MGAT1-deficient cells and their use

Abstract

A method for producing modified cells lacking mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase 1 ("MGAT1") activity is provided. The MGAT1 activity-deficient CHO cell line produced by this method is also provided. A method for producing glycoproteins is further disclosed.

Description

[Technical Field]

[0001] This application claims the benefits and priority of U.S. Provisional Patent Application No. 63 / 502,866, filed on 17 May 2023. The entirety of the aforementioned application is incorporated herein by reference.

[0002] Sequence List This application includes a sequence listing submitted electronically in .xml format, which is incorporated herein by reference in its entirety. The .xml copy created on 15 May 2024 is named "A1000-01200US_20240515_SeqListing.xml" and is 20 kilobytes in size.

[0003] This disclosure pertains to methods for producing novel cell lines and glycoproteins. [Background technology]

[0004] The development of broad-spectrum protective vaccines against pathogenic viruses remains a major challenge in immunology and public health. For example, broad-spectrum protective vaccines are needed to address the ongoing emergence of new variants of SARS-CoV-2.

[0005] The SARS-CoV-2 spike protein is a key immunogen, susceptible to mutation, and contains a conserved epitope protected by glycans. Recent studies have shown that glycosylation of the spike protein has site-differentiated effects on viral infectivity, with spike proteins produced in lung epithelial cells upon infection possessing a more infectious glycoform. It has also been shown that immunization of mice with spike proteins containing monoglycosylated N-linked glycans induces a stronger immune response and better protection against SARS-CoV-2 variants compared to immunization with fully glycosylated spike proteins.

[0006] One method for producing viral antigens using modified glycosylation is to mutate the O- or N-glycosylation site of the antigen. However, this may alter the protein structure, resulting in epitope loss and thus reduced immunogenicity. Another method involves expressing the viral antigen in a cell line engineered to have a modified glycosylation pathway. [Overview of the project] [Problems that the invention aims to solve]

[0007] Therefore, there is a need for cell systems and methods for producing glycan-modified glycoprotein antigens that can be used to develop broad-spectrum neutralizing antibodies against viruses and other pathogens. [Means for solving the problem]

[0008] (Summary of the invention) To satisfy the above needs, a method is provided for producing modified cells lacking mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase 1 ("MGAT1") activity. This method includes the steps of: introducing an RNA-induced endonuclease into parent cells together with a guide RNA ("gRNA") containing the sequence described in GGAUGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4), or GAUCGCCAGGCACUACCGCU (SEQ ID NO: 5); culturing the parent cells; isolating multiple daughter cells from the cell culture; and identifying MGAT1-deficient modified cells.

[0009] The MGAT1 activity-deficient CHO cell line produced by the above method falls within the scope of the present invention.

[0010] MGAT1-deficient CHO cells are also provided, in which the cells contain nucleic acids having the sequence described in Sequence ID No. 6 within their genome.

[0011] A first method is disclosed for producing a glycoprotein, comprising the steps of: obtaining MGAT1-deficient cells prepared using the above method; expressing a protein having an N-glycosylation site in the cells; culturing the cells so that the protein is N-glycosylated with oligomannose glycan at the N-glycosylation site; and isolating the N-glycosylated protein from the cells.

[0012] A second method for producing a glycoprotein is further disclosed, comprising the steps of: first producing MGAT1-deficient cells using the method described above; expressing a protein having an N-glycosylation site in the cells; culturing the cells so that the protein is N-glycosylated with oligomannose glycan at the N-glycosylation site; and isolating the N-glycosylated protein from the cells.

[0013] Finally, a third method for producing a glycoprotein is disclosed, comprising the steps of: obtaining the aforementioned MGAT1-deficient CHO cells containing SEQ ID NO: 6; expressing a protein having an N-glycosylation site in the cells; culturing the cell line, thereby N-glycosylating the protein at the N-glycosylation site with oligomannose glycan; and isolating the N-glycosylated protein from the cells.

[0014] Details of one or more embodiments of the present invention are described below. Other features, purposes and advantages of the present invention will become apparent from the description, drawings and claims. [Brief explanation of the drawing]

