Nucleic acids targeting angiotensinogen and their applications

Nucleic acids targeting AGT are developed to address the limitations of current RAAS inhibitors by directly suppressing AGT expression, effectively reducing RAAS activation and treating hypertension and related disorders.

JP2026522388APending Publication Date: 2026-07-07

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Filing Date
2024-06-12
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current RAAS inhibitors, such as ACE inhibitors and Ang II receptor blockers, face limitations due to compensatory mechanisms that increase Ang II and aldosterone levels, leading to poor therapeutic efficacy in treating hypertension and heart failure, while targeting angiotensinogen (AGT) directly presents challenges.

Method used

Development of nucleic acids, specifically siRNAs with sequences targeting AGT, to suppress its expression and reduce RAAS pathway activity, using a targeted drug delivery system for effective treatment and prevention of AGT-related disorders.

Benefits of technology

The nucleic acids effectively suppress AGT expression, reducing RAAS activation and providing a more direct therapeutic approach to treat hypertension and related disorders, overcoming the limitations of existing RAAS inhibitors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026522388000001_ABST
    Figure 2026522388000001_ABST
Patent Text Reader

Abstract

A nucleic acid targeting angiotensinogen and its applications, wherein the nucleic acid can effectively suppress AGT expression and effectively reduce the degree of RAAS activation, and therefore can be used to treat and / or prevent AGT-related diseases such as hypertension.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] [Cross - reference to Related Applications] The present invention claims the priority of a Chinese patent application with application number 202310718430.6 filed on June 16, 2023, the entire content of which is incorporated herein by reference.

[0002] [Technical Field] The present invention belongs to the field of biotechnology, and specifically relates to nucleic acids targeting angiotensinogen and their uses.

Background Art

[0003] The renin - angiotensin - aldosterone system (RAAS) is a complex network regulatory system composed of multiple proteases and short - chain peptides. It is an important regulator of cardiovascular and renal functions. The over - activation of this system is a central part of many common pathological conditions, including hypertension, heart failure, and kidney disease (Lu H et al. Hypertension Res. 39:492 - 500, 2016). The RAAS pathway begins with renin degrading angiotensinogen, which is the substrate, to generate angiotensin I (Ang I), an inactive peptide. Subsequently, angiotensin - converting enzyme (ACE) in endothelial cells converts Ang I to angiotensin II (Ang II). The ACE activation of Ang II occurs most widely in the lungs. Ang II mediates vasoconstriction and the release of aldosterone from the adrenal glands, thereby causing sodium retention and an increase in blood pressure.

[0004] RAAS inhibitors include ACE inhibitors, angiotensin II receptor blockers (ARBs), aldosterone antagonists, and direct renin inhibitors. RAAS inhibitors are currently important drugs in the treatment of hypertension and the prevention and treatment of heart failure, and are widely used clinically (Schmieder RE et al. Lancet. 369 (9568):1208-1219; Antonaccio MJ. J Pharmcol.14:29-45, 1983; Ruiz-Ortega M et al. Trends Cardiovasc Med. 17(1): 19-25, 2007; Matsubara H. Cric Res.83(12):1182-1191, 1998). ACE inhibitors and Ang II receptor antagonists can increase blood levels of Ang II and aldosterone to pre-treatment levels or higher by activating compensatory pathways, leading to angiotensin reactivation and aldosterone breakout (Nobakht N et al. Nat Rev Nephrol. 7:356-359, 2011; Bomback AS and Klemmer PJ. Nat Clin Pract Nephrol. 3:486-492, 2007). This may be a key factor in the poor response to RAAS inhibitors in patients with refractory hypertension and heart failure (Narayan H and Webb DJ. Curr Hypertens Rep. 18:34, 2016; Roig E et al. Eur Heart J. 21: 53-57, 2000). Therefore, more effective therapeutic strategies should target the upstream of RAAS enzymes and receptors, avoiding compensatory mechanisms and intracellular secretory pathways that limit therapeutic efficacy (Mullick AE et al. Hypertension. 70(3):566-576, 2017).

[0005] Angiotensinogen (AGT, also known as SERPINA8, ANHU, hFLT1) is the co-precursor of all angiotensins (Wu C et al. Am J Med Sci. 4:183-190, 2011; Lu H et al. Hypertens Res 39:492-500, 2016), and the liver is the primary source of blood AGT (Yiannilouris G et al. Hypertension. 66:836-842, 2015; Matsusaka T et al. J Am Soc Nephrol. 23:1181-1189, 2012). Multiple studies have confirmed a significant positive correlation between elevated blood AGT levels and hypertension (Fasola AF et al. J Appl Physiol. 21:1709-1712, 1966). Lowering blood AGT levels can suppress RAAS pathway activity and thus lower blood pressure (Olearczyk J et al. Hypertension Res. 37:405-412, 2014). Intravenous administration of AGT to rats can improve blood pressure, and this can be reversed by treatment with anti-AGT antibodies (Menard J et al. Hypertension. 18:705-707, 1991). AGT-gene knockout mice exhibit decreased blood pressure, while AGT-overexpression causes elevated blood pressure (Kim HS et al. Proc Natl Acad Sci USA92:2735-2739, 1995; Kimura S et al. Embo J. (11:821-827, 1982). Treating hypertension by regulating AGT levels is a promising development target, but targeting AGT with conventional methods presents many challenges (Morgan L et al. Int J Biochem Cell Biol. 28:1211-1222, 1996).

[0006] RNA interference (RNAi) refers to the phenomenon in which homologous mRNA is efficiently and specifically degraded by small interference RNA (siRNA), a double-stranded small interference ribose nucleic acid that is highly conserved during evolution. Therefore, research and development of siRNA targeting AGT is of great significance. [Overview of the project]

[0007] The objective of this invention is to overcome the problems of the prior art and to provide a new nucleic acid targeting AGT and its applications.

[0008] A first aspect of the present invention provides a nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% or more sequence identity with a sequence represented by any of SEQ ID NO: 1-26, and the antisense strand comprises a sequence having 80% or more sequence identity with a sequence represented by any of SEQ ID NO: 27-52.

[0009] A second aspect of the present invention provides a targeted drug delivery system comprising a target group, a linking group, and the nucleic acid linked to the target group via the linking group.

[0010] A third aspect of the present invention provides a drug composition comprising the nucleic acid or targeted drug delivery system and a pharmaceutically acceptable carrier.

[0011] A fourth aspect of the present invention provides a method for suppressing the expression of angiotensin genes in cells, the method comprising contacting the cells with the nucleic acid, a targeted drug delivery system, or a drug composition to suppress the expression of angiotensin genes in the cells.

[0012] A fifth aspect of the present invention provides uses for the nucleic acid, targeted drug delivery system, or drug composition in either 1) treating and / or preventing angiotensin-related disorders, or 2) manufacturing a drug for treating and / or preventing angiotensin-related disorders.

[0013] The inventors of this invention have discovered that AGT is an optimal target for RNAi in the renin-angiotensin-aldosterone system, and therefore, this invention provides a novel nucleic acid that targets AGT and its applications. The nucleic acid of this invention can effectively suppress AGT expression and effectively reduce the degree of RAAS activation, and therefore can be used to treat and / or prevent AGT-related diseases such as hypertension. [Brief explanation of the drawing]

[0014] Clearly, the accompanying drawings in the following description are part of embodiments of the present invention, and those skilled in the art can obtain other accompanying drawings based on these without requiring any creative effort.

