Combinations for increasing bone growth and / or bone strength
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- SOCIETE DES PRODUITS NESTLE SA
- Filing Date
- 2024-05-24
- Publication Date
- 2026-05-29
Smart Images

Figure 2026517433000004 
Figure 2026517433000005 
Figure 2026517433000006
Abstract
Description
[Technical Field]
[0001] The present invention relates to compositions and methods for enhancing bone growth and / or bone strength in young children who have and / or are suffering from growth retardation and / or developmental delay. [Background technology]
[0002] Human skeletal growth and development require the adequate supply of many different nutritional factors. Classical nutritional deficiencies are associated with stunted growth (e.g., energy, protein, zinc), rickets (e.g., vitamin D), and other bone abnormalities (e.g., copper, zinc, vitamin C). There is evidence suggesting that maximum bone mass and subsequent fracture risk are influenced by patterns of growth and nutritional exposure during childhood. However, defining dietary reference values using bone health as a criterion is difficult, and the question of which type of diet constitutes the best support for optimal bone growth and development remains unresolved (see, for example, Prentice, A., et al., 2006. Proceedings of the Nutrition Society, 65(4), pp.348-360).
[0003] To improve the intake of growth-limiting nutrients, several approaches can be taken, including administering micronutrient supplements, fortifying foods with micronutrients, or improving dietary intake. However, in populations with poor dietary quality, deficiencies in multiple micronutrients may occur simultaneously, in which case growth may be affected by two or more growth-limiting nutrients (see, for example, Rivera, JA, et al., 2003. The Journal of Nutrition, 133(11), pp. 4010S-4020S).
[0004] Therefore, new nutritional interventions are needed to enhance bone growth and / or bone strength, for example, in young children suffering from stunted growth and / or developmental delay. [Overview of the project]
[0005] The inventors have surprisingly discovered that a combination of vitamin K2 (which can be produced, for example, from vitamin K1 in the gastrointestinal tract, as discussed below), vitamin A, and vitamin D synergistically promotes osteoblast calcification. Furthermore, the inventors have surprisingly discovered that a combination of vitamin K2, vitamin A, and vitamin D with short-chain fatty acids (SCFAs) synergistically promotes osteoblast differentiation. SCFAs can be produced, for example, by the fermentation of oligosaccharides in the intestines.
[0006] As an alternative to direct administration of vitamin K2, the inventors have surprisingly shown that vitamin K2 production in the gastrointestinal tract (e.g., via the conversion of vitamin K1) can be promoted by an oligosaccharide mixture containing bovine milk oligosaccharide (BMO). The inventors have also surprisingly shown that vitamin K2 production in the gastrointestinal tract (e.g., via the conversion of vitamin K1) can be further promoted by the administration of probiotics (e.g., Lactobacillus rhamnosus).
[0007] In one embodiment, the present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin K1, vitamin A, and vitamin D.
[0008] In another aspect, the present invention provides the use of a combination of a vitamin mixture and an oligosaccharide mixture in the manufacture of a medical food for enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture contains or comprises vitamin K1, vitamin A, and vitamin D.
[0009] In another embodiment, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture comprises or consists of vitamin K1, vitamin A, and vitamin D.
[0010] The subjects may be any appropriate subjects. In particular, the subjects may be young children or young adults. The subjects may be young human children or infants. For example, the subjects may be humans aged about 1 year or older. In some embodiments, the subjects are humans aged about 1 to about 3 years. Alternatively, the subjects may be young animals, for example, young pets. The subjects may have had and / or may have suffered from stunted growth and / or delayed growth. The subjects may have been premature, had a low birth weight, and / or experienced intrauterine growth restriction.
[0011] The oligosaccharide mixture may be any suitable mixture of oligosaccharides. In a preferred embodiment, the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
[0012] The oligosaccharide mixture may further contain one or more human milk oligosaccharides (HMOs). Preferably, the one or more HMOs include or consist of at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide. Preferably, the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof. In some embodiments, the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof. In some embodiments, the at least one sialyl oligosaccharide is 6'-sialyl lactose (6'-SL). Preferably, at least one fucosyl oligosaccharide is selected from the group consisting of 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difucosylhexaose-I (LNDFH-1), lacto-N-neodifucosylhexaose (LNnDFH), monofucosyl lacto-n-hexaose-III (MFNLH-III), difucosyl lacto-N-hexaose-a (DFLNHa), and combinations thereof. In some embodiments, at least one fucosyl oligosaccharide is difucosyl lactose (diFL). Preferably, at least one N-acetyl oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, at least one N-acetyl oligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.In some embodiments, the at least one N-acetyloligosaccharide is lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT). Preferably, the oligosaccharide mixture contains (a) at least one sialyl oligosaccharide in about 0.5% to about 2% by weight relative to the total weight of the oligosaccharide mixture; (b) at least one fucosyl oligosaccharide in about 2% to about 6% by weight relative to the total weight of the oligosaccharide mixture; and / or (c) at least one N-acetyl oligosaccharide in about 1% to about 4% by weight relative to the total weight of the oligosaccharide mixture.
[0013] The combination may further include one or more probiotics. In a preferred embodiment, the one or more probiotics include or consist of Lactobacillus rhamnosus. In some embodiments, the one or more probiotics include Bifidobacterium longum.
[0014] The combination can be administered by any suitable route. Preferably, the combination is administered orally. The combination can be administered separately, simultaneously, or sequentially. In some embodiments, the combination is administered simultaneously.
[0015] The combination can be administered to the subject in any appropriate amount. Preferably, vitamin K1 is administered to the subject in an amount of about 5 μg / day to about 200 μg / day. Preferably, vitamin A is administered to the subject in an amount of about 100 μgRE / day to about 1000 μgRE / day. Preferably, vitamin D is administered to the subject in an amount of about 2.5 μg / day to about 100 μg / day or about 5 μg / day to about 100 μg / day. Preferably, the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day. Preferably, BMO is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day. Preferably, L. rhamnosus is administered in a total amount of about 10 6 cfu / day ~ approximately 10 12 The total dose of cfu / day is administered to the target individual.
[0016] The combination may be provided in any suitable form, for example, in the form of a composition. The combination may be provided in the form of a nutritional composition. This combination may be provided in the form of a medical food for clinical nutrition. The combination may be provided in the form of growing-up milk.
[0017] The composition may contain any appropriate combination of vitamins. Preferably, the composition contains vitamin K1 in an amount of about 5 μg / 100g to about 200 μg / 100g on a dry weight basis. Preferably, the composition contains vitamin A in an amount of about 100 μgRE / 100g to about 1000 μgRE / 100g on a dry weight basis. Preferably, the composition contains vitamin D in an amount of about 2.5 μg / 100g to about 20 μg / 100g or about 5 μg / 100g to about 20 μg / 100g on a dry weight basis. Preferably, the composition contains an oligosaccharide mixture in a total amount of about 0.5% to about 5% on a dry weight basis. Preferably, the composition contains BMO in a total amount of about 0.5% to about 5% on a dry weight basis. Preferably, the composition contains about 10 6 cfu / 100g ~ approx. 10 12 Contains L. rhamnosus at a cfu / 100g level.
[0018] This combination may synergistically enhance bone growth and / or bone strength. This combination may enhance bone mineralization. This combination may promote osteoblast mineralization and / or osteoblast differentiation. This combination may increase vitamin K2 production. This combination may promote catch-up growth. Preferably, catch-up growth is measured using height velocity.
[0019] The inventors also surprisingly found that vitamin K2 production in the gastrointestinal tract (e.g., through the conversion of vitamin K1) is promoted by an oligosaccharide mixture containing bovine milk oligosaccharide (BMO).
[0020] In another aspect, the present invention provides the use of an oligosaccharide mixture to promote vitamin K2 production in the target intestine. The oligosaccharide mixture may be any of those described herein. The oligosaccharide mixture may be administered in combination with one or more probiotics.
[0021] In another embodiment, the present invention provides a method for promoting vitamin K2 production in the intestines of a subject, comprising administering an effective amount of an oligosaccharide mixture to the subject. The oligosaccharide mixture may be any of those described herein. The oligosaccharide mixture may be administered in combination with one or more probiotics. [Brief explanation of the drawing]
[0022] [Figure 1] Effects of vitamin K2, vitamin A, and vitamin D on osteoblast alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in preosteoblast cell lines. (A) ALP activity 7 days after differentiation (no ascorbic acid added). (B) Osteocalcin mRNA levels 21 days after differentiation (no ascorbic acid added). (C) Osteocalcin mRNA levels 28 days after differentiation (ascorbic acid added). Pos = positive control; Neg = negative control; MK-7 = 3 μM menaquinone-7 added; VitD = 1 nM 1α,25-dihydroxyvitamin D3 added; VitA = 100 nM all-trans retinoic acid added. [Figure 2]Effects of vitamin K2, vitamin A, vitamin D, and short-chain fatty acids (SCFAs) on osteoblast ALP activity in pre-osteoblast cell lines. ALP activity after 7 days of differentiation (without ascorbic acid). Pos = positive control; Neg = negative control; MK-7 + A + D = 3 μM menaquinone-7, 1 nM 1α,25-dihydroxyvitamin D3, and 100 nM all-trans retinoic acid added; SCFA 20 μM = 15 μM sodium acetate, 4 μM sodium propionate, and 1 μM sodium butyrate added; SCFA 50 μM = 37.5 μM sodium acetate, 10 μM sodium propionate, and 2.5 μM sodium butyrate added; SCFA 60 μM = 45 μM sodium acetate, 12 μM sodium propionate, and 3 μM sodium butyrate added. [Figure 3] Effects of human milk oligosaccharides (HMOs) on vitamin K2 production in an intestinal model: (A) The following groups were evaluated (in the absence of a milk matrix): blank and HMO + BMO (total 7.2 g / L). (B) The following groups were evaluated (in the milk matrix): LPR added (L. rhamnosus LPR not added); and LPR added (4.5 × 10⁷ cfu / mL L. rhamnosus LPR). [Figure 4] Design of preclinical experiments: Growth retardation group (vitamin K1 administration): The number of pups per BALB / c mother mouse was increased by 50% from D8 to D18 to induce dietary restriction. Weaning was performed on D18 in both groups (normal group and growth retardation group). Subsequently, male and female mice were given free access to food for 30 days, with nutritional supplementation once a day via pipette feeding. [Figure 5]Figures 5A and 5B show the effects of vitamin K1AD+ / - synbiotics [BMOS+L. rhamnosus (LPR)] on trabecular BV / TV and connection density (Conn.D) as evaluated by microcomputed tomography of the femur. Microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) was used to evaluate the trabecular microstructure at the distal metaphysis of the femur, as previously reported (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, the cancellous bone region was evaluated using isotropic 6 μm voxels. To exclude primary trabecular bone, 30 slices of bone beneath the distal growth plate were excluded from the analysis. 80 slices of the secondary trabecular bone directly beneath were analyzed. Morphometric variables were calculated from binarized images using direct three-dimensional techniques independent of prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). BV / TV fraction (%) and connectivity density (Conn. D) were evaluated. [Modes for carrying out the invention]
[0023] Herein, various preferred features and embodiments of the present invention are described by non-limiting examples. Those skilled in the art will understand that all features of the present invention disclosed herein can be combined without departing from the scope of the disclosed invention.
