Pharmaceutical compositions for treating central nervous system disorders

Pentacyclic triterpene saponins with a 12,13-dehydrooleanane-type aglycone core enhance nucleic acid delivery to CNS organs, addressing inefficiencies and safety concerns of current therapeutics, enabling safer and more comfortable treatment of CNS disorders.

JP2026521777APending Publication Date: 2026-07-01SAPREME TECH BV

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
SAPREME TECH BV
Filing Date
2024-06-19
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current nucleic acid therapeutics for treating CNS disorders face challenges such as inefficient cellular uptake, high doses leading to cytotoxicity, and immunostimulatory effects due to their inability to cross the blood-tissue barrier, necessitating invasive and uncomfortable local administration.

Method used

The use of pentacyclic triterpene saponins with a 12,13-dehydrooleanane-type aglycone core to enhance the cellular uptake and delivery of nucleic acid therapeutics directly to CNS organs, bypassing the blood-tissue barrier, allowing for lower doses and reduced administration frequency.

Benefits of technology

Enhances therapeutic efficacy of nucleic acid delivery to CNS organs with lower doses and volumes, reducing neurotoxicity and discomfort while maintaining safety and immunological stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026521777000037
    Figure 2026521777000037
  • Figure 2026521777000038
    Figure 2026521777000038
  • Figure 2026521777000039
    Figure 2026521777000039
Patent Text Reader

Abstract

The present invention relates to the field of therapy and drug delivery. More specifically, therapeutic methods and pharmaceutical compositions for treating disorders of the central nervous system are disclosed herein. The disclosed methods and compositions include topical administration of an effector component targeting an intracellular biological target to such organ, in combination with a saponin component that enhances the effective uptake of the effector component into cells and / or enhances the effective routing of the effector component into cells where the biological target is present. For example, the effector component may be an oligonucleotide therapeutic targeting a gene product associated with CNS disorders. Due to the cellular uptake stimulating and / or endosomal escape promoting effects of the saponin component, the neuropharmaceutical compositions presented herein for topical administration to the CNS can be formulated with lower concentrations of the effector component and / or lower volumes, which provides safety benefits to neurons and patient comfort.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of therapy and drug delivery. More specifically, therapeutic methods and pharmaceutical compositions for treating disorders of the central nervous system are disclosed herein. The disclosed methods and compositions include topical administration of an effector component targeting an intracellular biological target to such organ, in combination with a saponin component that enhances the effective uptake of the effector component into cells and / or enhances the effective routing of the effector component into cells where the biological target is present. For example, the effector component may be an oligonucleotide therapeutic targeting a gene product associated with CNS disorders. Due to the cellular uptake stimulating and / or endosomal escape promoting effects of the saponin component, the neuropharmaceutical compositions presented herein for topical administration to the CNS can be formulated with lower concentrations of the effector component and / or lower volumes, which provides safety benefits to neurons and patient comfort. [Background technology]

[0002] Patients with severe nerve tissue damage, including neurodegeneration, paralysis, and blindness, often require lifelong support, which places a significant burden not only on the patients themselves but also on their families and society. Consequently, strategies are needed to address disorders that lead to nerve damage and affect organs composed of nerve tissue.

[0003] Neurons are specialized, electrically excitable cells whose function is to send, receive, and transmit electrochemical signals across different areas of the body. They are extremely fragile cells with very limited regenerative capacity and extreme sensitivity to various types of stress, toxins, and injury (Di Virgilio, 2006). Their survival actually depends on other cell types called glial cells that surround neurons as part of the nervous tissue. Due to this fragility, in addition to being hidden behind the axial skeleton, most notably the 7mm thick bone structure of our skull, body organs containing nervous tissue are equipped with several adaptive mechanisms and anatomical protective structures, which are thought to exist to protect postmittal neurons from stress and injury.

[0004] The majority of neurons are concentrated within the central nervous system (CNS), and a large population also exists in the retina of the eye, which is formed from nerve tissue and connects directly to the brain via the optic nerve (Purves et al., 2001). The state of the eye as an anatomical extension of the brain is reflected not only by the presence of neurons and glial cells in both of these organs, but also by several clear similarities between their vascular characteristics and immune responses (Nguyen et al., 2021), namely the presence of blood-tissue barriers and so-called immune privileges.

[0005] The eyes and other CNS organs, namely the brain (with its trunk) and spinal cord, are considered immune-privileged organs where adaptive immunity and inflammation are highly regulated. This feature is thought to exist to protect susceptible nerve cells from potential immune-mediated injury and death (Hong and Kaer, 1999). The blood-tissue barrier then enables this protection by providing an anatomical interface between the capillaries and the cells and other components of these organs (e.g., cerebrospinal fluid [CSF] in the CNS, vitreous humor in the eye, etc.). This interface not only keeps infectious agents away but also restricts the exchange of substances across the capillary walls, protecting neurons from dangerous bodily metabolites and toxins that may be present in the blood. The barriers of the CNS and eyes are collectively called the blood-ocular barrier, which includes the blood-brain barrier (BBB), the blood-spinal cord barrier, and the blood-retinal barrier, respectively. While their presence and integrity are essential for neuroprotection, if a pathological process has already begun in the CNS or eyes, the options for pharmacological intervention are severely limited because most drug types cannot cross the blood-tissue barrier, or require elaborate modifications to do so (Mitusova et al., 2022).

[0006] Perhaps the most promising type of drug currently available for treating CNS disorders and several ocular conditions is nucleic acid therapies. They are based on chain-like polymers of DNA or RNA with frequent synthetic modifications (an overview can be found in Roberts et al., 2020). While these chains can contain whole transcripts or mutation repair sequences for gene therapy (Ghoraba et al., 2022), more frequently, shorter polymers (oligomers, called oligonucleotides for simplicity) are used to modulate gene expression when delivered to diseased cells. Typical examples include antisense oligonucleotides (ASOs, AONs) and RNA interference oligotherapies such as siRNA and microRNA (Roberts et al., 2020). Due to their immense potential, many are currently in development or clinical trials (Moumne et al., 2022), and some have been approved by the FDA for CNS and ocular disorders. Some examples include splice-modified 2'-O-MOE ASO nusinersen (Spinraza®) for the treatment of spinal muscular atrophy, PS-DNA ASO fomivirsen (Vitravene®) for intraocular cytomegalovirus retinitis infection, and synthetic DNA aptamar pegatinib (Macugen®) for neovascular age-related macular degeneration (AMD).

[0007] However, even the smallest oligonucleotide therapeutics cannot cross the blood-tissue barrier and require direct local administration to the CNS or eye to bypass the barrier. For example, Spinraza® is administered intrathecally during CSF, while both Vitravene® and Macugen® require repeated intravitreal injections into the eye. Such interventions are naturally uncomfortable for the patient due to the pressure that accumulates partly within and around the organ due to the puncture and introduction of the therapeutic volume. This can cause side effects such as nausea and tissue detachment. More importantly, these interventions also carry the potentially serious risk of neurotoxicity from the formulation components and the risk of highly harmful infections that increase with repeated administration, given the limited immunoprotection of these organs due to their immune privileges.

[0008] As a result, there is a need to reduce the injectable volume while reducing the frequency and discomfort associated with invasive local procedures, in some cases increasing the efficacy, bioavailability, and long-term effects of nucleic acid therapies. This is not easy, and oligonucleotide therapies are known to suffer from extremely inefficient cellular uptake, even when administered locally and delivered or targeted to the cells or sites of the desired therapeutic effect. This prevents them from effectively reaching the cytoplasmic and / or nuclear intracellular compartments where they are thought to act on their common targets. This is best reflected by the quantitative estimate that less than 2% of a therapeutic dose of oligonucleotide drug is actually internalized, due in some cases to an estimated 98% of oligonucleotide drugs being retained in endosomal compartments and ultimately degraded in lysosomes (Gilleron et al., 2013).

[0009] This inefficient cellular uptake leads to high doses, often high-volume administration, both of which increase the risk of potentially cytotoxic off-target effects. Furthermore, higher doses of nucleic acids increase the risk of stimulating the immune system regardless of the organ's immune privileged state, as observed, for example, in response to ASO injection into the brain of mice (Toonen et al., 2018).

[0010] In conclusion, improved compositions of nucleic acid therapeutics are necessary for the safe and sustainable treatment of neuron-rich tissues. Therefore, strategies are needed to deliver nucleic acid therapeutics in a more efficient manner, thereby allowing for dose reductions while simultaneously increasing the interval between invasive administrations. Importantly, these strategies must not induce neurotoxicity and must result in increased cellular uptake of the therapeutic agent without inducing neurotoxic stress or immunostimulatory effects.

[0011] The purpose of this disclosure is to provide compositions and strategies as described below. [Overview of the project] [Means for solving the problem]

[0012] This disclosure relates to findings that pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core are safe for direct topical administration and enhancement of nucleic acid therapeutics in organs rich in sensitive neurons of the central nervous system.

[0013] Interestingly, at the concentrations tested, pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core were observed in in vivo mouse data, and further demonstrated herein, to enhance the therapeutic effect of concurrently administered oligonucleotide therapeutics at substantially lower doses than their usual reference doses, while simultaneously showing no visible neurotoxic effects in the mouse brain.

[0014] Based on this finding, methods and compositions comprising topical administration of an effector component to CNS organelles are provided herein, which target intracellular biological targets and, in combination with a saponin component made of this particular saponin type, enhance the effective uptake of the effector component into cells where the biological target is present. For example, the effector component may be an oligonucleotide therapeutic targeting gene products associated with CNS disorders. Due to the cellular uptake-stimulating effect of the saponin component, the pharmaceutical compositions presented herein for topical administration to the CNS can be formulated with lower concentrations and / or lower volumes of the effector component, which provides safety benefits to neurons and patient comfort.

[0015] This particular type of saponin has been characterized and reported, for example, in International Publication No. 2020126620, as having endosomal escape-enhancing (EEE) activity against various antibody-drug conjugates (ADCs) in several cancer cells, where they show promising effects in enhancing known cancer treatments. However, cancer cells are robust cells that are targets of cell death therapeutic strategies. In contrast to known cancer-targeted treatments, local delivery to organs rich in susceptible neurons requires that a given therapeutic composition be safe, or at least non-cytotoxic, to the vulnerable neuronal cells present in these organs, whether the composition directly targets neurons or is intended to target other cell types within the same neural tissue compartment.

[0016] As disclosed herein, these specific saponins appear safe for the neural structures of the brain after direct local administration by injection, while simultaneously retaining the ability to enhance nucleic acid delivery. In particular, this enhancement is demonstrated herein in mature and differentiated cells of the brain. Such differentiated cells, in particular, are quite different from the cultured immortalized cell lines and much more metabolically active cell lines disclosed in International Publication No. 2020126620, and are more difficult to "transfect" with nucleic acids. As a result, the enhancement of the therapeutic effect of nucleic acids administered in vivo to the CNS at doses lower than the nominal dose in the presence of saponins, as presented herein, demonstrates the potential of the approaches disclosed herein for developing improved therapeutic compositions for nucleic acid-mediated treatment of CNS organs such as the brain.

[0017] In accordance with the foregoing, a saponin component for use in a therapeutic method for treating a subject suffering from a disorder of the (immunely privileged) organs of the CNS is disclosed herein for the first time, and the method is: Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the drug to the target population. Administration is performed directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not obstructed).

[0018] Advantageously, the organ is selected from the brain and spinal cord, preferably the brain.

[0019] In related embodiments, pharmaceutical compositions for use in treating disorders of organs of the central nervous system (CNS) are further disclosed herein, and the pharmaceutical compositions are Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the drug to the target population. The pharmaceutical composition is administered directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not obstructed).

[0020] In further relevant embodiments, methods for treating subjects suffering from organ disorders of CMS are provided herein, and the treatment methods are Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the above to the subject, The administration is performed directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not obstructed).

[0021] Furthermore, the use of saponin components in the manufacture of pharmaceuticals for use in treatment methods for subjects suffering from CNS organ disorders is provided herein, and the treatment method is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the above to the subject, The administration is performed directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not obstructed).

[0022] In short, to address the shortcomings of the prior art, the present disclosure provides saponin components and pharmaceutical compositions for use in the treatment of CNS disorders, the compositions comprising a saponin component comprising a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core and an effector component comprising a nucleic acid therapeutic agent intended to be delivered to one or more cells of an organ, the treatment comprising direct administration to the organ or direct administration into a body cavity or fluid cavity communicating with the cells of the organ (where the blood-tissue barrier is not obstructed).

[0023] Furthermore, it should be noted that one objective of further embodiments of this disclosure is to provide a solution to the problem that current nucleic acid therapeutics are less effective than desired and are not sufficient to reach and / or enter diseased cells in organs of the CNS after local administration.

[0024] Another objective of the disclosed embodiments is to provide a solution to the problem of poor nucleic acid delivery and target binding efficiency, which is likely to be the cause of too low an effective nucleic acid concentration at the target site in the CNS organ after local administration.

[0025] A further object of the disclosed embodiments is to provide a solution to one or more of the following problems: insufficient delivery of the required amount of nucleic acid therapeutic agent to the target site of action by local delivery to CNS organs, ineffective or suboptimal therapeutic efficacy thereafter, and extratarget activity and / or undesirable adverse effects therein or around the administration site.

[0026] One yet another object of some embodiments disclosed herein is to provide a solution to the problem of adverse effects related to toxicity, discomfort and / or post-administration complications, particularly in the case of adverse effects that induce overdose, especially when administered topically to the CNS of human patients who require it.

[0027] definition Where used herein, the terms “organs of the central nervous system,” “organs of the CNS,” and “CNS organs” should be interpreted as synonyms referring to any one of the organs belonging to the CNS. Typically, unless otherwise indicated, these terms are used to refer to one of the two main organs of the central nervous system (CNS). These organs are the brain (including the brainstem) and the spinal cord. In some specific contexts, these terms may be used to refer to the retina of the eye, which shares many anatomical and physiological similarities with the two main organs of the CNS. For example, all of these organs contain nerve cells made up of neurons and glial cells, are considered immune-privileged, are highly restricted to the passage of many compounds due to their blood-tissue barrier properties (as their names suggest, the blood-brain barrier, the spinal cord barrier, and the blood-blood-containing eye-retinal barrier), and are supplied by blood vessels (capillaries) protected by the axial skeletal structures of the skull and spine.

[0028] As used herein, the term “eye” should be understood to mean the eye of a vertebrate, preferably the human eye, which is a bilateral spherical organ that houses the photosensitive structures necessary for vision. For simplicity, as used herein, the term “eye” should be understood to be synonymous with the anatomical “eyeball,” that is, a complex spherical organ covered by a fibrous layer made up of the sclera and cornea, and located inside a bony cavity (orbital) known as the “eye socket” of the vertebrate skull.

[0029] The term "saponin" has its usual scientific meaning and refers to a chemical compound from the group of amphiphilic glycosides that contains one or more hydrophilic glycosides (usually located in a chain containing at least one sugar group, but more frequently containing a branched glycan chain with several sugar groups), one or more of which are covalently bonded to a lipophilic aglycone core of a steroid or terpenoid structure called a sapogenin.

[0030] In relation to saponins, the terms “aglycone core,” “sapogenin,” and “aglycone core structure” and “aglycone glycoside core (structure)” are used interchangeably and according to the scientifically accepted meanings in the field. That is, these terms refer to the lipophilic portion of a saponin, which has a steroid or terpenoid structure and to which one or more glycosides are attached (these glycosides are sometimes called “glycone antennas” or “sugar antennas”).

[0031] The term "glycan" or "glycan" has its usual scientific meaning and here refers to either a glycan, a carbohydrate antenna, a single sugar moiety (monosaccharide), or a chain containing multiple sugar moieties (oligosaccharide, polysaccharide). A glycan may consist only of sugar moieties, or it may also include further moieties, such as one of 4E-methoxycinnamic acid, 4Z-methoxycinnamic acid, and 5-O-[5-O-Ara / Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid, as found in QS-21, for example.

[0032] In relation to the names of sugar chains, the terms "Api / Xyl-" or "Api- or Xyl-" have their usual scientific meanings and, as used herein, refer to sugar chains that contain either an apiose (Api) moiety or a xylose (Xyl) moiety.

[0033] As will be apparent from this specification, a certain group of saponins having a terpenoid aglycone core form part of the pharmaceutical compositions and therapeutic methods presented herein. Due to this aglycone core structure, saponins are classified as pentacyclic triterpene saponins, particularly those containing a 12,13-dehydrooleanane type aglycone core. The chemical structure of this aglycone core type is schematically shown in the saponins shown in the scheme (detailed description) of saponin A. Examples of 12,13-dehydrooleanane type aglycone cores include the saponin aglycone cores of chiric acid and dipsogenin, which also contain an aldehyde functional group at the C-23 position of the aglycone core in their naturally occurring forms. For example, chiric acid has an aglycone glycoside core structure of SO1861, SO1832, AG1856.

[0034] Saponins may be naturally occurring or not, and may be modified, for example, during isolation processes, partial degradation, chemical modification, or partially or completely synthesized.

[0035] Therefore, as used herein, the term "saponin" should be interpreted to refer to any glycoside compound (free or conjugated to another compound) that can be obtained synthetically via chemical and / or biotechnological routes, insofar as the glycoside compound contains at least one hydrophilic glycoside moiety covalently bonded to the lipophilic aglycone core of a steroid or terpenoid structure, regardless of whether the glycoside compound is identical to a naturally occurring saponin, or appears to have a structure largely identical to a naturally occurring saponin but has at least one chemical modification on either the glycoside or aglycone core compared to its corresponding naturally occurring saponin, or does not appear to correspond to any naturally occurring saponin but is a saponin by the above definition, and for this reason does not resemble a naturally occurring saponin but still visually contains at least one hydrophilic glycoside moiety covalently bonded to the lipophilic aglycone core of a steroid or terpenoid structure.

[0036] As already stated above, when used herein, the term saponin shall be interpreted to include the following: (i) non-conjugate ("free") saponins as further referred to herein using the term "saponin molecule" in relation to the saponin components of the pharmaceutical compositions disclosed herein and the therapeutic methods; and (ii) A saponin that is covalently conjugated to another compound type and thus forms part of a conjugate comprising at least one saponin as the saponin moiety of the conjugate, wherein the saponin moiety is conjugated to at least one non-saponin moiety such as a linker for further conjugation, or as an effector molecule such as an oligonucleotide, or as a targeted ligand recognized by a cell surface receptor, such as an endocytosis receptor. Accordingly, with respect to the saponin components of the pharmaceutical compositions and therapeutic methods disclosed herein, covalently conjugated saponins are further referred to herein using the term “saponin moiety” to distinguish them from non-conjugated (“free”) saponins referred to using the term “saponin molecule” as described above.

[0037] As used herein, the term “saponin component” refers to a component of a pharmaceutical composition or therapeutic method (which should be interpreted as synonymous with the term “method of treatment”), and this component includes saponins as defined above.

[0038] In accordance with the above description, saponins may be present in the pharmaceutical composition or as part of a therapeutic method in a non-conjugated form (as used herein, "saponin molecule") or in a form covalently bonded to at least one other compound that is not a saponin, thereby forming part of a conjugate comprising a saponin (as used herein, "saponin portion" of the conjugate) and at least one other compound that is not a saponin (as used herein, "non-saponin portion" of the conjugate).

[0039] For example, as used herein, “saponin molecule” can refer to a natural saponin molecule found in or isolated from natural sources such as plant materials, or to a non-natural saponin molecule having chemical modifications compared to natural saponins. When such a saponin molecule is covalently conjugated to another compound, for example, a linker that can be used in a further conjugation step, the saponin portion of the conjugate thus formed is called the “saponin portion.”

[0040] For comparison, in the case of a saponin component of a pharmaceutical composition that includes a pentacyclic triterpene saponin comprising a 12,13-dehydrooleanane-type aglycone core and an acid-sensitive covalent bond with one or more atoms, and which contains a bond that can be considered to simply replace the aldehyde functional group at the C-23 position of the aglycone core because such one or more atoms cannot be further classified functionally (e.g., such one or more atoms are not linkers with chemical groups for further conjugate reactions; nor ligands for binding to receptors) or structurally (e.g., such one or more atoms are not oligonucleotides, peptides, oligosaccharides, etc.), such a saponin component is further referred to using the term "saponin molecule" rather than the term "saponin moiety".

[0041] However, if the saponin component includes a pentacyclic triterpene saponin comprising a 12,13-dehydrooleanane-type aglycone core and an acid-sensitive covalent bond to another functionally or structurally distinct non-saponin moiety (e.g., a linker, ligand, oligonucleotide, etc.), then such a saponin is further referred to using the term "saponin moiety" rather than "saponin molecule." The above distinction is obvious to those skilled in the art and does not require further explanation.

[0042] The term "Saponinum album" has its usual scientific meaning and, as used herein, refers to a mixture of saponins produced by Merck KGaA (Darmstadt, Germany) that contains saponins derived from Gypsophila paniculata and Gypsophila arostii, primarily SA1657 and SA1641.

[0043] The term "Quillaja saponin" has its usual scientific meaning and, as used herein, refers to the saponin fraction of Quillaja saponaria, and therefore the source of all other QS saponins, primarily containing QS-18 and QS-21.

[0044] "QS-21" or "QS21" has its usual scientific meaning and, as herein it refers to a mixture of QS-21 A-apio (about 63%), QS-21 A-xylo (about 32%), QS-21 B-apio (about 3.3%), and QS-21 B-xylo (about 1.7%).

[0045] Similarly, "QS-21A" has its usual scientific meaning and, as used herein, refers to a mixture of QS-21 A-apio (about 65%) and QS-21 A-xylo (about 35%).

[0046] Similarly, "QS-21B" has its usual scientific meaning and, as used herein, refers to a mixture of QS-21 B-apio (about 65%) and QS-21 B-xylo (about 35%).

[0047] The term "Quil-A" refers to a commercially available semi-purified extract derived from Quillaja saponaria, which contains over 50 different saponins in varying amounts, many of which incorporate the triterpene trisaccharide substructure Gal-(1→2)-[Xyl-(1→3)]-GlcA-, found in QS-7, QS-17, QS-18, and QS-21, into the C-3β-OH group. The saponins found in Quil-A are listed in Table 2 of van Setten (1995) [Dirk C. van Setten, Gerrit van de Werken, Gijsbert Zomer and Gideon FAKersten, Glycosyl Compositions and Structural Characteristics of the Potential Immuno-adjuvant Active Saponins in Quillaja saponaria Molina Extract Quil A, RAPID COMMUNICATIONS IN MASS SPECTROMETRY, VOL.9, 660-666 (1995)]. Quil-A, as well as quillaya saponins, are fractions of saponins derived from quillaya (Quillaja saponaria), and both contain a wide variety of different saponins, with much overlap in their composition. Because these two fractions are obtained by different purification procedures, they differ in their specific composition.

[0048] The terms "QS1861" and "QS1862" refer to QS-7 and QS-7 API. QS1861 has a molecular weight of 1861 daltons, and QS1862 has a molecular weight of 1862 daltons. QS1862 is listed in row 28 of Table 1 in Fleck et al. (2019) [Juliane Deise Fleck, Andresa Heemann Betti, Francini Pereira da Silva, Eduardo Artur Troian, Cristina Olivaro, Fernando Ferreira and Simone Gasparin Verza, Saponins from Quillaja saponaria and Quillaja brasiliensis: Particular Chemical Characteristics and Biological Activities, Molecules 2019, 24, 171; doi:10.3390 / molecules24010171]. The structure described is QS1862, an API variant of QS-7. Its molecular weight is 1862 daltons, which is the formal mass of glucuronic acid containing protons. At neutral pH, the molecule is deprotonated. When measured by mass spectrometry in anion mode, the measured mass is 1861 daltons.

[0049] The terms "SO1861" and "SO1862" refer to the same saponin from Saponaria officinalis, but in the deprotonated or API form, respectively. The molecular weight is 1862 daltons, which is the formal mass of glucuronic acid containing protons. At neutral pH, the molecule is deprotonated. When the mass is measured using mass spectrometry in anion mode, the measured mass is 1861 daltons.

[0050] The term “conjugate” has its usual scientific meaning and here refers to at least one first molecule (further referred to as the “first part”) that is covalently bonded to at least one second molecule (the “second part”), thereby forming a covalent assembly containing or comprising the first and second parts. Typical conjugates are ADC, AOC, and SO1861-EMCH (EMCH (see below) linked to the aldehyde group of the aglycone glycoside core structure of a saponin, according to formula (I)). Thus, as used herein, the term “conjugate” should be interpreted as a combination of two or more distinct parts that were covalently bonded and covalently bonded before conjugation (as used herein, to distinguish between purely conjugated and unconjugated states). For example, the different parts that form a conjugate disclosed herein may include one or more saponins or saponin moieties having one or more ligands that bind to endocytosis receptors present on the surface of neurons, glial cells, tumor cells, and preferably the ligands are, for example, antibodies or their binding fragments, such as IgG, monoclonal antibodies (mAbs), single-domain antibodies, such as VHH domains or other nanobody types, or divalent nanobody molecules containing two single-domain antibodies. In some embodiments, the conjugates disclosed herein may be made by covalently bonding different parts via one or more intermediate parts, such as linkers, such as via binding to a central or further linker. In a conjugate, it is not necessary for two or more, for example, three different parts to be directly covalently bonded to each other. The different parts in a conjugate may also be covalently bonded by both being covalently bonded to the same intermediate part, such as a linker, or by each being covalently bonded to an intermediate part, such as a further linker or a central linker, and these two intermediate parts, such as two (different) linkers, are covalently bonded to each other. According to this definition, as long as there are chains of covalently bonded atoms between them, there can be even more intermediate parts, such as linkers, between two different parts of a conjugate.

[0051] As used herein, the term “effector component” should be interpreted herein as referring to a component of a composition or treatment, which may include or consist of an effector molecule or part thereof. Examples of effector components are nucleic acid therapeutics or oligonucleotide therapeutics in which nucleic acids or oligonucleotides are the effector molecule or effector part. An effector component containing an oligonucleotide therapeutic may be referred to as an “oligonucleotide component” in such examples.

[0052] The terms “effector molecule” or “effector moiety” have their usual scientific meaning when referring to an effector molecule as part of a covalent conjugate, such as an effector component including nucleic acids, and including ligands for binding to endocytic cell surface receptors, for example. Here, it refers to a molecule that can selectively bind to one or more target molecules, such as proteins, peptides, carbohydrates, sugars such as glycans, (phospho)lipids, nucleic acids such as DNA and RNA, and enzymes, which modulate the biological activity of one or more such target molecules. In the effector molecules disclosed herein, the effector moiety exerts its effect, for example, in the cytosol (cytoplasm) and / or cell nucleus, and / or is delivered into the cell within endosomes and / or lysosomes, and / or is active after exiting or escaping the endosomal-lysosomal pathway (entering the cytoplasm with it). An effector molecule is a molecule selected from one or more of the following: small molecules such as drug molecules, toxins such as protein toxins, nucleic acids or polynucleotides such as BNA, ASO, PMO, siRNA, enzymes, peptides, proteins, or their active fragments or active domains, or any combination thereof. Therefore, for example, an effector molecule or effector moiety is a molecule or moiety selected from one or more of the following: small molecules such as drug molecules, toxins such as protein toxins, nucleic acids or polynucleotides such as BNA, ASO, PMO, siRNA, enzymes, peptides, proteins, or any combination thereof, which can selectively bind to one or more target molecules such as proteins, peptides, carbohydrates, sugars such as glycans, (phospho)lipids, nucleic acids such as DNA and RNA, or enzymes, and modulates the biological activity of such one or more target molecules upon binding to them. For example, the effector moiety is a toxin, or its active toxicity fragment, active toxicity derivative, or active toxicity domain. Typically, an effector molecule can exert a biological effect inside cells such as mammalian cells such as human cells, for example, in the cytosol or nucleus of the cell.Therefore, the effector molecules or parts disclosed herein are any substances that affect cellular metabolism through interaction with intracellular effector molecular targets, which are any molecules or structures within a cell, including the membranes of endocytosis and recycling pathway compartments and vesicle lumens, but excluding these compartments and vesicle membranes. Thus, such structures inside the cell include the nucleus, mitochondria, chloroplasts, endoplasmic reticulum, Golgi apparatus, other transport vesicles, the inner part of the plasma membrane, and the cytosol. Accordingly, typical effector molecules are drug molecules, enzymes, nucleic acids, such as plasmid DNA or ASO or siRNA or PMO, toxins, such as toxins contained in antibody-drug conjugates (ADCs), polynucleotides, such as siRNA, BNA, and nucleic acids contained in antibody-polynucleotide conjugates (AOCs). For example, an effector molecule / part may act as a ligand that can increase or decrease (intracellular) enzyme activity, gene expression (e.g., gene silencing), or cellular signaling. Typically, the effector moiety contained by the conjugate exerts its therapeutic (e.g., toxic, enzymatic inhibition, gene silencing, etc.) effect in the cytosol and / or cell nucleus. Typically, the effector moiety is delivered intracellularly in endosomes and / or lysosomes, and typically, the effector moiety is active after leaving or escaping the endosomal-lysosomal pathway. Within the saponin components disclosed herein, the saponin is not considered an effector molecule or effector moiety within the saponin components disclosed herein. Therefore, in saponin components containing a saponin, the saponin is not an effector moiety, and in effector components containing an effector moiety, the effector moiety is a different molecule from the conjugated saponin. In relation to the saponin components disclosed herein, the term saponin refers to a saponin that, when present in endosomes and / or lysosomes of mammalian cells such as human cells, is composed of the effector components disclosed herein and exerts endosomal / lysosome escape-enhancing activity on the effector portion present in the endosome / lysosome together with the saponin.

[0053] As used herein, the terms “nucleic acid” and “polynucleotide” are synonymous and should be interpreted to encompass any polymer molecule made up of units that include at least a nucleic acid base (or simply “base,” e.g., a canonical nucleic acid base such as adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U), or any known non-canonical, modified, or synthetic nucleic acid base such as 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 7-methylguanine, 5,6-dihydrouracil, etc.) or a functional equivalent thereof, and that the polymer molecule can perform hydrogen bond-based nucleic acid base pairing (such as Watson-Crick base pairing) with naturally occurring nucleic acids such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) under appropriate hybridization conditions; and naturally occurring nucleic acids should be understood as polymer molecules made up of units that are nucleotides, each nucleotide consisting of a pentose sugar, a phosphate group, and one nucleic acid base.

[0054] Therefore, from a chemical standpoint, the term nucleic acid, as defined herein, can be interpreted to include polymer molecules that are chemically DNA or RNA, as well as polymer molecules that are nucleic acid analogs, also known as xeno nucleic acids (XNAs) or artificial nucleic acids, in which one or more (or all) units are modified nucleotides or functional equivalents of nucleotides. Nucleic acid analogs are well known in the art and are widely used in research and medicine due to various properties such as improved specificity and / or affinity, higher binding strength to their targets and / or increased in vivo stability. Typical examples of nucleic acid analogs include, but are not limited to, locked nucleic acids (LNA) (also known as cross-linked nucleic acids (BNA)), phosphorodiamidate morpholino oligomers (PMO, also known as morpholino), peptide nucleic acids (PNA), glycol nucleic acids (GNA), threose nucleic acids (TNA), hexitol nucleic acids (HNA), 2'-deoxy-2'-fluoroarabino nucleic acids (FANA or FNA), 2'-deoxy-2'-fluororibonucleic acid (2'-F RNA or FRNA); althritol nucleic acids (ANA), and cyclohexene nucleic acids (CeNA).

[0055] In accordance with the foregoing, in some examples, the nucleic acids of this disclosure may be modified. For example, nucleic acids may be modified on their backbone. Examples of modifications that can be carried out on the backbone of nucleic acids include, but are not limited to, phosphorothioates (PS), boranophosphates, phosphonoacetates (PACE), morpholine, peptide nucleic acid backbone modifications (PNA), and amide-linked bases. Nucleic acids may also be modified on the sugar moiety and / or base moiety. Examples of modifications that can be carried out on the sugar moiety and / or base moiety include, but are not limited to, locked nucleic acids (LNA), phosphoramidates (NP), 2'F-RNA, 2'-O-methoxyethyl (2'MOE), 2'O-methyl (2'OMe), 2'-O-fluoro(2'-F)5-bromouracil, 5-iodouracil, 5-methylcytosine, ethylene-bridged nucleic acids (ENA), diaminopurines, 2-thiouracil, 4-thiouracil, pseudouracil, hypoxanthine, and 2-ami Noadenine, 6-methyl or other alkyl derivatives of adenine and guanine, 2-propyl and other derivatives of adenine and guanine, 6-azo-uracil, 8-halo, 8-amino, 8-thiol, 8-hydroxy-k and other 8-substituted adenine and guanine, restricted ethyl sugar moieties (cET), ribofuranosyl, 2'-0,4'-C-methylene and 2'-0,4'-C-ethylene bicyclic nucleotide analogs, acyclic nucleotides (UNA and PNA), and dihydrouridine modifications. Other modifications that may be performed on nucleic acids include, but are not limited to, modifications involving deoxyribonucleotide bases incorporated into the ribonucleotide sequence. Incorporation may be limited to overhang structures in the canonical siRNA architecture or may be distributed within the sequence. Modifications to RNA molecules include, but are not limited to, blunt-ended siRNA, 25-27 mer siRNA, single-stranded siRNA, short hairpin siRNA, dumbbell siRNA, asymmetric siRNA, short-spacing siRNA, and siRNA-antisense oligonucleotide hybrids (ASOs). Other nucleic acid analogs, including those with a non-ribose backbone, may be considered. Furthermore, naturally occurring nucleic acids, analogs, and mixtures of both can be prepared.Nucleic acids include, but are not limited to, any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xasanine, hypoxanine, isocytosine, isoguanine, 5-methylcytidine, pseudouridine, etc. Modified 5' cap structures, such as 3'-O-Me-m7G(5')ppp(5')G (reverse cap analogue), may also be used to enhance mRNA translation. Nucleic acids include any form of RNA, including DNA, triple-stranded, double-stranded or single-stranded, antisense, siRNA, ribozymes, deoxyribozymes, polynucleotides, oligonucleotides, chimerics, and derivatives thereof.

