Staffer array

Abstract

The techniques described herein generally relate to the preparation and production of recombinant AAVs.

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit of 35 U.S.C.§119(e) of U.S. Provisional Application No. 63 / 522,536, filed on June 22, 2023, the content of which is incorporated herein by reference in its entirety.

[0002] The technology described herein generally relates to the preparation and production of recombinant AAV.

Background Art

[0003] The presence of universal stuffer sequences in DNA molecules, such as plasmid DNA, closed - ended DNA molecules (clDNA) used in AAV vector production (use of rep - cap, Ad helper, and ITR - transduced genes), enables the use of a unique qPCR or ddPCR assay to quantify all residual DNA in purified AAV preparations. Some stuffer sequences induce unintended immune responses. In recent years, these stuffer sequences have raised regulatory and safety concerns because potential immunostimulatory CpG motifs have been detected in the sequences. Furthermore, some stuffers can potentially lead to the reconstitution of replicable viruses in the host during production and / or in previously infected hosts.

Summary of the Invention

Problems to be Solved by the Invention

[0004] Therefore, there is still a need in the art for a new synthetic stuffer that can provide a safe raw material for virus production. This disclosure addresses this need.

Means for Solving the Problems

[0005] In one embodiment, nucleic acids comprising short stuffer sequences are provided herein. In some embodiments, the short stuffer sequence comprises a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 6. In this specification, "short stuffer sequence" is also referred to as "short stuffer."

[0006] In some embodiments of any one of the embodiments described herein, the nucleic acid containing the short stuffer sequence is linear DNA. For example, the nucleic acid containing the short stuffer sequence may be closed-end linear double-stranded DNA (clDNA). The nucleic acid containing the short stuffer sequence may be circular DNA, such as plasmid DNA. For example, plasmid DNA may be a precursor plasmid DNA template for constructing clDNA.

[0007] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer sequence further comprises at least one protelomerase binding site. The short stuffer may be located upstream (5' end) or downstream (3' end) of the protelomerase binding site. Thus, in some embodiments of any one of the embodiments described herein, the short stuffer is located downstream of the protelomerase binding site. In some embodiments of any one of the embodiments described herein, the short stuffer is located upstream of the protelomerase binding site.

[0008] In some embodiments of any one of the embodiments described herein, the nucleic acid containing the short stuffer contains two protelomerase binding sites. The short stuffer may be located between or outside the two protelomerase binding sites. In some embodiments of any one of the embodiments described herein, the short stuffer is located between the two protelomerase binding sites. In some embodiments, the distance between the protelomerase binding site and the stuffer sequence is between 2 and 15 nucleotides. In some embodiments, the distance between the protelomerase binding site and the stuffer sequence is between 5 and 10 nucleotides. In some embodiments, the distance between the protelomerase binding site and the stuffer sequence is between 6 and 9 nucleotides.

[0009] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer sequence further comprises a xenotransgene operably ligated to one or more regulatory elements. It should be noted that the short stuffer may be located upstream (5' end) or downstream (3' end) of the xenotransgene. Thus, in some embodiments of any one of the embodiments described herein, the short stuffer is located upstream (i.e., 5') of the xenotransgene. In some other embodiments of any one of the embodiments described herein, the short stuffer is located downstream (i.e., 3') of the xenotransgene.

[0010] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer sequence further comprises at least one adeno-associated virus (AAV) reverse-terminal repeat (ITR) sequence. The short stuffer can be located upstream (5' end) or downstream (3' end) of the ITR. Thus, in some embodiments of any one of the embodiments described herein, the short stuffer is located upstream (e.g., 5' end) of the ITR sequence. In some embodiments of any one of the embodiments described herein, the short stuffer is located downstream (e.g., 3' end) of the ITR sequence. In some embodiments, the distance between the 5'ITR and the stuffer sequence is about 8 nucleotides to about 25 nucleotides. For example, the distance between the 5'ITR and the stuffer sequence is about 10 nucleotides to about 20 nucleotides. In some embodiments, the distance between the 5'ITR and the stuffer sequence is from about 16 nucleotides. In some embodiments, the distance between the 3'ITR and the stuffer sequence is about 8 nucleotides to about 25 nucleotides. For example, the distance between the 3'ITR and the stuffer sequence is approximately 10 to 20 nucleotides. In some other embodiments, the distance between the 3'ITR and the stuffer sequence is 16 bp.

[0011] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer further comprises at least one ITR sequence and a xenotransgene. The short stuffer, at least one ITR sequence and the xenotransgene can be arranged in any combination in the nucleic acid. For example, at least one ITR sequence may be located between the short stuffer and the xenotransgene. In another example, the xenotransgene may be located between the short stuffer and at least one ITR.

[0012] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer further comprises at least one protelomerase binding site and at least one ITR sequence. It should be noted that the short stuffer, at least one protelomerase binding site and at least one ITR sequence may be arranged in any combination in the nucleic acid. For example, the short stuffer may be located between at least one protelomerase binding site and at least one ITR.

[0013] In some embodiments of any one of the embodiments described herein, the nucleic acid containing the short stuffer includes at least two ITRs. The short stuffer can be positioned between the two ITRs or outside the two ITRs. In some embodiments, the short stuffer is located outside the two ITRs. For example, the short stuffer can be positioned upstream of the two ITRs (e.g., 5'). In another example, the short stuffer can be positioned downstream of the two ITRs (e.g., 3').

[0014] In some embodiments of any one of the aspects described herein, the nucleic acid containing the short stuffer includes two ITRs and a xenotransgene. Generally, the xenotransgene is located between the two ITRs. For example, the xenotransgene is located between the two ITRs, and one of the ITRs is located between the short stuffer and the xenotransgene. It should be noted that the short stuffer can be located upstream (e.g., 5') or downstream of one or both of the two ITRs. For example, the nucleic acid includes a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the xenotransgene is located between the first ITR sequence and the second ITR sequence, and the short stuffer is located upstream of the first ITR sequence. In another example, the nucleic acid contains a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the xenotransgene is located between the first and second ITR sequences, and the short stuffer is downstream of the second ITR sequence.

[0015] In some embodiments of any one of the aspects described herein, one of the ITRs is a mutant ITR that has a deletion of the Rep-nicking site (trs), thereby promoting the generation of a self-complementary (sc) genome of AAV as described in U.S. Patent No. 7,790,154 (which is incorporated herein by reference in its entirety). In a non-limiting example, the vector construct has a mutation in one TR such that the Rep-nicking site (trs) is deleted and the other TR is wild-type. This causes rolling hairpin replication to begin from the wild-type (wt) end of the genome, pass through the mutant end without termination, and then continue back across the genome to form a dimer. The final product is a self-complementary genome with the mutant TR in the middle and wt TRs at each end. Replication and packaging of this molecule then proceed normally from the wt TR, except that the dimeric structure is maintained in each iteration. In some embodiments, the short stuffer sequence of the present invention may be located upstream (e.g., 5') or downstream (e.g., 3') of the mutant ITR. In one preferred embodiment, the short stuffer sequence is located upstream (e.g., 5') of the mutant ITR and / or downstream (e.g., 3') of the wt ITR.

[0016] In some embodiments of one aspect described herein, a template for preferentially constructing a duplicated vector is constructed using a soluble AAV TR at one end, and the modified AAV TR is constructed by inserting a sequence into the TR as described in U.S. Patent No. 7,790,154, which is incorporated herein by reference in its entirety. In some embodiments, the short stuffer sequence of the present invention may be located upstream (e.g., 5') or downstream (e.g., 3') of the modified ITR, including the insertion. The insertion of the linker displaces the wt AAV nicking site inward from its native position, making it impossible to cleave by the AAV Rep protein after replication. These substrates accumulate dimeric intermediates until gene conversion occurs. These molecules produced are dimers in form (covalently linked via the modified TR), and more specifically, they are self-complementary, thus providing an excellent source of parvovirus vectors carrying double-stranded substrates. In a non-restrictive example, the wt AAV plasmid psub201 can be used to produce this template, as described by Samulski et al. (1987) J. Virology 61:3096.

[0017] In some embodiments of any one aspect described herein, a nucleic acid comprising a short stuffer sequence comprises a single ITR and a 56 bp recognition sequence for protelomerase (TelN) to covalently bond the upper and lower strands, and a nucleic acid coding vector can be generated using only a single ITR, as described as a closed-end double-stranded AAV (cceAAV) in Zhang et al., Molecular Therapy, Methods and Clinical Development, Volume 32, Issue 1, 101206, March 14, 2024, which is incorporated herein by reference in its entirety. In some embodiments, the short stuffer sequence is located upstream (e.g., 5') or downstream (e.g., 3') of the ITR sequence. In preferred embodiments, the short stuffer sequence of the present invention is located upstream (e.g., 5') of the single ITR. In specific embodiments, the short stuffer sequence is located upstream (e.g., 5') or downstream (e.g., 3') of the 56 bp recognition sequence for protelomerase (TelN). In one preferred embodiment, the short stuffer sequence is located downstream (e.g., 3') of the 56 bp recognition sequence of the protelomerase (TelN) sequence. In some embodiments of any one of the embodiments described herein, the nucleic acid containing the short stuffer sequence contains one ITR.

[0018] In the nucleic acids described herein, each ITR sequence is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 ITR sequences and / or chimeras of 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A can be independently selected. Note that if the nucleic acids described herein contain two or more ITR sequences, the ITR sequences may originate from the same AAV serotype or from different AAV serotypes. Therefore, in some embodiments of any one of the embodiments described herein, the ITR sequences originate from the same AAV serotype. In some embodiments of any one of the embodiments described herein, the ITR sequences originate from different AAV serotypes.

[0019] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer sequence further comprises at least one AAV ITR sequence comprising a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one nucleotide sequence of SEQ ID NOs. 71 or 82-89.

[0020] In some embodiments of any one of the embodiments described herein, the short stuffer is located upstream of the ITR sequence (e.g., at the 5' end), and the ITR includes a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one of the nucleotide sequences of SEQ ID NOs. 71 or 82-89. In some embodiments of any one of the embodiments described herein, the short stuffer is located downstream of the ITR sequence (e.g., at the 3' end), and the ITR includes a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one of the nucleotide sequences of SEQ ID NOs. 71 or 82-89.

[0021] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer further comprises at least one ITR sequence and a xenotransgene, wherein the ITR comprises a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one nucleotide sequence of SEQ ID NOs. 71 or 82-89. In these embodiments, the short stuffer, at least one ITR sequence, and xenotransgene can be arranged in any combination in the nucleic acid. For example, at least one ITR sequence may be located between the short stuffer and the xenotransgene. In another example, the xenotransgene may be located between the short stuffer and at least one ITR.

[0022] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer further comprises at least one protelomerase binding site and at least one ITR sequence, the ITR comprising a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one nucleotide sequence of SEQ ID NOs. 71 or 82-89.

[0023] In these embodiments, the short stuffer, at least one protelomerase binding site, and at least one ITR sequence can be arranged in any combination within the nucleic acid. For example, the short stuffer may be located between at least one protelomerase binding site and at least one ITR.

[0024] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer comprises at least two ITRs, each ITR independently comprising a nucleotide sequence having at least 85% identity (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, i.e., completely identical) to any one nucleotide sequence of SEQ ID NOs. 71 or 82-89. In these embodiments, the short stuffer can be located between the two ITRs or outside the two ITRs. In some embodiments, the short stuffer is located outside the two ITRs. For example, the short stuffer can be located upstream (e.g., 5') of the two ITRs. In another example, the short stuffer can be located downstream (e.g., 3') of the two ITRs.

[0025] In some embodiments of any one of the aspects described herein, a nucleic acid comprising a short stuffer comprises two ITRs and a heterologous transgene, and each ITR independently comprises a nucleotide sequence having at least 85% (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%, i.e., completely identical) identity to any one of the nucleotide sequences of SEQ ID NO: 71 or 82-89. In these embodiments, the heterologous transgene can be located between the two ITRs. For example, the heterologous transgene is located between the two ITRs, and one of the ITRs is located between the short stuffer and the heterologous transgene. It should be noted that the short stuffer can be arranged upstream (e.g., 5') or downstream of one or both of the two ITRs. For example, the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterologous transgene is located between the first ITR sequence and the second ITR sequence, and the short stuffer is upstream of the first ITR sequence. In another example, the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterologous transgene is located between the first ITR sequence and the second ITR sequence, and the short stuffer is downstream of the second ITR sequence.

[0026] In some embodiments of any one of the aspects described herein, a nucleic acid comprising a short stuffer further comprises a nucleic acid sequence encoding one or more helper proteins that assist AAV replication and thus rAAV production.

[0027] In some embodiments of any one of the aspects described herein, a nucleic acid comprising a short stuffer further comprises a nucleic acid sequence encoding one or more helper proteins that assist rAAV production and at least one protelomerase binding site. Note that the short stuffer, the at least one protelomerase binding site, and the nucleic acid sequence encoding one or more helper proteins can be arranged in any combination in the nucleic acid. For example, the short stuffer can be located between the protelomerase binding site and the nucleic acid sequence encoding one or more helper proteins. Further, the short stuffer can be upstream (5') or downstream (3') of the nucleic acid sequence encoding one or more helper proteins. In some embodiments, the short stuffer is upstream of the 5' end of the nucleic acid sequence encoding one or more helper proteins. In some other embodiments, the short stuffer is downstream of the 3' end of the nucleic acid sequence encoding one or more helper proteins.

[0028] Helper proteins that assist rAAV production can include one or more of the E2A region, the E4 region, and the viral associated (VA) RNA region. In some embodiments, helper proteins that assist rAAV production can optionally include one or more of the E1 region, the E3 region, and / or the major late promoter (MLP) region. In some embodiments of any one of the aspects described herein, the helper protein is a helper protein of adenovirus. In some embodiments of any one of the aspects described herein, the nucleic acid sequence encoding one or more helper proteins comprises a nucleotide sequence having at least 85% identity to any one of the nucleotide sequences of SEQ ID NOs: 67-70.

[0029] In some embodiments of any one of the aspects described herein, a nucleic acid comprising a short stuffer further comprises a nucleic acid sequence encoding AAV rep protein and AAV cap protein.

[0030] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer further comprises at least one protelomerase binding site and a nucleic acid sequence encoding an AAV rep protein and an AAV cap protein.

[0031] It should be noted that the short stuffer, at least one protelomerase binding site, and the nucleic acid sequences encoding the AAV rep and AAV cap proteins can be arranged in any combination within the nucleic acid. For example, the short stuffer may be located between at least one protelomerase binding site and the nucleic acid sequences encoding the AAV rep and AAV cap proteins. Furthermore, the short stuffer may be upstream (5') or downstream (3') of the nucleic acid sequences encoding the AAV rep and AAV cap proteins. In some embodiments, the short stuffer is upstream of the 5' end of the nucleic acid sequences encoding the AAV rep and AAV cap proteins. For example, the short stuffer is upstream of the 5' end of the nucleic acid sequences encoding the AAV rep and AAV cap proteins, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequences encoding the AAV rep and AAV cap proteins. In some other embodiments, the short stuffer is downstream of the 3' end of the nucleic acid sequences encoding the AAV rep and AAV cap proteins. For example, the short stuffer is located downstream of the 3' end of the nucleic acid sequence encoding the AAV rep protein and AAV cap protein, and is situated between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and AAV cap protein.

[0032] AAV rep proteins and AAV cap proteins may be independent of any AAV serotype. For example, AAV rep protein and AAV cap protein are independent of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV These proteins originate independently of JEA, AAV2 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimeras thereof. It should be noted that AAV rep proteins and AAV cap proteins may originate from the same or different AAV serotypes. Therefore, in some embodiments, the AAV Rep protein and AAV Cap protein originate from the same AAV serotype. In some other embodiments, the AAV Rep protein and AAV Cap protein originate from different AAV serotypes.

[0033] In some embodiments of any one of the embodiments described herein, the nucleic acid containing a short stuffer further comprises a stop codon (e.g., TAA, TAG, or TGA). If the nucleic acid contains a stop codon, the short stuffer may be located downstream (3' end) or upstream (5' end) of the stop codon. Thus, in some embodiments, the nucleic acid contains a stop codon upstream (5' end) of the short stuffer. In some other embodiments, the nucleic acid contains a stop codon upstream (3' end) of the short stuffer.

[0034] In some embodiments of any one of the embodiments described herein, the nucleic acid comprises at least one ITR sequence and a protelomerase binding site upstream of the ITR sequence, the short stuffer comprises the sequence of SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to either SEQ ID NO: 1 or 4, and the short stuffer is located between the ITR and the protelomerase binding site.

[0035] In some embodiments of any one of the embodiments described herein, the nucleic acid comprises at least one ITR sequence and a protelomerase binding site downstream of the ITR sequence, the short stuffer comprises the sequence of SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to either SEQ ID NO: 1 or 4, and the short stuffer is located between the ITR and the protelomerase binding site.

[0036] Another embodiment described herein is a nucleic acid containing a large stuffer. Generally, a large stuffer contains a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs. 7-9 or 81, or a nucleotide sequence complementary to any one of SEQ ID NOs. In this specification, "large stuffer" is also referred to as "large stuffer sequence."

[0037] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a large stuffer further comprises nucleic acid sequences encoding AAV Rep protein and AAV cap protein operably ligated to one or more promoters. It should be noted that the large stuffer may be located upstream (e.g., at the 5' end) or downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein. For example, the large stuffer may be located upstream (e.g., at the 5' end) of the nucleic acid sequence encoding the AAV Rep protein. In another example, the large stuffer may be located downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein.

[0038] In some embodiments, the large stuffer is located within the nucleic acid sequence encoding the AAV Rep protein. For example, the large stuffer is located in an intron of the nucleic acid sequence encoding the AAV Rep protein.

[0039] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a large stuffer further comprises a nucleic acid sequence encoding an AAV Rep protein operably ligated to a promoter, with the large stuffer located upstream of the promoter. In some other embodiments of any one of the embodiments described herein, the nucleic acid comprising a larger stuffer further comprises a nucleic acid sequence encoding an AAV Rep protein operably ligated to a promoter, with the large stuffer located downstream of the promoter.

[0040] Exemplary AAV rep promoters include, but are not limited to, the p5 promoter and the p19 promoter. Therefore, in some embodiments, the nucleic acid containing the larger stuffer further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to the p19 promoter, with the larger stuffer located upstream of the promoter. In some other embodiments, the nucleic acid containing the larger stuffer further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to the p19 promoter, with the larger stuffer located downstream of the promoter.

[0041] It should be noted that the AAV rep protein can be a large AAV rep protein or a small AAV rep protein. Therefore, in some embodiments, the AAV rep protein is a large AAV rep protein. For example, the AAV rep protein is Rep68 or Rep78. In some embodiments of any one of the embodiments described herein, the AAV Rep is a large Rep (Rep68).

[0042] It should be noted that AAV Rep proteins can be modified AAV Rep proteins.

[0043] In some embodiments of various models, the nucleic acid containing a larger stuffer further includes nucleic acid sequences encoding AAV Rep protein and AAV cap protein operably linked to a promoter. It should be noted that the sequence encoding the AAV Rep protein may be upstream or downstream of the sequence encoding the AAV cap protein. For example, the sequence encoding the AAV Rep protein may be upstream (e.g., at the 5' end) of the sequence encoding the AAV Cap protein. In another example, the sequence encoding the AAV Rep protein may be downstream (e.g., at the 3' end) of the sequence encoding the AAV Cap protein.

[0044] Generally speaking, large stuffers are not of mammalian origin. In other words, large stuffers do not contain mammalian-derived nucleotide sequences.

[0045] In some embodiments of any one of the models described herein, the large stuffer includes a nucleotide sequence of non-mammalian origin.

[0046] In some embodiments of any one of the embodiments described herein, the large stuffer is synthetic.