[0015] [Figure 1] This shows the pharmacokinetics of SN-682160, SN-682172, SN-682173, SN-682175, and SN-682176 in human-derived AGT transgenic mice in the embodiments of the present invention. [Figure 2] This shows the pharmacokinetics of SN-682726 and SN-682728 in human-derived AGT transgenic mice in the embodiments of the present invention. [Figure 3] This shows the efficacy of SN-682726 and SN-2073 in human-derived AGT transgenic mice in the embodiments of the present invention. [Modes for carrying out the invention]

[0016] Specific embodiments of the present invention will be described in detail below. The specific embodiments described herein are for illustrative and interpretive purposes only and are not intended to limit the present invention. Those skilled in the art should understand that various modifications and changes can be made to the present invention without departing from the scope or spirit of the invention. For example, further embodiments can be created by applying features described or explained as part of one embodiment to another embodiment.

[0017] Explanation of terms Unless otherwise specified, all terms used to disclose this invention (including technical and scientific terms) have the same meaning as those commonly understood by those skilled in the art. Through further guidance, the definitions set forth below are used to better understand the teachings of this invention. The terms used herein are used solely to describe specific embodiments and are not intended to limit the invention.

[0018] As used herein, the selection of terms “and / or,” “or / and,” and “and / or” includes any one of two or more related enumerations, and also includes any and all combinations of related enumerations, where any and all combinations include any two related enumerations, any multiple related enumerations, or any combination of all related enumerations. Furthermore, when at least three items are linked by a combination of at least two linking words selected from “and / or,” “or / and,” and “and / or,” it should be understood that in this application, each of the technical solutions undoubtedly includes a technical solution linked by a “logical AND,” and each of them further undoubtedly includes a technical solution linked by a “logical OR.” For example, “A and / or B” includes three parallel schemes: A, B, and A+B. For example, the technical solution of "A, and / or B, and / or C, and / or D" includes one of A, B, C, and D (i.e., all technical solutions linked by "logical OR"), and also includes any and all combinations of A, B, C, and D, i.e., any two or three combinations of A, B, C, and D, and further includes four combinations of A, B, C, and D (i.e., all technical solutions linked by "logical AND").

[0019] The terms "comprising", "including", and "containing" used in the present invention are synonyms, and these are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0020] In the present invention, numerical ranges indicated by endpoints include all numerical values and fractions included in the range, as well as the recited endpoints.

[0021] In the present invention, for numerical values of concentration, variations within a certain range are included. For example, it can vary within the corresponding accuracy range. For example, in the case of 2%, variations within the range of ±0.1% can be tolerated. When the numerical value is large or for numerical values that do not require overly precise control, it is also allowed to include larger variations. For example, in the case of 100 mM, variations within the ranges of ±1%, ±2%, ±5%, etc. are tolerated. For molecular weight, it is allowed to include variations of ±10%.

[0022] In the present invention, descriptions such as "a plurality", "a plurality of kinds", etc. refer to two or more in quantity unless otherwise particularly limited.

[0023] In the present invention, the open-endedly described technical features include the closed technical solution composed of the recited features and also include the open technical solution including the recited features.

[0024] In the present invention, it should be understood that "preferred", "better", "optimal", "desirable" are only for explaining more effective embodiments or examples and do not limit the protection scope of the present invention.

[0025] In this invention, "arbitrarily," "at will," "at willing selection," "at willingly," "optionally," and "optionally" mean that they may or may not be present, that is, they mean that one of two parallel schemes, "present" or "absent," is selected. If there are multiple "arbitrary" or "optional" means in a single technical solution, unless otherwise specified, each "arbitrary" or "optional" is independent, provided there are no contradictions or mutual constraints.

[0026] In the present invention, the term “nucleic acid” refers to a composition comprising RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can sequence-specifically degrade or repress (e.g., degrade or repress under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA. The nucleic acid may act via an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or via any alternative mechanism or pathway. The limited scope of nucleic acids disclosed herein, including sense and antisense strands, includes, but is not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates.

[0027] In the present invention, when referring to the expression of a particular gene, the terms “silencing,” “reduction,” “suppression,” “downregulation,” or “knockdown” mean that, when measured at the level of RNA transcribed from the gene or polypeptides, proteins, or protein subunits translated from mRNA, the expression of the gene is reduced in a cell, cell population, tissue, organ, or subject that is not thus treated with the nucleic acids described herein.

[0028] In this invention, "fully complementary" means that in a hybridization pair of nuclear bases or nucleotide sequence molecules, all (100%) of the bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may include all or part of the first or second nucleotide sequence.

[0029] In this invention, "partially complementary" means that in a hybridization pair of nuclear bases or nucleotide sequence molecules, at least 70% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may include all or part of the first or second nucleotide sequence.

[0030] In this invention, "basically complementary" means that in a hybridization pair of nuclear bases or nucleotide sequence molecules, at least 85% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may include all or part of the first or second nucleotide sequence.

[0031] In the present invention, "at least partially complementary" means that in a hybridization pair of nuclear bases or nucleotide sequence molecules, the first oligonucleotide and the second oligonucleotide are partially complementary, basically complementary, or completely complementary.

[0032] In this invention, the term “treatment” means a method or step employed to provide relief or reduction of the number, severity and / or frequency of one or more disease symptoms in a subject. Such treatment may include prevention, management, prophylactic treatment, and / or suppression or reduction of the number, severity and / or frequency of one or more disease symptoms in a subject.

[0033] In this invention, the term “linking” means that two compounds or molecules are joined together via a covalent bond. Unless otherwise specified, the term “linking” as used herein may refer to linking between a first compound and a second compound, which may or may not have any intermediate atoms or groups of atoms.

[0034] nucleic acid The present invention provides nucleic acids (modified or unmodified) comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% or more sequence identity (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) with a sequence represented by any of SEQ ID NO: 1 to 26, and the antisense strand comprises a sequence represented by SEQ ID Includes sequences that have 80% or more sequence identity (for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) with any of the sequences shown in NO:27~52.

[0035] In some embodiments, the antisense chain has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0036] In some embodiments, the sense strand has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0037] In practical implementation, those skilled in the art can obtain a combined nucleic acid (siRNA) by combining the sequences provided in the present invention, taking into consideration the complementarity of the sense strand and the antisense strand.

[0038] In a preferred embodiment of the present invention, as shown in Table 1, the nucleic acid is selected from at least one of the following: siRNA-1, whose sense strand sequence is SEQ ID NO:1 and antisense strand sequence is SEQ ID NO:27; siRNA-2, whose sense strand sequence is SEQ ID NO:2 and antisense strand sequence is SEQ ID NO:28; siRNA-3, whose sense strand sequence is SEQ ID NO:3 and antisense strand sequence is SEQ ID NO:29; siRNA-4, whose sense strand sequence is SEQ ID NO:4 and antisense strand sequence is SEQ ID NO:30; siRNA-5, whose sense strand sequence is SEQ ID NO:5 and antisense strand sequence is SEQ ID NO:31; ...; siRNA-24; siRNA-25; siRNA-26.