[0024] No reference to prior art documents in this specification should be considered an acknowledgment that such prior art is well known or that it forms part of a common general understanding in the art. All publications referenced herein are incorporated herein by reference.
[0025] As used herein, the words “comprises,” “comprising,” and similar words should not be interpreted as exclusive or exhaustive. In other words, they mean “including, but not limited to.” The terms “comprises,” “comprising,” etc., also include the term “consisting of.”
[0026] Unless otherwise specified, the implementation of the present invention will employ prior art that is within the capabilities of those skilled in the art. Such art is described in the literature. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as they are commonly understood by those skilled in the art.
[0027] Numerical ranges include the numerical values that define the range, and all percentages disclosed herein are weight / weight unless otherwise specified. As used herein, the term “about” means approximately, nearly, roughly, or near. When the term “about” is used with a number or range, the value or range is modified by expanding the upper and lower boundaries of the stated number(s). Generally, the terms “about” and “near” are used herein to adjust a number to be more than or less than 10% of the stated value.
[0028] combination In one embodiment, the present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength in a subject.
[0029] The combinations of the present invention may also be referred to as combination therapy. As used herein, “combination therapy” may refer to a therapy comprising the administration of two or more agents, mixtures (e.g., vitamin mixtures, oligosaccharide mixtures, and / or probiotic mixtures), or compositions.
[0030] The combination may be administered in any suitable form by any suitable route. Preferably, the combination is administered orally and / or enterally. In a preferred embodiment, the combination is administered orally. The combination may be administered separately, simultaneously, or sequentially. In a preferred embodiment, the combination is administered simultaneously.
[0031] Vitamin mixture The combination of the present invention includes a vitamin mixture. As used herein, "vitamin mixture" may refer to a mixture of two or more vitamins. Vitamins are organic micronutrients necessary for the body to perform a range of normal functions, and examples of vitamins include vitamin K1, vitamin A, vitamin D, vitamin C, folate, vitamin B3, vitamin B6, vitamin B12, and vitamin E.
[0032] The vitamin mixture used in the present invention comprises or consists of vitamin K1, vitamin A, and vitamin D. Surprisingly, the inventors have found that a combination of vitamin K2 (which can be produced from vitamin K1 in the gastrointestinal tract, for example, as discussed below), vitamin A, and vitamin D synergistically promotes osteoblast calcification.
[0033] Vitamin K Vitamin K represents a family of lipid-soluble compounds that share the common chemical structure of 3-substituted 2-methyl-1,4-naphthoquinone. This family is naturally present in food as phylloquinone (vitamin K1) and menaquinone (vitamin K2).
[0034] Vitamin K1 (phylloquinone) may have the following general formula:
[0035] [ka]
[0036] Vitamin K1 has a phytyl side chain and is typically the major form of dietary vitamin K, found in dark green leafy vegetables (e.g., spinach, lettuce, and other salad plants) and Brassica species.
[0037] Vitamin K2 (menaquinone) may have the following general formula:
[0038] [ka]
[0039] Vitamin K2 is composed of various forms with different numbers (n) of isoprenyl units, where n can range from 4 to 13. Each form is indicated by a suffix (-n), for example, menaquinone-4 (abbreviated as MK-4) has four isoprene residues (n=4). MK-4 can be formed through the metabolic transformation of phylloquinone during the absorption process of phylloquinone in the intestinal mucosa and other organs. Other menaquinones can be produced in the digestive tract by certain anaerobic bacteria of the colon microbiota.
[0040] The inventors also surprisingly found that vitamin K2 production in the gastrointestinal tract (e.g., through the conversion of vitamin K1) is promoted by an oligosaccharide mixture containing bovine milk oligosaccharide (BMO).
[0041] In one embodiment, the present invention provides the use of an oligosaccharide mixture to promote vitamin K2 production in the intestines of a subject.
[0042] In one embodiment, the present invention provides a method for promoting vitamin K2 production in the intestines of a subject, comprising administering an effective amount of an oligosaccharide mixture to the subject.
[0043] The oligosaccharide mixture may be any of those described herein. In some embodiments, the oligosaccharide mixture includes or consists of bovine milk oligosaccharides (BMOs). In some embodiments, the oligosaccharide mixture further includes one or more human milk oligosaccharides (HMOs). The oligosaccharide mixture may be administered in combination with one or more probiotics, for example, any of those described herein. In some embodiments, one or more probiotics include or consist of Lactobacillus rhamnosus.
[0044] In some embodiments, the oligosaccharide mixture promotes the de novo production of menaquinone-7 in the target intestine (e.g., by the gut microbiota). In some embodiments, the oligosaccharide mixture promotes the bioconversion of phylloquinone to menaquinone-4 in the target intestine (e.g., by the gut microbiota).
[0045] Vitamin A Vitamin A comprises a family of molecules containing 20 carbon atoms, comprising a methyl-substituted cyclohexenyl ring (beta-ionone ring) and a tetraene side chain having a hydroxyl group (retinol), an aldehyde group (retinal), a carboxylic acid group (retinoic acid), or an ester group (retinyl ester) at the 15th carbon atom. The term vitamin A may also include provitamin A carotenoids, which are food-derived precursors of retinol. Of the many carotenoids found in nature, several, including α-carotene, β-carotene, and β-cryptoxanthin, possess provitamin A nutritional activity.
[0046] The amount of vitamin A may be referred to in terms of retinol equivalents (RE) or retinol activity equivalents (RAE). For the food-derived provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the REs are set at 6 μg, 12 μg, and 12 μg, respectively. Using μgRAE, the vitamin A activity of provitamin A carotenoids is estimated to be half the vitamin A activity when μgRE is used. For the food-derived provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the RAEs are set at 12 μg, 24 μg, and 24 μg, respectively. (For example, see Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc. Washington (DC): National Academies Press (US); April 2001, Vitamin A.)
[0047] Vitamin D Vitamin D is a group of lipid-soluble secosteroids, including vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Calcitriol (also known as 1,25-dihydroxyvitamin D) is the active form of vitamin D. Preferably, vitamin D includes or consists of vitamin D2 and vitamin D3. Preferably, vitamin D includes or consists of calcitriol.
[0048] Administration of vitamin K1, vitamin A, and vitamin D Subjects may be administered any appropriate amount of vitamin K1, vitamin A, and vitamin D in any appropriate form and via any appropriate route of administration (e.g., in any form and via any route described herein).
[0049] The appropriate dosage of vitamin K1 is described, for example, in Koziol-Kozakowska, A. and Maresz, K., 2022. Children, 9(1), p.78 and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2017. EFSA Journal, 15(5), p.e04780. The appropriate dosage of vitamin A is described, for example, in Ross, AC and Moran, NE, 2020. Current Developments in Nutrition, 4(10), p.nzaa096 and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2015. EFSA Journal, 13(3), p.4028. The appropriate dosage of vitamin D is described, for example, in Greer, FR, 2004. The American Journal of Clinical Nutrition, 80(6), pp. 1759S-1762S and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2016. EFSA Journal, 14(10), p. e04547.
[0050] Preferably, vitamin K1 is administered to the subject at a dose of at least about 0.2 μg / kg / day, at least about 0.5 μg / kg / day, or at least about 0.8 μg / kg / day. Preferably, vitamin K1 is administered to the subject at a dose of about 2 μg / kg / day or less, about 1.5 μg / kg / day or less, or about 1.2 μg / kg / day or less. Preferably, vitamin K1 is administered to the subject at a dose of about 0.2 μg / kg / day to about 2 μg / kg / day, about 0.5 μg / kg / day to about 1.5 μg / kg / day, or about 0.8 μg / kg / day to about 1.2 μg / kg / day. In some embodiments, vitamin K1 is administered to the subject at a dose of about 1 μg / kg / day.
[0051] Preferably, vitamin K1 is administered to the subject in amounts of at least about 5 μg / day, at least about 10 μg / day, at least about 15 μg / day, at least about 20 μg / day, at least about 25 μg / day, or at least about 30 μg / day. Preferably, vitamin K1 is administered to the subject in amounts of about 200 μg / day or less, about 100 μg / day or less, about 90 μg / day or less, about 80 μg / day or less, about 70 μg / day or less, or about 60 μg / day or less. Preferably, vitamin K1 is administered to the subject in amounts of approximately 5 μg / day to approximately 200 μg / day, approximately 10 μg / day to approximately 100 μg / day, approximately 15 μg / day to approximately 90 μg / day, approximately 20 μg / day to approximately 80 μg / day, approximately 25 μg / day to approximately 70 μg / day, or approximately 30 μg / day to approximately 60 μg / day.
[0052] Preferably, vitamin A is administered to the subject in amounts of at least about 100 μgRE / day, at least about 200 μgRE / day, or at least about 300 μgRE / day. Preferably, vitamin A is administered to the subject in amounts of about 1000 μgRE / day or less, about 800 μgRE / day or less, about 600 μgRE / day or less, or about 400 μgRE / day or less. Preferably, vitamin A is administered to the subject in amounts of about 100 μgRE / day to about 1000 μgRE / day, about 200 μgRE / day to about 800 μgRE / day, about 300 μgRE / day to about 600 μgRE / day, or about 300 μgRE / day to about 400 μgRE / day.
[0053] Preferably, vitamin A is administered to the subject in amounts of at least about 100 μgRE / day, at least about 200 μgRAE / day, or at least about 300 μgRAE / day. Preferably, vitamin A is administered to the subject in amounts of about 1000 μgRAE / day or less, about 800 μgRAE / day or less, about 600 μgRAE / day or less, or about 400 μgRAE / day or less. Preferably, vitamin A is administered to the subject in amounts of about 100 μgRAE / day to about 1000 μgRAE / day, about 200 μgRAE / day to about 800 μgRAE / day, about 300 μgRAE / day to about 600 μgRAE / day, or about 300 μgRAE / day to about 400 μgRAE / day.
[0054] Preferably, vitamin D is administered to the subject in amounts of at least about 2.5 μg / day, at least about 5 μg / day, at least about 10 μg / day, or at least about 15 μg / day. Preferably, vitamin D is administered to the subject in amounts of about 100 μg / day or less, about 75 μg / day or less, or about 50 μg / day or less. Preferably, vitamin D is administered to the subject in amounts of about 2.5 μg / day to about 100 μg / day, about 5 μg / day to about 100 μg / day, about 10 μg / day to about 75 μg / day, or about 15 μg / day to about 50 μg / day. Preferably, vitamin D is administered to the subject in amounts of about 15 μg / day.
[0055] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A is administered at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, and vitamin D is administered at a dose of approximately 2.5 μg / day to approximately 100 μg / day.
