describes the finding that +ssRNA viral-based synRNAs lacking a poly(A) tail can be efficiently translated in vivo when a 5'-Cap is added. Materials and Methods

[0256] Mice. C57BL / 6 and BALB / c mice were purchased from Jackson Laboratory and were housed and maintained in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0257] Preparation of Plasmid DNA for IVT. Because the SapI restriction enzyme site used to linearize plasmid DNA for IVT is present within the luciferase gene, MluI restriction enzyme was chosen to linearize the plasmid DNA template. Plasmid DNA described in Example 1 for NOV2m was modified by adding an MluI restriction enzyme site immediately after the SapI restriction enzyme site. Plasmid DNA described in Example 11 for TCVm was modified by adding an MluI restriction enzyme site immediately after the SapI restriction enzyme site. The luciferase gene was cloned into the NdeI-NotI sites of the multiple cloning site of these plasmid DNAs.

[0258] Production of synRNA by in vitro transcription. DNA templates were linearized with MluI restriction enzyme and used in IVT to produce synRNAs: TCVm-LUC2 synRNA(MluI) and NOV2m-LUC2 synRNA(MluI). As a negative control, NOV2m-LUC2 synRNA was also linearized with SapI, which truncated the LUC2 gene so that LUC2 protein was not formed (NOV2m-LUC2 synRNA(SapI)). The synRNAs were modified with m1Ψ.

[0259] Intramuscular injection of synRNA and luciferase assay. 20.0 μg of synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer's protocol. The synRNA / LNP complex was directly injected intramuscularly into the right thigh region of C57BL / 6 and BALB / c mice. Luciferase activity was monitored the following day (day 1) and the following day (day 2) using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Results and Conclusions

[0260] Representative bioluminescence images of luciferase assays in mice are shown in Figure 18A, and luciferase activity assessed by the bioluminescence imaging system is plotted in Figure 18B. The results clearly demonstrated that TCVm-LUC2(MluI) was highly translated in vivo, even though it lacked a poly(A) tail. NOV2m-LUC2(MluI) also worked, although its translation efficiency was lower than that of TCVm-LUC2. These Poly(A)-less synRNAs could be translated in both C57BL / 6 and BALB / c. Example 15. EGFP protein expression from +ssRNA virus-based synRNA with 5'-Cap and 3'-adenine homopolymers

[0261] This example demonstrates the expression of EGFP from +ssRNA virus-based synRNAs (with 5'-Cap and 3'-adenine homopolymer additions) encoding EGFP. The synRNAs tested included control-EGFP synRNA, NOV2m-EGFP synRNA, TCVm-EGFP synRNA, and MNESVm-EGFP synRNA. Materials and Methods

[0262] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0263] Preparation of DNA templates by tail-PCR. DNA templates for in vitro transcription (IVT) were prepared according to the protocol of Mandal and Rossi (2013). DNA fragments containing the T7 promoter, 5'-UTR, EGFP CDS, and 3'-UTR were amplified from control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP by tail-PCR using 3'-primers containing 0 (for A0), 20 (for A20), 30 (for A30), 60 (for A60), and 120 (for A120) thymine (T) nucleotides. Control-EGFP synRNA containing the 3'-UTR of hemoglobin alpha, adult chain 1 (Hba-a1) was prepared as previously described (Warren et al., 2010; Mandal and Rossi, 2013). The poly(A) tail of A120 is of standard length (Warren et al., 2010). NOV2m-EGFP synRNA, TCVm-EGFP synRNA, and MNESVm-EGFP synRNA were as described in the previous section.

[0264] Production of synRNA by in vitro transcription. SynRNA was produced using DNA templates for IVT. Based on the results shown previously, NOV2m-EGFP and TCVm-EGFP were modified with m1Ψ because this performed better than the unmodified versions. Meanwhile, MNESVm-EGFP was used in its unmodified form (Unm) because it performed better than the nucleoside-modified form (m1Ψ) in the experiments shown previously. A 5'-cap can be added to synRNA using standard methods. However, for convenience, CleanCapAG (Henderson 2021; TriLink) was used to add a 5'-cap (cap1) to synRNA.

[0265] Transfection of control-EGFP synRNA (A0, A20, A30, A60, A120), NOV2m-EGFP synRNA (A0, A20, A30, A60, A120), TCVm-EGFP synRNA (A0, A20, A30, A60, A120), and MNESVm-EGFP synRNA (A0, A20, A30, A60, A120) into HDFn cells. 3 × 104 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with or without 250 ng / mL B18R (Sigma) at 33°C or 37°C for 24 hours after synRNA transfection.

[0266] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) 1 day after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0267] The control-EGFP synRNA showed the expected expression pattern. A0 and A20 showed no or very low translation (Figures 19, 20, 21, and 22). Starting with A30, translation efficiency gradually increased up to A60 and A120. The translation efficiency of the control-EGFP synRNA was not significantly affected by temperature (33°C or 37°C) or the presence of B18R (Figures 19, 20, 21, and 22).

[0268] NOV2m synRNA showed expression from A0. Translation efficiency was enhanced by adding A20 poly(A) and further enhanced by adding A30, A60, and A120. The translation efficiency of NOV2m synRNA was not significantly affected by temperature (33°C or 37°C) or the presence of B18R (Figures 19, 20, 21, and 22).

[0269] TCVm synRNA showed strong expression from A0. However, the addition of A20 poly(A) reduced translation efficiency from A0, and it was only enhanced to the A0 level by adding poly(A) longer than A30. The translation efficiency of TCVm synRNA was not significantly affected by temperature (33°C or 37°C) or the presence of B18R (Figures 19, 20, 21, 22).

[0270] MNESVm synRNA (Unm) showed strong expression from A0. However, addition of A20 and A30 3'-adenine homopolymers reduced translation efficiency from A0, and it was only enhanced to the A0 level by adding 3'-adenine homopolymers longer than A60. The translation efficiency of MNESVm synRNA was not significantly affected by temperature (33°C or 37°C) or the presence of B18R (Figures 19, 20, 21, and 22).

[0271] The TCVm-EGFP synRNA (m1Ψ) and MNESVm-EGFP synRNA (Unm), both lacking poly(A) tails, showed strong EGFP expression, followed by NOV2m-EGFP synRNA (m1Ψ). The control-EGFP synRNA (m1Ψ) showed no or very low EGFP expression. When adenine homopolymers were added, NOV2m-EGFP synRNA showed the highest expression levels at all lengths of 3'-adenine homopolymers—A20, A30, A60, and A120 (Figures 19, 20, 21, and 22). Notably, even with the standard A120 3'-adenine homopolymer length, NOV2m synRNA performed much better than the control synRNA, TCVm synRNA, and MNESVm synRNA. SynRNAs are most frequently used under natural in vivo conditions, i.e., at body temperature of 37°C and in the absence of B18R. Under these conditions, it is noteworthy that NOV2m synRNAs containing A20 and A30 showed EGFP expression levels comparable to or even stronger than control synRNAs containing the standard A120 3'-adenine homopolymer, given the desired short 3'-adenine homopolymer length (Figures 19, 20, 21, 22).

[0272] Thus, the present disclosure provides RNA molecules containing a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR) followed by a short adenine homopolymer, where the 5'-UTR and 3'-UTR are derived from a +ssRNA virus. These new types of synRNAs containing the short adenine homopolymer can be used for high-level expression of proteins of interest, while also offering advantages for production and purification, if necessary, by use of an oligo(dT) column. Example 16. Expression of full-length human dystrophin (DMD) from +ssRNA viral-based synRNA in vitro

[0273] This example describes the successful expression of a large protein, DMD, from a +ssRNA virus-based synRNA in vitro. Materials and Methods

[0274] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0275] Plasmid DNA Preparation. In this example, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (shown in Figure 1C), followed by digestion with the NdeI restriction enzyme site to linearize the plasmid DNA. The full-length CDS of human dystrophin (DMD) protein (transcript variant Dp427m, NCBI accession number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0276] Production of synRNA by in vitro transcription. Plasmid DNA was linearized with NdeI and used in IVT to produce synRNA with m1Ψ modification. 5'-Cap1 was added using CleanCapAG (Henderson 2021; TriLink). The size of this NOV2m-DMD-A28 synRNA was 11.3 kb (Figure 23A).

[0277] Transfection of NOV2m-DMD-A28 synRNA. 6 × 10^4 HDFn cells / well were plated in a 4-well chamber slide. The next day, cells were transfected with 1.0 μg or 2.0 μg of NOV2m-DMD-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured with 250 ng / mL B18R (Sigma) at 37°C for 24 hours after synRNA transfection.