[0015] [Figure 1] This figure demonstrates Western blot autoradiographs showing SARS-CoV-2 spike proteins expressed in three different MGAT1-deficient CHO K1 cell lines, either with or without treatment (-) with endonuclease H ("EndoH"). [Figure 2A] This figure demonstrates a Western blot autoradiograph examining culture media taken from MGAT1-deficient CHO K1 cell lines expressing SARA-CoV2 spike protein ("S protein") compared to standard proteins including Sfg, Shm, and Smg. Sfg = fully glycosylated S protein, Shm = high-mannose S protein, Smg = monoglycosylated S protein, A = adherent culture medium, and S = suspension culture medium. [Figure 2B] This figure demonstrates a Western blot autoradiograph for examining histidine-tagged S proteins purified from suspension cultures of MGAT1-deficient CHO K1 cell lines, with or without EndoH treatment (-) compared to standard proteins including Shm and Smg. Shm = high-mannose S protein, Smg = monoglycosylated S protein. [Figure 3A] This is a schematic presentation of the glycan composition of the 61-F.FSNVT.W fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7), or was glycan-free ("un"). The treated fragment either contained no glycans or only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3B] This is a schematic presentation of the glycan composition of the 74-F.HAIHVSGTNGTK.R fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(1), HexNAc(2)Hex(3), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3C] This is a schematic presentation of the glycan composition of the 122-L.IVNNATNVVIK.V fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3D] This is a schematic presentation of the glycan composition of the 149-Y.YHKNNKSWMESGVY.S fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(2)Hex(5). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3E] This is a schematic presentation of the glycan composition of the 163-Y.SSANNCTFEYVSQPF.L fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(2)Hex(5) and HexNAc(2)Hex(6). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3F]Schematic presentation of the glycan composition of the 232-I.GINIT.R fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(1), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), HexNAc(2)Hex(8), and HexNAc(2)Hex(9), or did not carry glycans (``un''). The treated fragment either did not carry glycans or carried only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3G] Schematic presentation of the glycan composition of the 280-K.YNENGTIT.D fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(2)Hex(4), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated fragment carried only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3H] Schematic presentation of the glycan composition of the 329-V.RFPNIT.N fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5), or did not carry glycans (``un''). The treated fragment either did not carry glycans or carried only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3I]Schematic presentation of the glycan compositions of the 341-F.GEVFNAT.R fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). The treated fragment mainly carried HexNAc(1) and a small amount of HexNAc(2)Hex(4). The solid squares represent NAc, and the solid circles represent mannose. [Figure 3J] Schematic presentation of the glycan compositions of the 601-S.VITPGTNTS.N fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(2)Hex(3), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated fragment carried only HexNAc(1). The solid squares represent NAc, and the solid circles represent mannose. [Figure 3K] Schematic presentation of the glycan compositions of the 614-V.LYQGVNCT.E fragment of the SARS-CoV2 spike protein without the delta His-tag, expressed using typical cells according to the present disclosure, with or without treatment with EndoH. The untreated fragment carried glycans containing HexNAc(1), HexNAc(2)Hex(5), and HexNAc(2)Hex(6). The treated fragment mainly carried HexNAc(1). The solid squares represent NAc, and the solid circles represent mannose. [Figure 3L]This is a schematic presentation of the glycan composition of the 655-V.NNSYECDIPI.G fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3M] This is a schematic presentation of the glycan composition of the 707-A.YSNNSIA.I fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3N] This is a schematic presentation of the glycan composition of the 715-T.NFTIS.V fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), HexNAc(2)Hex(8), and HexNAc(2)Hex(9) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3O]This is a schematic presentation of the glycan composition of the 799-K.TPPIKDFGGFNFS.Q fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(1), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), HexNAc(2)Hex(7), and HexNAc(2)Hex(8). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3P] This is a schematic presentation of the glycan composition of the 1072-A.QEKNFTT.A fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(1), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3Q] This is a schematic presentation of the glycan composition of the 1096-S.NGTHWFVT.Q fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(4), HexNAc(2)Hex(5), HexNAc(2)Hex(6), and HexNAc(2)Hex(7) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3R]This is a schematic presentation of the glycan composition of the 1132-V.NNTV.Y fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(1), HexNAc(2)Hex(4), HexNAc(2)Hex(5), and HexNAc(2)Hex(7). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3S] This is a schematic presentation of the glycan composition of the 1156-K.NHTSPDVDLG.D fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells of this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3T] This is a schematic presentation of the glycan composition of the 1171-S.GINASVV.N fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells of this disclosure, with and without treatment with EndoH. The untreated fragment contained or did not contain glycans including HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5) ("un"). The treated fragment either did not contain glycans or contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Figure 3U]This is a schematic presentation of the glycan composition of the 655-V.NNSYECDIPI.G fragment of the delta-His-tagged SARS-CoV2 spike protein, expressed using typical cells according to this disclosure, with and without treatment with EndoH. The untreated fragment contained glycans including HexNAc(1), HexNAc(2)Hex(4), and HexNAc(2)Hex(5). The treated fragment contained only HexNAc(1). Solid squares represent NAc, and solid circles represent mannose. [Modes for carrying out the invention]

[0016] In one embodiment, the present disclosure provides a method for producing MGAT1 activity-deficient modified cells. The method includes introducing an RNA-inducible endonuclease together with a guide RNA (gRNA) into a parent cell, for example, CHO K1.