[0056] According to the cannon, the length of a nucleic acid is expressed herein by the number of units that make up a single strand of nucleic acid. Since each unit corresponds to exactly one nucleic acid base capable of associating in one base-pairing event, the length is often expressed in so-called “base pairs” or “bp,” regardless of whether the nucleic acid in question is a single-stranded (ss) nucleic acid or a double-stranded (ds) nucleic acid. In naturally occurring nucleic acids, 1 bp corresponds to 1 nucleotide, abbreviated as 1 nt. For example, a single-stranded nucleic acid consisting of 1000 nucleotides (or a double-stranded nucleic acid consisting of two complementary strands, each consisting of 1000 nucleotides) is described as having a length of 1000 base pairs or 1000 bp, and this length can also be expressed as 1 kilobase, abbreviated as 1000 nt or 1 kb. 2 kilobases or 2 kb is equal to the length of 2000 base pairs, which is considered equivalent to a single-stranded RNA or DNA of 2000 nucleotides. However, in order to avoid confusion, and considering that nucleic acids as defined herein may contain or consist of units that are not only chemically nucleotides but also functional equivalents thereof, the length of nucleic acids shall, in this specification, be expressed preferentially by "bp" or "kb" rather than the equally common notation "nt" in the art.

[0057] In advantageous embodiments, the nucleic acids disclosed herein are 1 kb or less, preferably 500 bp or less, and most preferably 250 bp or less.

[0058] In particularly advantageous embodiments, nucleic acids are oligonucleotides (or simply oligos) defined as nucleic acids not exceeding 200 bp, that is, oligonucleotides that are any polymer molecules consisting of 200 units or less, where each unit contains a nucleic acid base or an equivalent functionally equivalent thereof, which gives the oligonucleotide the ability to associate with DNA or RNA by hydrogen bond-based nucleic acid base pairing under appropriate hybridization conditions. Within the scope of this definition, it will be immediately apparent that oligonucleotides disclosed herein may contain or consist of units that are not only nucleotides but also synthetic equivalents thereof. In other words, from a chemical standpoint, the term oligonucleotide as used herein is to be interpreted as including or potentially consisting of RNA, DNA, or nucleic acid analogs, including, but not limited to, LNA (BNA), PMO (morpholino), PNA, GNA, TNA, HNA, FANA, FRNA, ANA, CeNA, etc.

[0059] The term "proteinic" has its usual scientific meaning and, as used herein, refers to a molecule that is protein-like (meaning the molecule possesses the physicochemical properties of a protein to some extent), of a protein, relating to a protein, containing a protein, belonging to a protein, consisting of a protein, similar to a protein, or is a protein. When the term "proteinic" is used, for example, in "proteinic molecule," it refers to the presence of at least a portion of a molecule that is similar to a protein or is a protein, and "protein" should be understood to include a chain of amino acid residues of at least two residue lengths, and therefore includes peptides, polypeptides and proteins, as well as aggregates of protein or protein domains. In a proteinic molecule, at least two amino acid residues are linked by an amide bond, such as a peptide bond. In a proteinic molecule, the amino acid residues are native amino acid residues and / or artificial amino acid residues, such as modified native amino acid residues. In a preferred embodiment, a proteinic molecule is a molecule containing at least two amino acid residues, preferably 2 to about 2,000 amino acid residues. In one embodiment, a proteinic molecule is a molecule containing 2 to 20 amino acids (typical of peptides). In one embodiment, the protein molecule is a molecule containing 21 to 1,000 amino acids (typical for polypeptides, proteins, protein domains, etc., ligands for receptors such as antibodies, Fab, scFv, and EGF). Preferably, the amino acid residues are linked (typically) by peptide bonds. As disclosed herein, the amino acid residues are or contain (modified) (non) native amino acid residues.

[0060] As used herein, the term “antibody or its binding fragment or its binding domain” refers to a polypeptide comprising at least one immunoglobulin variable domain or at least one antigenic determinant, such as a paratope that specifically binds to an antigen. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody. However, in some embodiments, the antibody is a Fab fragment, an F(ab') fragment, an F(ab')2 fragment, an Fv fragment, or an scFv fragment. In some embodiments, the antibody is a nanobody derived from a camelid antibody or a nanobody derived from a shark antibody. In some embodiments, the antibody is a diabody. In some embodiments, the antibody comprises a framework having a human germline sequence. In another embodiment, the antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgAl, IgA2, IgD, IgM, and IgE constant domains. In some embodiments, the antibody includes a heavy (H) chain variable region (abbreviated herein as VH) and / or (e.g., and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, the antibody includes a constant domain, e.g., an Fc region. An immunoglobulin constant domain refers to a heavy chain or light chain constant domain. The amino acid sequences and functional variations of human IgG heavy chain and light chain constant domains are known. With respect to the heavy chain, in some embodiments, the heavy chain of the antibody described herein may be an alpha (a), delta (D), epsilon (e), gamma (g), or mu (m) heavy chain. In some embodiments, the heavy chain of the antibody described herein may include a human alpha (a), delta (D), epsilon (e), gamma (g), or mu (m) heavy chain. In detailed embodiments, the antibody described herein includes human gamma 1 CHI, CH2, and / or (e.g., and) CH3 domains. In some embodiments, the amino acid sequence of the VH domain includes an amino acid sequence of the human gamma(g) heavy chain constant region, such as any known in the art.Non-limiting examples of human constant region sequences are described in the art, see, for example, U.S. Patent No. 5,693,780 and Kabat EA et al, (1991), cited above. In some embodiments, the VH domain contains an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, the antibody is modified, for example, by glycosylation, phosphorylation, SUMOylation, and / or (e.g., and) methylation. In some embodiments, the antibody is a glycosylated antibody conjugated to one or more sugar or carbohydrate molecules. In some embodiments, one or more sugar or carbohydrate molecules are conjugated to the antibody by N-glycosylation, O-glycosylation, C-glycosylation, GPIation (GPI anchoring), and / or (e.g., and) phosphoglycosylation. In some embodiments, one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, one or more sugar or carbohydrate molecules are branched oligosaccharides or branched glycans. In some embodiments, one or more sugar or carbohydrate molecules include mannose units, glucose units, N-acetylglucosamine units, N-acetylgalactosamine units, galactose units, fucose units, or phospholipid units. In some embodiments, the antibody is a construct comprising polypeptides containing one or more antigen-binding fragments of the Disclosure linked to a linker polypeptide or an immunoglobulin constant domain. The linker polypeptide comprises two or more amino acid residues linked by peptide bonds and is used to link one or more antigen-binding moieties. Examples of linker polypeptides have been reported (see, for example, Holliger, P, et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123). Furthermore, the antibody may be part of a larger immunoadhesion molecule formed by the covalent or noncovalent association of the antibody or antibody moiety with one or more other proteins or peptides.Examples of such immunoadhesion molecules include the creation of tetrameric scFv molecules using the streptavidin core domain (Kipriyanov, SM, et al. (1995) Human Antibodies and Hybridomas 6:93-101) and the creation of divalent biotinylated scFv molecules using cysteine ​​residues, marker peptides, and C-terminal polyhistidine tags (Kipriyanov, SM, et al. (1994) Mol.Immunol.31:1047-1058).

[0061] The terms “single-domain antibody,” or abbreviated as “sdAb,” or “nanobody” have their usual scientific meanings and, as used herein, refer to an antibody fragment consisting of a single monomer variable antibody domain unless otherwise stated, such as two or more monomer variable antibody domains, for example, in relation to a bivalent sdAb, including two such monomer variable antibody domains in tandem. A bivalent nanobody is a molecule containing two single-domain antibodies that target epitopes on molecules located outside the cell, such as epitopes on the extracellular domains of cell surface molecules present on the cell. Preferably, the cell surface molecules are cell surface receptors. A bivalent nanobody is also referred to as a bivalent single-domain antibody. Preferably, these two different single-domain antibodies are covalently bound directly or covalently bound through an intermediate molecule that covalently binds to the two different single-domain antibodies. Preferably, the intermediate molecule of the divalent nanobody has a molecular weight of less than 10,000 daltons, more preferably less than 5,000 daltons, even more preferably less than 2,000 daltons, and most preferably less than 1,500 daltons.

[0062] The term "GalNAc" has its usual scientific meaning and, as used herein, refers to N-acetylgalactosamine and its IUPAC name: 2-(acetylamino)-2-deoxy-D-galactose.

[0063] As used herein, the term “covalently linked” means that two or more molecules are linked together by at least one covalent bond, i.e., directly, or via a chain of covalent bonds, i.e., via a linker containing at least one atom.

[0064] As used herein, the term “part” typically refers to a molecule that is bound, linked, or conjugated to further molecules, linkers, molecular assemblies, etc., thereby forming part of a larger molecule, conjugate, or molecular assembly. Typically, a part is a first molecule covalently bonded to a second molecule (the second part), which contains one or more chemical groups initially present on the first and second molecules. For example, if a saponin molecule is covalently bonded to one or more GalNAc molecules via at least one linker, the saponin molecule is the saponin part in the formed saponin-GalNAc conjugate, and the GalNAc molecules are one or more parts in the conjugate. For example, a nucleic acid, such as an antisense oligonucleotide conjugated to an endocytosis receptor-binding ligand such as an antibody or one or more GalNAc molecules, is the nucleic acid part in the nucleic acid-GalNAc conjugate.

[0065] As used herein, the terms “approximately” or “about” refer to values ​​similar to the specified reference value when applied to one or more target values. In some embodiments, unless otherwise specified or otherwise evident from the context, the terms “approximately” or “about” refer to a range of values ​​that are within the range of 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction from the specified reference value (unless such numbers would exceed 100% of the possible values).

[0066] The terms first, second, third, etc., used herein and in the claims are used, for example, to distinguish between similar elements, compositions, components in a composition, or distinct method steps, and are not necessarily used to describe a sequential or chronological order. These terms are interchangeable under appropriate circumstances, and the embodiments disclosed herein may operate in an order other than those described or illustrated herein, unless otherwise specified.

[0067] The term “comprising” as used in the claims should not be construed to be limited, for example, to elements or method steps or components of a particular composition that are subsequently enumerated; the term does not exclude other elements or method steps or components in a particular composition. The term should be construed to specify the presence of a particular feature, complete, (method) step or component, but not to exclude the presence or addition of one or more other features, complete, steps or components, or groups thereof. Accordingly, the scope of the expression “a method comprising steps A and B” should not be limited to a method consisting solely of steps A and B, but rather, with respect to this disclosure, only the enumerated steps of the method are A and B, and furthermore, the claims should be construed to include equivalents of those method steps. Accordingly, the scope of the expression “a composition comprising components A and B” should not be limited to a composition consisting solely of components A and B, but rather, with respect to this disclosure, only the enumerated components of the composition are A and B, and furthermore, the claims should be construed to include equivalents of those components.

[0068] Furthermore, the use of the indefinite article "a" or "an" to refer to an element or component does not exclude the possibility of two or more elements or components existing, unless the context clearly requires that there is only one of that element or component. Therefore, the indefinite article "a" or "an" usually means "at least one."

[0069] Except for chemical formulas and / or mathematical formulas, the use of terms in parentheses in the text generally means that the term in parentheses specifies possible options or possible meanings, and therefore should not be considered limiting.

[0070] The embodiments described herein can function in combination unless otherwise specified. Furthermore, various embodiments are referred to as “preferred,” “e.g.,” “for example,” or “in detail,” etc., but these should not be limited and should be interpreted as exemplary ways in which the concepts disclosed herein can be carried out.

[0071] For all figures, "Figure" and "Fig." refer to the same thing.

[0072] As used herein, the term “endocytosis receptor” should be understood as any one of a cell surface molecule, potential receptor, or transporter that is accessible from outside or on the surface of the cell membrane (also known as the plasma membrane) and can undergo internal translocation via the endocytosis pathway upon external stimuli, such as ligand binding to the receptor. In some embodiments, endocytosis receptors may be internalized by clathrin-mediated endocytosis, but may also be internalized by clathrin-independent pathways, such as phagocytosis, macropinocytosis, caveolae and raft-mediated uptake, or constitutive clathrin-independent endocytosis. In some embodiments, endocytosis receptors include an intracellular domain, a transmembrane domain, and / or (e.g., and) an extracellular domain, which may further include a ligand-binding domain. In some embodiments, endocytosis receptors are internalized by the cell after ligand binding. In some embodiments, the ligand may be a specific cell targeting agent, such as a native ligand (or a synthetic fragment thereof) or an antibody or its binding fragment.

[0073] As used herein, the term “ligand” should be understood as any molecule that can bind to or be recognized by a receptor. Typical ligands may be antibodies, antibody-bound fragments, or simply antibody fragments. Alternatively, typical ligands may also be proteins, peptides, polysaccharides, glycoproteins, or fragments of any one of these that can be recognized by endocytosis receptors.

[0074] As used herein, the term “covalently linked” means that two or more molecules are linked together by at least one covalent bond, i.e., directly, or via a chain of covalent bonds, i.e., via a linker containing at least one atom.

[0075] The terms “antibody-oligonucleotide conjugate” or “AOC” have their usual scientific meanings and are used herein to refer to IgG, Fab, scFv, immunoglobulin, immunoglobulin fragment, one or more V H Domain, single-domain antibody, V HH Camelidae V H This refers to any polynucleotide (oligonucleotide) molecule that can exert a therapeutic effect when it comes into contact with target cells such as those of a human patient, including any conjugate of antibodies such as BNA, antisense oligonucleotides (ASO, AON), short-chain or small interfering RNA (siRNA; silencing RNA), antisense DNA, antisense RNA, etc., and oligonucleotides selected from a sequence of natural or synthetic nucleic acids, including single-stranded or double-stranded molecules such as DNA, modified DNA, RNA, mRNA, modified RNA, and synthetic nucleic acids.

[0076] As used herein, the term "subject" refers to a person who has or is at risk of having a specific health-related disorder, such as a disease or other pathological condition. The terms "subject" and "patient" are used interchangeably herein.

[0077] As used herein, the term “treatment” has its conventional meaning and refers to a medical intervention or management of an object intended to cure, improve, stabilize, or prevent a health-related disorder, such as an eye disorder. This term “treatment” includes, for example, active treatments, which are a type of action specifically directed toward the improvement of a health-related disorder, and causal treatments, which are treatments directed toward the removal of the cause of the associated health-related disorder. As used herein, the term “prevention” means a medical intervention or management of an object intended to maintain health or normal bodily function. As used herein, preventive measures should be construed as falling within the scope of treatment unless otherwise indicated.

[0078] As used herein, the term “ocular disorder” should be interpreted broadly to refer to any ocular health-related disorder that affects the vision or comfort of the subject, particularly relating to at least one of the subject’s eyes. Typically, the term “ocular disorder” relates to an ocular disease or pathological condition relating to at least one of the subject’s eyes.

[0079] Similarly, as used herein, the term “CNS disorder” should be interpreted broadly to refer to any health-related disorder of the CNS, particularly those involving changes in the brain and / or spinal cord. Typically, the term “CNS disorder” relates to a neurological disorder or pathological condition involving at least a portion of the brain or spinal cord in question.

[0080] As used herein, the term “administer” should be interpreted as referring to a method of providing a substance, such as a compound, or a pharmaceutical composition to a subject. Conversely, as used herein, the term “delivery” should be interpreted as referring to a method of reaching a target site, such as a specific region, cell, or tissue type, such as the retina of the eye. For example, as used herein, administration can be an intrathecal, intravenous, topical, intranasal, intraocular, or other method of providing a compound into the body of a subject, with the intended site of delivery, for example, the cerebellum or retina. Generally, the terms “administer” or “dosage” are interpreted as analogous to providing a substance that is physiologically and / or (e.g., and) pharmacologically useful (e.g., to treat a symptom in a subject).

[0081] As used herein, the term “carrier” has its conventional meaning and refers to a pharmaceutically acceptable diluent, adjuvant, excipient, or vehicle on which the pharmaceutically active ingredient is administered.

[0082] As used herein, the term “excipient” has its conventional meaning and refers to pharmaceutically acceptable ingredients commonly used in pharmaceutical techniques for preparing granular, solid, or liquid oral dosage forms. [Brief explanation of the drawing]

[0083] [Figure 1] Enhanced in vivo efficacy of ASO compounds in the CNS by topical co-administration of saponin components: Intracerebroventricular administration of either 10 μg of Malat1 ASO or 3 μg of Malat1 ASO, or co-administration of 3 μg of Malat1 ASO with the saponin component (here, SO1861), compared to controls (saponin component only and vehicle group), focusing on intracerebroventricular administration to the right ventricle and effects in different brain regions near or peripheral to the injection site. All data are presented as mean ± SEM (n=3). Two-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 2A]Specificity of enhancement of ASO compounds by co-administration of saponin components, as measured by Malat1 RNA knockdown in nerve cells. (A) Titration of Malat1 ASO with and without co-administration of a fixed amount of triterpenoid saponin component (here, SO1861 as an example of a pentacyclic 12,13-dehydrooleanane type saponin) compared with steroid(like) saponins / molecular digitonin, tomatine, or digoxin; (B) Titration of triterpenoid saponin component (SO1861) compared with steroid(like) saponins / molecular digitonin, digoxin, glycyrrhizin, and tomatine in co-administration with a fixed amount of ASO at 200 nM. [Figure 2B] Specificity of enhancement of ASO compounds by co-administration of saponin components, as measured by Malat1 RNA knockdown in nerve cells. (A) Titration of Malat1 ASO with and without co-administration of a fixed amount of triterpenoid saponin component (here, SO1861 as an example of a pentacyclic 12,13-dehydrooleanane type saponin) compared with steroid(like) saponins / molecular digitonin, tomatine, or digoxin; (B) Titration of triterpenoid saponin component (SO1861) compared with steroid(like) saponins / molecular digitonin, digoxin, glycyrrhizin, and tomatine in co-administration with a fixed amount of ASO at 200 nM. [Figure 3] Compared to Malat1 ASO alone, this represents improved efficacy of a saponin component containing a payload (ASO-saponin), which is obtained by covalent conjugation of the saponin molecule SO1861 to the payload Malat1 ASO, providing the saponin component ASO-saponin (Malat1-ASO-SC-SO1861) for delivery in neuronal cells. [Figure 4] Improvement of the efficacy of PMO targeting the CNS disease-related gene Sod1 by the saponin component saponin (here, 3 μM SO1861-SC-Mal) in neuronal cells: PMO efficacy is measured by the increase in abnormal transcript induction (leading to mRNA degradation) by the co-administration of a certain amount of saponin component alone. [Figure 5A] Enhancement of STAT3 mRNA reduction by co-administration of saponin components with different PMOs or ASOs (with different mechanisms of action) in targeted, conjugated, or free forms: (A) Regulation of STAT3 expression in neuronal cells by co-administration of the saponin component saponin (3 μM SO1861-SC-Mal) to STAT3_ST6 PMO (an early stop codon, and therefore an exon skip resulting in STAT3 mRNA reduction); (B) Regulation of STAT3 expression in A431 cells by either free STAT3_ST6 PMO (with or without co-administration of the saponin component saponin (SO1861-SC-Mal) or an antibody-targeted PMO-SO1861 conjugate) based on the conjugation of SO1861-SC (cetuximab (Cet-SO1861-STAT3_ST6 PMO)); (C) RNA degradation of STAT3 (D) Regulation of STAT3 expression by co-administration of different (targeted and untargeted) saponin components (saponin (SO1861), saponin (1) (SO1861-AH-Block), saponin (2) (conjugate SO1861-AH)) against mRNA-targeted ASO (ribonuclease H-mediated RNA degradation); (F) Regulation of STAT3 expression by splice-switching PMO (STAT3_ST2), resulting in an increase in STAT3β isoforms: PMO was added to A431 cells in either free form (STAT3-ST2) or targeted ligand-conjugate form (Cet-STAT3_ST2 PMO), with or without co-administration of the saponin component saponin (SO1861-SC-Mal), or in antibody-targeted PMO-SO1861 conjugate (the saponin component is Cet-saponin-STAT3_ST2 PMO, where the saponin is SO1861). [Figure 5B]Enhancement of STAT3 mRNA reduction by co-administration of saponin components with different PMOs or ASOs (with different mechanisms of action) in targeted, conjugated, or free forms: (A) Regulation of STAT3 expression in neuronal cells by co-administration of the saponin component saponin (3 μM SO1861-SC-Mal) to STAT3_ST6 PMO (an early stop codon, and therefore an exon skip resulting in STAT3 mRNA reduction); (B) Regulation of STAT3 expression in A431 cells by either free STAT3_ST6 PMO (with or without co-administration of the saponin component saponin (SO1861-SC-Mal) or an antibody-targeted PMO-SO1861 conjugate) based on the conjugation of SO1861-SC (cetuximab (Cet-SO1861-STAT3_ST6 PMO)); (C) RNA degradation of STAT3 (D) Regulation of STAT3 expression by co-administration of different (targeted and untargeted) saponin components (saponin (SO1861), saponin (1) (SO1861-AH-Block), saponin (2) (conjugate SO1861-AH)) against mRNA-targeted ASO (ribonuclease H-mediated RNA degradation); (F) Regulation of STAT3 expression by splice-switching PMO (STAT3_ST2), resulting in an increase in STAT3β isoforms: PMO was added to A431 cells in either free form (STAT3-ST2) or targeted ligand-conjugate form (Cet-STAT3_ST2 PMO), with or without co-administration of the saponin component saponin (SO1861-SC-Mal), or in antibody-targeted PMO-SO1861 conjugate (the saponin component is Cet-saponin-STAT3_ST2 PMO, where the saponin is SO1861). [Figure 5C]Enhancement of STAT3 mRNA reduction by co-administration of saponin components with different PMOs or ASOs (with different mechanisms of action) in targeted, conjugated, or free forms: (A) Regulation of STAT3 expression in neuronal cells by co-administration of the saponin component saponin (3 μM SO1861-SC-Mal) to STAT3_ST6 PMO (an early stop codon, and therefore an exon skip resulting in STAT3 mRNA reduction); (B) Regulation of STAT3 expression in A431 cells by either free STAT3_ST6 PMO (with or without co-administration of the saponin component saponin (SO1861-SC-Mal) or an antibody-targeted PMO-SO1861 conjugate) based on the conjugation of SO1861-SC (cetuximab (Cet-SO1861-STAT3_ST6 PMO)); (C) RNA degradation of STAT3 (D) Regulation of STAT3 expression by co-administration of different (targeted and untargeted) saponin components (saponin (SO1861), saponin (1) (SO1861-AH-Block), saponin (2) (conjugate SO1861-AH)) against mRNA-targeted ASO (ribonuclease H-mediated RNA degradation); (F) Regulation of STAT3 expression by splice-switching PMO (STAT3_ST2), resulting in an increase in STAT3β isoforms: PMO was added to A431 cells in either free form (STAT3-ST2) or targeted ligand-conjugate form (Cet-STAT3_ST2 PMO), with or without co-administration of the saponin component saponin (SO1861-SC-Mal), or in antibody-targeted PMO-SO1861 conjugate (the saponin component is Cet-saponin-STAT3_ST2 PMO, where the saponin is SO1861). [Figure 5D]Enhancement of STAT3 mRNA reduction by co-administration of saponin components with different PMOs or ASOs (with different mechanisms of action) in targeted, conjugated, or free forms: (A) Regulation of STAT3 expression in neuronal cells by co-administration of the saponin component saponin (3 μM SO1861-SC-Mal) to STAT3_ST6 PMO (an early stop codon, and therefore an exon skip resulting in STAT3 mRNA reduction); (B) Regulation of STAT3 expression in A431 cells by either free STAT3_ST6 PMO (with or without co-administration of the saponin component saponin (SO1861-SC-Mal) or an antibody-targeted PMO-SO1861 conjugate) based on the conjugation of SO1861-SC (cetuximab (Cet-SO1861-STAT3_ST6 PMO)); (C) RNA degradation of STAT3 (D) Regulation of STAT3 expression by co-administration of different (targeted and untargeted) saponin components (saponin (SO1861), saponin (1) (SO1861-AH-Block), saponin (2) (conjugate SO1861-AH)) against mRNA-targeted ASO (ribonuclease H-mediated RNA degradation); (F) Regulation of STAT3 expression by splice-switching PMO (STAT3_ST2), resulting in an increase in STAT3β isoforms: PMO was added to A431 cells in either free form (STAT3-ST2) or targeted ligand-conjugate form (Cet-STAT3_ST2 PMO), with or without co-administration of the saponin component saponin (SO1861-SC-Mal), or in antibody-targeted PMO-SO1861 conjugate (the saponin component is Cet-saponin-STAT3_ST2 PMO, where the saponin is SO1861). [Figure 6A] This figure shows the enhancement of siRNA efficacy by co-administration of the saponin component saponin (1.3 μM SO1861) in cells derived from human brain tissue (U87, isolated from malignant glioma). (A) Efficacy of AHA1 siRNA combined with the saponin component saponin (1.3 μM SO1861), as measured by RNA levels, and (B) Efficacy of MMP14 siRNA (including chemically modified variants to improve stability against siRNA degradation). [Figure 6B] This figure shows the enhancement of siRNA efficacy by co-administration of the saponin component saponin (1.3 μM SO1861) in cells derived from human brain tissue (U87, isolated from malignant glioma). (A) Efficacy of AHA1 siRNA combined with the saponin component saponin (1.3 μM SO1861), as measured by RNA levels, and (B) Efficacy of MMP14 siRNA (including chemically modified variants to improve stability against siRNA degradation). [Figure 7] Synthesis and chemical structure of SO1861-SC-azide. [Figure 8A] Synthesis and chemical structure of GN3-SC-SO1861. [Figure 8B] Synthesis and chemical structure of GN3-SC-SO1861. [Figure 9A] Enhanced efficacy of co-administration of targeted saponin component and targeted siRNA in vivo: efficacy and duration of effect (here, reduction of serum TTR protein) of co-administration of saponin component (GN3-SC-SO1861) and oligonucleotide, in this case GN3-siTTR. GN3-siTTR was always administered on day 0, and the saponin component was administered at the time indicated by the arrow; n=6 mice in all groups except vehicle, here n=3; mean serum TTR levels ± SD are shown. (A) GN3-siTTR administered with saponin component on day 0, (B) GN3-siTTR administered on day 0 and saponin component administered on day 7 (arrow), (C) GN3-siTTR administered on day 0 and saponin component administered on day 28 (arrow). [Figure 9B]Enhanced efficacy of co-administration of targeted saponin component and targeted siRNA in vivo: efficacy and duration of effect (here, reduction of serum TTR protein) of co-administration of saponin component (GN3-SC-SO1861) and oligonucleotide, in this case GN3-siTTR. GN3-siTTR was always administered on day 0, and the saponin component was administered at the time indicated by the arrow; n=6 mice in all groups except vehicle, here n=3; mean serum TTR levels ± SD are shown. (A) GN3-siTTR administered with saponin component on day 0, (B) GN3-siTTR administered on day 0 and saponin component administered on day 7 (arrow), (C) GN3-siTTR administered on day 0 and saponin component administered on day 28 (arrow). [Figure 9C] Enhanced efficacy of co-administration of targeted saponin component and targeted siRNA in vivo: efficacy and duration of effect (here, reduction of serum TTR protein) of co-administration of saponin component (GN3-SC-SO1861) and oligonucleotide, in this case GN3-siTTR. GN3-siTTR was always administered on day 0, and the saponin component was administered at the time indicated by the arrow; n=6 mice in all groups except vehicle, here n=3; mean serum TTR levels ± SD are shown. (A) GN3-siTTR administered with saponin component on day 0, (B) GN3-siTTR administered on day 0 and saponin component administered on day 7 (arrow), (C) GN3-siTTR administered on day 0 and saponin component administered on day 28 (arrow). [Figure 10] Structure of trivalent GalNAc-oligonucleotide, for example, trivalent GalNAc-siRNA also called GN3-siRNA, or in specific cases, GN3-siTTR. [Figure 11A]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11B]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11C]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11D]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11E]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11F]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11G]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11H]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 11I]Enhanced in vivo efficacy of targeted-ASO compounds by local co-administration of saponin components in the CNS: Analysis of Malat1 expression in the right ventricle after intraventricular administration of vehicle (DPBS; Group A), Malat1 ASO with co-administration of saponin component (Group B), saponin component alone (Group C), single-component Malat1 ASO-saponin (Groups D+E), targeted aCD71-Malat1 ASO alone (Group F), or aCD71-Malat1 ASO with co-administration of saponin component (Group G) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM (n=3 (or n=2 for treatment group D)). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12] Summary of Malat1 expression analysis in Figure 11. Relative Malat1 expression compared to the vehicle in various brain regions after local co-administration of saponin components to (targeted)-ASO compounds, sorted by efficacy of treatment group B; in this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. [Figure 13A]Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13B] Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13C]Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13D] Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13E]Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13F] Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13G]Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13H] Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13I]Enhanced in vivo efficacy of (targeted)-PMO compounds by topical co-administration of saponin components in the CNS: Analysis of Sod1 expression upon intracerebroventricular administration of vehicle (DPBS; group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I); in this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are shown as mean ± SEM (n=3). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14] Summary of Sod1 expression analysis in Figure 13. Relative Sod1 expression in various brain regions compared to the vehicle after local co-administration of a saponin component to a (targeted)-PMO compound, sorted by the efficacy of treatment group K; in this example, the saponin component is SO1861-SC-Mal, and the saponin component saponin(1) is SO1861. [Figure 15A] Covalent conjugation of saponin components to the payload improves payload efficacy. (A) Analysis of Malat1 expression in Neuro-2a cells treated with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or 400nM saponin(1) (saponin component, SO1861-SC); (B) Analysis of Malat1 expression in Neuro-2a cells after treatment with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or unconjugated Malat1 ASO + saponin(1) (saponin component, SO1861-SC). [Figure 15B]Covalent conjugation of saponin components to the payload improves payload efficacy. (A) Analysis of Malat1 expression in Neuro-2a cells treated with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or 400nM saponin(1) (saponin component, SO1861-SC); (B) Analysis of Malat1 expression in Neuro-2a cells after treatment with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or unconjugated Malat1 ASO + saponin(1) (saponin component, SO1861-SC). [Figure 16A] The saponin component enhances mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (1) at a dose of 400 nM or 4 μM; (C) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (2); (C) Regulation of MALAT1 expression by CD71-targeted aCD71-Malat1 ASO or aCD71-Malat1 ASO co-administered with the saponin component (2); In this example, saponin (1) is SO1861-SC and saponin (2) is SO1861-AH(Block). [Figure 16B]The saponin component enhances mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (1) at a dose of 400 nM or 4 μM; (C) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (2); (C) Regulation of MALAT1 expression by CD71-targeted aCD71-Malat1 ASO or aCD71-Malat1 ASO co-administered with the saponin component (2); In this example, saponin (1) is SO1861-SC and saponin (2) is SO1861-AH(Block). [Figure 16C] The saponin component enhances mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (1) at a dose of 400 nM or 4 μM; (C) Regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO co-administered with the saponin component, saponin (2); (C) Regulation of MALAT1 expression by CD71-targeted aCD71-Malat1 ASO or aCD71-Malat1 ASO co-administered with the saponin component (2); In this example, saponin (1) is SO1861-SC and saponin (2) is SO1861-AH(Block). [Figure 17A]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Figure 17B]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Figure 17C]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Figure 17D]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Figure 17E]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Figure 17F]Saponin components enhance mRNA reduction when co-administered (targeted) with ASO in nerve cells; (A) Induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO co-administered with saponin components; (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO co-administered with saponin components; (C) Induction of abnormal SOD1 transcription by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO co-administered with saponin components; (E) Induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO or single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low. (F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low; in this example, the saponin component saponin(1) is SO1861-AH(Block) and the saponin component saponin is SO1861-SC. [Modes for carrying out the invention]

[0084] The innovative concepts presented herein are described in relation to specific aspects and embodiments of this disclosure, but this is descriptive and should be considered not to limit anything beyond what is stated in the claims. The aspects and / or embodiments described herein can be combined and work together unless otherwise specified. The innovative concepts disclosed herein are described with reference to these aspects and embodiments, but their alternatives, modifications, substitutions and equivalents should be apparent to those skilled in the art by reading this specification and examining the drawings and / or graphs. The disclosed matters are not limited in any way to the exemplary embodiments and can be modified without departing from the scope defined by the appended claims.

[0085] Improved pharmaceutical compositions for therapeutic disorders affecting organs of the central nervous system (CNS) are disclosed herein, comprising a saponin component and a nucleic acid therapeutic agent capable of treating or improving CNS disorders, the composition being administered topically to the organ, i.e., into the organ, or into a body cavity containing and protecting the organ, or into a fluid cavity in which the cells of the organ are in fluid communication without obstruction of the blood-tissue barrier.

[0086] The saponins of the novel compositions disclosed herein for local delivery to the CNS are endosome escape-promoting (EEE) saponins.

[0087] While we do not wish to be bound by any theory, the pharmaceutical compositions disclosed herein were conceived based on the observation that a certain group of pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core appear to exhibit potent endosomal escape-enhancing properties. This particular type of saponin has been characterized and reported, for example, in International Publication No. 2020126620, as having endosomal escape-enhancing (EEE) activity against various antibody-drug conjugates (ADCs) in several cancer cells. As demonstrated by the enhancement of HSP27 gene transcripts by saponin silencing using HSP27-specific BNA-based oligonucleotides in different tumor model cell lines, this class of saponins can dramatically improve cancer treatment using oligonucleotide therapies, as further disclosed in International Publications No. 2020126626, 2020126627, 2020126620, 2020126627, 2020126064, 2020126604, 2020126600, and 2020126609.