[0047] In some embodiments of any one of the features described herein, the large stuffer does not contain more than one of the following (for example, one, two, three, four, five, six, seven, or eight of the following): transcription factor binding sites; regulatory elements; AAV Rep binding sites; donor or acceptor splicing sites; endonuclease cleavage sites, the endonucleases may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; repeat sequences or palindromic sequences longer than 5 nucleotides; strong secondary structures; or repeat sequences or palindromic sequences, repeat sequences or palindromic sequences longer than 5 nucleotides.

[0048] In some embodiments of any one of the aspects described herein, the large stuffer contains a GC content of less than about 50%, for example, less than about 45%, or less than about 40%.

[0049] In some embodiments of any one of the embodiments described herein, the nucleic acid containing the large stuffer is greater than 5.5 kb.

[0050] In some embodiments of any one of the models described herein, a large stuffer includes an array MAG upstream of which M is A or C.

[0051] In some embodiments of any one of the models described herein, the large stuffer is at least 2kb in size.

[0052] A further embodiment described herein is a nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10. In some embodiments, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises a large stuffer of at least 2 kb in size.

[0053] In some embodiments of any one of the aspects described herein, a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 contains one or more nucleotides between positions 45 and 46 of SEQ ID NO: 10. For example, a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 contains about 10 to about 10,000 nucleotides between positions 45 and 46 of SEQ ID NO: 10. In some embodiments, a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 contains about 2,000 to about 10,000 nucleotides between positions 45 and 46 of SEQ ID NO: 10.

[0054] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises a nucleic acid sequence encoding an AAV Rep protein operably ligated to a promoter. It should be noted that the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located upstream (e.g., at the 5' end) or downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located upstream (e.g., at the 5' end) of the nucleic acid sequence encoding the AAV Rep protein. In another example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein.

[0055] In some embodiments of any one of the aspects described herein, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in the nucleic acid sequence encoding the AAV Rep protein. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in an intron within the nucleic acid sequence encoding the AAV Rep protein.

[0056] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter, wherein the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located upstream of the promoter. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located upstream of the p19 promoter.

[0057] In some other embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter, wherein the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is downstream of the promoter. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is downstream of the p19 promoter.

[0058] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter. It should be noted that the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located upstream (e.g., at the 5' end) or downstream (e.g., at the 3' end) of the nucleic acid sequences encoding AAV Rep and AAV Cap proteins. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located upstream (e.g., at the 5' end) of the nucleic acid sequences encoding AAV Rep and AAV Cap proteins. In another example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 may be located downstream (e.g., at the 3' end) of the nucleic acid sequences encoding AAV Rep and AAV Cap proteins.

[0059] In some embodiments of any one of the embodiments described herein, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in the nucleic acid sequence encoding the AAV Rep protein and the AAV Cap protein. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in an intron within the nucleic acid sequence encoding the AAV Rep protein and the AAV Cap protein.

[0060] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter, wherein the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located upstream of the promoter. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located upstream of the p19 promoter.

[0061] In some other embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter, wherein the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is downstream of the promoter. For example, the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is downstream of the p19 promoter.

[0062] In some embodiments of any one of the embodiments described herein, a large stuffer having a size of at least 2 kb is located between positions 44 and 45 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10.

[0063] In some embodiments of any one of the embodiments described herein, a large stuffer having a size of at least 2 kb comprises a nucleotide sequence having at least 85% identity to any one of the nucleotide sequences of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81.

[0064] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is greater than 5.5 kb.

[0065] In some embodiments of any one of the models described herein, the large stuffer having a size of at least 2 kb does not contain a mammalian nucleotide sequence.

[0066] In some embodiments of any one of the embodiments described herein, the large stuffer having a size of at least 2 kb comprises a nucleotide sequence of non-mammalian origin.

[0067] In some embodiments of any one of the models described herein, the large stuffer having a size of at least 2kb is synthetic.

[0068] In some embodiments of any one of the embodiments described herein, a large stuffer having a size of at least 2 kb does not contain more than one of the following (e.g., 1, 2, 3, 4, 5, 6, 7, or 8): transcription factor binding sites; regulatory elements; AAV Rep binding sites; donor or acceptor splicing sites; endonuclease cleavage sites where the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; repeat sequences or palindromic sequences longer than 5 nucleotides; and / or strong secondary structures; or repeat sequences or palindromic sequences, repeat sequences or palindromic sequences longer than 5 nucleotides.

[0069] In some embodiments of any one of the embodiments described herein, a large stuffer having a size of at least 2 kb comprises a nucleotide sequence having at least 85% of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81.

[0070] In some embodiments of any one of the models described herein, the 5' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to sequence MAG, where M is A or C. In some embodiments, the 3' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to A or G. For example, the 5' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to sequence MAG, where M is A or C, and the 3' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to A or G.

[0071] In some embodiments of any one of the models described herein, a large stuffer having a size of at least 2kb is located downstream of the array MAG, where M is A or C.

[0072] In some embodiments of any one of the embodiments described herein, the nucleic acid comprises a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 11 to 13, or a nucleotide sequence complementary to any one of the SEQ ID NOs: 1 to 13. For example, the nucleic acid comprises a nucleotide sequence having at least 85% identity with SEQ ID NO: 13, or a nucleotide sequence complementary to SEQ ID NO: 13.

[0073] In some embodiments of any one of the aspects described herein, nucleic acids described herein, for example, nucleic acids containing large stuffers, interfere with the production of replication-competent rAAV vectors.

[0074] In some embodiments of any of the embodiments described herein, the nucleic acids described herein may be single-stranded or double-stranded. In some embodiments of any of the embodiments described herein, the nucleic acid is linear DNA. For example, the nucleic acid is closed-end linear double-stranded DNA (clDNA). Alternatively, clDNA is also called closed-end DNA or neDNA. Examples of closed linear double-stranded DNA molecules or closed-end DNA molecules include, but are not limited to, doggibone DNA (dbDNA) and dumbbell-shaped DNA.

[0075] In some embodiments of any one of the aspects described herein, the nucleic acid described herein is a vector such as a plasmid, bacmid, or cosmid.

[0076] In other embodiments described herein, the host cell is a host cell containing the nucleic acid described herein. In some embodiments, the host cell may be a prokaryotic cell, such as a bacterial cell. Examples of bacterial cells that may be host cells include, but are not limited to, Escherichia coli (E. coli). In some embodiments, the host cell may be a eukaryotic cell. For example, the host cell may be an insect cell or a mammalian cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is HEK293 or a HeLa cell.

[0077] In some embodiments of any one of the embodiments described herein, the host cell comprises at least one nucleic acid encoding one or more helper proteins that assist in rAAV production, at least one nucleic acid encoding AAV rep protein and AAV cap protein, and at least one nucleic acid encoding the transgene of interest. For example, the host cell comprises at least one nucleic acid encoding one or more helper proteins that assist in AAV replication and rAAV production, at least one nucleic acid encoding AAV rep protein and AAV cap protein, and at least one nucleic acid encoding the transgene of interest, wherein the nucleic acids encoding AAV rep protein and AAV cap protein include the large stuffer described herein.

[0078] In another example, a host cell comprises at least one nucleic acid encoding one or more helper proteins that assist in rAAV production, at least one nucleic acid encoding AAV rep protein and AAV cap protein, and at least one nucleic acid encoding the transgene of interest, wherein at least one (e.g., one or both) of the nucleic acids encoding the one or more helper proteins and the nucleic acid encoding the transgene comprises the short stuffer described herein.

[0079] In yet another example, a host cell comprises at least one nucleic acid encoding one or more helper proteins that assist in rAAV production, at least one nucleic acid encoding AAV rep protein and AAV cap protein, and at least one nucleic acid encoding the transgene of interest, wherein at least one (e.g., one or both) of the nucleic acids encoding the one or more helper proteins and the nucleic acid encoding the transgene comprises a short stuffer as described herein, and the nucleic acid encoding the AAV rep protein and AAV cap protein comprises a large stuffer as described herein.

[0080] Another aspect described herein is the use of nucleic acids or host cells described herein in a method for producing multiple viral particles. For example, the use of nucleic acids containing short stuffers or cells containing them in a method for producing multiple viral particles, such as recombinant AAV (rAAV) particles. Although we do not wish to be bound by theory, nucleic acids containing large stuffers and / or sequences having at least 85% identity with Sequence ID No. 10 described herein may prevent the production of rAAV with replication ability.

[0081] Another aspect described herein is a method for producing multiple viral particles. This method comprises culturing a host cell containing nucleic acid described herein, for example short stuffer, in a culture medium under conditions that produce viral particles, for example rAAV particles.

[0082] While we do not wish to be bound by theory, the Stuffer sequences described herein do not interfere with vector production. [Brief explanation of the drawing]

[0083] [Figure 1A] This is a schematic diagram showing fragments containing short stuffers for functional validation. The selected stuffers were cloned upstream of the luciferase reporter gene to detect potential transcriptional activity. For comparison, negative control (no stuffer sequences) and positive control (CMV promoter) sequences were also designed. Fragments with stop codons contain stuffer sequences #3, #6, and #7. Fragments without stop codons contain stuffer sequences #2, #8, and #9. [Figure 1B]This is a schematic diagram showing fragments containing short stuffers for functional validation. The selected stuffers were cloned upstream of the luciferase reporter gene to detect potential transcriptional activity. For comparison, negative control (no stuffer sequences) and positive control (CMV promoter) sequences were also designed. Fragments with stop codons contain stuffer sequences #3, #6, and #7. Fragments without stop codons contain stuffer sequences #2, #8, and #9. [Figure 2A-1] This is a schematic diagram of the stuffer sequences subcloned into the precursor backbone. Figure 2A: Control (negative, positive, original stuffer); Figure 2B: Test (stuffer #3, #6, #7 with stop codon); Figure 2C: Test (stuffer #2, #8, #9 without stop codon). [Figure 2A-2] This is a schematic diagram of the stuffer sequences subcloned into the precursor backbone. Figure 2A: Control (negative, positive, original stuffer); Figure 2B: Test (stuffer #3, #6, #7 with stop codon); Figure 2C: Test (stuffer #2, #8, #9 without stop codon). [Figure 2B] This is a schematic diagram of the stuffer sequences subcloned into the precursor backbone. Figure 2A: Control (negative, positive, original stuffer); Figure 2B: Test (stuffer #3, #6, #7 with stop codon); Figure 2C: Test (stuffer #2, #8, #9 without stop codon). [Figure 2C] This is a schematic diagram of the stuffer sequences subcloned into the precursor backbone. Figure 2A: Control (negative, positive, original stuffer); Figure 2B: Test (stuffer #3, #6, #7 with stop codon); Figure 2C: Test (stuffer #2, #8, #9 without stop codon). [Figure 3A] This study investigated the amplification of precursor plasmids and the production of neDNA containing novel stuffer sequences on a 20 mL scale, including stuffer sequence neDNA production. Figure 3A shows identity by size confirmation, and Figure 3B shows identity by Sanger sequencing. [Figure 3B]This study investigated the amplification of precursor plasmids and the production of neDNA containing novel stuffer sequences on a 20 mL scale, including stuffer sequence neDNA production. Figure 3A shows identity by size confirmation, and Figure 3B shows identity by Sanger sequencing. [Figure 4] This is a schematic diagram of stuffer sequence-luciferase neDNA transfection into HEK293 cells. [Figure 5] This figure shows the luciferase enzyme activity of different neDNAs relative to total protein 48 hours after transfection of HEK293 cells. Results are expressed as relative optic units per microgram of total protein. Simulation: No neDNA. Statistical analysis: One-way ANOVA multiple comparison. ****: P<0.0001, ns: Not significant. [Figure 6] This figure shows luciferase mRNA expression 48 hours after transfection, relative to β-actin mRNA. [Figure 7] This is a schematic diagram of an experimental design to investigate whether the stuffer sequence located immediately downstream of the TelRL sequence (ATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATA, SEQ ID NO: 14) has promoter activity in vivo, so that it is determined by luciferase expression (mRNA and enzyme activity). [Figure 8-1] This figure shows that all stuffer sequences drive a similar level of luciferase expression (mRNA) compared to the construct without stuffer. Luciferase expression was observed at the mRNA level, but no protein activity was detected. This was consistent with the results of in vitro cell culture experiments. [Figure 8-2] This figure shows that all stuffer sequences drive a similar level of luciferase expression (mRNA) compared to the construct without stuffer. Luciferase expression was observed at the mRNA level, but no protein activity was detected. This was consistent with the results of in vitro cell culture experiments. [Figure 8-3] This figure shows that all stuffer sequences drive a similar level of luciferase expression (mRNA) compared to the construct without stuffer. Luciferase expression was observed at the mRNA level, but no protein activity was detected. This was consistent with the results of in vitro cell culture experiments. [Figure 9-1] This figure shows that even after normalization by plasmid copy number, there are no clear differences in expression among the stuffers. Luciferase mRNA expression in animals injected with DNA is substantially above background levels (mice administered by vehicle showed no expression). The TelRL sequence appears to be responsible for low levels of expression in the liver. [Figure 9-2] This figure shows that even after normalization by plasmid copy number, there are no clear differences in expression among the stuffers. Luciferase mRNA expression in animals injected with DNA is substantially above background levels (mice administered by vehicle showed no expression). The TelRL sequence appears to be responsible for low levels of expression in the liver. [Figure 10] This figure examines four different AAV products for validation in in vivo trials. [Figure 11] This is a diagram identifying the AAV9 2L batch. [Figure 12-1] This figure shows genome titers determined by ddPCR. [Figure 12-2] This figure shows genome titers determined by ddPCR. [Figure 13] This figure compares genome titers obtained by ITR-ddPCR with particle titers obtained by SEC-HPLC. [Figure 14] This figure shows the values ​​obtained from ITR ddPCR and SEC-HPLC. [Figure 15A]This figure shows the copies / mL (Figure 15A) and relative percentage of residual neDNA and pDNA in the purified AAV vector relative to the ITR ddPCR (Figure 15A) titer. Residual neDNA is detected by ddPCR using primers and probes targeting the stuffer 2, stuffer 7, 5'TelRS, or 3'TelRS sequence, depending on the neDNA used for AAV production. Residual pDNA is detected by ddPCR using primers and probes targeting the kanamycin resistance coding sequence. [Figure 15B] This figure shows the copies / mL (Figure 15A) and relative percentage of residual neDNA and pDNA in the purified AAV vector relative to the ITR ddPCR (Figure 15A) titer. Residual neDNA is detected by ddPCR using primers and probes targeting the stuffer 2, stuffer 7, 5'TelRS, or 3'TelRS sequence, depending on the neDNA used for AAV production. Residual pDNA is detected by ddPCR using primers and probes targeting the kanamycin resistance coding sequence. [Figure 16] This figure shows the genome integrity of the vector as determined by AGE. [Figure 17] This figure shows the design of a synthetic stuffer for the "neutral" array. [Figure 18-1] This figure shows the design of the final rep-cap cassette with synthetic stuffing. [Figure 18-2] This figure shows the design of the final rep-cap cassette with synthetic stuffing. [Figure 19-1] This figure shows the experimental design for the selection between rep-cap cassettes and 2 / 8 rep-caps. [Figure 19-2] This figure shows the experimental design for the selection between rep-cap cassettes and 2 / 8 rep-caps. [Figure 20] This figure shows a comparison of ddPCR titers and residual plasmids for pRC2-8_SynINT2.2, pRC2-8_SynINT3.1, and pRC2-8_SynINT3.2 on February 8th. [Figure 21]This figure shows the residual plasmid ratios of pRC2-8_SynINT2.2, pRC2-8_SynINT3.1, and pRC2-8_SynINT3.2 on February 8th. [Figure 22] This figure shows the SEC-HPLC data for pRC2-8_SynINT2.2, pRC2-8_SynINT3.1, and pRC2-8_SynINT3.2 on February 8th. [Figure 23] This is a schematic diagram of the AAV genome transcription map. [Figure 24] This figure shows how an optimized short intron sequence was slightly modified by introducing a unique restriction site and removing other restriction sites for the purpose of further cloning, ultimately reaching a size of 167 bp. The sequences shown are sequence number 90 (top figure) and sequence number 91 (bottom figure). [Figure 25] This figure shows the intron sequence used to select the insertion site for reconstructing the consensus splice donor and acceptor sites. The sequence shown is MAGGTRAG(N)xYNYYRAY(N)y(Y)10NYAGR (Sequence ID 92), where N is A, G, C, or T; M is C or A; R is A or G; Y is C or T; x is from 10 to 10,000; y is from 0 to 20. [Figure 26-1] This figure shows the initial rep-cap cassette used for the production of AAV serotype 8, and a new rep-cap cassette obtained after inserting synthetic introns downstream and upstream of the p19 promoter. [Figure 26-2] This figure shows the initial rep-cap cassette used for the production of AAV serotype 8, and a new rep-cap cassette obtained after inserting synthetic introns downstream and upstream of the p19 promoter. [Figure 27] This figure shows the plasmid map of pUC19_β-actin (SEQ ID NO: 72). [Figure 28] This figure shows the plasmid map of the positive control DNA (SEQ ID NO: 73). [Figure 29A-1]This is a schematic diagram of an element composed of XX85, which further includes a protelomerase site. Exemplary elements may include stuffer sequences 2 and / or 7 (sequence numbers 1 and 4) upstream of the 5' end of the E4 region (i.e., a 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., a 3' stuffer). Furthermore, the 5' stuffer can be located at the AscI site 5' of the E4 region, and / or the 3' stuffer can be located at the NotI site 3' of the E2A region. [Figure 29A-2] This is a schematic diagram of an element composed of XX85, which further includes a protelomerase site. Exemplary elements may include stuffer sequences 2 and / or 7 (sequence numbers 1 and 4) upstream of the 5' end of the E4 region (i.e., a 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., a 3' stuffer). Furthermore, the 5' stuffer can be located at the AscI site 5' of the E4 region, and / or the 3' stuffer can be located at the NotI site 3' of the E2A region. [Figure 29B-1] This is a schematic diagram of an element composed of XX85, which further includes a protelomerase site. Exemplary elements may include stuffer sequences 2 and / or 7 (sequence numbers 1 and 4) upstream of the 5' end of the E4 region (i.e., a 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., a 3' stuffer). Furthermore, the 5' stuffer can be located at the AscI site 5' of the E4 region, and / or the 3' stuffer can be located at the NotI site 3' of the E2A region. [Figure 29B-2] This is a schematic diagram of an element composed of XX85, which further includes a protelomerase site. Exemplary elements may include stuffer sequences 2 and / or 7 (sequence numbers 1 and 4) upstream of the 5' end of the E4 region (i.e., a 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., a 3' stuffer). Furthermore, the 5' stuffer can be located at the AscI site 5' of the E4 region, and / or the 3' stuffer can be located at the NotI site 3' of the E2A region. [Figure 30A]This figure shows data indicating Rep protein expression in Pro10™ cells, analyzed using WES capillaries and an immunoblotting system (Protein Simple) at the time of harvesting the AAV3B-lux2A-GFP 2L scale product. Rep protein was detected with monoclonal antibody 303.9 (Progen), and expression was normalized with β-actin. R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 30B] This figure shows data indicating Rep protein expression in Pro10™ cells, analyzed using WES capillaries and an immunoblotting system (Protein Simple) at the time of harvesting the AAV3B-lux2A-GFP 2L scale product. Rep protein was detected with monoclonal antibody 303.9 (Progen), and expression was normalized with β-actin. R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 30C] This figure shows data indicating Rep protein expression in Pro10™ cells, analyzed using WES capillaries and an immunoblotting system (Protein Simple) at the time of harvesting the AAV3B-lux2A-GFP 2L scale product. Rep protein was detected with monoclonal antibody 303.9 (Progen), and expression was normalized with β-actin. R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 31-1] This figure shows data indicating the migration, purity, and VP protein ratio of purified AAV3B-lux2A-GFP products on a 2L scale, analyzed by CE-SDS using the Maurice capillary electrophoresis system (Protein Simple). R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 31-2] This figure shows data indicating the migration, purity, and VP protein ratio of purified AAV3B-lux2A-GFP products on a 2L scale, analyzed by CE-SDS using the Maurice capillary electrophoresis system (Protein Simple). R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 32] This bar graph shows the vector genome titers of purified AAV3B 2L scale products with two different transgenes obtained by ITR ddPCR. R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 33] This bar graph shows the capsid titer and A260 / A280 ratio of 2L scale products of purified AAV3B-lux2A-GFP using two different transgens, as determined by SEC-HPLC. R-511 is pUC_RC3b; R-512 is pRC3b_SynINT3.1 (downstream p19); R-513 is pRC3b_SynINT3.2 (upstream p19). [Figure 34A] This is a schematic diagram of the cell plating and passage required for amplification of replication-competent AAV (rcAAV) and detection by qPCR targeting the Rep-coding sequence. [Figure 34B] This figure shows that rcAAV was detected in a specific AAV3B vector when constructed with a standard rep-cap plasmid, whereas rcAAV was not detected when the same vector was constructed with an oversized rep-cap construct consisting of large stuffer sequences. [Figure 35]This bar graph shows the productivity (VG / L) of the final product obtained by ITR-ddPCR in three batches. The UC pool (ultracentrifugation pool) is a pool of iodixanol density gradient fractions collected after ultracentrifugation (containing complete AAV particles). The BV pool (bulk virus pool) is a pool of fractions eluted from the affinity capture column (containing purified AAV particles) after pH adjustment. The BV pool is the input for the density gradient. [Figure 36] This bar graph shows the productivity (VP / L) of the final product obtained by ELISA from three batches. [Figure 37] This bar graph shows the productivity (VG / L) of the final product obtained by ITR-qPCR in three batches. The UC pool (ultracentrifugation pool) is a pool of iodixanol density gradient fractions collected after ultracentrifugation (containing complete AAV particles). The BV pool (bulk virus pool) is a pool of fractions eluted from the affinity capture column (containing purified AAV particles) after pH adjustment. The BV pool is the input for the density gradient. [Figure 38] This figure shows the SDS-PAGE and silver staining analysis of the final products of R-511, R-512, and R-513. [Figure 39] This figure shows the Western blot analysis of the final products of R-511, R-512, and R-513. [Figure 40] This bar graph shows HCDNA-qPCR data obtained using 123bp or 254bp amplicons, categorized by DNase pretreatment (+) and unpretreatment (-), and is normalized using the titer 1E+09 VG obtained by ddPCR. [Figure 41] This bar graph shows data obtained from the KanR-ddPCR assay, with and without DNase pretreatment (+), and represents the percentage (right) between the KanR sequence copy number and the VG titer obtained by ITR-qPCR. [Figure 42] This figure shows an exemplary AAV-GFP vector design according to the present disclosure. [Figure 43]This figure shows the plasmid map of the ssAAV9-GFP vector (SEQ ID NO: 93). [Figure 44A] Figure 43 shows the results of ITR-ddPCR and SEC-HPLC (Figure 44A) and ultracentrifugation analysis (Figure 44B) of rAAV production using the ssAAV-GFP vector. [Figure 44B] Figure 43 shows the results of ITR-ddPCR and SEC-HPLC (Figure 44A) and ultracentrifugation analysis (Figure 44B) of rAAV production using the ssAAV-GFP vector. [Modes for carrying out the invention]

