Modified UNC13A oligonucleotide
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- QURALIS CORP
- Filing Date
- 2024-05-31
- Publication Date
- 2026-06-16
Smart Images

Figure 2026519598000001_ABST
Abstract
Description
[Technical Field]
[0001] (Cross-reference of related applications) This application claims the benefit of and priority thereto of U.S. Provisional Patent Application No. 63 / 470,722, filed on 2 June 2023, the entire disclosure thereof, is incorporated herein by reference in its entirety for all purposes.
[0002] (Field of Invention) This application relates, in general terms, to a method for treating neurological disorders using UNC13A splice-switching antisense oligonucleotides, specifically UNC13A antisense oligonucleotides having one or more spacers that target a UNC13A transcript. [Background technology]
[0003] Motor neuron diseases are a class of neurological disorders that result in the degeneration and death of motor neurons (neurons that coordinate voluntary muscle movements by the brain). Motor neuron diseases can be sporadic or hereditary and may affect the upper and / or lower motor neurons. Examples of motor neuron diseases include amyotrophic lateral sclerosis (ALS), progressive bulbar palsy, pseudobulbar palsy, primary ALS, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.
[0004] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases affecting approximately 15,000 individuals in the United States. ALS is characterized by the degeneration and death of upper and lower motor neurons, resulting in loss of voluntary muscle control. Motor neuron death is accompanied by fasciculations and atrophy of muscles. Early symptoms of ALS include muscle spasms, muscle cramps, muscle weakness (e.g., affecting the arms, legs, neck, or diaphragm), slurred speech and nasal voice, and difficulty chewing or swallowing. Ultimately, this leads to loss of physical strength and motor control, including that necessary for speaking, eating, and breathing. Disease progression may be accompanied by weight loss, malnutrition, anxiety, depression, an increased risk of pneumonia, muscle cramps, neuropathy, and, in some cases, dementia. Most individuals diagnosed with ALS die from respiratory failure within five years of the onset of first symptoms. Currently, there is no effective treatment for ALS.
[0005] ALS can occur in individuals of all ages, but is most common in those aged 55-75 and slightly more common in men. ALS can be characterized as sporadic or familial. Sporadic ALS appears to occur randomly and accounts for over 90% of all ALS cases. Familial ALS accounts for 5-10% of all ALS cases.
[0006] FTD refers to a spectrum of progressive neurodegenerative diseases caused by the loss of neurons in the frontal and temporal lobes of the brain. FTD is the third most common form of dementia (after Alzheimer's disease and Lewy body dementia) and the second most common form of dementia in individuals under 65 years of age. It is estimated that 50,000 to 60,000 people in the United States are affected by FTD. FTD is characterized by behavioral and personality changes, as well as speech impairments. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and nonfluent variant primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms of ALS, including muscle weakness, atrophy, fasciculations, spasticity, speech difficulties (dysarthria), and dysphagia (difficulty swallowing), in addition to the symptoms associated with FTD. While individuals usually succumb to FTD within 5 to 10 years, ALS with FTD often leads to death within 2 to 3 years of the onset of the first disease symptoms.
[0007] Similar to ALS, there is no known treatment for FTD or ALS with FTD, and no known medications to prevent or slow the progression of either disease.
[0008] Therefore, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP-43 protein disorders (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic-predominant age-related TDP-43 encephalopathy) There is an urgent need to identify compounds and / or compositions that can prevent, improve, and treat neurological disorders such as encephalopathy (LATE), epilepsy, cerebral age-related TDP-43 with sclerosis (CARTS), facial sensorimotor neuropathy, Guam-island Parkinson's dementia complex, multiple system proteinosis, CTE, and synaptic disorders such as autism. [Overview of the project]
[0009] Oligonucleotides comprising one or more spacers and containing sequences at least 85% complementary to the isolength portion of the UNC13A transcript are described herein.
[0010] In one embodiment, a modified UNC13A oligonucleotide comprising 18 oligonucleotide units including at least one spacer is provided herein.
[0011] In some embodiments, the modified UNC13A oligonucleotide contains a sequence that is at least 85% complementary to any one of the equilength portions of SEQ ID NOs: 1 to 12.
[0012] In some embodiments, 16 of the 18 oligonucleotide units are complementary to one of the equal-length portions of sequence numbers 1 to 12.
[0013] In some embodiments, the oligonucleotide includes a segment having up to seven linked nucleosides.
[0014] In some embodiments, the oligonucleotide includes a segment having up to 6, 5, 4, 3, or 2 linked nucleosides.
[0015] In some embodiments, all segments of the oligonucleotide contain up to seven linked nucleosides.
[0016] In some embodiments, the oligonucleotide comprises a sequence that shares at least 85% identity with one of the equilength portions of SEQ ID NOs: 13-1283 or 2571-2594.
[0017] In some embodiments, the oligonucleotide includes two spacers.
[0018] In some embodiments, the oligonucleotide is 100% identical to any one of sequence numbers 2571-2594.
[0019] In some embodiments, the spacer is a nucleoside substituent containing a non-sugar substituent that cannot be linked to a nucleotide base.
[0020] In some embodiments, the spacer is located between positions 4 and 15 of the oligonucleotide.
[0021] In some embodiments, the oligonucleotide further includes a second spacer, the second spacer located between the 10th and 15th positions of the oligonucleotide.
[0022] In some embodiments, the spacer and the second spacer are separated by at least 2 nucleic acid bases, at least 3 nucleic acid bases, at least 5 nucleic acid bases, at least 5 nucleic acid bases, at least 6 nucleic acid bases, or at least 7 nucleic acid bases in the oligonucleotide.
[0023] In some embodiments, a spacer is located between positions 4 and 9 of the oligonucleotide, and a second spacer is located between positions 10 and 15 of the oligonucleotide.
[0024] In some embodiments, a spacer is located at position 8 of the oligonucleotide, and a second spacer is located at position 11 of the oligonucleotide.
[0025] In some embodiments, the spacer is located at position 5 of the oligonucleotide, and the second spacer is located at position 13 of the oligonucleotide.
[0026] In some embodiments, a spacer is located at position 6 of the oligonucleotide, and a second spacer is located at position 14 of the oligonucleotide.
[0027] In some embodiments, at least one of these two spacers is adjacent to the guanine nucleic acid base.
[0028] In some embodiments, at least one of these two spacers is located immediately before the guanine nucleic acid base.
[0029] In some embodiments, each of the first or second spacers is a nucleoside substituent containing a non-sugar substituent, the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and cannot form a covalent bond with a nucleotide base.
[0030] In some embodiments, each of the first spacer or the second spacer independently of equation (X)
[0031] [ka]
[0032] It is expressed by, in the formula, Ring A is an optionally substituted 4- to 8-membered monocyclic cycloalkyl group or a 4- to 8-membered monocyclic heterocyclyl group, the heterocyclyl group containing one or two heteroatoms selected from O, S, and N, provided that A cannot form a covalent bond with a nucleic acid base.
[0033] [ka] The symbols represent the bonding points to internucleoside bonds.
[0034] In some embodiments, each of the first spacer or the second spacer independently of equation (Xa)
[0035] [ka] It is represented by [this].
[0036] In some embodiments, ring A is a 4- to 8-membered monocyclic cycloalkyl group optionally substituted from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl, or a 4- to 8-membered monocyclic heterocyclyl group selected from oxetanyl, tetrahydrofuranil, tetrahydropyranil, 1,4-dioxanil, 4-irolidinyl, piperidinyl, piperazinyl, morpholinil, and azepanil.
[0037] In some embodiments, ring A is tetrahydrofuranyl.
[0038] In some embodiments, ring A is tetrahydropyranyl.
[0039] In some embodiments, each of the first spacer or the second spacer is independently of formula I
[0040] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-, n is 0, 1, 2, or 3.
[0041] In some embodiments, each of the first spacer or the second spacer is independently of formula I'
[0042] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-, n is 0, 1, 2, or 3.
[0043] In some embodiments, each of the first spacer or the second spacer independently of equation (Ia)
[0044] [ka] It is expressed by, in the formula, n is 0, 1, 2, or 3.
[0045] In some embodiments, each of the first spacer or the second spacer independently of equation (Ia')
[0046] [ka] It is expressed by, in the formula, n is 0, 1, 2, or 3.
[0047] In some embodiments, each of the first spacer or the second spacer is independently of formula II
[0048] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0049] In some embodiments, each of the first spacer or the second spacer is independently represented by formula II'
[0050] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0051] In some embodiments, each of the first spacer or the second spacer independently comprises formula (Iia)
[0052] [ka] It is represented by [this].
[0053] In some embodiments, each of the first spacer or the second spacer independently of formula (Iia')
[0054] [ka] It is represented by [this].
[0055] In some embodiments, each of the first spacer or the second spacer independently comprises formula (IIi)
[0056] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0057] In some embodiments, each of the first spacer or the second spacer independently of equation (IIi')
[0058] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0059] In some embodiments, each of the first spacer or the second spacer independently comprises formula (IIib)
[0060] [ka] It is represented by [this].
[0061] In some embodiments, each of the first spacer or the second spacer independently of formula (IIib')
[0062] [ka] It is represented by [this].
[0063] In some embodiments, each of the first spacer or the second spacer is independently of Equation III
[0064] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0065] In some embodiments, each of the first spacer or the second spacer is independently defined by formula III'
[0066] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0067] In some embodiments, each of the first spacer or the second spacer independently comprises formula (IIIa)
[0068] [ka] It is represented by [this].
[0069] In some embodiments, each of the first spacer or the second spacer independently comprises formula (IIIa')
[0070] [ka] It is represented by [this].
[0071] In some embodiments, the oligonucleotide further comprises locked nucleic acid (LNA).
[0072] In some embodiments, the locked nucleic acid (LNA) is located at one of the positions 4, 7, 9, 12, or 13 of the oligonucleotide.
[0073] In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 10%. In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 20%. In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 25%. In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 30%. In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 40%. In some embodiments, the oligonucleotide containing the spacer has a GC content of at least 50%.
[0074] In some embodiments, the oligonucleotide has a length of 18 oligonucleotide units.
[0075] In some embodiments, at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester bonds, phosphorothioate bonds, alkyl phosphate bonds, phosphorodithioate bonds, phosphotriester bonds, alkylphosphonate bonds, 3-methoxypropylphosphonate bonds, methylphosphonate bonds, aminoalkylphosphotriester bonds, alkylenephosphonate bonds, phosphine bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphodiamidate bonds, phosphorodiamidate bonds, aminoalkylphosphoramide bonds, thiophosphoramide bonds, thionoalkylphosphonate bonds, thionoalkylphosphotriester bonds, thiophosphate bonds, selenophosphate bonds, and boranophosphate bonds.
[0076] In some embodiments, one or more nucleoside-to-nucleoside bonds of the oligonucleotide are modified nucleoside-to-nucleoside bonds.
[0077] In some embodiments, the modified nucleoside bond is a phosphorothioate bond.
[0078] In some embodiments, all nucleoside-to-nucleoside bonds in the oligonucleotide are phosphorothioate bonds.
[0079] In some embodiments, the phosphorothioate bond is in either an Rp configuration or an Sp configuration.
[0080] In some embodiments, the oligonucleotide includes at least one modified sugar moiety.
[0081] In some embodiments, the modified sugar moiety is one of the following: 2'-OMe modified sugar moiety, bicyclic sugar moiety, 2'-O-(2-methoxyethyl)(2'-O-(2-methoxyethyl, 2'-MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2'-4'-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA), and tricyclic analogs (e.g., tcDNA).
[0082] In some embodiments, the oligonucleotides represent an increase of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full-length UNC13A protein.
[0083] In some embodiments, the oligonucleotides exhibit at least a 100% increase in the full-length UNC13A protein.
[0084] In some embodiments, oligonucleotides exhibit an increase of at least 200% compared to the full-length UNC13A protein.
[0085] In some embodiments, oligonucleotides exhibit an increase of at least 300% compared to the full-length UNC13A protein.
[0086] In some embodiments, the increase in full-length UNC13A protein is measured in comparison to the decrease in the level of full-length UNC13A protein achieved using TDP43 antisense oligonucleotides.
[0087] In some embodiments, the oligonucleotide represents at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of the full-length UNC13A protein.
[0088] In some embodiments, the oligonucleotide exhibits a reduction of at least 50%, 60%, 70%, 80%, or 90% of the misspliced UNC13A transcript.
[0089] In another embodiment, a method for treating a patient requiring treatment for a neurological disease and / or neurological disorder is provided herein, comprising administering an oligonucleotide according to any one of claims 1 to 64 to the patient.
[0090] In some embodiments, neurological disorders are selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, limbic-dominant age-related TDP-43 encephalopathy (LATE)), epilepsy, age-related TDP-43 brain disease with sclerosis (CARTS), facial-onset sensorimotor neuropathy, Guam Parkinson's dementia complex, multiple system proteinopathy, CTE, and synaptic disorders such as autism.
[0091] In some embodiments, the neurological disease is ALS.
[0092] In some embodiments, the neurological disorder is FTD.
[0093] In some embodiments, the neurological disorder is ALS with FTD.
[0094] In some embodiments, the neurological disorder is Alzheimer's disease (AD).
[0095] In some embodiments, the neurological disorder is Parkinson's disease (PD).
[0096] In some embodiments, the neuropathy is chemotherapy-induced neuropathy. [Brief explanation of the drawing]
[0097] [Figure 1] Examples of antisense oligonucleotides (AONs) are shown, some of which are complementary to mRNA transcripts or premRNA transcripts. Dashed lines indicate the positions of AONs that may or may not be occupied by spacers. [Modes for carrying out the invention]
[0098] Features and other details of this disclosure are described in more detail here. Certain terms used in this specification, examples, and appended claims are summarized here. These definitions should be read in light of the remainder of this disclosure and should be understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.
[0099] Oligonucleotides capable of targeting regions of transcripts transcribed from genes are disclosed herein. In various embodiments, such oligonucleotides target the UNC13A transcript. In addition, oligonucleotides comprising antisense oligonucleotide sequences, and methods for using them to treat neurological diseases such as amyotrophic lateral sclerosis and frontotemporal dementia, and / or neuropathy such as chemotherapy-induced neuropathy are disclosed herein. In various embodiments, the oligonucleotides target sequences of the UNC13A transcript that result in a reduction in the level of misspliced UNC13A transcript. Also disclosed are pharmaceutical compositions comprising UNC13A oligonucleotides targeting regions of the UNC13A transcript for the treatment of neurological diseases and / or neuropathy, and the manufacture of pharmaceuticals containing the disclosed UNC13A oligonucleotides targeting regions of the UNC13A transcript for use in the treatment of neurological diseases and / or neuropathy.
[0100] definition Terms such as “to treat,” “to cure,” and “to treat” are used herein in general to mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in that it partially or completely cures the disease and / or adverse effects caused by the disease. As used herein, the term “treatment” encompasses any treatment of a disease in mammals, in particular humans, and includes (a) inhibiting the disease, i.e., preventing an increase in the severity or extent of the disease; (b) alleviating the disease, i.e., causing partial or complete improvement of the disease; or (c) preventing a relapse of the disease, i.e., preventing the disease from becoming active again after a previous successful treatment of the symptoms of the disease or after treatment of the disease.
[0101] "Prevention" includes delaying the onset of clinical symptoms, complications, or biochemical signs of a state, disorder, disorder, disorder, or condition in a subject who may have or is prone to having a state, disorder, disorder, disorder, or condition, but has not yet experienced or shown any clinical or subclinical symptoms of the state, disorder, disorder, disorder, or condition. "Prevention" includes preventive treatment of a state, disorder, disorder, disorder, or condition in a subject, or a state, disorder, disorder, disorder, or condition developing in a subject, and includes preventive treatment of clinical symptoms, complications, or biochemical signs of a state, disorder, disorder, disorder, or condition in a subject, or a state, disorder, disorder, disorder, or condition developing in a subject.
[0102] As used herein, the terms “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” refer interchangeably to any and all solvents, dispersions, coatings, isotonic agents, and absorption retarders, etc., that are suitable for pharmaceutically active administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may also contain other active compounds that provide supplemental, additional, or enhanced therapeutic functions.
[0103] As used herein, the term “pharmaceutical composition” refers to a composition comprising at least one biologically active compound disclosed herein, such as UNC13A antisense oligonucleotide (AON), formulated with one or more pharmaceutically acceptable excipients.
[0104] The terms “individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the present invention can be administered to mammals such as humans, but can also be administered to other mammals such as animals requiring veterinary treatment, e.g., domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammal treated by the method of the present invention is preferably a mammal in which modulation of UNC13A expression and / or activity is desired.
[0105] As used herein, “UNC13A” (also known as Unc-13 homolog A, Munc13-1, KIAA1032, unc-13 homolog A (C. elegans), or protein Unc-13 homolog A) refers to the gene or gene product (e.g., the protein or mRNA transcript (including premRNA) encoded by the gene) and its allele variants, as well as orthologues found in non-human species (e.g., non-human primates or mice), as identified by Entrez Gene ID number 23025.
[0106] The term "UNC13A transcript" refers to a UNC13A transcript that may be either a UNC13A pre-mRNA sequence or a UNC13A mature RNA sequence. While UNC13A transcript sequences have been shown to contain thymine (T), those skilled in the art will understand that thymine (T) can generally be replaced with uracil (U) in RNA sequences.
[0107] The terms “UNC13A oligonucleotide,” “UNC13A antisense oligonucleotide,” or “UNC13A AON” refer to oligonucleotides that can increase, restore, or stabilize full-length UNC13A activity, e.g., full-length UNC13A expression, e.g., full-length UNC13A mRNA and / or full-length UNC13A protein expression. Generally, UNC13A oligonucleotides reduce the level of misspliced UNC13A transcripts by targeting UNC13A transcripts (e.g., UNC13A premRNA, or misspliced UNC13A having a target sequence). In various embodiments, UNC13A oligonucleotides contain a sequence that is at least 85% complementary to an isolength portion of a transcript containing sequences that are at least 90% identical to sequence numbers 1-12. While UNC13A target sequences have been shown to contain thymine (T), those skilled in the art will understand that thymine (T) can generally be replaced with uracil (U) in RNA sequences.
[0108] In various embodiments, the UNC13A oligonucleotide is characterized by having one or more spacers, where each spacer divides the UNC13A oligonucleotide into segments of linked nucleosides. In various embodiments, the UNC13A oligonucleotide has two spacers. In one embodiment, the UNC13A oligonucleotide has three segments of linked nucleosides separated by two spacers. In such embodiments, the UNC13A oligonucleotide has one segment having up to seven linked nucleosides. For example, the UNC13A oligonucleotide may have, at its 5' to 3' end, five linked nucleosides followed by a spacer, seven linked nucleosides followed by a second spacer, and four linked nucleosides. Thus, the second segment of seven linked nucleosides makes up one segment having up to seven linked nucleosides.
[0109] As used herein, the term “UNC13A oligonucleotide” encompasses both “UNC13A parent oligonucleotides” and “UNC13A oligonucleotides having one or more spacers” (e.g., UNC13A oligonucleotides having two spacers). Examples of UNC13A oligonucleotides include oligonucleotides containing any one of the sequences 13-1283 or 2571-2594.
[0110] The term "UNC13A parent oligonucleotide" refers to an oligonucleotide that targets the UNC13A transcript and can increase, restore, or stabilize full-length UNC13A activity, e.g., full-length UNC13A expression, e.g., full-length UNC13A mRNA and / or full-length UNC13A protein expression. UNC13A parent oligonucleotides do not contain spacers. Examples of UNC13A parent oligonucleotides include oligonucleotides containing any one of the sequences from SEQ ID NOs: 13-1283. UNC13A oligonucleotides containing spacers are described with respect to the corresponding UNC13A parent oligonucleotide, as described below.
[0111] The term “olvl molecule having one or more spacers” or “olvl molecule containing a spacer” refers to an oligonucleotide having at least one spacer. In various embodiments, an oligonucleotide having one or more spacers may include one spacer, two spacers, three spacers, four spacers, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, an oligonucleotide containing one or more spacers includes at least one segment having up to seven linked nucleosides. For example, as described in the direction from 5' to 3', an oligonucleotide containing a spacer may include a segment having four linked nucleosides, followed by a spacer, a second segment having eight linked nucleosides, followed by a second spacer, and a third segment having five linked nucleosides. Here, the first segment with four linked nucleosides and the third segment with five linked nucleosides each represent a segment having up to seven linked nucleosides. As another example, an oligonucleotide with spacers may include a segment having 7 linked nucleosides, followed by a spacer, a second segment having 2 linked nucleosides, followed by a second spacer, and a third segment having 7 linked nucleosides. Here, the first and third segments having 7 nucleosides and the second segment having 2 linked nucleosides represent segments having up to 7 linked nucleosides. In various embodiments, an oligonucleotide with one or more spacers may include multiple segments having up to 7 linked nucleosides. In various embodiments, each segment of an oligonucleotide with one or more spacers may have up to 7 linked nucleosides. For example, an oligonucleotide may be 18mer and may include two spacers that divide the 18mer into three distinct segments, each having 6 linked nucleosides. Thus, each segment of the oligonucleotide may have up to 6 linked nucleosides.