[0056] Oligosaccharide mixture The combination of the present invention includes an oligosaccharide mixture. As used herein, “oligosaccharide mixture” may refer to a mixture of two or more oligosaccharides. Oligosaccharides are sugar polymers containing a small number (typically 2 to 10) monosaccharides and are one of the most well-known prebiotics. Short-chain fatty acids (SCFAs), such as acetates, butyrates, and propionates, can be produced by the fermentation of oligosaccharide mixtures in the intestines.
[0057] Oligosaccharide mixtures can increase vitamin K2 production. Surprisingly, the inventors have found that oligosaccharide mixtures can promote the endogenous production of vitamin K2.
[0058] Bovine milk oligosaccharides (BMOs) The oligosaccharide mixture used in the present invention may contain or consist of bovine milk oligosaccharides (BMOs). Oligosaccharides in bovine milk are formed in the mammary glands by the combination of monosaccharides glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine, fucose, and sialic acids N-acetylneuraminic acid and N-glycolylneuraminic acid. The composition (collection) of BMOs found in milk and colostrum has been analyzed in detail, and comprehensive studies typically identify 30 to 50 different structures (see, for example, Robinson, RC, 2019 Frontiers in nutrition, 6, p. 50).
[0059] Although bovine milk typically contains fewer oligosaccharide structures than human milk, the two share at least 10 common structures, including 3'-sialyl lactose and 6'-sialyl lactose, which constitute the majority of the BMO pool (see, for example, Robinson, RC, 2019. Frontiers in nutrition, 6, p. 50).
[0060] Human milk oligosaccharides (HMOs) The oligosaccharide mixture used in the present invention may further contain or consist of one or more human milk oligosaccharides (HMOs). Many different types of HMOs are found in human milk and are typically based on combinations of glucose, galactose, sialic acid (N-acetylneuraminic acid), fucose and / or N-acetylglucosamine, and many different bonds between them. Almost all HMOs have a lactose moiety at the reducing end, and the non-reducing end portion is occupied by sialic acid and / or fucose (if present). HMOs can be acidic (e.g., charged sialic acid-containing oligosaccharides) or neutral (e.g., fucosyl oligosaccharides).
[0061] Preferably, one or more HMOs may comprise at least one fucosyl oligosaccharide, at least one sialyl oligosaccharide, and / or at least one N-acetyl oligosaccharide. In some embodiments, one or more HMOs comprise or consist of at least one fucosyl oligosaccharide, at least one sialyl oligosaccharide, and at least one N-acetyl oligosaccharide. In some embodiments, one or more HMOs comprise or consist of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), 6'-sialyl lactose (6'-SL), lacto-N-tetraose (LNT), and lacto-N-neotetraose (LNnT). In some embodiments, one or more HMOs include or consist of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), 6'-sialyl lactose (6'-SL), 3'-sialyl lactose (3'-SL), lacto-N-tetraose (LNT), and lacto-N-neotetraose (LNnT).
[0062] In some embodiments, the oligosaccharide mixture contains at least one fucosyl oligosaccharide in an amount of about 0.5% to about 2% by weight, relative to the total weight of the oligosaccharide mixture. In some embodiments, the oligosaccharide mixture contains at least one sialyl oligosaccharide in an amount of about 2% to about 6% by weight, relative to the total weight of the oligosaccharide mixture. In some embodiments, the oligosaccharide mixture contains at least one N-acetyl oligosaccharide in an amount of about 1% to about 4% by weight, relative to the total weight of the oligosaccharide mixture.
[0063] In some embodiments, the oligosaccharide mixture comprises at least one fucosyl oligosaccharide in an amount of about 2% to about 6% by weight relative to the total weight of the oligosaccharide mixture, and at least one N-acetyl oligosaccharide in an amount of about 1% to about 4% by weight relative to the total weight of the oligosaccharide mixture.
[0064] In some embodiments, the oligosaccharide mixture comprises, based on the total weight of the oligosaccharide mixture, at least one fucosyl oligosaccharide in an amount of about 2% to about 6% by weight; at least one sialyl oligosaccharide in an amount of about 0.5% to about 2% by weight; and at least one N-acetyl oligosaccharide in an amount of about 1% to about 4% by weight.
[0065] Oligosaccharides can be obtained by any suitable method. Suitable methods for synthesizing oligosaccharides are well known to those skilled in the art. For example, processes for producing oligosaccharides have been developed by microbial fermentation, enzymatic processes, chemical synthesis, or combinations thereof (see, for example, Zeuner et al., 2019. Molecules, 24(11), p.2033).
[0066] Fucosyl oligosaccharide In some embodiments, the oligosaccharide mixture includes at least one fucosyl oligosaccharide.
[0067] Non-limiting examples of fucosyl oligosaccharides include 2'-fucosyl lactose (2'FL), 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose, e.g., lacto-N-fucopentaose I (LNFP-I), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III) or lacto-N-fucopentaose V (LNFP-V), lacto-N-fucohexaose, lacto-N-difucohexaose I, lacto-neofucopentaose V (LNnFP-V), lacto-N-difucosylhexaose-I (LNDFH-1), lacto-N-neodifucosylhexaose Examples include ose (LNnDFH), fucosyllacto-N-hexaose, fucosyllacto-N-neohexaose (e.g., fucosyllacto-N-neohexaose I, fucosyllacto-N-neohexaose II), monofucosyllacto-n-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose I, difucolact-N-neohexaose, difucosyllacto-N-neohexaose I, difucosyllacto-N-neohexaose II, difucosyllacto-N-hexaose-a (DFLNHa), fucosyl-para-lacto-N-hexaose, tri-fucopara-lacto-N-hexaose I, and combinations thereof.
[0068] In a preferred embodiment, at least one fucosyl oligosaccharide includes 2'-fucosyl lactose (2'FL), which is typically the most common HMO naturally present in human breast milk.
[0069] In some embodiments, at least one fucosyl oligosaccharide is selected from the group consisting of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), and combinations thereof. In some embodiments, at least one fucosyl oligosaccharide comprises or consists of 2'-fucosyl lactose (2'FL) and difucosyl lactose (diFL).
[0070] Fucosyl oligosaccharides can be obtained by any suitable method. For example, 2'FL can be produced by biotechnological methods using specific fucosyltransferases and / or fucosidases, either by using enzyme-based fermentation techniques (recombinant or natural enzymes) or microbial fermentation techniques. In the latter case, microorganisms can be manipulated to express or produce their respective natural enzymes and substrates. Alternatively, 2'FL can be produced by chemical synthesis from lactose and free fucose. diFL can be synthesized by enzymatic, biotechnological, and / or chemical processes.
[0071] sialyl oligosaccharide In some embodiments, the oligosaccharide mixture comprises at least one sialyl oligosaccharide.
[0072] Non-exclusive examples of sialyl oligosaccharides include 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof.
[0073] In some embodiments, at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof. In some embodiments, at least one sialyl oligosaccharide includes or consists of 6'-sialyl lactose (6'-SL). In some embodiments, at least one sialyl oligosaccharide includes or consists of 6'-sialyl lactose (6'-SL) and 3'-sialyl lactose (3'-SL).
[0074] Sialyl oligosaccharides can be obtained by any preferred method. For example, 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL) can be isolated from natural sources such as animal milk by chromatography or filtration techniques. Alternatively, 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL) can be produced by biotechnological methods using specific sialyltransferases or sialidases, neuraminidases, either by enzyme-based fermentation techniques (recombinant or natural enzymes), chemical synthesis, or microbial fermentation techniques. In the latter case, microorganisms can be manipulated to express or produce their respective natural enzymes and substrates. Single-microbial cultures or mixed cultures can be used. The formation of sialyl oligosaccharides can be initiated from acceptor substrates of any degree of polymerization (DP), DP=1 or greater. Alternatively, sialyl lactose can be produced by chemical synthesis from lactose and free N'-acetylneuraminic acid (sialic acid). Siaylic lactose is also commercially available from companies such as Kyowa Hakko Kogyo (Japan) or GeneChem (South Korea).
[0075] If the oligosaccharide mixture contains 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL), it may be particularly beneficial if 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL) are included in the nutritional composition in a weight ratio of approximately 10:1 to approximately 1:10, for example, approximately 10:1 to approximately 2:1, approximately 8:1 to approximately 3:1, approximately 6:1 to approximately 3:1, approximately 5:1 to approximately 3:1, approximately 5:1 to approximately 4:1, or approximately 1:2 to approximately 1.5:1.
[0076] N-acetyloligosaccharide In some embodiments, the oligosaccharide mixture includes at least one N-acetyloligosaccharide.
[0077] Preferably, at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, and combinations thereof. Non-limiting examples of N-acetyloligosaccharides include LNT (lacto-N-tetraose), para-lacto-N-neohexaose (para-LNnH), LNnT (lacto-N-neotetraose), and any combination thereof. Other examples include lacto-N-hexaose, lacto-N-neohexaose, para-lacto-N-hexaose, para-lacto-N-neohexaose, lacto-N-octaose, lacto-N-neooctaose, isolact-N-octaose, para-lacto-N-octaose, and lacto-N-decaose.
[0078] In some embodiments, at least one N-acetyloligosaccharide is selected from the group consisting of lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, at least one N-acetyloligosaccharide comprises or consists of lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT).
[0079] N-acetyloligosaccharides can be obtained by any preferred method. For example, LNnT can be chemically synthesized by enzymatic transfer of sugar units from the donor to the acceptor using glycosyltransferase. Alternatively, LNnT can be prepared by chemically converting free or oligosaccharide-bound ketohexoses (e.g., fructose) to N-acetylhexosamine or N-acetylhexosamine-containing oligosaccharides. LNT can be synthesized by enzymatic, biotechnological, and / or chemical processes.
[0080] Administration of oligosaccharide mixture Subjects may be administered any appropriate amount of oligosaccharides in any appropriate form and via any appropriate route of administration (e.g., via any form and route described herein).
[0081] Appropriate doses of human oligosaccharides are described, for example, in EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2015. EFSA Journal, 13(11), p.4299; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(6), p.e05717; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2020. EFSA Journal, 18(5), p.e06097; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2022. EFSA Journal, 20(5), p.e07331; and EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(12), p.e05907.
[0082] Preferably, the oligosaccharide mixture is administered to the subject in amounts of at least about 0.5 g / day, at least about 1 g / day, or at least about 2 g / day. Preferably, the oligosaccharide mixture is administered to the subject in amounts of about 10 g / day or less, about 8 g / day or less, or about 5 g / day or less. Preferably, the oligosaccharide mixture is administered to the subject in amounts of about 0.5 g / day to about 10 g / day, about 1 g / day to about 8 g / day, or about 2 g / day to about 5 g / day.
[0083] Preferably, BMO is administered to the subject in amounts of at least about 0.5 g / day, at least about 1 g / day, or at least about 2 g / day. Preferably, BMO is administered to the subject in amounts of about 10 g / day or less, about 8 g / day or less, or about 5 g / day or less. Preferably, BMO is administered to the subject in amounts of about 0.5 g / day to about 10 g / day, about 1 g / day to about 8 g / day, or about 2 g / day to about 5 g / day.