[0017] In this specification, “MGAT1 deficiency” or “MGAT1 activity deficiency” refers to the inability of mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase 1 in cells to function compared to that of wild-type or unmodified cells. MGAT1 deficiency can be achieved by modifying the MGAT1 gene by inserting or deleting or substituting one or more nucleotides, resulting in a missense, nonsense, or frameshift mutation of the gene. The modified gene may no longer express the protein product or may express a non-functional protein product.

[0018] In some embodiments, the RNA-induced endonuclease is a clustered, regularly spaced, palindromic short repeat-associated protein ("Cas") which may be Streptococcus pyogenes Cas9 ("SpCas9"), enhanced SpCas9 (eSpCas9), or high-fidelity SpCas91 (SpCas9-HF1). In certain embodiments, the RNA-induced endonuclease is SpCas9.

[0019] While we do not wish to be bound by theory, in embodiments where the RNA-induced endonuclease is a Cas protein, the introduced gRNA will bind to the target gene at a site based on hybridization between the gRNA and the target gene. Hybridization between the gRNA and the target gene forms a complex that assembles the Cas protein and thereby activates it. The activated Cas protein cleaves the binding site, knocking out a fragment of the target gene and resulting in a double-strand break (DSB). The DSB will then be repaired by the homologous recombination repair (HDR) mechanism. The repaired gene, therefore, has lost its fragment and is no longer complete. The gene can either not be expressed, or its expressed gene product will lose its function.

[0020] In some embodiments, the gRNA may include the nucleic acid sequence described in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In certain embodiments, the gRNA includes the nucleic acid sequence described in SEQ ID NO: 3.

[0021] In some embodiments, the parental cell of the Disclosure includes a gene encoding a protein exhibiting MGAT1 activity. In embodiments in which the gRNA includes the nucleic acid sequence described in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, the gene of the parental cell encoding the protein exhibiting MGAT1 activity includes a target sequence that can hybridize with at least a portion of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0022] In some embodiments, the gRNA used in this method comprises clustered regularly spaced palindromic short repeat RNAs ("crRNA") and transactivating crRNAs ("tracrRNA"). In some embodiments, the crRNA and tracrRNA are coupled to each other by hybridization, and in other embodiments, the crRNA and tracrRNA are formed within the same nucleic acid molecule. In certain embodiments, the tracrRNA comprises the nucleic acid sequence described in SEQ ID NO: 11. It should be noted that in some embodiments, the crRNA comprises the nucleic acid sequence described in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, and further comprises a region complementary to the 5' end of the tracrRNA. For example, the crRNA comprising SEQ ID NO: 3 is GGUAGUGGAGGACGAUCUGGGUUUUAGAGCUAUGCU 3' (SEQ ID NO: 13). Typical crRNAs containing sequence numbers 2, 4, and 5 are GGAUGCGCAGACCUGAGCAGGUUUUAGAGCUAUGCU (sequence number 12), UUUCUCCACCUGUAGCAGGGGUUUUAGAGCUAUGCU (sequence number 14), and GAUCGCCAGGCACUACCGCUGUUUUAGAGCUAUGCU (sequence number 15), respectively.

[0023] In some embodiments, RNA-inducible endonucleases and gRNAs can be introduced into CHO cells, such as parent cells which may be CHO K1, using electroporation as a pre-formed complex.

[0024] In some embodiments, the above method includes a step of identifying MGAT1 activity-deficient modified cells. Identification may be achieved by using an MGAT1 enzyme activity assay or by sequencing the genomic DNA of candidate cells to identify cells having insertions and / or deletions that result in loss of MGAT1 gene expression and / or loss of enzymatic activity of the MGAT1 gene product. For example, the identification step may be carried out by performing a bacteriophage T7 endonuclease I ("T7EI") digestion assay on genomic DNA fragments amplified from candidate cells and sequencing the genomic DNA fragments of T7EI digestion assay-positive cells. It is known to those skilled in the art that the T7EI digestion assay is an effective tool for identifying small sequence mismatches. For example, a DNA fragment amplified from the genomic DNA of a cell can be denatured and re-annealed with a wild-type DNA molecule. The annealed DNA fragment is then digested by T7 endonuclease I, thereby yielding digested DNA fragments of different sizes if mismatches are present. However, the present disclosure is not limited to the use of the T7EI digestion assay.

[0025] In one aspect of this disclosure, glycoproteins can be produced using the modified cells described above. The first method is characterized by expressing a glycoprotein having an N-glycosylation site in MGAT1-deficient cells (which may be modified CHO cells according to this disclosure). In some embodiments, this method is performed in vitro. The glycoprotein can be expressed in cells modified with a vector expressing the protein by suitable methods known to those skilled in the art, such as transfection, retroviral transduction, and lentiviral transduction. The vector may be, but is not limited to, a plasmid expression vector, a retroviral vector, and a lentiviral vector. If a viral vector is used, the viral particles can be produced in suitable host cells known to those skilled in the art.