[0039] In some preferred embodiments, the antisense strand comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides that differ by up to 0, 1, 2, or 3 nucleotides from the sequence shown in any of SEQ ID NO: 27-52, and the sense strand comprises a nucleotide sequence that is at least partially complementary (e.g., partially complementary, basically complementary, or fully complementary) to the antisense strand.

[0040] In some preferred embodiments, the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, which differ from the sequence shown in any of SEQ ID NO: 1 to 26 by up to 0, 1, 2, or 3 nucleotides.

[0041] In this invention, the sense chain and the antisense chain may have the same length or may have different lengths.

[0042] All nucleotide groups in the above nucleic acid may not be chemically modified, or they may contain at least one modified nucleotide group, and the modification may be applied to any nucleotide at any position.

[0043] In some embodiments, the sense chain and the antisense chain may be partially complementary, basically complementary, or completely complementary to each other.

[0044] In some preferred embodiments, the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence shown in any of SEQ ID NO: 29, 32, 38, 40, 41, 42, 43, or 44, and the sense strand comprises a nucleotide sequence that is at least partially complementary (e.g., partially complementary, basically complementary, or fully complementary) to the antisense strand. When the antisense strand has the above sequence, the double-stranded RNA has a significant and superior inhibitory effect on AGT.

[0045] In some preferred embodiments, the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 3, 6, 12, 14, 15, 16, 17, 18 by 0, 1, or 2 nucleotides.

[0046] In some more preferred embodiments, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in any of SEQ ID NO: 29, 40, 41, 43, or 44 by 0, 1, or 2 nucleotides, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.

[0047] In some preferred embodiments, the sense strand includes a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 3, 14, 15, 17, or 18 by 0, 1, or 2 nucleotides.

[0048] In some more preferred embodiments, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO:40 by 0, 1, or 2 nucleotides, and the sense strand comprises a nucleotide sequence that is at least partially complementary (e.g., partially complementary, basically complementary, or fully complementary) to the antisense strand. When the antisense strand has such a sequence, the differently modified double-stranded RNAs all exhibit excellent inhibitory effects against AGT.

[0049] In some preferred embodiments, the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO:14 by 0, 1, or 2 nucleotides.

[0050] In some preferred embodiments, the GC content in the nucleic acid is 20-45%, more preferably 20-35%.

[0051] In some embodiments, the sense or antisense strand in the nucleic acid still has an approximate or equivalent inhibitory effect on AGT even if its sequence identity with the corresponding sequence described in the present invention is less than 100%, or if it differs by one or more nucleotides. For example, the UU ligated to the 3' end of the antisense strand of the nucleic acid is replaced with AA, CC, GG, or UG, or any combination of two nucleic acids. Such nucleic acid sequences are also included within the scope of protection of the present invention.

[0052] The above technical solution relating to bare sequences (i.e., unmodified sequences) described in the present invention does not depend on the modification method or the selection of the target carrier for its superior effectiveness. The applicable modification schemes and more preferred modification schemes will be described below.

[0053] In the nucleic acid described in the present invention, the nucleic acid includes a nucleotide group as a basic structural unit, the nucleotide group includes a phosphate group, a ribose group, and a base, and preferably the nucleic acid includes at least one modified nucleotide group. The inhibitory efficiency of modified nucleic acids against AGT is 50% or higher (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).

[0054] In the nucleic acid described in the present invention, the modified nucleotide group is a nucleotide group modified with a phosphate group and / or a ribose group. The modified site can be located at at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, and 30th positions of the nucleotides at positions 1, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, and 30th sense strand and / or antisense strand.

[0055] For example, modification of the phosphate group refers to modifying the oxygen in the phosphate group, and includes thiophosphate modification (phosphorthioate) and boranophosphate modification. As shown in the following formula, the oxygen in the phosphate group is replaced with sulfur, borane, amino group, alkyl group, or alkoxy group, respectively. All of these modifications can stabilize the structure of nucleic acids and maintain high specificity and affinity of base pairs.

[0056] [ka] [ka] [ka]

[0057] In the above structural formula, BASE represents a base A, U, C, G, or T. X may be oxygen (O) or sulfur (S). R may be the same or different in the above structure, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxy, allyl, ethylamino, propargyl, amino, cyanoethyl, acetyl, etc., and R' and R'' may independently be hydrogen (H), methyl (CH3), ethyl (CH2CH3), propyl (CH2CH2CH3), isopropyl (CH(CH3)2), allyl, propargyl, acyloxybenzyl, or acyloxyethyl.

[0058] Ribose group modification refers to modification of the 2'-hydroxy (2'-OH) group within the ribose group. By introducing substituents such as methoxy or fluorine at the 2'-hydroxy position of the ribose group, nucleic acids become less susceptible to cleavage by ribonucleases, thereby increasing the stability of nucleic acids and strengthening their resistance to hydrolysis by nucleases. Modifications of the 2'-hydroxy in nucleotide pentoses include 2'-fluoromodification (e.g., 2'-arabino-fluoro modification), 2'-methoxymodification (2'-OME), 2'-methoxyethyl modification (2'-MOE), 2'-2,4-dinitrophenol modification (2'-DNP modification), cyclic locked ethyl modification (2',4'-constrained ethyl modification), 2'-amino modification (2'-Amino modification), 2'-deoxy modification, BNA, acyclic nucleic acid modification, mismatch nucleic acid modification, and L-type nucleic acid modification. BNA (internal ring crosslinked nucleotide) refers to a nucleotide that is constrained or cannot be accessed. BNA can include a crosslinked structure with "fixed" C3'-endoglucosidase activity, containing a five-membered, six-membered, or seven-membered ring. Typically, the crosslink is incorporated at the 2'-,4'-positions of the ribose ring to provide 2',4'-BNA nucleotides, such as locked ethyl modified (LNA), cyclic locked ethyl modified (ENA), and ethyl locked nucleic acid modified (cET BNA). Acyclic nucleic acids are nucleotides formed by the cleavage of the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) nucleotides and glyceronucleotide (GNA) nucleotides. Mismatch nucleic acid modification refers to the substitution of a 3',5'-phosphate linkage chain with a 2',5'-phosphate linkage chain. L-type nucleic acid modification refers to the substitution of a naturally occurring D-type nucleic acid with its enantiomer, the L-type nucleic acid.

[0059] [ka] [ka] [ka] [ka]

[0060] Here, BASE represents a base A, U, C, G, or T. R may be the same or different in the above structure, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxy, allyl, ethylamino, propargyl, cyanoethyl, acetyl, etc.

[0061] The nucleic acids described in the present invention are preferably nucleotide groups modified with a ribose group, in which the 2'-OH of the ribose group is substituted with methoxy or fluorine.

[0062] In a particularly preferred embodiment of the present invention, the nucleotide group in the sense strand of the nucleic acid containing a uracil base or a cytosine base is a nucleotide group modified with a ribose group, that is, the 2'-OH of the ribose group in the nucleotide group containing a uracil base or a cytosine base in the sense strand of the nucleic acid is substituted with methoxy or fluorine. More preferably, dTdT may be linked to the 3' ends of both the sense strand and the antisense strand of the nucleic acid, or AA or UU or any combination of two nucleic acids (which may be CC, GG, or UG, but are not limited to these) may be linked to the 3' end of the antisense strand of the nucleic acid, thereby enabling the sequence to have a specific inducement for mRNA degradation. The nucleic acid having the above modification exhibits a better in vivo inhibitory effect, and the above modification can further reduce the immunogenicity of the nucleic acid of the present invention in vivo.