[0084] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, and the oligosaccharide mixture at a dose of approximately 0.5 g / day to approximately 10 g / day.
[0085] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, and BMO at a dose of approximately 0.5 g / day to approximately 10 g / day.
[0086] Probiotics The combination of the present invention may further include one or more probiotics. As used herein, the term “probiotics” may refer to a component containing a sufficient number of viable microorganisms to alter the target gut microbiota (see, for example, Hill, C., et al., 2014. Nature reviews Gastroenterology & hepatology, 11(8), p. 506). Preferably, the probiotics include commercially available probiotic strains and / or strains that have been shown to have health benefits (see, for example, Fijan, S., 2014. International journal of environmental research and public health, 11(5), pp. 4745-4767). Examples of probiotic microorganisms include Bifidobacterium, Lactobacillus, Limosilactobacillus, Lacticaseibacillus, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and Escherichia coli.
[0087] One or more probiotics can increase vitamin K2 production. Surprisingly, the inventors have found that probiotics can promote endogenous vitamin K2 production through the production of precursors.
[0088] In some embodiments, one or more probiotics include or consist of Lactobacillus caseibacillus, Bifidobacterium, Lactobacillus, and / or Rimosilactobacillus. In some embodiments, one or more probiotics include or consist of Lactobacillus rhamnosus, Bifidobacterium longum, and / or Bifidobacterium animalis.
[0089] Lactobacillus rhamnosus In a preferred embodiment, one or more probiotics include or consist of Lactobacillus rhamnosus.
[0090] Lacticaseibacillus rhamnosus (also known as Lactobacillus rhamnosus) is a Gram-positive, short-rod bacterium, a homofermentative facultative anaerobe, non-spore-forming, and often observed in a chain-like form. Lactobacillus rhamnosus GG (LGG) is one of the most widely used probiotic strains. Its various health benefits have been well-established (see, for example, Segers, ME and Lebeer, S., 2014. Microbial cell factories, 13(1), pp. 1-16). L. rhamnosus may promote the endogenous production of vitamin K2 through the production of precursors.
[0091] In some embodiments, one or more probiotics include or consist of Lactobacillus rhamnosus LPR.
[0092] Bifidobacterium longum In some embodiments, one or more probiotics include or consist of Bifidobacterium longum.
[0093] Bifidobacterium longum is a bacterium found in the human digestive tract. In 2002, three previously considered separate species of Bifidobacterium—B. infantis, B. longum, and B. suis—were merged into a single species named B. longum, encompassing the respective biotypes of infantis, longum, and suis (Sakata, S., et al., 2002. International Journal of Systematic and Evolutionary Microbiology, 52(6), pp.1945-1951).
[0094] In some embodiments, one or more probiotics include or consist of Bifidobacterium longum ssp. infantis (also known as Bifidobacterium infantis), Bifidobacterium longum ssp. suis (also known as Bifidobacterium suis), and / or Bifidobacterium longum ssp. longum (also known as Bifidobacterium longum).
[0095] In some embodiments, one or more probiotics include or consist of Bifidobacterium infantis. In some embodiments, one or more probiotics include or consist of Bifidobacterium infantis LMG 11588 or its derivatives (e.g., R0033, which is reported to the U.S. Food and Drug Administration as generally recognized as safe (GRAS); see, e.g., Duboux, S., et al., 2022. Microorganisms, 10(2), p.203). B. Infantis may promote the endogenous production of vitamin K2 through the production of precursors.
[0096] Bifidobacterium animalis In some embodiments, one or more probiotics include or consist of Bifidobacterium animalis.
[0097] Bifidobacterium animalis is a bacterium of the genus Bifidobacterium that can be found in the large intestine of most mammals, including humans. Bifidobacterium animalis and Bifidobacterium lactis were previously described as two separate species. Currently, both are considered to be B. animalis, including the subspecies Bifidobacterium animalis subspecies animalis and Bifidobacterium animalis subspecies lactis (see Masco, L., et al, 2004. International Journal of Systematic and Evolutionary Microbiology, 54(4), pp.1137-1143).
[0098] In some embodiments, one or more probiotics include or consist of Bifidobacterium animalis ssp. lactis (also known as Bifidobacterium lactis). For example, the bacterium Bifidobacterium lactis HN019 has been studied for various traits important to its ability to function as a probiotic (see, e.g., Sanders, ME, 2006. Journal of Clinical Gastroenterology, 40(9), pp. 776-783).
[0099] Probiotic administration Subjects may be administered any appropriate amount of probiotics in any appropriate form and via any appropriate route of administration (e.g., via any form and route described herein).
[0100] Preferably, one or more probiotics are present in a quantity of at least about 10 5 cfu / day, at least about 10 6cfu per day, at least about 10 7 cfu per day, at least about 10 8 cfu per day, at least about 10 9 cfu per day or at least about 10 10 administered to the subject in a total amount of cfu per day. Preferably, one or more probiotics are about 10 12 cfu per day or less, about 10 11 cfu per day or less or about 10 10 administered to the subject in a total amount of cfu per day or less. Preferably, one or more probiotics are about 10 6 cfu per day to about 10 12 cfu per day, about 10 7 cfu per day to about 10 11 cfu per day or about 10 8 cfu per day to about 10 10 administered to the subject in a total amount of cfu per day.
[0101] Preferably, Lactobacillus rhamnosus is at least about 10 5 cfu per day, at least about 10 6 cfu per day, at least about 10 7 cfu per day, at least about 10 8 cfu per day, at least about 10 9 cfu per day, or at least about 10 10 administered to the subject in an amount of cfu per day. Preferably, Lactobacillus rhamnosus is about 10 12 cfu per day or less, about 10 11 cfu per day or less or about 10 10 administered to the subject in an amount of cfu per day or less. Preferably, Lactobacillus rhamnosus is about 10 6 cfu per day to about 10 12 cfu per day, about 10 7 cfu per day to about 10 11 cfu per day or about 10 8 cfu per day to about 10 10 administered to the subject in an amount of cfu per day.
[0102] Preferably, Bifidobacterium longum (e.g., B. infantis) is at least about 10 5cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 The subject is administered a dose of cfu / day. Preferably, Bifidobacterium longum (e.g., B. infantis) is administered at a dose of approximately 10 12 cfu / day or less, approximately 10 11 Less than cfu / day, or about 10 10 The target is administered a dose of less than cfu / day. Preferably, Bifidobacterium longum (e.g., B. infantis) is administered at a dose of approximately 10 6 cfu / day ~ approximately 10 12 cfu / day, approximately 10 7 cfu / day ~ approximately 10 11 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10 The patient is administered cfu / day.
[0103] Preferably, Bifidobacterium animalis (e.g., B. lactis) is present at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 The subject is administered a dose of cfu / day. Preferably, Bifidobacterium animalis (e.g., B. lactis) is administered at a dose of approximately 10 12 cfu / day or less, approximately 10 11 Less than cfu / day, or about 10 10 The target is administered a dose of cfu / day or less. Preferably, Bifidobacterium animalis (e.g., B. lactis) is administered at a dose of approximately 10 6 cfu / day ~ approximately 10 12 cfu / day, approximately 10 7 cfu / day ~ approximately 10 11 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10The patient is administered cfu / day.
[0104] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, and Lactobacillus rhamnosus at a dose of approximately 10 6 cfu / day ~ approximately 10 12 The patient is administered cfu / day.
[0105] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, BMO at a dose of approximately 0.5 g / day to approximately 10 g / day, and Lactobacillus rhamnosus at approximately 10 6 cfu / day ~ approximately 10 12 The patient is administered cfu / day.
[0106] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 5 μg / day to approximately 100 μg / day, and Lactobacillus rhamnosus at a dose of approximately 10 6 cfu / day ~ approximately 10 12 The patient is administered cfu / day.
[0107] Preferably, vitamin K1 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 5 μg / day to approximately 100 μg / day, BMO at a dose of approximately 0.5 g / day to approximately 10 g / day, and Lactobacillus rhamnosus at approximately 10 6 cfu / day ~ approximately 10 12 The patient is administered cfu / day.
[0108] composition Preferably, the combination is in the form of a composition. The composition may contain the combination in any therapeutically effective amount.
[0109] The composition may be any type of composition that can incorporate the combination, for example, a food or beverage product, an animal feed product, a composition in the form of a nutritional supplement for humans or animals, or a pharmaceutical composition. The composition may be in the form of a solid (e.g., powder), a liquid, or a semi-liquid. This combination may be in the form of a food composition, a pet food composition, a beverage, a nutritional formula, a nutritional supplement, or nutraceuticals.
[0110] Food and beverage products include all products intended for oral consumption by humans for the purpose of providing nutrition and / or pleasure. For example, food and beverage products may be nutritional compositions, such as nutritional compositions for young children. Examples of food and beverage products include dairy products, such as milk products or yogurt, soups, sauces, sweets and savory snacks, powdered beverages, and cereal products.
[0111] In some embodiments, the combination may take the form of a nutritional composition, a medical food for clinical nutrition, a growing-up milk, or a supplement.
[0112] In some embodiments, the combination takes the form of a nutritional composition. As used herein, “nutritional composition” may mean a composition that provides nutrition to a subject. This nutritional composition is usually administered orally or intravenously and typically comprises a lipid source or fat source and a protein source.
[0113] In some embodiments, the combination is in the form of a medical food for clinical nutrition. As used herein, “medical food for clinical nutrition” is also known as “Foods for Special Medical Purposes (FSMPs)” and refers to special foods designed to help satisfy the nutritional or dietary needs of persons living with a disease, disability, or medical condition that prevents them from achieving adequate nutritional intake temporarily or permanently from or through changes in their regular diet.
[0114] In some embodiments, the combination takes the form of an infant formula. In this case, the infant formula may be a premature infant formula, a human milk fortifier, a starter infant formula, a follow-on formula, a baby food formula, an infant cereal formula, or a growing-up milk.
[0115] In a preferred embodiment, the combination is in the form of growing-up milk. As used herein, the term “growing-up milk” (or GUM) refers to a milk formula product that is given to children aged 1 year and older. Growing-up milk is generally a diet-based beverage adapted to the specific nutritional requirements of young children (e.g., children about 1 to about 3 years of age). Growing-up milk is also known as “young child formula” or “infant milk.”
[0116] In some embodiments, the composition (e.g., Growing Up Milk) is in powder form and is reconstituted with an aqueous medium (e.g., water) before administration. In other embodiments, the composition (e.g., Growing Up Milk) is in a liquid form ready for administration (e.g., a ready-to-feed formula).