[0084] It should be understood that both the general description above and the detailed description below are illustrative and descriptive only and do not limit the invention as described in the claims. Section headings used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, and professional works, are expressly incorporated herein by reference in whole for any purpose.

[0085] Short stuffer arrangement The various embodiments described herein include stuffer sequences, such as short stuffers or large stuffers. As used herein, “stuffer” sequence refers to a non-coding sequence of non-viral origin. The stuffer sequence preferably has no or minimal regulatory effect on coding sequences within the same nucleic acid molecule.

[0086] In one embodiment, nucleic acids comprising short stuffer sequences are provided herein. Generally, short stuffer sequences are less than 500 nucleotides in length. For example, short stuffers are about 50 to about 400 nucleotides in length. In some embodiments, short stuffers are about 100 to about 300 nucleotides in length. For example, short stuffers are about 150 to about 250 nucleotides in length. In some embodiments, short stuffers are less than about 200 nucleotides in length.

[0087] In some embodiments, the short stuffer may be a TATA box, a CpG dinucleotide, an endonuclease cleavage site, a transcription factor binding site, an open reading frame (ORF) longer than 10 amino acids, a donor splicing site or an acceptor splicing site, a regulatory element, a repeat sequence or a palindromic sequence, a repeat sequence or a palindromic sequence longer than 5 nucleotides, and / or not include one or more AAVRep binding sites (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or all 9).

[0088] In some embodiments, the short stuffer has a GC content of less than about 50%. For example, the short stuffer has a GC content of less than about 45%. In some embodiments, the short stuffer has a GC content of less than about 40%, for example, less than about 35%.

[0089] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 6. For example, the short stuffer comprises a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with any one of SEQ ID NOs: 1 to 6 or a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 6. In some embodiments, the short stuffer comprises a nucleotide sequence having 100% identity with any one of SEQ ID NOs: 1 to 6 or a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 6. For example, the short stuffer comprises a nucleotide sequence having 100% identity with any one of SEQ ID NOs: 1 to 6 or a nucleotide sequence complementary to any one of SEQ ID NOs: 1 to 6.

[0090] In some embodiments, the short stuffer includes a nucleotide sequence having at least 85% identity with SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to SEQ ID NO: 1 or 4. For example, the short stuffer includes a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to SEQ ID NO: 1 or 4. In some embodiments, the short stuffer includes a nucleotide sequence having 100% identity with SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to SEQ ID NO: 1 or 4. For example, the short stuffer consists of a nucleotide sequence having 100% identity with SEQ ID NO: 1 or 4 or a nucleotide sequence complementary to SEQ ID NO: 1 or 4.

[0091] In some embodiments, the short stuffer includes a nucleotide sequence containing at least 75 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to at least 75 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6. For example, the short stuffer includes a nucleotide sequence containing at least 100 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to at least 100 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6. In some embodiments, the short stuffer includes a nucleotide sequence containing at least 125 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to at least 125 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6. For example, the short stuffer includes a nucleotide sequence containing at least 150 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to at least 150 consecutive nucleotides from any one of SEQ ID NOs: 1 to 6.

[0092] The short stuffer sequences described herein are preferably neutral sequences that, for example, do not affect or have minimal effect on the transcriptional activity of the nucleic acid molecule in which they exist.

[0093] Large stuffer Embodiments of the various aspects described herein include large stuffers. As used herein, a large stuffer or large stuffer sequence is a non-coding sequence that can increase the size of the expression cassette beyond the DNA packaging limit of the AAV capsid, which is about 5 kb. Preferably, the large stuffer has no or minimal regulatory effect, for example, a transcriptional regulatory effect on coding sequences within the same nucleic acid molecule. The large stuffer sequence is preferably a neutral sequence.

[0094] Generally, large stuffers have a length exceeding 2kb. For example, large stuffers have a length exceeding 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, or 3.0kb. In some embodiments, large stuffers have a length exceeding 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, or 4.0kb. For example, a large stuffer has a length exceeding 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, or 5.0kb. In some embodiments, a large stuffer has a length exceeding 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, for example, exceeding 5.6kb, 5.7kb, 5.8kb, 5.9kb, or greater than 6.0kb. In some embodiments, the large stuffer has a length greater than 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.1kb, 7.2kb, 7.3kb, 7.4kb, 7.5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, or 8.0kb.

[0095] Generally, large stuffers are not of mammalian origin. In other words, large stuffers do not contain mammalian-derived nucleotide sequences. In some embodiments of any one of the embodiments described herein, large stuffers contain non-mammalian-derived nucleotide sequences. In some embodiments of any one of the embodiments described herein, large stuffers are synthetic.

[0096] Typically, a large stuffer does not contain more than one of the following (e.g., 1, 2, 3, 4, 5, 6, 7, or 8): transcription factor binding sites; regulatory elements; AAV Rep binding sites; donor or acceptor splicing sites; endonuclease cleavage sites, where the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; repeat sequences or palindromic sequences longer than 5 nucleotides; and / or strong secondary structures; or repeat sequences or palindromic sequences, repeat sequences or palindromic sequences longer than 5 nucleotides.

[0097] In some embodiments, the large stuffer has a GC content of less than about 50%. For example, the large stuffer has a GC content of less than about 45%. In some embodiments, the large stuffer has a GC content of less than about 40%, for example, less than about 35%.

[0098] In some embodiments of any one of the embodiments described herein, the large stuffer includes a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81. For example, the large stuffer includes a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the large stuffer includes a nucleotide sequence having 100% identity with any one of the nucleotide sequences of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81. For example, the large stuffer consists of a nucleotide sequence having 100% identity with any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81.

[0099] In some embodiments, the large stuffer includes a nucleotide sequence having at least 85% identity with SEQ ID NO: 9 or a nucleotide sequence complementary to SEQ ID NO: 9. For example, the large stuffer includes a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 9, or a nucleotide sequence complementary to SEQ ID NO: 9. In some embodiments, the large stuffer includes a nucleotide sequence having 100% identity with SEQ ID NO: 9, or a nucleotide sequence complementary to SEQ ID NO: 9. For example, the large stuffer consists of a nucleotide sequence having 100% identity with SEQ ID NO: 9, or a nucleotide sequence complementary to SEQ ID NO: 9.

[0100] Short stuffer: A fragment of a large stuffer. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 1250 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 1250 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 1000 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 1000 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 950 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 950 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 900 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 900 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 850 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 850 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 800 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 800 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 750 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 750 nucleotides from any one of SEQ ID NOs: 7-9 or 81.

[0101] In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 250 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 250 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 200 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 200 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 150 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 150 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 100 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to less than approximately 100 nucleotides from any one of SEQ ID NOs: 7-9 or 81.

[0102] In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 25 to approximately 100 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 25 to approximately 100 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 100 to approximately 900 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 100 to approximately 900 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 150 to approximately 800 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 150 to approximately 800 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, a short stuffer includes a nucleotide sequence of a continuous fragment of approximately 250 to 750 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 250 to 750 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, a short stuffer includes a nucleotide sequence of a continuous fragment of approximately 275 to 700 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 275 to 700 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, a short stuffer includes a nucleotide sequence of a continuous fragment of approximately 300 to 675 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 300 to 675 nucleotides from any one of SEQ ID NOs: 7-9 or 81.In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 325 to approximately 650 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 325 to approximately 650 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 350 to approximately 600 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 325 to approximately 600 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 375 to approximately 550 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 375 to approximately 550 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, a short stuffer contains a nucleotide sequence of a continuous fragment of approximately 400 to 500 nucleotides from any one of sequence numbers 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 400 to 500 nucleotides from any one of sequence numbers 7-9 or 81.

[0103] In some authorizations, short stuffers are approximately 25 nucleotides, approximately 30 nucleotides, approximately 35 nucleotides, approximately 40 nucleotides, approximately 45 nucleotides, approximately 50 nucleotides, approximately 55 nucleotides, approximately 60 nucleotides, approximately 65 nucleotides, approximately 70 nucleotides, approximately 75 nucleotides, approximately 80 nucleotides, approximately 85 nucleotides, approximately 90 nucleotides, approximately 95 nucleotides, approximately 100 nucleotides, approximately 105 nucleotides, approximately 110 nucleotides, approximately 115 nucleotides, approximately 120 nucleotides, approximately 125 nucleotides, approximately 130 nucleotides, approximately 135 nucleotides, approximately 140 nucleotides, approximately 145 nucleotides, approximately 150 nucleotides, approximately 155 nucleotides, approximately 160 nucleotides, approximately 165 nucleotides, approximately 170 nucleotides, approximately 175 nucleotides, approximately 180 nucleotides, approximately 185 nucleotides, approximately 190 nucleotides, approximately 195 nucleotides, approximately 200 nucleotides, approximately 205 nucleotides, approximately 210 nucleotides, approximately 215 nucleotides, approximately 220 nucleotides, approximately 225 nucleotides, approximately 230 nucleotides, approximately 235 nucleos Tide, approximately 240 nucleotides, approximately 245 nucleotides, approximately 250 nucleotides, approximately 255 nucleotides, approximately 260 nucleotides, approximately 265 nucleotides, approximately 270 nucleotides, approximately 275 nucleotides, approximately 280 nucleotides, approximately 285 nucleotides, approximately 290 nucleotides, approximately 295 nucleotides, approximately 300 nucleotides, approximately 305 nucleotides, approximately 310 nucleotides, approximately 315 nucleotides, approximately 320 nucleotides, approximately 325 nucleotides, approximately 330 nucleotides, approximately 335 nucleotides, approximately 340 nucleotides, approximately 345 nucleotides, approximately 350 Nucleotides, approximately 355 nucleotides, approximately 360 nucleotides, approximately 365 nucleotides, approximately 370 nucleotides, approximately 375 nucleotides, approximately 380 nucleotides, approximately 385 nucleotides, approximately 390 nucleotides, approximately 395 nucleotides, approximately 400 nucleotides, approximately 405 nucleotides, approximately 410 nucleotides, approximately 415 nucleotides, approximately 420 nucleotides, approximately 425 nucleotides, approximately 430 nucleotides, approximately 435 nucleotides, approximately 440 nucleotides, approximately 445 nucleotides, approximately 450 nucleotides, approximately 455 nucleotides, approximately 460 nucleotides,Approximately 465 nucleotides, approximately 470 nucleotides, approximately 475 nucleotides, approximately 480 nucleotides, approximately 485 nucleotides, approximately 490 nucleotides, approximately 495 nucleotides, approximately 500 nucleotides, approximately 505 nucleotides, approximately 510 nucleotides, approximately 515 nucleotides, approximately 520 nucleotides, approximately 525 nucleotides, approximately 530 nucleotides, approximately 535 nucleotides, approximately 540 nucleotides, approximately 545 nucleotides, approximately 550 nucleotides, approximately 555 nucleotides, approximately 560 nucleotides, approximately 565 nucleotides, approximately 570 nucleotides, approximately 575 nucleotides, approximately 580 nucleotides, approximately 585 nucleotides, approximately 590 nucleotides, approximately 595 nucleotides, approximately 600 nucleotides, approximately 605 nucleotides, approximately 610 nucleotides, approximately 615 nucleotides, approximately 620 nucleotides, approximately 625 nucleotides, approximately 630 nucleotides Cleotide, approximately 635 nucleotides, approximately 640 nucleotides, approximately 645 nucleotides, approximately 650 nucleotides, approximately 655 nucleotides, approximately 660 nucleotides, approximately 665 nucleotides, approximately 670 nucleotides, approximately 675 nucleotides, approximately 680 nucleotides, approximately 685 nucleotides, approximately 690 nucleotides, approximately 695 nucleotides, approximately 700 nucleotides, approximately 705 nucleotides, approximately 710 nucleotides, approximately 715 nucleotides, approximately 720 nucleotides, approximately 725 nucleotides, approximately 730 nucleotides, approximately 735 nucleotides, approximately 740 nucleotides, approximately 745 nucleotides, approximately 750 nucleotides, approximately 755 nucleotides, approximately 760 nucleotides, approximately 765 nucleotides, approximately 770 nucleotides, approximately 775 nucleotides, approximately 780 nucleotides, approximately 785 nucleotides, approximately 790 nucleotides, approximately 795 nucleotides, Approximately 800 nucleotides, approximately 805 nucleotides, approximately 810 nucleotides, approximately 815 nucleotides, approximately 820 nucleotides, approximately 825 nucleotides, approximately 830 nucleotides, approximately 835 nucleotides, approximately 840 nucleotides, approximately 845 nucleotides, approximately 850 nucleotides, approximately 855 nucleotides, approximately 860 nucleotides, approximately 865 nucleotides, approximately 870 nucleotides, approximately 875 nucleotides, approximately 880 nucleotides, approximately 885 nucleotides, approximately 890 nucleotides, approximately 895 nucleotides, approximately 900 nucleotides, approximately 905 nucleotides, approximately 910 nucleotides Rheotide, approximately 915 nucleotides, approximately 920 nucleotides, approximately 925 nucleotides, approximately 930 nucleotides, approximately 935 nucleotides, approximately 940 nucleotides, approximately 945 nucleotides, approximately 950 nucleotides, approximately 955 nucleotides, approximately 960 nucleotides, approximately 965 nucleotides, approximately 970 nucleotides, approximately 975 nucleotides, approximately 980 nucleotides, approximately 985 nucleotides, approximately 990 nucleotides, approximately 995 nucleotides, approximately 1000 nucleotides, approximately 1005 nucleotides, approximately 1010 nucleotides, approximately 1015 nucleotides, approximately 1020 nucleotides Otid, approximately 1025 nucleotides, approximately 1030 nucleotides, approximately 1035 nucleotides, approximately 1040 nucleotides, approximately 1045 nucleotides, approximately 1050 nucleotides, approximately 1055 nucleotides, approximately 1060 nucleotides, approximately 1065 nucleotides, approximately 1070 nucleotides, approximately 1075 nucleotides, approximately 1080 nucleotides, approximately 1085 nucleotides, approximately 1090 nucleotides, approximately 1095 nucleotides, approximately 1100 nucleotides, approximately 1105 nucleotides, approximately 1110 nucleotides, approximately 1115 nucleotides, approximately 1120 nucleotides, approximately 112 5 nucleotides, approximately 1130 nucleotides, approximately 1135 nucleotides, approximately 1140 nucleotides, approximately 1145 nucleotides, approximately 1150 nucleotides, approximately 1155 nucleotides, approximately 1160 nucleotides, approximately 1165 nucleotides, approximately 1170 nucleotides, approximately 1175 nucleotides, approximately 1180 nucleotides, approximately 1185 nucleotides, approximately 1190 nucleotides, approximately 1195 nucleotides, approximately 1200 nucleotides, approximately 1205 nucleotides, approximately 1210 nucleotides, approximately 1215 nucleotides, approximately 1220 nucleotides, approximately 1225 nucleotides,Approximately 1230 nucleotides, approximately 1235 nucleotides, approximately 1240 nucleotides, approximately 1245 nucleotides, approximately 1250 nucleotides, approximately 1255 nucleotides, approximately 1260 nucleotides, approximately 1265 nucleotides, approximately 1270 nucleotides, approximately 1275 nucleotides, approximately 1280 nucleotides, approximately 1285 nucleotides, approximately 1290 nucleotides, approximately 1295 nucleotides, approximately 1300 nucleotides, approximately 1305 nucleotides, approximately 1310 nucleotides, approximately 1315 nucleotides, approximately 1320 nucleotides, approximately 1325 nucleotides, approximately 1330 nucleotides, approximately 1335 nucleotides, approximately 1340 nucleotides, approximately 1345 nucleotides, approximately 1350 nucleotides, approximately 1355 nucleotides, approximately 1360 nucleotides, Approximately 1365 nucleotides, approximately 1370 nucleotides, approximately 1375 nucleotides, approximately 1380 nucleotides, approximately 1385 nucleotides, approximately 1390 nucleotides, approximately 1395 nucleotides, approximately 1400 nucleotides, approximately 1405 nucleotides, approximately 1410 nucleotides, approximately 1415 nucleotides, approximately 1420 nucleotides, approximately 1425 nucleotides, approximately 1430 nucleotides, approximately 1435 nucleotides, approximately 1440 nucleotides, approximately 1445 nucleotides, approximately 1450 nucleotides, approximately 1455 nucleotides, approximately 1460 nucleotides, approximately 1465 nucleotides, approximately 1470 nucleotides, approximately 1475 nucleotides, approximately 1480 nucleotides, approximately 1485 nucleotides, approximately 1490 nucleotides, approximately 1495 nucleotides, Alternatively, a nucleotide sequence of a continuous fragment of approximately 1500 nucleotides, or one of the sequence numbers 7-9, 81 of approximately 25 nucleotides, approximately 30 nucleotides, approximately 35 nucleotides, approximately 40 nucleotides, approximately 45 nucleotides, approximately 50 nucleotides, approximately 55 nucleotides, approximately 60 nucleotides, approximately 65 nucleotides, approximately 70 nucleotides, approximately 75 nucleotides, approximately 80 nucleotides, approximately 85 nucleotides, approximately 90 nucleotides, approximately 95 nucleotides, approximately 100 nucleotides, approximately 105 nucleotides, approximately 110 nucleotides, approximately 115 nucleotides, approximately 120 nucleotides, approximately 125 nucleotides, approximately 130 nucleotides, approximately 135 nucleotides, approximately 140 nucleotides, approximately 145 nucleotides, approximately 150 nucleotides, approximately 155 nucleotides, approximately 160 nucleotides, approximately 165 nucleotides, approximately 170 nucleotides, approximately 175 nucleotides, approximately 180 nucleotides, approximately 185 nucleotides, approximately 190 nucleotides, approximately 195 nucleotides, approximately 200 nucleotides, approximately 205 nucleotides, approximately 210 nucleotides, approximately 215 nucleotides, approximately 220 nucleotides, approximately 225 nucleotides, approximately 230 nucleos Tide, approximately 235 nucleotides, approximately 240 nucleotides, approximately 245 nucleotides, approximately 250 nucleotides, approximately 255 nucleotides, approximately 260 nucleotides, approximately 265 nucleotides, approximately 270 nucleotides, approximately 275 nucleotides, approximately 280 nucleotides, approximately 285 nucleotides, approximately 290 nucleotides, approximately 295 nucleotides, approximately 300 nucleotides, approximately 305 nucleotides, approximately 310 nucleotides, approximately 315 nucleotides, approximately 320 nucleotides, approximately 325 nucleotides, approximately 330 nucleotides, approximately 335 nucleotides, approximately 340 nucleotides, approximately 345 Nucleotides, approximately 350 nucleotides, approximately 355 nucleotides, approximately 360 nucleotides, approximately 365 nucleotides, approximately 370 nucleotides, approximately 375 nucleotides, approximately 380 nucleotides, approximately 385 nucleotides, approximately 390 nucleotides, approximately 395 nucleotides, approximately 400 nucleotides, approximately 405 nucleotides, approximately 410 nucleotides, approximately 415 nucleotides, approximately 420 nucleotides, approximately 425 nucleotides, approximately 430 nucleotides, approximately 435 nucleotides, approximately 440 nucleotides, approximately 445 nucleotides, approximately 450 nucleotides, approximately 455 nucleotides,Approximately 460 nucleotides, approximately 465 nucleotides, approximately 470 nucleotides, approximately 475 nucleotides, approximately 480 nucleotides, approximately 485 nucleotides, approximately 490 nucleotides, approximately 495 nucleotides, approximately 500 nucleotides, approximately 505 nucleotides, approximately 510 nucleotides, approximately 515 nucleotides, approximately 520 nucleotides, approximately 525 nucleotides, approximately 530 nucleotides, approximately 535 nucleotides, approximately 540 nucleotides, approximately 545 nucleotides, approximately 550 nucleotides, approximately 555 nucleotides, approximately 560 nucleotides, approximately 565 nucleotides, approximately 570 nucleotides, approximately 575 nucleotides, approximately 580 nucleotides, approximately 585 nucleotides, approximately 590 nucleotides, approximately 595 nucleotides, approximately 600 nucleotides, approximately 605 nucleotides, approximately 610 nucleotides, approximately 615 nucleotides, approximately 620 nucleotides, approximately 625 nucleotides, Approximately 630 nucleotides, approximately 635 nucleotides, approximately 640 nucleotides, approximately 645 nucleotides, approximately 650 nucleotides, approximately 655 nucleotides, approximately 660 nucleotides, approximately 665 nucleotides, approximately 670 nucleotides, approximately 675 nucleotides, approximately 680 nucleotides, approximately 685 nucleotides, approximately 690 nucleotides, approximately 695 nucleotides, approximately 700 nucleotides, approximately 705 nucleotides, approximately 710 nucleotides, approximately 715 nucleotides, approximately 720 nucleotides, approximately 725 nucleotides, approximately 730 nucleotides, approximately 735 nucleotides, approximately 740 nucleotides, approximately 745 nucleotides, approximately 750 nucleotides, approximately 755 nucleotides, approximately 760 nucleotides, approximately 765 nucleotides, approximately 770 nucleotides, approximately 775 nucleotides, approximately 780 nucleotides, approximately 785 nucleotides, approximately 790 nucleotides, approximately 795 nucleotides, Approximately 800 nucleotides, approximately 805 nucleotides, approximately 810 nucleotides, approximately 815 nucleotides, approximately 820 nucleotides, approximately 825 nucleotides, approximately 830 nucleotides, approximately 835 nucleotides, approximately 840 nucleotides, approximately 845 nucleotides, approximately 850 nucleotides, approximately 855 nucleotides, approximately 860 nucleotides, approximately 865 nucleotides, approximately 870 nucleotides, approximately 875 nucleotides, approximately 880 nucleotides, approximately 885 nucleotides, approximately 890 nucleotides, approximately 895 nucleotides, approximately 900 nucleotides, approximately 905 nucleotides, approximately 910 nucleotides Rheotide, approximately 915 nucleotides, approximately 920 nucleotides, approximately 925 nucleotides, approximately 930 nucleotides, approximately 935 nucleotides, approximately 940 nucleotides, approximately 945 nucleotides, approximately 950 nucleotides, approximately 955 nucleotides, approximately 960 nucleotides, approximately 965 nucleotides, approximately 970 nucleotides, approximately 975 nucleotides, approximately 980 nucleotides, approximately 985 nucleotides, approximately 990 nucleotides, approximately 995 nucleotides, approximately 1000 nucleotides, approximately 1005 nucleotides, approximately 1010 nucleotides, approximately 1015 nucleotides, approximately 1020 nucleotides Otid, approximately 1025 nucleotides, approximately 1030 nucleotides, approximately 1035 nucleotides, approximately 1040 nucleotides, approximately 1045 nucleotides, approximately 1050 nucleotides, approximately 1055 nucleotides, approximately 1060 nucleotides, approximately 1065 nucleotides, approximately 1070 nucleotides, approximately 1075 nucleotides, approximately 1080 nucleotides, approximately 1085 nucleotides, approximately 1090 nucleotides, approximately 1095 nucleotides, approximately 1100 nucleotides, approximately 1105 nucleotides, approximately 1110 nucleotides, approximately 1115 nucleotides, approximately 1120 nucleotides, approximately 112 5 nucleotides, approximately 1130 nucleotides, approximately 1135 nucleotides, approximately 1140 nucleotides, approximately 1145 nucleotides, approximately 1150 nucleotides, approximately 1155 nucleotides, approximately 1160 nucleotides, approximately 1165 nucleotides, approximately 1170 nucleotides, approximately 1175 nucleotides, approximately 1180 nucleotides, approximately 1185 nucleotides, approximately 1190 nucleotides, approximately 1195 nucleotides, approximately 1200 nucleotides, approximately 1205 nucleotides, approximately 1210 nucleotides, approximately 1215 nucleotides, approximately 1220 nucleotides, approximately 1225 nucleotides,Approximately 1230 nucleotides, approximately 1235 nucleotides, approximately 1240 nucleotides, approximately 1245 nucleotides, approximately 1250 nucleotides, approximately 1255 nucleotides, approximately 1260 nucleotides, approximately 1265 nucleotides, approximately 1270 nucleotides, approximately 1275 nucleotides, approximately 1280 nucleotides, approximately 1285 nucleotides, approximately 1290 nucleotides, approximately 1295 nucleotides, approximately 1300 nucleotides, approximately 1305 nucleotides, approximately 1310 nucleotides, approximately 1315 nucleotides, approximately 1320 nucleotides, approximately 1325 nucleotides, approximately 1330 nucleotides, approximately 1335 nucleotides, approximately 1340 nucleotides, approximately 1345 nucleotides, approximately 1350 nucleotides, approximately 1355 nucleotides, approximately 1360 nucleotides, approximately 1365 nucleotides, approximately 1370 nucleotides Otide contains a nucleotide sequence complementary to a continuous fragment of approximately 1375 nucleotides, approximately 1380 nucleotides, approximately 1385 nucleotides, approximately 1390 nucleotides, approximately 1395 nucleotides, approximately 1400 nucleotides, approximately 1405 nucleotides, approximately 1410 nucleotides, approximately 1415 nucleotides, approximately 1420 nucleotides, approximately 1425 nucleotides, approximately 1430 nucleotides, approximately 1435 nucleotides, approximately 1440 nucleotides, approximately 1445 nucleotides, approximately 1450 nucleotides, approximately 1455 nucleotides, approximately 1460 nucleotides, approximately 1465 nucleotides, approximately 1470 nucleotides, approximately 1475 nucleotides, approximately 1480 nucleotides, approximately 1485 nucleotides, approximately 1490 nucleotides, approximately 1495 nucleotides, or approximately 1500 nucleotides.