[0026] By expressing glycoproteins in MGAT1-deficient cells, the N-glycosylation site is N-glycosylated by oligomannose glycans. The N-glycosylated protein, i.e., oligomannose glycoprotein, is then isolated from the cells by standard procedures known to those skilled in the art. For example, the N-glycosylated protein can be purified from the culture supernatant. Alternatively, cells can be collected by centrifugation, and the N-glycosylated protein can be purified from the cell pellet.

[0027] In some embodiments, MGAT1-deficient cells may be cultured in an adherent culture or a suspension culture.

[0028] A first method for producing glycoproteins may also include a step of removing oligomannose glycan to leave only an N-acetylglucosamine residue at the N-glycosylation site, thereby producing a monoglycosylated protein. Oligomannose glycan can be removed from a glycoprotein containing oligomannose glycan by incubation with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetyl-betaglucosaminohydrolase ("Endo H").

[0029] In some embodiments, the glycoprotein expressed in MGAT1-deficient cells may be, for example, a cellular protein or a viral envelope protein.

[0030] In certain embodiments, the glycoprotein is a viral envelope protein, such as the SARS-CoV-2 spike protein, the pan-SARS-CoV-2 spike protein, the pan-beta-coronavirus spike protein, or the influenza hemagglutinin. The SARS-CoV-2 spike protein may be, but is not limited to, alpha-SARS-CoV-2, beta-SARS-CoV-2, gamma-SARS-CoV-2, delta-SARS-CoV-2, omicron-SARS-CoV-2, or a variant thereof.

[0031] In certain embodiments, the SARS-CoV-2 spike protein may include the amino acid sequence described in SEQ ID NO: 16 or SEQ ID NO: 17.

[0032] In other embodiments, the glycoprotein is a cellular protein such as alpha-fetoprotein, β-human chorionic gonadotropin, cancer antigens 15-3, 19-9, 27, 29, 125, and 549, carcinoembryonic antigen, carcinoembryonic antigen-associated cell adhesion molecule, human epidermal growth factor receptor 2, carcinoembryonic fibronectin, placental alkaline phosphatase, and prostate-specific antigen.

[0033] In one embodiment of this disclosure, two further methods for producing glycoproteins are provided. In some embodiments, these methods are performed in vitro.

[0034] A second typical method includes the steps of the first method, except that the second method further includes the step of producing MGAT1 activity-deficient modified cells.

[0035] A third typical method is a specific variation of the first method, which specifically utilizes MGAT1-deficient cells containing nucleic acids having the sequence described in Sequence ID No. 6 within their genome.

[0036] The following specific examples should be construed as illustrative only and not in any way as an limitation to the remainder of this disclosure. Without further detail, it is expected that those skilled in the art will be able to make the most of this disclosure based on the description herein. All publications referenced herein are incorporated herein by reference in their entirety. [Examples]

[0037] [Example 1] MGAT1 gene editing in CHO cells Typical adherent CHO K1 cells were cultured at 37°C and 5% CO2 in Ham F12 (Sigma) supplemented with 2 mM GLUTAMAX (GIBCO) and 10% fetal bovine serum ("FBS"). In suspension culture, typical CHO K1 cells were also grown at 37°C and 5% CO2 in BalanCD CHO Growth A Medium (FUJIFILM Irvine Scientific) supplemented with 8 mM GLUTAMAX (FUJIFILM Irvine Scientific) and 0.5% Anti-Clumping Supplement (FUJIFILM Irvine Scientific).

[0038] [Example 2] Gene editing Gene editing of the MGAT1 gene in CHO K1 cells was performed using standard techniques. Briefly, ribonucleoprotein particles ("RNPs") were prepared in vitro by mixing recombinant Cas9, universal tracrRNA (SEQ ID NO: 11), and crRNA containing sequences described in SEQ ID NOs: 2, 3, 4, or 5. The mixture was incubated at 37°C for 10 minutes to form RNPs.

[0039] RNP (5 μL) containing 3.3 μM Cas9, 6.6 μM tracrRNA, and one of four crRNAs at 6.6 μM was added to 10 μL of CHO K1 cells in 1.0 × 10⁶ R buffer using the Neon system (Thermo Fisher) according to the instructions. 5 Individual cells were electroporated. After electroporation, cells were seeded into 24-well plates (2 mL per well) and cultured at 37°C and 5% CO2 for 3 days.