[0117] In another embodiment, the combination is in the form of a supplement. As used herein, “supplement” or “dietary supplement” may be used to complement the nutrition of a subject (typically so, but a dietary supplement may also be added to any type of composition intended to be ingested by the subject). If the composition is a supplement, such composition may be provided in the form of a unit dose. Supplements typically exist in the form of a liquid, gel, powder, or tablet or capsule. Powdered supplements typically include supplements that will be dissolved in water or milk, or sprinkled on food or beverages. Such supplements are intended to provide additional nutrition and / or health benefits to the subject ingesting the supplement. Supplements may be used to provide nutrition and / or health benefits to humans and animals.
[0118] In another embodiment, the combination is in the form of a fortifier. The fortifier may be a milk formula fortifier or a growing-up milk fortifier.
[0119] In another embodiment, the combination is in the form of a pharmaceutical product. Examples of pharmaceutical products include drops, syrups, powders, tablets, or capsules intended to treat or prevent an adverse medical condition in a person in need.
[0120] The combination may also be in the form of animal food or animal nutritional supplement. Preferably, the animal is a mammal. Examples of animals include primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, and birds.
[0121] The nutritional compositions of the present invention, particularly Growing Up Milk, generally contain a protein source, a carbohydrate source, and a lipid source. However, in some embodiments, particularly when the nutritional compositions of the present invention are supplements or fortifiers, only lipids (or lipid sources) may be present.
[0122] The nutritional composition of the present invention may contain approximately 100 kcal / 100g to approximately 1000 kcal / 100g, approximately 200 kcal / 100g to approximately 800 kcal / 100g, or approximately 400 kcal / 100g to approximately 600 kcal / 100g on a dry weight basis.
[0123] Vitamin mixture The nutritional composition according to the present invention (e.g., Growing Up Milk) may contain any appropriate amount of vitamin K1, vitamin A, and vitamin D.
[0124] Preferably, the nutritional composition contains vitamin K1 in amounts of at least about 5 μg / 100g, at least about 10 μg / 100g, at least about 15 μg / 100g, at least about 20 μg / 100g, at least about 25 μg / 100g, or at least about 30 μg / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin K1 in amounts of about 2100 μg / 100g or less, about 100 μg / 100g or less, about 90 μg / 100g or less, about 80 μg / 100g or less, about 70 μg / 100g or less, or about 60 μg / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin K1 in amounts of approximately 5 μg / 100g to approximately 200 μg / 100g, approximately 10 μg / 100g to approximately 100 μg / 100g, approximately 15 μg / 100g to approximately 90 μg / 100g, approximately 20 μg / 100g to approximately 80 μg / 100g, approximately 25 μg / 100g to approximately 70 μg / 100g, or approximately 30 μg / 100g to approximately 60 μg / 100g.
[0125] Preferably, the nutritional composition contains vitamin A in an amount of at least about 100 μgRE / 100g, at least about 200 μgRE / 100g, or at least about 300 μgRE / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin A in an amount of about 1000 μgRE / 100g or less, about 800 μgRE / 100g or less, about 600 μgRE / 100g or less, or about 400 μgRE / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin A in amounts of approximately 100 μgRE / 100g to approximately 1000 μgRE / 100g, approximately 200 μgRE / 100g to approximately 800 μgRE / 100g, approximately 300 μgRE / 100g to approximately 600 μgRE / 100g, or approximately 300 μgRE / 100g to approximately 400 μgRE / 100g on a dry weight basis.
[0126] Preferably, the nutritional composition contains vitamin A in an amount of at least about 100 μg RAE / 100g, at least about 200 μg RAE / 100g, or at least about 300 μg RAE / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin A in an amount of about 1000 μg RAE / 100g or less, about 800 μg RAE / 100g or less, about 600 μg RAE / 100g or less, or about 400 μg RAE / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin A in amounts of approximately 100 μg RAE / 100g to approximately 1000 μg RAE / 100g, approximately 200 μg RAE / 100g to approximately 800 μg RAE / 100g, approximately 300 μg RAE / 100g to approximately 600 μg RAE / 100g, or approximately 300 μg RAE / 100g to approximately 400 μg RAE / 100g on a dry weight basis.
[0127] Preferably, the nutritional composition contains vitamin D in amounts of at least about 2.5 μg / 100g, at least about 5 μg / 100g, at least about 10 μg / 100g, or at least about 15 μg / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin D in amounts of about 100 μg / 100g or less, about 75 μg / 100g or less, or about 50 μg / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin D in amounts of about 2.5 μg / 100g to about 100 μg / 100g, about 5 μg / 100g to about 100 μg / 100g, about 10 μg / 100g to about 75 μg / 100g, or about 15 μg / 100g to about 50 μg / 100g on a dry weight basis.
[0128] Oligosaccharide mixture The nutritional composition according to the present invention (for example, Growing Up Milk) may contain any appropriate amount of oligosaccharides.
[0129] Preferably, the nutritional composition contains an oligosaccharide mixture in a total amount of at least about 0.5% by weight, at least about 1% by weight, or at least about 2% by weight on a dry weight basis. Preferably, the nutritional composition contains an oligosaccharide mixture in a total amount of about 10% by weight or less, about 8% by weight or less, or about 5% by weight or less on a dry weight basis. Preferably, the nutritional composition contains an oligosaccharide mixture in a total amount of about 0.5% to about 10% by weight, about 1% to about 8% by weight, or about 2% to about 5% by weight on a dry weight basis.
[0130] Preferably, the nutritional composition contains BMO in a total amount of at least about 0.5% by weight, at least about 1% by weight, or at least about 2% by weight on a dry weight basis. Preferably, the nutritional composition contains BMO in a total amount of about 10% by weight or less, about 8% by weight or less, or about 5% by weight or less on a dry weight basis. Preferably, the nutritional composition contains BMO in a total amount of about 0.5% to about 10% by weight, about 1% to about 8% by weight, or about 2% to about 5% by weight on a dry weight basis.
[0131] Probiotics The nutritional composition according to the present invention (e.g., Growing Up Milk) may contain any appropriate amount of probiotics.
[0132] Preferably, the nutritional composition contains at least about 10 5 cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10 cfu / 100 g in total amount of one or more probiotics. Preferably, the nutritional composition contains, on a dry weight basis, about 10 12 cfu / 100 g or less, about 10 11 cfu / 100 g or less, about 10 10 cfu / 100 g or less in total amount of one or more probiotics. Preferably, the nutritional composition contains, on a dry weight basis, about 10 6 cfu / 100 g to about 10 12 cfu / 100 g, about 10 7 cfu / 100 g to about 10 11 cfu / 100 g, or about 10 8 cfu / 100 g to about 10 10 cfu / 100 g in total amount of one or more probiotics.
[0133] Preferably, the nutritional composition contains, on a dry weight basis, at least about 10 5 cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10 cfu / 100 g amount of Lactobacillus rhamnosus. Preferably, the nutritional composition contains, on a dry weight basis, about 10 12 cfu / 100 g or less, about 10 11 cfu / 100 g or less, about 10 10 cfu / 100 g or less amount of Lactobacillus rhamnosus. Preferably, the nutritional composition contains, on a dry weight basis, about 10 6 cfu / 100 g to about 1012 cfu / 100g, approx. 10 7 cfu / 100g~approx. 10 11 cfu / 100g, or approximately 10 8 cfu / 100g~approx. 10 10 Contains Lactobacillus rhamnosus at a cfu / 100g level.
[0134] Preferably, the nutritional composition contains at least about 10% on a dry weight basis. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 cfu / 100g, or at least about 10 8 cfu / 100g, at least about 10 9 cfu / 100g, or at least about 10 10 The nutritional composition contains Bifidobacterium longum (e.g., B. infantis) in amounts of cfu / 100g. Preferably, the nutritional composition is about 10 by dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 The nutritional composition contains Bifidobacterium longum (e.g., B. infantis) in amounts of less than cfu / 100g. Preferably, the nutritional composition is about 10 by dry weight. 6 cfu / 100g~approx. 10 12 cfu / 100g, approx. 10 7 cfu / 100g~approx. 10 11 cfu / 100g, or approximately 10 8 cfu / 100g~approx. 10 10 Contains Bifidobacterium longum (e.g., B. infantis) at a cfu / 100g level.
[0135] Preferably, the nutritional composition contains at least about 10% on a dry weight basis. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 cfu / 100g, or at least about 10 8 cfu / 100g, at least about 10 9 cfu / 100g, or at least about 10 10The nutritional composition contains Bifidobacterium animalis (e.g., B. lactis) in amounts of cfu / 100g. Preferably, the nutritional composition is about 10 by dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 The nutritional composition contains Bifidobacterium animalis (e.g., B. lactis) in amounts of cfu / 100g or less. Preferably, the nutritional composition is about 10 by dry weight. 6 cfu / 100g~approx. 10 12 cfu / 100g, approx. 10 7 cfu / 100g~approx. 10 11 cfu / 100g, or approximately 10 8 cfu / 100g~approx. 10 10 Contains Bifidobacterium animalis (e.g., B. lactis) at a cfu / 100g level.
[0136] protein The nutritional composition according to the present invention (for example, growing-up milk) may contain a protein source. The inclusion of a protein source is particularly preferable when the nutritional composition of the present invention is growing-up milk. The amount of protein may be about 1 g to about 4 g per 100 kcal, or about 1.5 g to about 3 g per 100 kcal.
[0137] For example, protein sources based on whey, casein, and mixtures thereof can be used in the same way as, for example, soy-based plant protein sources. With respect to whey protein, the protein source may be based on acidic whey, sweet whey, or mixtures thereof, and may contain α-lactalbumin and β-lactoglobulin in any desired proportion. In some embodiments, the primary protein source is whey (i.e., more than 50%, for example more than 60% or more than 70% of the protein is derived from whey protein). The protein may be in an intact state, a hydrolyzed state, or a mixture of intact and hydrolyzed proteins. The term "intact" means that the main part of the protein is intact, i.e., the molecular structure has not changed, for example, at least 80% of the protein has not changed, for example at least 85% of the protein has not changed, preferably at least 90% of the protein has not changed, and more preferably at least 95% of the protein has not changed, for example at least 98% of the protein has not changed. In certain embodiments, the protein remains completely unchanged.
[0138] In the context of this invention, the term "hydrolyzed" means that a protein has been hydrolyzed, or broken down into its constituent amino acids.
[0139] The protein may be either completely hydrolyzed or partially hydrolyzed. If a hydrolyzed protein is required, the hydrolysis process may be carried out as desired, as is known in the art. For example, a hydrolyzed whey protein can be prepared by enzymatically hydrolyzing a whey fraction in one or more steps. It has been found that if the whey fraction used as the raw material is substantially lactose-free, the lysine blackage that the protein undergoes during the hydrolysis process is significantly reduced. This can reduce the degree of lysine blackage from about 15% by weight of the total lysine to less than 10% by weight of the total lysine, and for example, about 7% by weight of lysine significantly improves the nutritional value of the protein source.
[0140] In a particular embodiment, the protein of the composition is hydrolyzed, completely hydrolyzed, or partially hydrolyzed. The degree of hydrolysis (DH) of the protein may be 2 to 20, or 8 to 40, or 20 to 60, or 20 to 80, or greater than 10, greater than 20, greater than 40, greater than 60, greater than 80, or greater than 90.