[0088] As described herein and further demonstrated in the accompanying examples, not only does it contain a pentacyclic triterpene saponin containing a safe 12,13-dehydrooleanane-type aglycone core in combination with oligonucleotide therapeutics after topical administration to the mouse brain in vivo, but it also visibly increased the bioavailability of oligonucleotide therapeutics.

[0089] In line with these findings, in a first general embodiment, saponin components are provided for use in therapeutic methods for treating subjects suffering from organ disorders of the central nervous system (CNS), and the method is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the drug to the target population. Administration is performed directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not obstructed).

[0090] In a more general embodiment, a pharmaceutical composition is provided for use in treating disorders of organs of the CNS, and the pharmaceutical composition is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component containing a nucleic acid therapeutic agent intended to be delivered to one or more cells in an organ, This includes administering the drug to the target population. The pharmaceutical composition is administered directly into an organ, or into a body cavity or fluid cavity that is in communication with the cells of the organ (where the blood-tissue barrier is not obstructed).

[0091] In advantageous embodiments, for example, a targeting option is provided to target specific cells while avoiding targeting other cells. Accordingly, in advantageous embodiments compatible with the above embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided. The saponin component further comprises a first ligand recognized by a first endocytosis receptor, and / or the effector component further comprises a second ligand recognized by a second endocytosis receptor. In some cases, the second endocytosis receptor is the same as the first endocytosis receptor, and in other cases, the second ligand is the same as the first ligand, or, under the condition that both two different endocytosis receptors are present on the same cell, the second endocytosis receptor is different from the first endocytosis receptor. Preferably, the first ligand and / or the second ligand is a proteinogenic ligand, such as a naturally occurring peptide or protein ligand (e.g., a cytokine or growth factor such as EGF) or its receptor interaction portion, or an antibody or its binding fragment, such as F(ab')2 fragment, Fab' fragment, Fab fragment, scFv, dsFv, scFv-Fc, reduced IgG (rIgG), minibody, diabody, triabody, tetrabody, Fc fusion protein, nanobody, variable V domain, single-domain antibody (sdAb), preferably V HH For example, Camelidae V H That is the case.

[0092] Possible embodiments using non-proteinogenic ligands are also feasible, as will be described in more detail later in relation to ligands. Typical such ligands include, for example, vitamin A, glutamates, or glycans such as glucose or mannose 6-phosphate units. A well-known and widely used approach in liver-related applications is a targeting option using non-proteinogenic ligands containing one or more GalNAc moieties to specifically target asialoglycoprotein receptors (ASGPRs). Thus, in possible embodiments, the first ligand and optionally the second ligand are non-proteinogenic ligands recognized at least in part by endocytosis receptors on the cell surface of, for example, neurons or glial cells, targeting, for example, glucose transporters and optionally containing one or more glucose units.

[0093] Saponin component Accordingly, the “saponin components” disclosed herein include pentacyclic triterpene saponins (also called sapogenins or aglycones) that are typically represented as a pentacyclic C30 terpene skeleton, frequently contain an aldehyde functional group at the C-23 position in their naturally occurring state, and have a 12,13-dehydrooleanane type aglycone core in their structure. Examples of such known saponins are shown in Table 2A below and in the scheme of saponin A below.

[0094] A notable feature of these saponins is the aldehyde functional group at the C-23 position of the saponin aglycone core structure. While we do not wish to be bound by any theory, it has been observed that the presence of the aforementioned aldehyde functional group (sometimes called the "aldehyde group"; which should be interpreted as synonymous in this context) in the aglycone core may be particularly beneficial to the saponin's ability to stimulate and / or enhance the endosomal evasion of therapeutic nucleic acids.

[0095] Therefore, in advantageous embodiments, saponin components (or pharmaceutical compositions) for use disclosed herein are provided, and pentacyclic triterpene saponins are, - The aldehyde functional group at the C-23 position of the aglycone core, or - An acid-sensitive covalent bond configured to decompose under acidic conditions to generate an aldehyde functional group at the C-23 position of the aglycone core, wherein the acid-sensitive covalent bond is selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond and / or an oxime bond, preferably selected from a semicarbazone bond and a hydrazone bond. It also includes.

[0096] Most naturally occurring, known pentacyclic triterpene saponins contain a 12,13-dehydrooleanane type aglycone core, which also includes an aldehyde functional group at the C-23 position in their native or unconjugated forms, and the aglycone core is a chiric acid or dipsogenin. An exemplary chemical structure of such a saponin is schematically shown in the scheme of saponin A:

[0097] [ka]

[0098] In line with this, it has been observed that saponins containing a chiric acid aglycone or dipsogenin aglycone core structure are particularly suitable for the purposes of this disclosure. Accordingly, the following embodiments, which are consistent with the preceding embodiments, provide saponin components or pharmaceutical compositions for use disclosed herein, wherein the pentacyclic triterpene saponin comprises a chiric acid, dipsogenin, and an aglycone core selected from either a chiric acid or a dipsogenin aldehyde-substituted derivative, respectively, defined as a chiric acid-based or dipsogenin-based aglycone core, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to decompose under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core, preferably a chiric acid or These are chiral acid aglycone cores, respectively: AG1856, AG1, AG2, agrostemoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, and QS-21 B-xylo or any one of their aldehyde-substituted derivatives, or dipsogenin or dipsogenin-based aglycone core is selected from SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658, and phytracagenin or any one of their aldehyde-substituted derivatives.

[0099] Saponins can include one or more glycans bound to the aglycone core structure. Preferred saponins for compositions to be used in accordance with this disclosure include single-chain (i.e., mono-desmoside) or double-chain (i.e., bis-desmoside) saponins bound to the aglycone core structure. Accordingly, in the following embodiments conforming to the preceding embodiments, saponin components or pharmaceutical compositions for this disclosure are provided, wherein the pentacyclic triterpene saponin is a mono-desmoside or a bi-desmoside, preferably comprising a first glycan bound to the C-3 position of the aglycone core, more preferably the first glycan being selected from group A as described in Table 1A, even more preferably the first glycan comprising a glucuronic acid group, preferably a terminal glucuronic acid group, and most preferably the first glycan comprising Gal-(1→2)-[Xyl-(1→3)]-GlcA.

[0100] In certain embodiments conforming to prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, where the pentacyclic triterpene saponins are isolated from Saponaria officinalis and are preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, and most preferably SO1861.

[0101] The saponin components disclosed herein may include one or more unconjugated saponin molecules and / or conjugated saponin molecules further referred to as saponin moieties (purely to distinguish them from their unconjugated free molecular counterparts).

[0102] Accordingly, in possible embodiments compatible with the prior embodiments, a saponin component or a pharmaceutical composition for use disclosed herein is provided, where the saponin component comprises a non-conjugated saponin molecule. (Defined as a pentacyclic triterpene saponin not covalently conjugated to the non-saponin portion, and optionally, the saponin component consists of a non-conjugated saponin molecule.)

[0103] In one of the prior embodiments and in alternative embodiments that are compatible with other prior embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, comprising at least one non-saponin moiety covalently conjugated with a saponin moiety. Preferably, the acid-sensitive covalent bond is conjugated via an acid-sensitive covalent bond that decomposes under acidic conditions, more preferably an acid-sensitive covalent bond at the C-23 position of the aglycon core, and even more preferably the acid-sensitive covalent bond at the C-23 position of the aglycon core is configured to decompose under acidic conditions to generate an aldehyde functional group at the C-23 position of the aglycon core, thus resulting in the release of a pentacyclic triterpene saponin containing an aldehyde functional group at the C-23 position of the aglycon core from the non-saponin moiety, and even more preferably the acid-sensitive covalent bond is a semicarbazone bond, a hydrazone bond, an imine bond, or an acetal bond, selected from one or more of acetal bonds, ketal bonds, ester bonds, and / or oxime bonds containing a 1,3-dioxolane bond, most preferably selected from semicarbazone bonds and hydrazone bonds, and / or the saponin moiety is covalently conjugated with at least one non-saponin moiety by an acid-stable bond, preferably via a glucuronic acid group if the group is present.

[0104] In related embodiments, saponin components for use disclosed herein are provided, the non-saponin portion of which is Linker, The first ligand according to claim 2, Effector components, and / or Scaffold Molecules Includes one or more of the following: Preferably, the saponin portion is directly and covalently conjugated with the linker. More preferably, the linker includes or is covalently conjugated to a saponin moiety via an acid-sensitive covalent bond, more preferably at the C-23 position of the aglycone core, or via an acid-stable bond, preferably at the glucuronic acid group if the aforementioned group is present; More preferably, the linker is further covalently conjugated to the first ligand and / or effector component, possibly via a scaffold molecule; For example, the scaffold molecule may be a polyfunctional linker scaffold molecule, or optionally a polymer scaffold molecule containing a dendron, such as a polyamidoamine (PAMAM) dendrimer, or polyethylene glycol, such as PEG3 to PEG30.

[0105] As used herein, the term scaffold molecule refers to a portion of a conjugate that can function as a scaffold for conjugating other portions to the conjugate. In relation to this specification, such a scaffold molecule can be used to achieve covalent bonding between a saponin portion, an effector portion, and, more optionally, a first ligand. Linking to the scaffold molecule may occur directly or via any further first, second linkers.

[0106] Typical scaffold molecules known in the art are based on oligomeric or polymer structures and are often either dendrons such as polyamidoamine (PAMAM) dendrimers or polyethylene glycols such as any of PEG3-PEG30. In advantageous embodiments of the present disclosure, any one of such scaffold molecules can be used. For example, it may be a polymer or oligomeric structure which is advantageously one of PEG4-PEG12, or one of G2, G3, G4, and G5 dendrons, more preferably G2 or G3 dendron or PEG3-PEG30. Dendritic structures appear to be particularly advantageous for ophthalmic applications. This is because ophthalmic therapeutic formulations suffer from low retention problems, leading to frequent injections. Providing a scaffold molecule that can be retained for extended periods in ophthalmic solutions or CNS can offer the advantage of longer exposure.

[0107] In another example compatible with the above, a polyfunctional linker can be used as a scaffold (referred to above as the "polyfunctional linker scaffold molecule"). The polyfunctional linker scaffold molecule can be prepared from a trifunctional linker, such as the one shown by structure A in the following examples, which is represented here in a non-conjugated form:

[0108] [ka]

[0109] In possible embodiments, the conjugate may contain 1 to 4 such trifunctional linkers for all molecules of the targeted ligand contained in the conjugate, more preferably 1 to 2 trifunctional linkers, and most preferably 1.2 to 1.8 trifunctional linkers on average.

[0110] In the conjugate form, the trifunctional linker of that conjugate form has structure B:

[0111] [ka]

[0112] (In the formula, S is at least one saponin moiety, L1 is a linker bound to the saponin portion. NA is an effector component that contains nucleic acids. L2 is a linker coupled to the effect component. A is one or more molecules of the first ligand, preferably an antibody or a conjugated fragment thereof. L3 is a linker bound to the first ligand, (L1, L2, and L3 are either the same or different.) It is represented by [this].

[0113] In particularly advantageous embodiments, a saponin component or a pharmaceutical composition for use disclosed herein is provided, wherein the saponin portion is covalently conjugated with a non-saponin portion containing an effector component, and this conjugation brings together the saponin component and the effector component in a conjugate further referred to as the saponin-effector component. Preferably, the saponin-effector component further contains a linker, and more preferably, the linker is directly and covalently conjugated to the saponin portion. In some cases, the saponin-effector component may further contain the primary ligand (resulting in a conjugate further called a targeted saponin-effector component).

[0114] In possible embodiments, the targeted saponin-effector component comprises 1 to 16 saponin moieties and 1 to 5 nucleic acid molecules (also called effector moieties) per ligand moiety, preferably the targeted saponin-effector component comprises 2 to 8 saponin moieties per ligand moiety. Preferably, there are 3 to 6 saponin moieties per ligand moiety; more preferably, 4 to 5 saponin moieties per ligand moiety; most preferably, the targeted saponin-effector component contains an average of 4 to 4.5 saponin moieties per ligand molecule.

[0115] In an advantageous embodiment conforming to the prior embodiments, the administration includes providing an effector component and a saponin component, which are formulated as at least two pharmaceutical formulations (physically separated and provided, for example, in different containers or packages) that can be formulated as a single pharmaceutical formulation or administered simultaneously or sequentially, wherein the first pharmaceutical formulation comprises the saponin component and the second pharmaceutical formulation comprises the effector component, and a saponin component or pharmaceutical composition for use disclosed herein is provided.

[0116] In certain advantageous embodiments, a boost application of a saponin component, called a boost saponin component, can be performed after administration.

[0117] The inventors have observed that such a boost application (booster) of a saponin component (boosted saponin component) can result in an extension of the duration of action of nucleic acid therapeutics and / or an extension of the administration interval of nucleic acid therapeutics and / or a decrease in the frequency of administration of nucleic acid therapeutics and / or an (delayed) enhancement of the effect of nucleic acid therapeutics.

[0118] In an advantageous embodiment, administration is further continued at intervals of at least one day, preferably at least one week, by a boosting application of a saponin component also called a boosting saponin component, which is provided without an effector component and preferably comprises any one non-conjugate saponin molecule or saponin moiety, preferably the saponin moiety being covalently conjugated with at least a linker, or at least a first ligand, or at least a linker and a first ligand.

[0119] In possible embodiments, the interval is at least one day after administration, preferably at least two days, at least three days, at least one week, at least two weeks, at least three weeks, at least one month, at least two months, at least three months, at least four months, at least five months, or at least six months.

[0120] In some embodiments, the boosting application can be carried out directly within an organ or in a body cavity or fluid cavity communicating with the cells of the organ.

[0121] In certain embodiments, the boosting application can be performed at the administration site, or, if the administration involves application at multiple sites, the boosting application can be performed at one of these sites.

[0122] For example, in the case of administration at multiple sites or repeated administration, or administration involving multiple partial doses, for example, if the administration involves the provision of two or more pharmaceutical formulations as separate, possibly time-limited, doses, the site of administration should be interpreted as at least one of the sites of administration.

[0123] Alternatively, in some advantageous embodiments, the boosting application can be carried out within an organ, or within a body cavity or fluid cavity communicating with the cells of the organ, but by an application route that is less invasive and / or penetrates less into the target body compared to the administration route.

[0124] For example, if administration is performed intrathecally within the central nervous system (CNS), boosting can be performed only epidurally, which is a more standardized, less complex intervention, better tolerated by patients, and more commonly used by anesthesiologists.

[0125] In another example, if administration is performed intravitreously into the eye, the boost application of the saponin component may be applied via a less painful periorbital route, or even topically.

[0126] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, and the dosage is as follows: - A two-component free saponin preparation defined as containing a saponin component comprising a non-conjugate saponin molecule, wherein the two-component free saponin preparation further comprises an effector component which may contain a second ligand recognized by a second endocytosis receptor; - A two-component linker-saponin preparation defined as containing a saponin component including a saponin moiety, wherein the saponin moiety is covalently conjugated with the linker; a two-component linker-saponin preparation further comprising an effector component optionally containing a second ligand recognized by a second endocytosis receptor; - A two-component targeted saponin formulation defined as comprising a saponin component containing a saponin moiety, wherein the saponin moiety is covalently conjugated with a first ligand, and preferably the non-saponin moiety contains a linker; a two-component targeted saponin formulation further comprising an effector component which may contain a second ligand; A one-component formulation defined as containing a saponin-effector component. This includes providing a single pharmaceutical formulation selected from one or more of the following: In some cases, the saponin-effector component is a target saponin-effector component that further contains the first ligand.

[0127] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, and the administration comprises providing at least two pharmaceutical formulations, the first pharmaceutical formulation and the second pharmaceutical formulation being selected from any one or more of the following: - A non-targeting combination, A first pharmaceutical formulation wherein the saponin component does not contain a ligand, preferably contains a non-conjugated saponin molecule and / or a saponin moiety, or consists of a saponin moiety, the saponin moiety being covalently conjugated to a linker, The second pharmaceutical formulation is one in which the effector component does not contain a ligand. A non-targeting combination defined as including; - A combination of targeted effectors, A first pharmaceutical formulation wherein the saponin component does not contain a ligand, preferably contains a non-conjugated saponin molecule and / or a saponin moiety, or consists of a saponin moiety, the saponin moiety being covalently conjugated to a linker, The effector component contains a second ligand, and A targeted effector combination defined as including; - A targeted saponin combination, A first pharmaceutical formulation comprising a saponin component containing a saponin moiety, the saponin moiety being covalently conjugated with a first ligand, and preferably, a non-saponin moiety containing a linker, The effector component may, in some cases, contain a second ligand, and a second pharmaceutical formulation A targeted saponin combination defined as containing [specific components].

[0128] In short, as disclosed herein, the saponin component is - It is a 12,13-dehydrooleanane type pentacyclic triterpene saponin; - Preferably, the aglycone core contains an acid-sensitive covalent bond configured to decompose under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core, and preferably the acid-sensitive covalent bond is selected from one or more of semicarbazone bonds, hydrazone bonds, imine bonds, acetal bonds including 1,3-dioxolane bonds, ketal bonds, ester bonds and / or oxime bonds, and preferably selected from semicarbazone bonds and hydrazone bonds. - A mono-desmoside or a bi-desmoside, preferably a bi-desmoside; and / or - Comprising a first sugar chain linked to its aglycone core structure selected from Group A as described in Table 1A, and / or comprising a second sugar chain linked to its aglycone core structure selected from Group B as described in Table 1A, preferably, the first sugar chain and the second sugar chain are included in a saponin molecule or a saponin moiety:

[0129]

Table 1

[0130]

Table 2

[0131]

Table 3

[0132] and / or - Preferably, comprising a first sugar chain linked to the C-3 position of its aglycone core structure selected from Group A as described in Table 1A, preferably, the first sugar chain of the saponin molecule contains a glucuronic acid group, or optionally, the first sugar chain of the saponin moiety contains a glucuronic acid group; and / or - Preferably, comprising a first sugar chain containing a terminal glucuronic acid residue, and / or comprising a second sugar chain containing at least 4 sugar residues in a branched configuration; and / or - Preferably, comprising a first sugar chain of at least 4 sugar residues containing a terminal fucose residue and / or a terminal rhamnose residue selected from Table 1A, Gal-(1→2)-[Xyl-(1→3)]-GlcA and / or a branched second sugar chain; and / or - Preferably, the saponin aglycone core structure comprises a first sugar chain at the C-3 position and / or a second sugar chain at the C-28 position, preferably the first sugar chain being a sugar substituent on the C-3β-OH group of the saponin aglycone core structure and / or the second sugar chain being a sugar substituent on the C-28-OH group of the saponin aglycone core structure; and / or - The first and / or second glycan chain, preferably the second glycan chain, optionally contain at least one acetoxy (Me(CO)O-) group; and / or - below: Chiral acid; Gypsogenin; 2α-hydroxyoleanolic acid; 16α-hydroxyoleanolic acid; Hederagenin (23-hydroxyoleanolic acid); 16α,23-hydroxyoleanolic acid; Protoestigenin-21(2-methylbuta-2-enoate)-22-acetate; 23-Oxo-Baringtogenol C-21,22-Bis(2-methylbuta-2-enoate); 23-Oxo-Baringtogenol C-21(2-methylbuta-2-enoate)-16,22-diacetate; 3,16,28-trihydroxyoleanane-12-ene; Gypsogenic acid; and its derivatives Includes an aglycone core structure selected from; and / or - Preferably comprising an aglycone core structure selected from chiric acid, dipsogenin, and their derivatives; and / or - Preferably, it comprises an aglycone core structure schiric acid; and / or - Select one or more saponins listed in Table 2A:

[0133] [Table 4]

[0134]

Table 5

[0135]

Table 6

[0136]

Table 7

[0137]

Table 8

[0138]

Table 9

[0139] and / or a) List A: - A Quillaja saponaria saponin mixture, or a saponin isolated from Quillaja saponaria, for example, Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21A, QS-21B, QS-7-xyl; - A Saponinum album saponin mixture, or a saponin isolated from Saponinum album; - A Saponaria officinalis saponin mixture, or a saponin isolated from Saponaria officinalis; and - A Quillaja bark saponin mixture, or a saponin isolated from Quillaja bark, for example, Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21A, QS-21B, QS-7-xyl selected from any one or more of; or b) Containing a gypsogenin aglycone core structure, List B: SA1641, Gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658, and Phytolaccagenin Selected from; or c) Containing a chiral aglycone core structure, List C: AG1856, AG1, AG2, Agrostemoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo Selected from; or d) A 12,13-dehydrooleanane type aglycone core structure lacking an aldehyde group at the C-23 position of the aglycone, as listed in D: Estin Ia, Estinate, α-Hederin, AMA-1, AMR, AS6.2, AS64R, Assam Saponin F, Dipsacocoid B, Esculentside A, Macrantoidin A, NP-005236, NP-012672, Primulic Acid 1, Saikosaponin A, Saikosaponin D, Tea Seed Saponin I and Tea Seed Saponin J Selected from, Preferably one or more selected from list A, B or C, more preferably selected from list B or C, even more preferably selected from list C; and / or - One or more of the following: AG1856, GE1741, saponins isolated from Quillaya saponaria, Quil-A, QS-17, QS-21, QS-7, SA1641, saponins isolated from Saponaria officinalis, saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, all having the formula "SO1832".

[0140] [ka]

[0141] , SO1861 having the formula "SO1861"

[0142] [ka]

[0143] , SO1862 and SO1904, preferably one or more of QS-21, SO1832, SO1861, SA1641, AG1856 and GE1741, more preferably AG1856, SO1832 or SO1861, most preferably SO1861 or SO1832; and / or - Saponins isolated from Saponaria officinalis, preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861; and / or - A saponin molecule in which the carboxyl group of the glucuronic acid unit in the first sugar chain bonded to C-3 of the aglycone core structure of the saponin molecule is converted to an amide bond by reaction with 2-amino-2-methyl-1,3-propanediol (AMPD), as shown for SO1861 in formula (3):

[0144] [ka]

[0145] Or a saponin molecule having one of the following formulas (9) to (12):

[0146] [ka]

[0147] [ka]

[0148] In some preferred embodiments, the saponin comprises a glucuronic acid group as a carbohydrate substituent of the C-3β-OH group, and preferably the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, SO1658, Gypsoside A, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, GE1741, SO1542, S O1584, SO1674, SO1700, Saponarioside B, SO1730, SO1772, SO1832 (protonated SO1831; also called Saponarioside A), SO1861 (deprotonated SO1862), SO1862 (protonated SO1861; also called Sapofectosid), SO1904, QS-7 (also called QS1861), QS-7 api (also known as QS1862), QS-17, QS-18, QS-21A-apio, QS-21A-xylo, QS-21 B-apio, QS-21 B-xylo, QS-21, agrostemoside E (also known as AG1856 or AG2.8), NP-005236, NP-012672, β-Aescin (indicated as Aescin Ia), asescinate, tea seed saponin I, tea seed saponin J, assamonin F, primulic acid 1.

[0149] In certain preferred embodiments, the saponin does not contain an aldehyde functional group bonded to the C-4 atom of the aglycone core structure, and preferably the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-005236, AMA-1, AMR, α-Hederin, NP-012672, β-Aescin (description: Aescin Ia), Asescinate, Dipsacococci, Escletoside A, Camellia Sinensis Seed Saponin I, Camellia Sinensis Seed Saponin J, Assam Saponin F, Primulic Acid 1, AS64R, Macrantoidin A, Saikosaponin A, Saikosaponin D, AS6.2.

[0150] In certain preferred embodiments, the saponin contains a glucuronic acid group as a carbohydrate substituent of the C-3β-OH group, and the saponin does not contain an aldehyde functional group bonded to the C-4 atom of the aglycone core structure. Preferably, the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-005236, NP-012672, β-Aescin (listed as: Aescin Ia, Acesinate, Dipsacocoid B, Esculentside A, Tea Seed Saponin I, Techa Seed Saponin J, Assam Saponin F, Primulic Acid I, Macrantoidin A, Saikosaponin A, Saikosaponin D).

[0151] In some specific embodiments, we can provide saponin components or compositions for use disclosed herein, which are, in some cases, compatible with prior art, one, two, or three, preferably one or two, more preferably one: - At least one aldehyde group in the aglycone core structure of the saponin is derivatized, if present. - The carboxyl group of the glucuronic acid moiety in the first sugar chain of at least one saponin is derivatized when present in at least one saponin, and - At least one acetoxy (Me(CO)O-) group on the second sugar chain of at least one saponin is derivatized, if present.

[0152] In more specific embodiments, a saponin component or composition for use in the present disclosure is provided, wherein at least one saponin is i. Aglycone core structure, - Reduction to alcohol; - Conversion to a hydrazone bond via reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) (where the maleimide group of EMCH is optionally derivatized by the formation of a thioether bond with mercaptoethanol); - Conversion to a hydrazone bond via reaction with N-[β-maleimidopropionic acid]hydrazide (BMPH) (where the maleimide group of BMPH is optionally derivatized by the formation of a thioether bond with mercaptoethanol); or - Conversion to a hydrazone bond via reaction with N-[κ-maleimidoundecanoic acid]hydrazide (KMUH) (where the maleimide group of KMUH is optionally derivatized by the formation of a thioether bond with mercaptoethanol). an aglycone core structure containing an aldehyde group derivatized by; or ii. A first sugar chain comprising a carboxyl group, preferably a carboxyl group of the glucuronic acid moiety, which is derivatized by conversion to an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM); or iii. A second sugar chain containing an acetoxy group (Me(CO)O-) that has been derivatized by conversion to a hydroxyl group (HO-) through deacetylation; or iv. Any combination of two or three derivatizations i., ii., and / or iii., preferably any combination of two derivatizations from i., ii., and / or iii. Includes.

[0153] In certain embodiments, a saponin component or composition for disclosed use is provided, wherein the aldehyde functional group at the C-23 position of the aglycone core structure of at least one saponin is covalently bonded to a linker EMCH, and the EMCH is covalently bonded via a thioether linkage to a sulfhydryl group of an oligomer or polymer molecule of a covalently bonded saponin conjugate, such as a sulfhydryl group of cysteine. When the EMCH linker is bonded to the aldehyde group of the saponin aglycone, a hydrazone bond is formed. Such a hydrazone bond is a typical example of a bond that can be cleaved under acidic conditions inside endosomes and lysosomes.

[0154] If a saponin component contains a saponin portion, that portion is one of the saponin molecules covalently bonded to it. - A linker suitable for covalently bonding saponin molecules to further molecules, such as, a. Polyethylene glycol (PEG) having any number of lengths from 2 to 60 (PEG2, PEG3, PEG4, PEG5, PEG6, PEG7-PEG10, PEG11-PEG25, PEG25-PEG50, etc.); b. peptide; c. Linear or branched or cyclic alkyl, linear or branched or cyclic alkenyl, linear or branched or cyclic alkynyl; d. A polymer structure or oligomer structure, for example: The polymer or oligomer structure is as follows: i. Poly- or oligo(amine), e.g., polyethyleneimine and poly(amideamine), ii. Polyethylene glycol, iii. Poly(lactide) and other poly or oligo(ester) iv. Poly(lactam), v. Polylactide-co-glycolidopolymer, vi. Poly or oligosaccharides such as cyclodextrins and polydextroses, vii. Proteins, peptides, and polylysine and other poly or oligo (amino acid) compounds, and viii. DNA oligomers or polymers, RNA polymers, stabilized RNA polymers and PNA (peptide nucleic acid) polymers, and / or ix. G2, G3, G4, or G5 type dendrons A polymer structure or oligomer structure selected from the above. Linkers include or are these; - For example, the linker as defined above, having further molecules covalently bonded to the linker, The aforementioned further molecule, a. Further linkers, e.g., the linker defined above; and / or b. An effector portion which is a therapeutic oligonucleotide; and / or c. Ligands for binding to endocytosis cell receptors One or more of the following: The ligand is a proteinogenic ligand, a non-proteinogenic ligand, or a combination thereof, preferably the ligand is a proteinogenic ligand, for example, a. A protein ligand that can bind to endocytosis cell surface receptors, and upon binding, leads to the internalization of protein ligands, such as cytokines or EGF; b. Antibodies defined as immunoglobulin (Ig) or its functional binding fragments or binding domains. That is the case.

[0155] Saponin components are suitable for passive or active movement from the outside of a cell to the inside of the cell. Furthermore, saponins are suitable for movement from outside the cell to inside the cell, which is movement within the cell's endosomes. Saponin components are suitable for entering cells via endocytosis, when a ligand for binding to an endocytic cell receptor, which is bound to the saponin portion of the saponin component, binds to the endocytic cell receptor. Upon ligand binding, endocytosis occurs, and the saponin component is delivered to the endosome of a cell containing the cell receptor.

[0156] Notable examples of such cell surface receptors are CD71 and CD63.

[0157] The ligand for binding to such endocytic cell surface receptors is, for example, contained in the saponin component and / or effector component (such as a nucleic acid component) if the effector molecule or effector portion contained in the effector component is to exert its therapeutic or prophylactic activity in tumor cells.

[0158] Examples of endocytosis receptors that can be selected for targeting by ligands contained in saponin components (and / or effector components such as nucleic acid components) include transferrin receptor (CD71), insulin-like growth factor 1 (IGF-I) receptor (IGF1R), tetraspanin CD63; muscle-specific kinase (MuSK), glucose transporter GLUT4, cation-independent mannose 6-phosphate receptor (CI-MPR), and LDL receptor. Ligands for binding to such endocytosis cell surface receptors are contained in the saponin component and / or effector component (such as nucleic acid components) if the effector molecule or effector portion contained in the effector component is to exert its therapeutic or prophylactic activity in muscle cells.

[0159] When the proteinaceous ligand contained in the saponin component (and suitable for binding to endocytic cell surface receptors) is an antibody, the antibody is selected from, for example, IgG, IgM, IgE, IgA, or IgD, or any antigen-binding fragment thereof, and is preferably selected from monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, chimeric antibodies, resurface antibodies, anti-idiotype antibodies, mouse antibodies, rat antibodies, rat / mouse hybrid antibodies, llama antibodies, llama heavy chain-only antibodies, heavy chain-only antibodies, Vhh domains, Vh domains, Fab, scFv, Fv, single-domain antibodies (sdAb), F(ab)2, Fcab fragments, or molecules comprising them. Monoclonal antibodies and Fab and a single sdAb or a series of covalently bound sdAbs are preferred.

[0160] A linker (or, in some embodiments, a ligand covalently bound to the linker) covalently bound to the saponin molecule, forming a saponin component containing the saponin moiety, is, in preferred embodiments, covalently bound to the saponin via a cleavable bond present in mammalian cells, such as endosomes in human cells, under conditions that allow for cleavage. Such cleavable bonds are readily cleaved under, for example, acidic, reducing, enzymatic, and / or photo-induced conditions. Preferably, the cleavable bond is • Bonds that are cleaved under acidic conditions, including semicarbazone bonds, hydrazone bonds, imine bonds, acetal bonds (including 1,3-dioxolane bonds), ketal bonds, ester bonds, and / or oxime bonds. Preferably, a proteolytic bond, such as an amide or peptide bond, that will be subjected to proteolytic degradation by cathepsin B; • Bonds that can be cleaved by redox reactions, such as disulfide bonds, or bonds that readily undergo thiol exchange reactions, such as thioether bonds. Includes a severable join selected from, Preferably, the acid-sensitive bond is one that is cleaved in vivo under acidic conditions present in human cell endosomes and / or lysosomes, preferably at pH 4.0 to 6.5, more preferably at pH ≤ 5.5, and more preferably an acid-sensitive bond selected from one or more of the following: an acid-sensitive bond selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond; even more preferably selected from a semicarbazone bond and a hydrazone bond; most preferably a hydrazone bond.

[0161] In one embodiment of the present invention, the saponin molecule contains a glucuronic acid functional group having a carboxylic acid functional group at the carbohydrate substituent of the C-3β-OH group of the saponin, and the carboxylic acid functional group is converted to an active ester.

[0162] In one embodiment of the present invention, the saponin moiety comprises a glucuronic acid functional group having a carboxylic acid functional group in the carbohydrate substituent on the C-3β-OH group of the saponin, and the carboxylic acid functional group is converted to an active ester when a linker is bonded to the carboxylic acid functional group. In one embodiment, the ligand defined above is covalently bonded to the linker, which is bonded to the saponin moiety. An example of such a saponin moiety containing an active ester is a moiety resulting from the activation of the carboxyl group of a saponin molecule selected to provide the saponin moiety via 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU).

[0163] In the embodiment, the linker bound to the saponin molecule of the saponin component further comprises an oligomer or polymer structure which is either a dendron such as a polyamidoamine (PAMAM) dendrimer, or a polyethylene glycol such as any of PEG3 to PEG30. Preferably, the polymer or oligomer structure is any one of PEG4 to PEG12, or any one of G2 dendron, G3 dendron, G4 dendron, and G5 dendron, and more preferably G2 dendron, G3 dendron, or PEG3-PEG30.

[0164] For example, the saponin component contains a saponin moiety with a covalently bonded linker and is a molecule according to formulas (I) to (V):

[0165] [ka]

[0166] [ka]

[0167] [ka]

[0168] and / or for example, saponin components are - As shown for SO1861 in formula (18), the carboxyl group of the glucuronic acid unit in the first sugar chain bonded to C-3 of the aglycone core structure of the saponin is converted to an amide bond by reaction with N-(2-aminoethyl)maleimide (AEM), saponin:

[0169] [ka]

[0170] Or a saponin having one of the following formulas (14) to (16) and (19) to (21):

[0171] [ka]

[0172] [ka]

[0173] Includes.