[0040] [Example 3] Detection of gene-edited clones by T7EI assay To examine the results of gene editing as described in Example 2, electroporated cells were prepared in a quantity of 1.0 × 10⁶ cells. 5 The cells were grown until they reached a certain number, then harvested and dissolved in 100 μL of lysis buffer (10 mM Tris-HCl pH 8.0, 0.05% SDS, 250 μg / mL proteinase K) at 37°C for 15 minutes, followed by thermal inactivation at 85°C for 15 minutes.

[0041] The region of interest of the MGAT1 gene was amplified from a cell lysate sample by polymerase chain reaction ("PCR") using the forward primer ACCCGTGAGGTGTTCCGCCT (SEQ ID NO: 7) and the reverse primer AGACACGGGCAAGGAAATCCC (SEQ ID NO: 8) to obtain a 943 bp product.

[0042] A T7 nuclease E1 digestion assay was performed on PCR products according to the manufacturer's protocol (NEW England Biolabs: "NEB"). T7E1-treated samples were analyzed by agarose gel electrophoresis to identify cells containing insertions / deletions ("indels") within the region of interest of the MGAT1 gene.

[0043] Indel-positive cell clones were further analyzed by sequencing the 943 bp product after column purification using the forward primer ACCCCCTCACCAGCCGTGAT (SEQ ID NO: 9) and the reverse primer TCTGGACGAATACAGGCCCGC (SEQ ID NO: 10).

[0044] Clonal cell lines were obtained by seeding cells in a series of serial dilutions.

[0045] [Example 4] MGAT1 - Screening of CHO K1 clonal cell lines Loss of MGAT1 activity in the CHO K1 clone cell line was evaluated by expressing SARS-CoV-2 spike glycoprotein in cells. The expressed spike protein was then incubated with EndoH to detect incompletely glycosylated, highly mannose-modified spike proteins. The glycoprotein was expressed in the CHO K1 clone cell line using the lentiviral expression system outlined below.

[0046] lentivirus production 293T cells (ATCC registration number CRL-3216) 1.7 × 10⁻⁶7 The cells were added to a 15 cm plate. After 24 hours of incubation, the cells were transfected with a total of 30 μg of four plasmid vectors: 10 μg of plasmid expressing viral GAG, POL, and ENV genes and containing a REV response element; 2.5 μg of plasmid expressing REV; 2.5 μg of plasmid expressing VSV-G protein; and 15 μg of plasmid containing a histidine-tagged S protein coding sequence (the wild-type S protein sequence is described in SEQ ID NO: 16) and a lentiviral backbone. The plasmids were transfected into 293T cells using lipofectamine 3000 according to the supplier's instructions (Thermo Fisher). After 48 hours of incubation, the cell supernatant was collected, passed through a 0.45 μm filter, and concentrated 100-fold with Lenti-X lentiviral concentrate (Takara) according to the manufacturer's protocol.

[0047] Spike protein production 30 μL of concentrated lentivirus was used with candidate MGAT1 - CHO-K1 cloned cells 2×10 4 It was added to each cell. After performing one rotation of single-cell limiting dilution, the cells were divided into 1 × 10 cells. 5 The cells were further multiplied until they reached more than 10⁶. 5Individuals were seeded into the wells of a 24-well plate using 0.5 mL of culture medium and grown for 96 hours. Supernatants were collected from each well and purified using COVID-19 Spike Protein Affinity Regin (Repligen, SR-24156:NGL#22) according to the instruction manual. Briefly, the collected supernatant was loaded onto the column, and an additional 10 mL of Buffer A (20 mM Tris-HCl, 140 mM NaCl, pH 7.5) was loaded. The column was then washed with 8 CV of Buffer A followed by elution with 7 CV of Buffer B (100 mM acetate, 1 M arginine, pH 5.5), and then the column was stripped with 4 CV of Buffer C (200 mM acetic acid). Subsequently, the column was subjected to a 4 CV in-place cleaning (CIP) process with Buffer D (0.1 N NaOH). Next, the column was neutralized with 5 CV of Buffer A. After purification, the collected supernatant was concentrated to a final volume of 20 μL.

[0048] EndoH Digestion and Western Blot Each 10 μL of concentrated supernatant containing approximately 20 μg of protein was digested with 1 μg of EndoH or mock-digested at 37 °C for 2 hours according to the manufacturer's (NEB) instructions. MGAT1 - Cells produce high-mannose glycoproteins that can be digested by EndoH and exhibit fast mobility, i.e., a gel shift, in acrylamide gel electrophoresis.

[0049] After digestion, 16 μL of each sample was examined using Western blot analysis with the BOLT (trademark) system (Thermo Fisher) using an 8% Bis-Tris mini protein gel according to the manufacturer's instructions.