[0104] In some embodiments, the short stuffer is approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 110 A nucleotide sequence of a continuous fragment of 0 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides, or approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides as of SEQ ID NO: 7 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides,It contains a nucleotide sequence complementary to a continuous fragment of approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 1100 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides. For example, a short stuffer is a nucleotide arrangement of a continuous fragment of approximately 500 nucleotides, 525 nucleotides, 550 nucleotides, 575 nucleotides, 600 nucleotides, 625 nucleotides, 650 nucleotides, 675 nucleotides, 725 nucleotides, 750 nucleotides, 775 nucleotides, 800 nucleotides, 825 nucleotides, 850 nucleotides, 875 nucleotides, 900 nucleotides, 925 nucleotides, 950 nucleotides, 975 nucleotides, or 1000 nucleotides. It includes a sequence, or a nucleotide sequence complementary to a continuous fragment of approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, or approximately 1000 nucleotides.

[0105] In some embodiments, the short stuffer is approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 110 A nucleotide sequence of a continuous fragment of 0 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides, or approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides of SEQ ID NO: 8 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides,It contains a nucleotide sequence complementary to a continuous fragment of approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 1100 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides. For example, a short stuffer is a nucleotide arrangement of a continuous fragment of approximately 500 nucleotides, 525 nucleotides, 550 nucleotides, 575 nucleotides, 600 nucleotides, 625 nucleotides, 650 nucleotides, 675 nucleotides, 725 nucleotides, 750 nucleotides, 775 nucleotides, 800 nucleotides, 825 nucleotides, 850 nucleotides, 875 nucleotides, 900 nucleotides, 925 nucleotides, 950 nucleotides, 975 nucleotides, or 1000 nucleotides. It includes a sequence, or contains a nucleotide sequence complementary to a continuous fragment of approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, or approximately 1000 nucleotides.

[0106] In some embodiments, the short stuffer is approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 110 A nucleotide sequence of a continuous fragment of 0 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides, or approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides of SEQ ID NO: 9 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides,It contains a nucleotide sequence complementary to a continuous fragment of approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 1100 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides. For example, a short stuffer is a nucleotide arrangement of a continuous fragment of approximately 500 nucleotides, 525 nucleotides, 550 nucleotides, 575 nucleotides, 600 nucleotides, 625 nucleotides, 650 nucleotides, 675 nucleotides, 725 nucleotides, 750 nucleotides, 775 nucleotides, 800 nucleotides, 825 nucleotides, 850 nucleotides, 875 nucleotides, 900 nucleotides, 925 nucleotides, 950 nucleotides, 975 nucleotides, or 1000 nucleotides. It includes a sequence, or contains a nucleotide sequence complementary to a continuous fragment of approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, or approximately 1000 nucleotides.

[0107] In some embodiments, the short stuffer is approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides, approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 110 A nucleotide sequence of a continuous fragment of 0 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides, or approximately 25 nucleotides, approximately 50 nucleotides, approximately 75 nucleotides, approximately 100 nucleotides, approximately 125 nucleotides, approximately 150 nucleotides, approximately 175 nucleotides of SEQ ID NO: 81 nucleotides, approximately 200 nucleotides, approximately 225 nucleotides, approximately 250 nucleotides, approximately 275 nucleotides, approximately 300 nucleotides, approximately 325 nucleotides, approximately 350 nucleotides, approximately 375 nucleotides, approximately 400 nucleotides, approximately 425 nucleotides, approximately 450 nucleotides, approximately 475 nucleotides, approximately 500 nucleotides, approximately 525 nucleotides, approximately 550 nucleotides, approximately 575 nucleotides, approximately 600 nucleotides, approximately 625 nucleotides, approximately 650 nucleotides, approximately 675 nucleotides, approximately 725 nucleotides, approximately 750 nucleotides,It contains a nucleotide sequence complementary to a continuous fragment of approximately 775 nucleotides, approximately 800 nucleotides, approximately 825 nucleotides, approximately 850 nucleotides, approximately 875 nucleotides, approximately 900 nucleotides, approximately 925 nucleotides, approximately 950 nucleotides, approximately 975 nucleotides, approximately 1000 nucleotides, approximately 1025 nucleotides, approximately 1050 nucleotides, approximately 1075 nucleotides, approximately 1100 nucleotides, approximately 1125 nucleotides, approximately 1150 nucleotides, approximately 11075 nucleotides, approximately 1200 nucleotides, approximately 1325 nucleotides, approximately 1350 nucleotides, approximately 1375 nucleotides, approximately 1400 nucleotides, approximately 1425 nucleotides, approximately 1450 nucleotides, approximately 1475 nucleotides, or approximately 1500 nucleotides. For example, a short stuffer is a nucleotide arrangement of a continuous fragment of approximately 500 nucleotides, 525 nucleotides, 550 nucleotides, 575 nucleotides, 600 nucleotides, 625 nucleotides, 650 nucleotides, 675 nucleotides, 725 nucleotides, 750 nucleotides, 775 nucleotides, 800 nucleotides, 825 nucleotides, 850 nucleotides, 875 nucleotides, 900 nucleotides, 925 nucleotides, 950 nucleotides, 975 nucleotides, or 1000 nucleotides. It includes a sequence, or a nucleotide sequence complementary to a continuous fragment of approximately 500 nucleotides, 525 nucleotides, 550 nucleotides, 575 nucleotides, 600 nucleotides, 625 nucleotides, 650 nucleotides, 675 nucleotides, 725 nucleotides, 750 nucleotides, 775 nucleotides, 800 nucleotides, 825 nucleotides, 850 nucleotides, 875 nucleotides, 900 nucleotides, 925 nucleotides, 950 nucleotides, 975 nucleotides, or 1000 nucleotides.

[0108] In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 75 to 250 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 75 to 250 nucleotides from any one of SEQ ID NOs: 7-9 or 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of approximately 100 to 200 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 100 to 200 nucleotides from any one of SEQ ID NOs: 7-9 or 81. In some cases, the short stuffer is a sequence of fragments of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides from one of the sequence fragments of sequence number 7-9 or 81. The sequence contains a nucleotide sequence complementary to a continuous fragment of approximately 75 nucleotides, approximately 80 nucleotides, approximately 85 nucleotides, approximately 90 nucleotides, approximately 95 nucleotides, approximately 100 nucleotides, approximately 105 nucleotides, approximately 110 nucleotides, approximately 115 nucleotides, approximately 120 nucleotides, approximately 125 nucleotides, approximately 130 nucleotides, approximately 135 nucleotides, approximately 140 nucleotides, approximately 145 nucleotides, approximately 150 nucleotides, approximately 155 nucleotides, approximately 160 nucleotides, approximately 165 nucleotides, approximately 170 nucleotides, approximately 175 nucleotides, approximately 180 nucleotides, approximately 185 nucleotides, approximately 190 nucleotides, approximately 195 nucleotides, or approximately 200 nucleotides, which is either a creotide sequence or one of the sequence numbers 7-9 or 81.For example, a short stuffer contains a nucleotide sequence of a continuous fragment of approximately 100, 150, 175, or 200 nucleotides from any one of sequence numbers 7-9 or 81, or a nucleotide sequence complementary to a continuous fragment of approximately 100, 150, 175, or 200 nucleotides from any one of sequence numbers 7-9 or 81.

[0109] In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 250 nucleotides of the sequence fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the sequence fragment of less than approximately 250 nucleotides of SEQ ID NO: 9. For example, the short stuffer includes a nucleotide sequence of less than approximately 200 nucleotides of the sequence fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the sequence fragment of less than approximately 200 nucleotides of SEQ ID NO: 9. In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 150 nucleotides of the sequence fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the sequence fragment of less than approximately 150 nucleotides of SEQ ID NO: 9. For example, the short stuffer includes a nucleotide sequence of less than approximately 100 nucleotides of the sequence fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the sequence fragment of less than approximately 100 nucleotides of SEQ ID NO: 9.

[0110] In some embodiments, the short stuffer includes a nucleotide sequence of approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 9. For example, the short stuffer includes a nucleotide sequence of approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 9. In some cases, short stuffers are sequential fragments of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of sequence fragment nucleotides of sequence number 9. The sequence contains a nucleotide sequence complementary to a continuous fragment of approximately 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 nucleotides of the creotide sequence or sequence of approximately 75, 80, 85, 90, 95, 100, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 nucleotides of sequence number 9.For example, a short stuffer contains a nucleotide sequence of approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 9, or a nucleotide sequence complementary to the approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 9.

[0111] In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 250 nucleotides of the sequence fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the sequence fragment of less than approximately 250 nucleotides of SEQ ID NO: 7. For example, the short stuffer includes a nucleotide sequence of less than approximately 200 nucleotides of the sequence fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the sequence fragment of less than approximately 200 nucleotides of SEQ ID NO: 7. In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 150 nucleotides of the sequence fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the sequence fragment of less than approximately 150 nucleotides of SEQ ID NO: 7. For example, the short stuffer includes a nucleotide sequence of less than approximately 100 nucleotides of the sequence fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the sequence fragment of less than approximately 100 nucleotides of SEQ ID NO: 7.

[0112] In some embodiments, the short stuffer includes a nucleotide sequence of approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 7. For example, the short stuffer includes a nucleotide sequence of approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 7. In some cases, short stuffers are sequential fragments of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides. The sequence contains a nucleotide sequence complementary to a continuous fragment of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides from sequence number 7.For example, a short stuffer contains a nucleotide sequence of approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 7, or a nucleotide sequence complementary to the approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 7.

[0113] In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 250 nucleotides of the sequence fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the sequence fragment of less than approximately 250 nucleotides of SEQ ID NO: 8. For example, the short stuffer includes a nucleotide sequence of less than approximately 200 nucleotides of the sequence fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the sequence fragment of less than approximately 200 nucleotides of SEQ ID NO: 8. In some embodiments, the short stuffer includes a nucleotide sequence of less than approximately 150 nucleotides of the sequence fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the sequence fragment of less than approximately 150 nucleotides of SEQ ID NO: 8. For example, the short stuffer includes a nucleotide sequence of less than approximately 100 nucleotides of the sequence fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the sequence fragment of less than approximately 100 nucleotides of SEQ ID NO: 8.

[0114] In some embodiments, the short stuffer includes a nucleotide sequence of approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 8. For example, the short stuffer includes a nucleotide sequence of approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 8. In some cases, short stuffers are sequential fragments of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of sequence fragment nucleotides of sequence 8. The sequence contains a nucleotide sequence complementary to a continuous fragment of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of the creotide sequence or the sequence of approximately 75, 80, 85, 90, 95, 100, 110, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 nucleotides of sequence number 8.For example, the short stuffer contains a nucleotide sequence of approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 8, or a nucleotide sequence complementary to the approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 8.