[0063] The nucleic acids of the present invention may also include modifications involving the linkage of a monophosphate nucleoside to the 5' end of the antisense strand. The 5'-monophosphate at the end of the siRNA guide strand is important for RISC recognition. Here, 5'-hydroxyl phosphorylation plays a certain role in whether the siRNA can be effectively loaded onto intracellular Ago2. The monophosphate at the 5' end of the guide strand in the siRNA has an H-bond interaction with Argonaute-2 (Ago2), thus ensuring accurate positioning and precise cleavage of the mRNA target. Commonly used derivatives of 5'-monophosphate nucleosides include the following, and these phosphate nucleoside derivatives have been shown to have certain stability in biological metabolites and to play a certain role in promoting the loading of the siRNA guide strand onto intracellular Ago2 (Nucleic Acids Research, 2015, 43, 2993-3011). The nucleic acids described in the present invention preferably use trans-vinyl phosphate (VP) as the first choice, but may also include derivatives of monophosphate nucleosides other than those mentioned above.

[0064] [ka] [ka] [ka] [ka] [ka]

[0065] In the above structure, BASE represents a base A, U, C, G, or T. R may be the same or different in the above structure, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxy, allyl, ethylamino, propargyl, cyanoethyl, amino, acetyl, etc.

[0066] In some embodiments, at least one nucleotide in the nucleic acid is a modified nucleotide or contains a modified interbond.

[0067] In some preferred embodiments, the modified nucleotide is selected from one or more of 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-ring-open nucleotide analog, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribonol, reverse nucleotide, reverse 2'-O-methylnucleotide, reverse 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methylnucleotide, and the modified nucleotide is more preferably selected from one or more of 2'-O-methylnucleotide and 2'-fluoronucleotide.

[0068] In some preferred embodiments, the modified internucleotide bond is preferably selected from one or more of thiophosphate nucleotide internucleotide bonds and methylphosphonate nucleotide internucleotide bonds, and the modified internucleotide bond is more preferably selected from one or more of thiophosphate monoester nucleotide internucleotide bonds and thiophosphodiester nucleotide internucleotide bonds.

[0069] In some embodiments, the antisense strand has 2'-O-methylnucleotides at the 5th and 6th nucleotides from the 5' end, and a 2'-fluoronucleotide at the 7th nucleotide. By modifying the antisense strand based on any of the sequences described in the present invention, the inhibitory effect of siRNA on AGT can be further significantly improved.

[0070] In some preferred embodiments, the 5' and 3' ends of the antisense chain each contain two thiophosphate nucleotide interbonds, where the 1st, 2nd, 7th, 9th, 14th, and 16th nucleotides from the 5' end are 2'-fluoronucleotides, and the remaining nucleotides are all 2'-O-methylnucleotides.

[0071] In some embodiments, the sense strand has a 2'-O-methylnucleotide or a 2'-fluoronucleotide as its second nucleotide from the 5' end, preferably a 2'-O-methylnucleotide. By applying the above modification to the sense strand, the inhibitory effect of siRNA on AGT can be further improved.

[0072] In some preferred embodiments, the 5' end of the sense strand contains two thiophosphate nucleotide interbonds, where the 4th, 7th, 9th, 10th, and 11th nucleotides from the 5' end are 2'-fluoronucleotides, and the remaining nucleotides are all 2'-O-methylnucleotides.

[0073] In some embodiments, the antisense strand has at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides, each differing from the antisense strand sequence shown in either Table 3 or Table 8 by up to 0, 1, 2, or 3 nucleotides, and the sense strand has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, each differing from the sense strand sequence shown in either Table 3 or Table 8 by up to 0, 1, 2, or 3 nucleotides.

[0074] In some embodiments, the sense strand and antisense strand form an siRNA shown in either Table 4 or Table 8.

[0075] In some embodiments, the antisense strand includes, from the 5' end to the 3' end, a nucleotide sequence that differs from the following nucleotide sequence by 0, 1, or 2 nucleotides: AfsCfsacuuUfuUfuguuUfcAfcaaacsasa.

[0076] The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.

[0077] In some embodiments, the sense strand includes a nucleotide sequence that differs from any of the following nucleotide sequences by 0, 1, or 2 nucleotides from its 5' end to its 3' end: gsusuUfguGfaAfAfCfaaaaaagugu; gsUfsuUfguGfaAfAfCfaaaaaagugu.

[0078] In each sequence of the present invention, a nucleotide written in lowercase indicates that the nucleotide is a 2'-O-methyl nucleotide, 'f' indicates that the nucleotide adjacent to its left is a 2'-fluorine-modified nucleotide, and 's' indicates that two adjacent nucleotides are linked via a thiophosphodiester bond.

[0079] The nucleic acids described in the present invention can be obtained by conventional methods in the art, such as solid-phase synthesis and liquid-phase synthesis. Regarding solid-phase synthesis, commercially available customized services are already available, making the modified nucleotide group commercially available. The modified nucleotide group can be introduced via a nucleotide monomer having the corresponding modification.

[0080] Based on the above-mentioned synthesized nucleic acid (siRNA), the present invention can further construct an shRNA expression plasmid having the same or similar function as the above-mentioned siRNA. Methods for constructing such expression plasmids are well known to those skilled in the art and will not be described in detail here.

[0081] The present invention further provides target gene sites of the nucleic acids described above. In some embodiments, the target gene sites are as shown in one of the first columns of Table 1.

[0082] [Table 1]