[0278] Immunohistochemistry. Human DMD protein was detected by immunohistochemistry using an anti-dystrophin antibody (MANDYS106: Millipore Sigma) (which recognizes only human DMD, but not mouse DMD). Immunohistochemistry was performed according to standard methods. To visualize nuclei, samples were also stained with 4',6-diamidino-2-phenylindole (DAPI). Results and Conclusions

[0279] Plasmid DNA containing the full-length DMD coding region (transcript variant Dp427m, NCBI accession number NM_004006) and a 28-residue 3'-adenine homopolymer was successfully constructed. Plasmid DNA was amplified in E. coli using standard procedures. The plasmid DNA was linearized using NdeI restriction enzyme digestion and directly used as a DNA template for IVT. Unlike Example 15, in which the 3'-adenine homopolymer was added to the DNA template using tail-PCR, the 28-adenine homopolymer was already incorporated into the plasmid DNA. Therefore, DNA template preparation was simpler, more efficient, and less costly than the tail-PCR method.

[0280] The NOV2m-DMD-A28 synRNA (11.3 kb) was successfully produced by standard IVT methods. The nucleotide sequence of the NOV2m-DMD-A28 synRNA is set forth as SEQ ID NO:42.

[0281] After delivery into HDFn cells by standard transfection methods, NOV2m-DMD-A28 synRNA produced DMD, which was detected by immunohistochemistry using an antibody against human DMD (MANDYS106) (Figure 23B). Transfection efficiency was high, and DMD expression was robust (Figure 23B).

[0282] Thus, the present disclosure demonstrates that large proteins (e.g., full-length human DMD) can be expressed in vitro from +ssRNA virus-based synRNAs. The present disclosure also demonstrates that the synRNAs are encoded entirely in plasmid DNA, resulting in a simple, efficient, and cost-effective synRNA manufacturing process. Example 17. Expression of full-length human dystrophin (DMD) from +ssRNA viral-based synRNA in vivo

[0283] This example describes the successful expression of a large protein, DMD, from a +ssRNA virus-based synRNA in vivo. Materials and Methods

[0284] Mice. BALB / c mice were purchased from Jackson Laboratory and were housed and maintained in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0285] Plasmid DNA Preparation. In this example, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (shown in Figure 1C), followed by digestion with NdeI restriction enzyme. DNA encoding a fusion protein of luciferase and full-length human dystrophin (DMD) protein (transcript variant Dp427m, NCBI accession number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-LUC-DMD-A28).

[0286] Production of synRNA by in vitro transcription. Plasmid DNA was linearized with NdeI and used in IVT to produce synRNA with m1Ψ modification. 5'-Cap1 was added using CleanCapAG (Henderson 2021; TriLink). The size of this NOV2m-LUC-DMD-A28 synRNA was 13.0 kb (Figure 24A).

[0287] Intramuscular injection of synRNA and luciferase assay. 20.0 μg of NOV2m-LUC-DMD-A28 synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer's protocol. The synRNA / LNP complex was directly injected intramuscularly into the right thigh region of BALB / c mice (day 0). The following day (day 1), luciferase activity was monitored using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Results and Conclusions

[0288] Representative bioluminescence images of mice to visualize luciferase activity are shown in Figure 24B. Luciferase activity assessed by the bioluminescence imaging system is plotted in Figure 24C. The results clearly demonstrated that NOV2m-LUC-DMD-A28 synRNA was translated in vivo and resulted in the production of a fusion protein of LUC and full-length DMD.

[0289] This disclosure demonstrates that large fusion proteins can be expressed in vivo from +ssRNA virus-based synRNAs. This disclosure also demonstrates that the synRNAs are encoded entirely in plasmid DNA, resulting in a simple, efficient, and cost-effective synRNA manufacturing process. Example 18. Expression of full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein from +ssRNA viral-based synRNA in vitro

[0290] This example describes the successful expression of a large protein, COL7A1, from a +ssRNA virus-based synRNA in vitro. Materials and Methods

[0291] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0292] Plasmid DNA Preparation. In this example, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (shown in Figure 1C). The plasmid DNA was then linearized by digestion with the NdeI restriction enzyme site. The full-length CDS of human type VII collagen alpha-1 (VII) chain (COL7A1) protein (NCBI accession number NM_000094) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-COL7A1-A28). A fusion protein of the full-length CDS of COL7A1 protein (NCBI accession number NM_000094) and luciferase (LUC2) protein was also cloned into the multiple cloning site of NOV2m-A28 (NOV2m-COL7A1-LUC-A28).

[0293] Production of synRNA by in vitro transcription. Plasmid DNA was linearized with NdeI and used in IVT to produce synRNA with m1Ψ modifications. 5'-Cap1 was added using CleanCapAG (Henderson 2021; TriLink). The size of the NOV2m-DMD-A28 synRNA was 9.0 kb, and the size of the NOV2m-COL7A1-LUC-A28 synRNA was 10.7 kb (Figure 25A).

[0294] Transfection of NOV2m-COL7A1-A28 and NOV2m-COL7A1-LUC-A28 synRNAs. 6 × 10^4 HDFn cells / well were plated in 4-well chamber slides. The next day, cells were transfected with 1.0 μg of NOV2m-COL7A1-A28 synRNA or NOV2m-COL7A1-LUC-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). In one condition, transfection was performed only once (1× transfection). In another condition, transfection was repeated on days 2 and 3 (3× transfection). HDFn cells were cultured with 250 ng / mL B18R (Sigma) at 37°C for 24 h after synRNA transfection (1× transfection) or for 24 h after the third synRNA transfection (3× transfection).

[0295] Immunohistochemistry. Human COL7A1 protein expression was detected by immunohistochemistry using an anti-COL7A1 antibody (MCA597GA) (which recognizes only human COL7A1, but not mouse COL7A1). Immunohistochemistry was performed according to standard methods. To visualize nuclei, samples were also stained with 4',6-diamidino-2-phenylindole (DAPI). Results and Conclusions

[0296] Plasmid DNA containing the full-length CDS of human type VII collagen alpha-1 (VII) chain (COL7A1) protein (NCBI accession number NM_000094) and a 28-residue 3'-adenine homopolymer was successfully constructed. Plasmid DNA was amplified in E. coli using standard procedures. The plasmid DNA was linearized using NdeI restriction enzyme digestion and directly used as a DNA template for IVT. Unlike Example 15, in which the 3'-adenine homopolymer was added to the DNA template using tail-PCR, the 28-adenine homopolymer was incorporated into the plasmid DNA. Therefore, DNA template preparation was simpler, more efficient, and less costly than the tail-PCR method.

[0297] Both NOV2m-COL7A1-A28 synRNA (9.0 kb) and NOV2m-COL7A1-LUC-A28 synRNA (10.7 kb) were successfully produced.

[0298] After delivery into HDFn cells by standard transfection methods, both NOV2m-COL7A1-A28 synRNA and NOV2m-COL7A1-LUC-A28 synRNA produced COL7A1 protein and COL7A1-LUC fusion protein, respectively, as detected by immunohistochemistry using an antibody against human COL7A1 (Figure 25B). Transfection efficiency was high, and DMD expression was robust (Figure 25B).

[0299] Thus, this disclosure demonstrates that large proteins (e.g., full-length human COL7A1), as well as even larger fusion proteins, can be expressed in vitro from +ssRNA viral-based synRNA vectors. This disclosure also demonstrates that the synRNA is encoded entirely in plasmid DNA, resulting in a simple, efficient, and cost-effective synRNA production process. Example 19. EGFP protein expression from DENVm synRNA with 5'-Cap and 3'-adenine homopolymer

[0300] This example illustrates the expression of EGFP from a DENVm synRNA encoding EGFP (with the addition of a 5'-Cap and 3'-adenine homopolymer). Materials and Methods

[0301] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0302] Preparation of DNA templates by tail-PCR. DNA templates for in vitro transcription (IVT) were prepared according to the protocol of Mandal and Rossi (2013). DNA fragments containing the T7 promoter, 5'-UTR, EGFP CDS, and 3'-UTR were amplified from DENVm-EGFP by tail-PCR using 3'-primers containing 0 (for A0), 20 (for A20), 30 (for A30), 60 (for A60), and 120 (for A120) thymine (T) nucleotides. DENVm-EGFP synRNA was prepared as described in the previous section.

[0303] Production of synRNA by in vitro transcription. DNA templates were used in IVT to produce synRNA.

[0304] Based on the results shown above, DENVm-EGFP synRNA was used in its unmodified form (Unm). A 5'-cap was added to the synRNA using standard methods. However, for convenience, CleanCapAG (Henderson 2021; TriLink) was used to add the 5'-cap (cap1) to the synRNA.

[0305] Transfection of DENVm-EGFP synRNA (A0, A20, A30, A60, A120) into HDFn cells. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The next day, cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for 24 hours after synRNA transfection.