[0174] In a preferred embodiment, the saponin component is a molecule according to formula (I) above, or SO1861, or a conjugate of SO1861 and a first ligand.

[0175] Effector components The development of the advantageous compositions presented herein was based on the remarkable realization that by including endosomal escape-promoting saponins in the conjugates presented herein, any nucleic acid can be delivered to cells within CNS organelles in an improved and efficient manner by topical administration to aid in the treatment of underlying disorders.

[0176] As previously stated herein, the term "effector component" refers to a component that includes an effector portion or consists of an effector molecule, where the effector portion or effector molecule is a nucleic acid therapeutic agent, preferably an oligonucleotide therapeutic agent.

[0177] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, and the nucleic acid therapeutic agent is, - Gene therapy drugs that can treat or improve a disorder by replacing or restoring the function of an abnormal or non-functional gene involved in the disorder with a functional variant, or by introducing a repair product into the gene; or - Oligonucleotide therapeutics defined as nucleic acid therapeutics having a size of 200 nt or less, preferably 5 to 150 nt, more preferably 8 to 100 nt, and most preferably 10 to 50 nt, preferably oligonucleotide therapeutics capable of treating or improving disorders by regulating the expression of genes involved in the disorder. Selected from.

[0178] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or a pharmaceutical composition for use disclosed herein is provided, wherein the nucleic acid therapeutic agent is defined as DNA and / or RNA and / or modified equivalents of DNA and / or RNA, comprising one or more nucleotide analogs and / or skeletal modifications of synthetic nucleic acids (red heteronucleotides, XNA), and preferably the nucleic acid therapeutic agent is selected from the following: - For example, a DNA therapeutic agent comprising a plasmid or minicircle DNA, and possibly circular double-stranded DNA (dsDNA); and / or a DNA therapeutic agent comprising, for example, single-stranded DNA (ssDNA), preferably a plasmid, minicircle DNA, a CRISPR gene editing-related construct, a DNA aptamer, and / or a DNA antisense oligonucleotide (ASO, AON), such as DNA anti-microRNA ASO (anti-miRNA ASO, anti-miR ASO), most preferably a DNA ASO; - For example, RNA therapeutics containing double-stranded RNA (dsRNA) such as small interfering RNA (siRNA) or small activating RNA (saRNA), and / or single-stranded RNA (ssRNA) such as mRNA or microRNA (miRNA), and possibly including non-coding RNA (ncRNA) such as transfer RNA (tRNA), ribosomal RNA (rRNA), circular RNA (circRNA) such as exac RNA or ciRNA, small non-coding RNA such as miRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-coding RNA (lncRNA), such as long intercalating / intergenetic non-coding RNA (lincRNA); preferably, RNA-based therapeutics are selected from RNA ASO, siRNA, miRNA, RNA miRNA inhibitors (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamers, ribozymes, RNA decoys, short hairpin RNA (shRNA), anti-hairpin shaped microRNA; most preferably, RNA therapeutics are RNA Selected from ASO, siRNA, miRNA, and / or RNA aptamers; - Preferably a mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent comprising or consisting of one of the following modifications: phosphoramidate morpholino oligomers (PMO, morpholino), peptide nucleic acids (PNA), phosphorothioate-modified antisense oligonucleotides (PS-ASO), 2'-O-methyl (2'-OMe) phosphorothioate RNA, 2'-O-methoxyethyl (2'-O-MOE) RNA (2'-O-methoxyethyl-RNA (2'-MOE, MOE)), locked nucleic acids (LNA, cross-linked nucleic acids, BNA; e.g., 2'-O,4'-aminoethylene cross-linked nucleic acids) The therapeutic agents for mixed DNA / RNA and / or synthetic nucleic acids include or consist of gapmers (mixmers), synthetic gapmers, synthetic CpG oligonucleotides, synthetic RNA decoys, synthetic ASOs and / or synthetic anti-microRNAs, such as (BNA-NC), BNA-based siRNA, BNA-based antisense oligonucleotides (BNA-ASO), BNA-based anti-microRNAs, 2'-deoxy-2'-fluoroarabino nucleic acids (FANA), 3'-fluorohexitol nucleic acids (FHNA), glycol nucleic acids (GNA), threose nucleic acids (TNA), and more preferably mixed DNA / RNA and / or synthetic nucleic acid therapeutic agents, including gapmers (mixmers), synthetic gapmers, synthetic CpG oligonucleotides, synthetic RNA decoys, synthetic ASOs and / or synthetic anti-microRNAs, for example, anti-microRNA ASOs, for example miRNA masking ASOs (miR-Mask, blocking miR, usually single-stranded 2'-O-methyl-modified oligoribonucleotides) or antagomirs (miRNA antagonists) or other LNA-based or 2'-O-methylRNA-based anti-microRNAs. More preferably, the nucleic acid therapeutic agent is a mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent selected from the following: a mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent selected from synthetic ASO, substantially DNA-based synthetic ASO, preferably substantially RNA-based synthetic ASO containing 2'-MOE modification, substantially DNA-based synthetic aptamer, substantially RNA-based synthetic aptamer, synthetic gapmer, synthetic siRNA, synthetic miRNA, synthetic anti-miRNA and / or synthetic anti-miRNA ASO.

[0179] For example, targeting the CNS with 2'-MOE-containing ASOs is considered advantageous due to their high stability in cerebrospinal fluid (CSF) after intrathecal injection, thereby making them particularly suitable for CNS targeting (Khorkova et al., 2017).

[0180] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided. Nucleic acid therapeutics are oligonucleotide therapeutics, preferably siRNA therapeutics or antisense oligonucleotide (ASO) therapeutics, preferably comprising one or more nucleotide analogs and / or skeletal modifications, more preferably mutation-specific therapeutics, such as mutation-specific ASOs comprising one or more nucleotide analogs and / or skeletal modifications, and may be designed to silence and / or induce exon skipping of genes involved in the disorder.

[0181] In the following embodiments, which are consistent with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the nucleic acid therapeutic agent is HTT, LRRK2, SNCA, parkin gene, PINK1, DJ-1, DRP-1, SCN1A, SOD1, TDP-43, FUS, C9orf72, NEK1, UBQLN2, ATXN2, SMN2, SMN1, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, IL-12RB2, IL-1R1, MBP, MIR29B, AR, FAS, C2orf72 UBE3A, UBE2A, GFAP, DMD, DYN2, DGAT2, MFSD8 (CLN7), TTR, VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IKBKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNG) The gene is one of the following: A1, CNGA2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1 and MMP14, preferably one of the genes HTT, SOD1, MFSD8(CLN7), SMN1, SMN2, TTR, Malat1, AHA1 or MMP14.

[0182] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or a pharmaceutical composition for use disclosed herein is provided, wherein the nucleic acid therapeutic agent is preferably an oligonucleotide therapeutic agent capable of silencing a gene or rendering a gene product (which may be, for example, mRNA or miRNA, or an aptamer such as pegatinib), and more preferably the oligonucleotide therapeutic agent is selected from the group consisting of:Nusinersen (ASO for SMN2 splicing in SMA); inotersen (ASO for TTR in hATTR), eplontersen (ASO for TTR in hATTR), vutrisiran (siRNA for TTR in hATTR), patisiran (siRNA for TTR in hATTR), tofersen (ASO for SOD1 in ALS), QRX-704 (ASO for HTT), jacifusen (ION-363; ASO for FUS); tominersen (IONIS-HTTRx or RG6042; ASO for HTT), WVE-003 (ASO for HTT); zyrganersen (ASO for GFAP in Alexander disease); atesidorsen, cimdelirsen (ASO for GHR in acromegaly), ATL-1102 (CD in relapsing MS) ASO for 49d); BIIB-080 (ASO for TAU / MAPT in Alzheimer's disease, frontotemporal degeneration, and AD dementia); GTX-102 (ASO for UBE2A); ION-464 (ASO for SNCA), ION-541 (ASO for ATXN2); ION-859 (ASO for LRRK2), IONIS-PKKRx (ASO for KLKB1), STK-001 (Splicating SCN1A) ASOs for [purpose of use], WVE-004 (ASO for C9orf72), trabedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (siRNA for PTGS2 / TGFB1), danvatirsen (ASO for STAT3), AZD-8701 (ASO for FOXP3); siG-12D-LODER (siRNA for KRAS), IONISAR-2.5Rx (ASO for AR), SR-063 (siRNA for AR), plexigeversen (ASO for GRB2); MTL-CEBPA (saRNA for CEBPA activation), oblimersen (ASO for Bcl-2 in melanoma); rademircene (anti-miR-21), fomivirsen (ASO for CMV virus IE2), pegatinib (aptamer that binds to and blocks VEGF), bevacilanib (siRNA for VEGF-A), siRNA-027 (siRNA for VEGFR-1) NA), aganilsen (ASO for IRS1), sepofalsen (ASO for CEP290 splicing), rufepilsen (CODA-001; ASO vs. connexin 43 (GJA1)), IONIS-FB-LRx (ASO for CFB), QR-1123 (ASO for RHO), urtevirsen (QR-421a; ASO for USH2A), QPI-1007 (siRNA for NAION), cibianisirane (siRNA for TRPV1); bamosilane (siRNA for ADRB2).

[0183] In certain embodiments conforming to prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the nucleic acid therapeutic agent is an oligonucleotide therapeutic agent selected from the group consisting of:Nusinersen (ASO for SMN2 splicing in SMA); inotersen (ASO for TTR in hATTR), eplontersen (ASO for TTR in hATTR), vutrisiran (siRNA for TTR in hATTR), patisiran (siRNA for TTR in hATTR), tofersen (ASO for SOD1 in ALS), QRX-704 (ASO for HTT), jacifusen (ION-363;F ASO for US); tominersen (IONIS-HTTRx or RG6042; ASO for HTT), WVE-003, (ASO for HTT); zilganersen (ASO for GFAP in Alexander disease); atesidorsen, cimdelirsen (ASO for GHR in acromegaly), ATL-1102 (ASO for CD49d in relapsing MS); BIIB-080 (ASO for TAU / MAPT in Alzheimer's disease, frontotemporal degeneration, and AD dementia); G TX-102 (ASO for UBE2A); ION-464 (ASO for SNCA), ION-541 (ASO for ATXN2); ION-859 (ASO for LRRK2), IONIS-PKKRx (ASO for KLKB1), STK-001 (ASO for splicing SCN1A), WVE-004 (ASO for C9orf72), trabedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (PTGS2 / TG siRNA against FB1, danvatirsen (ASO against STAT3), AZD-8701 (ASO against FOXP3); siG-12D-LODER (siRNA against KRAS), IONISAR-2.5Rx (ASO against AR), SR-063 (siRNA against AR), plexigeversen (ASO against GRB2); MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO against Bcl-2 in melanoma); rademircene (anti-miR-21).

[0184] An overview of oligonucleotide therapeutics and their indications can be found in Table 2B.

[0185] [Table 10]

[0186] [Table 11]

[0187] [Table 12]

[0188] In a subsequent embodiment consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, wherein a first endocytosis receptor and / or a second endocytosis receptor is selected from the following: - CD71 (transferrin receptor) - CD63 (tetraspanin) - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor) - InsR (insulin receptor) - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose 6-phosphate receptor), - LDL receptor - TGFβ receptor, - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor) - IL13-R (Interleukin-13 receptor) - AMPAR / NMDAR (AMPA-type glutamate receptor and NMDA-type glutamate receptor) - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2) - STRA6 (Retinol-binding protein (RBP) receptor).

[0189] The receptors particularly suitable for the applications disclosed herein are: transferrin receptor (CD71), tetraspanin (CD63), insulin-like growth factor 1 (IGF-I) receptor (IGF1R), InsR (insulin receptor), glucose transporter GLUT4, cation-independent mannose 6-phosphate receptor (CI-MPR), LDL receptor, TrkA receptor, IL13-R, AMPAR / NMDAR, TGFb receptor, vascular endothelial growth factor receptors 1 and 2 (VEGFR1 and VEGFR2), and STRA6 (retinol-binding protein (RBP) receptor). STRA6 is of interest for retinal cell delivery because, for example, it is expressed on retinal pigment epithelial (RPE) cells.

[0190] Further examples of known cell surface receptors are as follows: CD71, CD63, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin α-Vβ-3, HER2, EGFR, CD20, CD22, folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, prostate-specific membrane antigen (PSMA), CanAg, integrin-αV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123 CD352, DLL3, CD25, Ephrin A4, MUC-1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA-4, CD52, PDGFRA, VEGFR1, VEGFR2, c-Met(HGFR), EGFR1, RANKL, ADAMTS5, CD16, CXCR7(ACKR3), glucocorticoid-inducible TNFR-related protein (GITR). For example, preferred endocytic cell surface receptors for tumor targeting are as follows: The pharmaceutical combination or pharmaceutical composition of the present invention is a cell surface receptor selected from HER2, c-Met, VEGFR2, CXCR7, CD71, EGFR and EGFR1.

[0191] In a subsequent embodiment conforming to the preceding embodiment, a saponin component or pharmaceutical composition for use herein is provided, comprising a first ligand and / or a second ligand, wherein the first endocytosis receptor and / or the second endocytosis receptor is present on cells and / or tissues within the CNS, preferably the cells being selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells, blood cells and / or tumor cells, more preferably the cells being selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells and / or tumor cells; Most preferably, the first ligand and / or the second ligand are - An antibody or a conjugate fragment thereof that binds to any one of the receptors listed in the previous embodiment; - A native ligand or fragment thereof recognized by any one of the receptors listed in the previous embodiments. Selected from; Preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or its fragments recognized by CD71; - Insulin or fragments thereof; - Insulin-like growth factor 1 (IGF-I) or a fragment thereof; - Insulin-like growth factor 2 (IGF-II) or a fragment thereof; - Mannose 6-phosphate, preferably in multiple units thereof; - Glucose, preferably multiple units thereof, for example, zymosan A; - TGFβ or its fragments; - EGF or fragments thereof; - Neurotrophin (nerve growth factor, NGF) or fragments thereof; - Interleukin-13 (IL-13) or its fragments; - Glutamate or its units; - Vascular endothelial growth factor A (VEGF-A) or its fragments; - Retinol (vitamin A) or other forms of vitamin A; - Retinol-binding protein (RBP) or a fragment thereof; - The following: Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, and LDL receptors. Selected from, More preferably, the first ligand and / or the second ligand is an antibody or a binding fragment thereof that binds to CD71, even more preferably a monoclonal antibody or a single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

[0192] In certain embodiments conforming to prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein a first endocytosis receptor and / or a second endocytosis receptor is selected from the following: - CD71 (transferrin receptor) - CD63 (tetraspanin) - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor) - InsR (insulin receptor) - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose 6-phosphate receptor), - LDL receptor - TGFβ receptor; - EGFR - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor) - IL13-R (Interleukin-13 receptor) AMPAR / NMDAR (AMPA-type glutamate receptor and NMDA-type glutamate receptor).

[0193] In embodiments conforming to prior embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, comprising a first ligand and / or a second ligand, wherein the first ligand and / or the second ligand are - An antibody or a conjugate fragment thereof that binds to any one of the receptors listed in the previous embodiment; - A native ligand or fragment thereof recognized by any one of the receptors listed in the previous embodiments; Selected from, Preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or its fragments recognized by CD71; - Insulin or fragments thereof; - Insulin-like growth factor 1 (IGF-I) or a fragment thereof; - Insulin-like growth factor 2 (IGF-II) or a fragment thereof; - Mannose 6-phosphate, preferably in multiple units thereof; - Glucose, preferably multiple units thereof, for example, zymosan A; - TGFβ or its fragments; - EGF or fragments thereof; - Neurotrophin (nerve growth factor, NGF) or fragments thereof; - Interleukin-13 (IL-13) or its fragments; - Glutamate or its units; - The following: Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, and LDL receptors. Selected from, More preferably, the first ligand and / or the second ligand is an antibody or a binding fragment thereof that binds to CD71, even more preferably a monoclonal antibody or a single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

[0194] Central nervous system disorders are a significant burden and costly for patients, their families, and society. The majority of these disorders are related to the brain.

[0195] The complexity of the brain makes it difficult to pinpoint a single cause, and often both genetic and environmental factors play a role in their pathophysiology.

[0196] The importance and recognition of genetic components can differ among neurodegenerative disorders, such as Parkinson's disease (PD), which involves a larger environmental component, compared to other diseases, such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), which involve lesions of many different genes, while Huntington's disease is clearly linked to the huntingtin (HTT) gene. In oncology, the location and size of tumors in the central nervous system (CNS) are factors that influence the severity of the disorder and the likelihood of survival. Glioblastoma (GBM) is one of the best-known and most deadly cancers in the CNS.

[0197] For both oncological disorders in the central nervous system (CNS) and other CNS disorders such as neurodegenerative disorders, reaching the target site is a challenge because the brain is protected by the blood-brain barrier (BBB), limiting access to pharmacological interventions. In particular, the BBB makes standard systemic administration routes, such as intravenous or subcutaneous administration, virtually impossible for oligonucleotide therapies. Consequently, other administration routes, including, to name a few, epidural, intrathecal, intraventricular, or intranasal delivery, must be considered. For oncological disorders, postoperative injection into the tumor lumen may also be considered.

[0198] Anatomically, the brain and spinal cord are enclosed by four membranes known as the meninges, whose function is to protect the central nervous system. Starting from the area furthest from the nerve tissue of the brain and spinal cord, these are: the dura mater (the meninge closest to the bones of the skull and vertebral column), the arachnoid mater, the subarachnoid lymphoid mater (SLYM), and the pia mater. The arachnoid mater and pia mater are sometimes collectively called the pia mater. Typically, three distinct spaces are defined with respect to the dura mater and pia mater. The first and outermost is the epidural space between one or more skull bones of the vertebral column and the dura mater of the brain and spinal cord. The spinal cord terminates between the first and second lumbar vertebrae, at which point only cerebrospinal fluid is present. This is a relatively safe site for epidural injections, the site of lumbar puncture ("spinal puncture"), and is frequently used for analgesics and anesthesia. Below the epidural space is the subdural space between the dura mater and the arachnoid mater, which is not normally a space but can open in cases of trauma such as brain hemorrhage or other medical conditions. The last one is the subarachnoid space between the arachnoid mater and the pia mater, which is filled with cerebrospinal fluid (CSF) that buffers and protects the brain and spinal cord and is in direct contact with their tissues and cells.

[0199] Regarding the anatomical sites mentioned above, different administration sites known to healthcare professionals can be defined.

[0200] In subsequent embodiments conforming to the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the administration is selected from epidural, intrathecal, ventricular, cisterna magna, intraparenchymal, and / or intranasal, and / or postoperative injection into a tumor lumen formed postoperatively within the CNS. Preferably, the administration is selected from intrathecal, ventricular, cisterna magna, and / or intranasal; more preferably, the administration is intrathecal.

[0201] Due to the possibility of direct access to nerve tissue, the preferred route is intrathecal, which means that administration takes place in the subarachnoid space (this has the advantage that the pharmaceutical composition containing the saponin and effector components reaches the CSF).

[0202] A further advantageous pathway is within the nasal cavity, which uses olfactory neurons to reach the brain. Olfactory neurons are bipolar neurons that extend their dendrites into the mucous layer, terminating as olfactory receptors and projecting into the olfactory bulb. This provides a direct portal vein between the nose and the central nervous system. Furthermore, their unmyelinated axons are lined with olfactory nerve sheath cells (OECs) and olfactory neurofibroblasts, which are continuous with the meninges, and therefore the subarachnoid space (Cassano et al., 2021).

[0203] In a subsequent embodiment consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, administered intradurally, intraarachnoid, subarachnoid, or intrapia mater, and / or within brain tissue. Preferably, the administration is performed in the subarachnoid space and / or within the subarachnoid space; more preferably, the administration is performed in the subarachnoid space, thereby allowing the pharmaceutical composition comprising the saponin component and effector component to reach the CSF.

[0204] Further embodiments conforming to the prior embodiments provide saponin components or pharmaceutical compositions for use disclosed herein, and CNS disorders are, - Preferably, one or more neurodegenerative disorders selected from Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), multiple system atrophy (MSA), multiple sclerosis (MS), and / or Lewy body dementia (DLB). - Preferably, a neurological disorder selected from stroke, epilepsy, for example, Dravet syndrome (DS), and / or spinal cord disease; - Preferably selected from one or more of glioblastoma, meningioma, (oligodendroglioma), astrocytoma, ependymoma, medulloblastoma, CNS lymphoma, and metastasis to the CNS; more preferably selected from glioblastoma, meningioma, (oligodendroglioma), and / or metastasis to the CNS, oncological disorder, - Preferably selected from autoimmune diseases of the CNS, immune-related diseases caused by genetic defects, diseases caused by infection or inflammation, and more preferably selected from meningitis, encephalitis, prion diseases, and / or coronavirus disease 2019 (COVID-19), immunodeficiency. - A mental disorder preferably selected from one or more of the following: Tourette syndrome (TS), mood disorders, personality disorders, anxiety disorders, substance use or addiction disorders, obsessive-compulsive disorder, neurodevelopmental disorders, and eating disorders, and more preferably selected from mood disorders which are anxiety disorders, obsessive-compulsive disorder, eating disorders, and / or preferably treatment-resistant mood disorders. Selected from.

[0205] In embodiments conforming to prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, and the CNS disorders are selected from neurological disorders associated with spinal muscular atrophy (nusinersen for treatment has been approved), hereditary transthyretin amyloidosis (hATTR), amyotrophic lateral sclerosis (ALS), preferably SOD1-related amyotrophic lateral sclerosis (tophasen for treatment has been developed), Huntington's disease (thomasen for treatment has been developed), Alzheimer's disease, Parkinson's disease, Batten's disease (miracen for personalized treatment has been proven), frontotemporal dementia, ataxia type 3, multiple system atrophy; Rett syndrome; Alexander disease; Angelman syndrome; Lafora disease; GFAP astrocytic degeneration, prion diseases, and acromegaly.

[0206] Further embodiments conforming to the preceding embodiments provide a saponin component or pharmaceutical composition for use disclosed herein, wherein the effector component comprises an oligonucleotide therapeutic targeting one of STAT3, SOD1, Malat1, AHA1, MMP14, TTR, and HTT, or an oligonucleotide therapeutic selected from nusinersen, tominersen, tofersen, inotercene, eprontersen, butricilane, patisirane, and travedersen, wherein the saponin component preferably comprises SO1861 or SO1861, and the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to decompose under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core. Preferably, the administration is intrathecal and preferably comprises a two-component free saponin preparation, a two-component linker-saponin preparation, or a one-component preparation as defined above.

[0207] In embodiments of the present invention, the effector portion is one of the above-defined effector molecules, which are covalently bonded: - A linker selected from one or more of the linkers defined above for the saponin portion; - A linker, for example, a linker having further molecules covalently bonded to it, as defined above. The aforementioned further molecule is defined as defined above with respect to the saponin portion, d. Further linkers, such as the linker defined above; e. A ligand for binding to endocytosis cell receptors, one or more of the above, A ligand is a proteinogenic ligand, a non-proteinogenic ligand, or a combination thereof. Protein ligands include, for example: a. Protein ligands that can bind to cell surface receptors and, upon binding, lead to the internalization of protein ligands, such as cytokines or EGF; b. The saponin portion is the antibody defined above.

[0208] In embodiments of the present invention, the effector component comprises an effector moiety conjugated with a ligand for binding to an endocytic cell surface receptor, wherein the effector component contains either the same ligand as the saponin component or a different ligand than that contained in the saponin component. When the ligands contained in the effector component and the saponin component are different, these different ligands typically both bind to the same endocytic cell surface receptor present on the same cell. Such endocytic receptors may be the same endocytic receptor or two different endocytic receptors.

[0209] For example, the ligand contained in the effector component may be an antibody that can bind to a first tumor cell-specific receptor present on tumor cells, and the ligand contained in the saponin component may be an antibody or ligand such as EGF that can bind to a second tumor cell-specific receptor present on the same tumor cells.

[0210] In preferred embodiments, the saponin component includes an oligonucleotide therapeutic agent.

[0211] In a preferred embodiment, the saponin component includes a ligand that can bind to endocytic cell surface receptors.

[0212] In preferred embodiments, the oligonucleotide component includes a ligand capable of binding to endocytic cell surface receptors.

[0213] In preferred embodiments, the saponin component comprises both a ligand capable of binding to the endocytic cell surface receptor as defined herein and an oligonucleotide as defined herein.

[0214] A preferred embodiment is a therapeutic combination or therapeutic composition comprising one of the saponin components defined above herein and one of the oligonucleotide components defined above herein.

[0215] A preferred embodiment is a therapeutic combination or therapeutic composition comprising one of the saponin components defined above herein and one of the oligonucleotide components defined above herein.

[0216] A preferred embodiment is a therapeutic combination or therapeutic composition comprising one of the saponin components defined herein, wherein the saponin component comprises a ligand defined herein, and one of the oligonucleotide components defined herein, wherein the oligonucleotide component comprises a ligand defined herein, for targeting endocytic cell surface molecules present on the same cell as the endocytic cell surface molecules targeted by the ligand composed of the saponin component.

[0217] A preferred embodiment is a saponin component comprising a saponin moiety and an oligonucleotide.

[0218] A preferred embodiment is a saponin component consisting of saponin molecules.

[0219] A preferred embodiment is an oligonucleotide component consisting of an oligonucleotide molecule.

[0220] A preferred embodiment is a therapeutic combination or therapeutic composition comprising a saponin molecule and an oligonucleotide molecule.

[0221] A preferred embodiment is a therapeutic combination or therapeutic composition of any of the saponin component a defined above and any one of the oligonucleotide components defined above.

[0222] A preferred embodiment is a therapeutic composition comprising or consisting of an oligonucleotide and a saponin component comprising the ligand defined above.

[0223] Any one of the therapeutic compositions preferably comprises a therapeutically acceptable excipient and / or a therapeutically acceptable diluent.

[0224] Finally, embodiments of the pharmaceutical compositions disclosed herein, further comprising any one or more components selected from the following, are provided herein: pharmaceutically acceptable excipients and / or pharmaceutically acceptable diluents and / or analgesics and / or immunosuppressants and / or anti-inflammatory agents and / or antibiotics.

[0225] Anti-inflammatory agents include, but are not limited to, non-steroidal anti-inflammatory drugs such as bromfenac, nepafenac, ketorolac, diclofenac, and flurbiprofen. Corticosteroids such as dexamethasone, difluprednate, loteprednol, fluocinolone, fluorometholone, triamcinolone, rimexolone, prednisone, and prednisolone; and integrin antagonists such as lifitegrast. Immunosuppressants are not limited to these, but include antimetabolites such as azathioprine, methotrexate, and mycophenolate mofetil. Calcineurin inhibitors, such as cyclosporine, tacrolimus, and voclosporine; alkylating agents such as cyclophosphamide and chlorambucil; TNF inhibitors such as etanercept, infliximab, and adalimumab; lymphocyte inhibitors such as rituximab and abatacept; interferons, such as interferon alfa, and interleukin antagonists, such as the IL-1 antagonist anakinra and the IL-2 antagonist daclizumab. Antibiotics include, but are not limited to, ofloxacin, moxifloxacin, levofloxacin, ciprofloxacin, gatifloxacin, azithromycin, becifloxacin, tobramycin, polymyxin b, trimethoprim, and trifluridine. Vidarabine, gentamicin, and chloramphenicol. Neomycin, erythromycin, and batilisin, as well as analgesics, include, but are not limited to, the above-mentioned nonsteroidal anti-inflammatory drugs and corticosteroids, and local anesthetics such as tetracaine, propalacaine, and lidocaine. [Examples]

[0226] The following examples help illustrate the broad applicability of topical co-administration of various saponin components and various oligonucleotides. Furthermore, these examples demonstrate that simultaneous administration of saponin components and oligonucleotides significantly improves their efficacy: (1) Examples include the treatment of sporadic and hereditary (common) hereditary diseases, as well as non-hereditary diseases that benefit from gene / RNA regulation, and various types of cancer that originate in or spread to the CNS, in relevant target tissues, such as (but not limited to) the central nervous system; (2) By targeting disease-related genes for preferred tissues, including but not limited to STAT3, SOD1, Malat1, AHA1, MMP14, and TTR; (3) By using various oligonucleotide modalities to target these genes (e.g., PMO, or phosphorothioate-modified (PS) 2'-MOE ASO, or PS 2'-locked nucleic acid (LNA) ASO, or siRNA with different stabilizations), for example, (a) (i) results in immature stop codon and nonsense mutation-dependent mRNA degradation (RNA degradation), or (ii) Altered viable transcripts, followed by different / functional proteins (isoforms). Exon skipping to induce frame shifts, or (b) Alternative splicing that leads to RNA degradation / Splice site blockade to induce abnormal transcripts, (c) By stimulating RNA cleavage (degradation) through the recruitment of ribonuclease (RNase) H, thereby cleaving the RNA strand of the DNA-RNA double helix, or (d) Post-transcriptional arrest or silencing of the gene expression of target mRNA by siRNA; (4) By using specific pentacyclic 12,13-dehydrooleanane type saponin components rather than steroid(like) saponins / molecules, (5) By using either a free / non-conjugate (e.g., SO1861, or SO1861-AH-Block, or SO1861-SC-Mal) or covalently conjugated component (an oligonucleotide, e.g., ASO-SC-SO1861, or Cet-SO1861-STAT3_ST6 PMO, or Cet-SO1861-STAT3_ST2 PMO, or GN3-SC-SO1861), i.e., a specific pentacyclic 12,13-dehydrooleanane-type saponin component administered co-administered with or without a cell receptor-targeting ligand, (6) Not limited to that, but by enabling various mechanisms of action through different administration routes, including intraventricular (ICV) routes.

[0227] The data presented herein demonstrate that pentacyclic 12,13-dehydrooleanane saponin components, whether directly conjugated, ligand-conjugated, or unconjugated, enhance the potency of oligonucleotide therapeutics delivered to tissues of CNS origin without inducing / substantially increasing treatment-related neurotoxicity.

[0228] This data also suggests that direct conjugation of oligonucleotide therapeutics with pentacyclic 12,13-dehydrooleanane saponin components may be beneficial for reaching specific brain regions, particularly those far from the injection site or less exposed to CSF ​​flow.

[0229] Furthermore, such covalent conjugates ensure the desired synchronization of cellular delivery of oligonucleotide therapeutics and saponin components, thereby resulting in improved therapeutic efficacy compared to ASO alone and compared to ASO administered co-administered with saponins.

[0230] Finally, and importantly, the data further suggest that ligand-targeted conjugates of oligonucleotide therapeutics with pentacyclic 12,13-dehydrooleanane saponins ("one-component conjugates") are particularly advantageous for carrying out endosomal enrichment and synchronous delivery of the saponin component and the therapeutic payload to the same cellular compartment.

[0231] Example 1: Enhancement of in vivo efficacy of ASO compounds by local co-administration of saponin components in the brain / CNS Malat1 (also known as MALAT1) is involved in the pathogenesis of Parkinson's disease and has been shown to enhance the stability of α-synuclein protein, leading to aggregation and Lewy body formation, and ultimately neuronal degradation. Malat1 acts as a decoy, suppressing miR-124 and enhancing apoptotic signaling. This effect causes neuronal degeneration (Liu et al., 2017; Front. BioScience (Landmark Ed) 2019, 24(7), 1203-1240). It also plays a crucial role in proliferative vitreoretinopathy, influencing apoptosis of retinal ganglion cells in glaucoma rats by regulating the PI3K / Akt signaling pathway (Li et al., Long Non-Coding RNA-MALAT1 Mediates Retinal Ganglion Cell Apoptosis Through the PI3K / Akt Signaling Pathway in Rats with Glaucoma, Cellular Physiology and Biochemistry (2018) 43(5):2117-2132, 2017), and targeting Malat1 reduces retinal neurodegeneration in diabetic mice (Zhang et al., Targeting long non-coding RNA MALAT1 alleviates retinal neurodegeneration in diabetic mice, Int J Ophthalmol 2020, 13(2), 213-219).

[0232] In vivo research design Male C57Bl / 6 mice (n=15; 7-8 weeks old at arrival) were randomly assigned to one of five treatment groups (n=3). Mice received 10 μL of their assigned treatment solution according to Table A1, namely vehicle (PBS), SO1861 (2.23 μg), Malat1-ASO (10 μg), Malat1-ASO (3 μg) administered unilaterally into the right ventricle (ICV), or Malat1-ASO (3 μg) + SO1861. Mice were terminated 10 days after administration. The brain was immediately dissected and separated into cerebral (left / right), cerebellar, and brainstem tissue samples. Tissue samples were stored in RNALater for 24 hours and then frozen at -80°C until analysis for Malat1 RNA expression levels.