[0112] Generally, UNC13A oligonucleotides containing one or more spacers are described in relation to the corresponding UNC13A parent oligonucleotide. An exemplary UNC13A oligonucleotide containing one or more spacers includes any of sequence numbers 2571-2594.
[0113] In various embodiments, one or more spacers may be located at one or more positions of the oligonucleotide. A spacer may be located between a first position and a second position of the oligonucleotide. As used herein, a spacer located between a first position and a second position includes a spacer located at the first position, at the second position, or at any position of the oligonucleotide sandwiched between the first and second positions.
[0114] In this specification, the term “therapeutic dose” means the amount of oligonucleotide that elicits a biological or medical response in a tissue, system, animal, or human, as determined by a researcher, veterinarian, physician, or other clinician. In one embodiment, the oligonucleotide contains a sequence that is at least 85% complementary to an isolength portion of a transcript containing a sequence that is at least 90% identical to sequence numbers 1284-2554. The oligonucleotide is administered in a therapeutic dose to treat and / or prevent a disease, condition, disorder, or state, such as a neurological disease and / or neurological disorder. Alternatively, the therapeutic dose of oligonucleotide is the amount required to achieve a desired therapeutic and / or preventive effect, such as an amount that results in the prevention or reduction of symptoms associated with a disease related to decreased UNC13A activity in motor neurons.
[0115] The phrase "UNC13A oligonucleotide that targets the UNC13A transcript" refers to a UNC13A oligonucleotide that binds to the UNC13A transcript.
[0116] As used herein, the term “pharmaceutically acceptable salt” refers to a salt of any acidic or basic group that may be present in the UNC13A oligonucleotide used in the composition. The UNC13A oligonucleotides contained in the composition of the present invention are inherently basic and can form a wide variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds include, but are not limited to, those that form non-toxic acid addition salts, i.e., salts containing pharmaceutically acceptable anions, and include malates, oxalates, chlorides, bromides, iodides, nitrates, sulfates, bisulfates, phosphates, acidic phosphates, isonicotinates, acetates, lactates, salicylates, citrates, tartrates, oleates, tannates, pantothenates, bicarbonate tartrates, ascorbicates, succinates, maleates, gentisinates, fumarates, glucons, glucurons, saccharates, formates, benzoates, glutamates, methanesulfons, ethanesulfons, benzenesulfons, p-toluenesulfons, and pamoates (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. The UNC13A oligonucleotide contained in this composition, including the amino portion, can form pharmaceutically acceptable salts with various amino acids in addition to the acids described above. Compounds contained in this composition, which are inherently acidic, can form base salts with various pharmaceutically acceptable cations. Examples of such salts include alkali metal salts or alkaline earth metal salts, and in particular calcium salts, magnesium salts, sodium salts, and lithium salts. The pharmaceutically acceptable salts of this disclosure include, for example, pharmaceutically acceptable salts of UNC13A oligonucleotides containing any of the sequences of SEQ ID NOs: 13-1283 or 2571-2594.
[0117] The UNC13A oligonucleotides of this disclosure may contain one or more chiral centers, groups, bonds, and / or double bonds, and therefore may exist as stereoisomers such as geometric isomers, enantiomers, or diastereomers. As used herein, the term “stereoisomer” encompasses all geometric isomers, enantiomers, or diastereomers. These compounds may be designated by the symbol “R” or “S” (or “Rp” or “Sp”) depending on the stereoconfiguration of substituents around a stereocentral atom, e.g., a stereocentral carbon, phosphorus, or sulfur atom. In some embodiments, one or more bonds in a compound may have either an Rp configuration or an Sp configuration (e.g., one or more phosphorothioate bonds may have either an Rp configuration or an Sp configuration). The configuration of each phosphorothioate bond may be independent of other phosphorothioate bonds (e.g., one phosphorothioate bond may have an Rp configuration and a second phosphorothioate bond may have an Sp configuration). In various embodiments, UNC13A oligonucleotides can have mixed configurations of phosphorothioate bonds. For example, a UNC13A oligonucleotide may have five phosphorothioate bonds in an Rp configuration, followed by fifteen phosphorothioate bonds in an Sp configuration, followed by five phosphorothioate bonds in an Rp configuration. The present invention encompasses various stereoisomers and mixtures thereof of these compounds. Stereoiomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated as "(±)" in nomenclature, but those skilled in the art will recognize that the structure may implicitly indicate a chiral center.
[0118] The individual stereoisomers of the UNC13A oligonucleotides of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by the preparation of a racemic mixture followed by resolution methods well known to those skilled in the art. These resolution methods include (1) attachment of the enantiomeric mixture to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography, and liberation of the optically pure product from the auxiliary, (2) salt formation using an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on a chiral chromatography column. Mixtures of stereoisomers can also be resolved into their component stereoisomers by well-known methods such as chiral phase gas chromatography, chiral phase supercritical fluid chromatography, chiral phase simulated moving bed chromatography, chiral phase high performance liquid chromatography, crystallization of the compound as a chiral salt complex, or crystallization of the compound in a chiral solvent. Stereoisomers can also be obtained from stereoisomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthesis methods.
[0119] The UNC13A oligonucleotides disclosed herein can exist in solvated and non-solvated forms with pharmaceutically acceptable solvents such as water, ethanol, etc., and the present invention is intended to encompass both solvated and non-solvated forms.
[0120] This disclosure also encompasses fluorescently labeled compounds of the present invention. This disclosure also encompasses isotopically labeled compounds of the present invention (i.e., isotopically labeled UNC13A oligonucleotides) that are identical to those listed herein except that one or more atoms have been replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number found in nature. Examples of isotopes that can be incorporated into the compounds of the present invention include, respectively, 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P,32 P, 33 P, 35 S, 18 F, and 36 Examples include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, and chlorine, such as Cl.
[0121] A certain isotope-labeled disclosed compound (for example, 3 H, 14 C, or 35 Those labeled with S may be useful in compound and / or substrate tissue distribution assays. Tritiation (i.e., 3 H), carbon-14 (i.e., 14 C) Isotopes are particularly preferred for their ease of preparation and detectability. Furthermore, deuterium (i.e., 2 Substitution with heavier isotopes, such as 1H, may result in certain therapeutic benefits due to greater metabolic stability (e.g., increased in vivo half-life or reduced required dosage), and therefore may be preferable in some situations.
[0122] As used herein, “2'-O-(2-methoxyethyl)” (also 2'-MOE and 2'-O(CH2)2OCH3 and MOE) refers to the O-methoxyethyl modification at the 2' position of the furanose ring. 2'-O-(2-methoxyethyl) is used interchangeably with “2'-O-methoxyethyl” in this disclosure. The sugar moiety in a nucleoside modified with 2'-MOE is the modified sugar.
[0123] As used herein, “2'-MOE nucleoside” (or “2'-O-(2-methoxyethyl) nucleoside” means a nucleoside containing a 2'-MOE modified sugar moiety.
[0124] As used herein, “2'-substituted nucleoside” means a nucleoside having a substituent other than H or OH at the 2' position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides having bicyclic sugar modifications.
[0125] As used herein, "5-methylcytosine" (5-MeC) refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine (5-MeC) is a modified nucleic acid base.
[0126] As used herein, “bicyclic sugar” means a furanose ring modified by a bridge between two atoms. Bicyclic sugars are modified sugars.
[0127] As used herein, “bicyclic nucleoside” (also known as BNA) means a nucleoside having a sugar moiety that includes a bridge that connects two carbon atoms of a sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring.
[0128] As used herein, “cap structure” or “terminal cap portion” means a chemical modification incorporated into any of the ends of an antisense compound.
[0129] As used herein, "cEt" or "restricted ethyl" means a bicyclic nucleoside having a sugar moiety containing a bridge connecting a 4'-carbon and a 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-O-2.
[0130] As used herein, “restricted ethyl nucleoside” (also known as cEt nucleoside) means a nucleoside containing a bicyclic sugar moiety including a 4'-CH(CH3)-O-2' bridge. In some embodiments, cEt can be modified. In some embodiments, cEt can be S-cEt (in S-restricted ethyl 2'-4'-bridged nucleic acid). In some other embodiments, cEt can be R-cEt.
[0131] As used herein, “nucleoside bond” refers to a covalent bond between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, “non-natural bond” refers to a “modified nucleoside bond.”
[0132] As used herein, “contiguous” in the context of oligonucleotides refers to nucleosides, nucleic acid bases, sugar moieties, or nucleoside bonds that are directly adjacent to each other. For example, “contiguous nucleic acid bases” means nucleic acid bases that are directly adjacent to each other in a sequence. As an opposite example, two nucleosides separated by a spacer are not contiguous.
[0133] As used herein, “locked nucleic acid,” “LNA,” or “LNA nucleoside” means a nucleic acid monomer having a crosslink (e.g., methylene, ethylene, aminooxy, or oxyimino crosslink) that bonds two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, (A) α-L-methyleneoxy(4'-CH2-O-2')LNA, (B) β-D-methyleneoxy(4'-CH2-O-2')LNA, (C) ethyleneoxy(4'-(CH2)2-O-2')LNA, (D) aminooxy(4'-CH2-ON(R)-2')LNA, and (E) oxyamino(4'-CH2-N(R)-O-2')LNA, where R is H, C1-C 12 It is an alkyl group or a protecting group (see U.S. Patent No. 7,427,672 issued on September 23, 2008).
[0134] As used herein, LNA compounds include, but are not limited to, compounds having at least one crosslink between the 4' and 2' positions of a sugar, each of which independently comprises -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x The formula comprises one or two to four linking groups independently selected from - and -N(R1)-, where x is 0, 1, or 2, n is 1, 2, 3, or 4, and each R1 and R2 independently comprises H, a protecting group, a hydroxyl group, and C1-C 12 Alkyl, substituted C1-C12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1~C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group.
[0135] An example of a 4'-2' bridging group included in the definition of LNA is the formula: -[C(R1)(R2)] n -,-[C(R1)(R2)] n One of the following is a bridged group: -O-, -C(R1R2)-N(R1)-O-, or -C(R1R2)-ON(R1)-. Furthermore, other bridged groups included in the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2-N(R1)-O-2'-bridged groups, where each R1 and R2 independently consists of H, a protecting group, or C1-C 12 It is alkyl.
[0136] Furthermore, the definition of LNA according to the present invention also includes LNA in which the 2'-hydroxyl group of the ribosyl sugar ring is bonded to the 4' carbon atom of the sugar ring, thereby forming a bridge and creating a bicyclic sugar moiety. The bridge can be a methylene(-CH2-) group bonding the 2' oxygen atom and the 4' carbon atom, in which case the term methyleneoxy(4'-CH2-O-2')LNA is used. Moreover, in the case of a bicyclic sugar moiety having an ethylene bridge group at this position, the term ethyleneoxy(4'-CH2CH2-O-2')LNA is used.
[0137] As used herein, “spacer” refers to a nucleoside substituent (e.g., a non-nucleoside group that replaces a nucleoside present in the UNC13A parent oligonucleotide). Spacers are characterized by the absence of a nucleotide base and the replacement of the nucleoside sugar moiety with a non-sugar substituent. The non-sugar substituents of spacers lack aldehyde, ketone, acetal, ketal, hemiacetal, or hemiketal groups. Therefore, while the non-sugar substituents of spacers can bond to the 3' and 5' positions of an adjacent nucleoside via an internucleoside linker as described herein, they cannot form covalent bonds with nucleotide bases (i.e., they cannot link nucleotide bases to other groups in the oligonucleotide, such as internucleoside bonds, conjugate groups, or terminal groups). Generally, UNC13A oligonucleotides with spacers are described in relation to the UNC13A parent oligonucleotide, where the spacer replaces a nucleoside in the UNC13A parent oligonucleotide. In all embodiments of this disclosure, the spacer cannot hybridize to a nucleoside containing a nucleic acid base at the corresponding position in the UNC13A transcript within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is located after nucleoside 4 of the AON (i.e., at position 5 from the 5' end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position in the target UNC13A transcript).
[0138] As used herein, “mismatch” or “non-complementary group” means a case in which a group of the first nucleic acid (e.g., a nucleic acid base) cannot pair with the corresponding group (e.g., a nucleic acid base) of the second nucleic acid or target nucleic acid.
[0139] As used herein, “modified nucleoside bond” refers to substitution or any alteration of a naturally occurring nucleoside bond (e.g., a phosphodiester nucleoside bond).
[0140] As used herein, “modified nucleic acid base” means any nucleic acid base other than adenine, cytosine, guanine, thymine, or uracil. Examples of modified nucleic acid bases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. “Unmodified nucleic acid base” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0141] As used herein, “modified nucleoside” means a nucleoside that independently has a modified sugar moiety and / or a modified nucleic acid base. A universal base is a modified nucleic acid base that can pair with any one of the five unmodified nucleic acid bases. Modified nucleosides include debasic nucleosides that lack a nucleic acid base. However, modified nucleosides do not contain spacers or other groups that cannot link nucleic acid bases.
[0142] As used herein, “linked nucleosides” refers to nucleosides linked in a continuous sequence (i.e., there are no additional nucleosides between the linked ones). In various embodiments, an oligonucleotide may have different segments of linked nucleosides linked via spacers. Here, the spacers (i.e., nucleoside substitutions) are not considered nucleosides and thus divide the oligonucleotide into two segments of linked nucleosides. An oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides linked in a continuous sequence), followed by a spacer, and then a second segment of Z linked nucleosides. Here, the Y linked nucleosides and the Z linked nucleosides are described either in a 5'-to-3' direction or a 3'-to-5' direction. In various embodiments, the first segment consists of seven or fewer linked nucleosides (e.g., Y=7 or less), while the second segment contains eight or more linked nucleosides (e.g., Z=8 or more).
[0143] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one (i.e., one or more) modified nucleoside bonds, modified sugars, and / or modified nucleic acid bases.
[0144] As used herein, "modified sugar" or "modified sugar moiety" means a modified furanosyl sugar moiety, or a modified sugar moiety other than a furanosyl moiety that can link nucleic acid bases to another group such as an internucleoside bond, conjugate group, or terminal group in an oligonucleotide.
[0145] As used herein, “monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
[0146] As used herein, “motif” means a pattern of unmodified and modified nucleosides in an antisense compound.
[0147] As used herein, “natural sugar moiety” means the sugar moiety found in DNA(2'-H) or RNA(2'-OH).
[0148] As used herein, “naturally occurring nucleoside bond” means a 3'-to-5' phosphodiester bond.
[0149] As used herein, “non-complementary nucleic acid bases” refers to a pair of nucleic acid bases that do not form hydrogen bonds with each other or otherwise support hybridization.
[0150] As used herein, “nucleic acid” refers to a molecule composed of monomeric nucleotides. Examples of nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, non-coding RNA, small interfering ribonucleic acid (siRNA), short-hairpin RNA (shRNA), and microRNA (miRNA).
[0151] As used herein, “nucleic acid base” means a heterocyclic portion that can base-pair with a base of another nucleic acid.
[0152] As used herein, “nucleic acid base complementarity” refers to a nucleic acid base that can base-pair with another nucleic acid base. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleic acid bases refer to nucleic acid bases of an antisense compound that can base-pair with the corresponding nucleic acid bases of the target nucleic acid. For example, if a nucleic acid base at a particular position in an antisense compound can hydrogen-bond with a nucleic acid base at a particular position in the target nucleic acid, the positions of the hydrogen bonds between the oligonucleotide and the target nucleic acid are considered complementary in that nucleic acid base pair.
[0153] As used herein, “nucleic acid sequence” means the sequence of nucleic acid bases, independent of any sugars, bonds, and / or nucleic acid base modifications.
[0154] As used herein, “nucleoside” refers to a nucleic acid base linked to a sugar. The term “nucleoside” also includes “modified nucleosides” that independently have a modified sugar moiety and / or a modified nucleic acid base.
[0155] As used herein, “nucleoside mimetic” includes structures used to replace a sugar or sugar and base at one or more positions in an oligomeric compound, such as morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranil, bicyclo, or tricyclo sugar mimetic, for example, a nucleoside mimetic having a non-furanose sugar unit, and does not necessarily have to replace a bond. Nucleotide mimes include structures used to replace nucleosides and bonds at one or more positions in oligomeric compounds, such as peptide nucleic acids or morpholinos (morpholinos linked by phosphorodiamidates or other non-phosphodiester bonds). Sugar substitutes overlap slightly with nucleoside mimes, which is a slightly broader term, but are intended to indicate only the substitution of sugar units (furanose rings). The tetrahydropyranyl ring provided herein is an example of a sugar substitute in which a furanose sugar group is replaced by a tetrahydropyranyl ring system. "Mimicking" refers to a group substituted for a sugar, a nucleic acid base, and / or a nucleoside bond. Generally, mimes are used in place of a sugar or a combination of sugar-nucleoside bonds, while the nucleic acid base is retained for hybridization to a selected target.
[0156] As used herein, “nucleotide” means a nucleoside having a phosphate group covalently bonded to the sugar portion of the nucleoside.
[0157] As used herein, “oligomeric compound” or “oligomer” means a polymer of linked monomer subunits that can hybridize to at least one region of a nucleic acid molecule.
[0158] As used herein, “oligonucleotide” means a polymer of one or more segments of linked nucleosides, each of which may be independently modified or unmodified.
[0159] As used herein, “hotspot region” refers to a range of nucleic acid bases on a target nucleic acid suitable for oligomer compound-mediated modulation of the splicing of the target nucleic acid.
[0160] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to specific mechanisms, the most common mechanisms of hybridization involve hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between complementary nucleic acid bases.
[0161] As used herein, “increasing the amount of activity” means more transcriptional expression, more accurate splicing resulting in full-length mature mRNA and / or protein expression, and / or more activity compared to transcriptional expression or activity in an untreated or control sample.
[0162] Antisense medication Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate transcripts such as mRNA. In various embodiments, antisense therapeutics may include one or more spacers and can be used to modulate transcripts transcribed from genes such as UNC13A premRNA.
[0163] Antisense therapeutics may be single-stranded or double-stranded deoxyribonucleic acid (DNA) based, ribonucleic acid (RNA) based, or DNA / RNA chemoanalytic compounds. Generally, antisense therapeutics are designed to contain a sequence that is complementary or nearly complementary to the mRNA or premRNA sequence transcribed from a given gene in order to facilitate binding between the antisense therapeutic and premRNA or mRNA. In certain embodiments, the antisense therapeutic acts by binding to mRNA or premRNA, thereby inhibiting protein translation, altering premRNA splicing to mature mRNA (e.g., by preventing the binding of appropriate proteins such as splicing activator proteins), and / or causing mRNA disruption. In certain embodiments, the antisense therapeutic sequence is complementary to a portion of the sense sequence of the target gene or mRNA. In certain embodiments, the antisense therapeutic described herein is an oligonucleotide-based compound comprising an oligonucleotide sequence complementary to the premRNA sense or a portion thereof, and one or more spacers. In certain embodiments, the antisense therapeutic described herein may also be a nucleotide chemoanalytic compound.
[0164] In certain embodiments, the oligonucleotides disclosed herein may be oligonucleotide sequences having a length of 18 oligonucleotide units. As used herein, “oligonucleotide unit” refers to either an oligonucleotide nucleoside (e.g., a nucleoside containing a sugar and / or a nucleic acid base) or a nucleoside substituent (e.g., a spacer). In various embodiments, the oligonucleotides are 18 oligonucleotide units long.
[0165] In certain embodiments, the AON may include a chemically modified nucleoside (e.g., a 2'-O-methylated nucleoside or a 2'-O-(2-methoxyethyl) nucleoside) and a modified nucleoside bond (e.g., a phosphorothioate bond). In certain embodiments, the AON described herein includes an oligonucleotide sequence complementary to an RNA sequence such as a UNC13A mRNA sequence. In certain embodiments, the AON described herein may include a chemically modified nucleoside and a modified nucleoside bond (e.g., a phosphorothioate bond). In certain embodiments, the AON described herein includes one or more spacers.