[0115] In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 250 nucleotides of SEQ ID NO: 81, or a nucleotide sequence complementary to a continuous fragment of less than approximately 250 nucleotides of SEQ ID NO: 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 200 nucleotides of SEQ ID NO: 81, or a nucleotide sequence complementary to a continuous fragment of less than approximately 200 nucleotides of SEQ ID NO: 81. In some embodiments, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 150 nucleotides of SEQ ID NO: 81, or a nucleotide sequence complementary to a continuous fragment of less than approximately 150 nucleotides of SEQ ID NO: 81. For example, the short stuffer includes a nucleotide sequence of a continuous fragment of less than approximately 100 nucleotides of SEQ ID NO: 81, or a nucleotide sequence complementary to a continuous fragment of less than approximately 100 nucleotides of SEQ ID NO: 81.

[0116] In some embodiments, the short stuffer includes a nucleotide sequence of approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 81, or a nucleotide sequence complementary to the approximately 75 to approximately 250 nucleotides in a continuous fragment of SEQ ID NO: 81. For example, the short stuffer includes a nucleotide sequence of approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 81, or a nucleotide sequence complementary to the approximately 100 to approximately 200 nucleotides in a continuous fragment of SEQ ID NO: 81. In some cases, short stuffers are sequential fragments of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of sequence nucleotides of sequence 81. The sequence contains a nucleotide sequence complementary to a continuous fragment of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of the creotide sequence or a continuous fragment of approximately 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, or 200 nucleotides of sequence number 81.For example, a short stuffer contains a nucleotide sequence of approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 81, or a nucleotide sequence complementary to the approximately 100, 150, 175, or 200 nucleotides in a continuous fragment of SEQ ID NO: 81.

[0117] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9 or 81, wherein the nucleic acid comprising the short stuffer further comprises at least one protelomerase binding site.

[0118] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least two protelomerase binding sites.

[0119] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises a xenotransgene operably linked to one or more regulatory elements.

[0120] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least one adeno-associated virus (AAV) reverse terminal repeat (ITR) sequence.

[0121] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least one ITR sequence and a xenotransgene.

[0122] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least one protelomerase binding site and at least one ITR sequence.

[0123] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least two ITRs.

[0124] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides, wherein the nucleic acid comprising the short stuffer further comprises at least one pair of ITRs and xenotransgenes.

[0125] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9 or 81, wherein the nucleic acid comprising the short stuffer further comprises at least two protelomerase binding sites and at least two ITRs.

[0126] In some embodiments of any one of the embodiments described herein, the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9 or 81, wherein the nucleic acid comprising the short stuffer further comprises a stop codon (e.g., TAA, TAG, or TGA).

[0127] In some embodiments of any one of the embodiments described herein, the nucleic acid comprises a short stuffer, at least one ITR sequence, and a protelomerase binding site upstream of the ITR sequence, wherein the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9 or 81.

[0128] In some embodiments of any one of the embodiments described herein, the nucleic acid comprises a short stuffer, at least one ITR sequence, and a protelomerase binding site downstream of the ITR sequence, wherein the short stuffer is located between the ITR and the protelomerase binding site and comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9 or 81.

[0129] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer comprises a nucleic acid sequence encoding one or more helper proteins that assist in AAV replication and, consequently, rAAV production, wherein the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides from any one of SEQ ID NOs: 7-9 or 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides.

[0130] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising a short stuffer further comprises a nucleic acid sequence encoding one or more helper proteins that assist in rAAV production, and at least one protelomerase-binding site, wherein the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to any one of SEQ ID NOs: 7-9 or 81 of less than approximately 1500 nucleotides.

[0131] In some embodiments of any one of the embodiments described herein, the nucleic acid comprising the short stuffer further comprises a nucleic acid sequence encoding an AAV rep protein and / or an AAV cap protein, wherein the short stuffer comprises a nucleotide sequence of a continuous fragment of less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9, 81, or a nucleotide sequence complementary to less than approximately 1500 nucleotides of any one of SEQ ID NOs: 7-9 or 81.

[0132] While we do not wish to be constrained by theory, variable-size stuffer sequences can be used to increase the size of short transgene sequences. For example, stuffer sequences can be added upstream or downstream of a short transgene expression cassette to increase the sequence size between AAV ITRs so that the entire vector genome is approximately the same size as the wild-type AAV genome, e.g., about 4.5kb to about 4.8kb, e.g., about 4.7kb.

[0133] Generally, a short stuffer has a unique sequence, region, or domain that enables its identification. In other words, a short stuffer contains a unique sequence, region, or domain that can be detected. Each of the short stuffer sequences described herein has a unique sequence, and therefore the entire short stuffer sequence can be used as a unique identifier. While we do not wish to be bound by theory, a short stuffer sequence can be used in a nucleic acid sequence for viral production to detect residual DNA in its viral preparations. In non-limiting examples, a short stuffer sequence is used in AAV, e.g., recombinant AAV (rAAV) production, and in a DNA sequence for lentiviral production to detect residual DNA in rAAV preparations and lentiviral preparations.

[0134] Intron In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 85% identity with SEQ ID NO: 10. A nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is also referred to herein as an intron.

[0135] As used herein, an intron is any nucleotide sequence present within a gene that does not remain in the final mature mRNA molecule after transcription of that gene and does not code for any amino acids that make up the protein encoded by that gene. There are four main types of introns in tRNA: self-splicing group I introns, self-splicing group II introns, self-splicing group III introns, and spliceme introns. The frequency of introns in different genomes has been observed to vary considerably across the spectrum of organisms.

[0136] In some embodiments, the nucleic acid containing the intron contains one or more nucleotides between positions 45 and 56 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10. For example, the intron contains approximately 10 to 10,000 nucleotides between positions 45 and 46 of a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and at least 100% identity with SEQ ID NO: 10.

[0137] In some embodiments, the nucleic acid includes approximately 2,000 to approximately 5,000 nucleotides, approximately 2,500 to approximately 5,000 nucleotides, approximately 3,000 to approximately 5,000 nucleotides, approximately 3,500 to approximately 5,000 nucleotides, approximately 3,500 to approximately 5,000 nucleotides, approximately 4,000 to approximately 5,000 nucleotides, approximately 4,500 to approximately 5,000 nucleotides, approximately 2,500 to approximately 4,500 nucleotides, approximately 2,500 to approximately 4,000 nucleotides, approximately 2,500 to approximately 3,500 nucleotides, and approximately 2,500 to approximately 3,000 nucleotides between positions 45 and 46 of a nucleotide sequence having at least 85% identity with sequence number 10.

[0138] In some embodiments, the larger stuffer described herein is located between positions 45 and 46 of a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and at least 100% identity with sequence number 10.

[0139] In some embodiments, the nucleic acid further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter.

[0140] In some embodiments, nucleotide sequences having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity with sequence number 10 are located within the nucleic acid sequence encoding the AAV Rep protein.

[0141] In some embodiments, the nucleic acid sequence encoding the AAV Rep protein includes an intron containing a nucleotide sequence having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity with SEQ ID NO: 10.

[0142] In some embodiments, a nucleotide sequence having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity with sequence number 10 is located upstream of a promoter operably ligated to the nucleic acid encoding the Rep protein.

[0143] In some embodiments, a nucleotide sequence having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity with sequence number 10 is located downstream of a promoter, for example, downstream of the p19 promoter.

[0144] In some embodiments, the promoter is a p19 promoter.

[0145] In some embodiments, the AAV Rep is a large Rep (Rep68).

[0146] In some embodiments, the large stuffer does not contain mammalian-derived nucleotide sequences. In some embodiments, the large stuffer contains non-mammalian-derived nucleotide sequences. In some embodiments, the large stuffer is synthetic.

[0147] In some embodiments, the large stuffer does not include two or more of the following: a transcription factor binding site; a regulatory element; an AAV Rep binding site; a donor or acceptor splicing site; an endonuclease cleavage site, the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; a repeat or palindromic sequence longer than 5 nucleotides; and / or a strong secondary structure; or a repeat or palindromic sequence, a repeat or palindromic sequence longer than 5 nucleotides.

[0148] In some embodiments, the 5' end of a nucleotide sequence having at least 85% identity with respect to sequence number 10, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity is ligated to sequence MAG. M is A or C, and the 5' end of a nucleotide sequence having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, and at least 100% identity with respect to sequence number 10 is ligated to A or G.

[0149] Intron + Large Spacer (SynINT) In some embodiments, the nucleic acid containing a large stuffer includes a synthetic intron, the synthetic intron comprising a nucleotide sequence having at least 85% identity with nucleotides 1-45 of SEQ ID NO: 10, with its 3' end ligated to a 2kb synthetic intron, the 3' end of which is ligated to the 5' end of a nucleotide sequence having at least 85% identity with nucleotides 46-167 of SEQ ID NO: 10. The synthetic intron is also referred to herein as SynINT.

[0150] As used herein, an intron is any nucleotide sequence present within a gene that does not remain in the final mature mRNA molecule after transcription of that gene and does not code for any amino acids that make up the protein encoded by that gene. There are four main types of introns in tRNA: self-splicing group I introns, self-splicing group II introns, self-splicing group III introns, and spliceme introns. The frequency of introns in different genomes has been observed to vary considerably across the spectrum of organisms.

[0151] In some embodiments, introns of at least 2kb size do not contain mammalian-derived nucleotide sequences. In other embodiments, introns of at least 2kb size do not contain non-mammalian-derived nucleotide sequences. In further embodiments, introns of at least 2kb size are synthetic.

[0152] In some embodiments, an intron of at least 2 kb size does not include two or more of the following: a transcription factor binding site; a regulatory element; an AAV Rep binding site; a donor or acceptor splicing site; an endonuclease cleavage site, the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; a repeat sequence or palindromic sequence longer than 5 nucleotides; and / or a strong secondary structure; or a repeat sequence or palindromic sequence, a repeat sequence or palindromic sequence longer than 5 nucleotides.

[0153] In some embodiments, the introns contain a GC content of less than about 50%, for example, less than about 45%, or less than about 40%.

[0154] In some embodiments of any one of the embodiments described herein, the synthetic intron comprises a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 11-13. For example, the synthetic intron comprises a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with any one of SEQ ID NOs: 11-13. In some embodiments, the synthetic intron comprises a nucleotide sequence having 100% identity with any one of SEQ ID NOs: 11-13. For example, the synthetic intron comprises a nucleotide sequence having 100% identity with any one of SEQ ID NOs: 11-13.

[0155] In some embodiments, the synthetic intron includes a nucleotide sequence having at least 85% identity with SEQ ID NO: 13. For example, the synthetic intron includes a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 13. In some embodiments, the synthetic intron includes a nucleotide sequence having 100% identity with SEQ ID NO: 13. For example, the synthetic intron consists of a nucleotide sequence having 100% identity with SEQ ID NO: 13.

[0156] In some embodiments of any one of the embodiments described herein, the nucleic acid containing the synthetic intron further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter. It should be noted that the synthetic intron may be located upstream (e.g., at the 5' end) or downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein. For example, the synthetic intron may be located upstream (e.g., at the 5' end) of the nucleic acid sequence encoding the AAV Rep protein. In another example, the synthetic intron may be located downstream (e.g., at the 3' end) of the nucleic acid sequence encoding the AAV Rep protein.

[0157] In some embodiments of any one of the aspects described herein, the synthetic intron is located in the nucleic acid sequence encoding the AAV Rep protein. For example, the synthetic intron is located in an intron within the nucleic acid sequence encoding the AAV Rep protein.

[0158] In some embodiments of any one of the aspects described herein, the nucleic acid comprising the synthetic intron further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter, wherein the synthetic intron is located upstream of the promoter. For example, the synthetic intron is located upstream of the p19 promoter.

[0159] In some other embodiments of any one of the embodiments described herein, the nucleic acid comprising the synthetic intron further comprises a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter, wherein the synthetic intron is downstream of the promoter. For example, the synthetic intron is downstream of the p19 promoter.

[0160] In some embodiments of any one of the aspects described herein, the nucleic acid containing the synthetic intron further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter. Note that the synthetic intron may be located upstream (e.g., at the 5' end) or downstream (e.g., at the 3' end) of the nucleic acid sequences encoding the AAV Rep and AAV Cap proteins. For example, the synthetic intron may be located upstream (e.g., at the 5' end) of the nucleic acid sequences encoding the AAV Rep and AAV Cap proteins. In another example, the synthetic intron may be located downstream (e.g., at the 3' end) of the nucleic acid sequences encoding the AAV Rep and AAV Cap proteins.

[0161] In one embodiment of any of the embodiments, Sequence ID No. 65 is described herein, comprising any of the sequences of Sequence ID Nos. 11 to 13, where the AAV Cap sequence is replaced with another AAV Cap sequence known in the art. Those skilled in the art can use appropriate restriction enzymes present in Sequence ID Nos. 11 to 13 to replace the AAV Cap sequence, for example AAV8, with another AAV Cap sequence known in the art. Similarly, Sequence ID No. 65 can be inserted into a Rep sequence from any AAV serotype known in the art.

[0162] In one embodiment of any of the embodiments, Sequence ID No. 66 is described herein, comprising any of the sequences of Sequence ID Nos. 11 to 13, where the AAV Cap sequence is replaced with another AAV Cap sequence known in the art. Those skilled in the art can use appropriate restriction enzymes present in Sequence ID Nos. 11 to 13 to replace the AAV Cap sequence, for example AAV8, with another AAV Cap sequence known in the art. Similarly, Sequence ID No. 66 can be inserted into a Rep sequence from any AAV serotype known in the art.

[0163] In some embodiments of any one of the aspects described herein, the synthetic intron is located in the nucleic acid sequence encoding the AAV Rep protein and the AAV Cap protein. For example, the synthetic intron is located in an intron within the nucleic acid sequence encoding the AAV Rep protein and the AAV Cap protein.

[0164] In some embodiments of any one of the aspects described herein, the nucleic acid comprising the synthetic intron further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter, wherein the synthetic intron is located upstream of the promoter. For example, the synthetic intron is located upstream of the p19 promoter.

[0165] In some other embodiments of any one of the embodiments described herein, the nucleic acid containing the synthetic intron further comprises nucleic acid sequences encoding AAV Rep and AAV Cap proteins operably linked to a promoter, with the synthetic intron located downstream of the promoter. For example, the synthetic intron is located downstream of the p19 promoter.

[0166] Generally, nucleic acids containing synthetic introns have a length greater than 5.5 kb, for example, greater than 5.6 kb, greater than 5.7 kb, greater than 5.8 kb, greater than 5.9 kb, or greater than 6.0 kb. In some embodiments, the nucleic acids constituting the synthetic intron have a length greater than 6.5 kb, greater than 6.6 kb, greater than 6.7 kb, greater than 6.8 kb, greater than 6.9 kb, greater than 7.0 kb, greater than 7.1 kb, greater than 7.2 kb, greater than 7.3 kb, greater than 7.4 kb, greater than 7.5 kb, greater than 7.6 kb, greater than 7.7 kb, greater than 7.8 kb, greater than 7.9 kb, or greater than 8.0 kb. For example, nucleic acids containing synthetic introns have lengths exceeding 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, or 10.0kb. In some embodiments, nucleic acids containing synthetic introns have lengths greater than 10.1kb, greater than 10.1kb, greater than 10.2kb, greater than 10.3kb, greater than 10.4kb, greater than 10.5kb, greater than 10.6kb, greater than 10.7kb, greater than 10.8kb, greater than 10.9kb, greater than 11.0kb, greater than 11.1kb, greater than 11.2kb, greater than 11.3kb, greater than 11.4kb, greater than 11.5kb, greater than 11.6kb, greater than 11.7kb, greater than 11.8kb, greater than 11.9kb, or greater than 12.0kb. For example, nucleic acids containing synthetic introns have lengths exceeding 12.1kb, 12.2kb, 12.3kb, 12.4kb, 12.5kb, 12.6kb, 12.7kb, 12.8kb, 12.9kb, 13.0kb, 13.1kb, 13.2kb, 13.3kb, 13.4kb, or 13.5kb.In some embodiments, nucleic acids containing synthetic introns have lengths exceeding 13.6kb, 13.7kb, 13.8kb, 13.9kb, 14.0kb, 14.1kb, 14.2kb, 14.3kb, 14.4kb, 14.5kb, 14.6kb, 14.7kb, 14.8kb, 14.9kb, or 15.0kb.

[0167] In some embodiments of any one of the embodiments described herein, the synthetic intron does not contain a mammalian-derived nucleotide sequence. In some embodiments of any one of the embodiments described herein, the synthetic intron contains a non-mammalian-derived nucleotide sequence. In some embodiments, the synthetic intron is synthetic.

[0168] Generally, a synthetic intron is located downstream of the sequence MAG, where M is A or C. Therefore, in some embodiments of any one of the embodiments described herein, the 5' end of the synthetic intron is ligated to the sequence MAG, where M is A or C. In some embodiments, the 3' end of the synthetic intron is ligated to A or G. For example, the 5' end of the synthetic intron is ligated to the sequence MAG, where M is A or C, and the 3' end of the synthetic intron is ligated to A or G.

[0169] In some embodiments of any one of the embodiments described herein, the synthetic intron does not contain more than one of the following (e.g., one, two, three, four, five, six, seven, or eight of the following): transcription factor binding sites; regulatory elements; AAV Rep binding sites; donor or acceptor splicing sites; endonuclease cleavage sites, the endonucleases may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; repeat sequences or palindromic sequences longer than 5 nucleotides; and / or strong secondary structures; or repeat sequences or palindromic sequences, repeat sequences or palindromic sequences longer than 5 nucleotides.

[0170] Endonuclease cleavage site A short spacer can be adjacent to one or more endonuclease cleavage sites. For example, a short spacer may have an endonuclease cleavage site at its 5' end. In another example, a short spacer may have an endonuclease cleavage site at its 3' end. In yet another example, a short spacer may have an endonuclease cleavage site at its 5' end and an endonuclease cleavage site at its 3' end. Exemplary endonucleases include, but are not limited to, BglII, SbfI, PacI, SwaI, ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, and AflII.

[0171] In some embodiments, the short spacer includes an endonuclease cleavage site at its 5' end for an endonuclease selected from the group consisting of BglII, SbfI, PacI, SwaI, ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, and AflII. For example, the short spacer includes an endonuclease cleavage site at its 5' end for BglII.

[0172] In some embodiments, the short spacer includes an endonuclease cleavage site at its 3' end for an endonuclease selected from the group consisting of BglII, SbfI, PacI, SwaI, ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, and AflII. For example, the short spacer includes an endonuclease cleavage site at its 3' end for SbfI, PacI, or SwaI.

[0173] In some embodiments, the short spacer includes an endonuclease cleavage site at its 5' end and an endonuclease cleavage site at its 3' end, where each endonuclease cleavage site is for an endonuclease independently selected from the group consisting of BglII, SbfI, PacI, SwaI, ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, and AflII. For example, the short spacer includes an endonuclease cleavage site for BglII at its 5' end and an endonuclease cleavage site for SbfI, PacI, or SwaI at its 3' end.

[0174] Closed-end DNA (neDNA): DNA having a closed linear structure is described herein as closed-end DNA or neDNA. neDNA is alternatively referred to as closed-end linear double-stranded DNA (clDNA, or celDNA). Closed-end linear double-stranded DNA molecules typically contain a covalently closed end, also described as a hairpin loop, where base pairing between complementary DNA strands is absent. The hairpin loop joins the ends of the complementary DNA strands. This type of structure is typically formed at the telomere ends of chromosomes to protect chromosomal DNA from loss or damage by sequestering terminal nucleotides into a closed structure. In the examples of closed linear DNA molecules described herein, the hairpin loop lies adjacent to the complementary base-paired DNA strands, forming a closed linear (cl)DNA shape structure. In some examples, neDNA further includes at least one, e.g., two, protelomerase binding sites. Non-limiting examples of closed linear double-stranded DNA, or closed-end DNA (neDNA), include doggibone DNA (dbDNA) and / or dumbbell-shaped DNA.