[0083] Human AGT code sequence (NM_001382817.3, SEQ ID NO:53): 1 agaaagtaga ccctcaccag gcatggaatc tgccagtgcc ttgatcttgg acttccagct 61 tccagaactg gtatgcggaa gcgagcaccc cagtctgaga tggctcctgc cggtgtgagc 121 ctgagggcca ccatcctctg cctcctggcc tgggctggcc tggctgcagg tgaccgggtg 181 tacatacacc ccttccacct cgtcatccac aatgagagta cctgtgagca gctggcaaag 241 gccaatgccg ggaagcccaa agacccccacc ttcatacctg ctccaattca ggccaagaca 301 tcccctgtgg atgaaaaggc cctacaggac cagctggtgc tagtcgctgc aaaacttgac 361 accgaagaca agttgaggc cgcaatggtc gggatgctgg ccaacttctt gggcttccgt 421 atatatggca tgcacagtga gctatggggc gtggtccatg gggccaccgt cctctcccca 481 acggctgtct ttggcaccct ggcctctctc tatctgggag cctggacca cacagctgac 541 aggctacagg caatcctggg tgttccttgg your area actgcacctc ccggctggat 601 gcgcacaagg tcctgtctgc cctgcaggct gtacagggcc tgctagtggc ccagggcagg 661 gctgatagcc aggcccagct gctgctgtcc acggtggtgg gcgtgttcac agcccaggc 721ctgcacctga agcagccgtt tgtgcagggc ctggctctct atacccctgt ggtcctccca 781 cgctctctgg acttcacaga actggatgtt gctgctgaga agattgacag gttcatgcag 841 901 gctttcaaca cctacgtcca cttccaaggg aagatgaagg gcttctccct gctggccgag 961 ccccaggagt tctgggtgga caacagcacc tcagtgtctg ttcccatgct ctctggcatg 1021 ggcaccttcc agcactggag tgacatccag gacaacttct cggtgactca agtgcccttc 1081 actgagagcg cctgcctgct gctgatccag cctcactatg cctctgacct ggacaaggtg 1141 gagggtctca ctttccagca aaactccctc aactggatga agaaactatc tccccggacc 1201 atccacctga ccatgcccca actggtgctg caaggatctt atgacctgca ggacctgctc 1261 gcccaggctg agctgcccgc cattctgcac accgagctga acctgcaaaa attgagcaat 1321 gaccgcatca gggtggggga ggtgctgaac agcatttttt ttgagcttga agcggatgag 1381 agagagccca cagagtctac ccaacagctt aacaagcctg aggtcttgga ggtgaccctg 1441 aaccgcccat tcctgtttgc tgtgtatgat caaagcgcca ctgccctgca cttcctgggc 1501 cgcgtggcca acccgctgag cacagcatga ggccagggcc ccagaacaca gtgcctggca 1561 aggcctctgc ccctggcctt tgaggcaaag gccagcagca gataacaacc ccggacaaat 1621 cagcgatgtg tcacccccag tctcccacct tttcttctaa tgagtcgact ttgagctgga 1681 aagcagccgt ttctccttgg tctaagtgtg ctgcatggag tgagcagtag aagcctgcag 1741 cggcacaaat gcacctccca gtttgctggg tttattttag agaatggggg tggggaggca 1801 agaaccagtg tttagcgcgg gactactgtt ccaaaaaga ttccaaccga ccagcttgtt 1861 tgtgaaca aaaagtgttc ccttttcaag ttgagaaca aaattgggtt ttaaaattaa 1921 father tttgcattgc cttcggtttg father cttgatgta agaacatgac 1981 ctccgtgtag tgtctgtaat accttagttt tttccacaga tgcttgtgat ttttgaacaa 2041 tacgtgaaag atgcaagcac ctgaatttct gtttgaatgc ggaaccatag ctggttattt 2101 ctcccttgtg ttagtaataa acgtcttgcc acaataagcc tccaaaaa

[0084] Targeted drug delivery systems The present invention further provides a targeted drug delivery system, characterized in that the targeted drug delivery system comprises a target group, a linking group, and the nucleic acid linked to the target group via the linking group.

[0085] Here, the target group can further enhance the targeting of small nucleic acids and may be provided from monosaccharides (e.g., glucose, mannose, allose, althrose, galactose, galactosamine, N-acetylgalactosamine, talose, fructose, idose, etc.) and / or polypeptides (e.g., proteins, monoclonal antibodies, nanoforms). The linking group may be selected from -O-[CH2CH2O]n-, -[CH2]m-CONH-[CH2]nO-, -O-[CH2CH2O]m-CONH-[CH2]nO-, and -O-[CH2]m-CONH-[CH2H2O]nO-, where m and n may each be an integer from 1 to 10 independently.

[0086] Based on common sense in this field, the nucleic acids (siRNAs) of the present invention exhibit excellent inhibitory effects even when applied to different targeted drug delivery systems. In other words, the effectiveness of the bare and modified sequences to be protected by the present invention is independent of the choice of target carrier. To further improve the bioavailability and therapeutic effect of siRNAs, the present invention further optimizes the targeted drug delivery system and provides the following technical solutions.

[0087] In some embodiments, the linking group is linked to the 3' or 5' end of the sense strand or antisense strand of the nucleic acid.

[0088] In some specific embodiments, the linking group is linked to the 3' end of the sense strand of the nucleic acid.

[0089] In some embodiments, the targeted drug delivery system includes a ligand and the nucleic acid linked to the ligand.

[0090] In some embodiments, the ligand is a GalNAc derivative.

[0091] In some embodiments, the ligand is one or more GalNAc derivatives linked via single-chain, double-chain, or triple-chain branched linkers.

[0092] In some preferred embodiments, the structure of the target drug delivery system is as shown in the following formula I.

[0093] [ka]

[0094] In formula I, Nu represents the nucleic acid (siRNA). In some embodiments, the compound portion in the system may be linked to the 5' or 3' end of the sense strand of the siRNA via a phosphate diester bond, or to the 5' or 3' end of the antisense strand of the siRNA via a phosphate diester bond. The targeted drug delivery system can improve the cell permeability of nucleic acid drugs (Nu) and enhance their intracellular stability by utilizing the structural properties on the left, and is easy to manufacture and highly practical.

[0095] Drug composition The present invention further provides a drug composition comprising the nucleic acid or targeted drug delivery system and a pharmaceutically acceptable carrier.

[0096] The drug composition can be prepared by conventional methods from the nucleic acid and the pharmaceutically acceptable carrier. For example, the drug composition may be an injectable solution. The injectable solution can be administered by subcutaneous injection, intramuscular injection, or intravenous injection.

[0097] In the drug composition described in the present invention, the amounts of nucleic acid or targeted drug delivery system and pharmaceutically acceptable carrier are not particularly required, and generally, the content of the pharmaceutically acceptable carrier per 1 part by weight of the nucleic acid (or 1 part by weight of the targeted drug delivery system in terms of nucleic acid) may be 1 to 100,000 parts by weight (for example, 1 part by weight, 5 parts by weight, 10 parts by weight, 50 parts by weight, 100 parts by weight, 500 parts by weight, 1,000 parts by weight, 5,000 parts by weight, 10,000 parts by weight, 50,000 parts by weight, 100,000 parts by weight, or any value between any two of the above numbers).

[0098] In the drug composition described in the present invention, the pharmaceutically acceptable carrier may be any carrier commonly used in the art, and may include, for example, at least one of a pH buffer, a protective agent, and an osmotic pressure modifier. The pH buffer may be a trimethylolaminomethane hydrochloride buffer with a pH of 7.5 to 8.5 and / or a phosphate buffer with a pH of 5.5 to 8.5, preferably a phosphate buffer with a pH of 5.5 to 8.5. The protective agent may be at least one of inositol, sorbitol, and sucrose. Based on the total weight of the drug composition, the content of the protective agent may be 0.01 to 30% by weight (for example, 0.01% by weight, 0.05% by weight, 0.1% by weight, 0.5% by weight, 1% by weight, 5% by weight, 10% by weight, 15% by weight, 20% by weight, 25% by weight, 30% by weight, or any value between any two of these numbers). The osmotic pressure modifier may be sodium chloride and / or potassium chloride. The content of the osmotic pressure adjusting agent is such that the osmotic pressure of the drug composition is 200 to 700 milliosmoles / kilogram. Based on the required osmotic pressure, a person skilled in the art can determine the content of the osmotic pressure adjusting agent.

[0099] In a preferred embodiment of the present invention, the pharmaceutically acceptable carrier is a liposome. The liposome may be any liposome capable of encapsulating nucleic acids, and its diameter may be 25 to 1000 nm, and it may contain, but is not limited to, cholesterol and its analogues or derivatives.

[0100] The amount of the drug composition used in the present invention may be a dose commonly used in the art, and the dose can be determined based on various parameters, particularly the age, weight, and sex of the subject. For example, for a female mouse 3-4 months old and weighing 25-30 g, the dose of the drug composition may be 0.01-100 mg / kg body weight, preferably 1-10 mg / kg body weight, depending on the amount of nucleic acid in the drug composition.