[0166] In various embodiments, the oligonucleotide includes one or more spacers. In various embodiments, the oligonucleotide includes two spacers. For example, the oligonucleotide includes 18 oligonucleotide units having 16 nucleic acid bases and 2 nucleoside substituents (e.g., 2 spacers). Further embodiments of oligonucleotides having one spacer and oligonucleotides having two spacers are described herein.
[0167] In some embodiments, the antisense oligonucleotide may be a gene transcript inhibitor (e.g., shRNA, siRNA, PNA, LNA, 2'-O-methyl(2'OMe) antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl)(MOE)AON, or a morpholino oligomer (e.g., phosphorodiamidate morpholino (PMO))) or a composition containing such a compound. In some embodiments, the oligonucleotide may be 2'OMe (e.g., an AON containing one or more 2'OMe-modified sugars), MOE (e.g., an AON containing one or more MOE-modified sugars), peptide nucleic acids (e.g., an AON containing one or more N-(2-aminoethyl)-glycine units linked by amino or carbonylmethylene bonds as repeating units instead of a sugar-phosphate backbone), locked nucleic acids (e.g., an AON containing one or more locked ribose, which may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an AON containing one or more cET sugars), or restricted methoxy The antisense oligonucleotide (AON) is an antisense oligonucleotide (AON) containing ethyl (cMOE) (e.g., an AON containing one or more cMO sugars), morpholino oligomer (e.g., an AON containing one or more PMO-containing skeletons), deoxy-2'-fluoronucleoside (e.g., an AON containing one or more 2'-fluoro-β-D-arabinonucleosides), tricyclo-DNA (tcDNA) (e.g., an AON containing one or more tcDNA-modified sugars), 2'-O,4'-C-ethylene-bridged nucleic acid (ENA) (e.g., an AON containing one or more ENA-modified sugars), or hexitol nucleic acid (HNA) (e.g., an AON containing one or more HNA-modified sugars).In some embodiments, AON comprises one or more internucleoside bonds independently selected from phosphorothioate bonds, phosphodiester bonds, phosphotryester bonds, methylphosphonate bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphorodiamidate bonds, phosphorodiamidate morpholino (PMO) (morpholino) bonds, PNA bonds, or any combination of phosphorothioate bonds, phosphodiester bonds, phosphotryester bonds, methylphosphonate bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphorodiamidate bonds, phosphorodiamidate morpholino (PMO) (morpholino) bonds, and PNA bonds. In some embodiments, UNC13A AON comprises one or more phosphorothioate bonds, phosphodiester bonds, or a combination of phosphorothioate bonds and phosphodiester bonds.
[0168] Peptide nucleic acids (PNAs) are short, artificially synthesized polymers having a structure that mimics DNA or RNA. PNAs contain a backbone composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In certain embodiments, the PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and / or stabilize their levels (e.g., full-length UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).
[0169] Locked nucleic acids (LNAs) are oligonucleotide sequences containing one or more modified RNA nucleotides in which the ribose portion is modified by an extra crosslink connecting the 2' oxygen and 4' carbon atoms. LNAs are thought to have a higher Tm than similar oligonucleotide sequences. In certain embodiments, the LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity. For example, LNAs can bind to UNC13A premRNA, prevent missplicing of UNC13A premRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).
[0170] Morpholino oligomers are oligonucleotide compounds containing DNA bases attached to a methylenemorpholine ring skeleton linked via phosphorodiamidate groups. In certain embodiments, the morpholino oligomers of the present invention can be designed to bind to a specific premRNA sequence of interest. For example, a morpholino oligomer binds to UNC13A premRNA, thereby preventing missplicing of the premRNA and increasing, restoring, and / or stabilizing UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can be used as antisense therapeutic agents that bind with high specificity to UNC13A premRNA sequences, prevent missplicing of UNC13A premRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can also be used to bind to UNC13A premRNA sequences, alter UNC13A premRNA splicing and UNC13A gene expression, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).
[0171] UNC13A oligonucleotides complementary to UNC13A transcripts In some embodiments, the UNC13A AON includes a sequence that is at least % complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the UNC13A transcript (e.g., SEQ ID NOs. 1-12). In some embodiments, the UNC13A AON includes a sequence that is 90-95% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the UNC13A transcript (e.g., SEQ ID NOs. 1-12). In certain embodiments, the UNC13A AON includes a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the UNC13A transcript (e.g., SEQ ID NOs. 1-12). In certain embodiments, the UNC13A AON includes a sequence that is 84%-88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the UNC13A transcript (e.g., SEQ ID NOs. 5057-5065 or SEQ ID NOs. 1-12). In certain embodiments, the UNC13A AON includes a sequence that is 89% to 92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the misspliced UNC13A transcript (e.g., SEQ ID NOs. 1 to 12). In certain embodiments, the UNC13A AON includes a sequence that is 94% to 96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a region of the UNC13A transcript (e.g., SEQ ID NOs. 1 to 12).
[0172] In various embodiments, UNC13A AON includes a sequence that shares at least 85% identity with one of the isolength portions of sequence numbers 13-1283 or 2571-2594. In various embodiments, UNC13A AON includes a sequence that shares at least 90% identity with one of the isolength portions of sequence numbers 2571-2594.
[0173] In some embodiments, UNC13A AON includes a spacer and has segments having up to seven linked nucleosides. In some embodiments, UNC13A AON includes a spacer and has segments having up to seven, six, five, four, or three linked nucleosides.
[0174] UNC13A AON binding specificity can be assessed by measuring parameters such as dissociation constant, melting temperature, or other criteria such as changes in protein or RNA expression levels, or by other assays that measure UNC13A activity or expression.
[0175] In some embodiments, UNC13A AON may include non-double-stranded oligonucleotides. In some embodiments, UNC13A AON may include a double helix of two oligonucleotides, where the first oligonucleotide comprises a nucleic acid base sequence that is completely or nearly completely complementary to the UNC13A premRNA sequence, and the second oligonucleotide comprises a nucleic acid base sequence that is complementary to the nucleic acid base sequence of the first oligonucleotide.
[0176] In some embodiments, UNC13A AON can target UNC13A premRNA produced from the UNC13A gene of one or more species. For example, UNC13A AON can target UNC13A premRNA from a mammalian UNC13A gene, such as the human (i.e., Homo sapiens) UNC13A gene. In certain embodiments, UNC13A AON targets human UNC13A premRNA. In some embodiments, UNC13A AON contains a nucleic acid sequence complementary to the nucleic acid sequence of the UNC13A gene or UNC13A premRNA or a portion thereof.
[0177] The UNC13A AON described herein includes antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below.
[0178] [Table 1-1]
[0179] [Table 1-2]
[0180] [Table 1-3]
[0181] [Table 1-4]
[0182] [Table 1-5] (Continued from Table 1)
[0183] [Table 1-6]
[0184] Table 1-7
[0185] Table 1-8
[0186] Table 1-9
[0187] Table 1-10
[0188] Table 1-11
[0189] Table 1-12
[0190] Table 1-13
[0191] Table 1-14
[0192] Table 1-15
[0193] Table 1-16
[0194] Table 1-17
[0195] Table 1-18
[0196] Table 1-19
[0197] Table 1-20
[0198] Table 1-21
[0199] Table 1-22
[0200] Table 1-23
[0201] Table 1-24 *At least one (i.e., one or more) nucleoside bonds in the oligonucleotide sequence are independently selected from phosphorothioate bonds, alkyl phosphate bonds, phosphorodithioate bonds, phosphotriester bonds, alkylphosphonate bonds, 3-methoxypropylphosphonate bonds, methylphosphonate bonds, aminoalkylphosphotriester bonds, alkylenephosphonate bonds, phosphine bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphorodiamidate bonds, phosphorodiamidate (e.g., phosphorodiamidate morpholino (PMO), 3'-aminoribose, or 5'-aminoribose) bonds, aminoalkylphosphoroamidate bonds, thiophosphoroamidate bonds, thionoalkylphosphonate bonds, thionoalkylphosphotriester bonds, thiophosphate bonds, selenophosphate bonds, and boranophosphate bonds.
[0202] UNC13A Transfer In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 1. (Sequence ID 1 (SOURCE NCBI reference sequence NM_001080421.3)).
[0203] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 2. (Sequence ID 2 (SOURCE NCBI reference sequence NM_001387021.1)).
[0204] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 3. (Sequence ID 3 (SOURCE NCBI reference sequence NM_001387022.1)).
[0205] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 4. (Sequence ID 4 (SOURCE NCBI reference sequence NM_001387023.1)).
[0206] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 5. (Sequence ID 5 (SOURCE NCBI reference sequence XM_011527810.2)).
[0207] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 6. (Sequence ID 6 (SOURCE(NCBI reference sequence XM_017026502.1))).
[0208] In various embodiments, the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 7. (Sequence ID 7 (SOURCE NCBI reference sequence XM_011527811.2)).
[0209] In various embodiments, the UNC13A transcript is a premRNA UNC13A transcript. In various embodiments, the UNC13A premRNA transcript contains the sequence provided as Sequence ID No. 8. (Sequence ID 8 (SOURCE NCBI reference sequence NG_052872.1)).
[0210] In various embodiments, the UNC13A transcript is a premRNA UNC13A transcript. In various embodiments, the UNC13A premRNA transcript contains the sequence provided as SEQ ID NO: 9. The NCBI reference sequence NC_000019.10 and the reference GRCh38.p13 primary assembly are SEQ ID NO: 9.
[0211] UNC13A transcript with latent exons In some embodiments, the UNC13A AON targets a region of the UNC13A transcript containing a latent exon sequence, and the UNC13A mRNA transcript contains the sequence provided as Sequence ID No. 10.
[0212] [Table 2] (Sequence ID 10) (In the sequence, the underlined part is the TDP-43 binding site).
[0213] In some embodiments, the latent exon sequence within the UNC13A mRNA transcript is provided as SEQ ID NO: 11. CCATCTCTCCATCCATCCTTTTATCTACTCATCACTCATTCATCTGTTCAATCATTCATTCATTCACCAGCATTTATTCAACAAACTAGTTCCTGGGGATAAGAGTTCTTTCCAGGAAACCCAGGCAGCTGGAAGAGACATACCCAGACACAAACGGCCCAATCCTGAGTGGTTAGGG (Sequence ID 11).
[0214] In some embodiments, the latent exon sequence within the UNC13A mRNA transcript is provided as SEQ ID NO: 12.
[0215] CCATCTCTCCATCCATCCTTTTATCTACTCATCACTCATTCATCTGTTCAATCATTCATTCATTCACCAGCATTTATTCAACAAACTAGTTCCTGGGGATAAGAGTTCTTTCCAGGAACCCAGGCAG (Sequence ID 12).
[0216] UNC13A oligonucleotides that target the region of the UNC13A transcript. In various embodiments, the UNC13A AON disclosed herein is complementary to a specific region of a UNC13A transcript (e.g., UNC13A premRNA) that contains a sequence sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. In some embodiments, the UNC13A AON contains a sequence complementary to a specific region of a UNC13A transcript that contains a sequence sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. In some embodiments, the UNC13A AON contains a sequence that is at least 85% complementary to a specific region of a UNC13A transcript. In some embodiments, the UNC13A AON contains sequences that are at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON contains sequences that are 90-99% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON contains sequences that are 90-95% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON contains sequences that are 95-99% complementary to a particular region of the UNC13A transcript.
[0217] In some embodiments, UNC13A AON (e.g., UNC13A AON) has a segment having up to seven linked nucleosides. In some embodiments, UNC13A AON has a segment having up to six, five, four, three, or two linked nucleosides. These segments of UNC13A AON may be separated from other segments of UNC13A AON via spacers. The segments of UNC13A AON are complementary to a UNC13A transcript (e.g., UNC13A transcript) containing a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. 1-7 or 10-12, or to a specific region of a UNC13A premRNA transcript transcribed from SEQ ID NOs. 8-9.
[0218] Antisense oligonucleotides having one or more spacers In various embodiments, the antisense oligonucleotide includes one or more spacers. In certain embodiments, the antisense oligonucleotide includes two spacers. Generally, a spacer refers to a nucleoside substituent lacking a nucleotide base, where the nucleoside sugar portion is replaced by a non-sugar substituent. The non-sugar substituent cannot be linked to a nucleic acid base, but can be linked to the 3' and 5' positions of a nucleoside adjacent to the spacer via internucleoside linking groups.
[0219] As used herein, “oligonucleotide unit” means either an oligonucleotide nucleoside (e.g., a nucleoside containing a sugar and / or nucleic acid base) or a nucleoside substituent (e.g., a spacer).
[0220] In certain embodiments, an oligonucleotide having one or more spacers has a length of 18 oligonucleotide units. In various embodiments, an oligonucleotide having one or more spacers has a length of at least 18 oligonucleotide units.
[0221] In various embodiments, UNC13A AON includes a sequence that shares at least 85% identity with one of the isolength portions of sequence numbers 13-1283 or 2571-2594.
[0222] In some embodiments, the spacer is given by equation (X)
[0223] [ka] It is, In the formula, ring A is as defined herein.
[0224] In some embodiments, the spacer is given by equation (Xa)
[0225] [ka] It is, In the formula, ring A is as defined herein, and the -CH2-O group is located on the ring A atom adjacent to the -O- group.
[0226] As generally defined herein, ring A of formulas (X) and (Xa) is optionally substituted 4- to 8-membered monocyclic cycloalkyl groups (e.g., ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or 4- to 8-membered monocyclic heterocyclyl groups, the heterocyclyl group comprising one or two heteroatoms selected from O, S, and N (e.g., ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring A is tetrahydrofuranyl. In some embodiments, ring A is tetrahydropyranyl. In some embodiments, ring A is pyrrolidinyl. In some embodiments, ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2, or 3 substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt, -O(CH2)OMe, -O(CH2)2OMe, and CN.
[0227] In some embodiments, tetrahydrofuranil is substituted with one or two substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt, -O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranil is substituted with two substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt, -O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranil is substituted with one substituent selected from halo (e.g., -F, -Cl), -OMe, -OEt, -O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranil is substituted with -O(CH2)2OMe.
[0228] In some embodiments, the spacer is given by formula (I)
[0229] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-, n is 0, 1, 2, or 3.
[0230] In some embodiments, the spacer is given by formula (I')
[0231] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-, n is 0, 1, 2, or 3.
[0232] In some embodiments, the spacer is given by formula (Ia)
[0233] [ka] It is expressed by, in the formula, n is 0, 1, 2, or 3.
[0234] In some embodiments, the spacer is given by formula (Ia')
[0235] [ka] It is expressed by, in the formula, n is 0, 1, 2, or 3.
[0236] As generally defined herein, X is selected from -CH2- and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-.
[0237] As generally defined herein, n is 0, 1, 2, or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In a particular embodiment, n is 3.
[0238] In some embodiments, the spacer is given by formula (II)
[0239] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0240] In some embodiments, the spacer is given by equation (II')
[0241] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O.
[0242] In some embodiments, the spacer is given by formula (Iia)
[0243] [ka] It is represented by [this].
[0244] In some embodiments, the spacer is given by formula (Iia')
[0245] [ka] It is represented by [this].
[0246] In some embodiments, the spacer is given by formula (IIi)
[0247] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0248] In some embodiments, the spacer is given by equation (IIi')
[0249] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O.
[0250] In some embodiments, the spacer is given by formula (IIib)
[0251] [ka] It is represented by [this].
[0252] In some embodiments, the spacer is given by formula (IIib')
[0253] [ka] It is represented by [this].
[0254] In some embodiments, the spacer is given by formula (IIic)
[0255] [ka] It is represented by [this].
[0256] In some embodiments, the spacer is given by formula (IIic')
[0257] [ka] It is represented by [this].
[0258] In some embodiments, the spacer is given by formula (III)
[0259] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O-.
[0260] In some embodiments, the spacer is given by equation (III')
[0261] [ka] It is expressed by, in the formula, X is selected from -CH2- and -O.
[0262] In some embodiments, the spacer is given by formula (IIIa)
[0263] [ka] It is represented by [this].
[0264] In some embodiments, the spacer is given by formula (IIIa')
[0265] [ka] It is represented by [this].
[0266] In some embodiments, the open positions of formulas (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa), and (IIIa') (i.e., positions containing the -CH2- group of X that are not specifically indicated as having only hydrogen atoms) are further substituted with 0 to 3 substituents independently selected from halos (e.g., -F, -Cl), -OMe, -OEt, -O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, formulas (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa), and (IIIa') are not further substituted.
[0267] UNC13A oligonucleotides having one or more spacers are described with respect to the corresponding UNC13A parent oligonucleotide, as will be further described below. In various embodiments, UNC13A oligonucleotides having spacers differ from the UNC13A parent oligonucleotide in that the spacers replace nucleosides in the UNC13A parent oligonucleotide. As used below, “position” of UNC13A oligonucleotide refers to a specific position counted from the 5' end of the UNC13A oligonucleotide. In various embodiments, the spacer replaces one of the nucleosides at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 of the UNC13A parent oligonucleotide. In certain embodiments, the spacer replaces one of the nucleosides at positions 5, 6, 7, 8, 11, 13, or 14 of the UNC13A parent oligonucleotide.
[0268] In various embodiments, the UNC13A oligonucleotide includes two spacers, each replacing a nucleoside in the UNC13A oligonucleotide (for example, the two spacers replace two distinct nucleosides in the UNC13A oligonucleotide). In various embodiments, the first and second spacers are separated by at least 5 nucleic acid bases, at least 6 nucleic acid bases, or at least 7 nucleic acid bases. In specific embodiments, the first and second spacers are separated by at least 2 nucleic acid bases, at least 3 nucleic acid bases, at least 4 nucleic acid bases, at least 5 nucleic acid bases, at least 6 nucleic acid bases, or at least 7 nucleic acid bases. In specific embodiments, the first and second spacers are not adjacent to each other in the oligonucleotide.
[0269] In certain embodiments, the first spacer is replaced by a nucleoside between positions 4 and 9 of the UNC13A oligonucleotide. In various embodiments, the second spacer is replaced by a nucleoside between positions 10 and 15 of the UNC13A oligonucleotide.
[0270] In a preferred embodiment, the first spacer is replaced by the nucleoside at position 8 of the UNC13A oligonucleotide, and the second spacer is replaced by the nucleoside at position 11 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer is replaced by the nucleoside at position 5 of the UNC13A oligonucleotide, and the second spacer is replaced by the nucleoside at position 13 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer is replaced by the nucleoside at position 6 of the UNC13A oligonucleotide, and the second spacer is replaced by the nucleoside at position 14 of the UNC13A oligonucleotide.
[0271] In various embodiments, one or more spacers are arranged in the oligonucleotide to replace one or more adenosine or thymine nucleosides (as opposed to guanine or cytosine nucleosides). For example, one or more spacers may replace 1, 2, 3, 4, 5, 6, 7, 8, or 9 adenosine or thymine nucleosides in the oligonucleotide. In various embodiments, one or more spacers are arranged in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides). For example, one or more spacers may replace 1, 2, 3, 4, 5, 6, 7, 8, or 9 guanine or cytosine nucleosides in the oligonucleotide. In various embodiments, the spacers are arranged in the oligonucleotide to replace an equal number of adenosine / thymine nucleosides and guanine / cytosine nucleosides. For example, the first spacer in the oligonucleotide may be replaced with an adenosine / thymine nucleoside, and the second spacer in the oligonucleotide may be replaced with a guanine / cytosine nucleoside.
[0272] In various embodiments, one or more spacers are placed in the oligonucleotide to control the sequence content within the oligonucleotide. For example, two spacers are arranged such that at least one of the spacers is adjacent to a guanine group. In various embodiments, an oligonucleotide with spacers may include one spacer adjacent to a guanine group, or two spacers adjacent to a guanine group. In one embodiment, when counted from the 5' end of the oligonucleotide, the spacer is immediately before the guanine group in the sequence. Therefore, in various embodiments, an oligonucleotide with spacers may include one spacer immediately before the guanine group, or two spacers, each immediately before a guanine group. In one embodiment, when counted from the 5' end of the oligonucleotide, the spacer follows immediately after the guanine group. Therefore, in various embodiments, an oligonucleotide with spacers may include one spacer immediately following the guanine group, or two spacers, each immediately following a guanine group. In various embodiments, the spacers in the oligonucleotide can be arranged to maximize the number of spacers adjacent to the guanine group.