[0141] At least 70%, 80%, 85%, 90%, 95%, or 97% of the protein may be hydrolyzed. In certain embodiments, 100% of the protein is hydrolyzed.
[0142] In one particular embodiment, the protein of the composition is a plant protein.
[0143] carbohydrates The nutritional composition according to the present invention (for example, growing-up milk) may contain a carbohydrate source. The inclusion of a carbohydrate source is particularly preferable when the nutritional composition of the present invention is growing-up milk. The amount of carbohydrates may be about 5g to about 20g per 100kcal, or about 10g to about 15g per 100kcal.
[0144] While lactose is a preferred carbohydrate source for growing-up milk, any carbohydrate source conventionally found in growing-up milk, such as lactose, sucrose, saccharose, maltodextrin, starch, or mixtures thereof, can be used.
[0145] Lipids The nutritional composition according to the present invention (for example, growing-up milk) may contain lipids and essential fatty acids. This is particularly preferable when the nutritional composition of the present invention is growing-up milk. The amount of lipids may be about 1g to about 10g per 100kcal, or about 2g to about 6g per 100kcal.
[0146] Non-limiting examples of lipids include palm olein, high-oleic sunflower oil, high-oleic safflower oil, canola oil, fish oil, coconut oil, bovine milk fat, and combinations thereof. Compositions may be particularly beneficial if they contain fat in an amount of about 25 to about 30 g / 100 g by dry weight of the composition. Non-limiting examples of essential fatty acids include linoleic acid (LA) and alpha-linolenic acid (ALA). The compositions of the present invention may further contain gangliosides, monosialoganglioside-3 (GM3) and disialoganglioside-3 (GD3), and combinations thereof.
[0147] Other ingredients The nutritional composition of the present invention (e.g., Growing Up Milk) may also contain all vitamins and minerals understood to be essential for a daily diet in nutritionally significant amounts. Minimum requirements have been established for certain vitamins and minerals. Examples of minerals, vitamins, and other nutrients optionally present in the composition of the present invention include vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B12, vitamin E, vitamin C, folic acid, inositol, niacin, biotin, pantothenic acid, choline, calcium, phosphorus, iodine, iron, magnesium, copper, zinc, manganese, chlorine, potassium, sodium, selenium, chromium, molybdenum, taurine, and L-carnitine. Minerals are usually added in salt form. The presence and amount of certain minerals and other vitamins will vary depending on the target population. If necessary, the nutritional composition of the present invention may also contain emulsifiers and stabilizers, such as soy, lecithin, and mono- and diglyceride citrates.
[0148] The nutritional composition of the present invention (for example, Growing Up Milk) may also contain other substances that may have beneficial effects, particularly on bone health or bone development, such as lactoferrin, osteopontin, TGFβ, slgA, glutamine, nucleotides, and nucleosides.
[0149] Preparation of composition The compositions according to the present invention can be prepared by any known or other suitable method. For example, a nutritional composition, such as growing-up milk, may be proposed by blending a protein source with a carbohydrate source and a lipid source in appropriate proportions. If used, an emulsifier may be included at this point. Vitamins and minerals may be added at this point, but they can usually be added later to avoid thermal decomposition. Water, preferably reverse-osmotic water or deionized water, can then be added and mixed to form a liquid mixture. The mixing temperature is preferably room temperature, but may be higher. The liquid mixture can then be heat-treated to reduce the bacterial content. The mixture may then be homogenized.
[0150] If it is desired to produce a powdered composition, the homogenized mixture is dried in a suitable drying apparatus, such as a spray dryer or freeze dryer, to obtain a powder.
[0151] The processes used in formula manufacturing are based on the concept that the product must be nutritionally appropriate and microbiologically safe for consumption. Therefore, steps to eliminate or limit microbial growth are central to the manufacturing process. While the processing techniques for each specific formula are proprietary to the manufacturer, they generally involve preservation of oil-in-water (o / w) emulsions by dehydration in the case of powder products, or sterilization in the case of ready-to-feed or concentrated liquid products. Powdered formulas can be manufactured using various processes, such as dry blending dehydrated components to form a uniform formula, or hydrating and wet mixing a mixture of macro components, such as fat components, protein components, and carbohydrate components, and then evaporating and spray-drying the resulting mixture. A combination of the above two processes may also be used, where the base powder is produced by first wet-mixing and spray-drying all or some of the macro components, and then dry-blending the remaining components, including carbohydrates, minerals, vitamins, and other micronutrients, to create the final formula. Liquid formulas are available in ready-to-feed form or as concentrates that typically need to be diluted with water at a 1:1 ratio. The manufacturing processes used for these products are similar to those used for the production of recycled milk.
[0152] If it is desirable to manufacture a liquid formula, the homogenized mixture may be filled into a suitable container, preferably aseptically. However, the liquid composition may be retorted in the container, and suitable equipment for this type of filling and retorting is commercially available.
[0153] subject The subject may be any suitable subject. Preferably, the subject may be a mammal. In a preferred embodiment, the subject is a human. In other embodiments, the subject may be an animal, preferably a pet. The pet may be an animal selected from dogs, cats, birds, fish, rodents, such as mice, rats and guinea pigs, rabbits, etc. In some embodiments, the pet is a small dog breed.
[0154] In some embodiments, the subjects are young people, adolescents, or children. The term “young people” may refer to individuals who have not yet reached adulthood. The term “adolescents” may refer to individuals during the period from the onset of puberty to adulthood. The term “children” may refer to individuals in the stage between birth and puberty.
[0155] In a preferred embodiment, the subjects are young children or infants. As used herein, “young children” or “infants” may refer to children about 1 to 3 years of age.
[0156] In preferred embodiments, the subjects are approximately one year of age or older. For example, the subjects may be approximately 12 months of age or older, approximately 18 months of age or older, or approximately 24 months of age or older.
[0157] In a preferred embodiment, the subjects are approximately 3 years of age or younger. For example, the subjects may be approximately 36 months of age or younger, or approximately 30 months to approximately 24 months of age or younger.
[0158] In other preferred embodiments, the subjects are approximately 1 to 3 years old. For example, the subjects may be approximately 12 months to 36 months old, approximately 18 months to 36 months old, or approximately 24 months to 36 months old.
[0159] The present invention is particularly suitable for children who have suffered from growth retardation due to being premature, having a low birth weight, having experienced intrauterine growth restriction, or having experienced malnutrition or disease, such as Crohn's disease and / or celiac disease and / or cancer, or for children who have been treated with drugs that cause malabsorption, anorexia and / or metabolic bone disease, such as chemotherapy drugs and / or corticosteroids. The present invention is particularly preferred for use in children who have been premature, had a low birth weight, experienced intrauterine growth restriction, had intrauterine malnutrition, or experienced growth retardation. The present invention is also suitable for children who are at risk of bone disease, have a family history of bone disease, or have already experienced at least one, preferably several, fracture episodes.
[0160] In some embodiments, the subjects suffer from and / or stunted growth. Stunted growth may be defined as having an "age-specific height" value less than two standard deviations of the WHO Child Growth Standards median (see, for example, De Onis, M. and Branca, F., 2016. Maternal & child nutrition, 12, pp. 12-26).
[0161] In some embodiments, subjects suffer from and / or faltering growth. The term “faltering growth” can describe a pattern in children and other adolescents in which weight gain is slower than expected for their age and sex (e.g., King, C. and Davis, T., 2010. European Journal of Clinical Nutrition, 64(1), pp. S11-S13). In some embodiments, subjects suffer from and / or faltering growth due to malnutrition and a history of disease, such as anorexia, Crohn's disease and / or celiac disease. In some embodiments, subjects suffer from and / or faltering growth due to treatment with drugs that cause malabsorption, anorexia and / or metabolic bone disease, such as chemotherapy drugs and / or corticosteroids.
[0162] In some embodiments, subjects were premature, low birth weight, or experienced intrauterine growth restriction. The term “premature” may refer to an infant born with a gestational age of less than 37 weeks. The term “low birth weight” may refer to an infant with a birth weight of less than 2500g.
[0163] Methods for increasing bone growth and / or bone strength The inventors have shown that the combination of the present invention can be used to enhance bone growth and / or bone strength in a subject.
[0164] In the context of the present invention, the term "enhancing bone growth and / or bone strength" may, in particular, refer to one or more of the following physiological processes: catch-up growth, bone mass acquisition, optimization of maximum bone mass, promotion of bone formation, promotion of bone assimilation, promotion of bone mineralization, increase in bone density and microstructure, regulation of the biomechanical properties of bone, and regulation of the ratio of bone formation and / or bone resorption.
[0165] In one embodiment, the present invention provides a combination of the present invention for use in enhancing bone growth and / or bone strength in a given area.
[0166] In one embodiment, the present invention provides the use of a combination according to the present invention in the manufacture of a medical food for enhancing bone growth and / or bone strength in a subject.
[0167] In one embodiment, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, comprising administering a therapeutically effective amount of the combination according to the present invention to a subject in need thereof.
[0168] As used herein, “enhancing bone growth and / or strength” may refer to supporting normal bone growth and / or strength, for example, during childhood and adolescence. Supporting normal bone growth and / or strength can result in normal bone anatomical structure and physiological function. Appropriate methods and parameters for measuring bone growth and strength are known to those skilled in the art (see, for example, Donnelly, E., 2011. Clinical Orthopaedics and Related Research, 469(8), pp. 2128-2138). Preferably, normal bone growth and / or strength can be measured using one or more bone parameters selected from trabecular volume fraction (BV / TV), bone mineral density (BMD), bone mineral density (BMC), cortical volume (Ct.BV), medio-lateral diameter, antero-posterior diameter, ultimate force (FMax), and bone stiffness. In some embodiments, normal bone growth and / or strength are measured using one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax). Suitable methods for measuring these parameters are available to those skilled in the art.
[0169] Methods to promote catch-up growth The combination of the present invention can promote catch-up growth, for example, in subjects with developmental inhibition and / or developmental delay.
[0170] In one embodiment, the present invention provides a combination according to the present invention for use in promoting catch-up growth in a target.
[0171] In one embodiment, the present invention provides the use of a combination according to the present invention in the manufacture of a medical food for promoting catch-up growth in a subject.
[0172] In one embodiment, the present invention provides a method for promoting catch-up growth in a subject, the method comprising administering a therapeutically effective amount of the combination according to the present invention to a subject in need thereof.
[0173] As used herein, "catch-up growth" may refer to a rate of height increase exceeding the normal range for age, lasting at least one year after a period of temporary growth inhibition, and this growth may be complete or incomplete (see, for example, Wit, J., and Boersma, B., 2002. Journal of Pediatric Endocrinology and Metabolism, 15, pp. 1229-1242).
[0174] Appropriate methods and parameters for measuring catch-up growth are known to those skilled in the art. Preferably, catch-up growth can be measured using the rate of height increase or the height standard deviation score (see, for example, Frongillo, EA, Leroy, J.Land, Lapping, K., 2019. Advances in Nutrition, 10(3), pp.372-379 and Desmond, C. and Casale, D., 2017. PloS one, 12(12), p.e0189135).