[0050] After electrophoretic transfer from the gel to the PVDF membrane, the S protein was detected using a mouse anti-SARS-CoV2 (clone 1035206; R&D Systems) primary antibody and a horseradish peroxidase-conjugated goat anti-mouse Fc (Invitrogen) secondary antibody, and then visualized using Clarity Max Western ECL Substrate (BioRad).

[0051] The results are shown in Figure 1. All three candidate CHO K1 clone cell lines showed a gel shift of the S protein to the lower molecular weight side after EndoH digestion, which supports the absence of MGAT1 activity in these cells.

[0052] A typical CHO K1 clone cell line was selected for further analysis. The MGAT1 gene in this cell line has two nucleotide deletions at positions 640 and 641 of SEQ ID NO: 1 within the MGAT1 coding sequence. These two-nucleotide deletions cause a frameshift in the MGAT1 coding sequence. The DNA sequence containing these deletion sites is shown in SEQ ID NO: 6.

[0053] [Example 5] Optimization of S protein expression The CHO K1 clonal cell line was configured for suspension culture using standard methods. Adherence cultures of the clonal cell line were grown in 24-well plates, while suspension cultures were grown in T125 flasks. Histidine-tagged S protein was expressed in both cell cultures using the method described above.

[0054] The cultured medium was collected (0.5 mL from a 24-well plate and 30 mL from a T125 flask), concentrated to 20 μL, and analyzed using Western blotting as described above. The results are shown in Figure 2A.

[0055] Complete glycosylation (S fg ), high mannose glycosylation (S hm ), and monoglycosylation (S mg Standard S protein samples from ) showed different mobilities, as expected. See Figure 2, first three lanes.

[0056] Both adherent (A) and suspension (S) cultures of the CHO K1 clonal cell line expressed significant amounts of S protein after lentiviral infection. See Figure 2A, last two lanes. The mobility of the S protein was consistent with the high mannose morphology, which indicates that the CHO K1 cell line expressed MGAT1- This confirmed that.

[0057] Histidine-tagged high-mannose S protein was purified from suspension culture medium by nickel chelation using standard techniques, subjected to the EndoH treatment described in Example 4 above, and analyzed by Western blotting. The results are shown in Figure 2B. The fact that the untreated S protein purified from the CHO K1 clonal cell line moved to the same position indicates that it is a high-mannose S protein, while the EndoH-treated purified S protein moved to the position corresponding to the monoglycosylated S protein.

[0058] Alternatively, the experiments described in Examples 4 and 5 were repeated to express a SARS-CoV-2 spike protein (delta strain) without a His tag. The expressed and purified S protein was divided into five parts and treated with chymotrypsin, chymotrypsin and trypsin, trypsin, α-lytic protease and trypsin, and α-lytic protease, respectively. The treated samples were then vacuum-dried for MS analysis. The results showed that the purity of the expressed spike protein sample was over 90%, indicating efficient protease digestion and a digestibility higher than 95%.

[0059] After protease digestion, the spike protein was cleaved into 17 peptide fragments containing a total of 21 N-glycosylation sites (no peptides containing the N17 glycosylation site were included). All 21 N-glycosylation sites were highly mannosylated (i.e., high mannose content), particularly mannose-5 (Man5). Since only a single GluNAc was observed after treatment, the high mannose content was further verified using Endo H treatment (Figures 3A-3U).

[0060] Other Embodiments Embodiment 1. A method for producing mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase (MGAT1) deficient modified cells, comprising the steps of: introducing an RNA-inducible endonuclease into parent cells together with a guide RNA (gRNA) containing the sequence described in GGAUGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4), or GAUCGCCAGGCACUACCGCU (SEQ ID NO: 5); culturing the parent cells and growing the parent cells; isolating a plurality of daughter cells from the cell culture; identifying MGAT1 deficient modified cells; and isolating the MGAT1 deficient modified cells.

[0061] Embodiment 2. The method of Example 1, wherein the step of identifying MGAT1 activity-deficient modified cells includes the steps of performing a bacteriophage T7 endonuclease I (T7EI) digestion assay on genomic DNA fragments amplified from multiple daughter cells, and sequencing the genomic DNA fragments of T7EI digestion assay-positive cells.

[0062] Embodiment 3. The method of Embodiment 1 or Embodiment 2, wherein the gRNA comprises clustered regularly spaced palindromic short repeat RNA (crRNA) and transactivating crRNA (tracrRNA), and the RNA-inducible endonuclease is Cas9.

[0063] Embodiment 4. Any one of Embodiments 1 to 3, wherein the method includes a step of introducing an RNA-inducible endonuclease into a cell together with a guide RNA by electroporation of a pre-formed complex of an RNA-inducible endonuclease and gRNA (gRNA).

[0064] Embodiment 5. Any one of Embodiments 1 to 4, wherein the parent cell is a CHO cell.