[0306] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) 1 day after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0307] DENVm synRNA in the unmodified form (Umn) showed expression in vitro from A0. Translation efficiency was enhanced by adding A20 poly(A) and further enhanced by adding A30, A60, and A120. The translation efficiency of DENVm synRNA (Unm) was largely unaffected by temperature (33°C or 37°C) or the presence of B18R (Figure 26).

[0308] Thus, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR) followed by a short adenine homopolymer, wherein the 5'-UTR and 3'-UTR are derived from dengue virus. Although dengue virus does not naturally have a polyA at its 3' end, the present findings demonstrate that these new types of synRNAs containing short adenine homopolymers can be used for high-level expression of proteins of interest while, if necessary, offering advantages for production and purification by the use of an oligo(dT) column. Example 20. EGFP protein expression from synRNA with 5'-Cap, 3'-adenine homopolymer, and 5'-UTR and 3'-UTR derived from SARS-CoV-2 virus

[0309] This example describes EGFP expression from a SARS-CoV-2 virus-based synRNA encoding EGFP. Materials and Methods

[0310] Cell Culture. Human dermal fibroblasts, neonatal (HDFn) were purchased from ThermoFisher Scientific (Catalog No. C0045C) and cultured according to the manufacturer's instructions.

[0311] Preparation of DNA template: Plasmid DNA containing a T7 promoter, 5'-UTR (derived from SARS-CoV-2), MCS, 3'-UTR (derived from SARS-CoV-2), and a 50-adenine homopolymer at the 3' end was synthesized (Figure 27A). The EGFP coding region (SEQ ID NO: 5) was cloned into the MCS (SEQ ID NO: 8).

[0312] Production of synRNA by in vitro transcription. A DNA template was used for IVT to produce a synRNA designated SARSVm. The 5'-UTR nucleotide sequence of SARSVm is set forth in SEQ ID NO: 37, and the 3'-UTR and adenine homopolymer nucleotide sequence is set forth in SEQ ID NO: 38. Both nucleoside-unmodified synRNA (Unm) and nucleoside-modified synRNA (m1Ψ) were synthesized and tested. A 5'-cap was added to the synRNA using standard methods. However, for convenience, CleanCapAU (Henderson 2021; TriLink) was used to add a 5'-cap (cap1 to the synRNA).

[0313] Transfection of SARSVm-EGFP into HDFn cells. 3 × 10^4 HDFn cells / well were plated in 24-well plates on day -1. The following day (day 0), cells were transfected with 1.0 μg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33°C or 37°C with or without 250 ng / mL B18R (Sigma) for 24 hours after synRNA transfection.

[0314] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) 1 day after transfection. GFP-positive (+) cells were expressed as a percentage (%) of total cells with a fluorescence intensity of GFP > 30 for all GFP+ cells, GFP > 300 for strong GFP+ cells, or GFP > 2000 for very strong GFP+ cells. Results and Conclusions

[0315] The nucleoside-modified form (m1Ψ) of SARSVm synRNA showed strong expression under both temperature conditions (33°C or 37°C) and under both B18R(+) and B18R(-) conditions (Figure 27B). However, in the unmodified form (Unm), protein translation efficiency was low under all four conditions [37°C, 33°C, B18R(+), or B18R(-)] (Figure 27B).

[0316] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR) followed by a short adenine homopolymer, wherein the 5'-UTR and 3'-UTR are derived from a +ssRNA virus and have an adenine homopolymer at their 3' ends. Example 21. In vivo protein expression from NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) in muscle and skin

[0317] This example describes the finding that +ssRNA virus-based synRNAs with short adenine homopolymers can be efficiently translated in mouse muscle and skin. Materials and Methods

[0318] Mice. BALB / c mice were purchased from Jackson Laboratory and were housed and maintained in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0319] Preparation of plasmid DNA for IVT. NOV2m plasmid DNA was modified to include a 50-adenine homopolymer after the 3'-UTR, followed by an NdeI restriction enzyme site for plasmid linearization. DENVm plasmid DNA was modified to include a 50-adenine homopolymer after the 3'-UTR, followed by an NdeI restriction enzyme site for plasmid linearization. The luciferase gene was cloned into the MCS of both plasmid vectors.

[0320] Production of synRNA by in vitro transcription. DNA templates were linearized with NdeI restriction enzyme and used in IVT to produce synRNAs: NOV2m(A50)-LUC synRNA and DENVm(A50)-LUC. Both nucleoside-unmodified synRNA (Unm) and nucleoside-modified synRNA (m1Ψ) were synthesized and tested. 5'-caps were added to synRNAs using standard methods. However, for convenience, CleanCapAG (Henderson 2021; TriLink) was used to add 5'-caps (cap1 to synRNAs).

[0321] Intramuscular injection of synRNA and luciferase assay. 20.0 μg of synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer's protocol. The synRNA / LNP complex was directly injected intramuscularly into BALB / c mice. Starting the following day (day 1), luciferase activity was monitored using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Monitoring of luciferase activity was terminated on day 8, when no further signal could be detected.

[0322] Intradermal injection of synRNA and luciferase assay. 20.0 μg of synRNA was dissolved in lactated Ringer's solution. To test the effect of chitosan oligosaccharide on gene expression, synRNA was mixed with or without chitosan oligosaccharide (final concentration of 1.5 μg / ml). The final volume was 60 μL. Starting the next day (day 1), luciferase activity was monitored using an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ). Monitoring of luciferase activity was terminated on day 13, when no signal could be detected any more. Results and Conclusions

[0323] Muscle: Luciferase activity following intramuscular injection of synRNA was assessed using a bioluminescence imaging system, and the results are plotted in Figure 28. The results showed that NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) were all translated at high levels in vivo. Although the difference was not large, the 50-adenine homopolymer performed better than the 30-adenine homopolymer. Nucleoside modifications helped to enhance translation efficiency in muscle for NOV2m but not for DENVm. Overall, DENVm(A50), whether modified or unmodified, performed better than NOV2m(A50).

[0324] Skin: Luciferase activity following intradermal injection of synRNA was assessed using a bioluminescence imaging system, and the results are plotted in Figure 29. The results showed that NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) were all translated at high levels in vivo. However, for both NOV2m and DENVm, the 50-adenine homopolymer performed better than the 30-adenine homopolymer. Nucleoside modifications did not make a significant difference, but for NOV2m, modified synRNAs performed better than unmodified synRNAs, while for DENVm, unmodified synRNAs performed better than modified synRNAs. Interestingly, chitosan oligosaccharide dramatically enhanced luciferase expression in all conditions tested: NOV2m(m1Ψ), NOV2m(Unm), DENVm(m1Ψ), and DENVm(Unm). Overall, NOV2m(A50,m1Ψ) performed better than the others, but DENVm(A50,Unm) also performed at a comparable level. Example 22. Expression of full-length human dystrophin (DMD) from +ssRNA viral-based synRNA in vivo

[0325] This example describes the successful expression of a large protein, full-length human dystrophin, from a +ssRNA virus-based synRNA in vivo. Materials and Methods

[0326] Mice. BALB / c mice were purchased from Jackson Laboratory and were housed and maintained in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0327] Plasmid DNA Preparation. In this example, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (shown in Figure 1C), followed by digestion with the NdeI restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human dystrophin (DMD) gene (transcript variant Dp427m, NCBI accession number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0328] Production of synRNA by in vitro transcription. Plasmid DNA was linearized with NdeI and used in IVT to produce synRNA with m1Ψ modification. 5'-Cap1 was added using CleanCapAG (Henderson 2021; TriLink). The size of this NOV2m-DMD-A28 synRNA was 11.3 kb (Figure 23A).

[0329] Intramuscular injection of synRNA. 20.0 μg of NOV2m-DMD-A28 synRNA was complexed with InvivoFectamine 3.0 (ThermoFisher) according to the manufacturer's protocol. The synRNA / Invivofectamine complex was injected directly into the muscle of BALB / c mice (day 0). One day after injection, the mice were sacrificed, and the skeletal muscle at the injection site was dissected for immunostaining.

[0330] Immunohistochemistry. Human DMD protein was detected by immunohistochemistry using an anti-dystrophin antibody (MANDYS106: Millipore Sigma) (which recognizes only human DMD, but not mouse DMD). Mouse and human DMD proteins were detected by immunohistochemistry using an anti-dystrophin antibody (AB15277: Abcam) (which recognizes both mouse and human DMD). Immunohistochemistry was performed according to standard methods. To visualize nuclei, samples were also stained with 4',6-diamidino-2-phenylindole (DAPI). Confocal microscopic images were taken. Results and Conclusions

[0331] Representative immunostaining images are shown in Figure 31. Muscle sections were stained with an anti-human DMD antibody (MANDYS106) (upper panel), which recognizes human dystrophin but not mouse dystrophin. Untreated muscles showed no staining, but NOV2m-DMD-A28 synRNA-injected muscles (two representative images) demonstrated the production and proper localization of human dystrophin protein (Figure 31, upper panel). In addition, muscle sections stained with an anti-mouse DMD antibody (AB15277), which recognizes both mouse and human dystrophin proteins, demonstrated the proper localization of mouse dystrophin (as well as human dystrophin) protein in both untreated and NOV2m-DMD-A28 synRNA-injected muscles (lower panel).