[0273] In various embodiments, one or more spacers are arranged in the oligonucleotide so as to replace one or more adenosine or thymine nucleosides, such that one or more spacers are located adjacent to a guanine group. For example, two spacers may replace adenosine or thymine nucleosides in the oligonucleotide, with each of these two spacers located adjacent to a guanine group.
[0274] In various embodiments, a UNC13A oligonucleotide having one or more spacers has a specific GC content. As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogen-containing bases in the oligonucleotide that are either guanine (G) or cytosine (C). In various embodiments, a UNC13A oligonucleotide having one or more spacers has a GC content of at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In certain embodiments, a UNC13A oligonucleotide having one or more spacers has a GC content of at least 30%. In certain embodiments, a UNC13A oligonucleotide having one or more spacers has a GC content of at least 40%. In various embodiments, one or more spacers are arranged in the UNC13A oligonucleotide to maximize the GC content. For example, instead of selecting guanine or cytosine for spacer replacement in a UNC13A oligonucleotide, thymine or adenine can be selected for spacer replacement.
[0275] In various embodiments, the UNC13A oligonucleotide with spacers is designed such that 1) each segment of the UNC13A oligonucleotide has up to seven linked nucleosides, and 2) at least two spacers are positioned adjacent to the guanine group. In some embodiments, the UNC13A oligonucleotide with spacers is designed such that 1) each segment of the UNC13A oligonucleotide has up to seven linked nucleosides, and 2) each of the two spacers is positioned in front of the guanine group.
[0276] In various embodiments, including one or more spacers in a UNC13A oligonucleotide does not reduce the effectiveness of the UNC13A oligonucleotide with spacers in restoring full-length UNC13A protein or full-length UNC13A mRNA compared to the effect of the corresponding control oligonucleotide. In various embodiments, including one or more spacers in a UNC13A oligonucleotide enhances the effectiveness of the UNC13A oligonucleotide with spacers in restoring full-length UNC13A protein or full-length UNC13A mRNA compared to the effect of the control oligonucleotide. In various embodiments, including one or more spacers in a UNC13A oligonucleotide does not reduce the effectiveness of the UNC13A oligonucleotide with spacers in reducing the amount of UNC13A transcript compared to the effect of the control oligonucleotide. In various embodiments, including one or more spacers in a UNC13A oligonucleotide enhances the effectiveness of the UNC13A oligonucleotide with spacers in reducing the amount of UNC13A transcript compared to the effect of the control oligonucleotide.
[0277] Table 2 records exemplary UNC13A oligonucleotides with one or more spacers and their relationships with the corresponding UNC13A parent oligonucleotides. Each UNC13A oligonucleotide is assigned a sequence name. When used below, the sequence name nomenclature is represented as "X_spA_spB" (for a UNC13A AON with two spacers), where "X" refers to the length of the UNC13A AON, "A" refers to the position in the UNC13A AON where the first spacer is located, and "B" refers to the position in the UNC13A AON where the second spacer is located.
[0278] In various embodiments, the UNC13A oligonucleotide includes two spacers. In various embodiments, the inclusion of spacers divides the UNC13A oligonucleotide into three distinct segments, at least one of which has a maximum 7-linked nucleoside length. An exemplary UNC13A AON with two spacers is shown in Table 2 below.
[0279] [Table 3] At least one nucleoside bond in the nucleic acid base sequence is selected from phosphorothioate bonds, alkyl phosphate bonds, phosphorodithioate bonds, phosphotriester bonds, alkylphosphonate bonds, 3-methoxypropylphosphonate bonds, methylphosphonate bonds, aminoalkylphosphotriester bonds, alkylenephosphonate bonds, phosphine bonds, phosphoramidate bonds, phosphoramidothioate bonds, phosphorodiamidate (e.g., phosphorodiamidate morpholino (PMO), 3'-aminoribose, or 5'-aminoribose) bonds, aminoalkylphosphoramidate bonds, thiophosphoramidate bonds, thionoalkylphosphonate bonds, thionoalkylphosphotriester bonds, thiophosphate bonds, selenophosphate bonds, and boranophosphate bonds.
[0280] In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides) include not only one or more spacers but also one or more locked nucleic acids (LNAs). In some embodiments, the antisense oligonucleotides disclosed herein include two spacers and two LNAs. In some embodiments, the antisense oligonucleotides disclosed herein include two spacers and three LNAs.
[0281] In various embodiments, the spacer and LNA are located adjacent to each other in the antisense oligonucleotide. For example, counting from 5' to 3', the LNA may be located at the 4th position of the antisense oligonucleotide, and the spacer may be located at the 5th position. Another example is counting from 5' to 3', where the LNA is located at the 5th position and the spacer is located at the 6th position. Another example is counting from 5' to 3', where the LNA is located at the 7th position and the spacer is located at the 8th position. Another example is counting from 5' to 3', where the LNA is located at the 10th position and the spacer is located at the 11th position. Another example is counting from 5' to 3', where the LNA is located at the 12th position and the spacer is located at the 13th position. As another example, if counted from 5' to 3', the LNA could be located at the 13th position of the antisense oligonucleotide, and the spacer could be located at the 14th position of the antisense oligonucleotide.
[0282] In certain embodiments, in the antisense oligonucleotide, the first spacer is located adjacent to the first LNA, and the second spacer is located adjacent to the second LNA. For example, counting from 5' to 3', the first LNA may be located at the 4th position of the antisense oligonucleotide, the first spacer at the 5th position, the second LNA at the 12th position, and the second spacer at the 13th position. As another example, counting from 5' to 3', the first LNA may be located at the 7th position, the first spacer at the 8th position, the second LNA at the 10th position, and the second spacer at the 11th position. As another example, if counting from 5' to 3', the first LNA can be located at the 5th position of the antisense oligonucleotide, the first spacer can be located at the 6th position of the antisense oligonucleotide, the second LNA can be located at the 13th position of the antisense oligonucleotide, and the second spacer can be located at the 14th position of the antisense oligonucleotide.
[0283] Performance of UNC13A oligonucleotide Generally, UNC13A oligonucleotides and / or UNC13A parental oligonucleotides (e.g., UNC13A oligonucleotides having any of the sequences of SEQ ID NOs. 13-1283 or 2571-2594) target UNC13A transcripts (e.g., UNC13A premRNA) containing sequences that share at least 85% identity with SEQ ID NOs. 1284-2554 in order to increase, restore, rescue, or stabilize the expression level of UNC13A mRNA, which can be translated to produce a functional UNC13A protein (e.g., full-length UNC13A). In various embodiments, UNC13A AONs can exhibit an increase of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of full-length UNC13A mRNA. In various embodiments, UNC13A AON can represent an increase of at least 100%, 200%, 300%, or 400% of full-length UNC13A mRNA. In various embodiments, UNC13A AON can represent a decrease of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of misspliced UNC13A mRNA. In various embodiments, UNC13A AON can represent an increase of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of full-length UNC13A protein. In various embodiments, UNC13A AON can represent an increase of at least 100%, 200%, 300%, or 400% of full-length UNC13A protein. In some embodiments, the percentage increase in full-length UNC13A protein is an increase compared to the decrease in the level of full-length UNC13A protein achieved using TDP43 antisense oligonucleotides. For example, full-length UNC13A protein can be depleted using TDP43 antisense oligonucleotides, and then full-length UNC13A protein can be increased using UNC13A AON.
[0284] In some embodiments, UNC13A AON can demonstrate rescue of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the full-length UNC13A protein. In some embodiments, the rescue percentage of full-length UNC13A refers to the percentage of full-length UNC13A after depletion with TDP43 antisense oligonucleotides and after treatment with UNC13A AON, compared to a negative control (e.g., cells that were not depleted or treated, or cells treated with vehicle solution).
[0285] In various embodiments, UNC13A AON can exhibit a reduction of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of UNC13A transcripts having latent exons. In various embodiments, UNC13A AON can exhibit a reduction of at least 100% of UNC13A transcripts having latent exons. In various embodiments, the reduction of UNC13A transcripts having latent exons is measured by comparing it to the level of UNC13A transcripts having latent exons detected using TDP43 antisense oligonucleotides. In various embodiments, UNC13A AON can exhibit a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of UNC13A transcripts having latent exons.
[0286] qualification A nucleoside is a base-sugar combination. The nucleic acid base (also known as the base) portion of a nucleoside is usually a heterocyclic base portion. A nucleotide is a nucleoside that further contains a phosphate group covalently bonded to the sugar portion of the nucleoside. In the case of nucleosides containing pentofuranosyl sugars, the phosphate group can be linked to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through the covalent bonds between adjacent nucleosides, forming linear polymer oligonucleotides. Within the oligonucleotide structure, phosphate groups are generally said to form internucleoside bonds within the oligonucleotide.
[0287] Modifications to antisense compounds include substitutions or changes to nucleoside bonds, sugar moieties, or nucleic acid bases. Modified antisense compounds are often preferred over their native form because they possess desirable properties such as enhanced cellular uptake, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased activity.
[0288] Chemically modified nucleosides are sometimes used to increase the binding affinity of shortened or cleaved antisense oligonucleotides to their target nucleic acids. Therefore, in many cases, comparable results can be obtained using shorter antisense compounds containing such chemically modified nucleosides.
[0289] Inter-modified nucleoside bonding The naturally occurring nucleoside bond in RNA and DNA is a 3'-to-5' phosphodiester bond. Antisense compounds with one or more modifications, i.e., nucleoside bonds that are not naturally occurring, are often preferred over antisense compounds with naturally occurring nucleoside bonds because they possess desirable properties such as enhanced cellular uptake, increased affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0290] Oligonucleotides having modified nucleoside bonds include not only nucleoside bonds that retain a phosphorus atom, but also nucleoside bonds that do not contain a phosphorus atom. Typical phosphorus-containing nucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing bonds are well known.
[0291] In certain embodiments, the antisense compound targeting UNC13A nucleic acid includes one or more modified nucleoside bonds. In certain embodiments, the modified nucleoside bonds are scattered throughout the antisense compound. In certain embodiments, the modified nucleoside bonds are phosphorothioate bonds. In certain embodiments, each nucleoside bond in the antisense compound is a phosphorothioate nucleoside bond. In certain embodiments, the antisense compound targeting UNC13A nucleic acid includes at least one phosphodiester bond and at least one phosphorothioate bond.
[0292] modified sugar moiety Antisense compounds may optionally contain one or more nucleosides that are modified with sugar groups. Such sugar-modified nucleosides may confer to the antisense compound enhanced nuclease stability, increased binding affinity, or several other beneficial biological properties. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include the addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs), and substitution of ribosyl ring oxygen atoms with S, N(R), or C(R1)(R2) (wherein R, R1, and R2 are independently H, C1-C). 12 Examples of chemically modified sugars include, but are not limited to, alkyl groups or protecting groups, and combinations thereof. Examples include 2'-F-5'-methyl-substituted nucleosides (see International Publication 2008 / 101157, published August 21, 2008, for other disclosed 5',2'-bis-substituted nucleosides), or substitution of a ribosyl ring oxygen atom with S having a further substitution at the 2' position (see U.S. Patent Application No. 2005-0130923, published June 16, 2005), or alternatively, 5' substitution of BNA (see International Publication 2007 / 134181, published November 22, 2007, where LNA is substituted, for example, with a 5'-methyl group or a 5'-vinyl group).
[0293] Examples of nucleosides having a modified sugar moiety include, but are not limited to, nucleosides containing the substituents 5'-vinyl, 5'-methyl(R or 5), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3. The substituent at the 2' position may be allyl, amino, azide, thio, O-allyl, or O-C1~C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n )-- You can also select from each R l , R m , and R n These are independently H or substituted or unsubstituted C1-C 10 It is alkyl.
[0294] Examples of additional modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl)(2'-MOE), 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), restricted ethyl 2'-4'-crosslinked nucleic acids (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).
[0295] As used herein, “bicyclic nucleoside” refers to a modified nucleoside containing a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides containing a bridge between a 4'-ribosyl ring atom and a 2'-ribosyl ring atom. In certain embodiments, the antisense compounds provided herein comprise one or more bicyclic nucleosides containing a 4'-2' bridge. Examples of such 4'-2' bridged bicyclic nucleosides include formulas: 4'-(CH2)-O-2'(LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2'(ENA), 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' (and their analogues; see U.S. Patent No. 7,399,845 issued July 15, 2008), 4'-C(CH3)(CH3)-O-2' (and its analogues, 20 See International Publication No. 2009 / 006478, published on January 8, 2009), 4'-CH2-N(OCH3)-2' (and its analogues, see International Publication No. 2008 / 150729, published on December 11, 2008), 4'-CH2-ON(CH3)-2' (see U.S. Patent Application Publication No. 2004-0171570, published on September 2, 2004), 4'-CH2-N(R)-O-2' (wherein R is H, C1~C) 12 Examples include, but are not limited to, one of the following: alkyl (or protecting group) (see U.S. Patent No. 7,427,672 issued September 23, 2008), 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C-(=CH2)-2' (and its analogues, see International Publication No. 2008 / 154401 published December 8, 2008).
[0296] Further reports related to bicyclic nucleosides can be found in the publicly available literature (e.g., Singh et al., Chem.Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.Natl.Acad.Sci.USA, 2000, 97, 5633-5638; Kumar et al., Bioorg.Med.Chem.Lett., 1998, 8, 2219-2222; Singh et al., J.Org.Chem., 1998, 63, 10035-10039; Srivastava et al.) al., J.Am.Chem.Soc.,2007,129(26)8362-8379, Elayadi et al.,Curr.Opinion Invest.Drugs,2001,2,558-561, Braasch et al.,Chem.Biol.,2001,8,1-7, and Orum et al.,Curr.Opinion Mol.Ther., 2001, 3,239-243, U.S. Patent Nos. 6,268,490, 6,525,191, 6,670,461, 6,770,748, 6,794,499, 7,034,133, 7,053,207, 7,399,845, 7,547,684, and 7,696,345, U.S. Patent Application Publication No. 2008 / 0039618, 2009-0012281, U.S. Patent Application Publication No. 60 / See publications 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787, and 61 / 099,844, International Publications 1994 / 014226, 2004 / 106356, 2005 / 021570, 2007 / 134181, 2008 / 150729, 2008 / 154401, and 2009 / 006478.Each of the aforementioned bicyclic nucleosides can be prepared to have one or more stereochemical sugar configurations, for example, α-L-ribofuranose and β-D-ribofuranose (see International Application DK98 / 00393, published on March 25, 1999, as International Publication No. 99 / 14226).
[0297] In certain embodiments, the bicyclic sugar moiety of the BNA nucleoside includes, but is not limited to, a compound having at least one crosslink between the 4' and 2' positions of the pentofuranosyl sugar moiety, and such crosslinks are independently -[C(R a )(R b )] n -, -C(R a )=C(R b )-,-C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x -, and -N(R a )- comprises one or two to four linking groups independently selected from, where x is 0, 1, or 2, n is 1, 2, 3, or 4. Each R a and R b These are independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl, or a protecting group.
[0298] In certain embodiments, the bridge of the bicyclic sugar moiety is -[C(R a )(R b )] n -, -[-[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O-, or -C(R a R b )-O-N(R)-. In certain embodiments, the bridge is 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4-CH2-O-2’, 4’-(CH2)2-O-2’, 4’-CH2-O-N(R)-2’, and 4’-CH2-N(R)-O-2’, wherein each R is independently H, a protecting group, or C1-C 12 alkyl, and R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12 alkenyl, C2-C 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1~C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group, where R is H, C1-C 12 It is an alkyl group or a protecting group (see U.S. Patent No. 7,427,672 issued on September 23, 2008).
[0299] In certain embodiments, bicyclic nucleosides are further defined by their isomer configuration. For example, nucleosides containing a 4'-2'-methylene-oxy bridge can be in either an α-L or β-D configuration. Previously, α-L-methyleneoxy(4'-CH2-O-2')BNA was incorporated into antisense oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0300] In certain embodiments, the bicyclic nucleosides include α-L-methyleneoxy(4'-CH2-O-2')BNA, β-D-methyleneoxy(4'-CH2-O-2')BNA, ethyleneoxy(4'-(CH2)2-O-2)BNA, aminooxy(4'-CH2-ON(R)-2')BNA, oxyamino(4'-CH2-N(R)-O-2')BNA, and methyl(methyleneoxy Examples include, but are not limited to, ethyleneoxy)(4'-CH(CH3)-O-2')BNA, methylene-thio(4'-CH2-S-2')BNA, methylene-amino(4'-CH2-N(R)-2')BNA, methyl carboncyclic (4'-CH2-CH(CH3)-2')BNA, and propylene carboncyclic (4'-(CH2)3-2')BNA, where R is H, C1-C 12 It is an alkyl group or a protecting group (see U.S. Patent No. 7,427,672 issued on September 23, 2008).
[0301] In some embodiments, this disclosure provides methods for treating, improving, or preventing neurological diseases and / or neurological disorders, and further includes methods for administering to a patient a pharmaceutically acceptable composition, for example, a pharmaceutically acceptable formulation comprising one or more UNC13A oligonucleotides. UNC13A oligonucleotides can increase, restore, or stabilize levels of UNC13A activity, e.g., UNC13A activity, and / or UNC13A expression, e.g., UNC13A mRNA and / or protein expression.
[0302] This disclosure also provides pharmaceutical compositions comprising UNC13A oligonucleotides formulated with one or more pharmaceutically or cosmetically acceptable excipients. These formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisional, intraventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal) administration, or topical use, such as compositions suitable for topical application to the skin and / or mucous membranes, e.g., as part of a composition in the form of a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor, or tincture. In any given case, the most preferred mode of administration depends on the degree and severity of the condition being treated and the properties of the specific UNC13A oligonucleotide used.
[0303] This disclosure also provides pharmaceutical compositions comprising UNC13A oligonucleotides or pharmaceutically acceptable salts thereof (e.g., UNC13A AONs containing any sequence from SEQ ID NOs. 2571 to 2594).
[0304] This disclosure also provides methods comprising the use of pharmaceutical compositions comprising UNC13A AON formulated with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising UNC13A AON and one or more pharmaceutically acceptable excipients. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisional, intraventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), transmucosal (e.g., buccal, vaginal, and rectal), or topical use. The most preferred mode of administration in any given case depends on the clinical symptoms, complications, or biochemical signs of the state, disorder, disease, or condition to be prevented in the subject, the state, disorder, disease, or condition to be prevented in the subject, and / or the properties of the specific compound and / or composition used.
[0305] Additional chemically modified UNC13A oligonucleotide The UNC13A AON described herein may include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Examples of chemically modified nucleosides include, but are not limited to, uracin, uridine, and 2'-O-(2-methoxyethyl) modifications, such as 2'-O-(2-methoxyethyl)guanosine, 2'-O-(2-methoxyethyl)adenosine, 2'-O-(2-methoxyethyl)cytosine, and 2'-O-(2-methoxyethyl)thymidine. In certain embodiments, a mixed form may be used, for example, a combination of UNC13A peptide nucleic acid (PNA) and UNC13A locked nucleic acid (LNA). Examples of chemically modified nucleosides include, but are not limited to, locked nucleic acid (LNA), 2'-O-methyl, 2'-fluoro, and 2'-fluoro-β-D-arabinonucleotide (FANA), as well as fluorocyclohexenyl nucleic acid (F-CeNA) modifications. The chemically modified nucleosides that may be included in UNC13A AON as described herein are described in Johannes and Lucchino, (2018) "Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs" Nucleic Acid Ther. 28(3):178-93, Rettig and Behlke, (2012) "Progress toward in vivo use of siRNAs-II" Mol Ther 20:483-512, and Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3):238-48, the contents of each of these are incorporated herein by reference.
[0306] The UNC13A AON described herein may include chemical modifications that promote the stabilization of the oligonucleotide's terminal 5'-phosphate and 5'-phosphate phosphatase-resistant analogs. Examples of chemical modifications that promote oligonucleotide terminal 5'-phosphate stabilization or are 5'-phosphate phosphatase-resistant analogs include, but are not limited to, 5'-methylphosphonate, 5'-methylenephosphonate, 5'-methylenephosphonate analogs, 5'-E-vinylphosphonate (5'-E-VP), 5'-phosphorothioate, and 5'-C-methyl analogs. Chemical modifications that promote AON terminal 5'-phosphate stabilization and 5'-phosphate phosphatase-resistant analogs are described in Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility," Nat Biotechnol., 35(3):238-48, which are incorporated herein by reference.