[0101] Methods and Uses The present invention further provides a method for suppressing the expression of angiotensin genes within cells, the method comprising contacting the cells with the nucleic acid, the targeted drug delivery system, or the drug composition to suppress the expression of angiotensin genes within the cells.

[0102] In some embodiments, the cells are located in the body of, for example, a human subject, such as a subject with an angiotensinogen (AGT)-related disease.

[0103] In some embodiments, the cells are located outside the body. The method is used for research purposes or to construct animal models.

[0104] In some embodiments, contacting the cells with the nucleic acid suppresses AGT expression by at least 50%, 60%, 70%, 80%, 90%, or 95% (for example, compared to the AGT expression level before the cells first come into contact with the nucleic acid, for example, compared to before the subject is administered an initial dose of the nucleic acid). In some embodiments, suppressing AGT expression can reduce the AGT protein level in the subject's serum sample by at least 50%, 60%, 70%, 80%, 90%, or 95% compared to the AGT expression level before the cells first come into contact with the nucleic acid.

[0105] The present invention further provides uses for the nucleic acid, the targeted drug delivery system, or the drug composition in either 1) treating and / or preventing angiotensin-related disorders, or 2) producing a drug for treating and / or preventing angiotensin-related disorders.

[0106] In some embodiments, the disease is (i) a disease associated with an enhancement or increase in angiotensin activity levels, or (ii) a disease that benefits from a decrease in angiotensinogen expression.

[0107] In some embodiments, the disease is a disease associated with the hyperactivation of the renin-angiotensin-aldosterone system (RAAS). In some specific embodiments, “diseases associated with the hyperactivation of the RAAS system” may include hypertension, heart failure, kidney disease, early-onset dementia, ophthalmic diseases, and the like.

[0108] In some embodiments, the disease is hypertension, hypertension, borderline hypertension, primary hypertension, secondary hypertension, simple systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, treatment-resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension. One or more of the following conditions are selected: hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic stenosis, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, nephropathy, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), glucose intolerance, type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus), and metabolic syndrome.

[0109] In the present invention, the subject may be a mammal and may include primates (e.g., humans and non-human primates such as monkeys and chimpanzees), non-primates (e.g., cattle, pigs, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, or mice), or birds. In some embodiments, the subject is preferably a primate, and more preferably a human. Administration can be carried out via various routes depending on whether local or systemic treatment is required. The method of administration may be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, transdermal (e.g., via an implantable device), or intra-soft tissue. Dosages can be found in the preceding text and are not described in detail here.

[0110] In some embodiments, the nucleic acid, the targeted drug delivery system, or the drug composition is administered to the subject by subcutaneous, intravenous, and / or intramuscular administration. [Examples]

[0111] Embodiments of the present invention will be described in detail below with reference to examples. It should be understood that these examples are used solely to illustrate the present invention and are not intended to limit the scope of the invention. For experimental methods in the following examples where specific conditions are not specified, the guidelines provided herein should be given priority, and experimental manuals or common conditions in the art may be followed, or other experimental methods known in the art may be referred to, or conditions recommended by the manufacturer may be followed.

[0112] In the following specific embodiments, unless otherwise specified, there may be slight deviations in the measurement parameters of the raw material components within the range of weighing accuracy. For temperature and time parameters, deviations within the permissible range due to the test accuracy or operating accuracy of the instrument are acceptable.

[0113] Example 1: Sequence screening of siRNA Double-stranded siRNA can enter cells and be incorporated into the RISC complex. In the RISC complex, the double-stranded siRNA is unwound by the endonuclease Ago2, leaving only the antisense strand for identifying the target mRNA. Generally, a GC content of 35–55% is considered optimal for siRNA selection. GC content is also related to the siRNA's melting temperature. However, siRNA with lower GC content can be unwound more quickly or efficiently due to its thermal stability. The siRNA sequences designed in this invention (as shown in Table 2) include siRNA sequences with lower GC content to better select the siRNA.

[0114] [Table 2]

[0115] Here, the GC content of the preferred sequence GUUUGUGAAACAAAAAAGUGU is 28.6%.

[0116] The sense strand and antisense strand sequences corresponding to the above sequence are shown in Table 1.

[0117] In this example, each sense strand and antisense strand was further modified, and the modified sequences are shown in Table 3.

[0118] [Table 3]

[0119] In the table, a / c / g / u = 2'-OMe nucleotide, Af / Cf / Gf / Uf = 2'-F nucleotide, and s = thiophosphodiester bond.

[0120] The sense strand and antisense strand from Table 2 are formed into the modified double-stranded siRNA shown in Table 4 using solid-phase synthesis.

[0121] [Table 4]

[0122] In the table, a / c / g / u = 2'-OMe nucleotide, Af / Cf / Gf / Uf = 2'-F nucleotide, and s = thiophosphodiester bond.

[0123] Add 0.5 ml of cell culture medium (DMEM, 10% calf serum, 1% penicillin + streptomycin solution) to a 96-well cell culture dish, and 10 4 Individual Hep3B (Procell, Cat#CL-0102) cells were seeded at 37°C and 5% CO2. 2 Incubate overnight in an incubator. Add RNAiMAX (1.5 microliters / well) and the small interfering nucleic acids (siRNA) listed in Table 3 to the Opti-MEM culture medium, add to the cell culture wells to achieve a final concentration of 1 nM or 10 nM per well, and incubate at 37°C in 5% CO2. 2The cells were incubated in an incubator for 48 hours. To extract RNA, the cell culture supernatant was aspirated and removed, washed with PBS, and aspirated again. Then, 50 μL of the prepared lysate (following the recommendations of the Cells-to-CT Kit (Thermo Fisher Scientific, Cat#4391851c)) was added and mixed uniformly. After standing for 10 minutes, 2.5 μL of Stop solution was added to stop the reaction for 2 minutes. RT-PCR was performed according to the recommendations of the High Capacity cDNA Reverse Transcription Kits (Thermo Fisher, Catalog No.: 4368814), with 10 ml of the lysated liquid included in each reaction. Gene expression quantification was measured by real-time fluorescence PCR. The TaqMan probe for human AGT was Hs00174854_m1, and the probe for the internal standard gene (human HPRT1) was Hs02800695_m1 (Thermo Fisher Scientific, Waltham, MA, USA). The PCR conditions were 95°C for 20 seconds (1 cycle), 95°C for 1 second, and 60°C for 20 seconds (40 cycles). The real-time fluorescence PCR instrument used was QuantStudio. TM The system used was the 6Pro Real-Time Fluorescence Quantitative PCR System (Thermo Fisher). AGT gene expression was calculated using 2^-ΔΔCt, with human HPRT1 gene expression used as the internal standard. AGT gene expression levels are shown as relative values ​​compared to a control group of cells using only RNAiMAX. The results are shown in Table 5.