[0332] This disclosure demonstrates that large proteins, such as full-length human dystrophin protein, can be expressed from +ssRNA virus-based synRNAs in vivo, and the produced dystrophin protein can be properly localized in mouse skeletal muscle. Example 23. Restoration of muscle strength in mutant mice by intramuscular injection of +ssRNA viral-based synRNA encoding human dystrophin protein

[0333] This example describes the successful functional restoration of skeletal muscle mutant mice lacking the mouse dystrophin protein by intramuscular injection of +ssRNA viral-based synRNA encoding the full-length human dystrophin protein. Materials and Methods

[0334] Mouse: D2.B10-Dmd mdx D2.mdx mice, also known as / J mice, were purchased from the Jackson Laboratory. According to the Jackson Laboratory website, "D2.B10 (DBA / 2-congenic) Dmd mdx Mice (also called DBA / 2J-mdx or D2-mdx mice) may be an excellent model of Duchenne progressive muscular dystrophy because they better recapitulate several human features of DMD muscle pathology (low hindlimb muscle mass, fewer myofibrils, increased fibrosis and adiposity, and muscle weakness) compared to strains carrying this mutant allele in other genetic backgrounds. DBA / 2 mice (wild-type control, recommended by Jackson Laboratory) were also purchased from Jackson Laboratory. Mice were housed and maintained according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0335] Plasmid DNA Preparation. In this example, we used a NOV2m synRNA (NOV2m-A28) containing 28 3'-adenine homopolymer residues. To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (shown in Figure 1C), followed by digestion with the NdeI restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human dystrophin (DMD) gene (transcript variant Dp427m, NCBI accession number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0336] Production of synRNA by in vitro transcription. Plasmid DNA was linearized with NdeI and used in IVT to produce synRNA with m1Ψ modification. 5'-Cap1 was added using CleanCapAG (Henderson 2021; TriLink). The size of this NOV2m-DMD-A28 synRNA was 11.3 kb (Figure 23A).

[0337] Intramuscular injection of synRNA. 20.0 μg of NOV2m-DMD-A28 synRNA was complexed with InvivoFectamine 3.0 (ThermoFisher) according to the manufacturer's protocol. D2.mdx mutant mice received three intramuscular injections of approximately 4 μg (12 μL) of NOV2m-DMD-A28 synRNA in the ventral forearm and two intramuscular injections in the dorsal forearm using a 31G needle: a total of 20 μg (in 60 μL) in the right and left forearms.

[0338] Muscle strength measurements: Peak muscle strength of the forearm was measured using a grip strength scale (Harvard Apparatus). Measurements were performed twice, 30 minutes apart. Peak muscle strength was normalized by mouse body weight, and the average of the two measurements was used for analysis. Results and Conclusions

[0339] D2.mdx mutant mice (Coley, Bogdanik et al. 2016; Hammers, Hart et al. 2020) and wild-type DBA / 2 mice received three intramuscular injections of approximately 4 μg (12 μL) of NOV2m-DMD-A28 synRNA into the ventral forearm and two intramuscular injections into the dorsal forearm using a 31G needle: a total of 20 μg (in 60 μL) in the right and left forearms. Injections began at week 11 and continued weekly for a total of six injections. The last injection was administered at 16 weeks of age. One week after the last injection (measured at 17 weeks of age), peak forearm muscle strength was measured using a grip strength scale. Measurements were performed twice, 30 minutes apart. Peak muscle strength was normalized by mouse body weight, and the average of the two measurements was used for analysis. Figure 32A shows peak muscle strength measured one week after the last injection (at 17 weeks of age). The NOV2m-DMD-A28 synRNA-injected group showed a statistically significant (*p<0.05) recovery in muscle strength compared with the uninjected group (D2.mdx) and the control mRNA-LUC-injected group (D2.mdx-LUC) (Figure 32A). There were no statistically significant differences between the D2.mdx-DMD and wild-type DBA / 2 groups. There were no safety findings related to either the injection or treatment for the NOV2m-DMD-A28 synRNA-injected group.

[0340] We also tested whether a single intramuscular injection of NOV2m-DMD-A28 synRNA could restore muscle strength in D2.mdx mutant mice. To minimize damage to muscle tissue caused by a 31G needle (0.261 mm outer diameter), we used a 34G needle (0.159 mm outer diameter). 20 μg of NOV2m-DMD-A28 synRNA was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 μL. D2.mdx mutant mice were administered a single intramuscular injection of 4 μg (12 μL) of mRNA-DMD using a 34G needle in three sites on the ventral forearm and two sites on the dorsal forearm: a total of 20 μg (in 60 μL) in each of the right and left forearms. Injections were performed at 18 weeks of age. Three weeks later, at 21 weeks of age, peak forearm muscle strength was measured using a grip strength scale (Harvard Apparatus). Measurements were taken twice, 30 minutes apart. Peak muscle strength was normalized by mouse body weight, and the average of the two measurements was used for analysis.