[0165]

[0205] Alternative methods for generating covalently closed-end linear double-stranded DNA lacking bacterial sequences are known in the art, for example, by forming minicircle DNA from plasmids (for example, as described in U.S. Patent No. 8,828,726 and U.S. Patent No. 7,897,380, the contents of each of these are incorporated in whole by reference).

[0175] Protelomerase binding site One method for generating closed-end linear double-stranded nucleic acids involves incorporating a protelomerase binding site (also called a protelomerase target site) into a precursor molecule such that the protelomerase binding site is adjacent to the nucleic acid of interest. The nucleic acid of interest can then be exposed to protelomerase, thereby allowing for cleavage and ligation of the DNA at that site. Non-limiting examples of protelomerase binding sites are described, for example, in U.S. Patent No. 9,109,250; U.S. Patent No. 6,451,563; Nucleic Acids Res. 2015 Oct 15;43(18):e120; U.S. Patent No. 9,499,847; U.S. Patent Application No. 15 / 508,766; International Patent Application PCT / GB2017 / 052413; and Antisense & Nucleic Acid Drug Development 11:149-153 (2001), which are incorporated herein by reference in their entirety. Generally, closed linear DNA contains half of its protelomerase-binding sites.

[0176] In some embodiments, protelomerase binding sites derived from prokaryotes can be used. In lysogenic bacteria, bacteriophage N15 exists as a linear extrachromosomal DNA with covalently closed ends (see Rybchin VN, Svarchevsky AN (1999) The plasmid prophage N15: a linear DNA with covalently closed ends. Mol Microbiol 33:895-903). This DNA is produced by a cleaving-joining reaction, which is carried out by a single enzyme, such as the protelomerase TelN (prokaryotic telomerase) [Deneke J, Ziegelin G, Lurz R, Lanka E (2000) The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci USA 97:7721-7726]. Protelomerases such as TelN recognize target sequences in double-stranded DNA. The target site is an incomplete palindromic structure called telRL, formed by telR and telL in 2 / 2, corresponding to the covalently closed ends of a linear prophage. The enzyme cleaves both DNA strands and ligates the resulting ends to form a covalently closed hairpin structure. The resulting DNA molecule has two hairpin loops. TelN can linearize recombinant plasmids containing the telRL site [Deneke J, et al., (2000). Proc Natl Acad Sci USA 97:7721-7726]. Therefore, this enzyme can be used on plasmid DNA for expression in higher organisms.

[0177] Using the TelN / telRL system, closed linear DNA fragments can be generated by linearizing a parent plasmid containing one telRL site, or by excising a DNA fragment or a non-viral vector fragment. This non-viral vector fragment contains a polyadenylation signal from the parent plasmid having a promoter, the gene of interest, and two adjacent ITRs, each further having two telRL sites adjacent to the respective segments. The resulting linear, covalently closed DNA molecule is functional in vivo.

[0178] The host cell is designed to encode at least one recombinase. The host cell may also be designed to encode two or more recombinases. The term “recombinase” refers to an enzyme that catalyzes DNA exchange at specific target sites, such as palindromic sequences, through excision / insertion, inversion, translocation, and exchange. Examples of recombinases suitable for use in this system include, but are not limited to, TelN, Tel, Tel(gp26 K02 phage)Cre, Flop, phiC31, Int, and other lambdoid phage integrases, such as phi 80, HK022, and HP1 recombinases. The target sequences of each of these recombinases are as follows: telRL site: TATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATA (Sequence code 14); pal site:ACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGT(Sequence ID 15); φK02 telRL part:CCATTATACGCGCGTATAATGG(Sequence ID 16); loxP site:TAACTTCGTATAGCATACATTATACGAAGTTAT(Sequence ID 17); FRT site: GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC (Sequence No. 18); phiC31 attP site:CCCAGGTCAGAAGCGGTTTTCGGGAGTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTT GGGGGCGTAGGGTCGCCGACAYGACACAAGGGGTT (Sequence ID 19); and λattP site: TGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAA AAAAGCTGAACGAGAAACGTAAAATGATATAAA (Sequence ID 20).

[0179] In some embodiments, the 56 bp protelomerase (Tel N) binding site described in Zhang et al., Molecular Therapy, Methods and Clinical Development, Volume 32, Issue 1, 101206, March 14, 2024, This is TATCAGCACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGCTGATA (sequence number 95).

[0180] Recombinase expression is controlled by any regulatory or inductive promoter, i.e., a promoter that is activated under specific physical or chemical conditions or stimuli. Examples of suitable promoters include thermoregulatory promoters such as the λpL promoter, IPTG-regulated lac promoter, glucose-regulated ara promoter, T7 polymerase-regulated promoter, cold shock-inducible cspA promoter, pH-inducible promoter, or combinations thereof such as the tac(T7 and lac) dual regulatory promoter.

[0181] Alternative methods for generating covalently closed-end linear double-stranded DNA lacking bacterial sequences are known in the art, for example, by forming minicircle DNA from plasmids (e.g., as described in U.S. Patent No. 8,828,726 and U.S. Patent No. 7,897,380, the contents of which are incorporated in whole by reference). For example, one cell-free synthesis method combines the use of two enzymes—Phi29 DNA polymerase and protelomerase—to generate high-fidelity covalently closed linear DNA constructs. The constructs do not contain antibiotic resistance markers and thus eliminate the packaging of these sequences. This process can amplify AAV genomic DNA in a two-week process on a commercial scale while maintaining the ITR sequences necessary for viral production.

[0182] By amplifying double-stranded DNA using rolling circle amplification with Phi29 DNA polymerase, and then using protelomerase to covalently generate closed-end linear double-stranded DNA, and combining this with a streamlined purification process, a pure DNA product containing only the desired sequence can be obtained. Phi29 DNA polymerase offers high fidelity (1 × 10⁻⁶). 6 ~1 × 10 7 It possesses high processability (approximately 70 kbp). Due to these characteristics, this polymerase is particularly suitable for the mass production of GMP DNA. Protelomerase (also known as telomere-degrading enzyme) catalyzes the formation of covalently closed hairpin ends on linear DNA and has been identified in several phages, bacterial plasmids, and bacterial chromosomes. A pair of protelomerases recognizes a reverse palindromic DNA recognition sequence and catalyzes strand breaks, strand exchanges, and DNA ligation to produce closed linear hairpin ends. The formation of these closed-end structures makes the DNA resistant to exonuclease activity, allows for simple purification, and improves the stability and duration of expression.

[0183] In one embodiment, the DNA construct includes a protelomerase binding site, and the covalently closed ends are formed by protelomerase enzyme activity (e.g., in vitro). Protelomerase binding sites and corresponding protelomerases for use in the present invention are provided in U.S. Patent No. 9,499,847, the contents of which are incorporated herein by reference in their entirety. The protelomerase target sequences used in the present invention preferably include a double-stranded palindrome (complete reverse repeat) sequence of at least 14 base pairs in length. Preferred complete reverse repeat sequences include sequences SEQ ID NOs. 22-26 and their variants. SEQ ID NO. 21 (NCATNNTANNCGNNTANNATGN) is a 22-base consensus sequence of a complete reverse repeat of a mesothermal bacteriophage. The base pairs of a complete reverse repeat are conserved at specific positions between different bacteriophages, but sequence flexibility is possible at other positions. Therefore, Sequence ID No. 21 is the minimal consensus sequence of a fully reversed repeat sequence for use with bacteriophage protelomerase in the process of the present invention.

[0184] Within the consensus defined by SEQ ID NO: 21, SEQ ID NO: 22 (CCATTATACGCGCGTATAATGG) is a complete reverse repeat sequence for use with Escherichia coli phage N15 and Klebsiella phage Phi KO2 protelomerase. Furthermore, within the consensus defined by SEQ ID NO: 21 and / or SEQ ID NOs: 23 to 26 (SEQ ID NO: 23 (GCATACTACGCGCGTAGTATGC), SEQ ID NO: 24 (CCATACTATACGTATAGTATGG), SEQ ID NO: 25 (GCATACTATACGTATAGTATGC)), it is a particularly preferred complete reverse repeat sequence for use with protelomerases derived from Yersinia phage PY54, Halomonas phage phiHAP-1, and Vibriophage VP882, respectively. SEQ ID NO: 26 (ATTATATATATAAT) is a particularly preferred complete reverse repeat sequence for use with Lyme disease Borrelia (Borrelia burgdorferi) protelomerase. This complete reverse repeat sequence originates from lpB31.16, a linear, covalently closed plasmid found in Lyme disease Borrelia burgdorferi. This 14-nucleotide sequence is shorter than the 22-bp consensus complete reverse repeat for bacteriophages (SEQ ID NO: 21), suggesting that bacterial protelomerases may differ in their specific target sequence requirements for bacteriophage protelomerases. However, all protelomerase target sequences share a common structural motif of complete reverse repeats.

[0185] The complete reverse repeat sequence may be longer than 22 bp, depending on the requirements of the specific protelomerase used in the processes described herein. Therefore, in some embodiments, the complete reverse repeat may be at least 30, at least 40, at least 60, at least 80, or at least 100 base pairs long. Examples of such complete reverse repeat sequences include SEQ ID NOs. 27-29 and their variants. SEQ ID NOs. 27 (GGCATACTATACGTATAGTATGCC); SEQ ID NOs. 28 (ACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGT); SEQ ID NOs. 29 (CCTATATTGGGCCACCTATGTATGCACAGTTCGCCCATACTATACGTATAGTATGGGCGAACTGTGCATACATAGGTGGCCCAATATAGG). SEQ ID NOs. 27-29 and their variants are particularly preferred for use with protelomerases derived from vibriophage VP882, Yersinia phage PY54, and halomonas phage phi HAP-1, respectively.

[0186] A complete reverse repeat may be adjacent to further reverse repeat sequences. Adjacent reverse repeats may be complete or incomplete, i.e., fully symmetric or partially symmetric. Adjacent reverse repeats may be continuous with or discontinuous with the central palindrome. The protelomerase target sequence may contain an incomplete reverse repeat sequence containing a complete reverse repeat sequence of at least 14 base pairs in length. An example is Sequence ID No. 34. The incomplete reverse repeat sequence may contain a complete reverse repeat sequence of at least 22 base pairs in length. An example is Sequence ID No. 30.

[0187] In certain embodiments, the protelomerase target sequence includes the sequences of SEQ ID NOs. 30: (TATCAGCACACAATTGCCCATTATACG-CGCGTATAATGGACTATTGTGTGCTGATA); SEQ ID NOs. 31: (ATGCGCGCATCCATTATACGCGCGTATAATGGCGATAATACA); SEQ ID NOs. 32: (TAGTCACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGTTACTG); SEQ ID NOs. 33: (GGGATCCCGTTCCATACATACATGTATCCATGTGGCATACTATACGTATAGTATGCCGATGTTACATATGGTATCATTCGGGATCCCGTT); SEQ ID NOs. 34: (TACTAAATAAATATTATATATATAATTTTTTATTAGTA). The sequences of SEQ ID NOs. 30-34 include the above-mentioned complete reverse repeat sequences and further include adjacent sequences derived from related organisms. Protelomerase target sequences containing the sequence of SEQ ID NO. 30 or its variants are preferred for use in combination with Escherichia coli (E. coli) N15 TelN protelomerase and its variants. Protelomerase target sequences containing the sequence of SEQ ID NO. 31 or its variants are preferred for use in combination with Klebsiella phage Phi K02 protelomerase and its variants. Protelomerase target sequences containing the sequence of SEQ ID NO. 32 or its variants are preferred for use in combination with Yersinia phage PY54 protelomerase and its variants. Protelomerase target sequences containing the sequence of SEQ ID NO. 33 or its variants are preferred for use in combination with Vibrio phage VP882 protelomerase and its variants. Protelomerase target sequences containing the sequence of SEQ ID NO. 34 or its variants are preferred for use in combination with Lyme disease Borrelia (Borrelia burgdorferi) protelomerase.

[0188] Variants of either the palindromic or protelomerase-targeted sequences described herein include their homologs or variants. Variants include cleavage, substitution, or deletion of the native sequence. A variant sequence is any sequence that, when present in a DNA template, enables conversion to closed-end linear double-stranded DNA by protelomerase enzymatic activity. This can be readily determined by using a suitable assay for the formation of closed linear DNA. Any suitable assay described in the Art may be used. An example of a suitable assay is described in Deneke et al., PNAS (2000) 97, 7721-7726. In certain embodiments, the variant enables protelomerase binding and activity equivalent to that observed in the native sequence. Examples of preferred variants of palindromic sequences described herein include cleaved palindromic sequences that preserve the complete repeat structure and remain capable of forming closed linear DNA. However, variant protelomerase-targeted sequences may be modified so as not to preserve the complete palindromic structure, provided that they can act as substrates for protelomerase activity.

[0189] Those skilled in the art will understand that, based on the structural principles outlined above, suitable protelomerase target sequences for use in the present invention can be easily identified. Candidate protelomerase target sequences can be screened for their ability to promote the formation of closed linear DNA using the assay described above.

[0190] The covalently closed vectors described herein may be produced in vitro or in vivo. The vector is a covalently closed linear double-stranded vector capable of expressing a transgene in target cells. An example of an in vitro process for producing closed linear expression cassette DNA, such as expression cassette DNA containing the ITR described herein, includes: a) contacting a DNA template containing at least one expression cassette flanked on both sides by protelomerase target sequences with at least one DNA polymerase in the presence of one or more primers under conditions that promote amplification of the template; and b) contacting the amplified DNA produced in a) with at least one protelomerase under conditions that promote the formation of closed linear expression cassette DNA. The closed linear expression cassette DNA product may, may be, or essentially be, a eukaryotic promoter operably linked to the coding sequence of interest, and optionally a eukaryotic transcription termination sequence. The closed linear expression cassette DNA product may further lack one or more bacterial or vector sequences selected from the group consisting typically of: (i) a bacterial origin of replication, (ii) a bacterial selection marker (typically an antibiotic resistance gene), and (iii) an unmethylated CpG motif.

[0191] As outlined above, any DNA template containing at least one protelomerase target sequence can be amplified according to the method herein. Therefore, while the production of therapeutic DNA molecules for, for example, DNA vaccines or other therapeutic proteins and nucleic acids is preferred, any type of closed linear DNA can be produced using the method herein. The DNA template may be double-stranded (ds) or single-stranded (ss) DNA. Double-stranded DNA templates may be open circular double-stranded DNA, closed circular double-stranded DNA, open linear double-stranded DNA, or closed linear double-stranded DNA. Preferably, the template is closed circular double-stranded DNA. Closed circular dsDNA templates are particularly preferred for use with RCA (rolling circle amplification) DNA polymerase. Circular dsDNA templates may be in the form of plasmids or other vectors typically used to contain genes for bacterial growth. Therefore, any commercially available plasmid or other vector, such as a commercially available DNA drug, can be amplified using the process described herein, and the amplified vector DNA can then be converted to closed linear DNA.

[0192] Ring-open dsDNA can be used as a template, which is a strand-substitution polymerase that allows the DNA polymerase to initiate amplification from the nicked DNA strand. In this embodiment, the template may be pre-incubated with one or more enzymes that nick the DNA strand in the template at one or more sites. Closed linear dsDNA can also be used as a template. The closed linear dsDNA template (starting material) may be identical to the closed linear DNA product. When closed linear DNA is used as a template, it can be incubated under denaturing conditions to form single-stranded circular DNA before or during conditions that promote amplification of the template DNA. In one embodiment, closed-ended linear double-stranded DNA is produced in eukaryotic cells, such as insect cells, as described in PCT Publications International Publication No. 2019032102 and International Publication No. 2019169233, which are incorporated herein by reference in their entirety. In one embodiment, the DNA is not produced in eukaryotic cells, and the DNA lacks a eukaryotic sequence. In one embodiment, a closed-end linear double-stranded DNA vector is prepared as described in PCT Public International Publication No. 2019143885, which is incorporated in its entirety herein by reference.

[0193] In some embodiments of any one of the embodiments described herein, the nucleic acid described herein, for example, the nucleic acid comprising a short stuffer, further comprises a protelomerase binding site. In some embodiments, the protelomerase binding site is ligated to the 5' end of the stuffer sequence, for example, to the 5' end of the stuffer, for example, operably ligated. In some other embodiments, the protelomerase binding site is ligated to the 3' end of the stuffer sequence, for example, to the 3' end of the short stuffer, for example, operably ligated.

[0194] In some embodiments, the nucleic acid includes a first protelomerase-binding site, for example, operably linked, attached to the 5' end of a short stuffer, and a second protelomerase-binding site, for example, operably linked, attached to the 3' end of the short stuffer. For example, the nucleic acid includes a first partial protelomerase-binding site, for example operably linked, attached to the 5' end of a short stuffer, containing only either telR or telL, and a second partial protelomerase-binding site, for example operably linked, attached to the 3' end of the short stuffer. The first and second partial protelomerase-binding sites together form a functional protelomerase-binding site.

[0195] In some embodiments, the short stuffer is located downstream of the protelomerase binding site. In other embodiments, the short stuffer is located upstream of the protelomerase binding site. In preferred embodiments, the nucleic acid contains two protelomerase binding sites, and the short stuffer is located between the two protelomerase binding sites.

[0196] In some embodiments, the short stuffer is located between the first protelomerase binding site and the ITR (e.g., ITR1).

[0197] In some embodiments, the nucleic acid includes a second protelomerase-binding site (telLR), the protelomerase-binding site located at 3' of the short stuffer.

[0198] In some embodiments, the short stuffer is located between the second protelomerase binding site and the ITR (e.g., ITR2).

[0199] Transgene Embodiments of various aspects described herein include transgenes, for example, heterogenes operably linked to one or more regulatory elements. For example, nucleic acids containing short stuffer sequences further include heterogenes operably linked to one or more regulatory elements.

[0200] In this specification, “transgene” is used to mean a polynucleotide or nucleic acid intended for or introduced into a cell or organism. Transgenes include any nucleic acid, such as genes encoding polypeptides or proteins. Transgenes suitable for use in gene therapy, for example, are well known to those skilled in the art. Exemplary transgenes include, but are not limited to, U.S. Patent No. 6,547,099; U.S. Patent No. 6,506,559; and U.S. Patent No. 4,766,072; U.S. Publication No. 20020006664; U.S. Publication No. 20030153519; U.S. Publication No. 20030139363; and the published PCT applications 01 / 68836 and 03 / 010180, each of which is incorporated herein by reference in whole, as well as miRNAs and other transgenes described in, for example, International Publication No. 2017 / 152149.

[0201] The composition of the transgene sequence depends on the intended use of the resulting vector. A suitable transgene can be readily selected by those skilled in the art. The selection of a transgene is not considered a limitation of the present invention. In some embodiments, the transgene is a nucleic acid sequence encoding a product useful in biology and medicine, such as a protein, peptide, RNA, enzyme, dominant-negative variant, or catalytic RNA. Desired RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNA, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNA. An example of a useful RNA sequence is one that inhibits or eliminates the expression of a target nucleic acid sequence in the treated animal. Typically, suitable target sequences include tumor targets and viral diseases. For examples of such targets, see the oncological targets and viruses specified below in the section on immunogens.