[0307] In some embodiments described herein, the UNC13A AON described herein may contain a chemically modified nucleoside, for example, a 2'O-methylribonucleoside, such as 2'O-methylcytidine, 2'O-methylguanosine, 2'O-methyluridine, and / or 2'O-methyladenosine. The UNC13A AON described herein may contain one or more chemically modified bases, including a 5-methylpyrimidine, such as 5-methylcytosine, and / or a 5-methylpurine, such as 5-methylguanine. The chemically modified nucleoside may further include pseudouridine or 5'methoxyuridine. The UNC13A AON described herein may contain any of the following chemically modified nucleosides: 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methylthymidine, 5-methylcytidine, 5-methyluridine, and / or 5-methyl-2'-deoxycytidine.
[0308] The UNC13A AON described herein may include a phosphate skeleton in which one or more of the oligonucleoside bonds are phosphate bonds. The UNC13A AON described herein may include a modified oligonucleotide skeleton in which one or more of the nucleoside bonds of the sequence are selected from the group consisting of phosphorothioate bonds, phosphorodithioate bonds, phosphotryester bonds, alkylphosphonate bonds, 3-methoxypropylphosphonate bonds, aminoalkylphosphotryester bonds, alkylenephosphonate bonds, phosphine bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphodiamidate bonds, phosphorodiamidate (e.g., phosphorodiamidate morpholino (PMO), 3'-aminoribose, or 5'-aminoribose) bonds, aminoalkylphosphoramidate bonds, thiophosphoramidate bonds, thionoalkylphosphonate bonds, thionoalkylphosphotryester bonds, thiophosphate bonds, selenophosphate bonds, and boranophosphate bonds. In some embodiments of the UNC13A AON described herein, at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are phosphorothioate bonds. For example, in some embodiments of the UNC13A AON described herein, one, two, three, or more nucleoside bonds of the oligonucleotide are phosphorothioate bonds. In preferred embodiments of the UNC13A AON described herein, all nucleoside bonds of the oligonucleotide are phosphorothioate bonds. Therefore, in some embodiments, all nucleotide bonds of any UNC13A AON from sequence numbers 13-1283 or 2571-2594 are phosphorothioate bonds. In some embodiments, one or more nucleotide bonds of any UNC13A AON from sequence numbers 13-1283 or 2571-2594 are phosphorothioate bonds.
[0309] In various embodiments, the nucleotide bond of UNC13A AON described herein, such as any of SEQ ID NOs. 13-1283 or 2571-2594, comprises a mixture of phosphodiester and phosphorothioate bonds.
[0310] In some embodiments, the nucleoside bond linking the base at position 3 of the UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 may be linked to each adjacent base (e.g., the preceding base and the following base) via a phosphodiester bond. An example of an 18-mer UNC13A AON having a phosphodiester bond linking the base at position 3 can be expressed as follows: XXoDoXXXXXXXXXXXXXXX In the sequence, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleic acid base in AON can be a nucleic acid base analog.
[0311] In some embodiments, one of the nucleoside bonds linking the base at position 3 of the UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 may be linked to either the preceding or following base via a phosphodiester bond. An example of an 18-mer UNC13A AON having a phosphodiester bond linking the base at position 3 to the preceding base can be expressed as follows: XXoDXXXXXXXXXXXXXXX In the sequence, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleic acid base in AON can be a nucleic acid base analog.
[0312] An example of an 18-mer UNC13A AON having a phosphodiester bond that links the base at position 3 to a later base can be expressed as follows: XXDoXXXXXXXXXXXXXXX In the sequence, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleic acid base in AON can be a nucleic acid base analog.
[0313] In various embodiments, in addition to one of the nucleoside bonds linking the base at position 3 of the UNC13A AON described herein being a phosphodiester bond, the UNC13A AON further comprises two spacers. These two spacers can be positioned in the UNC13A AON such that the UNC13A AON contains segments having up to seven linked nucleosides. An example of an 18-mer UNC13A AON having two spacers and a phosphodiester bond linking the base at position 3 to the preceding base can be expressed as follows: XXoDS1XXXXXXXXS2XXXXX In the sequence, "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleic acid base in AON can be a nucleic acid base analog.
[0314] In various embodiments, the UNC13A AON described herein includes one or more spacers, and the phosphodiester bond is located relative to one or more spacers. In some embodiments, the Y bases immediately preceding the spacer are linked via a phosphodiester bond. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In certain embodiments, Y is two bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the UNC13A AON are each linked to their respective adjacent bases via a phosphodiester bond. As described herein, the spacer can be located at various positions in the UNC13A AON, and therefore the two bases immediately preceding the spacer can vary within the UNC13A AON depending on where the spacer is located.
[0315] In various embodiments, UNC13A AON may contain two or more spacers. In some embodiments, only one of these spacers has Y bases linked via phosphodiester bonds immediately before it. In such embodiments, the other spacers are linked to their respective preceding bases via phosphorothioate bonds. In various embodiments, two of these spacers have Y bases linked via phosphodiester bonds immediately before them. In various embodiments, each spacer in UNC13A AON has Y bases linked via phosphodiester bonds immediately before it. In various embodiments, all other bases in UNC13A AON are linked via phosphorothioate bonds.
[0316] In some embodiments, the Y bases immediately preceding the spacer and the Z bases immediately following the spacer are linked via phosphodiester bonds. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. Y and Z can be independent of each other. In certain embodiments, Y is one base and Z is one base. For example, if the spacer is located at position 15, the bases at position 14 and 16 of UNC13A AON are each linked to their respective adjacent bases via phosphodiester bonds. To provide an example, such UNC13A AON (e.g., 18mer) can be represented as follows: XXXXXXXXXoDoSoEoXXXXXX In the sequence, "S" represents a spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the spacer, and "E" represents the base immediately following the spacer. Any nucleic acid base in AON can be a nucleic acid base analog.
[0317] As described herein, the spacer can be located at various positions in UNC13A AON, and therefore the base immediately preceding or following the spacer can vary within UNC13A AON depending on the location of the spacer.
[0318] In various embodiments, UNC13A AON may include two or more spacers. In some embodiments, only one of the spacers has Y bases immediately preceding the spacer and Z bases immediately following the spacer, linked via phosphodiester bonds. In such embodiments, the other spacers of UNC13A AON are linked to their respective preceding and succeeding bases via phosphorothioate bonds. To provide an example, such UNC13A AON (e.g., 18mer) can be expressed as follows: XXXoDoS1oEoXXXXXXXXS2XXX In the sequence, "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the spacer, and "E" represents the base immediately following the spacer. Any nucleic acid base in AON can be a nucleic acid base analog.
[0319] In some embodiments, the disclosed UNC13A AON may have, for example, at only one of the 5' or 3' ends, or at both the 5' and 3' ends, or located along the oligonucleotide sequence, at least one modified nucleic acid base, such as 5-methylcytosine and / or at least one methylphosphonate nucleotide.
[0320] UNC13A AON may contain at least one modified sugar. For example, the sugar portion of at least one nucleotide constituting the oligonucleotide is a ribose in which the 2'-OH group can be replaced by one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (where R is alkyl or aryl and R' is alkylene). Examples of modified sugar moieties include 2'-Ome modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'MOE or MOE), 2'-O-(N-methylacetamide), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), restricted ethyl 2'-4'-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA), and tricyclic analogs (e.g., tcDNA).
[0321] In some embodiments, UNC13A AON is 2'OMe (e.g., UNC13A AON containing one or more 2'OMe-modified sugars, 2'MOE or MOE (e.g., UNC13A AON containing one or more 2'MOE-modified sugars)), PNA (e.g., UNC13A AON containing one or more N-(2-aminoethyl)-glycine units linked by amide or carbonylmethylene bonds as repeating units instead of a sugar-phosphate backbone)), LNA (e.g., UNC13A AON containing one or more locudribose, which can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., UNC13A AON containing one or more cET sugars), cMOE (e.g., UNC13A AON containing one or more cMOE sugars), morpholino oligomer (e.g., UNC13A AON containing one or more PMO-containing backbones). UNC13A AON comprises a deoxy-2'-fluoronucleoside (e.g., UNC13A AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), tcDNA (e.g., UNC13A AON comprising one or more tcDNA-modified sugars), ENA (e.g., UNC13A AON comprising one or more ENA-modified sugars), or HNA (e.g., UNC13A AON comprising one or more HNA-modified sugars). In some embodiments, UNC13A AON comprises one or more phosphorothioate bonds, phosphodiester bonds, phosphotryester bonds, methylphosphonate bonds, phosphoramidate bonds, phosphoramidothioate bonds, thiophosphorodiamidate bonds, morpholino bonds, PNA bonds, or any combination of phosphorothioate bonds, phosphodiester bonds, phosphotryester bonds, methylphosphonate bonds, phosphoramidate bonds, morpholino bonds, and PNA bonds. In some embodiments, UNC13A AON comprises one or more phosphorothioate bonds, phosphodiester bonds, or a combination of phosphorothioate bonds and phosphodiester bonds.
[0322] In some embodiments, UNC13A AON having any one sequence of SEQ ID NOs. 13-1283 or 2571-2594 is a chiral controlled oligonucleotide, such as the chiral controlled oligonucleotide described in any of U.S. Patent Nos. 9,982,257, 10,590,413, 10,724,035, 10,450,568, and International Publication No. 2019200185 (each of which is incorporated herein by reference in its entirety).
[0323] For example, UNC13A AON having one of the sequences 13-1283 or 2571-2594 is a chiral controlled oligonucleotide comprising at least one type of oligonucleotide, each type comprising 1) a nucleotide sequence, 2) a pattern of skeletal linkage, 3) a pattern of skeletal chiral centers, and 4) a skeletal X-part (-XLR). 1 Defined by the pattern of ), at least one type of oligonucleotide comprises one or more phosphorothioate triester internucleotide bonds and one or more phosphate diester bonds, at least one type of oligonucleotide comprises at least two consecutive modified internucleotide crosslinks, and at least one oligonucleotide of type is as follows
[0324] [ka] It comprises one or more modified nucleotide crosslinks having independently the structure, In structure, P * This is an asymmetric phosphorus atom, and is either Rp or Sp. W is O, S, or Se, and X, Y, and Z are independently -O-, -S-, -N(-LR) 1 )-, or L, where L is a linear or branched C1-C bonded by covalent bonds or optionally substituted. 50It is an alkylene, and one or more methylene units of L are optionally and independently substituted with optionally selected C1-C6 alkylenes, C1-C6 alkenylenes,
[0325] [ka] It is replaced by -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O--, and R 1 C1-C are replaced by halogen, R, or optionally selected C 10 It is an aliphatic compound in which one or more methylene units are optionally and independently substituted with optionally selected C1-C6 alkylenes, C1-C6 alkenylenes,
[0326] [ka] -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, and each R′ is independently -R, -C(O)R, -CO2R, or -SO2R, or two R′s on the same nitrogen are interposed between them. Together with the existing atom, they form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon, together with their intervening atoms, form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring, where -Cy- represents an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene, and each R independently is hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl, and each
[0327] [ka] This independently represents binding to a nucleoside. In some embodiments, UNC13A AON having any one sequence of SEQ ID NOs. 13-1283 or 2571-2594 is a chiral-controlled oligonucleotide containing certain chemical modifications (e.g., 2'F (a 2'-fluoro containing a fluorine molecule at the 2'-ribose position instead of the 2'-hydroxyl group in the RNA monomer), 2'-OMe, phosphorothioate linkage, lipid conjugation, etc.) as described in U.S. Patent No. 10,450,568.
[0328] Motor neuron disease Motor neuron diseases are a group of disorders characterized by the loss of function of motor neurons, which regulate voluntary muscle movement in the brain. Motor neuron diseases may affect upper and / or lower motor neurons and may be sporadic or of familial origin. Examples of motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.
[0329] Symptoms of motor neuron disease include muscle weakness or weakness, muscle pain, spasms, slurred speech, dysphagia, loss of muscle control, joint pain, limb rigidity, dyspnea, drooling, and complete loss of muscle control, including that affecting basic functions such as breathing, swallowing, eating, speech, and limb movement. These symptoms may also be accompanied by depression, memory loss, difficulty planning, speech disorders, behavioral changes, and difficulty assessing spatial relationships and / or personality changes.
[0330] Motor neuron disorders can be evaluated and diagnosed by a skilled clinician, such as a neurologist, using a variety of tools and tests. For example, the presence or risk of developing a motor neuron disorder can be evaluated or diagnosed using blood and urine tests (e.g., assays for the presence of creatinine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction studies (NCS), spinal puncture, lumbar puncture, and / or muscle biopsy. Motor neuron disorders can be diagnosed using physical and / or neurological examinations to assess motor and sensory skills, neurological function, hearing and speech, vision, coordination and balance, mental state, and mood or behavioral changes.
[0331] Amyotrophic lateral sclerosis (ALS) ALS is a progressive motor neuron disease that destroys signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons. Symptoms of ALS include weakness and wasting of medullary muscles, generalized and bilateral physical weakness, spasticity, muscle spasms, muscle cramps, fasciculations, slurred speech, and dyspnea or loss of respiratory capacity. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43.
[0332] ALS is most common in men over 40, but can also occur in women and children. The risk of ALS is increased in smokers, those exposed to chemicals such as lead, or those who have served in the military. Most cases of ALS are sporadic, but only about 10% of cases are familial. Causes of ALS include sporadic or hereditary gene mutations, high levels of glutamate, and protein mishandling. Gene mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.
[0333] frontotemporal dementia Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). It has an average age of onset earlier than Alzheimer's disease, at 40 years old. Symptoms of FTD include extreme changes in behavior and personality, speech and language disorders, and motor-related symptoms such as tremors, rigidity, muscle spasms, weakness, and dysphagia. Subtypes of FTD include behavioral frontotemporal dementia (bvFTD), characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language ability, speech, writing, and comprehension. FTD is associated with changes in tau protein accumulation (Pick bodies) and TDP43 function. Approximately 30% of FTD cases are familial, and no other risk factors for the disorder other than a family history are known. Gene mutations associated with FTD include those in the genes C9orf72, progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1, and TBP.
[0334] Amyotrophic lateral sclerosis with frontotemporal dementia Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the leading cause of familial forms of ALS and FTD. In addition, mutations in TBK1, VCP, SQSTM1, UBQLN2, and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic personality changes, as well as muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and the frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 protein and / or FUS protein. TBK1 mutations are associated with ALS, FTD, and ALS with FTD.
[0335] Limbic system-dominant age-related TDP-43 encephalopathy (LATE) Limbic-dominant age-related TDP-43 encephalopathy (LATE) is characterized by the accumulation of misfolded TDP-43 protein in the brain, particularly in the limbic system. LATE is a neurological disorder that typically appears in older patients (e.g., over 80 years of age). LATE can be a diagnosis of dementia, and it often mimics the symptoms of Alzheimer's disease, including memory loss, confusion, and mood changes.
[0336] Treatment method This disclosure is intended to be used in part to treat patients in need of treatment for any of the following neurological disorders, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), limbic-dominant age-related TDP-43 encephalopathy (LATE), epilepsy, age-related TDP-43 brain disease with sclerosis (CARTS), facial-onset sensorimotor neuropathy, Guam Parkinson's dementia complex, multiple system proteinosis, CTE, and synaptic disorders such as autism. In some embodiments, methods for using UNC13A AON to treat patients in need of treatment for a neurological disorder are provided herein, the methods comprising administering the disclosed UNC13A AON. In some embodiments of the present disclosure, an effective amount of the disclosed UNC13A oligonucleotide may be administered to a patient in need to increase, restore, or stabilize the expression of UNC13A mRNA that can be translated to treat a neurological disorder and / or to produce a functional UNC13A protein, thereby increasing, restoring, or stabilizing UNC13A activity and / or function.
[0337] In some embodiments, treating a neurological disorder includes improving or alleviating at least one symptom associated with the neurological disorder (e.g., reducing muscle weakness in a patient with ALS). A method is provided for treating a patient suffering from a neurological disorder (e.g., ALS, FTD, or ALS with FTD), comprising administering the disclosed UNC13A AON. In some embodiments, a method is provided for slowing the progression of a neurological disorder, such as motor neuron disease.
[0338] Provided herein is a method for treating, reducing the risk of developing, or delaying the development of a neurological disorder in subjects requiring such treatment, a method comprising administering the disclosed UNC13A AON. The method includes, for example, treating a subject at risk of developing a neurological disorder, for example, administering an effective amount of the disclosed UNC13A AON to that subject. Neurological disorders that can be treated by this method include motor neuron disease, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.
[0339] Methods for preventing or treating neurological disorders (e.g., PD, ALS, FTD, and ALS with FTD) form part of this disclosure. Such methods may include administering a pharmaceutical formulation containing UNC13A AON disclosed herein to a patient who needs or is at risk thereof. For example, a method is provided for preventing or treating a neurological disorder, which includes administering UNC13A AON disclosed herein to a patient who needs it.
[0340] Patients treated using the above method may experience an increase, recovery, or stabilization of UNC13A mRNA expression in target cells (e.g., motor neurons) that can be translated to produce functional UNC13A protein, by at least about 5%, 10%, 20%, 30%, 40%, or even 50%, after administration of UNC13A oligonucleotide, for example, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 months, 5 months, or 6 months, or even longer, thereby experiencing an increase, recovery, or stabilization of UNC13A activity and / or function. In some embodiments, such administration of UNC13A oligonucleotide may be, for example, at least daily. UNC13A oligonucleotide may be administered orally. In some embodiments, UNC13A oligonucleotide may be administered intrathecal, intrathalamic, or intracisional. For example, in the embodiments described herein, the UNC13A oligonucleotide is administered intrathecally, intrathalamally, or intracisionally every three months. The delay or improvement in the clinical symptoms of a patient's neurological disorder as a result of administering the UNC13A oligonucleotide disclosed herein may be at least, for example, six months, one year, eighteen months, or even two years or more, compared to a patient who has not received a UNC13A oligonucleotide, such as the UNC13A oligonucleotide disclosed herein.
[0341] UNC13A oligonucleotides can be used alone or in combination with each other, thereby allowing at least two UNC13A oligonucleotides to be used together in a single composition or as part of a treatment plan. UNC13A oligonucleotides may also be used in combination with other drugs or AONs to treat neurological disorders or conditions.
[0342] In various embodiments, a method for treating a subject requiring treatment for amyotrophic lateral sclerosis (ALS) comprises administering to the subject an oligonucleotide, or a pharmaceutically acceptable salt thereof, comprising a segment having up to seven linked nucleosides, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs. 13-1283 or 2571-2594, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide independently comprises a phosphodiester bond, a phosphorothioate bond, an alkylphosphate bond, a phosphorodithioate bond, a phosphotriester bond, an alkylphosphonate bond, a 3-methoxypropylphosphonate bond, a methylphosphonate bond, an aminoalkylphosphotriester bond, an alkylenephosphonate bond, a phosphine bond, a phosphoramidate bond, a phosphoramidothioate bond, and a phosphoramidothioate bond. A method is disclosed herein in which a nucleoside is substituted with a component selected from the group consisting of a 3-bond, thiophosphodiamidate bond, phosphorodiamidate bond, aminoalkylphosphoamide bond, thiophosphoamide bond, thionoalkylphosphonate bond, thionoalkylphosphotryester bond, thiophosphate bond, selenophosphate bond, and / or at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleoside, 2'-O-methyl nucleoside, 2'-O-(N-methylacetamide) nucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), tricyclic nucleic acid, restricted methoxyethyl (cMOE), restricted ethyl (cET), and peptide nucleic acid (PNA), and optionally further comprising an oligonucleotide as a spacer.
[0343] In various embodiments, a method for treating a subject requiring treatment for frontotemporal dementia (FTD) comprises administering to the subject an oligonucleotide, or a pharmaceutically acceptable salt thereof, comprising a segment having up to seven linked nucleosides, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs. 13-1283 or 2571-2594, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide independently comprises a phosphodiester bond, a phosphorothioate bond, an alkylphosphate bond, a phosphorodithioate bond, a phosphotriester bond, an alkylphosphonate bond, a 3-methoxypropylphosphonate bond, a methylphosphonate bond, an aminoalkylphosphotriester bond, an alkylenephosphonate bond, a phosphine bond, a phosphoramidate bond, a phosphoramidothioate bond. A method is disclosed herein in which a nucleoside is substituted with a component selected from the group consisting of a bond, a thiophosphodiamidate bond, a phosphorodiamidate bond, an aminoalkylphosphoramide bond, a thiophosphoramide bond, a thionoalkylphosphonate bond, a thionoalkylphosphotriester bond, a thiophosphate bond, a selenophosphate bond, and / or at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleoside, 2'-O-methyl nucleoside, 2'-O-(N-methylacetamide) nucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), tricyclic nucleic acid, restricted methoxyethyl (cMOE), restricted ethyl (cET), and peptide nucleic acid (PNA), and optionally further comprising an oligonucleotide as a spacer.