[0341] As shown in Figure 32B, the NOV2m-DMD-A28 synRNA-injected group (n = 5) showed recovery of muscle strength, whereas the uninjected control group (n = 4) did not. This indicates that a single NOV2m-DMD-A28 synRNA injection not only restored muscle strength in D2.mdx mutant mice, but also that the produced dystrophin protein was stable and maintained at the injection site for at least 3 weeks. References Ball et al., (1992). Replication of Nodamura Virus after Transfection of Viral RNA into Mammalian Cells in Culture. Journal Of Virology, 66(4):2326-2334. Coley et al., (2016). Effect of genetic background on the dystrophic phenotype in mdx mice. Human Molecular Genetics, 25(1):130-145. Dorrington et al., (2009). ICTV Virus Taxonomy Profile: Tetraviridae. Fang et al., (2022). Advances in COVID-19 mRNA vaccine development. Signal Transduction and Targeted Therapy, 7(1):94. Hammers et al., (2020). The D2.mdx mouse as a preclinical model of the skeletal muscle pathology associated with Duchenne muscular dystrophy. Scientific Reports, 10:14070. Henderson et al., (2021). Cap 1 Messenger RNA Synthesis with Co-transcriptional CleanCap(registered trademark) Analog by In Vitro Transcription. Current Protocols, 1(2):e39. Holtkamp et al., (2006). Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. Blood, 108(13): 4009-4017. Jackson et al., (2020). The promise of mRNA vaccines: a biotech and industrial perspective. npj Vaccines, 5(1). Johnson et al., (2003). Recovery of infectivity from cDNA clones of Nodamura virus and identification of small nonstructural proteins. Virology, 305(2): 436-451. Kinney et al., (1997). Construction of infectious cDNA clones for dengue 2 virus: strain 16681 and its attenuated vaccine derivative, strain pdk-53. Virology, 230(2):300-308. Kowalski et al., (2019). Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. Molecular Therapy, 27(4): 710-728. Mandal and Rossi (2013). Reprogramming human fibroblasts to pluripotency using modified mRNA." Nat Protoc 8(3): 568-582. Mazeaud et al., (2018). The multiples fates of the flavivirus RNA genome during pathogenesis. Front Genet. 9:595. Mencin et al., (2023). Development and scale-up of oligo-dt monolithic chromatographic column for mRNA capture through understanding of base-pairing interactions. Separation and purification technology 2023 vol. 304. Newman and Brown, (1976). Absence of poly (A) from the infective RNA of Nodamura virus. Journal of General Virology, 30(1): 137-140. Nicholson and Pasquinelli, (2019). Tales of Detailed Poly(A) Tails. Trends in Cell Biology, 29(3): 191-200. Nicholson and White (2011). 3' cap-independent translation enhancers of positive-strand RNA plant viruses. Curr Opin Virol. 1(5):373-80. Reuter and Mathews (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11:129. Rosskopf et al., (2010). A 3′ terminal stem-loop structure in Nodamura virus RNA2 forms an essential cis-acting signal for RNA replication. Virus Research, 150(1-2): 12-21. Sachs et al., (1987). A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability. Mol Cell Biol, 7(9): 3268-76. Sahul et al., (2019). ICTV virus taxonomy profile: Nodaviridae. Journal of General Virology, 100(1): 3-4. Simmonds et al., (2017): ICTV Virus Taxonomy Profile: Flaviviridae, Journal of General Virology, 98:2-3. Trepotec et al., (2019). Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life. RNA, 25(4): 507-518. Vavilis et al. (2023). mRNA in the context of protein replacement therapy. Pharmaceutics. 15(1): 166.Wadhwa et al., (2020). Opportunities and challenges in the delivery of mRNA-based vaccines. Pharmaceutics, 12(2). Warren et al., (2010). Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified mRNA. Cell Stem Cell, 7(5): 618-630. Sequence >Sequence number 1 (NOV1-EGFP RNA) guauugaauccaaaacucaaa AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGA uucaucgucccaucugacgaaacccgaacuaggcuuaugccaguggu >SEQ ID NO: 2 (NOV2-EGFP RNA) guaaacaaccaauaacauc AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGuga uuccacccacagaagcguugacgacgcaaaacguccuuaaagcguugacgacgcaaaacguccccaagcucguagcaccgacccuauacccaucucuagggucuucaaccucuuggu >SEQ ID NO: 3 (NOV2M RNA, Multiple Cloning Site) guaaacaaccaauaacauc GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC uuccacccacagaagcguugacgacgcaaaacguccuuaaagcguugacgacgcaaaacguccccaagcucguagcaccgacccuauacccaucucuagggucuucaaccucuuggu >SEQ ID NO:4 (NOV2M-EGFP RNA) guaaacaaccaauaacauc ggcgcgcccucagcaucgauugaauuggccacc AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGuag ucuagagucgacccgggcggccgc uuccacccacagaagcguugacgacgcaaaacguccuuaaagcguugacgacgcaaaacguccccaagcucguagcaccgacccuauacccaucucuagggucuucaaccucuuggu >SEQ ID NO: 5 (EGFP RNA) AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGA >SEQ ID NO: 6 (NOV1 5'-UTR) guauugaauccaaaacucaaa >SEQ ID NO: 7 (NOV1 3'-UTR) uucaucgucccaucugacgaaacccgaacuaggcuuaugccaguggu >SEQ ID NO: 8 (mc RNA) GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC >SEQ ID NO: 9 (NOV2-5'UTR) guaaacaaccaauaacauc >SEQ ID NO: 10 (NOV2-3'UTR) uuccacccacagaagcguugacgacgcaaaacguccuuaaagcguugacgacgcaaaacguccccaagcucguagcaccgacccuauacccaucucuagggucuucaaccucuuggu >SEQ ID NO: 11 (DENVM RNA, multicloning site) AGUUGUUAGUCUACGUGGACCGACAAAGACAGAUUCUUUGAGGGAGCUAAGCUCAACGUAGUUCUAACAGUUUUUUAAUUAGAGAGCAGAUCUCUGAUCAAUAACCAACGGAAAAAGGCGAAAAACACGCCUUUCAAUAUCCUG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >SEQ ID NO: 12 (CAP-less - DENVM RNA, Multiple Cloning Site) GGUUGUUAGUCUACGUGGACCGACAAAGACAGAUUCUUUGAGGGAGCUAAGCUCAACGUAGUUCUAACAGUUUUUUAAUUAGAGAGCAGAUCUCUGAUCAAUAACCAACGGAAAAAGGCGAAAAACACGCCUUUCAAUAUCCUG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >SEQ ID NO: 13 (BYDVM RNA, Multiple Cloning Site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 14 (CAP-less - BYDVM RNA, Multiple Cloning Site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 15 (BYDV2M RNA, Multiple Cloning Site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUC CAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUUCCAACACAGCAAUGUGUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 16 (CAPless-BYDV2M RNA, multiple cloning site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUC CAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUUCCAACACAGCAAUGUGUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 17 (MNESVM RNA, multicloning site) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC >SEQ ID NO: 18 (CAP-less - MNESVM RNA, Multiple Cloning Site) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC​​​​​​​ GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGACAUGACACCUUUGAGACAGACCGUACAGCAGUCACACGGGACGCCACACCACCUUUGCAGAGGUGCCC UUGGGAAACCAAUGGUGUGGGGUGACACUGAUUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCUCACCAGGCCC >SEQ ID NO: 20 (CAP-less PMVM RNA, multiple cloning site) GGUAUUGGCUGCAACCCAUACCUGAAG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGACAUGACACCUUUGAGACAGACCGUACAGCAGUCACACGGGACGCCACACCACCUUUGCAGAGGUGCCC UUGGGAAACCAAUGGUGUGGGGUGACACUGAUUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCUCACCAGGCCC >SEQ ID NO: 21 (PEMV2M RNA, multiple cloning site) GGUAUUUAUAGAGAUCAGU GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO: 22 (CAP-less - PEMV2M RNA, Multiple Cloning Site) GGUAUUUAUAGAGAUCAGU GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC<000GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO: 23 (TCVM RNA, multiple cloning site) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUAUUAAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 24 (CAP-less - TCVM RNA, Multiple Cloning Site) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUAUUAAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 25 (DENVM 5'-UTR) GUUGUUAGUCUACGUGGACCGACAAAGACAGAUUCUUUGAGGGAGCUAAGCUCAACGUAGUUCUAACAGUUUUUUAAUUAGAGAGCAGAUCUCUGAUCAAUAACCAACGGAAAAAGGCGAAAAACACGCCUUUCAAUAUCCUG >Accession number 26 (DENVM 3'-UTR) AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >Accession number 27 (BYDV2M 5'-UTR) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC >Accession number 28 (BYDV2M 3'-UTR) AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 29 (PMVM 5'-UTR) GGUAUUGGCUGCAACCCAUACCUGAAG >SEQ ID NO: 30 (PMVM 3'-UTR) ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGACAUGACACCUUUGAGACAGACCGUACAGCAGUCACACGGGACGCCACACCACCUUUGCAGAGGUGCCCUUGGGAAACCAAUGGUGUGGGGUGACACUGAUUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCCUCACCAGGCCC >SEQ ID NO: 31 (PEMV2M 5'-UTR) GGUAUUUAUAGAGAUCAGU >SEQ ID NO: 32 (PEMV2M 3'-UTR) GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO: 33 (MNESVM 5'-UTR) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC >SEQ ID NO: 34 (MNESVM 