[0202] Transgenes can be used to correct or improve gene defects, which may include defects in which a normal gene is expressed below normal levels or defects in which a functional gene product is not expressed. Preferred types of transgene sequences encode a therapeutic protein or polypeptide that is expressed in host cells. In some embodiments, the transgene is a heterologous protein, and this heterologous protein is a therapeutic protein. Examples of therapeutic proteins include, but are not limited to, hemophilia-related coagulation proteins such as factor VIII, factor IX, and factor X; glial cell-derived neurotrophic factor (GDNF); acid α-glucosidase (GAA); cytochrome P450 family 46 subfamily A member 1 (CYP46A1); protein phosphatase inhibitor 1 constitutive active form (I1c); fukutin-related protein (FKRP); lysosome-associated membrane protein 2B (LAMP2B); blood factors such as β-globin, hemoglobin, tissue plasminogen activator, and coagulation factors; colony-stimulating factor (CSF); and interleukins, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, and IL-9.Growth factors, such as keratinocyte growth factor (KGF), stem cell factor (SCF), fibroblast growth factor (FGF, e.g., basic FGF and acidic FGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), bone morphogenetic protein (BMP), epidermal growth factor (EGF), growth differentiation factor-9 (GDF-9), hepatoma-derived growth factor (HDGF), myostatin (GDF-8), nerve growth factor (NGF), neurotrophin, platelet-derived growth factor (PDGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-α). GF-β, etc.; soluble receptors such as soluble TNF-α receptor, soluble VEGF receptor, soluble interleukin receptor (e.g., soluble IL-1 receptor and soluble type II IL-1 receptor), soluble g / d T cell receptor, and ligand-binding fragments of soluble receptors; enzymes such as α-glucosidase, imiglucase, β-glucocerebrosidase, and alglucerase; enzyme activators such as tissue plasminogen activator; chemokines, such as monokines induced by 1P-10, interferon-gamma (Mig), Groa / IL-8, RANTES, MIP-Ia, and MIR-1b., MCP-1, PF-4, etc.; vascular endothelial growth factor (VEGF, e.g., VEGF121, VEGF165, VEGF-C, VEGF-2), glioma-derived growth factor, angiogenin, angiogenin-2, and other angiogenic agents; etc.; anti-angiogenic agents, e.g., soluble VEGF receptor; protein vaccines; nerve growth factor (NGF), bradykinin, cholecystokinin, gustin, secretin, oxytocin, gonadotropin-releasing hormone, β-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone-releasing hormone, bombesin, dynorphin, warfarin, neurotensin, motilin, thyrotropin, neuropeptide Examples include: D Y, luteinizing hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II, thyrotropin-releasing hormone, vasoactive intestinal peptides, sleep peptides and other neuroactive peptides; thrombolytic agents; atrial natriuretic peptide; relaxin; glial fibrillary acidic protein; follicle-stimulating hormone (FSH); human α1 antitrypsin; leukemia inhibitory factor (LIF); tissue factor, luteinizing hormone; macrophage activator; tumor necrosis factor (TNF); neutrophil chemotactic factor (NCF); metalloproteinase tissue inhibitors; vasoactive intestinal peptides; angiogenin; angiogenic factors; fibrin; hirudin; IF-1 receptor antagonists; and others.Some other non-limiting examples of the target proteins include ciliary neurotrophic factor (CNTF); brain-derived neurotrophic factor (BDNF); amyloid precursor proteins including sAPPα; neurotrophin 3 and 4 / 5 (NT-3 and 4 / 5); aromatic amino acid decarboxylase (AADC); dystrophin family genes, e.g., minidystrophin, microdystrophin, nanodystrophin or their variants; lysosomal acid lipase; phenylalanine hydroxylase (PAH); glucose-6-phosphatase, acid maltase, glycogen debranching enzymes. Examples include glycogen storage disease-related enzymes such as muscle glycogen phosphorylase, liver glycogen phosphorylase, muscle phosphofructokinase, phosphorylase kinase (e.g., PHKA2), glucose transporter (e.g., GFUT2), aldolase A, β-enolase, glycogen synthase; lysosomal enzymes (e.g., β-N-acetylhexosaminidase A); and any variants thereof; nucleases containing Cas, e.g., spcas9, sacas9, or variants thereof; and inhibitory RNA, e.g., miRNA, shRNA, siRNA.

[0203] In some embodiments, the transgene sequence includes a reporter sequence that generates a detectable signal upon expression. Such reporter sequences include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-bound proteins including CD2, CD4, and CD8, influenza hemagglutinin protein, and other well-known proteins for which high-affinity antibodies exist or can be produced by conventional means, as well as DNA sequences encoding fusion proteins, particularly membrane-bound proteins appropriately fused to an antigen-tagging domain from hemagglutinin or Myc.

[0204] When these coding sequences associate with the regulatory elements that drive their expression, they provide signals detectable by conventional means, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), and immunohistochemistry, as well as enzyme-, radioactive, colorimetric, fluorescent, or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays. For example, if the marker sequence is the LacZ gene, the presence of the signal-carrying vector can be detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the signal-carrying vector can be visually measured by the production of color or light using a luminometer.

[0205] In some embodiments, the transgene is adjacent to the ITR. For example, the transgene is operably ligated to the ITR at its 5' end. In another example, the transgene is operably ligated to the ITR at its 3' end. In yet another example, the transgene is operably ligated to the ITR at its 5' end and operably ligated to the ITR at its 3' end.

[0206] Regulatory elements are regions of non-coding DNA that regulate gene transcription. There are two types of regulatory elements: cis-regulatory elements and trans-regulatory elements. Cis-regulatory elements are regions of non-coding DNA that regulate the transcription of adjacent genes. They control gene transcription by binding to transcription factors and are typically found near the gene they regulate. Cis-regulatory elements are usually 100 to 1000 base pairs long. Trans-regulatory elements are DNA sequences that encode upstream regulators that can modify or regulate the expression of distal genes. Unlike cis-regulatory elements, which function through intramolecular interactions between different parts of the same molecule, namely (1) the gene and (2) a regulatory element adjacent to that gene within the same DNA molecule, trans-regulatory elements function through (1) a transcription factor protein derived from the trans-regulatory element and (2) a DNA regulatory element adjacent to the gene being regulated.

[0207] In some embodiments, the short stuffer is located upstream of the xenotransfer gene. In other embodiments, the short stuffer is located downstream of the xenotransfer gene.

[0208] In some embodiments, at least one ITR is located between the short stuffer and the xenotransmitter. For example, the short stuffer is located upstream of the xenotransmitter, and at least one ITR is located between the short stuffer and the xenotransmitter. In another example, the short stuffer is located downstream of the xenotransmitter, and at least one ITR is located between the short stuffer and the xenotransmitter. In some embodiments, each end of the xenotransmitter is adjacent to an ITR, and one of the ITRs is located between the short stuffer and the xenotransmitter.

[0209] ITR In some embodiments, the nucleic acids described herein include at least one adeno-associated virus (AAV) reverse-terminal repeat (ITR) sequence. For example, a nucleic acid containing a short stuffer further includes at least one ITR sequence.

[0210] An "rAAV vector" or "rAAV genome" is an AAV genome (i.e., vDNA) containing one or more heterologous nucleotide sequences. Generally, an rAAV vector requires only cis (one or more) 145-nucleotide terminal repeat sequences ((one or more) TRs) to generate a virus. All other viral sequences are not essential and may be supplied trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). Typically, an rAAV vector genome retains only (one or more) minimal TR sequences to maximize the size of the transgene that can be efficiently packaged by the vector. Structural and non-structural protein-coding sequences may be supplied trans (e.g., from a vector such as a plasmid, or by stably incorporating the sequences into packaging cells). The rAAV vector genome may contain at least one TR sequence (e.g., an AAV TR sequence, a synthetic or other parvovirus TR sequence) and two TRs (e.g., two AAV TRs), which are typically located at the 5' and 3' ends of (one or more) heterologous nucleotide sequences, but do not need to be adjacent to them. The TRs may be the same or different from each other.

[0211] Reverse-end repeats (ITRs) are sequences of nucleotides found at the ends of several linear replicons, such as transposons, viruses, and plasmids. These sequences have the ability to form hairpin structures, which contribute to self-priming, enabling primase-independent synthesis of the second DNA strand. ITRs are also important for both the integration of AAV DNA into and rescue from the host cell genome, as well as for the efficient encapsulation of AAV DNA into the capsid, combined with the generation of fully assembled deoxyribonuclease-resistant AAV particles. Reverse-end repeat (ITR) sequences may or may not be of equal length. ITR sequences of equal length are more efficient in the amplification of the AAV genome.

[0212] As used herein, the terms “reverse terminal repeat” or “ITR” include any wild-type viral terminal repeat and synthetic sequences that can form a hairpin structure and function as a reverse terminal repeat (ITR). A non-limiting example of a synthetic ITR is the 165 bp “double D sequence” described in U.S. Patent No. 5,478,745 by Samulski et al. The capsid structures of autonomous parvovirus and AAV are described in detail in Bernard N. Fields et al., Virology, volume 2, chapters 69 & 70 (4th edition, Lippincott-Raven Publishers). See also the descriptions of the crystal structure of AAV2 (Xie et al., (2002) Proc.Nat.Acad.Sci.99:10405-10), AAV4 (Padron et al., (2005) I.Virol.79:5047-58), AAVS (Walters et al., (2004) I.Virol.78:3361-71), and CPV (Xie et al., (1996) I.Mol.Biol.6:497-520 and Tsao et al., (1991) Science 251:1456-64)."AAV reverse terminal repeat sequences" or "AAV ITR" are serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV AAV ITRS may be derived from any AAV, including but not limited to JEA, AAV2 3xA P2i, AAVDJ P2i, AAV 2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, AAV4A, or other AAVs currently known or to be discovered later. AAV ITRS do not need to have a wild-type terminal repeat sequence (e.g., the wild-type sequence may be modified by insertion, deletion, cleavage or missense mutation) as long as at least one of the ITRs mediates the desired function, a functional ITR, such as replication, viral packaging, integration, and / or proviral rescue. Those skilled in the art will understand that a functional Rep protein is selected for the replication of a functional ITR. In some embodiments, the ITRs are synthetic ITRs, mutant ITRs, or restriction ITRs, as described, for example, in International Publication No. 2014143932, U.S. Patent No. 9447433; International Publication No. 2011088081, U.S. Patent No. 9169494; and International Publication No. 2019143950, all of which are incorporated herein by reference in whole. The ITRs used in nucleic acids comprising the stuffer sequence of the present invention may vary in length, for example, up to 145 bp. In a particular embodiment, one or more ITRs are 145 bp long. In another embodiment, at least one ITR is 130 bp long. In yet another embodiment, at least one ITR is 119 bp long.

[0213] In some embodiments, the nucleic acids described herein include at least two ITRs. For example, the nucleic acid includes a heterologous transgene with an ITR adjacent to each end. If more than two ITRs are present, they may be the same or different. In some preferred embodiments, the ITR sequence is a 130 bp ITR, both flop-oriented (SEQ ID NO: 71), as described in Samulski RJ, Chang LS, Shenk TA recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication. J Virol. 1987 Oct;61(10):3096-101.doi:10.1128 / JVI.61.10.3096-3101.1987.PMID:3041032;PMCID:PMC255885, which is incorporated herein by whole reference.

[0214] In some embodiments, the short stuffer is located upstream of at least one ITR sequence. In other embodiments, the short stuffer is located downstream of at least one ITR sequence.

[0215] In some embodiments, at least one ITR sequence is located between the short stuffer and the xenotransgene. In some embodiments, the nucleic acid further comprises at least one protelomerase binding site, and the short stuffer is located between at least one protelomerase binding site and at least one ITR.

[0216] In some embodiments, the nucleic acid includes at least two ITRs and a short stuffer located outside the two ITRs. In some embodiments, the xenotransgene is located between the two ITRs.

[0217] In some embodiments, the xenotransfer is located between two ITRs, one of which is located between a short stuffer and the xenotransfer.

[0218] In some embodiments, the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterogeneous polynucleotide sequence is located between the first ITR sequence and the second ITR sequence, and the short stuffer is located upstream of the first ITR sequence.

[0219] In some embodiments, the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterogeneous polynucleotide sequence is located between the first ITR sequence and the second ITR sequence, the short stuffer is upstream of the first ITR sequence, and the nucleic acid does not contain a short stuffer downstream of the second ITR sequence.

[0220] In some embodiments, the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, with the short stuffer located upstream of the 5' ends of the first and second ITRs.

[0221] Helper protein In some embodiments of any aspect, the nucleic acid comprises a nucleic acid sequence encoding one or more helper proteins that assist in rAAV production. Generally, the helper proteins that assist in rAAV production are derived from helper viruses.

[0222] As used herein, the term “helper virus” refers to a virus that does not have the ability to replicate on its own and is used to produce copies of helper virus-dependent viral vectors, such as adeno-associated viruses. Helper viruses are used to co-infect cells together with viral vectors and provide the proteins necessary for the replication of the viral vector’s genome. Common helper viruses used to produce rAAV particles include adenoviruses, herpes simplex viruses, cytomegaloviruses, Epstein-Barr viruses, and vaccinia viruses.

[0223] Helper viruses include adenoviruses (AV) and herpes simplex viruses (HSV), and systems exist for producing AAV in insect and mammalian cell systems using baculoviruses. It has also been proposed that papillomaviruses can provide helper function for AAV (see, e.g., Hermonat et al., Molecular Therapy 9, 5289-S290 (2004)). Helper viruses include any virus that can enable AAV replication. AV is an unenveloped nuclear DNA virus with a double-stranded DNA genome of approximately 36 kb. AV can rescue latent AAV proviruses in cells by providing Ela, Elb55K, E2a, E4orf6, and VA genes, enabling AAV replication and capsid formation. HSV is a family of viruses with a relatively large double-stranded linear DNA genome capsidated into an icosahedral capsid enclosed in a lipid bilayer envelope. HSV is infectious and highly contagious. The following HSV-1 replications include the DNA-binding protein ICP8 encoded by the UL8 and UL52) and UL29 genes, with other proteins enhancing helper functions.

[0224] In some embodiments, the nucleic acid sequence encoding one or more helper proteins may encode one or more of the E2A region, the E4 region, and the virus-associated (VA)RNA region, as well as the E1 region, the E3 region, and / or the major late promoter (MLP) region.

[0225] The E1 region helps make the produced AAV replication-eligible. The E3 region contains genes encoding proteins that regulate the immune response after wild-type adenovirus infection. E3 function is activated only when the E1 region is functioning. The major late promoter is important for late-phase specific stimulation of transcription.

[0226] In some embodiments, each helper protein is selected independently of other helper proteins.

[0227] In some embodiments, the nucleic acid sequence encoding one or more helper proteins includes a nucleotide sequence having at least 85% identity with one of sequence numbers 67-68 (XX-680) or 69-70 (XX85). For example, the nucleic acid sequence encoding one or more helper proteins includes a nucleotide sequence having at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with one of sequence numbers 68-70. In some embodiments, the nucleic acid sequence encoding one or more helper proteins includes a nucleotide sequence having 100% identity with one of sequence numbers 68-70. For example, the nucleic acid sequence encoding one or more helper proteins consists of a nucleotide sequence having 100% identity with one of sequence numbers 68-70.

[0228] Exemplary sequences of helper proteins that assist in rAAV production are described, for example, in U.S. Provisional Patent Application No. 63 / 354,304 (Adenovirus-Based Nucleic Acids and Methods Thereof), filed on 22 June 2022, and are incorporated herein by reference in their entirety.

[0229] It should be noted that helper proteins may originate from wild-type adenovirus serotypes or their variants.

[0230] In some embodiments, the nucleic acid includes at least one protelomerase-binding site, and the short stuffer is located between the protelomerase-binding site and a nucleic acid sequence encoding one or more helper proteins.

[0231] In some embodiments, the short stuffer is located upstream of the 5' end of the nucleic acid sequence encoding one or more helper proteins, and is situated between the protelomerase binding site and the nucleic acid sequence encoding one or more helper proteins. In other embodiments, the short stuffer is located downstream of the 3' end of the nucleic acid sequence encoding one or more helper proteins, and is situated between the protelomerase binding site and the nucleic acid sequence encoding one or more helper proteins. In some preferred embodiments, the Ad helper sequence is one of sequence numbers 67-70.

[0232] AAV Rep Embodiments of various embodiments described herein that encode the AAV Rep protein. As used herein, the “nucleic acid sequence encoding the AAV rep protein,” also referred to as the “Rep coding sequence,” refers to a nucleic acid sequence encoding a parvovirus or AAV non-structural protein that mediates viral replication and the production of new viral particles. Parvovirus and AAV replication genes and proteins are described, for example, in Fields et al., Virology, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers), the contents of which are incorporated herein by reference in their entirety.

[0233] Nucleic acid sequences encoding AAV rep proteins do not necessarily have to encode all of the parvovirus or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequence does not need to encode all four AAV Rep proteins (Rep78, Rep68, Rep52, and Rep40); in fact, AAV5 is thought to express only the spliced ​​Rep68 and Rep40 proteins. In some embodiments, the Rep coding sequence encodes at least those replication proteins necessary for replication of the viral genome and packaging into new virions. Sequences encoding AAV Rep proteins generally encode at least one large Rep protein (i.e., Rep78 / 68) and one small Rep protein (i.e., Rep52 / 40).

[0234] In some embodiments, the Rep coding sequence encodes the Rep68 protein. For example, the Rep coding sequence encodes the Rep68 and Rep52 and / or Rep40 proteins. In some embodiments, the Rep coding sequence encodes the Rep68 and Rep52 proteins. In some other embodiments, the Rep coding sequence encodes the Rep68 and Rep40 proteins.

[0235] In some embodiments, the Rep coding sequence codes for Rep78. For example, the Rep coding sequence codes for Rep78 and Rep52 and / or Rep40 proteins. In some embodiments, the Rep coding sequence codes for Rep78 and Rep52 proteins. In some other embodiments, the Rep coding sequence codes for Rep78 and Rep40 proteins.

[0236] As used herein, the term “large Rep protein” refers to Rep68 and / or Rep78.

[0237] It should be noted that Rep proteins, such as large Rep proteins, can be either wild-type or synthetic. Wild-type Rep proteins, such as large Rep proteins, include serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV The AAV rep-cap sequence may be derived from any parvovirus or AAV, including but not limited to JEA, AAV2 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, AAV4, or any other AAV currently known or to be discovered later. Synthetic rep proteins, such as large rep proteins, may be altered by insertions, deletions, cleavage, and / or missense mutations. In some preferred embodiments, the AAV rep-cap sequence is p2 / 8, p2 / 9, or pUC_RCX.

[0238] AAV Cap Embodiments of the various aspects described herein include nucleic acid sequences encoding AAV Cap proteins. “Nucleic acid sequences encoding AAV cap proteins,” also referred to herein as “Cap coding sequences,” refer to nucleic acid sequences encoding structural proteins that form a functional parvovirus or AAV capsid (i.e., capable of packaging DNA and infecting target cells). Typically, a Cap coding sequence encodes all of the parvovirus or AAV capsid subunits, but may encode fewer than all of the capsid subunits, insofar as a functional capsid is produced. Viral capsid proteins (VP; VP1 / VP2 / VP3) form an outer capsid shell that protects the viral genome and are actively involved in cell binding and internalization (Samulski RJ, Muzyczka N. AAV-mediated gene therapy for research and therapeutic purposes. Annu Rev Virol. 2014;1(1):427-451. doi:10.1146 / annurev-virology-031413-085355). The capsid structure of autonomous parvovirus and AAV is described in detail by BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0239] In some embodiments, the AAV cap protein coding sequence codes for VP1. In some embodiments, the AAV cap protein coding sequence codes for VP2. In some embodiments, the AAV cap protein coding sequence codes for VP3. In some embodiments, the sequence coding for the AAV cap protein codes for two of VP1, VP2, and VP3. For example, the AAV cap protein coding sequence codes for VP1 and VP2. In another example, the AAV cap protein coding sequence codes for VP1 and VP3. In some embodiments, the sequence coding for the AAV cap protein codes for all three of VP1, VP2, and VP3.

[0240] Note that the Cap protein can be either wild-type or synthetic. Wild-type Cap proteins are found in serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, and AAV2 3xA. The synthetic Cap protein may be derived from any parvovirus or AAV, including but not limited to P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, AAV4, or any other AAV currently known or to be discovered later. The synthetic Cap protein may be altered by insertions, deletions, cleavage, and / or missense mutations.