[0233] [Table 13]

[0234] Analysis of Malat1 levels in brain tissue shows that topical co-administration of ASO with a saponin component significantly enhances ASO efficacy (Figure 1): For this purpose, Malat1 RNA expression after topical ICV administration of 10 μg Malat1 ASO, 3 μg Malat1 ASO, or 3 μg Malat1 ASO + saponin component SO1861 to the right ventricle was compared with control conditions (SO1861 alone and vehicle group) in different brain regions near or surrounding the injection site. Co-administration of 3 μg Malat1 ASO + SO1861 resulted in a marked and significant decrease in Malat1 RNA levels not only in tissues near the injection site (right cerebrum) but, surprisingly, also in the most distal tissues of the injection site (brainstem). Most importantly, compared to dose-matched conditions (i.e., 3 μg Malat1 ASO, without SO1861; approximately 83.7% Malat1 RNA), treatment with SO1861 also reaches approximately 85.3% Malat1 RNA in the right cerebrum. In contrast, the effect of topical co-administration of 3 μg Malat1 ASO + SO1861 is not only greater (44.3% residual Malat1), but even greater than the effect of a 3.33 times higher ASO dose (10 μg Malat1 ASO; 72.3% residual Malat1 RNA) in the right cerebrum. Furthermore, in the left cerebrum (further away from the injection site due to cerebrospinal fluid (CSF) flow), topical co-administration of 3 μg Malat1 ASO + saponin component SO1861 is still the most potent condition for reducing Malat1 RNA levels, and co-administration also has a significant effect in the cerebellum (least exposed to CSF ​​flow). In particular, even in the brainstem, the most distal brain region and the furthest from the injection site but highly exposed to CSF, topical co-administration of 3 μg of Malat1 ASO + SO1861 had an effect size equivalent to reducing RNA levels in the right cerebrum (45.0% of Malat1 remained). In conclusion, the Malat1-ASO (3 μg) + SO1861 combination effectively reduced Malat1 expression in all brain regions tested compared to the vehicle and SO1861 alone.The combination of Malat1-ASO (3 μg) + SO1861 showed improved efficacy in the brainstem and right cerebrum compared to Malat1 ASO (10 μg and 3 μg, respectively). In the brainstem and right cerebrum, both a dose-dependent effect of Malat1 ASO and a synergistic effect of the combined dose of Malat1-ASO (3 μg) + SO1861 were observed.

[0235] Example 2: Specificity of enhancement of ASO efficacy by co-administration of saponin components according to the present invention, compared to steroid(like) saponin / molecule measured by the efficacy of Malat1 mRNA knockdown in nerve cell lines. To evaluate the specificity of the enhancing effect of saponin components on ASO-induced Malat1 RNA reduction in co-administration, Malat1 ASO was titrated in Neuro-2a cells with fixed amounts of either the saponin component SO1861 or different steroid(like) saponins / molecules (digitonin, digoxin, and tomatine) (Figure 2A). Surprisingly, in this setting, only co-administration of Malat1 ASO with the saponin component SO1861 resulted in a significant decrease in Malat1 mRNA and an IC50 shift of approximately four orders of magnitude compared to ASO alone or all other co-administrations of ASO with steroid(like) saponins / molecules digitonin, digoxin, and tomatine (Figure 2A). More significantly, co-administration with saponin component SO1861 (1 μM) resulted in complete loss of Malat1 mRNA, even at an already approximately 30 nM ASO level. None of digitonin, digoxin, or tomatine (all 1 μM) enhanced the efficacy of Malat1 ASO when administered concurrently with ASO alone. Even at 20,000 nM ASO, Malat1 RNA was still measurable (approximately 10–15%) with co-administration of ASO with digitonin, digoxin, or tomatine, or with ASO alone. This indicates that the co-administration enhancing effect in neurons is specific to the saponin component SO1861 and is not observed with steroid(like) saponins / molecular digitonin, digoxin, or tomatine.

[0236] Next, to determine the minimum dose of saponin components required to achieve maximum potency through co-administration, titrations of saponin components (SO1861 or SO1861-AH-Block) or steroid(like) saponins / molecules digitonin, digoxin, glycyrrhizin, and tomatine were performed using a fixed 200 nM ASO (Figure 2B). This analysis showed that co-administration of the saponin component SO1861 already resulted in significant mRNA reduction and complete loss at relatively low doses: exposure concentrations of SO1861 below 650 nM were sufficient to reveal the near-complete potency of 200 nM ASO (i.e., >95% mRNA reduction). Furthermore, the saponin component SO1861-AH-Block was effective when compared to ASO alone or steroid(like) saponins / molecules. In contrast, digoxin, glycyrrhizin, and tomatine had no enhancing effect when co-administered with 200 nM ASO: no mRNA reduction was observed at any of the exposure concentrations tested. As expected, digitonin (known to permeate the plasma membrane) showed a reduction of approximately 70% of Malat1 mRNA only at a relatively high dose of 10,000 nM, and is therefore not very effective against the endosomal selective escape enhancer SO1861-AH-Block, which had already achieved a complete loss of Malat1 mRNA expression above 3200 nM.

[0237] Example 3: Enhancement of the efficacy of covalently conjugated ASO-saponin components in neuronal cells. To improve and synchronize the delivery of ASO and saponin to the same cell / compartment, ASO was directly (covalently) conjugated to SO1861 via an SC-containing linker, thereby obtaining a saponin component containing covalently bound ASO. Neuronal cells (Neuro-2a) were treated with the ASO-SC-SO1861 conjugate or ASO alone as a control, and the reduction in Malat1 mRNA was measured (Figure 3). This revealed that the covalently bound conjugate improved the IC50 from 160 nM without the saponin component to 60 nM with the saponin component. More importantly, while 4000 nM of ASO alone achieved only a 70% reduction in Malat1 mRNA expression, surprisingly, the ASO-SC-SO1861 conjugate, already at 2000 nM, showed a complete (100%) reduction in Malat1 mRNA expression (Figure 3). This data indicates that covalent conjugation of ASO and SO1861 results in improved efficacy in neuronal cell lines, and that conjugation of the saponin molecule into the payload does not introduce any limiting (inhibitory) factors. In contrast, such co-delivery by delivery of a saponin component containing the conjugated ASA ensures that ASO and saponin are delivered together to the same cell and cell compartment, optimizing their vivo / intracellular distribution and thereby enhancing their potency.

[0238] Example 4: Enhancement of the efficacy of Sod1-targeted PMO by co-administration of saponin components in nerve cells. Mutations in SOD1 are associated with familial amyotrophic lateral sclerosis (ALS), and knockdown of mutant SOD1 is associated with disease improvement. Therefore, a reduction in mutant SOD1 RNA arises as a potential treatment; Tophasen (Qalsody), an ASO-targeted mutant SOD1 RNA, was approved by the FDA in 2023. Thus, here we evaluated the knockdown-enhancing effect of a saponin component on the efficacy of a PMO that reduces Sod1 RNA in neuronal cell lines. For this purpose, a splice-site blocking SOD1 PMO (SEQ ID NO: 20) was designed to induce abnormal Sod1 transcripts, thereby resulting in immature stop codons (i.e., effectively leading to a reduction in Sod1 mRNA). The PMO was added to Neuro-2a cells in a dose range with or without a certain amount of the saponin component (SO1861-SC-Mal), and the levels of abnormal Sod1 RNA transcripts were determined by PCR. Notably, PMO alone (without the saponin component) did not induce any abnormal Sod1 transcripts, even at the highest concentration (50 μM PMO; Figure 4). However, notably, co-administration of PMO + 3 μM saponin component (SO1861-SC-Mal) resulted in a significant increase of up to 90% in abnormal Sod1 transcripts at 50,000 nM (Figure 4). Similar results in inducing large amounts of abnormal Sod1 transcripts were obtained by co-administration of the saponin component with a second PMO (SEQ ID NO: 23) designed to bind to different regions on Sod1 mRNA and induce the same effect (data not shown). This suggests that such co-administration of PMO and the saponin component enhances the delivery of PMO in neuronal cells, beneficially inducing abnormal transcripts of disease-related genes, thereby reducing the expression of mutant and pathogenic genes in neuronal cells, and in this example, leading to the prevention or treatment of ALS by nucleic acid therapy.

[0239] Example 5: Enhanced efficacy by simultaneous administration of saponin components using different antisense oligonucleotides with different mechanisms of action that target the disease-related STAT3 gene. Abnormal activation of the transcription factor gene STAT3 is associated with Alzheimer's disease (AD). Therefore, phosphorylation of STAT3 dramatically increases in the hippocampus of AD mouse models and in postmortem AD brains. Furthermore, STAT3 may act as a transcription factor for BACE1, a key enzyme in amyloid-beta (Aβ) production. Similarly, the STAT protein is activated by phosphorylation in the spinal cord of patients with amyotrophic lateral sclerosis (Ohgomori et al, Differential activation of neuronal and glial STAT3 in the spinal cord of SOD1G93A mouse model of amyotrophic lateral sclerosis, EJN, Volume 46, Issue 4, August 2017, Pages 2001-2014). STAT3 is also a biologically relevant therapeutic target in H3K27M mutant diffuse median glioma (Zhang et al., STAT3 is a biologically relevant therapeutic target in H3K27M mutant diffuse median glioma, Neuro Oncol, 2022, Oct 3;24(10):1700-1711.doi:10.1093 / neuonc / noac093). Antisense oligonucleotides targeting STAT3 are in clinical development (Hong et al., AZD9150, a Next-Generation Antisense Oligonucleotide Inhibitor of STAT3 with Early Evidence of Clinical Activity in Lymphoma and Lung Cancer, Sci Transl Med. 2015 Nov 18;7(314):314ra185.doi:10.1126 / scitranslmed.aac5272).

[0240] Here, we evaluated the co-administration-enhancing effect of saponin components containing different antisense oligonucleotides with different modes of action on the modulation of STAT3 RNA levels. First, mouse neurons were incubated with STAT3_ST6 PMO with or without the saponin component ([SEQ ID NO: 36]; Zammarchi et al., Antitumorigenic potential of STAT3 alternative splicing modulation, Proc Natl Acad Sci US A. 2011 Oct 25; 108(43): 17779-17784, Published online 2011 Oct 17. doi: 10.1073 / pnas.1108482108 (Zammarchi et al., 2011)). The resulting effects on Stat3 mRNA expression levels were determined. This STAT3_ST6 PMO has been previously shown to induce nonsense-mediated degradation of STAT3 mRNA by inducing STAT3 exon 6 skipping, effectively resulting in a reduction of STAT3 mRNA in various human cancer cell lines in vitro and in vivo. As shown in Figure 5A, in mouse neuronal cells, STAT3_ST6 PMO alone induced only a minimal reduction (4–7%) in Stat3 mRNA levels at 0.8 μM or 3.1 μM PMO. However, co-administration of STAT3_ST6 PMO + 3 μM saponin component (SO1861-SC-Mal) showed significantly improved efficacy, reducing Stat3 mRNA by as much as 56% using 3.1 μM STAT3_ST6 PMO (Figure 5A). Even with 0.8 μM PMO + 3 μM saponin component (SO1861-SC-Mal), a reduction of approximately 21% in Stat3 mRNA was still observed. This data suggests that saponin components can effectively enhance exon skipping, which skips PMOs, in order to reduce Stat3 mRNA levels in neuronal cells.

[0241] Next, both STAT3_ST6 PMO and the saponin component (SO1861-SC-Mal) were covalently conjugated to an EGFR-targeting ligand (monoclonal antibody cetuximab, Cet) to obtain Cet-SO1861-STAT3_ST6 PMO. This was then titrated within a dose range on the EGFR-expressing A431 cell line and compared to the dose range of unconjugated STAT3_ST6 PMO with or without a constant concentration of the saponin component. This confirmed that even at the highest concentration tested, STAT3_ST6 PMO alone did not show a decrease in STAT3 mRNA levels, but STAT3_ST6 PMO + 3 μM SO1861-SC-Mal showed a dose-dependent decrease in STAT3 mRNA levels in A431 cells (Figure 5B). Interestingly, the synchronization of cellular delivery of STAT3_ST6 PMO and the saponin component (SO1861-SC) in the form of a targeted conjugate Cet-SO1861-STAT3_ST6 PMO showed even greater efficacy, resulting in a dose-dependent reduction of STAT3 mRNA levels at very low concentrations of STAT3_ST6 PMO, with an IC50 of approximately 1 nM (Figure 5B). This data suggests that the saponin component acts effectively to reduce STAT3 RNA levels after conjugation and targeting of an exon-skipping PMO.

[0242] Next, the inventors evaluated the enhancement of STAT3 expression modification ASOs (antisense oligonucleotides with different modes of action, i.e., ribonuclease H-mediated RNA degradation) by different saponin components (targeted and non-targeted). For this purpose, human A431 epidermal carcinoma cells were incubated with RNA that degrades STAT3-ASO (Hong et al., 2015) and various saponin components (SO1861, SO1861-AH-maleimide-Block, or Cet-AH-SO1861). Treatment with ASO alone for 48 hours resulted in a significant decrease in STAT3 expression in A431 cells down to the remaining 32%, while co-administration of ASO + saponin component (targeted or non-targeted) showed a decrease of 11% to 18%, regardless of which saponin component was used (Figure 5C). This data demonstrates that co-administration of saponin components with RNA degradation-inducing ASOs, whether targeted or not, also yields excellent efficacy, lending credibility to the combination and use of different payload types in combination with saponin components for modulating STAT3 mRNA levels.

[0243] Furthermore, the effect of co-administration of saponin components to enhance efficacy was evaluated using splice-switching-inducing PMO, STAT3_ST2 PMO ([SEQ ID NO: 37]). This STAT3_ST2 PMO has been shown to regulate STAT3 preRNA splicing, thereby promoting the expression of STAT3β isoforms more than STAT3α isoforms, which may have beneficial therapeutic effects (Zammarchi et al., 2011). In particular, nusinersen (Spinraza) is an ASO designed to regulate alternative splicing so that the SMN2 gene can produce a full-length, functionally normal protein, as a treatment for spinal muscular atrophy (SMA), an autosomal recessive disorder caused by loss or mutation of the SMN1 gene and retention of the SMN2 gene. To evaluate the co-administration enhancing effect of saponin components on STAT3_ST2 PMO, human A431 epidermal carcinoma cells were titrated within the dose ranges of (1) STAT3_ST2 PMO with or without a saponin component, (2) Cet-STAT3_ST2 PMO with or without a saponin component (a conjugate in which STAT3_ST2 PMO is covalently conjugated to the EGFR-conjugated monoclonal antibody cetuximab), or (3) Cet-SO1861-STAT3_ST2 PMO (a conjugate in which both STAT3_ST2 PMO and a saponin component (SO1861-SC) are covalently conjugated to the EGFR-conjugated monoclonal antibody cetuximab). Since STAT3_ST2 PMO has been previously shown to induce splice switching of STAT3 mRNA from STAT3α to STAT3β (Zammarchi et al., 2011), the amount of STAT3β mRNA expression levels was determined under various treatment conditions (Figure 5D). This revealed that neither STAT3_ST2 PMO nor Cet-STAT3_ST2 PMO showed activity across the entire dose range tested when administered alone. However, co-administration of STAT3_ST2 PMO plus a saponin component showed dose-dependent efficacy and was a PMO with a clear IC50 of 1700 nM (Figure 5D).Notably, the targeted Cet-STAT3_ST2 PMO + saponin component (SO1861-SC-Mal) showed the strongest increase in efficacy with a PMO at IC50 = 0.2 nM, while one component (Cet-SO1861-STAT3_ST2 PMO; a saponin component containing both an oligonucleotide and an endocytosis cell surface receptor-targeting ligand, here a monoclonal antibody) also showed the strongest dose-dependent improvement in STAT3β mRNA expression with a PMO at IC50 = 4.0 nM (Figure 5D).

[0244] In summary, these data indicate that the enhanced effectiveness of targeting disease-related genes (in this case, STAT3) by saponin components can be achieved by different modalities (PMO, ASO) with different mechanisms of action (exon skipping resulting in RNA degradation by PMO or RNaseH-mediated RNA degradation by ASO, or by PMO-induced exon skipping resulting in a decrease in isoforms / an increase in another (beneficial) isoform), regardless of the presence or absence of cell-targeting ligands (endocytosis cell surface receptor-targeting ligands), or by conjugating PMO / ASO and / or conjugating saponin components.

[0245] Example 6: Enhanced efficacy by co-administration of saponin components with various modified AHA1 and MMP14 siRNAs in vitro. Microtubule-associated protein tau (MAPT, tau) forms neurotoxic aggregates that promote cognitive deficits in tauopathies, most commonly Alzheimer's disease (AD). AHA1 has been shown to contribute to tau fibril formation and neurotoxicity via Hsp90. This suggests that therapeutic agents targeting AHA1 may reduce toxic tau oligomers and delay or prevent the progression of neurodegenerative diseases (Shelton et al., Hsp90 activator Aha1 drives production of pathological tau aggregates, Proc Natl Acad Sci USA 2017;114(36):9707-9712). MMP-14 overexpression correlates with neurodegenerative processes in familial amyloid polyneuropathy (FAP) (Martins et al., MMP-14 overexpression correlates with neurodegenerative processes in familial amyloid polyneuropathy (Dis Model Mech)). (October 1, 2017; 10(10):1253-1260) and its upregulation are associated with glioma enlargement. In patients with Alzheimer's disease (AD), MMP-14 has been found to be overexpressed in the brain.

[0246] To evaluate the co-administration enhancement effect of saponin components on siRNA oligonucleotides in human brain cells, Neuro-2a cells were incubated with 2000 nM AHA1 siRNAs with different modifications: (1) 2'O-methyl with or without 1.3 μM saponin component (SO1861), (2) the commercially available stabilizing chemical siSTABLE (Thermo Scientific), or (3) the commercially available stabilizing chemical Accel (Thermo Scientific). 48-hour treatment in human brain cells revealed that improved siRNA stability improved the reduction in AHA1 mRNA expression. Co-administration of SO1861 significantly enhanced this effect (Figure 6A). Regardless of modification, co-administration with the saponin component SO1861 was the most effective treatment for all siRNAs.

[0247] In another example, we tested stabilized siRNA against MMP14 (this time using 2'-fluoro modification). We examined the efficacy of the siRNA and the co-administration enhancement effect of a saponin component (SO1861) in human brain cells. Treatment with 2000 nM siRNA alone did not show efficacy, but co-administration with a saponin component improved the efficacy of the stabilized siRNA (Figure 6B). This data suggests that the efficacy of (stabilized) siRNA can also be enhanced by a saponin component.

[0248] Example 7: Enhancement of efficacy of targeted siRNA (GN3-siTTR) by in vivo co-administration of targeted saponin component: Tolerability, efficacy, and durability of the effect. Transthyretin (TTR) protein is a relevant pathological factor in familial amyloid polyneuropathy (FAP), a neurodegenerative disorder characterized by misfolding and deposition of mutant transthyretin (TTR) in the peripheral nervous system (PNS). Hereditary transthyretin amyloidosis (ATTRv amyloidosis; v: mutant) is a genetic disorder caused by the accumulation of misfolded transthyretin protein in different organs. CNS symptom development appears to be particularly common in patients with the V30M mutation and long-term disease. TTR and its production by the choroid plexus (in the four ventricles of the brain) evade the therapeutic effects of liver transplants that do not cross the blood-brain barrier, as well as other approved disease-modifying therapies and TTR-targeted therapies. This allows for continuous accumulation of amyloid in the CNS throughout the disease. Effectively targeting or repairing mutant TTR in the CNS may be therapeutically beneficial.

[0249] In vivo research design Male C57BL / 6 mice were assigned to the drug treatment group (vehicle n=3, GN3-siTTR The test compound was administered to n=6 mice at various timing combinations of GN3-siTTR (also known as trimer GalNAc-siRNA targeting mouse Ttr, all n=6) and the target saponin component (here, GN3-SC-SO1861, also known as trimer GalNAc-SC-SO1861) (GN3-siTTR was always 0.3 mg / kg, and GN3-SC-SO1861 was always 1 mg / kg). See Table A4 for the administration groups. Blood samples were generally collected on days 4, 3, 7, 10, 14, 17, 21, 24, 28, 31, 35, and 49, unless otherwise indicated in Table A4. After blood collection, serum was prepared and dispensed into two tubes. One aliquot was used for serum TTR protein analysis, and the other aliquot was used for serum ALT enzyme analysis. Mice were sacrificed on day 49.

[0250] Bioanalysis of TTR protein To evaluate the efficacy of the treatment, serum samples were analyzed for TTR protein content using the ALPCO Mouse Prealbumin ELISA® Kit (#41-PALMS-E01, ALPCO) according to the manufacturer's instructions.

[0251] clinical chemistry To assess tolerability, ALT protein, acting as a reporter of hepatic tolerability, was evaluated in serum samples using a Roche COBAS 6000 analyzer.

[0252] [Table 14]

[0253] result The efficacy and in vivo tolerance of targeted siRNA (GN3-siTTR) are significantly improved by co-administration of a targeted saponin component (GN3-SC-SO1861), particularly when it is added with a delay and subsequently, independently of the administration schedule. Trivalent GalNAc is a targeting ligand that recognizes and binds to the endocytosis ASGPR1 receptor and was produced as previously described. Trivalent GalNAc was conjugated to trivalent GalNAc with DAR=1 by conjugating SO1861-SC-N3 (in the same manner as described in Figures 7 and 8) to obtain trivalent GalNAc-SC-SO1861, also known as (GalNAc)3-SC-SO1861 or GN3-SC-SO1861. Trivalent GalNAc-siRNA targeting mouse Ttr (also known as GN3-siTTR [SEQ ID NO: 1]) was custom produced (Figure 10).

[0254] All mice, with the exception of three control mice injected with a vehicle (PBS) only on day 0, received an intravenous (IV) injection of 0.3 mg / kg of targeted siRNA (GN3-siTTR) on day 0. Subsequently, all GN3-siTTR-administered mice, with the exception of one benchmark group of six animals, were further administered the targeted saponin component GN3-SC-SO1861 at a dose of 1 mg / kg on either day 0, day 7, or day 28. Serum samples were collected at different time points before and after administration to assess the effect of GN3-siTTR on serum TTR protein levels (Table A4). As expected, as shown in Figures 9A, 9B, and 9C, the vehicle-administered mice (n=3, day 0) showed consistently high levels of TTR protein in their serum throughout the study (i.e., days -4, 14, 28, and 49). Mice administered only with GN3-siTTR (n=6, day 0; 0.3 mg / kg) without the saponin component showed a maximum 80% TTR knockdown effect approximately 7–14 days after treatment with GN3-siTTR, with TTR protein levels returning to baseline levels (i.e., levels measured before administration and levels comparable to vehicle-treated mice) on day 49. In contrast, surprisingly, mice administered with a combination of GN3-siTTR (day 0; 0.3 mg / kg) and the saponin component GN3-SC-SO1861 (day 0; 1 mg / kg), especially compared to mice treated with vehicle and GN3-siTTR alone, achieved a much larger reduction (>95%) as early as day 3, the earliest day for serum TTR protein assessment (Figure 9A). Remarkably, mice that received GN3-siTTR on day 0, followed by a dose of a targeted saponin component at either day 7 (Figure 9B) or day 28 (Figure 9D), showed nearly complete TTR protein knockdown (>95%) within 3–7 days after saponin treatment. Furthermore, there was no loss of persistence of effect regardless of whether the targeted saponin component was administered (relative to the timing of GN3-siTTR administration): saponin components administered at either day 7 or day 28 after the initial targeted siRNA()GN3-siTTR administration resulted in up to an 80% reduction in TTR serum levels in either of these regimens at the end of the study on day 49 (Figures 9B, 9C).All of these co-treatment regimens were similarly well-tolerated, and generally, no saponin component-induced increase in ALT enzyme levels was observed. The absence of this increased level was observed to act as a substitute for hepatic tolerance. Taken together, these data indicate that co-administration of the targeted saponin component to the targeted siRNA (GN3-siTTR) significantly increases the efficacy, as measured in this example as protein reduction, compared to treatment with the same dose of GN3-siTTR alone. A near-complete reduction (>95%) of TTR protein expression with 0.3 mg / kg of GN3-siTTR was only achieved after co-administration with the targeted saponin component GN3-SC-SO1861, regardless of the time of saponin component administration, i.e., either on day 7 or day 28 throughout the study. In summary, these results confirm that the saponin component can mediate the efficient release of siRNA from the endosomal (depot) compartment for at least 28 days after the initial administration of the targeted siRNA compound. Furthermore, no loss of efficacy durability was observed. Notably, in all cases where the treatment was sequential (i.e., GN3-siTTR on day 0 and saponin component addition at 7 or 28 days), TTR levels decreased by 80% on day 49 after the initial GN3-siTTR treatment. In summary, the saponin component not only enhanced the potency of 0.3 mg / kg dose GN3-siTTR, but the time-delayed saponin-induced release significantly extended the duration of efficacy.

[0255] Example 8: Enhancement of in vivo efficacy of (targeted)-ASO / PMO compounds by local co-administration of saponin components in the brain / CNS. The pathophysiology of Parkinson's disease and CNS disorders such as familial amyotrophic lateral sclerosis (ALS) are associated with (mutated) the MALAT1 and SOD1 genes, and are therefore recognized as potential therapeutic targets for downmodulation. Topical co-administration of saponin components significantly enhances the efficacy of Malat1-targeted ASOs and reduces Malat1 expression levels in several (larger) brain regions of mice (Figure 1). To further indicate which specific brain regions exhibit significant enhancement, Malat1 gene expression was studied in more detail in (structurally and functionally) defined brain regions (Table A8). Furthermore, to analyze the effects of saponin components on different payload types in the brain / CNS, the effects of saponins on Sod1-targeted PMOs were also studied, and the efficacy and tolerability were compared between naked (unconjugated) ASO / PMOs and ligand-conjugated ASO / PMOs with and without co-administration of saponin components. Finally, we investigated the effects of a single-component approach in vivo, including the Malat1 ASO-saponin conjugate, in which ASO is directly (covalently) conjugated to a saponin component, which showed improved activity in vitro in a neuronal cell model (Figure 3).

[0256] [Table 15]

[0257] Figures 11 and 12 show the relative Malat1 mRNA expression in different brain regions for each treatment group, regardless of the presence or absence of the saponin component, compared to the vehicle-treated group. A significant decrease in CNS Malat1 mRNA expression was observed in almost all brain regions 10 days after unilateral ICV administration of Malat1 ASO combined with saponin (Group B), which was comparable to the effect in Study 1 (Figure 1) and confirmed the initial findings. A significant decrease in CNS Malat1 mRNA expression was also observed in almost all brain regions (Groups D and E) for the single-component Malat1 ASO-saponin conjugate, and as expected, higher doses were potenter than lower doses, confirming a specific (dose-dependent) effect. The efficacy of high-dose directly conjugated Malat1 ASO-saponin was comparable to the simultaneous administration of Malat1 ASO + saponin components in most brain regions. The potency of targeted ligand-conjugated ASOs (i.e., aCD71-Malat1 ASO conjugated treatment group, F+G) was not improved compared to unconjugated ASOs when co-administered with a saponin component. While the addition of a saponin component was necessary to counteract the high potency of either aCD71-Malat1 ASO or unconjugated ASO in almost all brain regions, ligand targeting did not significantly increase potency in the case of this ASO with a fully phosphorothioate-treated skeleton. It can be concluded that the saponin component enhances endosomal escape of both unconjugated (naked) and ligand-targeted ASOs with a negatively charged skeleton.

[0258] Notably, remarkably comparable relative efficacy response profiles for various treatments were observed in all brain regions except the cerebellum (Figure 12). Absolute responses (i.e., order of magnitude of response) showed differences, with the region closest to the injection site (right ventricle) being the most responsive. Thus, the hippocampus (right) showed up to 88% downmodulation of Malat1 with co-administration of Malat1 ASO+saponin (group B), while only 12% downmodulation was observed in the cerebellum. Interestingly, conjugated Malat1 ASO-saponin performed better in the cerebellum than co-administered Malat1 ASO+saponin or other aCD71-Malat1 ASO+saponin treatments, meaning that a greater potency increase was observed for conjugated ASO-saponin than for co-administration. This suggests that direct conjugation of the ASO and saponin components is beneficial for reaching specific brain regions, including those far from the injection site that are less exposed to CSF ​​flow.

[0259] Figures 13 and 14 show the relative Sod1 mRNA expression profiles in different brain regions for different treatment groups, with or without a saponin component, and with or without an antibody conjugate of SOD1 PMO (i.e., aCD71 targeting), compared to vehicle treatment. Importantly, downregulation of Sod1 mRNA was not observed in any of the SOD1 PMO treatment groups without a saponin component, i.e., under treatment conditions without a saponin component. However, in the presence of a saponin component containing the SOD1 PMO compound (i.e., co-administration), a clear and significant decrease in Sod1 mRNA was observed in almost all brain regions, with a maximum decrease of 22% compared to vehicle. Interestingly, unlike the aCD71-ASO conjugate, the group treated with ligand-conjugated aCD71-SOD1 PMO + saponin (group K) showed a clear increase in potency compared to treatment with unconjugated (naked) SOD1 PMO + saponin (group I). These results suggest that, in the case of (neutral-charged) PMO, the ligand is likely to increase PMO endosomal / cellular uptake, and since the saponin component mediates endosomal release, ligand conjugates, in combination with the saponin component, have a beneficial effect in achieving increased potency. Here again, the strongest response was observed near the injection site in the hippocampus (right), and, as expected, lower in areas farther from the injection site and CSF flow (e.g., the cerebellum and cerebral cortex (left) (Figure 14)).

[0260] In conclusion, these analyses indicate that the saponin component, either in co-administration or as a (covalent) conjugate, reveals and strongly enhances the effects of oligonucleotide treatment, e.g., ASO or (charge-neutral) PMO with a negatively charged / fully phosphorothioated skeleton in the brain / CNS. Depending on the chemical properties and characteristics of the oligonucleotide (e.g., neutral or negative skeleton charge), conjugation to a targeted ligand further improved and / or revealed potency (over unconjugated oligonucleotides). Whether directly conjugated, ligand-conjugated, or unconjugated, the saponin component increased the potency of the oligonucleotide.

[0261] Example 9: Enhancement of the efficacy of covalently conjugated ASO-saponins in neuronal cells. Direct (covalent) conjugation of saponin components with ASO (i.e., ASO-saponin conjugate) improves ASO efficacy in neurons by synchronizing the delivery of ASO and saponin to the same intracellular compartment where saponin affects ASO release (Figure 3). Further experiments were conducted in neuronal cells to further evaluate and enhance the improvement of ASO efficacy by conjugating saponin components to oligonucleotides, such as ASO. For this purpose, unconjugated (naked) ASO was first administered co-administered with a low (400 nM) dose of saponin (1), which is of the same type and in a similar amount as the ASO-saponin conjugate. This co-administration was compared with treatment with the ASO-saponin conjugate or ASO alone (Figure 15A). Cell viability was not affected by either of the applied treatments (data not shown). Notably, as previously shown, gene expression analysis completely suppresses target gene expression levels only for covalent conjugates at 2000 nM, confirming that covalent conjugates of saponins to ASO (i.e., ASO-saponin conjugates) significantly improve potency compared to saponins administered as ASO alone or co-administered (low-dose) with ASO. To confirm the benefit of the conjugates, cells were also treated with unconjugated ASO and saponin components (ASO + titration saponin (1)), both of which were titrated at the same compound ratio as the ASO-saponin conjugate at each data point on the curve (Figure 15B). This confirmed that, when compared at equal concentrations, conjugated ASO-saponin is indeed potent compared to unconjugated ASO + titration saponin (1). In summary, this data demonstrates that the synchronization of ASO and saponin cell delivery via a covalent conjugate results in improved efficacy in neuronal cell lines compared to ASO alone, but compared to ASO administered co-administered with a saponin.

[0262] Example 10: Enhancement of the efficacy of (targeted)-ASO by co-administration of saponin components in nerve cells. Neuronal 2a cells were treated with Malat1 ASO containing or without a saponin component (4 μM saponin(1) or saponin(2)). Gene expression analysis revealed that unconjugated ASO (without saponin component) resulted in up to a 50% reduction in Malat1 transcripts at 2000 nM ASO (Figure 16A). However, when ASO was administered co-administered with saponin(1), the efficacy increased dramatically by approximately 2000-fold, reaching a 50% transcript reduction with only about 1 nM ASO (Figure 16A). In a second example, unconjugated ASO (without saponin component) resulted in up to a 50% reduction in Malat1 transcripts with approximately 100 nM ASO (Figure 16B), while co-administered ASO with saponin(2) increased the efficacy by approximately 1000-fold, resulting in a 50% transcript reduction with only 0.1 nM ASO (Figure 16B). Both examples demonstrate a clear and potent increase in potency for co-administration of ASO with saponin components.

[0263] To evaluate whether the saponin component enhances the potency of targeted ASOs in the nervous system, Malat1 ASO was conjugated to a CD71-targeted mAb to obtain aCD71-Malat1 ASO. Neuronal 2a cells were treated with this targeted ASO in and out of the presence of the saponin component (4 μM saponin(2)). Interestingly, treatment with only about 10 nM of targeted ASO induced a 50% reduction in Malat1 transcripts (Figure 16C), but the targeted ASO (aCD71-Malat1 ASO) + saponin(2) yielded even higher potency, with only 0.01 nM of ASO (absolute concentration in the conjugate) being sufficient to induce a 50% reduction in Malat1 transcripts. These results suggest that ligand conjugates of ASOs (i.e., endosomal targeting) increase their potency, but that the potency enhancement is at least 1000-fold only when ASOs (targeted or untargeted) are combined with saponin components.

[0264] Example 11: Enhancement of the efficacy of PMO conjugates by saponin components in nerve cells. In Example 4, the inventors demonstrated that treatment of mouse neurons with Sod1-targeted PMO combined with a saponin component significantly enhanced the efficacy of PMO compared to treatment with PMO alone (see Example 4). To confirm and expand upon these findings, the complete efficacy of the treatment was determined by determining the amount of abnormal transcripts and residual full-length transcripts, i.e., the effect of PMO on inducing exon skipping or abnormal transcripts and nonsense-mediated mRNA decay. For this purpose, neuronal cells were treated with Sod1 PMO combined with a saponin component. This treatment induced an increase of up to 47% in abnormal transcripts (Figure 17). When determining the amount of residual full-length Sod1 transcripts after treatment, it was confirmed that PMO could not reduce transcripts in the absence of the saponin component. However, in the presence of the saponin component, a 70% reduction in Sod1 transcripts was observed with 1600 nM PMO (Figure 17B). These results indicate that PMO is highly active and induces nonsense-mediated mRNA, but this high on-target activity and potency are only revealed in the presence of saponins.