[0344] In various embodiments, a method for treating a subject requiring treatment for amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) comprises administering to the subject an oligonucleotide, or a pharmaceutically acceptable salt thereof, comprising a segment having up to seven linked nucleosides, wherein the oligonucleotide shares at least 85% identity with one of SEQ ID NOs. 13-1283 or 2571-2594, wherein at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently phosphodiester bonds, phosphorothioate bonds, alkylphosphate bonds, phosphorodithioate bonds, phosphotriester bonds, alkylphosphonate bonds, 3-methoxypropylphosphonate bonds, methylphosphonate bonds, aminoalkylphosphotriester bonds, alkylenephosphonate bonds, phosphinate bonds, phosphoramidate bonds, phospho Selected from the group consisting of a thioamidethioate bond, thiophosphodiamideate bond, phosphorodiamidate bond, aminoalkylphosphoroamideate bond, thiophosphoroamideate bond, thionoalkylphosphonate bond, thionoalkylphosphotriester bond, thiophosphate bond, selenophosphate bond, and boranophosphate bond, and / or at least one (i.e., one or more) nucleoside is 2'-O-(2-methoxyethyl)nucleoside A method is disclosed herein in which the nucleotide is substituted with a component selected from the group consisting of 2'-O-methyl nucleoside, 2'-O-(N-methylacetamide) nucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), tricyclic nucleic acid, restricted methoxyethyl (cMOE), restricted ethyl (cET), and peptide nucleic acid (PNA), and optionally further comprising an oligonucleotide as a spacer.
[0345] Treatment and evaluation Patients as described herein refer to any animal, including but not limited to mammals, primates, and humans, that is at risk of, has a neurological disorder, or has been diagnosed with a neurological disorder. In certain embodiments, patients may be non-human mammals such as cats, dogs, or horses. Patients may be individuals diagnosed as being at high risk of developing a neurological disorder, individuals who have been diagnosed with a neurological disorder, individuals who have previously had a neurological disorder, or individuals with symptoms or signs of a neurological disorder, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP Individuals may be evaluated for any of the signs or symptoms associated with neurological disorders such as 43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic-dominant age-related TDP-43 encephalopathy (LATE)), epilepsy, age-related TDP-43 brain disease with sclerosis (CARTS), facial-onset sensorimotor neuropathy, Guam Parkinson's dementia complex, multiple system proteinopathy, CTE, and synaptic disorders such as autism.
[0346] As used herein, “Patients in Need” means patients who have any of the symptoms or signs of a neurological disorder, patients who may have any of the symptoms or signs of a neurological disorder, or any patient who may benefit from the methods disclosed herein for treating a neurological disorder. Patients in Need may include patients who have been diagnosed as being at risk of developing a neurological disorder, patients who have had a neurological disorder in the past, or patients who have previously received treatment for a neurological disorder.
[0347] As used herein, “effective dose” refers to the amount of drug sufficient to treat at least partially the condition when administered to a patient. The therapeutic effective dose varies depending on the severity of the condition, the route of administration of the component, and the age and weight of the patient being treated. Therefore, the effective dose of the UNC13A oligonucleotide disclosed is the amount of UNC13A oligonucleotide required to treat a patient’s neurological condition such that the administration of the drug prevents the development of the neurological condition in the subject, prevents the progression of the neurological condition (e.g., prevents the onset or increase in the severity of neurological symptoms such as muscle weakness, spasms, or fasciculations), or reduces or completely improves all associated symptoms of the neurological condition, i.e., causes regression of the disease.
[0348] The effectiveness of the treatment may be evaluated by assessment of macroscopic symptoms associated with neurological disorders, analysis of histological features, biochemical assays, imaging methods such as magnetic resonance imaging, or other known methods. For example, the effectiveness of the treatment may be evaluated by analyzing macroscopic symptoms of the disease, such as changes in muscle strength and control of macroscopic pathology or other aspects associated with neurological disorders, after administering the disclosed UNC13A oligonucleotide to patients suffering from neurological disorders.
[0349] The effectiveness of treatment may also be evaluated at the tissue or cellular level, for example, by obtaining tissue biopsies (e.g., brain, spinal cord, muscle, motor neuron tissue biopsies, or olfactory nerve bulb cell biopsies) and evaluating macroscopic tissue or cell morphology or staining characteristics. Biochemical assays examining protein or RNA expression may also be used to evaluate the effectiveness of treatment. For example, those skilled in the art may evaluate the levels of proteins or gene products exhibiting neurological disease in dissociated cells or non-dissociated tissues using methods useful for evaluating RNA levels, such as immunocytochemistry, immunohistochemistry, Western blotting or Northern blotting, or quantitative or semi-quantitative polymerase chain reactions (e.g., digital PCR (dPCR, or dePCR), qPCR, etc.). Those skilled in the art will know of useful biomarkers found in cerebrospinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles ("CSF exosomes"), e.g., as described in Welton et al., (2017) "Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis" J Extracell Vesicles., 6(1):1-10, and Street et al., (2012) "Identification and proteomic profiling of exosomes in human cerebrospinal fluid" J Transl. Med., 10:5), urine, feces, lymph, blood, plasma, or serum (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 extracellular domain (p75 extracellular domain, p75). ECDThe presence or expression level of )) may also be evaluated. Those skilled in the art may also evaluate the presence or expression level of useful biomarkers found in plasma, extracellular vesicles / exosomes of nerve cells. Additional measurements of efficacy may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), kinetics, accurate test of limb isometric strength (ATLIS), compound muscle action potential (CMAP), and ALSFRS-R. In certain embodiments, the extracellular domain of the neurotrophin receptor p75 (p75) in urine may be used. ECD Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). It predicts disease status and survival rates in patients with C9ORF72-associated amyotrophic lateral sclerosis (c9ALS). CSF pNFH as a prognostic biomarker in clinical trials increases the likelihood of successful development of treatments for c9ALS.
[0350] When evaluating the effectiveness of a treatment, suitable controls may be selected to ensure an effective evaluation. For example, a person skilled in the art may compare the symptoms evaluated in a patient with a neurological disorder after administration of the disclosed UNC13A oligonucleotide with the symptoms of the same patient before treatment or at an early stage in the treatment process, or with the symptoms of another patient not diagnosed with a neurological disorder. Alternatively, a person skilled in the art may compare the results of biochemical or histological analysis of tissue after administration of the disclosed UNC13A oligonucleotide with the results of biochemical or histological analysis of tissue from the same patient, or from an individual not diagnosed with a neurological disorder, or from the same patient before administration of the UNC13A oligonucleotide. In addition, a person skilled in the art may compare blood, plasma, serum, cells, urine, lymph, cerebrospinal fluid, or fecal samples after administration of the UNC13A oligonucleotide with equivalent samples from an individual not diagnosed with a neurological disorder, or from the same patient before administration of the UNC13A oligonucleotide. In some embodiments, those skilled in the art may compare extracellular vesicles (e.g., CSF exosomes) after administration of UNC13A oligonucleotide with extracellular vesicles from individuals not diagnosed with neurological disorders or from the same patients before administration of UNC13A oligonucleotide.
[0351] The validation of UNC13A oligonucleotides may be determined by direct or indirect assessment of UNC13A expression levels or activity. For example, a biochemical assay measuring UNC13A protein or RNA expression may be used to assess the overall effect on UNC13A transcripts (e.g., UNC13A premRNA) containing sequences that share at least 85% identity with any one of SEQ ID NOs. 13-1283 or 2571-2594. For example, those skilled in the art may assess the overall UNC13A level by measuring UNC13A protein levels in cells or tissues by Western blotting. Those skilled in the art may also measure UNC13A mRNA levels by Northern blotting or quantitative polymerase chain reaction to determine the overall impact on UNC13A transcripts (e.g., UNC13A premRNA) containing sequences that share at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. Those skilled in the art may also assess levels of UNC13A protein or other proteins exhibiting UNC13A signaling activity in dissociated cells, non-dissociated tissues, extracellular vesicles (e.g., CSF exosomes), blood, serum, or fecal matter by immunocytochemical or immunohistochemical methods.
[0352] The regulation of the expression level of UNC13A transcripts (e.g., UNC13A premRNA) containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. This regulation is associated with autophagy, endocytosis, protein aggregation, and useful biomarkers (e.g., neurofilamentous light chain (NEFL), neurofilamentous heavy chain (NEFH), TDP-43, or p75) found in plasma, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph, feces, or tissues. ECDIn some cases, the regulation of UNC13A transcript expression (e.g., UNC13A premRNA) containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of sequence numbers 13-1283 or 2571-2594 may be evaluated indirectly by measuring parameters such as the presence or expression level of the sequence. The regulation of the expression level of UNC13A transcripts (e.g., UNC13A premRNA) containing sequences that share at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of sequence numbers 13-1283 or 2571-2594 may be indirectly assessed by measuring parameters such as the presence or expression levels of physiological biomarkers such as autophagy, endocytosis, protein aggregation, and compound muscle action potentials (CMAP). Additional measurements may include intensity duration constant (SDTC), short-latency intracortical inhibition (SICI), kinetics, accurate isometric muscle strength testing (ATLIS), compound muscle action potentials, and ALSFRS-R. In certain embodiments, the extracellular domain of the urinary neurotrophin receptor p75 (p75 ECD Phosphorylated neurofilament heavy chains (pNFH) in cerebrospinal fluid (CSF) are a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chains (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival rate in c9ALS patients. CSF pNFH as a prognostic biomarker in clinical trials increases the likelihood of successful development of treatments for c9ALS.
[0353] This disclosure also provides a method for restoring the expression of the full-length UNC13A transcript in the cells of patients suffering from neurological disorders. The full-length UNC13A transcript can be restored in any cells in which UNC13A expression or activity occurs, including cells of the nervous system (including the central nervous system (e.g., spinal cord or brain), peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, brain, brainstem, frontal lobe, temporal lobe, and spinal cord), musculoskeletal system, cerebrospinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes). Motor neurons include upper motor neurons and lower motor neurons.
[0354] Pharmaceutical composition and route of administration This disclosure also provides a method for treating neurological disorders by administering a pharmaceutical composition comprising the disclosed UNC13A oligonucleotide. In another aspect, this disclosure provides a pharmaceutical composition for use in the treatment of neurological disorders. The pharmaceutical composition may consist of the disclosed UNC13A oligonucleotide and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutical composition” means, for example, a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount of the therapeutic compound, in a pharmaceutically acceptable carrier, which is administered to a mammal, e.g., a human, for the treatment of a neurological disorder. In some embodiments, pharmaceutical compositions comprising the disclosed UNC13A oligonucleotide and a pharmaceutically acceptable carrier are described herein. In another aspect, this disclosure provides the use of the disclosed UNC13A oligonucleotide in the manufacture of a pharmaceutical for the treatment of a neurological disorder. As used herein, “pharmaceutical” has essentially the same meaning as “pharmaceutical composition.”
[0355] As used herein, “pharmaceutically acceptable carrier” means a buffer, carrier, and excipient suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, commensurate with a reasonable risk-benefit ratio. The carrier should be “acceptable” in the sense that it is compatible with other components of the formulation and is not harmful to the patient. pharmaceutically acceptable carriers include buffers, solvents, dispersions, coatings, isotonic agents, and absorption retarders suitable for pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment, the pharmaceutical composition includes an enteric coating suitable for modifying the absorption site of a substance administered orally and encapsulated in the gastrointestinal system or gastrointestinal tract. For example, the enteric coating may include an ethyl acrylate-methacrylate copolymer.
[0356] In one embodiment, the disclosed UNC13A oligonucleotide and any pharmaceutically active ingredient thereof may be administered by one or more routes, including topical, intrathecal, intrathalamic, intracerebral, intravascular, parenteral, oral, rectal, buccal, sublingual, vaginal, pulmonary, intratracheal, intranasal, percutaneous, or duodenal. As used herein, the term parenteral includes subcutaneous injection, intrapancreatic administration, intravenous, intracerebral, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection, or infusion techniques. For example, the disclosed UNC13A oligonucleotide may be administered subcutaneously to a subject. In another example, the disclosed UNC13A oligonucleotide may be administered orally to a subject. In another example, the disclosed UNC13A oligonucleotide may be administered parenterally directly to the nervous system, or to specific regions or cells of the nervous system (e.g., the brain, brainstem, lower motor neurons, spinal cord, upper motor neurons). For example, the disclosed UNC13A oligonucleotide may be administered intrathecally, intrathalamally, intracisionally, or intraventricularly.
[0357] In various embodiments, UNC13A oligonucleotides, such as UNC13A AON, can be exposed to a calcium-containing buffer before administration. Such calcium-containing buffers can mitigate the toxic adverse effects of UNC13A oligonucleotides. Further details regarding the exposure of exemplary antisense oligonucleotides to a calcium-containing buffer are described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is incorporated herein by reference in its entirety.
[0358] In some embodiments, UNC13A oligonucleotides, such as UNC13A AON, can be encapsulated in a nanoparticle coating. Nanoparticle encapsulation is thought to prevent the degradation of AON and enhance cellular uptake. For example, in some embodiments, UNC13A oligonucleotides are encapsulated in a coating of cationic polymers, such as synthetic polymers (e.g., poly-L-lysine, polyamidoamine, poly(β-aminoester), and polyethyleneimine) or naturally occurring polymers (e.g., chitosan and protamine). In some embodiments, UNC13A oligonucleotides are encapsulated in lipids or lipid-like substances, such as cationic lipids, cationic lipid-like substances, or ionizable lipids that are positively charged only at acidic pH. An example of lipid nanoparticle nucleotide therapy is XCUR-FXN of Exicure, a lipid nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, UNC13A oligonucleotides are encapsulated in lipid nanoparticles containing a hydrophobic moiety, such as cholesterol and / or polyethylene glycol PEG lipids.
[0359] In various embodiments, the pharmaceutical composition comprising the disclosed UNC13A oligonucleotide may further comprise a bora amphiphilic compound. Exemplary bora amphiphilic compounds are described in International Publication Nos. 2014039493(A1), 2014039500(A1), 2014039502(A1), 2014039503(A1), and 2014039504(A1), each of which is incorporated herein by reference in its entirety. In certain embodiments, the bora amphiphilic compound is of formula I:HG 2 L 1 HG 1 Compounds conforming to the formula, or pharmaceutically acceptable salts, solvates, hydrates, prodrugs, stereoisomers, tautomers, isotopic variants, or N-oxides thereof, or combinations thereof, where each HG 1 and HG 2 It is independently a hydrophilic head group, L 1 The linker is an alkylene, alkenyl, heteroalkylene, or heteroalkenyl linker, which is either unsubstituted or substituted with a C1-C20 alkyl, hydroxyl, or oxo molecule.
[0360] In one embodiment, with respect to the borahimphiphilic compound of formula I, the borahimphiphilic compound is of formula II, formula III, formula IV, formula V, or formula VI.
[0361] [ka] or
[0362] [ka]
[0363] Compounds according to or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof. During the ceremony, Each HG 1 and HG2 It is independently a hydrophilic head group, each Z 1 and Z 2 Independently, -C(R 3 )2-, -N(R 3 )-, or -O-, Each R 1a , R 1b , R 3 , and R 4 These are independently H or Ci-C8 alkyl, Each R 2a and R 2b These are independently H, Ci-C8 alkyl, OH, alkoxy, or O-HG 1 Or O-HG 2 And each n8, n9, n11, and n12 is an integer between 1 and 20, n10 is an integer between 2 and 20. Each dotted line represents either a single or double bond, independently of the others.
[0364] In one embodiment, with respect to a bora amphiphilic compound of formula I, formula II, formula III, formula IV, formula V, or formula VI, each HG 1 and HG 2 Independently,
[0365] [ka]
[0366] Selected from, in the formula, X is -NR 5a R 5b or -N + R 5a R 5b R 5c And each R 5a and R 5b These are, independently, H or substituted or unsubstituted C1-C 20 It is alkyl, or R 5a and R 5b These may combine to form an N-containing substituted or unsubstituted heteroaryl, or a substituted or unsubstituted heterocycline, and each R 5cThese are independently substituted or non-substituted C1~C 20 It is alkyl, and each R 8 These are, independently, H, substituted or unsubstituted C1-C 20 It is alkyl, alkoxy, or carboxyl, m1 is 0 or 1, and each n13, n14, and n15 is an integer between 1 and 20 independently.
[0367] In various embodiments, the pharmaceutical compositions disclosed herein include a complex between a bora amphiphilic substance and a pharmacologically or biologically active compound (e.g., UNC13A oligonucleotide disclosed herein). In various embodiments, the pharmaceutical compositions disclosed herein include a bora amphiphilic vesicle complex comprising one or more bora amphiphilic compounds, wherein the biologically active compound is an oligonucleotide (e.g., UNC13A oligonucleotide disclosed herein).
[0368] Pharmaceutical compositions containing the UNC13A oligonucleotides disclosed herein, such as the UNC13A oligonucleotides disclosed herein, can be provided in unit dosage forms and can be prepared by any preferred method. The pharmaceutical compositions should be formulated to be compatible with their intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, Remington's Pharmaceutical Sciences, 18 th See ed. (Mack Publishing Company, 1990).
[0369] In some embodiments, the pharmaceutical formulation is sterilized. Sterilization can be achieved, for example, by filtration using a sterile filtration membrane. If the composition is freeze-dried, sterilization by filtration can be performed before or after freeze-drying and reconstitution.
[0370] Parenteral administration The pharmaceutical compositions of this disclosure can be formulated for parenteral administration, for example, for injection via intravenous, intracisional, intraventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intrafocal, or intraperitoneal routes. The preparation of aqueous compositions, such as aqueous pharmaceutical compositions containing the UNC13A oligonucleotide disclosed, will be known to those skilled in the art in light of this disclosure. Typically, such compositions can be prepared as either liquid solutions or suspensions for injection, and solid forms suitable for use in preparing solutions or suspensions when liquid is added before injection can also be prepared, and the preparations can also be emulsified.
[0371] Suitable pharmaceutical forms for injection include sterile aqueous solutions or dispersions; preparations containing physiological saline, artificial cerebrospinal fluid, sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the immediate preparation of sterile injection solutions or dispersions. In all cases, the form must be sterile and fluid enough to allow for easy injection. It must be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi.
[0372] Solutions of the active compound, as a free base or a pharmacokinetically acceptable salt, can be prepared in water, suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and in oil. In addition, sterile fixatives can be used as solvents or suspensions. For this purpose, any non-irritating fixative, including synthetic monoglycerides or diglycerides, can be used. In addition, fatty acids such as oleic acid can be used in the preparation of injections. Sterile injection preparations may also be sterile injection solutions or suspensions in a non-toxic, parenterally acceptable diluent or solvent, for example, as a 1,3-butanediol solution. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. In one embodiment, the disclosed UNC13A antisense oligonucleotide can be suspended in a carrier fluid containing 1% (w / v) carboxymethylcellulose sodium and 0.1% (v / v) TWEEN® 80. These preparations contain preservatives to prevent microbial growth under normal storage and use conditions.
[0373] Preparations for injection, such as sterile aqueous or oily suspensions for injection, can be formulated according to known techniques using suitable dispersants or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile vehicle containing a basic dispersion medium and other necessary components listed above. A sterile solution for injection of the present disclosure may be prepared by incorporating the disclosed UNC13A antisense oligonucleotide into the required amount of a suitable solvent having various other components listed above, and then sterilizing and filtering as necessary. In the case of sterile powders for the preparation of sterile solutions for injection, preferred preparation methods are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient + any additional desired components from its previously sterilizing and filtered solution. Injectable formulations can be sterilized, for example, by filtration with a bacterial-retaining filter.
[0374] The preparation of more concentrated or highly concentrated solutions for intramuscular injection is also being considered. In this regard, the use of DMSO as a solvent is preferred because it provides very rapid penetration, allowing high concentrations of the disclosed oligonucleotides to be delivered to a small area.
[0375] Suitable preservatives for use in such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, and thimerosal. Suitable buffers include boric acid, sodium bicarbonate and potassium bicarbonate, sodium borate and potassium borate, sodium carbonate and potassium carbonate, sodium acetate, and sodium biphosphate in amounts sufficient to maintain the pH at approximately pH 6 to pH 8, for example, approximately pH 7 to pH 7.5. Suitable isotonic agents include dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, and sodium chloride, so that the sodium chloride equivalent of the solution is in the range of 0.9 ± 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, and thiourea. Suitable wetting agents and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282, and tyloxapol. Suitable thickeners include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, and carboxymethylcellulose.