[0175] In some embodiments, catch-up growth is measured in absolute terms of linear growth (i.e., a reduction in height deficit compared to the healthy reference population mean). In some embodiments, catch-up growth is measured in relative terms of linear growth (i.e., an improvement in age-specific height z-score and / or exceeding the -2SD or -1SD cutoff point). [Examples]
[0176] The present invention will be further illustrated with reference to the following examples. It will be understood that the claimed invention is not intended to be limited by these examples.
[0177] Example 1 - Effects of a combination of vitamin K2, vitamin A, vitamin D, and HMO mixture on bone development result The effects of vitamin K2, vitamin A, vitamin D, and short-chain fatty acids (SCFAs) on osteoblast alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in preosteoblast cell lines were investigated.
[0178] Seven days after differentiation (without ascorbic acid), vitamins A and D showed a significant effect on ALP activity, a marker of osteoblast differentiation, but vitamin K2 did not show a significant effect (see Figure 1A). On the other hand, 21 days after differentiation (without ascorbic acid), vitamin K2 showed a significant effect on the expression of osteocalcin, an important protein for osteoblast calcification activity, but vitamins A and D did not show a significant effect (see Figure 1B).
[0179] 28 days after differentiation (with ascorbic acid supplementation), a combination of vitamin K2, vitamin A, and vitamin D synergistically promoted osteoblast calcification (see Figure 1C).
[0180] The effects of SCFA were further investigated. Three mixtures—75% acetate, 20% propionate, and 5% butyrate—were evaluated to mimic normal physiological conditions (20 μM SCFA), physiological conditions after prebiotic addition (50 μM SCFA), and physiological conditions after synbiotic addition (60 μM SCFA).
[0181] Seven days after differentiation (without ascorbic acid), combinations of vitamin K2, vitamin A, and vitamin D with 50 μm or 60 μm SCFA synergistically promoted osteoblast differentiation (see Figure 2). This effect was up to 28.4% greater than the additive effect.
[0182] Materials and methods Culture and processing conditions for MC3T3-E1 subclone 4 The preosteoblast cell line MC3T3-E1 subclone 4 (CRL-2593) was purchased from ATCC (Manassas; Virginia, USA). Cells were maintained in growth medium (GM) consisting of ascorbic acid-free αMEM (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin. All media were replaced every 2-3 days. Cells were passaged using trypsin / EDTA solution at a confluence of less than 80%. To induce differentiation into osteoblasts, cells were passed through 5 × 10⁶ cells. 4 pieces / cm 2 The seeds were sown and grown in GM for 24 hours until confluence. The medium was then replaced with differentiation medium (DM), consisting of GM supplemented with 10 mM β-glycerophosphate and the target treatment solution. Depending on the experiment, 50 μg / mL of ascorbic acid was also added to the DM.
[0183] Osteoblast alkaline phosphatase activity Four subclonal cells of MC3T3-E1 were differentiated for 7 days using the following treatment solutions, without the addition of ascorbic acid, except for the positive control: a mixture consisting of 3 μM vitamin K2 (menaquinone-7), 100 nM vitamin A (all-trans retinoic acid), and 1 nM vitamin D (1α,25-dihydroxyvitamin D3); a mixture called "SCFA20" consisting of 15 μM sodium acetate, 4 μM sodium propionate, and 1 μM sodium butyrate; a mixture called "SCFA50" consisting of 37.5 μM sodium acetate, 10 μM sodium propionate, and 2.5 μM sodium butyrate; and a mixture called "SCFA60" consisting of 45 μM sodium acetate, 12 μM sodium propionate, and 3 μM sodium butyrate. The vitamin mixtures were also combined with three different combinations of short-chain fatty acids (SCFAs).
[0184] Seven days after differentiation, cells were harvested, and alkaline phosphatase (ALP) activity was measured using a modified version of a previously reported method. Briefly, cells were lysed by heat shock and collected in ALP buffer (1M diethanolamine, 0.24M MgCl2, pH 9.8). After adding 4-nitrophenyl phosphate disodium salt hexahydrate, the enzymatic reaction was monitored at 405 nm. The Michaelis-Menten kinetics were evaluated at 30°C for 30 minutes. max This was used as a substitute for ALP activity. Activity values were normalized by protein content measured using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer's instructions.
[0185] Osteocalcin RNA Extraction Four MC3T3-E1 subclonal cells were differentiated for 21 days (in DM without ascorbic acid, excluding the positive control) or 28 days (in DM containing ascorbic acid). The cells were then harvested for gene expression analysis. RNA was extracted using the RNeasy plus mini kit (Qiagen; Hilden, Germany) in conjunction with QIAcube (Qiagen) according to the manufacturer's instructions. Briefly, cells were lysed in RLT buffer, rotated in a QIAshredder column (Qiagen), and then processed with QIAcube. RNA concentration was measured using DropSense96 (TRINEAN, Gentbrugge, Belgium).
[0186] Reverse transcription and quantitative PCR (qPCR) cDNA was prepared using the High-Capacity cDNA Reverse Transcription Kit (AppliedBiosystems; Waltham, Massachusetts, USA) according to the manufacturer's instructions. Briefly, 0.7 μg of RNA was mixed with the kit components and reverse transcribed using the following program: 10 minutes at 25°C, 120 minutes at 37°C, and 5 minutes at 85°C. The cDNA was diluted 7-fold with RNase-free water and prepared using the LightCycler 1536 DNA Green Master Kit (Roche; Basel, Switzerland) according to the manufacturer's instructions. In short, cDNA was diluted seven-fold in a solution containing a master mix, Bright Green, and DNA primers with the following nucleotide sequences: Ocn-f ACCATCTTTCTGCTCACTCTG, Ocn-r GTTCACTACCTTATTGCCCTCC, B2m-f CACTGACCGGCCTGTATGCT, and B2m-r GTATGTTCGGCTTCCCATTCTC, targeting osteocalcin (Ocn) and β-2-microglobulin (B2m, housekeeping gene). The reaction was carried out on a LightCycler 480 II (Roche) with the following program: 7 minutes at 95°C, 1 second at 95°C, and 30 seconds at 60°C for 40 cycles. Relative gene expression was evaluated by the 2^-ΔCt method.
[0187] Example 2 - Promotion of vitamin K2 production in the gastrointestinal tract To evaluate the intestinal production of vitamin K2, a human microbial ecosystem simulator (SHIME®) was used (Van de Wiele, T., et al., 2015 The Impact of Food Bioactives on Health: in vitro and ex vivo models, pp. 305-317). The SHIME assay typically consists of colonic fermentation of a selected test compound at a dose under simulated conditions representing the target gastrointestinal tract. Menaquinone-7 production was measured by supercritical fluid chromatography-tandem mass spectrometry (SFC-MS / MS).
[0188] In these experiments, a two-stage batch system mimicking the conditions of the upper gastrointestinal tract (upper GIT, stomach, and small intestine) and colon was used as a simplified SHIME® system. A bovine milk-based infant formula, also known as infant formula milk, containing age-appropriate minerals, was used in these studies.
[0189] To simulate the absorption process occurring in the infant's small intestine, a dialysis approach was applied using a cellulose membrane with a 14 kDa cutoff. By introducing the small intestinal suspension into the dialysis membrane, digested molecules such as amino acids, sugars, micronutrients, and minerals were gradually removed from the upper gastrointestinal matrix.
[0190] Furthermore, the pH was gradually decreased from 5.5 to 3.0 during a one-hour incubation in the stomach to simulate the pH of an infant's stomach. During the first 30 minutes of small intestinal incubation (duodenum), the pH was maintained at 4.5 to optimize the absorption of available minerals. The pH was then induced to 7 during the subsequent 145-minute small intestinal phase (jejunum + ileum). After exposure to gastric and small intestinal conditions, the milk matrix was transferred to a colonic compartment containing infant fecal samples.
[0191] Fresh fecal material was collected from 12-month-old infant donors. Fecal suspensions were prepared and mixed with protective agents. At the start of short-term colon incubation, the test components (see below) were added to a sugar-depleted nutrient medium containing essential nutrients present in the colon (e.g., host-derived glycans such as mucin).
[0192] The following groups (test components) were evaluated (in the absence of milk matrix): blank; and HMO+BMO (total 7.2 g / L). The composition of HMO and BMO is shown in the table below:
[0193] [Table 1]
[0194] A mixture of HMO and BMO has been shown to promote vitamin K2 production in the gastrointestinal tract (see Figure 3A). Furthermore, in the milk matrix, Lactobacillus rhamnosus LPR (4.5 × 10⁻¹) 7 The addition of cfu / ml was shown to further increase vitamin K2 production in the gastrointestinal tract by approximately 40% (see Figure 3B).
[0195] Example 3 The preclinical trial setup was carried out as shown in Figure 4.
[0196] As previously reported, we evaluated the trabecular microstructure of the distal metaphysis of the femur using microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, we evaluated the cancellous bone region using isotropic 6 μm voxels. To exclude primary cancellous bone, 30 slices of bone below the distal growth plate were excluded from the analysis. 80 slices of secondary cancellous bone directly beneath it were analyzed. Morphometric variables were calculated from binarized images using direct three-dimensional techniques independent of prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). BV / TV fraction (%) and connectivity density (Conn. D) were evaluated.
[0197] As can be seen in Figures 5A and 5B, the synbiotics [BMOS + L. rhamnosus (LPR)] + vitamin K1AD promoted bone quality by increasing trabecular femoral volume (BV / TV). Connecting density (Conn.D) increased with vitamin K1AD and increased even further when combined with the synbiotics.
[0198] Embodiment Various preferred features and embodiments of the present invention are described below with reference to the numbered paragraphs.
[0199] 1. A combination of a vitamin mixture and an oligosaccharide mixture for use in promoting bone growth and / or strengthening of bone in young children or adolescent subjects, wherein the vitamin mixture contains or consists of vitamin K1, vitamin A, and vitamin D, and the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
[0200] 2. The combination for use described in paragraph 1, wherein vitamin K1 is administered to the subject in an amount of approximately 5 μg / day to approximately 200 μg / day.
[0201] 3. A combination of uses described in either paragraph 1 or 2, wherein vitamin A is administered to the subject in an amount of approximately 100 μgRE / day to approximately 1000 μgRE / day.
[0202] 4. A combination of uses described in any one of paragraphs 1 to 3, wherein vitamin D is administered to the subject in an amount of approximately 2.5 μg / day to approximately 100 μg / day.
[0203] 5. A combination for use according to any one of paragraphs 1 to 4, wherein the oligosaccharide mixture contains BMO in an amount of about 80% to about 100% by weight relative to the total weight of the oligosaccharide mixture.
[0204] 6. The combination for use described in any one of paragraphs 1 to 5, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs).