[0124] [Table 5]

[0125] To further confirm the activity of siRNA, highly effective siRNAs from Table 5 were conjugated to Tri-GalNAc (see Formula I above for its specific structure, and Table 6 for the conjugated sequence). Subsequently, dose-response experiments were performed in primary human hepatocytes. Each siRNA-GalNAc sample was dissolved in 100 μL of enzyme-free sterile water to form a 100 μM solution. 30 μL of the 100 μM test solution was added to 70 μL of inVitroGRO Plating Medium and diluted to a 30 μM solution to prepare for use as a working solution for the 30 nM final concentration group. The 30 μM test solution was further diluted threefold at eight concentration points using inVitroGRO Plating Medium to obtain final working solution concentrations of 4.6, 13.7, 41.2, 123.4, 370.4, 1111.1, 3333.3, and 10000 nM. Human primary hepatocytes were removed from liquid nitrogen, thawed and revived at 37°C, washed and counted in serum-containing inVitroGRO Plating Medium, centrifuged to remove the supernatant, and then diluted to 300 k / mL with fresh serum-containing inVitroGRO Plating Medium. Next, 90 μL of the diluted cell solution was spread onto a 96-well cell culture plate so that the number of cells per well was 30 k, and the prepared sample working solution was added to the cell solution to achieve final concentrations of 0.46, 1.37, 4.12, 12.34, 37.04, 111.11, 333.33, and 1000 nM. The cells were then placed in a 5% carbon dioxide incubator and incubated at 37°C for 48 hours. After 48 hours, all culture medium in the 96-well culture plate was aspirated and removed, washed with 1×PBS buffer, and 50 μL of prepared Cells to CT lysis solution (as recommended by the manufacturer) was added and mixed uniformly. After standing for 10 minutes, 2.5 μL of stop solution was added to stop the reaction for 2 minutes. RT-PCR was performed according to the recommendations of the High Capacity cDNA Reverse Transcription Kits (Thermo Fisher, Catalog No.: 4368814), with 10 ml of the lysated liquid included in each reaction.Gene expression quantification was measured using real-time fluorescence PCR. The TaqMan probe for human AGT was Hs00174854_m1, and the probe for the internal standard gene (human HPRT1) was Hs02800695_m1 (Thermo Fisher Scientific, Waltham, MA, USA). PCR conditions were 95°C for 20 seconds (1 cycle), 95°C for 1 second, and 60°C for 20 seconds (40 cycles). The real-time fluorescence PCR instrument used was QuantStudio. TM The system used is the 6Pro Real-Time Fluorescence Quantitative PCR System (Thermo Fisher). AGT gene expression is calculated using 2^-ΔΔCt, with human HPRT1 gene expression used as the internal standard. AGT gene expression levels are expressed as a percentage relative to a control group of cells using only culture medium, and the IC50 value is calculated (see Table 7).

[0126] [Table 6]

[0127] In the table, a / c / g / u = 2'-OMe nucleotide, Af / Cf / Gf / Uf = 2'-F nucleotide, and s = thiophosphodiester bond.

[0128] [Table 7]

[0129] To further investigate the efficacy of siRNA, SN-682160, SN-682172, SN-682173, SN-682175, and SN-682176 were subcutaneously injected at a dose of 10 mg / kg each into human-derived AGT transgenic mice. Blood samples were collected on day 10 to detect the remaining AGT protein levels in the plasma, and the results are shown in Figure 1. From Figure 1, it can be seen that SN-682172 can knock down AGT protein levels to less than 90% on day 10.

[0130] Example 2: Optimization of siRNA modification method To further enhance the activity of siRNA, the siRNA is modified according to Table 8.

[0131] [Table 8]

[0132] In the table, a / c / g / u = 2'-OMe nucleotide, Af / Cf / Gf / Uf = 2'-F nucleotide, and s = thiophosphodiester bond.

[0133] To further confirm the activity of the siRNAs, dose-response experiments were conducted in human primary hepatocytes using the siRNAs listed in Table 8, with the same method as described above. The absolute IC50 values ​​that suppressed AGT expression are shown in Table 9.

[0134] [Table 9]

[0135] Example 3: Verification of the efficacy of siRNA in vitro To further verify the efficacy, preferred siRNA drugs were compared with SN-2073 in human primary hepatocytes. The siRNAs under consideration are shown in Table 10. Here, SN-2073, used as a comparison, was manufactured based on the information disclosed in US11015201B2. The experimental steps in human primary hepatocytes were similar to those described above. AGT gene expression levels are shown as a percentage relative to a control group of cells using only the solvent, and the results are shown in Table 11.

[0136] [Table 10]

[0137] In the table, a / c / g / u = 2'-OMe nucleotide, Af / Cf / Gf / Uf = 2'-F nucleotide, Tgn = thymidine ethylene glycol, s = thiophosphodiester bond. The structure used in SN-682726 and SN-682728 is shown in formula I, and the Tri-galNac used in SN-2073 is Alnylam Tri-GalNAc (L96). Since both the structure shown in formula I and L96 belong to the triantennary N-acetylgalactosamine classification, the advantages of the modified sequence of the present invention can also be confirmed based on the following effect data.

[0138] [Table 11]

[0139] Experiments involving the free intake of primary human liver cells revealed that SN-682726 and SN-682728 of the present invention have superior activity compared to SN-2073.

[0140] Example 4: Verification of the in vivo effects of siRNA To further investigate siRNA activity, human-derived AGT transgenic mice were subcutaneously injected with SN-682726 or SN-682728 at doses of 1, 3, or 10 mg / kg, respectively, on day 0. PBS was used as a blank control group, and human AGT protein levels in the blood were subsequently monitored. The results are shown in Figure 2.

[0141] Figure 2 shows that both SN-682726 and SN-682728 can significantly reduce AGT protein levels and have long-term therapeutic effects, with SN-682726 exhibiting particularly superior efficacy.

[0142] To further investigate the effect of modification on drug efficacy, SN-682726 and SN-2073 as a control were compared in human-derived AGT transgenic mice. Mice were subcutaneously injected with 1, 3, or 10 mg / kg of SN-682726 or SN-2073 compound, respectively, on day 0. PBS served as a blank control group, and human AGT protein levels in the blood were subsequently monitored. The results are shown in Figure 3.

[0143] Figure 3 shows that SN-682726 maintained longer-term efficacy than the SN-2073 compound in all dose groups, exhibiting a 40% knockdown effect even at 130 days post-injection. Furthermore, the AGT protein levels in the SN-2073 group, used as a comparison, had already recovered to baseline levels by 110 days post-injection, demonstrating the superior efficacy of SN-682726.

[0144] Furthermore, the efficacy advantage of the siRNA drug in this invention does not depend on the selection of the target carrier. When the TriGalNAc is replaced with another available carrier (such as L96 mentioned above) and the resulting siRNA drug is compared with SN-2073, it still exhibits the aforementioned remarkable efficacy advantage in both in vitro cell studies and in vivo experiments. For example, even when the TriGalNAc in SN-682726 is replaced with L96, a superior AGT expression silencing effect can be obtained in primary monkey hepatocytes compared to SN-2073, as shown in Table 12.

[0145] [Table 12]

[0146] When the modification of SN-682726 was also applied to SN-2073 (SN-683015 in Table 13), SN-683015 was found to have superior efficacy compared to SN-2073 in primary monkey hepatocytes, as shown in Table 14.

[0147] [Table 13]

[0148] [Table 14]

[0149] Furthermore, the unmodified SN-682726 sequence (SN-122726) and the unmodified SN-2073 sequence (SN-122073, Table 15) were compared in Hep3B cells at three concentrations (0.1, 1, and 10 nM), and the results are shown in Table 16. It can be seen that the unmodified SN-122726 in the present invention can more effectively reduce AGT expression levels.