3'-UTR) GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC >SEQ ID NO: 35 (TCVM 5'-UTR) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA >SEQ ID NO: 36 (TCVM 3'-UTR) UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUAUUAAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 37 (SARSVM 5'-UTR) aUUaaaggUUUaUaccUUcccaggUaacaaaccaaccaacUUUcgaUcUcUUgUagaUcUgUUcUcUaaacgaacUUUaaaaUcUgUgUggcUgUcacUcggcUgcaUgcUUagUgcacUcacgcagUaUaa UUaaUaacUaaUUacUgUcgUUgacaggacacgagUaacUcgUcUaUcUUcUgcaggcUgcUUacggUUUcgUccgUgUUgcagccgaUcaUcagcacaUcUaggUUUUcgUccgggUgUgaccgaaaggUaag >SEQ ID NO: 38 (SARSVM3'-UTR+50A) CAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUUUCACCGAGGCCACGCGGAGUACGAUCGAGUGUACAGUGAACAAUGCUAGGGAGAGCUGCCUAUAUGGAA GAGCCCUAAUGUGUAAAAUUAAUUUUAGUAGUGCUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >SEQ ID NO: 39 (COL1A1 COL1A2 COL1A1 collagen coding region RNA: coding region of exemplary self-cleaving peptide underlined) GGCUCCGGAGAGGGCAGAGGAAGUCUGCUAACAUGCGGUGACGUCGAGGAGAAUCCUGGCCCA GGGUCGGGUCAAUGUACUAACUACGCUUUGUUGAAACUCGCUGGCGAUGUUGAAAGUAACCCCGGUCCU >SEQ ID NO: 40 (EPO MULTIMERS CODING REGION RNA: Underlined coding region of exemplary self-cleaving peptide) AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA GGUUCUGGCGUGAAAACAGACUUUGAAUUUUGACCUUCUCAAGUUGGCGGGAGACGUGGAGUCCAACCCAGGGCCCAUGGGGGUGCACGAAUGUCCUGCCUGGCUUGGGCUUCCUCCCUCCUCUGGGCCUCCCACCACGCCUCUCAUCUGUGACAGCCGAGUCCUCUUGGAACACCUCUUGGAAGGAGAAUAUCACGAGGGCUGUCUGAAACACUUGAGCCAGGGCCUGCCAGCACACUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCAGAACCUUGCUUGCUUGCUUGCUUGCUUGCAGAAGCAAUGAACCUUCCCUCCAGAAGGAACCAUCCCUCCAGAAGCAUCCGCAAGCUUGCUUCCACUUCCGAACAAUCUCUGCUCACUUCCGAACACUUCUGCACACUUUCCGCAAACUCUUCCGAGUCUACUUCCAAAUUUCCUUCCGAGUCUACUUUCCCAGGGAACACUAGCUAGCAAGGGGAACCAGGGGAGCCUCAGCACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGAGACAGAGAAGCACUUGUACACUUCCGAGCACAGAGAAGCA GGCUCCGGAGAGGGCAGAGGAAGUCUGCUAACAUGCGGUGACGUCGAGGAGAAUCCUGGCCCAAUGGGGGUGCACGAAUGUCCUGCCUGGCUUGGGCUUCCUCCCUCCUCUGGGCCUCCCACCACGCCUCUCAUCUGUGACAGCCGAGUCCUCUUGGAACACCUCUUGGAAGGAGAAUAUCACGAGGGCUGUCUGAAACACUUGAGCCAGGGCCUGCCAGCACACUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCAGAACCUUGCUUGCUUGCUUGCUUGCUUGCAGAAGCAAUGAACCUUCCCUCCAGAAGGAACCAUCCCUCCAGAAGCAUCCGCAAGCUUGCUUCCACUUCCGAACAAUCUCUGCUCACUUCCGAACACUUCUGCACACUUUCCGCAAACUCUUCCGAGUCUACUUCCAAAUUUCCUUCCGAGUCUACUUUCCCAGGGAACACUAGCUAGCAAGGGGAACCAGGGGAGCCUCAGCACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGAGACAGAGAAGCACUUGUACACUUCCGAGCACAGAGAAGCA GGGUCGGGUCAAUGUACUAACUACGCUUUGUUGAAACUCGCUGGCGAUGUUGAAAGUAACCCCGGUCCUAUGGGGGUGCACGAAUGUCCUGCCUGGCUUGGGCUUCCUCCCUCCUCUGGGCCUCCCACCACGCCUCUCAUCUGUGACAGCCGAGUCCUCUUGGAACACCUCUUGGAAGGAGAAUAUCACGAGGGCUGUCUGAAACACUUGAGCCAGGGCCUGCCAGCACACUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCUUGCAGAACCUUGCUUGCUUGCUUGCUUGCUUGCAGAAGCAAUGAACCUUCCCUCCAGAAGGAACCAUCCCUCCAGAAGCAUCCGCAAGCUUGCUUCCACUUCCGAACAAUCUCUGCUCACUUCCGAACACUUCUGCACACUUUCCGCAAACUCUUCCGAGUCUACUUCCAAAUUUCCUUCCGAGUCUACUUUCCCAGGGAACACUAGCUAGCAAGGGGAACCAGGGGAGCCUCAGCACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGGGACACAGAGACAGAGAAGCACUUGUACACUUCCGAGCACAGAGAAGCA GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCUAUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGAUAA >SEQ ID NO: 41 (TERT / TERC RNA in MNESVM+50A RNA: Underlined regions are the TERT and TERC coding regions) AGATATCGACCTGCCTGACCAGGCTGAGATTGCGCTAGCCGGCGTAGTTGGTATCTCTCGCGCAAGCGGGTTTGAAGGTGCGGCCTATCTTAGGGGGGTAAATTGTAACTTCGCACAAAGGCGCGCCACC aTgccgcgcgcTccccgcTgccgagccgTgcgcTcccTgcTgcgcagccacTaccgcgaggTgcTgccgcTggccacgTTcgTgcggcgccTggggccccagggcTggcggcTggTgcagcgcggggacccggcggcTTTccgcgcgcTggTggcccagTgccTggTgTgcgTgcccTgggacgcacggccgccccccgccgcccccTccTTccgccaggTgTccTgccTgaaggagcTggTggcccgagTgcTgcagaggcTgTgcgagcgcggcgcgaagaacgTgcTggccTTcggcTTcgcgcTgcTggacggggcccgcgggggcccccccgaggccTTcaccaccagcgTgcgcagcTaccTgcccaacacggTgaccgacgcacTgcgggggagcggggcgTgggggcTgcTgcTgcgccgcgTgggcgacgacgTgcTggTTcaccTgcTggcacgcTgcgcgcTcTTTgTgcTggTggcTcccagcTgcgccTaccaggTgTgcgggccgccgcTgTaccagcTcggcgcTgccacTcaggcccggcccccgccacacgcTagTggaccccgaaggcgTcTgggaTgcgaacgggccTggaaccaTagcgTcagggaggccggggTcccccTgggccTgccagccccgggTgcgaggaggcgcgggggcagTgccagccgaagTcTgccgTTgcccaagaggcccaggcgTggcgcTgccccTgagccggagcggacgcccgTTgggcaggggTccTgggcccacccgggcaggacgcgTggaccgagTgaccgTggTTTcTgTgTggTgTcaccTgccagacccgccgaagaagccaccTcTTTggagggTgcgcTcTcTggcacgcgccacTcccacccaTccgTgggccgccagcaccacgcgggccccccaTccacaTcgcggccaccacgTcccTgggacacgccTTgTcccccggTgTacgccgagaccaagcacTTccTcTacTccTcaggcgacaaggagcagcTgcggcccTccTTccTacTcagcTcTcTgaggcccagccTgacTggcgcTcggaggcTcgTggagaccaTcTTTcTgggTTccaggcccTggaTgccagggacTccccgcaggTTgccccgccTgccccagcgcTacTggcaaaTgcggccccTgTTTcTggagcTgcTTgggaaccacgcgcagTgccccTacggggTgcTccTcaagacgcacTgcccgcTgcgagcTgcggTcaccccagcagccggTgTcTgTgcccgggagaagccccagggcTcTgTggcggcccccgaggaggaggacacagacccccgTcgccTggTgcagcTgcTccgccagcacagcagccccTggcaggTgTacggcTTcgTgcgggccTgccTgcgccggcTggTgcccccaggccTcTggggcTccaggcacaacgaacgccgcTTccTcaggaacaccaagaagTTcaTcTcccTggggaagcaTgccaagcTcTcgcTgcaggagcTgacgTggaagaTgagcgTgcgggacTgcgcTTggcTgcgcaggagcccaggggTTggcTgTgTTccggccgcagagcaccgTcTgcgTgaggagaTccTggccaagTTccTgcacTggcTgaTgagTgTgTacgTcgTcgagcTgcTcaggTcTTTcTTTTaTgTcacggagaccacgTTTcaaaagaacaggcTcTTTTTcTaccggaagagTgTcTggagcaagTTgcaaagcaTTggaaTcagacagcacTTgaagagggTgcagcTgcgggagcTgTcggaagcagaggTcaggcagcaTcgggaagccaggcccgcccTgcTgacgTccagacTccgcTTcaTccccaagccTgacgggcTgcggccgaTTgTgaacaTggacTacgTcgTgggagccagaacgTTccgcagagaaaagagggccgagcgTcTcaccTcgagggTgaaggcacTgTTcagcgTgcTcaacTacgagcgggcgcggcgccccggccTccTgggcgccTcTgTgcTgggccTggacgaTaTccacagggccTggcgcaccTTcgTgcTgcgTgTgcgggcccaggacccgccgccTgagcTgTacTTTgTcaaggTggaTgTgacgggcgcgTacgacaccaTcccccaggacaggcTcacggaggTcaTcgccagcaTcaTcaaaccccagaacacgTacTgcgTgcgTcggTaTgccgTggTccagaaggccgcccaTgggcacgTccgcaaggccTTcaagagccacgTcTcTaccTTgacagaccTccagccgTacaTgcgacagTTcgTggcTcaccTgcaggagaccagcccgcTgagggaTgccgTcgTcaTcgagcagagcTccTcccTgaaTgaggccagcagTggccTcTTcgacgTcTTccTacgcTTcaTgTgccaccacgccgTgcgcaTcaggggcaagTccTacgTccagTgccaggggaTcccgcagggcTccaTccTcTccacgcTgcTcTgcagccTgTgcTacggcgacaTggagaacaagcTgTTTgcggggaTTcggcgggacgggcTgcTccTgcgTTTggTggaTgaTTTcTTgTTggTgacaccTcaccTcacccacgcgaaaaccTTccTcaggacccTggTccgaggTgTcccTgagTaTggcTgcgTggTgaacTTgcggaagacagTggTgaacTTcccTgTagaagacgaggcccTgggTggcacggcTTTTgTTcagaTgccggcccacggccTaTTccccTggTgcggccTgcTgcTggaTacccggacccTggaggTgcagagcgacTacTccagcTaTgcccggaccTccaTcagagccagTcTcaccTTcaaccgcggcTTcaaggcTgggaggaacaTgcgTcgcaaacTcTTTggggTcTTgcggcTgaagTgTcacagccTgTTTcTggaTTTgcaggTgaacagccTccagacggTgTgcaccaacaTcTacaagaTccTccTgcTgcaggcgTacaggTTTcacgcaTgTgTgcTgcagcTcccaTTTcaTcagcaagTTTggaagaaccccacaTTTTTccTgcgcgTcaTcTcTgacacggccTcccTcTgcTacTccaTccTgaaagccaagaacgcagggaTgTcgcTgggggccaagggcgccgccggcccTcTgcccTccgaggccgTgcagTggcTgTgccaccaagcaTTccTgcTcaagcTgacTcgacaccgTgTcaccTacgTgccacTccTggggTcacTcaggacagcccagacgcagcTgagTcggaagcTcccggggacgacgcTgacTgcccTggaggccgcagccaacccggcacTgcccTcagacTTcaagaccaTccTggacTgaGCGGCCGCGACAAACTCTCCGCCTAATGTCTGATGATGTGAGGAACGTGGACTGTGATGTGGTGGTGCGGTACCATGGCTGGTCACCATGGTAATGCGTAGGGCAACACAGTTCATTAAGACTCACTGATGATGGCACTAGGCACGGTTCACCCCCATCCTTCGGGAGGGCTATAGGGGGTGACCGGGTTACACCACCGGAAGACCGGAACATTGCCTTTGGGCAGCCCCAACCCCTGATGAGTCCGTGAGGACGAAACGGTAGGAATTCCTACCGTC GGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTCCCCGCGCGCTGTTTTTCTCGCTGACTTTCAGCGGGCGGAAAAGCCTCGGCCTGCCGCCTTCCACCGTTCATTCTAGAGCAAACAAAAAATGTCAGCTGCTGGCCCGTTCGCCCCTCCCGGGGACCTGCGGCGGGTCGCCTGCCCAGCCCCCGAACCCCGCCTGGAGGCCGCGGTCGGCCCGGGGCTTCTCCGGAGGCACCCACTGCCACCGCGAAGAGTTGGGCTCTGTCAGCCGCGGGTCTCTCGGGGGCGAGGGCGAGGTTCAGGCCTTTCAGGCCGCAGGAAGAGGAACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGCTGTGGGACGTGCACCCAGGACTCGGCTCACACATGC CACCGGAGTCGACTCCGGTCTGATGAGTCCGTGAGGACGAAGCATGTACTTAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >SEQ ID NO: 42 (NOV2M DMD28A mRNA) GUAAACAACCAAUAACAUCGCGAUCGCC CUUCUGGCCAGUAGAUUCUGCGCCUGCCUCGUCCCCUCAGCUUUCACACGAUGAUACUCAUUCACGCAUUGACAUAUUGCUAGCAGGCUAGCAGAAAUGGAAAACAGCAAUGGAUCUAUCUAAUAGAUAGCAUCUCUCCUAAAUGAGAGCAUAGAUGAUGACAUUUGUAAUCCAGCAUUACUGCCAAAUUUGACCAAGGA CUCCCCCCUGAGCCAGCCUCGUAGUCCUGCCCAGAUCUUGAUUCCUUAGAGAGUGGAGGAAAGAGGGGAGCUAGAGGAAAUCCUAGCAGAUCUUGAGGAAAAAACAGGAAUCUGCAAGCAGAAUAUGACCGUCUAAAAGCAGCAGCACGAACAUAAAGGCCUGUCCCCACUGCCGUCCCCUCCUGAAAAUGAUGCCCACCUCUCCC CCAGAGUCCCCGGGAGCUCAUGCUCUAUUGCUGAGGCCCAAGCUACUGCGUCAACACAAAGGCCGCCUGGAAGCCAGGAUGCAAAUCCUGGAAGACCACAAUAAAACAGCUGGAGUCCAGUUACACAGGCUAAGGCAGCUGCUGGAGCAACCCCAGGCCAAGGGCCAAAGUGAUGGCCACAACAACGGUGUCUCUCUCUCUCUUCCUUCCUUCCUUCUACCUCUCUACACAGAGGUCCAGAGCCUAUGCUGUCCUUCCAGUCAAACUUCGGACCUUGGUUGGCAGUCAAACUUCGGACCUUGGUGAGGAGGAAGAUCUUCUCUCCUCCCAGGACACAAGCACGGUUAGAAGGAGGUGUGGAUGGAGCAACUCAACAACUCCUUCCUUCCUAGUUA UUCCACCCACAGAAGCGUUGACGACGCAAAACGUCCUUAAAGCGUUGACGACGCAAAAACGUCCCCAAGCUCGUAGCACCGACCCUAUACCCAUCUCUUAGGGUCUUCAACCUCUUGGUAAAAAAAAAAAAAAAAAAAAAAAA