[0265] To evaluate the effect of ligand-mediated uptake (to increase endosomal PMO content), PMO was conjugated to a CD71-targeted mAb to obtain aCD71-SOD1 PMO. Neurons were treated with aCD71-SOD1 PMO (compound 2) in the presence and absence of a saponin component to evaluate how the saponin component enhanced the activity of targeted aCD71-SOD1 PMO compared to non-targeted PMO. After treatment, neither non-targeted PMO nor targeted aCD71-SOD1 PMO showed activity at any of the concentrations tested (i.e., there was no abnormal transcript induction (Figure 17C) and no nonsense mutation-dependent mRNA degradation mechanism (Figure 17D)). However, when the targeted aCD71-SOD1 PMO was administered co-administered with the saponin component, a surprising effect was observed: abnormal transcripts were detected even in the presence of saponin at 0.18 nM aCD71-SOD1 (corresponding to 0.26 nM PMO), and this increased abnormal transcripts by up to 66% at 114 nM aCD71-SOD1 (corresponding to 160 nM PMO) (Figure 17C). When determining the amount of full-length Sod1 transcripts remaining after cell treatment with the conjugate and co-administration of the saponin compound, as little as 0.18 nM aCD71-SOD1 (corresponding to 0.26 nM PMO) was sufficient to reduce Sod1 expression, and at the maximum concentration tested (114 nM aCD71-SOD1, corresponding to 160 nM PMO), a reduction of over 80% of Sod1 transcripts was measured (Figure 17D).

[0266] As the next step, the saponin component is conjugated to the target aCD71-SOD1 PMO at either a high or low conjugate ratio, and respectively aCD71-(saponin-SOD1 PMO) 高 and aCD71-(saponin-SOD1 PMO) 低Two different one-component conjugates were produced that result in targeted (and thus endosome-enriched) and synchronous delivery of the saponin component and payload to the same cellular compartment. Neuronal cells were treated with these one-component conjugates as well as aCD71-SOD1 PMO (without saponin compound), and aberrant transcripts were quantified (Figure 17E). The data show that aCD71-(saponin-SOD1 PMO) 低 and aCD71-(saponin-SOD1 PMO) 高 induce aberrant transcripts (already starting at conjugate exposure concentrations of 267 nM and 23 nM, respectively). At the highest concentration tested, aCD71-(saponin-SOD1 PMO) 低 achieved 64% aberrant transcripts, aCD71-(saponin-SOD1 PMO) 高 achieved 23% aberrant transcripts, while aCD71-SOD1 PMO (without saponin) did not affect the Sod1 transcript at any of the concentrations tested (Figure 17E). When determining the efficacy of such conjugates to reduce the Sod1 transcript (i.e., the step of measuring the remaining full-length Sod1 transcript), both aCD71-(saponin-SOD1 PMO) 低 and aCD71-(saponin-SOD1 PMO) 高 were very effective in reducing the full-length Sod1 RNA, while aCD71-SOD1 PMO (without saponin) again had no effect. A decrease could be measured starting from the 23 nM aCD71-(saponin-SOD1 PMO) 高 conjugate, which increased to a 47% decrease in the Sod1 transcript at 571 nM conjugate (Figure 17F). The aCD71-(saponin-SOD1 PMO) 低 value showed a maximum 83% decrease in the Sod1 transcript at 1333 nM conjugate. These data show that the conjugate with the saponin component enables obtaining the effect of the PMO on aberrant transcript induction and reduction of the full-length Sod1 transcript.

[0267] Materials and Methods Abbreviation Ab antibody AH Acylhydrazone bond AEM N-(2-aminoethyl)maleimide trifluoroacetate salt AMPD 2-amino-2-methyl-1,3-propanediol BOP (benzotriazole-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate Cet cetuximab d2 Divalent Dendron (Generation 2) DAR (Drug-to-Antibody Ratio) DBCO (Dibenzocyclooctin) DCM Dichloromethane DIPEA N,N-diisopropylethylamine DMF (N,N-dimethylformamide) DMSO (Dimethyl Sulfoxide) DTT (Dithiothreitol) EDCI.HCl 3-((ethylimino)methyleneamino)-N,N-dimethylpropane-1-aminium chloride EDTA (Ethylenediaminetetraacetic acid) EMCH.TFA N-(ε-maleimidocaproic acid)hydrazide, trifluoroacetate GalT β-1,4-galactosyltransferase Y289L HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate IPA Isopropyl Alcohol Mal Maleimide min mTz methyltetrazine MWCO Molecular Weight Cutoff NEM (N-ethylmaleimide) NHS N-hydroxysuccinimide NMM 4-methylmorpholine PEG poly(ethylene glycol) PEG4-SPDP(2-pyridyldithio)-PEG4-NHS ester PDT Pyridine-3-thiol RPM (Revolutions per minute) rt retention time SC semicarbazone bond SH Thiol SMCC succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate TBS Tris buffered saline solution TCO Transcyclooctene TCEP Tris(2-carboxyethyl)phosphine hydrochloride Temp Temperature TFA (Trifluoroacetic Acid) TFL Trifunctional Linker THF (Tetrahydrofuran) THPP Tris(3-hydroxypropyl)phosphine UDP-GalNAz Uridine diphosphato-N-azidoacetylgalactosamine disodium

[0268] [Table 16]

[0269] [Table 17]

[0270] [Table 18]

[0271] SO1861 was isolated and purified from a live plant extract obtained from Saponaria officinalis L using either Analyticon Discovery GmbH, Germany or Extrasynthese, France.

[0272] Analysis method LC-MS method 1 Apparatus: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range depends on the molecular weight of the product: Neg or neg / pos within the range of 1500-2400 or 2000-3000; ELSD: Gas pressure 40 psi, drift tube temperature: 50°C; Column: Acquity C18, 50 × 2.1 mm, 1.7 μm, temperature: 60°C, flow rate: 0.6 mL / min, linear gradient depends on the polarity of the product: A t0 = 2%A, t 5.0分 =50%A, t 6.0分 =98%A B t0 = 2%A, t 5.0分 =98%A, t 6.0分 =98%A Post-processing time: 1.0 minute, Eluent A: Acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0273] LC-MS method 2 Apparatus: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range depends on product molecular weight: pos / neg 100~800 or neg 2000~3000; ELSD: gas pressure 40 psi, drift tube temperature: 50℃; Column: Waters XSelect(trademark) CSH C18, 50×2.1mm, 2.5μm, temperature: 25℃, flow rate: 0.5 mL / min, gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, Post-time: 0.3 min, Eluent A: Acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0274] LC-MS method 3 Apparatus: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range depends on product molecular weight pos / neg 10⁵~800, 500~1200 or 1500~2500; ELSD: gas pressure 40 psi, drift tube temperature: 50°C; Column: Waters XSelect™ CSH C18, 50 × 2.1 mm, 2.5 μm, temperature: 40°C, flow rate: 0.5 mL / min, gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, Post-time: 0.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.

[0275] LC-MS method 4 Instrument: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range depends on product molecular weight: pos / neg 100~800 or neg 2000~3000; ELSD: gas pressure 40 psi, drift tube temperature: 50℃; Column: Waters Acquity Shield RP18, 50×2.1mm, 1.7μm, temperature: 25℃, flow rate: 0.5 mL / min, gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, Post-time: 0.3 min, Eluent A: Acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0276] LC-MS method 5 Apparatus: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range depends on product molecular weight: neg / pos in the range of 1500-2700; ELSD: gas pressure 40 psi, drift tube temperature: 50℃; Column: Acquity Premier Peptide BEH C18, 50×2.1mm, 1.7μm, temperature: 25℃, flow rate: 0.45 mL / min, gradient according to product polarity: A t0 = 2%B, t 4.0分 =50%B,t 5.0分 =98%B,t 6.0分 =98%B B t0 = 5%B, t 6.0分 =98%B,t 6.0分 =98%B Post-processing time: 1.0 minute, Eluent A: 10 mM ammonium bicarbonate in water (pH=9.5), Eluent B: Acetonitrile.

[0277] LC-MS method 6 Equipment: Agilent 1260 Infinity II, 1260 G7112B binary pump, 1260 G7167A multisampler, 1260MCT G7116A column compartment, 1260 G7115A DAD (210, 220 and 210-320nm), PDA (210-320nm), G6130B MSD (ESI pos / neg) mass range 90-1500, Column: XSelect CSH C18 (30×2.1mm 3.5μm), Flow rate: 1mL / min, Column temperature: 25℃, Eluent A: 10mM ammonium bicarbonate in water (pH 9.5); Eluent B: Acetonitrile, Gradient: t0 min = 5%B, t1.6 min = 98%B, t3 min = 98%B, Postrun: 1.2 min

[0278] LC-MS method 7 Instrument: Waters I-Class UPLC, binary solvent manager (BSM), sample manager FTN (SM-FTN) and sample organizer (SO), column manager (CM-A), PDA 210~320nm, SQD2ESI, mass range depending on product molecular weight: pos / neg within the range of 400~1600 or 1500~2500; ELSD: gas pressure 40 psi, drift tube temperature: 50℃; column: Acquity Premier peptide BEH C18, 50 × 2.1 mm, 1.7 μm, temperature: 25℃, flow rate: 0.45 mL / min, gradient: t0 = 2% B, t 4.0分 =50%B,t 6.0分 =98%B, Post-time: 1.0 min, Eluent A: 10 mM ammonium bicarbonate in water (pH=9.5), Eluent B: Acetonitrile.

[0279] Preparative separation method Preparative MP-LC method 1 Machine: Revelleris™ Preparative MPLC; Column: Waters XSelect™ CSH C18 (145 × 25 mm, 10 μm); Flow rate: 40 mL / min; Column temperature: Room temperature; Eluent A: 10 mM ammonium bicarbonate in water pH=9.0; Eluent B: 99% acetonitrile + 1% 10 mM ammonium bicarbonate in water; Gradient: A t 0分 =5%B, t 1分 =5%B, t 2分 =10%B, t 17分 = 50%B, t 18分 =100%B, t 23分 =100%B A t 0分 =5%B, t 1分 =5%B, t 2分 =20%B, t 17分 =60%B, t 18分 =100%B, t 23分 =100%B Detection UV: 210, 235, 254 nm and ELSD.

[0280] Preparative MP-LC method 2 Model: Reveleris (trademark) fractionation MPLC; Column: Phenomenex LUNA C18(3)(150×25mm, 10μm); Flow rate: 40 mL / min; Column temperature: room temperature; Eluent A: 0.1% (v / v) formic acid in water, Eluent B: 0.1% (v / v) formic acid in acetonitrile; Gradient: A t 0分 = 5%B, t 1分 = 5%B, t 2分 = 20%B, t 17分 = 60%B, t 18分 = 100%B, t 23分 = 100%B B t 0分 = 2%B, t 1分 = 2%B, t 2分 = 2%B, t 17分 = 30%B, t 18分 = 100%B, t 23分 = 100%B C t 0分 = 5%B, t 1分 = 5%B, t 2分 = 10%B, t 17分 = 50%B, t 18分 = 100%B, t 23分 = 100%B D t 0分 = 5% B, t 1分 = 5% B, t 2分 = 5% B, t 17分 = 40% B, t 18分 = 100% B, t 23分 = 100% B ; Detection UV: 210, 235, 254 nm and ELSD.

[0281] Fractionation LC-MS method 3 MS model: Agilent Technologies G6130B quadrupole; HPLC model: Agilent Technologies 1290 fractionation LC; Column: Waters XSelect (商標)CSH (C18, 150×19 mm, 10 μm); Flow rate: 25 ml / min; Column temperature: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water, pH = 9.0; Gradient: A t0 = 20% A, t 2.5分 = 20% A, t 11分 = 60% A, t 13分 = 100% A, t 17分 = 100% A B t0 = 5% A, t 2.5分 = 5% A, t 11分 = 40% A, t 13分 = 100% A, t 17分 = 100% A ; Detection: DAD (210 nm); Detection: MSD (ESI pos / neg) Mass range: 100 - 800; Fraction collection based on DAD.

[0282] Preparative LC - MS method 4 MS model: Agilent Technologies G6130B quadrupole; HPLC model: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150×19 mm, 10 μm); Flow rate: 25 ml / min; Column temperature: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water, pH = 9.0; Gradient: A t0 = 2% A, t 2.5分 = 2% A, t 11分 = 30% A, t 13分 = 100% A, t 17分 = 100% A B t0 = 10% A, t 2.5分 = 10% A, t 11分 = 50% A, t 13分 = 100% A, t 17分 = 100% A C t0 = 5% A, t 2.5分 = 5% A, t 11分 = 40% A, t 13分 = 100% A, t 17分 = 100% A Detection: DAD (210nm); Detection: MSD (ESI pos / neg) Mass range: 100~800; Fraction collection based on DAD

[0283] Flash chromatography Grace Reveleris X2(registered trademark) C-815 Flash; Solvent delivery system: Self-priming 3-piston pump, 4 independent channels containing up to 4 solvents in a single run, automatic switching line when solvent runs out; Maximum pump flow rate 250 mL / min; Maximum pressure 50 bar (725 psi); Detection: UV 200~400 nm, combination of up to 4 UV signals and full UV range scan, ELSD; Column size: Luer device type 4~330 g, 750 g~3000 g with optional holder attached.

[0284] UV-visible spectrophotometry Antibody concentrations, as well as sulfo-Cy5 concentrations and uptake, were determined using a Thermo Nanodrop 2000 spectrometer. Antibody concentrations in the conjugate were determined by a BCA assay. The BCA assay was performed using a Thermo SkanIT plate reader. Ellmans(TNB)ε412=14,150M-1cm-1 Cetuximab ε280 = 1.4 (mg / ml) - 1 cm - 1 Cetuximab-SO1861; Mass ε280 = 1.4 (mg / ml) - 1 cm⁻¹ STAT3-ST2; Molar EC260 = 201,445 M-1 cm-1; Rz 260:280 = 1.816 STAT3_ST6; Molar EC260 = 183,491 M-1 cm-1; Rz 260:280 = 1.653 PDT; molar EC343 = 8,080 M-1 cm-1.

[0285] SEC Native antibodies and conjugates were analyzed by SEC using an Akta purifier 100 system eluting with DPBS and a Biosep SEC-s3000 column:IPA(85:15). Purity % was determined by integrating the antibody peak against trace agglutination peaks.

[0286] SDS-PAGE and Western Blotting Undenatured antibodies and conjugates were analyzed on a protein ladder using 4-12% bis-tris gel and MOPS as running buffer by SDS-PAGE under both non-denaturing and reducing conditions (200V, 40 min). Samples containing LDS sample buffer and MOPS running buffer as diluents were prepared to 0.5 mg / mL. For reduced samples, DTT was added to achieve a final concentration of 50 mM. The samples were heat-treated at 90-95°C for 2 minutes, and 5 μg (10 μl) was added to each well. Protein ladders (10 μl) were loaded without pretreatment. Empty rows were filled with 1× LDS sample buffer (10 μl). After flowing onto the gel, it was washed three times with DI water (100 mL) while shaking (15 min, 200 rpm). Coomassie staining was performed by incubating the gel with PAGEBlue protein stain (30 mL) while shaking (60 min, 200 rpm). Excess staining solution was removed, the gel was rinsed twice with DI water (100 ml), and destained with DI water (100 ml) (60 minutes, 200 rpm). The resulting gel was imaged and processed using imageJ.

[0287] For Western blotting, washed gels (not Coomersie stained) were transferred to nitrocellulose membranes using the X-Cell blot module with the following settings (BP-BP-FP-Gel-NC-FP-BP-FP-Gel-NC-FP-BP-BP) and conditions (30V, 0.17 amperes, 60 minutes) and freshly prepared transfer buffer. BP - blotting pad; FP - filter pad; NC - nitrocellulose membrane. Subsequently, the NC was washed three times with PBS-T (100 ml), and nonspecific areas were blocked with blocking buffer (30 ml) while shaking (10 minutes, 200 rpm). Then, the gels were labeled with a combination of goat anti-human κ-HRP (1:2000) and goat anti-human IgG-HRP (1:2000) (30 ml), and diluted with blocking buffer while shaking (60 minutes, 200 rpm). Subsequently, the NC was washed with PBS-T (100 ml), and the complexed antibody was detected using a newly prepared CN / DAB substrate (25 ml) prepared with a stable peroxide substrate buffer. The color development was visually observed, and the resulting NC was photographed.

[0288] SO1861-AH-maleimide SO1861-AH-maleimide (also known as SO1861-AH-Mal or SO1861-EMCH) was prepared as previously described in International Publication No. 2021 / 259507A1 (page 72, Example 3, referred to as "SO1861-EMCH Synthesis"). SO1861 (121 mg, 0.065 mmol) and EMCH·TFA (110 mg, 0.325 mmol) were mixed with methanol (over-dried, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture was stirred at room temperature. After 1.5 hours, the reaction mixture was subjected to preparative MP-LC. The fractions corresponding to one product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (120 mg, 90%) as a white, cottony solid. Purity was 96% based on LC-MS. LRMS(m / z):2069[M-1]1- LC-MS rt(min): 1.084

[0289] SO1861-AH-maleimide block (a saponin molecule represented by formula (V), also known as SO1861-AH-Block) To SO1861-AH-maleimide (0.1 mg, 48 nmol), 200 μL of mercaptoethanol (18 mg, 230 μmol) was added, and the solution was shaken at 800 rpm for 1 hour at room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 hour, the solution was diluted with methanol and dialyzed broadly with methanol for 4 hours using a regenerated cellulose membrane tube (Spectra / Por 7) containing 1 kDa MWCO. After dialyzing, SO1861-Ald-EMCH-mercaptoethanol (saponin molecule according to formula (V)) was provided, and aliquots were taken and analyzed by MALDI-TOF-MS. (RP mode): m / z 2193Da([M+K]+,SO1861-AH-Block),m / z 2185Da([M+K]+,SO1861-AH-Block),m / z 2170Da([M+Na]+,SO1861-AH-Block).

[0290] SO1861-SC-maleimide synthesis SO1861-SC-maleimide (also known as SO1861-SC-Mal) was manufactured as previously described in International Publication No. 2023 / 038517A1 (page 168, lines 1-13 of Example 1, referred to as "SO1861-SC-Mal").

[0291] tert-butyl 2-(4-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrole-1-yl)hexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate (25.0 mg, 57.1 μmol) was dissolved in a mixture of dichloromethane (500 μL) and TFA (500 μL), and the reaction mixture was stirred at room temperature. After 30 minutes, reaction mixture 35 was evaporated under vacuum and co-evaporated with dichloromethane (3 × 5 mL) and methanol (5 mL). The residue and SO1861 (21.3 mg, 11.4 μmol) were dissolved in methanol (extra dry, 1.00 mL), and the resulting mixture was shaken for 1 minute and allowed to stand at room temperature. After 4 hours, the reaction mixture was subjected to preparative MP-LC2. The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (13.7 mg, 55%) as a white, cottony solid. Purity was 97% based on LC-MS. LRMS(m / z):2181[M-1]1- LC-MS rt(min): 2.133

[0292] Cetuximab-SC-SO1861 Aliquots of cetuximab (305 mg, 5.0 mg / ml, 61 ml) were modified with Tris / Tris. HCl / EDTA concentrate (30 μl / ml, 1830 μl). To cetuximab (305 mg, 2.03 × 10⁻³ mmol, 4.871 mg / ml), an aliquot of freshly prepared TCEP (2.77 equivalents, 5.63 × 10⁻³ mmol, 1.61 mg, 1.61 ml) prepared with TBS pH 7.5 (1 mg / ml) was added while gently swirling. The mixture was incubated at 20°C for 210 minutes with roller mixing. After incubation, an aliquot of the reaction mixture (0.211 ml) was removed and purified using a Zeba 7K spin desalting column eluted with TBS pH 7.5. Ab-SH was analyzed by UV-vis spectrophotometry and Ellman assay (3.321 mg / ml, thiol-to-cetuximab ratio = 4.2). To the bulk reaction product, aliquots of freshly prepared SO1861-SC-Mal (8 molar equivalents, 16.2 × 10⁻³ mmol, 35.4 mg, 17.70 ml) prepared in TBS pH 7.5 (2 mg / ml) were added while gently swirling, the mixture was briefly vortexed, and then incubated at 20°C for 120 minutes. In addition to the conjugate reaction, two aliquots of desalted Ab-SH (0.25 mg, 0.075 ml, 1.67 × 10⁻⁶ mmol) were reacted with either NEM (8.00 equivalents, 1.34 × 10⁻⁵ mmol, 6.7 μl of 0.25 mg / ml solution) or TBS pH 7.5 buffer (6.7 μl) at 20°C for 120 minutes, respectively, as a positive and negative control. After incubation, approximately 1.0 mg aliquot (0.270 ml) of the Ab-SO1861 mixture was removed and purified by gel filtration to TBS pH 7.5 using a Zeba 7K spin desalting column. The mixture, along with the positive and negative controls, was then characterized by Ellman's assay to obtain SO1861 uptake. After the reaction, the bulk Ab-SO1861 mixture was quenched by adding an aliquot of freshly prepared NEM solution (5 molar equivalents, 10.1 × 10⁻³ mmol, 507 μl of 2.5 mg / ml solution). The quenched reaction mixture was stored overnight at 2–8°C.The bulk was divided into multiple aliquots, and the conjugate was purified by running multiple times (a total of four times) using a disinfected 2.6 × 40 cm Superdex 200 column eluted with DPBS pH 7.5. The purified Ab-SO1861 aliquots were combined, filtered to 0.2 μm under laminar flow, and analyzed by UV-vis spectrophotometric analysis. The aliquots were concentrated to >2.5 mg / ml using a vivacell 100 centrifuge filter, then normalized to 2.5 mg / ml, and dispensed into aliquots for product testing, characterization, and further conjugate work. The result was cetuximab-SC-SO1861 conjugate. Total yield = 289 mg, 95%, purity: Ab ratio 99%, SO1861 = 4.1.

[0293] Cetuximab-SS-STAT3-ST2_PMO (also known as "Cet-STAT3_ST2 PMO") To an aliquot of cetuximab (127.5 mg, 8.50 × 10⁻⁴ mmol, 2.5 mg / ml) that had been pre-buffered with DPBS pH 7.5, an aliquot of freshly prepared PEG4-SPDP solution (10 mg / ml, 10.1 molar equivalents, 8.59 × 10⁻³ mmol, 0.480 ml) was added. The mixture was briefly vortexed, and then incubated at 20°C for 60 minutes with roller mixing. After incubation, the reaction was stopped by adding an aliquot of freshly prepared glycine solution (50 mg / ml, 50 molar equivalents, 4.29 × 10⁻² mmol, 64 μl). The mixture was briefly vortexed, and then incubated at 20°C for >15 minutes with roller mixing. The conjugate was purified using a disinfected 5 × 50 cm Superdex 200PG column eluted with TBS pH 7.5, and analyzed by UV-vis to obtain purified Cet-SPDP (133.9 mg, 105%, 1.34 mg / ml, SPDP to Ab ratio = 3.6). Ab-SPDP was used immediately.

[0294] Separately, STAT3-ST2_PMO-SS-amide (104.9 mg, 1.30 × 10⁻² mmol, 10.00 mg / ml) was reconstituted using TBS pH 7.5 and pooled into a single aliquot. A freshly prepared aliquot of THPP solution (50 mg / ml, 10 molar equivalents, 13.0 × 10⁻² mmol, 292 μl) was added to this, and the mixture was vortexed briefly and then incubated at 37°C for 60 minutes with roller mixing. After incubation, PMO was purified across multiple PD10 Sephadex G25M columns eluting TBS pH 7.5 to obtain PMO-SH. Total yield = 93.0 mg, 89%, thiol-to-PMO ratio = 0.88.

[0295] Aliquotes of Ab-SPDP (120.5 mg, 8.04 × 10⁻⁴ mmol, 1.34 mg / ml) were mixed with aliquots of PMO-SH (3.63 mg / ml, 7.0 molar equivalents, 5.63 × 10⁻³ mmol, 12.51 ml). The mixture was briefly vortexed, and then incubated overnight at 20°C with roller mixing. After approximately 16 hours, the conjugate mixture was analyzed by UV-vis to confirm uptake by PDT substitution, and then purified using a 5 × 50 cm Superdex 200PG column eluting with DPBS pH 7.5 to obtain purified Cet-SS-STAT3-ST2_PMO conjugate. The conjugate was analyzed by BCA colorimetric assay. The result was etuximab-SS-STAT3-ST2_PMO conjugate. Total yield = 69.6 mg, 55%, purity: 99%, STAT3-ST2_PMO to Cet ratio = 3.1.

[0296] Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) and cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) is also called "Cet-SO1861-STAT3_ST2 PMO". Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) is also called "Cet-SO1861-STAT3_ST6 PMO".

[0297] The following procedure is described exemplarily for cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO). Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) was synthesized using the same procedure.

[0298] To an aliquot of cetuximab-SC-SO1861 (127.5 mg, 8.50 × 10⁻⁴ mmol, 2.5 mg / ml) that had been pre-buffered with DPBS pH 7.5, an aliquot of freshly prepared PEG4-SPDP solution (10 mg / ml, 10.1 molar equivalents, 8.59 × 10⁻³ mmol, 0.480 ml) was added, the mixture was briefly vortexed, and then incubated at 20°C for 60 minutes with roller mixing. After incubation, the reaction was stopped by adding an aliquot of freshly prepared glycine solution (50 mg / ml, 50 molar equivalents, 4.29 × 10⁻² mmol, 64 μl), the mixture was briefly vortexed, and then incubated at 20°C for >15 minutes with roller mixing. The conjugate was purified using a disinfected 5 × 50 cm Superdex 200PG column eluted with TBS pH 7.5, and analyzed by UV-vis to obtain purified Cet-(SC-SO1861)-(SPDP) (133.9 mg, 105%, 1.34 mg / ml, SPDP to Ab ratio = 3.6). Ab-SPDP was used immediately.

[0299] Separately, STAT3-ST2_PMO-SS-amide (104.9 mg, 1.30 × 10⁻² mmol, 10.00 mg / ml) was reconstituted using TBS pH 7.5 and pooled into a single aliquot. To this, a freshly prepared aliquot of THPP solution (50 mg / ml, 10 molar equivalents, 13.0 × 10⁻² mmol, 292 μl) was added, the mixture was briefly vortexed, and then incubated at 37°C for 60 minutes with roller mixing. After incubation, PMO was purified across multiple PD10 Sephadex G25M columns eluting TBS pH 7.5 to obtain PMO-SH. STAT3-ST2_PMO-SH: 93.0 mg, 89%, thiol-to-PMO ratio = 0.88. STAT3-ST6_PMO-SH: 47 mg, 56%, thiol-to-PMO ratio = 0.87

[0300] Aliquotes of cetuximab-(SC-SO1861)-SPDP (120.5 mg, 8.04 × 10⁻⁴ mmol, 1.34 mg / ml) were mixed with aliquots of PMO-SH (3.63 mg / ml, 7.0 molar equivalents, 5.63 × 10⁻³ mmol, 12.51 ml). The mixture was briefly vortexed and then incubated overnight at 20°C with roller mixing. After approximately 16 hours, the conjugate mixture was analyzed by UV-vis to confirm uptake by PDT substitution, and then purified using a 5 × 50 cm Superdex 200PG column eluting with DPBS pH 7.5 to obtain purified Cet-(SC-SO1861)-(SS-STAT3-ST2_PMO) conjugate. The conjugate was analyzed by BCA colorimetric assay.

[0301] Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) Total yield: 46 mg, 39%, purity: 97% SO1861 to Cet ratio = 4.1 STAT3-ST2_PMO vs. Cet ratio = 5.1

[0302] Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) Total yield: 69 mg, 58%, purity: 96% SO1861 to Cet ratio = 4.1 STAT3-ST6_PMO vs. Cet ratio = 5.2

[0303] Cetuximab-AH-SO1861 (also known as "Cet-AH-SO1861") To a cetuximab solution (1087 mg in TBS, 4.800 mg / ml, 7.2 × 10⁻³ mmol, 2.5 mM EDTA, pH 7.5), an aliquot of freshly prepared TCEP solution (1 mg / ml, 2.72 molar equivalents, 2.0 × 10⁻² mmol, 5.65 mg) was added. The mixture was mixed by hand by swirling, and then incubated at 20°C for 210 minutes with roller mixing. After incubation (before the addition of SO1861-AH-maleimide), a 2 mg (0.417 ml) aliquot of cetuximab-SH (Ab-SH) was taken out and purified by gel filtration to TBS pH 7.5 using a zebaspine desalting column. This aliquot was characterized by UV-vis analysis and Ellman assay (3.693 mg / ml, thiol-to-Ab ratio = 4.0). To bulk Ab-SH, aliquots of freshly prepared SO1861-AH-maleimide solution (2 mg / ml, 5.2 molar equivalents, 3.8 × 10⁻² mmol, 38.9 ml) were added, the mixture was vortexed briefly, and then incubated at 20°C for 120 minutes. In addition to the conjugate reaction, two aliquots of desalted Ab-SH (0.5 mg, 0.135 ml, 3.33 × 10⁻⁶ mmol) were reacted with either NEM (8.00 equivalents, 2.66 × 10⁻⁵ mmol, 3.3 μg, 13.3 μl of 0.25 mg / ml solution) or TBS pH 7.5 buffer (13.3 μl) at 20°C for 120 minutes, as positive and negative controls, respectively. After incubation (before NEM addition), a 2 mg (0.450 ml) aliquot of the Ab-SO1861 mixture was taken and purified to TBS pH 7.5 by gel filtration using a zebaspine desalting column. This aliquot was characterized by UV-vis (3.271 mg / ml) and then by Ellman assay together with positive and negative controls to obtain SO1861 uptake. An aliquot of freshly prepared NEM solution (2.5 mg / ml, 5 molar equivalents, 3.6 × 10⁻² mmol, 4.54 mg) was added to the bulk Ab-SO1861 mixture, and the mixture was stored overnight at 2-8°C. The conjugate was purified by a 10 × 40 cm Sephadex G50M column eluting with DPBS pH 7.5 to obtain purified cetuximab-SO1861 conjugate.Aliquots were filtered to 0.2 μm and dispensed. The result was cetuximab-SO1861 conjugate. Yield = 1056 mg, 97%, SO1861 to Ab ratio = 3.9.

[0304] Malat1 ASO Antisense oligonucleotides targeting mouse (Mm)Malat1 mRNA having the sequence and modification (5'-C6-disulfide), Malat1 ASO [SEQ ID NO: 16] - [4*33 24G*9*T*G*G*T*T*A*T*G*231*3*2]; [1=2'-MOE-5Me-rU;2=2'MOE-rA,3=2'MOE-5Me-rC;4=2'MOE-rG;9=5-methyl-dC;*=phosphorothioate] were custom-synthesized by BioSpring Gesellschaft fur Biotechnologie mbH, Germany according to methods known in the art. This ASO was further modified to obtain Malat1-SS-PEG3-OH as described.

[0305] Malat1-SS-PEG3-OH Intermediate 1: 2-(2-(2-(pyridine-2-yldisulfanyl)ethoxy)ethoxy)ethane-1-ol Under an N2 atmosphere, 2,2'-dithiodipyridine (159 mg, 0.722 mmol) was dissolved in methanol (3.00 mL), and a solution of methanol (500 μL) containing 2-(2-(2-mercaptoethoxy)ethoxy)ethane-1-ol (100 mg, 0.602 mmol) was added dropwise. The reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum and co-evaporated with DCM (2 × 5 mL). The residue was purified by flash chromatography (ethyl acetate-heptane gradient, increasing from 0:100 to 100:0) to obtain the title compound (100 mg, 60%) as a colorless oil. Purity based on LC-MS 98%. LRMS (m / z): 276 [M+1] 1+ LC-MS rt(min): 1.59 6

[0306] Malat1-SS-PEG3-OH (also known as "Malat1-ASO") Malat1 (10.00 mg, 1.34 μmol) was added to a solution of 20 mM ammonium bicarbonate containing 2.5 mM TCEP (2.67 mL, 13.4 μmol). The reaction mixture was shaken for 1 minute and left at room temperature overnight. The reaction mixture was diluted with water to 10 mL, and the resulting mixture was filtered using a centrifugal filter with a molecular weight cutoff of 3000 Da (6000 × g, 30 minutes). The residue solution was diluted with water to 10 mL, and the resulting mixture was filtered using the same method as above. The residue solution was diluted with water (1.00 mL) and a solution of 2-(2-(2-(pyridine-2-yldisulfanyl)ethoxy)ethoxy)ethane-1-ol (1.47 mg, 5.35 μmol) in acetonitrile (500 μL). The resulting solutions were shaken for 1 minute and left at room temperature. After 5 hours, the reaction mixture was frozen and lyophilized overnight. The residue was subjected to preparative LC-MS. The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (7.43 mg, 74%) as a white, cottony solid. Purity based on LC-MS 91%. LRMS (m / z): 750 [M-10] 10- ,834[M-9] 9- ,938[M-8] 8- ,1072[M-7] 7- ,1251[M-6] 6- ,1501[M-5] 5- LC-MS rt(min): 1.51 7

[0307] Malat1-SC-SO1861 (also known as "Malat1-ASO-SC-SO1861") Malat1 (5.00 mg, 0.688 μmol) was added to a solution of 20 mM ammonium bicarbonate containing 2.5 mM TCEP (500 μL, 2.50 μmol). The reaction mixture was shaken for 1 minute and allowed to stand at room temperature. After 6 hours, the reaction mixture was frozen and lyophilized overnight. The residue was dissolved in a solution of 20 mM ammonium bicarbonate containing 2.5 mM TCEP (500 μL, 2.50 μmol). The reaction mixture was shaken for 1 minute and allowed to stand at room temperature. After 1 hour, the reaction mixture was poured into acetonitrile (10 mL). The resulting suspension was shaken and centrifuged (5000 RPM, 15 min). The solution was decanted and the residue was dissolved in a 20 mM ammonium bicarbonate solution (500 μL). SO1861-SC-Mal was added to this solution in different aliquots until complete conversion was observed by LC-MS. 2 A total of 8.60 mg (3.93 μmol) of SO1861-SC-Mal was added. The reaction mixture was frozen and lyophilized overnight. The residue was subjected to preparative LC-MS.B. The fractions corresponding to the product were immediately pooled together, frozen, and lyophilized overnight to obtain the title compound (3.50 mg, 55%) as a white, cottony solid. Purity was 96% based on LC-MS. LRMS (m / z): 1587 [M-6] 6- ,1905[M-5] 5- ,2380[M-4] 4- LC -MS rt(min):2.48 2

[0308] SOD1 PMO and STAT3 PMO Mouse (Mm)Sod1 (phosphodiamidate morpholino oligomer targeting SOD1 PMO [SEQ ID NO: 20]: GCCAGCCTAGGACCTACCTTGTGTA and SOD1 PMO(2) [SEQ ID NO: 23]: AGCCTATTTACCAGAAACCAGCAGT) (both of which induce nonsense-mediated decay (mRNA reduction) via exon skipping) were custom-produced by Gene Tools, LLC according to methods known in the art. A phosphorodiamidate morpholino oligomer that targets both mouse and human STAT3 mRNA by inducing exon skipping, specifically a phosphorodiamidate morpholino oligomer (STAT3_ST6 PMO [SEQ ID NO: 36]) that targets both mouse and human STAT3α mRNA by inducing an isotype splice switch from STAT3α mRNA to STAT3β, thereby effectively reducing STAT3α mRNA levels, was custom-manufactured by Gene Tools, LLC according to methods known in the art.