[0065] Embodiment 6. The method of Embodiment 5, wherein the gRNA contains the nucleic acid sequence described in Sequence ID No. 3.

[0066] Embodiment 7. A Chinese hamster ovarian cell line prepared according to any one of Embodiments 1 to 6.

[0067] Embodiment 8. The cell line of Embodiment 7, wherein the cell line is obtained from the CHO K1 cell line.

[0068] Embodiment 9. A method for producing a glycoprotein, comprising the steps of: obtaining mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase-deficient (MGAT1-deficient) cells produced according to any one of Embodiments 1 to 8; expressing a protein having an N-glycosylation site in the MGAT1-deficient cells, thereby N-glycosylating the protein with oligomannose glycan at the N-glycosylation site; and isolating the N-glycosylated protein from the cells.

[0069] Embodiment 10. The method of Embodiment 9, further comprising the step of incubating a glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetylbeta-glucosaminohydrolase (Endo-H) to remove oligomannose glycan, thereby leaving an N-acetylglucosamine residue at the N-glycosylation site.

[0070] Embodiment 11. The method of Embodiment 9 or Embodiment 10, wherein the protein is a viral envelope protein.

[0071] Embodiment 12. The method of Embodiment 11, wherein the protein is a viral envelope protein selected from the group consisting of SARS-CoV-2 spike protein, pan-salvecovirus spike protein, pan-beta-coronavirus spike protein, and influenza hemagglutinin.

[0072] Embodiment 13. The method of Embodiment 12, wherein the SARS-CoV2 spike protein is alpha-SARS-CoV2 spike protein, beta-SARS-CoV2 spike protein, gamma-SARS-CoV2 spike protein, delta-SARS-CoV2 spike protein, or omicron-SARS-CoV2 spike protein.

[0073] Embodiment 14. The method of Embodiment 13, wherein the SARS-CoV-2 spike protein comprises the amino acid sequence described in SEQ ID NO: 16 or SEQ ID NO: 17.

[0074] Embodiment 15. The method of Embodiment 9 or Embodiment 10, wherein the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, cancer antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, carcinoembryonic antigen-associated cell adhesion molecule, human epidermal growth factor receptor 2, carcinoembryonic fibronectin, placental alkaline phosphatase and prostate-specific antigen.

[0075] Embodiment 16. A method for producing a glycoprotein, comprising the steps of: producing mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase-deficient (MGAT1-deficient) cells according to any one of Embodiments 1 to 15; expressing a protein having an N-glycosylation site in the MGAT1-deficient cells, thereby causing the protein to be N-glycosylated with oligomannose glycan at the N-glycosylation site; and isolating the N-glycosylated protein from the cells.

[0076] Embodiment 17. A mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase activity-deficient Chinese hamster ovary cell line comprising nucleic acids having the sequence described in Sequence ID No. 6 in its genome.

[0077] Embodiment 18. The cell line of Embodiment 17, wherein the cell line is obtained from the CHO K1 cell line.

[0078] Embodiment 19. A method for producing a glycoprotein, comprising the steps of: obtaining a mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase-deficient Chinese hamster ovary cell line of Embodiment 17 or Embodiment 18; expressing a protein having an N-glycosylation site in the cell line, thereby N-glycosylating the protein with oligomannose glycan at the N-glycosylation site; and isolating the N-glycosylated protein from the cell line.

[0079] Embodiment 20. The method of Embodiment 19, further comprising the step of incubating a glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetylbeta-glucosaminohydrolase (Endo-H) to remove oligomannose glycan, thereby leaving an N-acetylglucosamine residue at the N-glycosylation site.

[0080] Embodiment 21. The method of Embodiment 19 or Embodiment 20, wherein the protein is a viral envelope protein.

[0081] Embodiment 22. The method of Embodiment 21, wherein the protein is a viral envelope protein selected from the group consisting of SARS-CoV-2 spike protein, pan-salvecovirus spike protein, pan-beta-coronavirus spike protein, and influenza hemagglutinin.

[0082] Embodiment 23. The method of Embodiment 22, wherein the SARS-CoV2 spike protein is alpha-SARS-CoV2 spike protein, beta-SARS-CoV2 spike protein, gamma-SARS-CoV2 spike protein, delta-SARS-CoV2 spike protein, or omicron-SARS-CoV2 spike protein.

[0083] Embodiment 24. The method of Embodiment 23, wherein the SARS-CoV-2 spike protein comprises the amino acid sequence described in SEQ ID NO: 16 or SEQ ID NO: 17.

[0084] Embodiment 25. The method of Embodiment 19 or Embodiment 20, wherein the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, cancer antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, carcinoembryonic antigen-associated cell adhesion molecule, human epidermal growth factor receptor 2, carcinoembryonic fibronectin, placental alkaline phosphatase and prostate-specific antigen.