[0205] 7. The combination for use described in paragraph 6, wherein the one or more HMOs include or consist of at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.
[0206] 8. The combination for use described in paragraph 7, wherein the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof, and preferably, the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.
[0207] 9. The above-mentioned at least one fucosyl oligosaccharide is 2'-fucosyl lactose (2'FL), 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difucosylhexaose A combination for use as described in either paragraph 7 or 8, selected from the group consisting of -I (LNDFH-1), lacto-N-neo-difucosylhexaose (LNnDFH), monofucosyl lacto-n-hexaose-III (MFNLH-III), difucosyl lacto-N-hexaose-a (DFLNHa), and combinations thereof, preferably in which at least one fucosyl oligosaccharide is 2'-fucosyl lactose (2'FL) and / or difucosyl lactose (diFL).
[0208] 10. The combination for use described in any one of paragraphs 7 to 9, wherein the at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, and preferably, the at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.
[0209] 11. The oligosaccharide mixture is (a) at least one sialyl oligosaccharide in an amount of about 0.5% to about 2% by weight relative to the total weight of the oligosaccharide mixture; (b) At least one fucosyl oligosaccharide in an amount of about 2% to about 6% by weight relative to the total weight of the oligosaccharide mixture; and / or (c) A combination for use according to any one of paragraphs 1 to 10, comprising at least one N-acetyloligosaccharide in an amount of about 1% to about 4% by weight relative to the total weight of the oligosaccharide mixture.
[0210] 12. A combination of uses described in any one of paragraphs 1 to 11, wherein the oligosaccharide mixture is administered to the subject in a total amount of approximately 0.5 g / day to approximately 10 g / day.
[0211] 13. A combination of uses described in any one of paragraphs 1 to 12, wherein BMO is administered to the subject in a total amount of approximately 0.5 g / day to approximately 10 g / day.
[0212] 14. The combination for use described in any one of paragraphs 1 to 13, wherein the combination further comprises one or more probiotics.
[0213] 15. The combination for use described in paragraph 14, wherein one or more of the probiotics contains or consists of Lactobacillus rhamnosus.
[0214] 16. L. rhamnosus, approximately 10 6 cfu / day ~ approximately 10 12 The combination for use described in paragraph 15, administered to the subject in a total amount of cfu / day.
[0215] 17. A combination of the above-mentioned probiotics for use as described in any one of paragraphs 14-16, wherein the one or more probiotics include Bifidobacterium longum and / or Bifidobacterium infantis.
[0216] 18. The combination for use described in any one of paragraphs 1 to 17, wherein the combination is provided in the form of a nutritional composition.
[0217] 19. The combination for use described in any one of paragraphs 1 to 18, wherein the combination is provided in the form of a medical food for clinical nutrition.
[0218] 20. The combination described above is provided in the form of growing-up milk, and is intended for use in any one of paragraphs 1 to 19.
[0219] 21. A combination for use as described in any one of paragraphs 18 to 20, wherein the composition contains vitamin K1 in an amount of about 5 μg / 100g to about 200 μg / 100g on a dry weight basis.
[0220] 22. A combination for use as described in any one of paragraphs 18 to 21, wherein the composition contains vitamin A in an amount of about 100 μg RE / 100 g to about 1000 μg RE / 100 g on a dry weight basis.
[0221] 23. A combination for use as described in any one of paragraphs 18 to 22, wherein the composition contains vitamin D in an amount of about 2.5 μg / 100g to about 100 μg / 100g on a dry weight basis.
[0222] 24. A combination for use according to any one of paragraphs 18 to 23, wherein the composition comprises the oligosaccharide mixture in a total amount of about 0.5% to about 5% by dry weight.
[0223] 25. A combination for use according to any one of paragraphs 18 to 24, wherein the composition comprises BMO in a total amount of about 0.5% to about 5% by dry weight.
[0224] 26. The composition is about 10 6 cfu / 100 g to about 10 12 cfu / 100 g of L. rhamnosus, a combination for use according to any one of paragraphs 18 to 25.
[0225] 27. A combination for use according to any one of paragraphs 1 to 26, wherein the subject is human.
[0226] 28. A combination for use according to any one of paragraphs 1 to 27, wherein the subject is about 1 year of age or older, preferably the subject is about 1 year to about 3 years of age.
[0227] 29. A combination for use according to any one of paragraphs 1 to 26, wherein the subject is an animal, preferably the animal is a pet.
[0228] 30. A combination for use according to any one of paragraphs 1 to 29, wherein the subject has and / or is suffering from growth inhibition and / or growth retardation.
[0229] 31. A combination for use according to any one of paragraphs 1 to 30, wherein the subject was a premature infant, or a low birth weight infant, or experienced intrauterine growth retardation.
[0230] 32. A combination for use according to any one of paragraphs 1 to 31, wherein the combination is for oral administration.
[0231] 33. A combination for use according to any one of paragraphs 1 to 33, wherein the combination is administered separately, simultaneously, or sequentially, preferably simultaneously.
[0232] 34. The combination for use described in any one of paragraphs 1 to 33, wherein the combination synergistically enhances bone growth and / or bone strength.
[0233] 35. The combination described above for use as described in any one of paragraphs 1 to 34, which enhances bone mineralization.
[0234] 36. The combination for use described in any one of paragraphs 1 to 35, wherein the combination promotes the calcification and / or differentiation of osteoblasts.
[0235] 37. The combination described above for use as described in any one of paragraphs 1 to 36, which increases vitamin K2 production.
[0236] 38. A combination for use described in any one of paragraphs 1 to 37, wherein the combination improves one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax).
[0237] 39. A combination for use described in any one of paragraphs 1 to 38, wherein the combination promotes catch-up growth, and preferably the catch-up growth is measured using the rate of height increase.
[0238] 40. Use of a combination of a vitamin mixture and an oligosaccharide mixture in the manufacture of a medical food for enhancing bone growth and / or bone strength in young children or adolescent subjects, wherein the vitamin mixture contains or consists of vitamin K1, vitamin A, and vitamin D, and the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
[0239] 41. A method for enhancing bone growth and / or bone strength in young children or adolescent subjects, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture contains or consists of vitamin K1, vitamin A, and vitamin D, and the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
[0240] 42. Use of an oligosaccharide mixture to promote vitamin K2 production in the intestines of a subject, wherein the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
[0241] 43. The use according to paragraph 42, wherein the oligosaccharide mixture contains BMO in an amount of about 80% to about 100% by weight relative to the total weight of the oligosaccharide mixture.
[0242] 44. The use according to paragraph 43, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs).
[0243] 45. The use according to paragraph 44, wherein the one or more HMOs include or consist of at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.
[0244] 46. The use as described in paragraph 45, wherein the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof, preferably the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.
[0245] 47. The above-mentioned at least one type of fucosyl oligosaccharide is 2'-fucosyl lactose (2'FL), 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difucosyl The use according to paragraph 45 or 46, wherein the fucosyl oligosaccharide is selected from the group consisting of fuco-hexaose-I (LNDFH-1), lacto-N-neo-difucosylhexaose (LNnDFH), monofucosyl lacto-n-hexaose-III (MFNLH-III), difucosyl lacto-N-hexaose-a (DFLNHa), and combinations thereof, and preferably, at least one of the fucosyl oligosaccharides is 2'-fucosyl lactose (2'FL) and / or difucosyl lactose (diFL).
[0246] 48. The use described in any one of paragraphs 45 to 47, wherein the at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, preferably the at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. 49. The oligosaccharide mixture is (a) at least one sialyl oligosaccharide of about 0.5% to about 2% by weight based on the total weight of the oligosaccharide mixture; (b) at least one fucosyl oligosaccharide of about 2% to about 6% by weight based on the total weight of the oligosaccharide mixture; and / or (c) at least one N-acetyl oligosaccharide of about 1% to about 4% by weight based on the total weight of the oligosaccharide mixture, a combination for use according to any one of paragraphs 42 to 48.
[0247] 50. The oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day, the use according to any one of paragraphs 42 to 49.
[0248] 51. BMO is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day, the use according to any one of paragraphs 42 to 50.
[0249] 52. The oligosaccharide mixture is administered in combination with one or more probiotics, the use according to any one of paragraphs 42 to 50.
[0250] 53. The one or more probiotics comprise or consist of Lactobacillus rhamnosus, a combination for use according to paragraph 52.
[0251] 54. L. rhamnosus is administered to the subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day, a combination for use according to paragraph 53.
[0252] 55. The one or more probiotics comprise Bifidobacterium longum and / or Bifidobacterium infantis, a combination for use according to any one of paragraphs 52 to 54.
[0253] While the present invention has been described using examples, it should be understood that modifications and alterations can be made without departing from the scope of the invention as defined in the claims. Furthermore, where known equivalents exist for certain features, such equivalents are incorporated as if they were specifically referred to herein.
Claims
1. A combination of a vitamin mixture and an oligosaccharide mixture for use in promoting bone growth and / or strengthening of bone in young children or adolescent subjects, wherein the vitamin mixture contains or consists of vitamin K1, vitamin A, and vitamin D, and the oligosaccharide mixture contains or consists of bovine milk oligosaccharide (BMO).
2. The combination for use according to claim 1, wherein vitamin K1 is administered to the subject in an amount of approximately 5 μg / day to approximately 200 μg / day, vitamin A is administered to the subject in an amount of approximately 100 μg RE / day to approximately 1000 μg RE / day, and / or vitamin D is administered to the subject in an amount of approximately 2.5 μg / day to approximately 100 μg / day.
3. The combination for use according to claim 1 or 2, wherein the oligosaccharide mixture contains BMO in an amount of about 80% to about 100% by weight relative to the total weight of the oligosaccharide mixture.
4. The combination for use according to any one of claims 1 to 3, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs), preferably the one or more HMOs comprising or consisting of at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.
5. The combination for use according to any one of claims 1 to 4, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.
6. The combination for use according to any one of claims 1 to 5, wherein the combination further comprises one or more probiotics.
7. The combination for use according to claim 6, wherein the one or more probiotics include or consist of Lactobacillus rhamnosus.
8. The combination for use according to any one of claims 1 to 7, wherein the combination is provided in the form of a nutritional composition, and optionally the combination is provided in the form of growing-up milk.
9. The combination for use according to any one of claims 1 to 8, wherein the subject is a human, preferably about one year of age or older, and more preferably about one to three years of age.
10. The combination for use according to any one of claims 1 to 8, wherein the subject is an animal, preferably a pet.
11. The combination for use according to any one of claims 1 to 10, wherein the subject is suffering from and / or developmental delay.
12. The combination for use according to any one of claims 1 to 11, wherein the combination is administered orally, preferably simultaneously.
13. The combination for use according to any one of claims 1 to 12, wherein the combination promotes the calcification and / or differentiation of osteoblasts.
14. The combination for use according to any one of claims 1 to 13, wherein the combination improves one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax).
15. The combination for use according to any one of claims 1 to 14, wherein the combination promotes catch-up growth, and preferably the catch-up growth is measured using the rate of height increase.