[0150] [Table 15]

[0151] [Table 16]

[0152] The above examples merely illustrate some embodiments of the present invention, and although the description is relatively specific and detailed, it should not be understood as limiting the scope of the patent for the present invention. Furthermore, those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and all of these fall within the scope of protection of the present invention.

Claims

1. A nucleic acid comprising a sense strand and an antisense strand, The nucleic acid is characterized in that the sense strand contains a sequence having 80% or more sequence identity with the sequence shown in any of SEQ ID NO: 1 to 26, and the antisense strand contains a sequence having 80% or more sequence identity with the sequence shown in any of SEQ ID NO: 27 to 52.

2. The nucleic acid according to claim 1, wherein the antisense strand comprises at least 15 consecutive nucleotides that differ by up to 3 nucleotides from the sequence shown in any of SEQ ID NO: 27 to 52, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand, and optionally, the sense strand comprises at least 15 consecutive nucleotides that differ by up to 3 nucleotides from the sequence shown in any of SEQ ID NO: 1 to 26.

3. The nucleic acid according to claim 1, characterized in that the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence shown in any of SEQ ID NO: 29, 32, 38, 40, 41, 42, 43, or 44, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand, and optionally, the sense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence shown in any of SEQ ID NO: 3, 6, 12, 14, 15, 16, 17, or 18.

4. The nucleic acid according to claim 1, characterized in that the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence shown in any of SEQ ID NO: 29, 40, 41, 43, or 44, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand, and optionally, the sense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence shown in any of SEQ ID NO: 3, 14, 15, 17, or 18.

5. The nucleic acid according to claim 1, characterized in that the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 40 by 0, 1, or 2 nucleotides, the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand, and optionally the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 14 by 0, 1, or 2 nucleotides.

6. The nucleic acid according to claim 1, characterized in that the GC content in the nucleic acid is 20 to 45%, more preferably 20 to 35%.

7. At least one nucleotide in the nucleic acid is a modified nucleotide or includes a modified interbond, The modified nucleotide is preferably selected from one or more of 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-ring-open nucleotide analog, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribonol, reverse nucleotide, reverse 2'-O-methylnucleotide, reverse 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methylnucleotide, and the modified nucleotide is more preferably selected from one or more of 2'-O-methylnucleotide and 2'-fluoronucleotide. The nucleic acid according to claim 1, wherein the modified internucleotide bond is preferably selected from one or more of thiophosphate nucleotide internucleotide bonds and methylphosphonate nucleotide internucleotide bonds, and the modified internucleotide bond is more preferably selected from one or more of thiophosphate monoester nucleotide internucleotide bonds and thiophosphodiester nucleotide internucleotide bonds.

8. The antisense strand has 2'-O-methylnucleotides at the 5th and 6th nucleotides counted from the 5' end, and 2'-fluoronucleotides at the 7th nucleotide. Preferably, the nucleic acid according to claim 7, wherein the 5' and 3' ends of the antisense strand each contain two thiophosphate nucleotide interbonds, and the 1st, 2nd, 7th, 9th, 14th and 16th nucleotides, counting from the 5' end, are 2'-fluoronucleotides, and all remaining nucleotides are 2'-O-methylnucleotides.

9. The sense strand has a 2'-O-methylnucleotide or 2'-fluoronucleotide as its second nucleotide from the 5' end, preferably a 2'-O-methylnucleotide. Preferably, the nucleic acid according to claim 7 or 8, wherein the 5' end of the sense strand contains two thiophosphate nucleotide interbonds, the 4th, 7th, 9th, 10th and 11th nucleotides counting from the 5' end are 2'-fluoronucleotides, and all remaining nucleotides are 2'-O-methylnucleotides.

10. The nucleic acid according to claim 1, wherein the antisense strand has at least 15 consecutive nucleotides that differ by up to 3 nucleotides from the antisense strand sequence shown in either Table 3 or Table 8, and the sense strand has at least 15 consecutive nucleotides that differ by up to 3 nucleotides from the sense strand sequence shown in either Table 3 or Table 8, and preferably the sense strand and the antisense strand form an siRNA shown in either Table 4 or Table 8.

11. The antisense strand, from its 5' end to its 3' end, includes the following nucleotide sequence and a nucleotide sequence in which 0, 1, or 2 nucleotides differ: AfsCfsacuuUfuUfuguuUfcAfcaaacsasa, The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand. Preferably, the sense strand includes a nucleotide sequence from its 5' end to its 3' end that differs from any of the following nucleotide sequences by 0, 1, or 2 nucleotides: gsusuUfguGfaAfAfCfaaaaaagugu; gsUfsuUfguGfaAfAfCfaaaaaagugu, The nucleic acid according to claim 1, characterized in that in each sequence, a nucleotide written in lowercase indicates that the nucleotide is a 2'-O-methyl nucleotide; f indicates that the nucleotide adjacent to its left is a 2'-fluorine-modified nucleotide; and s indicates that two adjacent nucleotides are linked via a thiophosphodiester bond.

12. A targeted drug delivery system characterized by comprising a target group, a linking group, and a nucleic acid according to any one of claims 1 to 11 linked to the target group via the linking group.

13. The material comprises a ligand and a nucleic acid linked to the ligand, preferably the ligand is a GalNAc derivative, more preferably the ligand is one or more GalNAc derivatives linked via a single-stranded, double-stranded, or triple-stranded branched linker, and even more preferably the structure is 【Chemistry 1】 As shown, The targeted drug delivery system according to claim 12, characterized in that Nu represents the nucleic acid in the formula.

14. A drug composition comprising a nucleic acid according to any one of claims 1 to 11 or a targeted drug delivery system according to any one of claims 12 to 13, and a pharmaceutically acceptable carrier.

15. A method for suppressing the expression of angiotensin genes within cells, characterized by contacting the cells with the nucleic acid described in any one of claims 1 to 11, the targeted drug delivery system described in any one of claims 12 to 13, or the drug composition described in claim 14, thereby suppressing the expression of angiotensin genes within the cells.

16. 1) To treat and / or prevent angiotensin-related disorders, 2) Uses of the nucleic acid according to any one of claims 1 to 11, the targeted drug delivery system according to any one of claims 12 to 13, or the drug composition according to claim 14, in any one of manufacturing a drug for treating and / or preventing angiotensin-related disorders.

17. The aforementioned disease is, (i) Diseases associated with increased or elevated levels of angiotensin activity, (ii) The use according to claim 16, characterized in that the disease is one that benefits from a reduction in angiotensinogen expression.

18. The use according to claim 16, characterized in that the disease is a disease related to the overactivation of the renin-angiotensin-aldosterone system.

19. The aforementioned diseases include hypertension, hypertension, pre-eclampsia, primary hypertension, secondary hypertension, simple systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, treatment-resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, blood The use described in 16 is characterized by being selected from one or more of the following: vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic stenosis, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, nephropathy, renal failure, systemic sclerosis, intrauterine growth restriction, fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease (NAFLD), glucose intolerance, type 2 diabetes, and metabolic syndrome.

20. The use according to claim 16, characterized in that the nucleic acid, the targeted drug delivery system, or the drug composition is administered to a subject by subcutaneous, intravenous, and / or intramuscular administration.