[0085] All features disclosed herein can be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature that serves the same, equivalent, or similar purpose. Thus, unless expressly otherwise specified, each feature disclosed is merely an example of a general series of equivalent or similar features.

[0086] From the above description, those skilled in the art will readily recognize the essential features of this disclosure and will be able to make various modifications and improvements to the invention without departing from its spirit and scope to suit various uses and conditions. Accordingly, other embodiments are also within the scope of these claims.

[0087] Sequence List

[0088] [Table 1] TIFF2026517008000003.tif216169TIFF2026517008000004.tif50169

Claims

1. A method for producing glycoprotein in vitro, A step to obtain mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase-deficient (MGAT1-deficient) cells, wherein the MGAT1-deficient cells contain sequence number 6 in their genome, and RNA-induced endonucleases are introduced into the parent cell. GGAUGCGCAGACCUGAGCAG (Sequence ID 2), GGUAGUGGAGGAACGAUCUGG (Sequence No. 3), UUUCUCCACCUGUGAGGG (Sequence ID 4), or GAUCGCCAGGCAACUACCGCU (Sequence ID 5) A step of introducing the sequence together with a guide RNA (gRNA) containing the sequence described above; The process of culturing parent cells and increasing their numbers; The process of isolating multiple daughter cells from a cell culture; A step to identify MGAT1 activity-deficient modified cells; and A step of obtaining MGAT1-deficient cells by a method comprising the step of isolating the MGAT1 activity-deficient modified cells; A step of expressing a protein having an N-glycosylation site in the MGAT1-deficient cells, thereby N-glycosylating the protein with oligomannose glycan at the N-glycosylation site; and The process of isolating N-glycosylated proteins from the MGAT1-deficient cells. A method that includes this.

2. The method according to claim 1, further comprising the step of incubating the N-glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetylbeta-glucosaminohydrolase (Endo-H) to remove oligomannose glycan, thereby leaving an N-acetylglucosamine residue at the N-glycosylated site.

3. The method according to claim 1, wherein the protein is a viral envelope protein.

4. The method according to claim 3, wherein the viral envelope protein is selected from the group consisting of SARS-CoV2 spike protein, pan-Salvecovirus spike protein, pan-Betacoronavirus spike protein, and influenza hemagglutinin.

5. The method according to claim 4, wherein the SARS-CoV2 spike protein is alpha-SARS-CoV2 spike protein, beta-SARS-CoV2 spike protein, gamma-SARS-CoV2 spike protein, delta-SARS-CoV2 spike protein, or omicron-SARS-CoV2 spike protein.

6. The method according to claim 5, wherein the SARS-CoV2 spike protein comprises SEQ ID NO: 16 or SEQ ID NO:

17.

7. The method according to claim 1, wherein the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, cancer antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, carcinoembryonic antigen-associated cell adhesion molecule, human epidermal growth factor receptor 2, carcinoembryonic fibronectin, placental alkaline phosphatase and prostate-specific antigen.

8. A method for producing glycoprotein in vitro, A step to obtain a mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosaminetransferase-deficient Chinese hamster ovary cell line, wherein the cell line contains Sequence ID No. 6 in its genome; A step of expressing a protein having an N-glycosylation site in the cell line, thereby N-glycosylating the protein with oligomannose glycan at the N-glycosylation site; and The process of isolating N-glycosylated proteins from the cell line. Methods that include...

9. The method according to claim 8, further comprising the step of incubating the N-glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine 1,4-N-acetylbeta-glucosaminohydrolase (Endo-H) to remove oligomannose glycan, thereby leaving an N-acetylglucosamine residue at the N-glycosylated site.

10. The method according to claim 8, wherein the protein is a viral envelope protein.

11. The method according to claim 10, wherein the viral envelope protein is selected from the group consisting of SARS-CoV2 spike protein, pan-Salvecovirus spike protein, pan-betacoronavirus spike protein, and influenza hemagglutinin.

12. The method according to claim 11, wherein the SARS-CoV2 spike protein is alpha-SARS-CoV2 spike protein, beta-SARS-CoV2 spike protein, gamma-SARS-CoV2 spike protein, delta-SARS-CoV2 spike protein, or omicron-SARS-CoV2 spike protein.

13. The method according to claim 12, wherein the SARS-CoV2 spike protein comprises SEQ ID NO: 16 or SEQ ID NO:

17.

14. The method according to claim 8, wherein the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, cancer antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, carcinoembryonic antigen-associated cell adhesion molecule, human epidermal growth factor receptor 2, carcinoembryonic fibronectin, placental alkaline phosphatase and prostate-specific antigen.

Images