[0309] STAT3 ASO STAT3 antisense oligonucleotides (STAT ASO) having the following sequence and the following modification [SEQ ID NO: 8]: 3*1*2*T*T*T*G*G*A*T*G*T*0*2*4*3 (0=5-methyl-dC, 1=2'MOE-5Me-rU, 2=2'MOE-rA, 3=2'MOE-5Me-rC, 4=2'MOE-rG, *=phosphorothioate) were prepared by BioSpring Gesellschaft fur Biotechnologie GmbH, Germany according to methods known in the art.

[0310] STAT3 ASO STAT3 antisense oligonucleotides (STAT ASO) having the following sequence and the following modification [SEQ ID NO: 8]: 3*1*2*T*T*T*G*G*A*T*G*T*0*2*4*3 (0=5-methyl-dC, 1=2'MOE-5Me-rU, 2=2'MOE-rA, 3=2'MOE-5Me-rC, 4=2'MOE-rG, *=phosphorothioate) were prepared by BioSpring Gesellschaft fur Biotechnologie GmbH, Germany according to methods known in the art.

[0311] HTRA LNA Antisense oligonucleotides targeting mouse (Mm) HtramRNA, HTRA LNA [SEQ ID NO: 19] having the sequence and modification 5'-[TL]*[AL]*[TL]*T*T*A*C*C*T*G*G*T*[TL]*[GL]*[TL]*[TL]; where [TL]=LNA-T;[AL]=LNA-A;[GL]=LNA-G;*=phosphorothioate, were custom manufactured by Bio-Synthesis, Inc. according to methods known in the art.

[0312] AHA1 siRNA Several siRNAs targeting human AHA1 (siAHA1) were custom-produced by Thermo Scientific using the same oligonucleotide sequence and different chemical modifications of the backbone and sugars, according to methods known in the art: (1) 2'O-methyl: Both the sense and antisense strands are modified with 2'O-methyl (sense strand: 5'-GGAmUGAAGmUGGAGAmUmUAGmU-dT*dT-3' [SEQ ID NO: 38] and antisense strand: 5'-ACmUAAUCUCmCACUUmCAUCCdT*dT-3' [SEQ ID NO: 40]; mU = 2'-OMe-rU; mC = 2'-OMe-rC; * = phosphorothioate) (Svenson et al., 2016, Tumor Selective Silencing Using an RNAi-Conjugated Polymeric Nanopharmaceutical, Molecular Pharmaceutics) (As described in 2016;13(3):737-747.doi:10.1021 / acs.molpharmaceut.5b00608). (3) Sistable: The proprietary commercially available stabilizing chemical siSTABLE (Thermo Scientific) or (4) Accell: The proprietary commercially available stabilizing chemical Accell (Thermo Scientific).

[0313] MMP14 siRNAs siRNA targeting human MMP14 (siMMP14) is modified with 2'-fluoropolymers on the sense and antisense strands according to methods known in the art (sense strand: 5'-AA66AGAAG65GAAGG5AGAA9*9-3'[SEQ ID NO: 39]; and antisense strand: 5'-5565A66556AG65565GG559*9-3'[SEQ ID NO: 41]; 5=2'-fluoro-rU; 6=2'-fluoro-rC; 9=dT; *=phosphorothioate).

[0314] RNA analysis of brain tissue Total RNA was isolated from frozen sections of mouse brain regions using TissueLyser II (Qiagen) and TRIzol® reagent (Thermo Scientific) as homogenizers according to the manufacturer's instructions. Conversion to cDNA was performed using the iScript® cDNA synthesis kit (BioRad) following standard procedures. Mouse (Mm)Malat1 expression levels and housekeeping gene levels were determined using quantitative real-time PCR assays (qRT-PCR) with iTaq® Universal SYBR® Green Supermix (BioRad) and Light Cycler 480 II (Roche Diagnostics) with specific DNA primers, and are listed in Table A2. Each analytical reaction was performed three times. Malat1 expression was determined by the ΔCt method and compared to two specific housekeeping control mRNAs. Results are expressed as normalized % relative Malat1 expression levels relative to the vehicle control.

[0315] [Table 19]

[0316] Cell-based Malat1 silencing in Neuron 2a cells Neuro-2a (mouse neuroblastoma cells) were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS, PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). For the experiment, Neuro-2a cells were harvested, resuspended at 60,000 cells / mL, and seeded at densities of 36,000 cells / well or 6,000 cells / well in 24-well or 96-well plates (Greiner BioOne). Cells were incubated overnight at 37°C. Before processing, 210 μL or 35 μL of culture medium was added to each well, followed by the addition of a conjugate from a 10-fold concentrated stock solution in DPBS (PAN-Biotech GmbH). After incubating the plates at 37°C for 72 hours, cells from 24-well plates were harvested for gene expression analysis, and cell viability was evaluated in 96-well plates.

[0317] Cell-processing Sod1 exon skipping in Neuro-2a cells Neuro-2a (mouse neuroblastoma cells) were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS, PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). For the experiment, Neuro-2a cells were harvested, resuspended at 70,000 cells / mL, and seeded at densities of 42,000 cells / well or 7,000 cells / well in 24 or 96-well plates (Greiner BioOne). Cells were incubated overnight at 37°C. Before treatment, 120 μL or 20 μL of medium was added to each well, followed by the addition of both saponins and / or PMO from a 10-fold concentrated stock solution in DPBS (PAN-Biotech GmbH). In the control wells, or when only one compound was applied in the treatment, additional DPBS was added to a final volume of 900 μL and 150 μL per well for 24-well and 96-well plates, respectively. After incubating the plates at 37°C for 72 hours, 24 wp of cells were harvested for gene expression analysis, and cell viability was assessed in 96 wp.

[0318] Cell-treated A431 cells A431, epidermal carcinoma cells were cultured at 37°C and 5% CO2 in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). The cells were seeded at 600 μL / well or 100 μL / well in 24-resp. 96-well plates (Greiner BioOne) at 30,000 cells / well or 6,000 cells / well, and incubated overnight at 37°C. The following day, 120 μL or 20 μL of medium per well was added to the 24-resp. 96-well plates, followed by the addition of a 10-fold concentrated compound mixture sample in DPBS (PAN-Biotech GmbH). The compound, namely antisense oligonucleotide (ASO) or (targeted)-PMO and / or saponin components, was found to be present at a 10-fold final concentration. After treating the cells with the compound at 37°C for 72 hours, 24 wp of cells were harvested for expression analysis, and cell viability was evaluated at 96 wp.

[0319] Cell treatment derived from malignant glioma, U87, cells U87 cells derived from malignant glioma were cultured at 37°C and 5% CO2 in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH). The cells were seeded at 1 mL / well or 100 μL / well in 12-resp. 96-well plates (Greiner BioOne) at a density of 100,000 cells / well or 7,000 cells / well, and incubated overnight at 37°C. The following day, the 12-resp. 96-well plates were refreshed with 0.85 mL or 127.5 μL of medium per well. Next, 100 μL or 15 μL of medium containing 10x final concentration SO1861 was added per well, followed by 50 μL or 7.5 μL of a 20x concentrated siRNA compound mixture diluted in DPBS (PAN-Biotech GmbH). After treating the cells with the compound at 37°C for 48 hours, 12 wp of cells were harvested for expression analysis, and cell viability was evaluated at 96 wp.

[0320] Cell viability assay (MTS) After treating cells at 37°C for 72 hours, cell viability was determined by an MTS assay performed according to the manufacturer's instructions (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega). Briefly, the MTS solution was diluted 20-fold with phenol red-free DMEM (PAN-Biotech GmbH) supplemented with 10% FBS. The treated medium was removed, and then 100 μL of diluted MTS solution was added per well. The plates were incubated at 37°C for approximately 20-30 minutes. Subsequently, the OD at 492 nm was measured using a Spectramax iD5 plate reader (Molecular Devices). For quantification, the background signal of the "medium only" well was subtracted from all other wells, and then the cell viability of treated / untreated cells was calculated by dividing the background-corrected signal of the treated well by the background-corrected signal of the untreated well (×100).

[0321] RNA isolation from cells and quantitative gene expression analysis Total RNA from cells was isolated using TRIzol® reagent (Thermo Scientific) according to the manufacturer's instructions. Conversion to cDNA was performed using the iScript® cDNA synthesis kit (BioRad) following standard procedures. The gene expression levels of the target gene (GOI) and specific housekeeping genes were determined using quantitative real-time PCR assays (qRT-PCR) with iTaq® Universal SYBR® Green Supermix (BioRad) and Light Cycler 480 II (Roche Diagnostics) with specific DNA primers, and are listed in Table A2. Each analytical reaction was performed three times. GOI expression was determined by the ΔCt method and compared to two specific housekeeping control mRNAs. Results are expressed as normalized % relative GOI expression levels relative to DPBS-treated control cells.

[0322] RNA isolation and gel analysis from cells Total RNA from cells was isolated using TRIzol® reagent (Thermo Scientific) according to the manufacturer's instructions. Conversion to cDNA was performed using the iScript® cDNA synthesis kit (BioRad) following standard procedures. Gene expression was determined using 50 ng of cDNA with SapphireAmp Fast PCR Master Mix (Takara) using the specific DNA primers listed in Table A3. PCR products were separated on a 2% agarose gel, and fragments were analyzed using ChemiDoc XRS+ (BioRad) with Image Lab software (BioRad). For quantification of exon skipping%, the signal intensity of the aberrant transcript(s) (Mm Sod1 448 bp and 378 bp) was divided by the total signal intensity of the skipped fragment(s) + full-length fragment(s) (Mm Sod1 545 bp) × 100.

[0323] [Table 20]

[0324] SO1861-SC-azide synthesis Intermediate 1: tert-butyl 2-(4-(6-azidohexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate 6-azidohexanoic acid (603 mg, 3.84 mmol), tert-butyl 2-(piperazine-1-carbonyl)hydrazine-1-carboxylate (781 mg, 3.20 mmol), EDCI.HCl (735 mg, 3.84 mmol), and Oxyma Pure (591 mg, 4.16 mmol) were dissolved in a mixture of dichloromethane (25 mL) and DIPEA (835 μL, 4.80 mmol), and the reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum, and the residue was dissolved in ethyl acetate (50 mL). The resulting solution was washed with 0.5 N potassium bicarbonate solution (50 mL), saturated sodium bicarbonate solution (2 × 50 mL), and brine (50 mL), dried over Na₂SO₄, filtered, and evaporated under vacuum. The residue was purified by flash chromatography (DCM-DCM with a 10% methanol (v / v) gradient from 100:0 to 40:60) to obtain the title compound (864 mg, 70%) as a white solid. Purity was 96% based on LC-MS. LRMS(m / z):284 / 328 / 406[M-99 / M-55 / M+23] 1+ LC-MS rt(min): 1.13 2

[0325] Intermediate 2: 4-(6-azidohexanoyl)piperazine-1-carbohydrazide 2,2,2-trifluoroacetate 50.0 mg, 130 μmol of tert-butyl 2-(4-(6-azidohexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate was dissolved in a mixture of dichloromethane (1.00 mL) and TFA (1.00 mL), and the reaction mixture was stirred at room temperature. After 1 hour, the reaction mixture was evaporated under vacuum and co-evaporated with dichloromethane (3 × 5 mL) to obtain the crude labeled product as a white solid. LRMS (m / z): 284 / 307 [M+1 / M+23] 1+

[0326] SO1861-SC-Azido SO1861 (60 mg, 0.032 mmol) and 4-(6-azidohexanoyl)piperazine-1-carbohydrazide 2,2-trifluoroacetate (51.2 mg, 0.129 mmol) were mixed with methanol (excess dry, 1.5 mL), the reaction mixture was shaken for 1 minute, and left at room temperature. After 3 hours, the reaction mixture was subjected to preparative MP-LC. 1A The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (55.6 mg, 81%) as a white solid. Purity was 96% based on LC-MS. LRMS (m / z): 2127 [M-1] 1- LC-MS rt(min): 3.39 5A

[0327] For the formula of SO1861-SC-azide (referred to as "SO1861-SC-N3" in Figure 7), please refer to Figure 7.

[0328] Synthesis of trivalent galNAc azide Intermediate 1: tert-butyl1-azide-17,17-bis((3-(tert-butoxy)-3-oxopropoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oate Intermediate 1 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0329] Di-tert-butyl 3,3'-((2-amino-2-((3-(tert-butoxy)-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropionate (1.27 g, 2.51 mmol) was mixed with a solution of 3-azido(PEG4)propionic acid N-hydroxysuccinimide (977 mg, 2.51 mmol) in DMF (10 mL). Next, DIPEA (657 μL, 3.77 mmol) was added, and the reaction mixture was stirred overnight at room temperature. The reaction mixture was evaporated under vacuum, and the residue was dissolved in ethyl acetate (100 mL). The resulting solution was washed with 0.5 N potassium bisulfate solution (2 × 100 mL) and brine (100 mL), dried over Na₂SO₄, filtered, and evaporated under vacuum. The residue was purified by flash chromatography (DCM-DCM with a 10% methanol (v / v) gradient increasing from 100:0 to 0:100), and the title compound (1.27 g, 65%) was obtained as a colorless oil. Purity was 100% (ELSD) based on LC-MS. LRMS (m / z): 780 [M+1] 1+ LC-MS rt(min): 2.10 2

[0330] Intermediate 2: 1-Azido-17,17-bis((2-carboxyethoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-euic acid Intermediate 2 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0331] To a solution of tert-butyl 1-azide-17,17-bis((3-(tert-butoxy)-3-oxopropoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-oate (1.27 g, 1.63 mmol) in DCM (5.0 mL), TFA (5.0 mL, 65 mmol) was added. The reaction mixture was stirred at room temperature. After 1.5 hours, the reaction mixture was evaporated under vacuum and then simultaneously evaporated with toluene (3 × 10 mL) and DCM (3 × 10 mL) to obtain the crude title product as a colorless oil. LRMS (m / z): 611 [M+1] 1+

[0332] Intermediate 3: Di-tert-butyl(10-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)-10-(13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl)-5,15-dioxo-8,12-dioxa-4,16-diazanonadecane-1,19-diyl)dicarbamate Intermediate 3 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0333] 1-Azido-17,17-bis((2-carboxyethoxy)methyl)-15-oxo-3,6,9,12,19-pentaoxa-16-azadocosan-22-euic acid (997 mg, 1.63 mmol), Oxyma Pure (1.04 g, 7.35 mmol), and EDCI.HCl (1.17 g, 6.12 mmol) were dissolved in DMF (10.0 mL). Next, DIPEA (1.99 mL, 11.4 mmol) was added, and then the mixture was added directly to a solution of N-BOC-1,3-propanediamine (1.07 g, 6.12 mmol) in DMF (10.0 mL). The reaction mixture was stirred overnight at room temperature. The reaction mixture was evaporated under vacuum, and the residue was dissolved in ethyl acetate (100 mL). The obtained solution was washed with 0.5N potassium bicarbonate solution (100 mL), saturated sodium bicarbonate solution (2 × 100 mL), and brine (100 mL), dried over 2SO4, filtered, and evaporated under vacuum. The residue was purified by flash chromatography (DCM-DCM with a 10% methanol (v / v) gradient increasing from 0:100 to 100:0, maintained at 100:0 until the product eluted), and the title compound (1.16 g, 66%) was obtained as a yellowish viscous oily substance. LC-MS 99% (ELSD). LRMS (m / z): 1080 [M+1] 1+ LC-MS rt(min): 1.51 3

[0334] Intermediate 4: Synthesis of 3,3'-((2-((3-((3-aminopropyl)amino)-3-oxopropoxy)methyl)-2-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)propane-1,3-diyl)bis(oxy))bis(N-(3-aminopropyl)propanamide)tris(2,2,2-trifluoroacetate) Intermediate 4 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0335] Di-tert-butyl(10-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)-10-(13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl)-5,15-dioxo-8,12-dioxa-4,16-diazanonadecane-1,19-diyl) dicarbamate (1.16 g, 1.08 mmol) was dissolved in DCM (10 mL) and TFA (10 mL, 131 mmol) was added. The reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum and then simultaneously evaporated with toluene (3 × 10 mL) and DCM (3 × 10 mL) to obtain the crude title product as a yellowish viscous oil. LRMS (m / z): 260 [M+3] 3+ ,390[M+2] 2+ ,780[M+1] 1+ ,

[0336] Intermediate 5: (2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((5-((2,5-dioxopyrrolidine-1-yl)oxy)-5-oxopentyl)oxy)tetrahydro-2H-pyran-3,4-diyldiacetate Intermediate 5 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0337] 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (3.00 g, 6.70 mmol obtained according to Nair et al., Multivalent N-Acetylgalactosamine-Conjugated siRNA Localizes in Hepatocytes and Elicits Robust RNAi-Mediated Gene Silencing, J.Am.Chem Soc., 2014, 136, 16958-16961) and N-hydroxysuccinimide (926 mg, 8.05 mmol) were dissolved in DCM (50 mL). Next, EDCI HCl (1.54 g, 8.05 mmol) and 4-(dimethylamino)pyridine (82 mg, 0.67 mmol) were added, and the reaction mixture was stirred overnight at room temperature. The reaction mixture was diluted with DCM, and the resulting solution was washed with 0.5N potassium bisulfate solution (150 mL), saturated sodium bicarbonate solution (150 mL), and brine (150 mL). The mixture was dried over Na2SO4, filtered, and evaporated under vacuum to obtain the title compound (3.60 g, 99%) as a white foam. Purity was 99% (ELSD) based on LC-MS. LRMS (m / z): 545 [M+1] 1+ LC-MS rt(min): 1.07 3

[0338] Intermediate 6: [(3R,6R)-3,4-bis(acetyloxy)-6-{4-[(3-{3-[2-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)-3-(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamide)propyl]carbamoyl}ethoxy)-2-[(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamide)propyl]carbamoyl}ethoxy)methyl]propoxy]propanamide}propyl)carbamoyl]butoxy}-5-acetamidooxan-2-yl]methylacetate Intermediate 6 was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0339] 3,3'-((2-((3-((3-aminopropyl)amino)-3-oxopropoxy)methyl)-2-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)propane-1,3-diyl)bis(oxy))bis(N-(3-aminopropyl)propanamide)tris(2,2,2-trifluoroacetate) (1.21 g, 1.08 mmol) was dissolved in a mixture of DMF (10 mL) and DIPEA (1.69 mL, 9.70 mmol). Next, (2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((5-((2,5-dioxopyrrolidine-1-yl)oxy)-5-oxopentyl)oxy)tetrahydro-2H-pyran-3,4-diyldiacetate (2.20 g, 4.04 mmol) was added, and the reaction mixture was stirred at room temperature over the weekend. The reaction mixture was then evaporated under vacuum, and the residue was purified by flash chromatography (DCM-DCM with a 30% methanol (v / v) gradient increasing from 0:100 to 100:0) to obtain the title compound (1.84 g, 83%) as a yellowish foam. LC-MS 95% (ELSD). LRMS(m / z):2068[M+1] 1+ LC-MS rt(min): 1.18 3

[0340] Intermediate 7: Trivalent GalNAc-Azide Trivalent GalNAc-azide was prepared as previously described in International Publication No. 2022 / 055351 (pages 136, line 3 to page 139, line 1, Figure 8, Example 1C).

[0341] [(3R,6R)-3,4-bis(acetyloxy)-6-{4-[(3-{3-[2-(1-azido-3,6,9,12-tetraoxapentadecane-15-amide)-3-(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)-6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamide)propyl]carbamoyl}ethoxy)-2-[(2-{[3-(5-{[(2R,5R)-4,5-bis(acetyloxy)- 6-[(acetyloxy)methyl]-3-acetamidooxan-2-yl]oxy}pentanamide)propyl]carbamoyl}ethoxy)methyl]propoxy]propanamide}propyl)carbamoyl]butoxy}-5-acetamidooxan-2-yl]methyl acetate (300 mg, 0.145 mmol) was dissolved in a mixture of triethylamine (2.00 mL, 14.4 mmol), methanol (2.00 mL), and water (2.00 mL), and the reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum. The residue was purified by preparative MP-LC. 2B The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (164 mg, 67%) as a white solid. Purity was 97% based on LC-MS. LRMS (m / z): 1688 [M-1] 1- LC-MS rt(min): 1.99 1A

[0342] Trivalent GalNAc-amineformate The trivalent GalNAc-amine formate was prepared as previously described in International Publication No. 2022 / 055351 (pages 143-144, Example 1D).

[0343] Trivalent GalNAc azide (36.5 mg, 21.6 μmol) was dissolved in potassium carbonate (5.97 mg, 43.2 μmol) in water (1.00 mL) and acetonitrile (1.00 mL). Next, a 1.0 M trimethylphosphine solution in THF (216 μL, 216 μmol) was added, and the resulting mixture was shaken for 1 minute and allowed to stand at room temperature. After 45 minutes, the reaction mixture was evaporated under vacuum, and the residue was dissolved in water / acetonitrile (9:1, v / v, 1 mL). The resulting solution was then subjected to preparative MP-LC. 2B The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (36.1 mg, 98%) as a white solid. Purity was 100% based on LC-MS. LRMS (m / z): 1662 [M-1] 1- LC-MS rt(min): 1.62 1A

[0344] Intermediate 8: Trivalent GalNAc-DBCO Trivalent GalNAc-DBCO was prepared as previously described in International Publication No. 2022 / 055351 (pages 143-144, Example 1D).

[0345] Trivalent GalNAc-amine formate (17.4 mg, 10.2 μmol) and DBCO-NHS (6.14 mg, 15.3 μmol) were dissolved in a solution of NMM (2.24 μL, 20.3 μmol) in DMF (0.50 mL). The reaction mixture was shaken for 1 minute and allowed to stand at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum, and the residue was dissolved in water / acetonitrile (8:2, v / v, 1 mL). The resulting solution was then subjected to preparative MP-LC. 2CThe fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (14.2 mg, 72%) as a white solid. Purity was 96% based on LC-MS. LRMS (m / z): 1950 [M-1] 1 LC-MS rt(min): 1.86 1B

[0346] GN3-SC-SO1861 SO1861-SC-N3 (18.0 mg, 8.45 μmol) and trivalent GN3-DBCO (16.5 mg, 8.45 μmol) were mixed with a mixture of acetonitrile (250 μL) and 20 mM ammonium bicarbonate (750 μL). The reaction mixture was shaken for approximately 1 minute and allowed to stand at room temperature. After 1 hour, the reaction mixture was subjected to preparative MP-LC.1A. The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (29.2 mg, 85%) as a white solid. Purity was 99% based on LC-MS. LRMS(m / z):2038[M-2H] 2- LC-MS rt(min): 2.19 5B

[0347] Please refer to Figure 8 for the formula GN3-SC-SO1861.

[0348] GN3-siTTR Trivalent GalNAc-siRNA targeting mouse trans tiretin (also known as the nucleic acid component GN3-siTTR [SEQ ID NO: 1] for the sense strand and SEQ ID NO: 15 for the antisense strand) with a highly enhanced stability chemical skeleton was custom-produced by BioSpring Gesellschaft fur Biotechnologie mbH, Germany according to methods known in the art (Figure 10). Trimeric GalNAc was produced by conjugating GalNAc monomers in a linear manner via their phosphate groups. The third phosphate group of GalNAc is ligated to the 3' end of the oligonucleotide sequence, resulting in the following conjugate with the sense strand [SEQ ID NO: 1]: 5'-6*6*7685451315875756566000; and the antisense strand [SEQ ID NO: 15]: 5min-5*1*6564643668627275855*5*5; where 0=GalNAc, 1=2'-fluoro-U, 2=2'-fluoro-A, 3=2'-fluoro-C, 4=2'-fluoro-G, 5=2'OMe-rU, 6=2'OMe-rA, 7=2'OMe-rC, 8=2'OMe-rG, and *=phosphorothioate. Such a linear trimer GalNAc can also be conjugated with a saponin component to produce, for example, GN3-SC-SO1861 by methods known in the art.

[0349] Materials for Examples 8-11 All chemicals, solvents, and buffers were purchased at their highest purity from either Sigma-Aldrich (Netherlands), Merck KGaA (Netherlands), Thermo-Fisher (Netherlands), VWR (Netherlands), or TCI (Europe), and were used as received unless otherwise specified.

[0350] SO1861 was isolated and purified from a live plant extract obtained from Saponaria officinalis L using either Analyticon Discovery GmbH, Germany or Extrasynthese, France.

[0351] Monoclonal antibodies Conjugate generation aCD71-SOD1 PMO (both Conjugate 1 and Conjugate 2) aCD71-(saponin-SOD1 PMO) 高 aCD71-(saponin-SOD1 PMO) 低 aCD71-Malat1 ASO The following monoclonal antibody was used: anti-mouse CD71mab rat IgG2a, clone: ​​R17 217.1.3 / TIB-219, lot number 821022M2, catalog number: BE0175, vendor: Bioxcell.

[0352] Conjugate generation aCD71-PMO(1) aCD71-PMO(2) aCD71-SOD1 ASO The following monoclonal antibody was used: anti-human CD71mab mouse IgG1, clone: ​​OKT-9, lot number 766322F1, catalog number BE0023, vendor: Bioxcell

[0353] Analysis method LC-MS method 1 Equipment: Agilent 1200 Bin. Binary pump: G1312A, Degasser: Autosampler, ColCom, DAD: Agilent G1316A, 210, 220 and 220-320nm, PDA: 210-320nm, MSD: Agilent LC / MSD G6130B ESI, pos / neg 100-1000; ELSD Alltech 3300 Gas flow rate 1.5 ml / min, Gas temperature: 40℃; Column: Waters XSelect (trademark) CSH C18, 30×2.1 mm, 3.5 μm, Temperature: 35℃, Flow rate: 1 mL / min, Gradient: t0 = 5%B, t 1.6分 =98%B,t 3分 =98%B, Post-run: 1.3 minutes, Eluent A: 0.1% formic acid in water, Eluent B: 0.1% formic acid in acetonitrile.

[0354] LC-MS method 2 Instrument: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, neg / pos in the range of 1500-2500 or 2000-3000; ELSD: Gas pressure 40 psi, drift tube temperature: 50℃; Column: Acquity Premier peptide BEH, 50 × 2.1 mm, 1.7 μm, temperature: 25℃, flow rate: 0.45 mL / min, lin. Linear gradient depends on the polarity of the product: A t0 = 2%B, t 4.0分 =50%B t 5.0分 =98%B,t 6.0分 =98%B B t0 = 5%B, t 5.0分 =98%B,t 7.0分 =98%B, Post time: 1.0 minute Eluent A: 10 mM ammonium bicarbonate in water (pH=9.5), Eluent B: Acetonitrile.

[0355] LC-MS method 3 Agilent 1260 Infinity II, 1260 G7112B binary pump, 1260 G7167A multisampler, 1290MCT G7116B column compartment, 1260 G7115A DAD (210~320nm, 210 and 220nm), PDA (210~320nm), G6130B MSD (ESI pos / neg) mass range 90~1500, column: Waters C4 BEH (50×2.1mm 3.5μm) flow rate: 1mL / min; column temperature: 40℃, eluent A: 0.1% formic acid in water, eluent B: 0.1% formic acid in acetonitrile, gradient: A t 0分 =5%B, t 2.5分 =98%B, t 4分 =98%B B t 0分 =5%B,t 0.05分 =5%B,t 5.0分 =98%B,t 6分 =98%B, Postrun: 1.5 minutes

[0356] LC-MS method 4 Agilent 1290 Infinity II, 1290G7120A bottle. Pump, 1290 G7167B multisampler, 1290 MCT G7116B column Comp, 1290 G7117B DAD (210~320nm), PDA (210~320nm), G6135B MSD (ESIpos / neg) mass range: 90-1500, column: XSelect CSH XP C18 (50×2.1mm, 2.5μm) flow: 0.8ml / min column temperature: 40℃, eluent A: 0.1% formic acid in water, eluent B: 0.1% formic acid in acetonitrile, gradient: t0 = 5%B, t 0.5分 =5%B,t 4.5分 =98%B,t 5.0分 =98%B, Postrun: 0.5 min

[0357] LC-MS method 5 Instrument: Waters IClass; Binary pump: UPIBSM, SM: UPISMFTN SO attached; UPCMA, PDA: UPPDATC, 210-320nm, SQD: ACQ-SQD2 ESI, mass range 1500-2500 neg / pos; ELSD: Gas pressure 40 psi, drift tube temperature: 50℃; Column: Acquity Premier peptide BEH, 50 × 2.1 mm, 1.7 μm, temperature: 25℃, flow rate: 0.45 mL / min, lin. gradient t0 = 2%B, t 4.0分 =50%B,t 5.0分 =98%B,t 7.0分 =98%B, Post-processing time: 1.0 minute, Eluent A: 10 mM ammonium bicarbonate in water (pH=9.5), Eluent B: Acetonitrile.

[0358] LC-MS method 6 Protein RP HPLC ESI MS containing 0.1% formic acid (solvent A) was performed on an X evo G2STOF mass spectrometer connected to an Acquity UPLC system using a BioResolve mAb RP Polyphenyl 450Å column (27 μm, 21 × 30 mm) H2O, with MeCN containing 0.1% formic acid (solvent B) as the mobile phase at a flow rate of 0.2 ml / min. The gradient was programmed as follows: gradient to 95% A in 0.93 minutes, then to 100% B in 4.28 minutes, then to 100% B in 1.04 minutes, then to 95% A in 1.04 minutes. The electrospray source was operated at a capillary voltage of 3.0 kV and a cone voltage of 175 V. Nitrogen was used as the desolvation gas at a total flow rate of 700 L / h. The total mass spectrum was reconstructed from the ion series using the Maxent1 algorithm pre-installed in the MassLynx 4.2 software, according to the manufacturer's instructions.

[0359] Preparative separation method Preparative MP-LC method 1 Machine: Revelleris™ Preparative MPLC; Column: Dr. Maisch Reprosil (C18, 150×25mm, 10μm); Flow rate: 40mL / min; Column temperature: Room temperature; Eluent A: 0.1% (v / v) formic acid in water; Eluent B: 0.1% (v / v) formic acid in acetonitrile; Gradient: t0 min=5%B, t1 min=5%B, t2 min=20%B, t17 min=60%B, t18 min=100%B, t23 min=100%B; Detection UV: 220, 254, 280, 320 nm; Fraction collection based on UV.

[0360] Preparative MP-LC method 2 Machine: Revelleris™ Preparative MPLC; Column: Phenomenex LUNA (C18, 150×25mm, 10μm); Flow rate: 40mL / min; Column temperature: Room temperature; Eluent A: 0.1% (v / v) formic acid in water; Eluent B: 0.1% (v / v) formic acid in acetonitrile; Gradient: t 0分 =5%B,t 1分 =5%B,t 2分 =30%B,t17分 =70%B,t 18分 =100%B,t 23分 =100%B; Detection UV: 220, 252, 280 nm. Fraction collection based on UV.

[0361] Preparative MP-LC method 3 Machine: Revelleris (trademark) preparative MPLC; Column: Phenomenex LUNA (C18, 150×25mm, 10μm); Flow rate: 40mL / min; Column temperature: Room temperature; Eluent A: 10mM ammonium bicarbonate in water pH=9.0; Eluent B: 99% acetonitrile + 1% 10mM ammonium bicarbonate in water; Gradient: A t 0分 =5%B, t 1分 =5%B, t 2分 =10%B, t 17分 = 50%B, t 18分 =100%B, t 23分 =100%B B t 0分 =5%B,t 1分 =5%B,t 2分 =20%B,t 17分 =60%B,t 18分 =100%B,t 23分 =100%B C t 0分 =5%B,t 1分 =5%B,t 2分 =30%B,t 17分 =70%B,t 18分 =100%B,t 23分 =100%B Detection UV: 210, 235, 254 nm and ELSD.