Claims

1. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR is Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof, or Nodamura virus RNA1 (NOV1) 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; The RNA molecule, wherein the CDS is heterologous to NOV2 or NOV1 and replaces the Nodamura virus capsid protein open reading frame or the Nodamura virus RNA-dependent RNA polymerase (RdRp) open reading frame of NOV2.

2. The RNA molecule of claim 1, wherein the 3'-UTR is NOV2 3'-UTR.

3. The RNA molecule of claim 2, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

10.

4. The RNA molecule of claim 1, wherein the 3'-UTR is NOV1 3'-UTR.

5. The RNA molecule of claim 4, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

7.

6. below: (i) the nucleotide sequence of SEQ ID NO: 6 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 7 as the 3'-UTR; or (i) the nucleotide sequence of SEQ ID NO: 9 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 10 as the 3'-UTR; The RNA molecule of claim 1, comprising:

7. 1. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces at least a portion of the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus whose genome lacks a poly(A) tail.

8. 8. The RNA molecule of claim 7, wherein the virus is a member of a viral family selected from the group consisting of Nodaviridae, Flaviviridae, and Tetraviridae.

9. The RNA molecule of claim 8, wherein the virus is a member of the Nodaviridae family.

10. The RNA molecule of claim 9, wherein the virus is Nodamura virus or Flock House virus.

11. The RNA molecule of claim 8, wherein the virus is a member of the Flaviviridae family.

12. The RNA molecule of claim 11, wherein the virus is a dengue virus.

13. The RNA molecule of claim 7, wherein the virus is a plant virus.

14. 14. The RNA molecule of claim 13, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV).

15. 15. The RNA molecule of any one of claims 1 to 14, comprising at least one modified nucleoside.

16. 16. The RNA molecule of claim 15, wherein the at least one modified nucleoside comprises "5mC+Ψ", "m1Ψ", "5moU" or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC+Ψ".

17. The RNA molecule of any one of claims 1 to 16, wherein the at least one CDS comprises two or more CDSs for two or more different proteins.

18. The RNA molecule of claim 17, wherein the two or more CDSs are operably linked to form a fusion protein comprising two or more different proteins.

19. The RNA molecule of claim 17, wherein the two or more CDSs are separated from each other by an internal ribosome entry site (IRES).

20. The RNA molecule of claim 17, wherein the two or more CDSs are separated from each other by a flexible linker or a nucleotide encoding a 2A self-cleaving peptide.

21. 21. The RNA molecule of any one of claims 1 to 20, wherein the RNA molecule comprises a heterologous adenine homopolymer at its 3' end of about 60 nucleotides or less in length, optionally wherein the heterologous adenine homopolymer is 20-60 nucleotides in length.

22. 21. The RNA molecule of any one of claims 1 to 20, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein.

23. 23. A DNA template for an RNA molecule according to any one of claims 1 to 22, optionally wherein a first restriction enzyme site(s) is / are present between the 5'-UTR and at least one coding region, and a second restriction enzyme site(s) is / are present between the at least one coding region and the 3'-UTR.

24. 24. A plasmid comprising the DNA template of claim 23, wherein the plasmid comprises a promoter upstream of the 5'UTR.

25. 25. A host cell comprising the plasmid of claim 24.

26. A recombinant virus comprising an RNA molecule according to any one of claims 1 to 22.

27. 23. A method for expressing a protein, comprising contacting a mammalian cell with an RNA molecule according to any one of claims 1 to 22.

28. 28. The method of claim 27, wherein the contacting is in vitro.

29. 28. The method of claim 27, wherein the contacting is in vivo.

30. The method of any one of claims 27 to 29, wherein the contacting is carried out in the presence of a B18R protein.

31. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, a 3'-untranslated region (3'-UTR), and an adenine homopolymer, wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS and adenine homopolymer are heterologous to the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus lacking its genomic poly(A) tail.

32. 32. The RNA molecule of claim 31, wherein the adenine homopolymer is about 60 nucleotides or less in length.

33. 33. The RNA molecule of claim 32, wherein the adenine homopolymer is 20 to 60 nucleotides in length.