[0376] Oral administration In some embodiments, compositions suitable for oral delivery of the disclosed UNC13A oligonucleotide, such as tablets comprising an enteric coating, for example, a gastric-resistant coating, are intended herein, so that the composition can deliver the UNC13A oligonucleotide, for example, to the gastrointestinal tract of a patient.
[0377] For example, a tablet for oral administration is provided comprising granules (e.g., at least partially formed from granules) containing a UNC13A oligonucleotide represented by one of SEQ ID NOs: 13-1283 or 2571-2594, which targets a UNC13A transcript containing a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 1284-2554, and a pharmaceutically acceptable excipient. Such a tablet may be coated with an enteric coating. The intended tablets may contain pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and / or lubricants, as well as colorants, release agents, coating agents, sweeteners, flavoring agents, such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and fragrances, preservatives, and / or antioxidants.
[0378] In some embodiments, the intended pharmaceutical formulation comprises a granular inner phase comprising a UNC13A oligonucleotide represented by one of SEQ ID NOs: 13-1283 or 2571-2594, which targets a UNC13A transcript containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 1284-2554, and a pharmaceutically acceptable salt. In some embodiments, the intended pharmaceutical formulation comprises a granular inner phase comprising a UNC13A oligonucleotide represented by one of SEQ ID NOs: 13-1283 or 2571-2594, which targets a UNC13A transcript containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 1284-2554, and a pharmaceutically acceptable filler. For example, the disclosed UNC13A oligonucleotide and filler may be blended with other excipients to form granules. In some embodiments, the granular internal phase may be formed using a wet granulation method, for example, by adding a liquid (e.g., water) to a blend of UNC13A oligonucleotides and a packing agent, after which the combination is dried, ground, and / or sieved to produce granules. Those skilled in the art will understand that other processes may be used to achieve the granular internal phase.
[0379] In some embodiments, the intended formulation may comprise one or more pharmaceutically acceptable excipients and include an outer granular phase that can be blended with the inner granular phase to form the disclosed formulation.
[0380] The disclosed formulations may include a granular inner phase containing fillers. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylate, dextrose, cellulose acetate, hydroxypropyl methylcellulose, partially pregelatinized starch, calcium carbonate, and other combinations thereof.
[0381] In some embodiments, the disclosed formulations may include an inner and / or outer granular phase containing a binder, which generally functions to hold together the components of the pharmaceutical formulation. Exemplary binders of this disclosure may include, but are not limited to, starch, sugars, modified cellulose such as cellulose or hydroxypropylcellulose, lactose, pregelatinized corn starch, polyvinylpyrrolidone, hydroxypropylcellulose, hydroxypropylmethylcellulose, low-substituted hydroxypropylcellulose, sodium carboxymethylcellulose, methylcellulose, ethylcellulose, sugar alcohols, and other combinations thereof.
[0382] The intended formulation (e.g., including the granular inner phase and / or granular outer phase) may contain disintegrants including, but not limited to, starch, cellulose, cross-linked polyvinylpyrrolidone, sodium starch glycolate, sodium carboxymethylcellulose, alginate, corn starch, sodium crosmellose, cross-linked carboxymethylcellulose, low-substituted hydroxypropylcellulose, acacia, and other combinations thereof. For example, the granular inner phase and / or granular outer phase may contain disintegrants.
[0383] In some embodiments, the intended formulation comprises a granular inner phase comprising a disclosed UNC13A oligonucleotide and an excipient selected from mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose, and sodium starch glycolate, or a combination thereof, and a granular outer phase comprising one or more of microcrystalline cellulose, sodium starch glycolate, and magnesium stearate, or a mixture thereof.
[0384] In some embodiments, the intended formulation may contain a lubricant; for example, the granular outer phase may contain a lubricant. Examples of lubricants include, but are not limited to, talc, silica, fat, stearin, magnesium stearate, calcium phosphate, silicon dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearate, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.
[0385] In some embodiments, the pharmaceutical formulation includes an enteric coating. Generally, enteric coatings create a barrier for oral drugs that controls the location at which the drug is absorbed along the gastrointestinal tract. Enteric coatings may contain polymers that disintegrate at different rates depending on the pH. Enteric coatings may include, for example, cellulose phthalate acetate, methyl acrylate-methacrylic acid copolymer, cellulose succinate acetate, hydroxypropyl methylcellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl phthalate acetate, and cellulose phthalate acetate.
[0386] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, and Eudragit® grades. In some embodiments, the enteric coating may constitute about 5% to 10% by weight, about 5% to 20% by weight, 8% to 15% by weight, about 8% to 20% by weight, about 10% to 20% by weight, or about 12% to 20% by weight, or about 18% by weight of the intended tablet. For example, the enteric coating may contain an ethyl acrylate-methacrylate copolymer.
[0387] For example, in a planned embodiment, tablets are provided containing or essentially comprising about 0.5% to about 70% by weight, for example, about 0.5% to about 10% by weight or about 1% to about 20% by weight of a disclosed UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof. Such tablets may, for example, contain about 0.5% to about 60% by weight of mannitol, for example, about 30% to about 50% by weight of mannitol, for example, about 40% by weight of mannitol, and / or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, the disclosed tablets may contain a granular inner phase comprising about 30% to about 60% by weight, e.g., about 45% to about 65% by weight, or alternatively, about 5% to about 10% by weight of the disclosed UNC13A oligonucleotide, about 30% to about 50% by weight, or alternatively, about 5% to about 15% by weight of mannitol, about 5% to about 15% by weight of microcrystalline cellulose, about 0% to about 4% by weight, or about 1% to about 7% by weight of hydroxypropyl methylcellulose, and about 0% to about 4% by weight, e.g., about 2% to about 4% by weight of sodium starch glycolate.
[0388] In another intended embodiment, a pharmaceutical tablet formulation for oral administration of the disclosed UNC13A oligonucleotide may comprise an inner granular phase comprising the disclosed UNC13A AON or a pharmaceutically acceptable salt thereof (such as a sodium salt) and a pharmaceutically acceptable filler, and may also comprise an outer granular phase which may comprise a pharmaceutically acceptable excipient such as a disintegrant. The outer granular phase may comprise components selected from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also comprise an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise an enteric coating comprising about 0.5% to 10% by weight of the disclosed UNC13A AON, e.g., the disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight of mannitol, about 10% to 30% by weight of microcrystalline cellulose, and an ethyl acrylate-methacrylate copolymer.
[0389] In another example, a pharmaceutically acceptable tablet for oral use may comprise a granular inner phase comprising about 5 to about 10 wt% of disclosed UNC13A AON, e.g., disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 40 wt% of mannitol, about 8 wt% of microcrystalline cellulose, about 5 wt% of hydroxypropyl methylcellulose, and about 2 wt% of sodium starch glycolate; a granular outer phase comprising about 17 wt% of microcrystalline cellulose, about 2 wt% of sodium starch glycolate, and about 0.4 wt% of magnesium stearate; and an enteric coating on the tablet comprising an ethyl acrylate-methacrylate copolymer.
[0390] In some embodiments, the pharmaceutical composition may contain about 13% by weight or about 15%, 16%, 17%, or 18% by weight of an enteric coating, for example, AcyrlEZE® (see, for example, International Publication 2010 / 054826, which is incorporated herein in its entirety by reference).
[0391] The dissolution rate is the rate at which the coating dissolves and the active ingredient is released. In one embodiment, the intended tablet may have a dissolution profile in which, for example, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in phosphate buffer at pH 7.2, releases about 50% to about 100% of UNC13A oligonucleotide after about 120 minutes to about 240 minutes, for example, after 180 minutes. In another embodiment, the intended tablet may have a dissolution profile in which, for example, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in dilute HCl at pH 1.0, substantially no UNC13A oligonucleotide is released after 120 minutes. In another embodiment, the intended tablets may have a solubility profile that, for example, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in pH 6.6 phosphate buffer, release about 10% to about 30%, or less than about 50%, of UNC13A oligonucleotides after 30 minutes.
[0392] In some embodiments, the methods provided herein may further include administering at least one other agent intended for the treatment of diseases and disorders disclosed herein. In one embodiment, the other agent intended may be administered concurrently (e.g., sequentially or simultaneously).
[0393] Dosage and frequency of administration The dosages or amounts listed below refer to either oligonucleotides or their pharmaceutically acceptable salts.
[0394] In some embodiments, the methods described herein include administering at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of UNC13A antisense oligonucleotide, for example, UNC13A oligonucleotide. In some embodiments, the methods include administering 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 70 mg to 80 mg, 80 mg to 90 mg, 90 mg to 100 mg, 100 mg to 150 mg, 150 mg to 200 mg, 200 mg to 250 mg, 250 mg to 30 mg This includes administering UNC13A antisense oligonucleotides in doses of 0 mg, 300 mg to 350 mg, 350 mg to 400 mg, 400 mg to 450 mg, 450 mg to 500 mg, 500 mg to 600 mg, 600 mg to 700 mg, 700 mg to 800 mg, 800 mg to 900 mg, 900 mg to 1 g, 1 mg to 50 mg, 20 mg to 40 mg, or 1 mg to 500 mg.
[0395] In some embodiments, the methods described herein include administering a formulation containing about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of the disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain about 40 mg, 80 mg, or 160 mg of the disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain at least 100 μg of the disclosed UNC13A oligonucleotide. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of the disclosed UNC13A oligonucleotide. The dose administered depends on variables such as the type and severity of the disease or symptom being treated, the patient's overall health and size, the in vivo potency of the UNC13A oligonucleotide, the pharmaceutical formulation, and the route of administration. The initial dose may be increased beyond the upper limit to rapidly achieve the desired blood or tissue level. Alternatively, the initial dose may be less than the optimal dose, and the dose may be gradually increased during the course of treatment. Human doses can be optimized, for example, in conventional Phase I dose escalation studies. The frequency of medication can vary depending on factors such as the route of administration, the dosage, and the disease, disorder, or condition being treated. Exemplary medication frequencies are once daily, once weekly, and once every two weeks. In some embodiments, medication is administered once daily over seven days. In some embodiments, medication is administered once every four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, ten weeks, eleven weeks, or twelve weeks. In some embodiments, medication is administered monthly to every three months.In some embodiments, the medication is administered once every two weeks for three doses, followed by monthly, bimonthly, or every three or four months.
[0396] Combination therapy In various embodiments, the UNC13A AON disclosed herein can be administered in combination with one or more additional therapies. Combination therapy with the disclosed oligonucleotides and one or more additional therapies may, in some embodiments, be used to treat amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteinosis. It may be synergistic in treating any of the following conditions: (for example, chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Parkinson's disease, Parkinson's disease with or without dementia, limbic-dominant age-related TDP-43 encephalopathy (LATE)), epilepsy, age-related TDP-43 brain disease with sclerosis (CARTS), facial-onset sensorimotor neuropathy, Guam Parkinson's dementia complex, multiple system proteinopathy, CTE, and synaptic disorders such as autism.
[0397] Non-exclusive examples of therapies for Parkinson's disease (PD) include deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, Inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), and benzthol. Examples include pine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapon (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, reishi mushroom, BIIB054, BIIB094, caffeine, salizotan, nuplazid, and embryonic dopamine cell transplantation.
[0398] Non-exclusive examples of therapies for Alzheimer's disease (AD) include aducanamab (Aduhlem), memantine (Namenda), donepezil (Aricept), rivastigmine (Exelon), galantamine (razadyne), Namzeric, suvorexant (belsomra), and recanemab.
[0399] A non-limiting example of a therapy for amyotrophic lateral sclerosis (ALS) is pridopidine.
[0400] Non-limiting examples of therapies for frontotemporal dementia (FTD) include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintelix)), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogestone.
[0401] Non-specific examples of therapies for epilepsy include brivalacetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), and oxcarbazepine (oxtellar). Examples include XR (Trileptal), perampanel (Fycompa), phenobarbital, phenytoin (Dilantin), pregabalin (Lyrica), thiagabine (Gabitril), topiramate (Topamax), valproate (Depakene, Depakote), and zonisamide (Zonegran).
[0402] Examples of additional therapies include any of the following: riluzole (Rilutek), PrimeC, edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyproestrone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants, and psychostimulants. Additional therapies may further include respiratory therapy, physical therapy, occupational therapy, speech therapy, and nutritional support. Further non-limiting examples of additional therapies include deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), benztropin (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapon (ongentys), and tolcapone. Tasmar, apomorphine (apokyn, kynmobi), exenatide, reishi mushroom, BIIB054, BIIB094, caffeine, salizotan, embryonic dopamine cell transplantation, aducanamab (Aduhlem), memantine (Namenda), donepezil (Aricept), rivastigmine (Exelon), galantamine (razadyne), Namzeric, suvorexant (belsomra), lecanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex),Fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintelix), divalproex sodium (Depakote), carbamazepine (Tegretol), medroxyprogestone, brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, T Examples include egretol, cenovamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar XR, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), thiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran). In various embodiments, the additional therapy may be a second antisense oligonucleotide. For example, the second antisense oligonucleotide may target UNC13A transcripts (e.g., UNC13A premRNA, mature UNC13A mRNA) to modulate the expression level of the full-length UNC13A protein.
[0403] Non-limiting examples of therapies for spinal cord injury include bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion. Further details of exemplary bioactive scaffolds as therapies for spinal cord injury are described in Alvarez et al., "Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury," Science, 374, 848-856 (2021), which is incorporated herein by reference in its entirety.
[0404] In various embodiments, the disclosed oligonucleotides and one or more additional therapies may be conjugated with each other and provided in a conjugated form. Further description of conjugates containing the disclosed oligonucleotides is provided below. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided concurrently. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided sequentially.
[0405] Conjugate In certain embodiments, oligomeric compounds comprising an oligonucleotide (e.g., UNC13A oligonucleotide) and optionally one or more conjugate groups and / or terminal groups are provided herein. The conjugate group comprises one or more conjugate moieties and a conjugate linker linking the conjugate moieties to the oligonucleotide. The conjugate group may be bonded to either or both ends of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugate group is bonded to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group bonded to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is bonded to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is bonded to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is bonded near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is bonded to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is bonded near the 5' end of the oligonucleotide.
[0406] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0407] conjugate group In certain embodiments, UNC13A AON is covalently bonded to one or more conjugate groups. In certain embodiments, the conjugate groups modify one or more properties of the conjugated oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate groups alter (e.g., increase) the circulation time of the oligonucleotide in the bloodstream so that an increased concentration of the oligonucleotide is delivered to the brain. In certain embodiments, the conjugate groups alter (e.g., increase) the residence time of the oligonucleotide in a target organ (e.g., the brain) so that an increase in the residence time of the oligonucleotide improves their performance (e.g., efficacy). In certain embodiments, the conjugate groups increase the delivery of the oligonucleotide to the brain across the blood-brain barrier and / or brain parenchyma (e.g., via receptor-mediated transcytosis). In certain embodiments, the conjugate groups enable the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, the conjugate group imparts a new property to the bound oligonucleotide, such as a fluorophore or reporter group that enables the detection of the oligonucleotide. Certain conjugate groups and conjugate moieties include, for example, cholesterol moieties (Letsinger et al. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al.EMBO J, 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides (1995, 14, 969-973), or the palmityl adamantane acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), the octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), the tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or the GalNAc cluster (e.g., International Publication No. 2014 / 179620) have been previously described.
[0408] Conjugate portion Examples of conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, pigments, bile acids, and phenylbutyric acid. In certain embodiments, the conjugate moiety is selected from peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, antibodies (e.g., antibodies for crossing the blood-brain barrier, such as anti-transferrin receptor antibodies), or cell-permeable peptides (e.g., transactivators of transcription (TAT) and penetratin).
[0409] In certain embodiments, the conjugate portion includes an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, S-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic agents, antibacterial agents, or antibiotics.
[0410] Conjugate Linker The conjugate moiety is bonded to UNC13A AON via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly bonded to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, a nucleoside, or an amino acid unit.
[0411] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0412] In certain embodiments, conjugate linkers, including the conjugate linker described above, are known in the art to be useful for conjugating a conjugate group to a parent compound, such as an oligonucleotide provided herein, which is a difunctional linkage. Generally, a difunctional linkage includes at least two functional groups. One of the functional groups is selected to bond to a specific site on the parent compound, and the other functional group is selected to bond to a conjugate group. Examples of functional groups used in a difunctional linkage include, but are not limited to, electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In certain embodiments, the difunctional linkage includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.
[0413] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C1 10 Alkyl, substituted, or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Examples of preferred substituents include, but are not limited to, alkynyls, and a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0414] In certain embodiments, the conjugate linker contains 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker contains 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker contains 3 linker nucleosides.
[0415] In certain embodiments, such a linker nucleoside is a modified nucleoside. In certain embodiments, such a linker nucleoside contains a modified sugar moiety. In certain embodiments, the linker nucleoside is unmodified. In certain embodiments, the linker nucleoside contains a heterocyclic base protected by an optional selection from purines, substituted purines, pyrimidines, or substituted pyrimidines. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable that the linker nucleoside be cleaved from the oligomeric compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the rest of the oligomeric compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0416] In this specification, linker nucleosides are not considered part of oligonucleotides. Therefore, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specified complementarity percentage to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker containing a linker nucleoside, those linker nucleosides are not counted against the length of the oligonucleotide and are not used in determining the complementarity percentage of the oligonucleotide to the reference nucleic acid.
[0417] In certain embodiments, it is desirable that the conjugate group be cleaved from UNC13A AON. For example, under certain circumstances, an oligomeric compound containing a particular conjugate moiety is better taken up by a particular cell type, but it is desirable that once the oligomeric compound is taken up, the conjugate group is cleaved to release the unconjugated oligonucleotide or parent oligonucleotide. Therefore, a particular conjugate linker may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.
[0418] In certain embodiments, the cleavable bond is selected from amides, esters, ethers, one or both phosphodiesters, phosphate esters, carbamates, or disulfides. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable portion includes a phosphate or a phosphodiester. In certain embodiments, the cleavable portion is a phosphate bond between the oligonucleotide and the conjugate portion or conjugate group.
[0419] In certain embodiments, the cleavable portion comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the rest of the oligomeric compound via cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxynucleoside that is bonded to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate nucleoside bond and covalently bonded to the conjugated linker or the rest of the conjugated portion by a phosphate bond or a phosphorothioate bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.
[0420] terminal group In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Examples of stabilized 5'-phosphates include, but are not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more debased nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are debased nucleosides. In various embodiments, the terminal group comprises one or more spacers.
[0421] Diagnostic methods This disclosure also provides a method for diagnosing patients with neurological disorders, which relies on detecting levels of UNC13A expression signaling in one or more biological samples from the patient. As used herein, the term “UNC13A expression signaling” may refer to UNC13A gene expression, or any indicator of gene or gene product activity. UNC13A gene products include RNA (e.g., mRNA), peptides, and proteins. Indicators of UNC13A gene expression that can be evaluated include, but are not limited to, the UNC13A gene or chromatin state, UNC13A gene interactions with cellular components that regulate gene expression, the expression level of UNC13A transcripts (e.g., UNC13A premRNA) containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs. 13-1283 or 2571-2594, or interactions between UNC13A RNA or protein and transcription, translation, or post-translational processing mechanisms.
[0422] Detection of the UNC13A expression signal can be achieved by in vivo, in vitro, or ex vivo methods. In preferred embodiments, the method of this disclosure may be performed in vitro. The detection method may involve detection in the patient's blood, serum, feces, tissue, cerebrospinal fluid, cerebrospinal fluid, urine, extracellular vesicles (e.g., CSF exosomes), or in cells. Detection can be achieved by measuring the expression signal of UNC13A transcripts (e.g., UNC13A premRNA) containing a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of sequence numbers 13-1283 or 2571-2594 in whole tissue, tissue explants, cell cultures, dissociated cells, cell extracts, extracellular vesicles (e.g., CSF exosomes), or body fluids including blood, cerebrospinal fluid, urine, lymph, plasma, or serum. Detection methods include assays that measure the expression level of the UNC13A gene product, such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blotting, quantitative or semi-quantitative polymerase chain reaction, medical imaging (e.g., MRI), or immunohistochemistry or immunocytochemistry.
[0423] General Modification While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the compounds described herein. References, GenBank accession numbers, etc., listed in this application are incorporated herein by reference in their entirety.