[0362] Preparative LC-MS method 4 MS machine: Agilent Technologies G6130B quadrupole; HPLC machine: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150×19mm, 10μm); Flow rate: 25ml / min; Column temperature: Room temperature; Eluent A: 10mM ammonium bicarbonate in water, pH=9.0; Eluent B: 100% acetonitrile; Gradient: A t0 = 10% B, t 2.5分 =10%B,t 11分 =50%B,t 13分 =100%B,t 17分 =100%B B t0 = 30%B, t 2.5分 =30%B,t 11分 =70%B,t 13分 =100%B,t 17分 =100%B C t0 = 20%B, t 2.5分 =20%B,t 11分 =60%B,t 13分 =100%B,t 17分 =100%B Detection: DAD (210nm); Detection: MSD (ESI pos / neg) Mass range: 100~800; Fraction collection based on DAD

[0363] Preparative LC-MS method 5 MS machine: Agilent Technologies G6120AA quadrupole; HPLC machine: Agilent Technologies 1200 preparative LC; Column: Waters XBridge Protein (C4, 150×19mm, 10μ); Flow rate: 25 ml / min; Column temperature: Room temperature; Eluent A: 0.1% formic acid in water; Eluent B: 100% acetonitrile; Gradient: t0 = 10% A, t 2.5分 =10%A,t 11分 =50%A,t 13分 =100%A,t 17分 =100%A; Detection: DAD (220~320nm); Detection: MSD (ESI pos / neg) Mass range: 100~1000; Fraction collection based on DAD.

[0364] Preparative LC-MS method 6 Machine: Revelleris (trademark) preparative MPLC; Column: Phenomenex LUNA C18(3) (150×25mm, 10μm); Flow rate: 40mL / min; Column temperature: Room temperature; Eluent A: 10mM ammonium bicarbonate in water pH=9.0; Eluent B: 99% acetonitrile + 1% 10mM ammonium bicarbonate in water; Gradient: t 0分 =5%B,t 1分 =5%B,t 2分 =10%B,t 17分 =50%B,t 18分 =100%B,t 23分 =100%B; Detection UV: 210, 235, 254 nm and ELSD.

[0365] Flash chromatography Grace Reveleris X2(registered trademark) C-815 Flash; Solvent delivery system: Self-priming 3-piston pump, 4 independent channels containing up to 4 solvents in a single run, automatic switching line when solvent runs out; Maximum pump flow rate 250 mL / min; Maximum pressure 50 bar (725 psi); Detection: UV 200~400 nm, combination of up to 4 UV signals and full UV range scan, ELSD; Column size: Luer device type 4~330 g, 750 g~3000 g with optional holder attached.

[0366] UV-visible spectrophotometry The concentrations and uptake of antibodies, PMO, and ASO were determined using a Thermo Nanodrop 2000 spectrometer. The antibody concentration in the conjugate was determined by a BCA assay. The BCA assay was performed using a Thermo SkanIT plate reader. SOD1 ASO,EC260 = 196000 M-1 cm-1. SOD1 PMO(1),EC265=253730M-1cm-1 SOD1 PMO(2),EC265=245060M-1cm-1.

[0367] SEC Native antibodies and conjugates were analyzed by SEC using either an Akta 100 system or a Biosep SEC-s3000 column eluted with DPBS: IPA (85:15) or a Cytiva Superdex 200PG column: IPA (90:10). Purity % was determined by integrating the antibody peak against trace agglutination peaks.

[0368] HIC Native antibodies and conjugates were analyzed by HIC using an Akta pure M system eluted with DPBS and a Cytiva HiScreen Phenyl HP column. The mean DAR was determined by integrating the conjugate peak against the trace antibody peak.

[0369] SDS-PAGE and Western Blotting Undenatured antibodies and conjugates were analyzed on a protein ladder using 4-12% bis-tris gel and MOPS as running buffer by SDS-PAGE under both non-denaturing and reducing conditions (200V, 40 min). Samples containing LDS sample buffer and MOPS running buffer as diluents were prepared to 0.5 mg / mL. For reduced samples, DTT was added to achieve a final concentration of 50 mM. The samples were heat-treated at 90-95°C for 2 minutes, and 5 μg (10 μl) was added to each well. Protein ladders (10 μl) were loaded without pretreatment. Empty rows were filled with 1× LDS sample buffer (10 μl). After flowing onto the gel, it was washed three times with DI water (100 mL) while shaking (15 min, 200 rpm). Coomassie staining was performed by incubating the gel with PAGEBlue protein stain (30 mL) while shaking (60 min, 200 rpm). Excess staining solution was removed, the gel was rinsed twice with DI water (100 ml), and destained with DI water (100 ml) (60 minutes, 200 rpm). The resulting gel was imaged and processed using imageJ.

[0370] For Western blotting, washed gels (not Coomersie stained) were transferred to nitrocellulose membranes using the X-Cell blot module with the following settings (BP-BP-FP-Gel-NC-FP-BP-FP-Gel-NC-FP-BP-BP) and conditions (30V, 0.17 amperes, 60 minutes) and freshly prepared transfer buffer. BP - blotting pad; FP - filter pad; NC - nitrocellulose membrane. Subsequently, the NC was washed three times with PBS-T (100 ml), and nonspecific areas were blocked with blocking buffer (30 ml) while shaking (10 minutes, 200 rpm). Then, the gels were labeled with a combination of goat anti-human κ-HRP (1:2000) and goat anti-human IgG-HRP (1:2000) (30 ml), and diluted with blocking buffer while shaking (60 minutes, 200 rpm). Subsequently, the NC was washed with PBS-T (100 ml), and the complexed antibody was detected using a newly prepared CN / DAB substrate (25 ml) prepared with a stable peroxide substrate buffer. The color development was visually observed, and the resulting NC was photographed.

[0371] synthesis SO1861-AH-maleimide SO1861-AH-maleimide (also known as SO1861-AH-Mal or SO1861-EMCH) was prepared as previously described in International Publication No. 2021 / 259507A1 (page 72, Example 3, titled "SO1861-EMCH Synthesis"). SO1861 (121 mg, 0.065 mmol) and EMCH·TFA (110 mg, 0.325 mmol) were mixed with methanol (over-dried, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture was stirred at room temperature. After 1.5 hours, the reaction mixture was subjected to preparative MP-LC (Method 6). The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (120 mg, 90%) as a white, cottony solid. Purity based on LC-MS (Method 5) 96%. LRMS(m / z):2069[M-1]1- LC-MS rt(min): 1.084

[0372] SO1861-AH-maleimide block (also called SO1861-AH-Block or SO1861-AH(Block), a saponin molecule according to formula (V)) To SO1861-AH-maleimide (0.1 mg, 48 nmol), 200 μL of mercaptoethanol (18 mg, 230 μmol) was added, and the solution was shaken at 800 rpm for 1 hour at room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 hour, the solution was diluted with methanol and dialyzed broadly with methanol for 4 hours using a regenerated cellulose membrane tube (Spectra / Por 7) containing 1 kDa MWCO. After dialyzing, SO1861-Ald-EMCH-mercaptoethanol (saponin molecule according to formula (V)) was provided, and aliquots were taken and analyzed by MALDI-TOF-MS. (RP mode): m / z 2193Da([M+K] + ,SO1861-AH-Block),m / z 2185Da([M+K] +,SO1861-AH-Block),m / z 2170Da([M+Na] + (SO1861-AH-Block)

[0373] SO1861-SC-maleimide synthesis SO1861-SC-maleimide (also known as SO1861-SC-Mal) was manufactured as previously described in International Publication No. 2023 / 038517A1 (Example 1, referred to as "SO1861-SC-Mal", page 168, lines 1-13).

[0374] tert-butyl 2-(4-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrole-1-yl)hexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate (25.0 mg, 57.1 μmol) was dissolved in a mixture of dichloromethane (500 μL) and TFA (500 μL), and the reaction mixture was stirred at room temperature. After 30 minutes, reaction mixture 35 was evaporated under vacuum and co-evaporated with dichloromethane (3 × 5 mL) and methanol (5 mL). The residue and SO1861 (21.3 mg, 11.4 μmol) were dissolved in methanol (extra dry, 1.00 mL), and the resulting mixture was shaken for 1 minute and allowed to stand at room temperature. After 4 hours, the reaction mixture was subjected to preparative MP-LC (Method 6). The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (13.7 mg, 55%) as a white, cottony solid. Purity was determined by LC-MS (Method 5) at 97%. LRMS(m / z):2181[M-1] 1- LC -MS rt(min):2.133

[0375] SO1861-SC SO1861-SC was manufactured as previously described in International Publication No. 2022055352A1 (Example 1, page 125, lines 8-17, "SO1861-SC").

[0376] Morpholine-4-carbohydrazide (3.89 mg, 26.8 μmol) and SO1861 (5.00 mg, 2.68 μmol) were dissolved in methanol (extra dry, 250 μL). Next, TFA (1.03 μL) was added, and the resulting mixture was shaken for 1 minute and left at room temperature. After 1 hour, the reaction mixture was subjected to preparative MP-LC (Method 6). The fractions corresponding to the product were immediately pooled together, frozen, and lyophilized overnight to obtain the title compound (3.29 mg, 62%) as a white, cottony solid. Purity was determined based on LC-MS (Method 5) at 95%. LRMS (m / z): 1991 [M-1] 1- LC -MS rt(min):1.99

[0377] TFL-(DIBO)-(d2[SS-SOD1 PMO])-(d2[SC-SO1861]) synthesis Intermediate 1: tert-butyl N-[2-(2-{2-[2-(2,2,2-trifluoroacetamide)ethoxy]ethoxy}ethoxy)ethyl]carbamate t-Boc-N-amide-PEG3-amine (21.8 g, 74.4 mmol) was dissolved in DCM (200 mL). Next, trifluoroethyl acetate (13.3 mL, 112 mmol) and triethylamine (15.5 mL, 112 mmol) were added, and the reaction mixture was stirred at room temperature over the weekend. The reaction mixture was washed with 10% potassium bicarbonate solution (2 × 200 mL) and saturated sodium bicarbonate solution (2 × 200 mL) as follows, dried over Na₂SO₄, filtered, and evaporated under vacuum. The residue was purified by flash chromatography (ethyl acetate-heptane gradient, 30:70 (v / v) ascending to 100% ethyl acetate) to obtain the title compound (15.1 g, 52%) as a colorless oil. Purity based on LC-MS (Method 1) 100%. LRMS(m / z):289 / 333 / 411[M-99 / M-55 / M+23] 1+ LC-MS rt(min): 1.77

[0378] Intermediate 2: tert-butyl N-{2-[2-(2-{2-[N-(2-{2-[2-[2-(2-azidoethoxy)ethoxy]ethoxy}ethyl)-2,2,2-trifluoroacetamide]ethoxy}ethoxy)ethoxy]ethyl}carbamate Mesyl-PEG4-azide (16.5 g, 55.5 mmol) and tert-butyl N-[2-(2-{2-[2-(2,2,2-trifluoroacetamide)ethoxy]ethoxy}ethoxy)ethyl]carbamate (15.0 g, 38.6 mmol) were dissolved in DMF (200 mL). Next, cesium carbonate (25.2 g, 77.3 mmol) was added, and the reaction mixture was stirred at 80°C. After 7 hours, the reaction mixture was evaporated under vacuum. The crude product was suspended in ethyl acetate (300 mL), and the resulting mixture was washed with 10% potassium bicarbonate solution (200 mL). The aqueous layer was washed with ethyl acetate (100 mL). The combined organic layers were dried over Na₂SO₄, filtered, and evaporated under vacuum. The residue was purified by flash chromatography (DCM-DCM(v / v) with a 10% methanol gradient increasing from 100:0 to 0:100), yielding the marked compound (14.7 g, 65%) as a slightly yellowish oil. Purity based on LC-MS (Method 1) 92%. LRMS (m / z): 490 / 613 [M-99 / M+23] 1+ LC-MS rt(min): 2.02

[0379] Intermediate 3: tert-butyl N-(23-azido-3,6,9,15,18,21-hexaoxa-12-azatrichosane-1-yl)carbamate 37.1 mL, 148 mmol of 4M sodium hydroxide solution was added to 148 mL of methanol. Next, this solution was diluted with 557 mL of 1,4-dioxane. The resulting mixture was added to 12.5 g, 21.2 mmol of N-{2-[2-(2-{2-[N-(2-{2-[2-(2-azidoethoxy)ethoxy]ethoxy}ethyl)-2,2,2-trifluoroacetamide]ethoxy}ethoxy)ethoxy]ethyl} tert-butyl carbamate, and the reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum. The residue was dissolved in 100 mL of DCM, and the resulting mixture was washed with 100 mL of saturated sodium bicarbonate solution. The aqueous layer was washed with 2 × 50 mL of DCM. The combined organic layers were dried over Na₂SO₄, filtered, and evaporated under vacuum. The crude product (10.65 g, quantitative) was used directly in the next step. LRMS (m / z): 495 [M+1] 1+ LC-MS rt(min): 1.50 (method 1)

[0380] Intermediate 4: (9H-Fluoren-9-yl)methyl N-{14-[(2-{2-[2-(2-azidoethoxy)ethoxy]ethoxy}ethyl)(2-{2-[2-(2-{[(tert-butoxy)carbonyl]amino}ethoxy)ethoxy]ethoxy}ethyl)carbamoyl]-3,6,9,12-tetraoxatetradecane-1-yl}carbamate Fmoc-N-amide-PEG4 acid (10.54 g, 21.62 mmol), tert-butyl N-(23-azido-3,6,9,15,18,21-hexaoxa-12-azatrichosane-1-yl)carbamate (10.65 g, 21.58 mmol), EDCI.HCl (4.34 g, 22.65 mmol), and Oxyma Pure (3.37 g, 23.73 mmol) were dissolved in DMF (250 mL), and the reaction mixture was stirred overnight at room temperature. Next, the reaction mixture was evaporated under vacuum. The crude product was dissolved in ethyl acetate (200 mL), and the resulting solution was washed with 10% potassium bicarbonate solution (200 mL) and saturated sodium bicarbonate solution (2 × 200 mL). The combined aqueous solution was washed with ethyl acetate (3 × 200 mL). The combined organic layer was dried over Na₂...

Claims

1. A saponin component for use in a therapeutic method for treating a subject suffering from a disorder of the central nervous system (CNS), wherein the method is The saponin component includes a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component comprising a nucleic acid therapeutic agent intended to be delivered to one or more cells of the aforementioned organ, This includes administering the above to the subject, The administration is performed directly into the organ or into a body cavity or fluid cavity that is in communication with the cells of the organ. A saponin component used in treatment methods for patients suffering from disorders of the central nervous system (CNS).

2. The saponin component further comprises a first ligand recognized by a first endocytosis receptor, and / or the effector component further comprises a second ligand recognized by a second endocytosis receptor. In some cases, the second endocytosis receptor is the same as the first endocytosis receptor, and in further cases, the second ligand is the same as the first ligand, or, under the condition that both two different endocytosis receptors are present on the same cell, the second endocytosis receptor is different from the first endocytosis receptor. Preferably, the first ligand and / or the second ligand are proteinogenic ligands, such as naturally occurring peptides or protein ligands or their receptor interaction moieties, or antibodies or their binding fragments. A saponin component for use as described in claim 1.

3. The aforementioned pentacyclic triterpene saponin, - The aldehyde functional group at the C-23 position of the aglycone core, or - An acid-sensitive covalent bond configured to decompose under acidic conditions to generate the aldehyde functional group at the C-23 position of the aglycone core, wherein the acid-sensitive covalent bond is selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, and is preferably selected from a semicarbazone bond and a hydrazone bond. A saponin component for use according to claim 1 or 2, further comprising:

4. The saponin component for use according to any one of claims 1 to 3, wherein the pentacyclic triterpene saponin is a monodesmoside or a bidesmoside, preferably comprising a first sugar chain bonded to the C-3 position of the aglycone core, more preferably the first sugar chain is selected from group A listed in Table 1A, even more preferably the first sugar chain comprises a glucuronic acid group, preferably a terminal glucuronic acid group, and most preferably the first sugar chain comprises Gal-(1→2)-[Xyl-(1→3)]-GlcA.

5. The pentacyclic triterpene saponin comprises an aglycon core selected from chiric acid, dipsogenin, and one aldehyde-substituted derivative of either chiric acid or dipsogenin, each defined as a chiric acid-based or dipsogenin-based aglycon core, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to decompose under acidic conditions to generate the aldehyde functional group at the C-23 position of the aglycon core, preferably the pentacyclic triterpene saponin is These are AG1856, AG1, AG2, agrostemoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 Selected from api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo or any one of the aldehyde-substituted derivatives thereof, The aforementioned pentacyclic triterpene saponin, Each is selected from SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658 and phytolaccagenin or any one of these aldehyde-substituted derivatives. A saponin component for use according to any one of claims 1 to 4.

6. The saponin component for use according to any one of claims 1 to 5, wherein the pentacyclic triterpene saponin is isolated from Saponaria officinalis and preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, and SO1904, more preferably one or more of SO1832, SO1861, and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861.

7. The saponin component for use according to any one of claims 1 to 6, wherein the saponin component comprises a non-conjugate saponin molecule.

8. The saponin component comprises a saponin moiety covalently conjugated with at least one non-saponin moiety, preferably via an acid-sensitive covalent bond that decomposes under acidic conditions, more preferably an acid-sensitive covalent bond at the C-23 position of the aglycon core, and even more preferably the acid-sensitive covalent bond at the C-23 position of the aglycon core is configured to decompose under acidic conditions to generate an aldehyde functional group at the C-23 position of the aglycon core, thus resulting in the release of the pentacyclic triterpene saponin containing the aldehyde functional group at the C-23 position of the aglycon core from the non-saponin moiety, and even more preferably the acid-sensitive covalent bond is a semicarbazone bond, a hydrazone bond, an imine bond, or an acetal bond, selected from one or more acetal bonds including a 1,3-dioxolane bond, ketal bonds, ester bonds, and / or oxime bonds, most preferably selected from semicarbazone bonds and hydrazone bonds. Furthermore / or the saponin moiety is covalently conjugated with the at least one non-saponin moiety by an acid-stable bond, preferably via a glucuronic acid group if the group is present. A saponin component for use according to any one of claims 1 to 7.

9. The non-saponin portion is Linker, The first ligand according to claim 2, The aforementioned effector components, and / or Scaffold Molecules Includes one or more of the following: Preferably, the saponin portion is directly and covalently conjugated with the linker. More preferably, the linker contains the saponin moiety via the acid-sensitive covalent bond, more preferably at the C-23 position of the aglycone core, or via the acid-stable bond, preferably at the glucuronic acid group if the group is present, or is covalently conjugated to the saponin moiety. More preferably, the linker is further covalently conjugated to the first ligand and / or the effector component, possibly via the scaffold molecule. For example, the scaffold molecule is a polyfunctional linker scaffold molecule, or optionally a polymer scaffold molecule containing a dendron, such as a polyamidoamine (PAMAM) dendrimer, or polyethylene glycol, such as PEG3 to PEG30. The saponin component for use according to claim 8.

10. The saponin portion is covalently conjugated with the non-saponin portion containing the effector component, and through this conjugation, the saponin component and the effector component come together in the conjugate, which is further called the saponin-effector component. Preferably, the saponin-effector component further comprises the linker, and more preferably, the linker is directly and covalently conjugated to the saponin portion. In some cases, the saponin-effector component further comprises the first ligand. A saponin component for use according to any one of claims 8 or 9.

11. The administration includes providing the effector component and the saponin component, which are formulated as a single pharmaceutical product, or as at least two pharmaceutical products that can be administered simultaneously or sequentially, wherein the first pharmaceutical product contains the saponin component and the second pharmaceutical product contains the effector component. In some cases, the administration is further continued at intervals of at least one day, preferably at least one week, by a boosting application of the saponin component, also called the boosting saponin component, the boosting saponin component is provided without the effector component, preferably comprising the non-conjugate saponin molecule described in claim 7 or the saponin moiety described in either claim 8 or 9, preferably the saponin moiety is covalently conjugated with at least the linker, or at least the first ligand, or at least the linker and the first ligand, Preferably, the boosting application is performed directly in the organ or in a body cavity or fluid cavity communicating with the cells of the organ; most preferably, the boosting application is performed directly at the site of administration. A saponin component for use according to any one of claims 1 to 10.

12. The aforementioned administration is as follows: - A two-component free saponin formulation defined as comprising the saponin component comprising the non-conjugate saponin molecule described in claim 7, wherein the pentacyclic triterpene saponin is preferably as defined in claim 3, and the two-component free saponin formulation further comprises an effector component optionally comprising a second ligand recognized by a second endocytosis receptor; - A two-component linker-saponin formulation defined as comprising a saponin component comprising a saponin moiety according to any one of claims 8 or 9, wherein the saponin moiety is covalently conjugated with the linker, and the two-component linker-saponin formulation further comprises an effector component optionally comprising a second ligand recognized by a second endocytosis receptor; - A two-component targeted saponin formulation defined as comprising the saponin component comprising the saponin moiety described in any one of claims 8 or 9, wherein the saponin moiety is covalently conjugated with the first ligand, preferably the non-saponin moiety comprises the linker, and the two-component targeted saponin formulation further comprises the effector component which may comprise the second ligand described in claim 2; - A one-component formulation defined as comprising the saponin-effector component described in claim 10; The provision of a single pharmaceutical formulation selected from one or more of the following: In some cases, the saponin-effector component further comprises the first ligand. A saponin component for use according to claim 11.

13. The aforementioned administration is as follows: - A non-targeting combination, A first pharmaceutical formulation wherein the saponin component does not contain a ligand and preferably contains a non-conjugate saponin molecule as described in claim 7 and / or a saponin moiety as described in either claim 8 or 9, or consists of the saponin moiety, wherein the saponin moiety is covalently conjugated with the linker, and the pentacyclic triterpene saponin is preferably as defined in claim 3. A second pharmaceutical formulation in which the effector component does not contain a ligand and A non-targeting combination defined as including; - A combination of targeted effectors, The first pharmaceutical formulation wherein the saponin component does not contain a ligand and preferably contains or consists of a non-conjugate saponin molecule as described in claim 7 and / or a saponin moiety as described in any one of claims 8 or 9, wherein the saponin moiety is covalently conjugated with the linker, and the pentacyclic triterpene saponin is preferably as defined in claim 3, The second pharmaceutical formulation wherein the effector component comprises the second ligand described in claim 2. A targeted effector combination defined as including; - A targeted saponin combination, The first pharmaceutical formulation comprises a saponin component comprising a saponin portion according to any one of claims 8 or 9, wherein the saponin portion is covalently conjugated with the first ligand, and preferably the non-saponin portion comprises the linker. The effector component may include the second ligand described in claim 2, and the second pharmaceutical formulation A targeted saponin combination defined as containing; The saponin component for use according to claim 10, comprising providing at least two pharmaceutical formulations, each comprising a combination of the first pharmaceutical formulation and the second pharmaceutical formulation selected from one or more of the above.

14. The nucleic acid therapeutic agent, - Gene therapy drugs that can treat or improve the said disorder by replacing or restoring the function of an abnormal or non-functional gene involved in the said disorder with a functional variant, or by introducing a repair product into the said gene; or - Oligonucleotide therapeutics defined as nucleic acid therapeutics having a size of 200 nt or less, preferably 5 to 150 nt, more preferably 8 to 100 nt, and most preferably 10 to 50 nt, preferably oligonucleotide therapeutics capable of treating or improving the disorder by regulating the expression of genes involved in the disorder. A saponin component for use according to any one of claims 1 to 13, selected from the above.

15. The nucleic acid therapeutic agent is defined as DNA and / or RNA, and / or modified equivalents of DNA and / or RNA, and comprises synthetic nucleic acids including one or more nucleotide analogs and / or skeletal modifications, preferably the nucleic acid therapeutic agent is - Preferably plasmids, minicircle DNA, CRISPR gene editing-related constructs, DNA aptamers, and / or DNA antisense oligonucleotides (ASOs, AONs), most preferably DNA therapeutic agents selected from DNA ASOs. - Preferably selected from RNA ASO, siRNA, miRNA, RNA miRNA inhibitors (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamers, ribozymes, RNA decoys, short hairpin RNA (shRNA), anti-hairpin shaped microRNA, and most preferably selected from RNA ASO, siRNA, miRNA, and / or RNA aptamers, RNA therapeutic agents. - Mixed DNA / RNA and / or synthetic nucleic acid therapeutic agents, preferably one of the following DNA-based or RNA-based modifications: phosphoramidate morpholino oligomers (PMO, morpholino), peptide nucleic acids (PNA), phosphorothioate-modified antisense oligonucleotides (PS-ASO), 2'-O-methyl (2'-OMe) phosphorothioate RNA, 2'-O-methoxyethyl (2'-O-MOE) RNA (2'-O-methoxyethyl-RNA (2'-MOE, MOE)), locked nucleic acids (LNA, cross-linked nucleic acids, BNA; e.g., 2'-O,4'-aminoethylene cross-linked nucleic acids (BNA-NC), BNA-based s A mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent comprising or consisting of iRNA, BNA-based antisense oligonucleotide (BNA-ASO), BNA-based anti-microRNA, etc.), 2'-deoxy-2'-fluoroarabino nucleic acid (FANA), 3'-fluorohexitol nucleic acid (FHNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA), more preferably comprising or consisting of gapmers (mixmers), synthetic gapmers, synthetic CpG oligonucleotides, synthetic RNA decoys, synthetic ASO, and / or synthetic anti-microRNA, Selected from, More preferably, the nucleic acid therapeutic agent is a mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent selected from: synthetic ASO, substantially DNA-based synthetic ASO, preferably substantially RNA-based synthetic ASO containing 2'-MOE modification, substantially DNA-based synthetic aptamer, substantially RNA-based synthetic aptamer, synthetic gapmer, synthetic siRNA, synthetic miRNA, synthetic anti-miRNA and / or synthetic anti-miRNA ASO. A saponin component for use according to any one of claims 1 to 14.

16. The saponin component for use according to any one of claims 1 to 15, wherein the nucleic acid therapeutic agent is an oligonucleotide therapeutic agent, preferably an siRNA therapeutic agent or an antisense oligonucleotide (ASO) therapeutic agent, preferably comprising one or more nucleotide analogs and / or skeletal modifications, more preferably a mutation-specific therapeutic agent, for example, a mutation-specific ASO comprising one or more nucleotide analogs and / or skeletal modifications, and optionally designed to silence and / or induce exon skipping of genes involved in the impairment.

17. The nucleic acid therapeutic agents are as follows: HTT, LRRK2, SNCA, Parkin gene, PINK1, DJ-1, DRP-1, SCN1A, SOD1, TDP-43, FUS, C9orf72, NEK1, UBQLN2, ATXN2, SMN2, SMN1, MAPT (tau gene), APP, BACE1, IL-4, IL-6, IL-7, IL-12RB2, IL-1R1, MBP, MIR29B, AR, FAS, C2orf72 UBE3A, UBE2A, GFAP, DMD, DYN2, DGAT2, MFSD8 (CLN7), TTR, VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, I The target is a gene selected from KBKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNGA2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1 and MMP14. Preferably, the gene is one of the following genes: HTT, SOD1, MFSD8 (CLN7), SMN1, SMN2, TTR, Malat1, AHA1, or MMP14, the saponin component for use according to any one of claims 1 to 16.

18. The nucleic acid therapeutic agent is an oligonucleotide therapeutic agent, preferably an oligonucleotide therapeutic agent capable of silencing genes or rendering gene products inoperable, and more preferably the oligonucleotide therapeutic agent is nusinersen; intelsen, eprontersen, butrisilane, patisirane, tofersen, QRX-704, jasifsen, tominersen, WVE-003; dyrganersen, atesidorsen, simderilsen, ATL-1102, BIIB-080, GTX-102, ION-464, ION-541, ION-859, IONIS-PKKRx, STK-001, A saponin component for use according to any one of claims 1 to 17, selected from the group consisting of WVE-004, travedersen, ISTH-0036, STP-705, dambatilsen, AZD-8701, siG-12D-LODER, IONISAR-2.5Rx, SR-063, plexigeversen, MTL-CEBPA, oblimersen, rademircene, homivirsen, pegatinib, bevacilanib, siRNA-027, aganilsen, sepofalsen, lufepirsen, IONIS-FB-LRx, QR-1123, urtebrusen, QPI-1007, cibanishiran, and bamosiran.

19. The first endocytosis receptor and / or the second endocytosis receptor are present on the cells and / or tissues within the CNS, preferably the cells are selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells, blood cells and / or tumor cells, more preferably the cells are selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells and / or tumor cells. Most preferably, the first endocytosis receptor and / or the second endocytosis receptor are The endocytosis receptor and / or the second endocytosis receptor are - CD71 (transferrin receptor) - CD63 (Tetraspanin) - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor) - InsR (insulin receptor) - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose-6-phosphate receptor), - LDL receptor - TGFβ receptor; - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor) - IL13-R (Interleukin-13 receptor) - AMPAR / NMDAR (AMPA-type glutamate receptor and NMDA-type glutamate receptor) - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2) - STR6 (Retinol-binding protein (RBP) receptor) A saponin component for use according to any one of claims 2 to 18, selected from the above.

20. The first ligand and / or the second ligand, - An antibody or a conjugate fragment thereof that binds to any one of the receptors described in claim 19; - A native ligand or fragment thereof recognized by any one of the receptors described in claim 19; Selected from, Preferably, the first ligand and / or the second ligand - Transferrin (Tf) or fragments thereof recognized by CD71; - Insulin or fragments thereof; - Insulin-like growth factor 1 (IGF-I) or a fragment thereof; - Insulin-like growth factor 2 (IGF-II) or a fragment thereof; - Mannose 6-phosphate, preferably multiple units thereof; - Glucose, preferably multiple units thereof, for example, zymosan A; - TGFβ or its fragments; - EGF or fragments thereof; - Neurotrophins (nerve growth factor, NGF) or fragments thereof; - Interleukin-13 (IL-13) or fragments thereof; - Glutamate or its units; - Vascular endothelial growth factor A (VEGF-A) or its fragments; - Retinol (vitamin A) or other forms of vitamin A; - Retinol-binding protein (RBP) or a fragment thereof; - The following: Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, and LDL receptors. Selected from, More preferably, the first ligand and / or the second ligand is an antibody or a conjugation fragment thereof that binds to CD71, even more preferably a monoclonal antibody or a single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71. A saponin component for use according to any one of claims 2 to 19.

21. The saponin component for use according to any one of claims 1 to 20, wherein the organ is the brain.

22. The administration includes, selected from the epidural, intrathecal, intraventricular, intracisional, intraparenchymal, intranasal, and / or postoperative injection into the tumor lumen formed after surgery within the CNS. Preferably, the administration is selected from intrathecal cavity, ventricle, cisterna magna, and / or intranasal cavity. More preferably, the administration is intrathecal. A saponin component for use according to any one of claims 1 to 21.

23. The saponin component for use according to any one of claims 1 to 22, wherein the administration is performed intradurally, intraarachnoidally, subarachnoidally, intrapia mater, and / or within brain tissue, preferably the administration is performed in the subarachnoid space and / or within the subarachnoid space, and more preferably the administration is performed in the subarachnoid space.

24. The aforementioned CNS failure, - Preferably, one or more neurodegenerative disorders selected from Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), multiple system atrophy (MSA), multiple sclerosis (MS), and / or Lewy body dementia (DLB). - Preferably, a neurological disorder selected from stroke, epilepsy, for example, Dravet syndrome (DS), and / or spinal cord disease; - Preferably one or more selected from glioblastoma, meningioma, (oligodendroglioma), astrocytoma, ependymoma, medulloblastoma, CNS lymphoma, and metastasis to the CNS, and more preferably selected from glioblastoma, meningioma, (oligodendroglioma), and / or metastasis to the CNS, oncological disorder, - Preferably selected from autoimmune diseases of the CNS, immune-related diseases caused by genetic defects, diseases caused by infection or inflammation, and more preferably selected from meningitis, encephalitis, prion diseases, and / or coronavirus disease 2019 (COVID-19), immunodeficiency. - A mental disorder preferably selected from one or more of the following: Tourette syndrome (TS), mood disorders, personality disorders, anxiety disorders, substance use or addiction disorders, obsessive-compulsive disorder, neurodevelopmental disorders, and eating disorders, and more preferably selected from mood disorders which are anxiety disorders, obsessive-compulsive disorder, eating disorders, and / or preferably treatment-resistant mood disorders. Selected from, and / or, the CNS disorder is selected from spinal muscular atrophy, hereditary transthyretin amyloidosis (hATTR), amyotrophic lateral sclerosis (ALS), preferably SOD1-associated amyotrophic lateral sclerosis, Huntington's disease, Alzheimer's disease, Parkinson's disease, Batten's disease, frontotemporal dementia, spinocerebellar ataxia type 3, multiple system atrophy; Rett syndrome, Alexander disease; Angelman syndrome; Lafora disease; GFAP astrocytic degeneration, prion diseases, and neurological disorders associated with acromegaly, the saponin component for use according to any one of claims 1 to 23.

25. The effector component comprises an oligonucleotide therapeutic agent targeting any one of STAT3, SOD1, Malat1, AHA1, MMP14, TTR, and HTT, or an oligonucleotide therapeutic agent selected from nusinersen, tominersen, tofersen, inotercene, eprontersen, butricilane, patisirane, and travedersen, and the saponin component comprises a pentacyclic triterpene saponin as defined in claim 3, preferably a pentacyclic triterpene saponin as defined in claim 5. , more preferably SO1861 or SO1861, wherein the aldehyde functional group at the C-23 position is substituted by the acid-sensitive covalent bond configured to decompose under acidic conditions to produce the aldehyde functional group at the C-23 position of the aglycone core, and further more preferably the administration is intrathecal, and most preferably comprises the two-component free saponin preparation or the two-component linker-saponin preparation or the one-component preparation as defined in claim 12, the saponin component for use according to any one of claims 1 to 24.