34. 32. The RNA molecule of claim 31, wherein the virus is a member of a viral family selected from the group consisting of Nodaviridae, Flaviviridae, and Tetraviridae.

35. 32. The RNA molecule of claim 31 , wherein the virus is a member of the Nodaviridae family.

36. 36. The RNA molecule of claim 35, wherein the virus is Nodamura virus or Flock House virus.

37. 32. The RNA molecule of claim 31 , wherein the virus is a member of the Flaviviridae family.

38. 38. The RNA molecule of claim 37, wherein the virus is a dengue virus.

39. 32. The RNA molecule of claim 31 , wherein the virus is a plant virus.

40. 40. The RNA molecule of claim 39, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV).

41. 41. The RNA molecule of any one of claims 31 to 40, comprising at least one modified nucleoside.

42. 42. The RNA molecule of claim 41, wherein the at least one modified nucleoside comprises "5mC+Ψ", "m1Ψ", "5moU" or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC+Ψ".

43. 43. The RNA molecule of any one of claims 31 to 42, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein.

44. 32. The RNA molecule of claim 31, wherein the adenine homopolymer is from about 60 nucleotides to about 120 nucleotides in length.

45. From 5' to 3': an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces at least the open reading frame of the viral RNA-dependent RNA polymerase; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus.

46. The RNA molecule of claim 45, wherein the RNA molecule further comprises an adenine homopolymer 15 to 200 nucleotides in length downstream of the 3'-UTR.

47. 47. The RNA molecule of claim 46, wherein the virus is a member of the coronavirus family.

48. 48. The RNA molecule of claim 47, wherein the virus is severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2).

49. From 5' to 3': an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; The CDS encodes a full-length human dystrophin or a full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein and replaces at least a portion of the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus.

50. 50. The RNA molecule of claim 49, wherein the viral genome lacks a poly(A) tail.

51. 51. The RNA molecule of claim 50, further comprising a heterologous adenine homopolymer at its 3' end, optionally wherein the adenine homopolymer is 20 to 60 nucleotides in length.

52. 50. The RNA molecule of claim 49, wherein the viral genome comprises a poly(A) tail and the RNA molecule further comprises a poly(A) tail.

53. 53. The RNA molecule of claim 52, further comprising a heterologous adenine homopolymer at the 3' end of the poly(A) tail, optionally wherein the poly(A) tail and the heterologous adenine homopolymer together are 20 to 120 nucleotides in length.

54. From 5' to 3': an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a 5'-UTR of a dengue virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of a dengue virus or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; and The RNA molecule, wherein the CDS is heterologous to the dengue virus and replaces the open reading frame of the dengue virus so that a portion of the open reading frame that interacts with the complementary sequence of the 3'-UTR to form a circular three-dimensional structure remains within the RNA molecule.

55. 55. The RNA molecule of claim 54, wherein the first start codon of the portion of the open reading frame remaining in the RNA molecule is mutated (so that it does not initiate translation of the first corresponding genomic sequence) and the first corresponding portion of the 3'-UTR (which interacts with the first start codon to form a circular conformation) is mutated (so that the mutated first start codon remains complementary to the first corresponding portion of the mutated 3'-UTR to form a circular conformation).

56. 56. The RNA molecule of claim 55, wherein a second start codon of the portion of the open reading frame remaining in the RNA molecule is mutated (so that it does not initiate translation of a second corresponding genomic sequence), and a second corresponding portion of the 3'-UTR (which interacts with the second start codon to form a circular conformation) is mutated (so that the mutated second start codon remains complementary to the mutated second corresponding portion of the 3'-UTR to form a circular conformation).

57. 57. The RNA molecule of any one of claims 54 to 56, further comprising a 5'-cap.

58. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:25 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:25; and (ii) The RNA molecule of any one of claims 54 to 57, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

26.

59. 59. The RNA molecule of any one of claims 54 to 58, further comprising a homopolymer of adenine downstream of the 3'-UTR.

60. 60. The RNA molecule of claim 59, wherein the adenine homopolymer is about 30 to about 60 nucleotides in length.

61. From 5' to 3': an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a plant viral 5'-UTR or a fragment thereof, and the 3'-UTR is a plant viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the plant virus and replaces at least a portion of the open reading frame of the plant virus; the virus is a positive-sense, single-stranded RNA (+ssRNA) virus whose genome lacks a poly(A) tail; and The RNA molecule, wherein the 3'-UTR contains a 3'-cap-independent translation enhancer (3'-CITE).

62. 62. The RNA molecule of claim 61, further comprising a 5'-cap that is heterologous to the plant virus.

63. 63. The RNA molecule of claim 61 or claim 62, further comprising an adenine homopolymer heterologous to the plant virus.

64. 64. The RNA molecule of claim 63, wherein the adenine homopolymer is about 30 to about 60 nucleotides in length.

65. 65. The RNA molecule of any one of claims 61 to 64, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Panicum mosaic virus (PMV), Pea elevated mosaic virus-2 (PEMV2), or Turnip crinkle virus (TCV).

66. 65. The RNA molecule of any one of claims 61 to 64, wherein the 3'-CITE is a BYDV-like translation element (BTE), a PMV-like translation element (PTE), an I-type secondary structure (ISS), or a T-type structure (TSS).

67. 67. The RNA molecule of claim 66, wherein the 3'-CITE is a BTE.

68. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:27 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:27; and (ii) the RNA molecule of claim 67, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

28.

69. 67. The RNA molecule of claim 66, wherein the 3'-CITE is a PTE.

70. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:29 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:29; and (ii) the RNA molecule of claim 69, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

30.

71. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 31; and (ii) the RNA molecule of claim 69, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 32 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

32.

72. 67. The RNA molecule of claim 66, wherein the 3'-CITE is an ISS.

73. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 33 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 33; and (ii) the RNA molecule of claim 72, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 34 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

34.

74. 67. The RNA molecule of claim 66, wherein the 3'-CITE is a TSS.

75. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 35; and (ii) The RNA molecule of Claim 74, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

36.

76. From 5' to 3': an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein: the 5'-UTR is a viral 5'-UTR or a fragment thereof, and the 3'-UTR is a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length; the CDS is heterologous to the virus and replaces the open reading frame of the virus; and The RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus.

77. 77. The RNA molecule of claim 76, wherein the viral 3'-UTR comprises a heterologous adenine homopolymer downstream of the viral homologous adenine homopolymer.

78. (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 37; and (ii) the RNA molecule of Claim 77, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

38.

79. 77. The RNA molecule of claim 76, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1).

80. 77. The RNA molecule of claim 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

39.

81. 77. The RNA molecule of claim 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 40 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

40.

82. 77. The RNA molecule of claim 76, comprising the nucleotide sequence of SEQ ID NO: 41 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

41.

83. The RNA molecule of any one of claims 76 to 82, wherein the 5'-UTR and 3'-UTR form a circular three-dimensional structure.

84. From 5' to 3': an RNA molecule comprising a viral 5'-untranslated region (5'-UTR), a multiple cloning site (MCS), and a viral 3'-untranslated region (3'-UTR), wherein: The above RNA molecule, wherein the virus is a positive-sense, single-stranded RNA (+ssRNA) virus and the MCS is 18 to 60 nucleotides in length.

85. 85. The RNA molecule of Claim 84, wherein the MCS comprises the nucleotide sequence of SEQ ID NO:

8.

86. 85. The RNA molecule of claim 84, comprising the nucleotide sequence of SEQ ID NO:3 or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

3.

87. 85. The RNA molecule of claim 84, comprising a nucleotide sequence selected from SEQ ID NOs: 11-24, or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to a nucleotide sequence selected from SEQ ID NOs: 11-24.

88. 88. The RNA molecule of any one of claims 84 to 87, further comprising at least one coding sequence (CDS) for at least one protein located within the MCS or that replaces a portion of the MCS.

89. 89. A DNA template for an RNA molecule according to any one of claims 31 to 88.

90. 90. The DNA template of claim 89, wherein a first restriction enzyme site(s) is / are present between the 5'-UTR and the at least one coding region, and a second restriction enzyme site(s) is / are present between the at least one coding region and the 3'-UTR.

91. 91. A plasmid comprising the DNA template of Claim 90, wherein the plasmid comprises a promoter upstream of the 5' UTR.

92. 92. A host cell comprising the plasmid of claim 91.

93. A recombinant virus comprising the RNA molecule of any one of claims 31 to 88.

94. 89. A method for expressing a protein, comprising contacting a mammalian cell with an RNA molecule according to any one of claims 31 to 88.

95. 95. The method of claim 94, wherein said contacting is in vitro.

96. 95. The method of claim 94, wherein the contacting is in vivo.

97. 97. The method of any one of claims 94 to 96, wherein the contacting is carried out in the presence of a B18R protein.

Images