[0424] The sequence listings attached to this application identify each sequence as either "RNA" or "DNA" as necessary, but in practice, these sequences may be modified using any combination of chemical modifications. Those skilled in the art will readily understand that the designation of "RNA" or "DNA" to describe modified oligonucleotides is optional in certain cases. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA having a modified sugar (a 2'-OH instead of one 2'-H in DNA) or as RNA having a modified base (thymine (methylated uracil) instead of the natural uracil in RNA). Thus, the nucleic acid sequences provided herein, including but not limited to the nucleic acid sequences in the sequence listings, are intended to include nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to nucleic acids having modified nucleic acid bases. As further examples, without limitation, oligomeric compounds having the nucleic acid base sequence "ATCGATCG" include compounds containing RNA bases, whether modified or unmodified, such as compounds having the sequence "AUCGAUCG", some DNA bases and some RNA bases, such as compounds having "AUCGATCG", and other modified base sequences, such as "AT m CGAUCG" (in the array, m C includes oligomeric compounds that have a cytosine base containing a methyl group at the 5th position.
[0425] Certain compounds described herein (e.g., modified oligonucleotides) have one or more chiral centers and therefore result in other stereoisomers that can be defined in terms of enantiomers, diastereomers, and absolute stereochemistry as (R) or (S), as α or β in the case of sugar anomers, or as (D) or (L) in the case of amino acids. Compounds provided herein that are described or stated to have a particular stereoisomer include only the indicated compound. Compounds provided herein that are described or stated to have a stereocenter that is not defined include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise specified. Similarly, all tautomer forms of the compounds herein are also included, unless otherwise specified. Unless otherwise specified, the compounds described herein are intended to include the corresponding salt forms.
[0426] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, the compounds described herein that contain a hydrogen atom are: 1 This includes all possible deuterium substitutions for each of the H hydrogen atoms. The isotopic substitutions included by the compounds herein include: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C, 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 This includes, but is not limited to, sulfur (S). In certain embodiments, non-radioactive isotope substitution can impart novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. [Examples]
[0427] This disclosure is further illustrated by the following embodiments. These embodiments are provided for illustrative purposes only and should not be construed as limiting the scope or content of this disclosure in any way.
[0428] Example 1: Method for evaluating UNC13A antisense oligonucleotides UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded at a density of 35,000 cells / well in 96-well plates. Antisense oligonucleotides (AONs) against TDP43 were transfected using Endoporter (Gene Tools, Philomath, OR, USA) to reduce the expression of the full-length UNC13A transcript. The vehicle control consisted of motor neurons treated with Endoporter alone. The positive control included cells treated with TDP43 AON alone ("AON TDP43" or "TDP43 AON").
[0429] TDP43 AON is a gapmer oligonucleotide, and its sequence and chemistry are as follows:
[0430] [Table 4] (Sequence ID 2595) is present, and in the sequence, * The first character is a phosphorothioate, the underlined character is DNA, the others are 2'MOE RNA, and each "C" is 5-MeC.
[0431] To evaluate the ability of UNC13a AON to restore full-length UNC13A (UNC13A FL) mRNA (also known as precisely spliced UNC13A (UNC13A CS) mRNA), antisense oligonucleotides against UNC13A were incubated with TDP43 AON in Endoporter in culture medium and then added to cells. After 72 hours, the antisense oligonucleotides and Endoporter were washed and replaced with fresh medium only. After another 12 days, RNA was collected from 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR assays were performed using Taqman probes and reference GAPDH quantification against full-length UNC13A transcripts.
[0432] Transcription levels (e.g., full-length UNC13A transcript or TDP43 transcript) were detected by RT-qPCR using TaqMan. Specifically, RT-qPCR was performed to detect GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was also performed to detect UNC13A-FL transcript using Thermofisher® TaqMan Gene Expression Assay Hs01000584_m1.
[0433] RT-qPCR was performed using an Applied Biosystems® 7500 real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. 45 cycles of amplification were performed at 95°C for 1 second, followed by 60°C for 20 seconds.
[0434] UNC13A-FL(Ct) was normalized relative to GAPDH(ΔCt). To visualize quantitative changes (e.g., decrease in UNC13A-FL), the normalized UNC13A-FL signal was further normalized relative to the vehicle (Endoporter alone, ΔΔCt). The relative amount of transcription level (RQ) was given by the equation RQ=2 -ΔΔCt We use this to calculate and explain the comparison of the treatment conditions with the normal healthy level (1.0). The RQ value of UNC13A FL was normalized using the following formula. (((RQAON-RQTDP43) / (RQendo-RQTDP43))×100 Table 3 shows the results of RT-qPCR of UNC13A AONs with two spacers in human motor neurons. UNC13A AONs (e.g., UNC13A oligonucleotides with two spacers) were tested for their ability to increase or restore full-length UNC13A mRNA levels (i.e., the mRNA from which the full-length UNC13A protein is translated). In some cases, UNC13A AONs with spacers increased full-length UNC13A mRNA "UNC13A FL," also referred to herein as precisely spliced UNC13A CS. In some cases, UNC13A AONs with two spacers increased full-length UNC13A mRNA or precisely spliced UNC13A mRNA (UNC13A CS). Specific AON sequences are labeled according to their corresponding sequence numbers.
[0435] In summary, these results demonstrate that different UNC13A AONs containing two spacers can increase UNC13A-FL mRNA compared to a control group treated with TDP-43 AON alone.
[0436] [Table 5] *Unless otherwise noted, the nucleosides of the antisense oligonucleotides shown are each modified nucleosides having a 2'-O-(2-methoxyethyl)(2'-MOE) sugar moiety, where each "C" is replaced by 5-methylcytosine (5-MeC), and all nucleoside bonds are phosphorothioate bonds. The spacer indicated by F is not a nucleoside. F represents the spacer of formula (Iia') disclosed herein.
[0437] Example 2: Method for evaluating UNC13A antisense oligonucleotides UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded at a density of 35,000 cells / well in 96-well plates. Antisense oligonucleotides (AONs) against TDP43 were transfected using Endoporter (Gene Tools, Philomath, OR, USA) to decrease the expression of the full-length UNC13A transcript and increase the expression of the UNC13A latent exon. The vehicle control consisted of motor neurons treated with Endoporter alone. The positive control included cells treated with TDP43 AON alone ("AON TDP43" or "TDP43 AON").
[0438] TDP43 AON is a gapmer oligonucleotide, and its sequence and chemistry are as follows:
[0439] [Table 6] (Sequence ID 2595) is present, and in the sequence, * The first character is a phosphorothioate, the underlined character is DNA, the others are 2'MOE RNA, and each "C" is 5-MeC.
[0440] To evaluate the ability of UNC13A AON to reduce UNC13A latent exon levels, antisense oligonucleotides against UNC13A were incubated with TDP43 AON in Endoporter in culture medium and then added to cells. After 72 hours, the antisense oligonucleotides and Endoporter were washed and replaced with fresh medium only. After another 6 days, RNA was collected from 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR assays were performed using Taqman probes and reference GAPDH quantification against UNC13A latent exons.
[0441] Transcription levels (e.g., UNC13A latent exon and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed to detect GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. The UNC13a latent exon was detected using a custom sequence. UNC13A latent exon: Forward primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 2596) Reverse primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 2597) Probe sequence: AGTTCTTTCCAGGAAACCCAGGCA (Sequence ID 2598)
[0442] RT-qPCR was performed using an Applied Biosystems® 7500 real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. 45 cycles of amplification were performed at 95°C for 1 second, followed by 60°C for 20 seconds.
[0443] UNC13A-latency (Ct) was normalized relative to GAPDH (ΔCt). To visualize quantitative changes (e.g., decrease in UNC13A-latency %), the normalized UNC13A-latency signal was further normalized relative to the vehicle (Endoporter alone, ΔΔCt). The relative amount of transcription level (RQ) was given by the equation RQ=2 -ΔΔCt We use this to calculate and explain the comparison of treatment conditions with the normal healthy level (1.0). The RQ value for UNC13A latent was normalized using the following formula. (((RQAON-RQendo) / (RQTDP43-RQendo))×100
[0444] Table 4 shows the results of RT-qPCR for UNC13A AON with spacers in human motor neurons.
[0445] As shown in Table 4, UNC13A AONs (e.g., UNC13A oligonucleotides with two spacers) were tested for their ability to reduce UNC13A transcripts with latent exons. In some cases, UNC13A AONs with spacers reduced UNC13A latent exon levels. In some cases, UNC13A AONs without spacers reduced UNC13A latent exon levels. Specific AON sequences are labeled according to their corresponding sequence numbers.
[0446] As shown in Table 4, a 200 nM dose of Sequence ID No. 2593 (AGAGFTCTTTCCFGGAAA) reduced the UNC13A latent exon level to 8.9%.
[0447] [Table 7] *Unless otherwise noted, the nucleosides of the antisense oligonucleotides shown are each modified nucleosides having a 2'-O-(2-methoxyethyl)(2'-MOE) sugar moiety, where each "C" is replaced by 5-methylcytosine (5-MeC), and all nucleoside bonds are phosphorothioate bonds. The spacer indicated by F is not a nucleoside. F represents the spacer of formula (Iia') disclosed herein.
Claims
1. A modified UNC13A oligonucleotide consisting of 18 oligonucleotide units, each containing at least one spacer.
2. The oligonucleotide according to claim 1, wherein the modified UNC13A oligonucleotide contains a sequence that is at least 85% complementary to any one of the equilength portions of SEQ ID NOs: 1 to 12.
3. The oligonucleotide according to claim 1 or 2, wherein 16 of the 18 oligonucleotide units are complementary to any one equal-length portion of sequence numbers 1 to 12.
4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide comprises a segment having up to seven linked nucleosides.
5. The oligonucleotide according to any one of claims 1 to 4, wherein the oligonucleotide comprises a segment having up to 6, 5, 4, 3, or 2 linked nucleosides.
6. The oligonucleotide according to any one of claims 1 to 5, wherein each segment of the oligonucleotide contains up to seven linked nucleosides.
7. The oligonucleotide according to any one of claims 4 to 6, comprising a sequence that shares at least 85% identity with one of the equilength portions of sequence numbers 13 to 1283 or 2571 to 2594.
8. The oligonucleotide according to claim 7, wherein the oligonucleotide includes two spacers.
9. The oligonucleotide according to claim 8, wherein the oligonucleotide is 100% identical to any one of sequence numbers 2571 to 2594.
10. The oligonucleotide according to any one of claims 1 to 9, wherein the spacer is a nucleoside substituent containing a non-sugar substituent that cannot be linked to a nucleotide base.
11. The oligonucleotide according to claim 10, wherein the spacer is located between the 4th and 15th positions of the oligonucleotide.
12. The oligonucleotide according to claim 10 or 11, further comprising a second spacer, the second spacer being located between the 10th and 15th positions of the oligonucleotide.
13. The oligonucleotide according to claim 12, wherein the spacer and the second spacer are separated by at least two nucleic acid bases, at least three nucleic acid bases, at least five nucleic acid bases, at least five nucleic acid bases, at least six nucleic acid bases, or at least seven nucleic acid bases in the oligonucleotide.
14. The oligonucleotide according to any one of claims 11 to 13, wherein the spacer is located between the 4th and 9th positions of the oligonucleotide, and the second spacer is located between the 10th and 15th positions of the oligonucleotide.
15. The oligonucleotide according to any one of claims 11 to 14, wherein the spacer is located at position 8 of the oligonucleotide, and the second spacer is located at position 11 of the oligonucleotide.
16. The oligonucleotide according to any one of claims 11 to 14, wherein the spacer is located at position 5 of the oligonucleotide, and the second spacer is located at position 13 of the oligonucleotide.
17. The oligonucleotide according to any one of claims 11 to 14, wherein the spacer is located at position 6 of the oligonucleotide, and the second spacer is located at position 14 of the oligonucleotide.
18. The oligonucleotide according to claim 14, wherein at least one of the spacer and the second spacer is adjacent to the guanine nucleic acid base.
19. The oligonucleotide according to claim 18, wherein each of the spacer and the second spacer is located immediately before the guanine nucleic acid base.
20. The oligonucleotide according to any one of claims 10 to 19, wherein each of the first spacer or the second spacer is a nucleoside substituent containing a non-sugar substituent, and the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and cannot form a covalent bond with a nucleotide base.
21. Each of the first spacer or the second spacer independently of equation (X) 【Chemistry 1】 It is expressed by, in the formula, Ring A is a optionally substituted 4- to 8-membered monocyclic cycloalkyl group or a 4- to 8-membered monocyclic heterocyclyl group, wherein the heterocyclyl group contains one or two heteroatoms selected from O, S, and N, provided that A cannot form a covalent bond with a nucleic acid base. 【Chemistry 2】 The oligonucleotide according to any one of claims 10 to 19, wherein the symbol represents a binding site to an internucleoside bond.
22. Each of the first spacer or the second spacer independently performs equation (Xa) 【Transformation 3】 The oligonucleotide according to claim 21, represented by [the specified figure].
23. The oligonucleotide according to claim 21 or 22, wherein ring A is a 4- to 8-membered monocyclic cycloalkyl group optionally substituted from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl, or a 4- to 8-membered monocyclic heterocyclil group selected from oxetanyl, tetrahydrofuranil, tetrahydropyranil, 1,4-dioxanil, 164-irolidinyl, piperidinyl, piperazinyl, morpholinil, and azepanil.
24. The nucleotide according to claim 23, wherein ring A is tetrahydrofuranyl.
25. The nucleotide according to claim 23, wherein ring A is tetrahydropyranyl.
26. Each of the first spacer or the second spacer independently, Formula I 【Chemistry 4】 It is expressed by, in the formula, X is -CH 2 Selected from - and -O-, The oligonucleotide according to any one of claims 10 to 19, wherein n is 0, 1, 2, or 3.
27. Each of the first spacer or the second spacer independently performs equation I' 【Transformation 5】 It is expressed by, in the formula, X is -CH 2 Selected from - and -O-, The oligonucleotide according to any one of claims 10 to 19, wherein n is 0, 1, 2, or 3.
28. Each of the first spacer or the second spacer independently of formula (Ia) 【Transformation 6】 It is expressed by, in the formula, The oligonucleotide according to any one of claims 10 to 19, wherein n is 0, 1, 2, or 3.
29. Each of the first spacer or the second spacer independently satisfies equation (Ia') 【Transformation 7】 It is expressed by, in the formula, The oligonucleotide according to any one of claims 10 to 19, wherein n is 0, 1, 2, or 3.
30. Each of the first spacer or the second spacer independently, Equation II 【Transformation 8】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
31. Each of the first spacer or the second spacer operates independently, as in formula II'. 【Chemistry 9】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
32. Each of the first spacer or the second spacer independently of equation (Iia) 【Chemistry 10】 An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
33. Each of the first spacer or the second spacer independently of equation (Iia') 【Chemistry 11】 An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
34. Each of the first spacer or the second spacer independently of equation (III) 【Chemistry 12】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
35. Each of the first spacer or the second spacer independently of equation (III') 【Chemistry 13】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
36. Each of the first spacer or the second spacer independently of formula (IIIb) 【Chemistry 14】 An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
37. Each of the first spacer or the second spacer independently of formula (IIIb') 【Chemistry 15】 An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
38. Each of the first spacer or the second spacer independently, Formula III 【Chemistry 16】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
39. Each of the first spacer or the second spacer independently performs formula III' 【Chemistry 17】 It is expressed by, in the formula, X is -CH 2 An oligonucleotide according to any one of claims 10 to 19, selected from - and -O-.
40. Each of the first spacer or the second spacer independently of formula (IIIa) [Chemistry 18] An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
41. Each of the first spacer or the second spacer independently of formula (IIIa') 【Chemistry 19】 An oligonucleotide according to any one of claims 10 to 19, represented by [the specified figure].
42. The oligonucleotide according to any one of claims 1 to 41, wherein the oligonucleotide further comprises locked nucleic acid (LNA).
43. The oligonucleotide according to claim 42, wherein the locked nucleic acid (LNA) is located at one of the positions 4, 7, 9, 12, or 13 of the oligonucleotide.
44. The oligonucleotide according to any one of claims 1 to 43, wherein the oligonucleotide including the spacer has a GC content of at least 10%.
45. The oligonucleotide according to any one of claims 1 to 44, wherein the oligonucleotide including the spacer has a GC content of at least 20%.
46. The oligonucleotide according to any one of claims 1 to 45, wherein the oligonucleotide including the spacer has a GC content of at least 25%.
47. The oligonucleotide according to any one of claims 1 to 46, wherein the oligonucleotide including the spacer has a GC content of at least 30%.
48. The oligonucleotide according to any one of claims 1 to 47, wherein the oligonucleotide including the spacer has a GC content of at least 40%.
49. The oligonucleotide according to any one of claims 1 to 48, wherein the oligonucleotide including the spacer has a GC content of at least 50%.
50. The oligonucleotide according to any one of claims 1 to 49, wherein the oligonucleotide has a length of 18 oligonucleotide units.
51. The oligonucleotide according to any one of claims 1 to 50, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide is independently selected from the group consisting of a phosphodiester bond, a phosphorothioate bond, an alkyl phosphate bond, a phosphorodithioate bond, a phosphotriester bond, an alkylphosphonate bond, a 3-methoxypropylphosphonate bond, a methylphosphonate bond, an aminoalkylphosphotriester bond, an alkylenephosphonate bond, a phosphine bond, a phosphoramidate bond, a phosphoramidothioate bond, a thiophosphodiamidate bond, a phosphorodiamidate bond, an aminoalkylphosphoramide bond, a thiophosphoramideate bond, a thionoalkylphosphonate bond, a thionoalkylphosphotriester bond, a thiophosphate bond, a selenophosphate bond, and a boranophosphate bond.
52. The oligonucleotide according to any one of claims 1 to 51, wherein one or more nucleoside bonds of the oligonucleotide are modified nucleoside bonds.
53. The oligonucleotide according to claim 52, wherein the modified nucleoside bond of the oligonucleotide is a phosphorothioate bond.
54. The oligonucleotide according to claim 52 or 53, wherein all nucleoside bonds of the oligonucleotide are phosphorothioate bonds.
55. The oligonucleotide according to claim 53, wherein the phosphorothioate bond is in one of the Rp configuration or the Sp configuration.
56. The oligonucleotide according to any one of claims 1 to 55, wherein the oligonucleotide comprises at least one modified sugar moiety.
57. The oligonucleotide according to claim 56, wherein the modified sugar moiety is one of the following: a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl)(2'-MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), restricted ethyl 2'-4'-crosslinked nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA), and a tricyclic analog (e.g., tcDNA).
58. The oligonucleotide according to any one of claims 1 to 57, wherein the oligonucleotide exhibits an increase of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full-length UNC13A protein.
59. The oligonucleotide according to any one of claims 1 to 58, wherein the oligonucleotide exhibits at least a 100% increase in full-length UNC13A protein.
60. The oligonucleotide according to any one of claims 1 to 59, wherein the oligonucleotide exhibits at least a 200% increase in full-length UNC13A protein.
61. The oligonucleotide according to any one of claims 1 to 60, wherein the oligonucleotide exhibits at least a 300% increase in full-length UNC13A protein.
62. The oligonucleotide according to any one of claims 58 to 61, wherein the increase in full-length UNC13A protein is measured in comparison to the decrease in the level of full-length UNC13A protein achieved using a TDP43 antisense oligonucleotide.
63. The oligonucleotide according to any one of claims 1 to 62, wherein the oligonucleotide exhibits rescue of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the full-length UNC13A protein.
64. The oligonucleotide according to any one of claims 1 to 63, wherein the oligonucleotide exhibits a reduction of at least 50%, 60%, 70%, 80%, or 90% of the misspliced UNC13A transcript.
65. A method for treating a patient who requires treatment for a neurological disease and / or neurological disorder, comprising administering an oligonucleotide according to any one of claims 1 to 64 to the patient.
66. The neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP-43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, limbic-dominant age-related TDP-43 encephalopathy (LATE)), epilepsy, age-related TDP-43 brain disease with sclerosis (CARTS), facial-onset sensorimotor neuropathy, Guam Parkinson's dementia complex, multiple system proteinopathy, CTE, and synaptic disorders such as autism, the method according to claim 65.
67. The method according to claim 66, wherein the neurological disease is ALS.
68. The method according to claim 66, wherein the neurological disorder is FTD.
69. The method according to claim 66, wherein the neurological disorder is ALS accompanied by FTD.
70. The method according to claim 66, wherein the neurological disorder is AD.
71. The method according to claim 66, wherein the neurological disorder is PD.
72. The method according to claim 65, wherein the nerve disorder is chemotherapy-induced nerve disorder.