[0241] Exemplary AAV cap protein (capsid) sequences are listed in Table 1. The stuffer sequences of the present invention are used in one or more helper nucleic acids. For example, either the short stuffer or the large stuffer described in the present invention is used in one or more of i) a nucleic acid encoding a transgene adjacent to AAV ITR, ii) a nucleic acid encoding an adenovirus helper protein, and iii) a nucleic acid encoding an AAV Rep-Cap protein to produce a recombinant AAV (rAAV) vector having at least one of the viral structural proteins VP1, VP2, or VP3 selected from the AAV serotypes listed in Table 1. [Table 1] TIFF2026522409000003.tif254166 TIFF2026522409000004.tif251166 TIFF2026522409000005.tif251165 TIFF2026522409000006.tif253166 TIFF2026522409000007.tif253166 TIFF2026522409000008.tif252166 TIFF2026522409000009.tif249165 TIFF2026522409000010.tif253166 TIFF2026522409000011.tif252166 TIFF2026522409000012.tif253166 TIFF2026522409000013.tif251166 TIFF2026522409000014.tif252166 TIFF2026522409000015.tif249165 TIFF2026522409000016.tif249166 TIFF2026522409000017.tif250166 TIFF2026522409000018.tif249165 TIFF2026522409000019.tif250165 TIFF2026522409000020.tif251166 TIFF2026522409000021.tif253166 TIFF2026522409000022.tif254166 TIFF2026522409000023.tif251165 TIFF2026522409000024.tif114166 In some embodiments, the AAV cap sequence may be derived from any AAV. In some preferred embodiments, the AAV cap sequence is derived from AAV3B, AAV6, or AAV8.

[0242] In some embodiments of the various aspects described herein, the nucleic acid includes a nucleic acid sequence encoding both the AAV Rep protein and the AAV Cap protein. In such embodiments, the Rep protein and Cap protein are serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 This can be independently selected from any parvovirus or AAV, including but not limited to 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, AAV4, or any other AAV currently known or to be discovered later.

[0243] In some embodiments, the AAV Rep protein and the AAV Cap protein originate from the same AAV serotype. In other embodiments, the AAV Rep protein and the AAV Cap protein originate from different AAV serotypes. Note that one or both of the AAV rep protein and the AAV cap protein may be synthetic.

[0244] In some embodiments, the nucleic acid includes at least one protelomerase-binding site, and the short stuffer is located between the protelomerase-binding site and the nucleic acid sequences encoding the AAV rep protein and the AAV cap protein.

[0245] In some embodiments, the short stuffer is located upstream of the 5' end of the nucleic acid sequences encoding the AAV rep protein and AAV cap protein, and is situated between the protelomerase binding site and the nucleic acid sequences encoding the AAV rep protein and AAV cap protein. In other embodiments, the short stuffer is located downstream of the 3' end of the nucleic acid sequences encoding the AAV rep protein and AAV cap protein, and is situated between the protelomerase binding site and the nucleic acid sequences encoding the AAV rep protein and AAV cap protein.

[0246] length In some embodiments, the nucleic acid containing the short stuffer is long enough to package the nucleic acid sequence into replication-competent AAV particles. For example, the nucleic acid containing the short stuffer is less than 6.5 kb in length. In some embodiments, the nucleic acid containing the short stuffer has lengths of less than 6.4 kb, less than 6.3 kb, less than 6.2 kb, less than 6.1 kb, less than 6.0 kb, less than 5.9 kb, less than 5.8 kb, less than 5.7 kb, less than 5.6 kb, less than 5.5 kb, less than 5.4 kb, less than 5.3 kb, less than 5.2 kb, less than 5.1 kb, or less than 5 kb. For example, nucleic acids containing short stuffers have lengths of less than 4.9kb, less than 4.8kb, less than 4.7kb, less than 4.6kb, less than 4.5kb, less than 4.4kb, less than 4.3kb, less than 4.2kb, less than 4.1kb, less than 4kb, less than 3.9kb, less than 3.8kb, less than 3.7kb, less than 3.6kb, less than 3.5kb, less than 3.4kb, less than 3.3kb, less than 3.2kb, less than 3.1kb, or less than 3.0kb. In some embodiments, nucleic acids containing short stuffers have lengths of less than 2.9kb, less than 2.8kb, less than 2.7kb, less than 2.6kb, less than 2.5kb, less than 2.4kb, less than 2.3kb, less than 2.2kb, less than 2.1kb, less than 2.0kb, less than 1.9kb, less than 1.8kb, less than 1.7kb, less than 1.6kb, less than 1.5kb, less than 1.4kb, less than 1.3kb, less than 1.2kb, less than 1.1kb, or less than 1.0kb. For example, nucleic acids containing short stuffers have lengths of less than 0.9kb, less than 0.8kb, less than 0.7kb, less than 0.6kb, less than 0.5kb, less than 0.4kb, less than 0.3kb, or less than 0.2kb.

[0247] In some embodiments, the nucleic acid containing the large stuffer is long enough to prevent the production of a replication-competent rAAV vector. For example, the nucleic acid containing the large stuffer is long enough to prevent the packaging of the nucleic acid sequence into replication-competent AAV particles. For example, the nucleic acid containing the large stuffer has a length greater than 5.5 kb, such as greater than 5.6 kb, greater than 5.7 kb, greater than 5.8 kb, greater than 5.9 kb, greater than 6.0 kb, greater than 6.1 kb, greater than 6.2 kb, or greater than 6.4 kb. In some embodiments, the nucleic acid containing the large stuffer has a length greater than 6.5kb, greater than 6.6kb, greater than 6.7kb, greater than 6.8kb, greater than 6.9kb, greater than 7.0kb, greater than 7.1kb, greater than 7.2kb, greater than 7.3kb, greater than 7.4kb, greater than 7.5kb, greater than 7.6kb, greater than 7.7kb, greater than 7.8kb, greater than 7.9kb, or greater than 8.0kb. For example, nucleic acids containing large stuffers have lengths exceeding 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, or 10.0kb. In some embodiments, nucleic acids containing large stuffers have lengths exceeding 10.1kb, 10.1kb, 10.2kb, 10.3kb, 10.4kb, 10.5kb, 10.6kb, 10.7kb, 10.8kb, 10.9kb, 11.0kb, 11.1kb, 11.2kb, 11.3kb, 11.4kb, 11.5kb, 11.6kb, 11.7kb, 11.8kb, 11.9kb, or 12.0kb.For example, nucleic acids containing large stuffers have lengths exceeding 12.1kb, 12.2kb, 12.3kb, 12.4kb, 12.5kb, 12.6kb, 12.7kb, 12.8kb, 12.9kb, 13.0kb, 13.1kb, 13.2kb, 13.3kb, 13.4kb, or 13.5kb. In some embodiments, the nucleic acid containing the large stuffer has a length greater than 13.6kb, greater than 13.7kb, greater than 13.8kb, greater than 13.9kb, greater than 14.0kb, greater than 14.1kb, greater than 14.2kb, greater than 14.3kb, greater than 14.4kb, greater than 14.5kb, greater than 14.6kb, greater than 14.7kb, greater than 14.8kb, greater than 14.9kb, or greater than 15.0kb.

[0248] In some embodiments, the nucleic acid further includes a stop codon (e.g., TAA, TAG, or TGA) upstream of the short stuffer. In other embodiments, the nucleic acid further includes a stop codon (e.g., TAA, TAG, or TGA) downstream of the short stuffer.

[0249] In some embodiments, the nucleic acid has a length sufficient to prevent the packaging of the nucleic acid sequence into replication-competent AAV particles.

[0250] vector In some embodiments of any of the embodiments described herein, the nucleic acids described herein are vectors. As used herein, “vector” refers to a compound used as a vehicle capable of carrying foreign genetic material to another cell, replicating and / or expressing it. Cloning vectors containing foreign nucleic acids are called recombinant vectors. Exemplary vectors include, but are not limited to, plasmids, phagemids, bacmids, cosmids, viral vectors, and artificial chromosomes (e.g., bacterial or yeast artificial chromosomes). In some embodiments of any one of the embodiments described herein, the nucleic acids described herein are plasmids. In some other embodiments, the nucleic acids described herein are bacmids. In yet another embodiment, the nucleic acids described herein are cosmids. Recombinant vectors typically include an origin of replication, multiple cloning sites, and a selection marker. The nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that functions as the “backbone” of the vector. The purpose of a vector for transferring genetic information to another cell is typically to isolate, grow, or express the insert within the target cell. An expression vector (expression construct) is used for the expression of an exogenous gene in target cells and generally contains a promoter sequence that drives the expression of the exogenous gene / ORF. The insertion of a vector into target cells is called transformation or transfection of bacterial and eukaryotic cells, while the insertion of a viral vector is often called transduction. The term “vector” may also be used more generally to describe items that help deliver foreign genetic material to another cell, such as transformed cells or nanoparticles, though this is not limited to these.

[0251] Closed-end linear double-strand DNA (clDNA) In some embodiments of any one of the aspects described herein, the nucleic acids described herein are closed-ended linear double-stranded DNA (clDNA). As used herein, the term “clDNA” or “closed-ended linear double-stranded DNA” refers to a closed linear nucleic acid construct that eliminates the need for bacterial cells and therefore eliminates bacterial sequences necessary for large-scale bacterial growth (e.g., antibiotic resistance genes).

[0252] Closed-end linear double-stranded DNA molecules typically contain covalently closed ends, also described as hairpin loops, where base pairing between complementary DNA strands is absent. Hairpin loops connect the ends of complementary DNA strands. This type of structure typically forms at the telomere ends of chromosomes to protect chromosomal DNA from loss or damage by sequestering terminal nucleotides into a closed structure. In the examples of closed linear DNA molecules described herein, the hairpin loops occupy the complementary base-paired DNA strands, forming a closed linear (cl)DNA shape structure. DNA having a closed linear structure is described herein as closed-end double-stranded DNA (clDNA, or celDNA). Alternatively, clDNA is referred herein as closed-end DNA (neDNA). In some examples, clDNA or neDNA further includes at least one, e.g., two, protelomerase-binding sites. Non-limiting examples of closed linear double-stranded DNA, or closed-end DNA (neDNA), include doggybone DNA (dbDNA) and / or dumbbell-shaped DNA.

[0253] In some embodiments, one or more nucleic acids may be present on a closed-end linear double-stranded nucleic acid. Such nucleic acids can be produced by various known methods, including in vitro cell-free synthesis and in vivo methods.

[0254] In certain embodiments, one or more nucleic acid sequences are amplified linear open-ended DNA having blunt ends or overhangs, and the synthesized hairpin molecule is ligated to one or both ends to form a closed-ended linear double-stranded DNA containing one or more of the nucleic acids described herein. Unligated hairpins are purified using means well known to those skilled in the art. DNA can be amplified by PCR and ligated into a double-stranded form.

[0255] One method of generating covalently closed-ended linear double-stranded nucleic acids is by incorporating a telomerase binding site into a precursor molecule such that the telomerase binding site is adjacent to the nucleic acid of interest. The nucleic acid of interest can be exposed to telomerase, thereby cleaving and ligating DNA at that site. Non-limiting examples of cell-free in vitro synthesis of dumbbell-shaped DNA and dbDNA are, for example, U.S. Patent No. 9,109,250; U.S. Patent No. 6,451,563; Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression Nucleic Acids Res. 2015 Oct 15;43(18):e120, High-Purity Preparation of a Large DNA Dumbbell-Antisense&nucleic acid drug development 11:149-153(2001); U.S. Patent No. 9,109,250; U.S. Patent No. 9,499,847; U.S. Patent No. 10,501,782; and International Publication No. 2018033730A1, all of which are incorporated herein by reference in their entirety.

[0256] In some embodiments, the nucleic acid is covalently closed-ended linear double-stranded DNA.

[0257] cell This disclosure also provides host cells containing nucleic acids as described herein. As used herein, the term “cell” refers not only to a single cell but also to a group of cells (i.e., two or more cells). Host cells may be prokaryotic or eukaryotic. Exemplary host cells include, but are not limited to, bacterial cells, yeast cells, plant cells, animal cells (including insect cells), or human cells. Exemplary host cells include, but are not limited to, HEK293, CHO, A549, BHK 21 (clone 13), CV-1, HeLa, LLCMK2, McCoy, MDCK, MRC-5, NCI-H292, Vero, Vero76, Wi 38, A549, Sf9, HepG2, MCF-7, MEF, NS0, HUVEC, Jurkat, Cos-7, 3T3, HL60, ML-1, KG-1, U-937, THP-1, K-562, Molt-4, TF-1, Sf9, Sf21, and Hi-5.

[0258] In some embodiments, the host cell is a eukaryotic cell. For example, the host cell is an insect or mammalian cell. In some embodiments, the host cell is a HEK293 cell. In some other embodiments, the host cell is a HeLa cell.

[0259] In some embodiments, the host cells are microbial cells, such as bacterial cells like Escherichia coli (E. coli) cells, and yeast cells like budding yeast (S. cerevisiae) cells.

[0260] In some embodiments of any one of the embodiments described herein, the host cell comprises a nucleic acid including a short stuffer, at least one ITR, and a nucleic acid sequence encoding a transgene.

[0261] In some embodiments of any one of the embodiments described herein, the host cell comprises a nucleic acid including a short stuffer and a nucleic acid sequence encoding one or more helper proteins that assist in rAAV production (e.g., an adenovirus-based helper protein, an AAV helper Rep-Cap protein).

[0262] In some embodiments of any one of the embodiments described herein, the host cell comprises a nucleic acid containing a short stuffer and a nucleic acid sequence encoding the AAV Rep protein and / or the AAV Cap protein.

[0263] In some embodiments of any one of the embodiments described herein, the host cell comprises a nucleic acid including a nucleic acid sequence encoding a large stuffer and an AAV Rep and / or AAV Cap protein.

[0264] In some embodiments of any one of the embodiments described herein, the host cell comprises (i) a nucleic acid comprising a short stuffer, at least one AAV ITR, and a nucleic acid sequence encoding a transgene; (ii) a nucleic acid comprising a short stuffer and one or more helper proteins (e.g., adenovirus helper proteins) that assist in rAAV production; and (iii) a nucleic acid sequence comprising a large stuffer and an AAV Rep protein and / or an AAV Cap protein.

[0265] Host cells can be used in methods for producing viral particles, such as rAAV particles. Generally, the method includes culturing host cells containing the nucleic acids described herein under conditions such that viral particles are produced, and may also include recovering the viral particles from the culture medium. Viral particles can be concentrated and purified by various biochemical and chromatographic methods, including methods that utilize differences in size, charge, hydrophobicity, solubility, specific affinity, etc., between the viral particles and other substances in the cell culture medium.

[0266] Cells can be cultured in suspension, and cells can be cultured under conditions free of animal components. Animal component-free media can be any animal component-free medium (e.g., serum-free medium) suitable for a given cell line, e.g., HEK293 cells. Examples, but not limited to, SFM4Transfx-293(HYCLONE), Ex-Cell 293(JRH BIOSCIENCES), LC-SFM(INVITROGEN), and Pro293-S(LONZA)Pro-10 cells (as described in U.S. Patent Application No. 9,441,206, which is incorporated by reference in its entirety).

[0267] use The nucleic acids and host cells described herein can be used for the manufacture or production of rAAV. For example, nucleic acids containing large stuffers can be used in methods to prevent the manufacture of replication-competent rAAV.

[0268] As used herein, “replica competent” refers to nucleic acids including, but not limited to, the viral genome, including, but not limited to, the ITR, transgenes, and promoters; the packaging components including, but not limited to, Rep / Cap; and the helper components including, but not limited to, E1, E2A, E4, and VA RNA. The E2A region in the ad helper produces the L4-100K protein. The L4-100K protein is involved in hexone assembly and transport of hexone structures to the nucleus, as well as other proteins that interact with hexones in the final formation of the capsid. This region may also produce adenovirus L4-22K and adenovirus L4-33K. L4-22K is a multifunctional protein involved in the packaging of the viral genome into an empty capsid, as well as the temporal transition from early to late infection by regulating both early and late gene expression. L4-33K functions as an alternative splicing factor involved in genome packaging. The E4 region contributes to the expression of early and late genes in virion packaging. Early genes support viral replication within host cells, while late genes support host cell lysis, viral assembly, and virion release. Virus-associated (VA)RNA regions are a type of non-coding RNA found in adenoviruses. They play a role in regulating the translation of both early and late genes. In some embodiments, at least one copy of VA RNA is present in the replication-competent nucleic acid.

[0269] Methods for producing multiple virus particles are also provided herein. Generally, these methods involve culturing host cells containing nucleic acids as described herein in a culture medium under conditions that produce virus particles.

[0270] In some embodiments, the nucleic acids described herein produce recombinant AAV (rAAV) by a method comprising transfecting cells with i) nucleic acids encoding the rAAV genome, ii) adenovirus helper nucleic acids, and iii) helper nucleic acids encoding the AAV capsid and unstructured replication genes, allowing sufficient time for the cells to produce rAAV particles, and producing a clarified lysate containing rAAV capsid particles, wherein the rAAV capsid particles in the clarified lysate contain at least about 15% complete capsid particles. In certain embodiments, the rAAV in the clarified lysate contains at least about 15% complete capsid particles, at least about 18% complete capsid particles, at least about 20% complete capsid particles, at least about 22% complete capsid particles, at least about 25% complete capsid particles, at least about 30% complete capsid particles, at least about 35% complete capsid particles, or a higher proportion of complete capsid particles. In some embodiments, the nucleic acids used in all steps i), ii), and iii) include any of the short stuffer sequences described herein. In some embodiments, at least one of the nucleic acids used in step i), ii), or iii) includes any short stuffer sequence described herein.

[0271] In certain embodiments of the embodiments, the copy number of the nucleic acid described herein used to produce rAAV is at least about 2,000 copies per cell to at least about 20,000 copies per cell. In some embodiments, the copy number of the nucleic acid described herein is at least about 1,000 copies per cell, at least about 1,500 copies per cell, at least about 2,000 copies per cell, at least about 2,500 copies per cell, at least about 3,000 copies per cell, at least about 3,500 copies per cell, at least about 4,000 copies per cell, at least about 4,500 copies per cell, at least about 5,000 copies per cell, at least about 5,500 copies per cell, at least about 6,000 copies per cell, at least Approximately 6,500 copies, at least 7,000 copies per cell, at least 7,500 copies per cell, at least 8,000 copies per cell, at least 8,500 copies per cell, at least 9,000 copies per cell, at least 9,500 copies per cell, at least 10,000 copies per cell, at least 12,000 copies per cell, at least 14,000 copies per cell, at least 16,000 copies per cell, at least 18,000 copies per cell, and at least 20,000 copies or more per cell.

[0272] In some embodiments, the copy number of the nucleic acids described herein is at least about 5,000 copies per cell to at least about 12,000 copies per cell. In some embodiments, the nucleic acids described herein are used to produce rAAV particles containing at least about 20% to at least about 35% full capsid particles. In an exemplary method for producing recombinant AAV, the method comprises: A) first transfecting cells with (i) the nucleic acids described herein present on a recombinant AAV genome containing an AAV endogenous genome flanked by left-inverted terminal repeats (L-ITRs) or nucleic acids encoding any transgene flanked by left and right ITRs, (ii) helper nucleic acids, and (iii) AAV capsid and unstructured replication (AAVRep-Cap) nucleic acids; B) producing a clarified lysate from a bioreactor, wherein the clarified lysate contains rAAV particles; and C) concentrating (or purifying) the rAAV in the clarified lysate (e.g., by chromatographic purification).

[0273] In some embodiments, the concentration step increases the proportion of complete virus particles (e.g., by removing at least some of the partially complete or empty virus particles). While we do not wish to be bound by theory, a concentrated solution containing complete virus particles (e.g., measured by % complete AAV particles, % complete rAAV particles) may still contain partially complete virus particles and / or empty virus particles. However, the proportion of partially complete virus particles and / or empty virus particles is substantially reduced compared to an unconcentrated clarified lysate.

[0274] As used herein, “transfection” refers to the insertion of nucleic acids into target cells. In some embodiments, the target cells are mammalian cells. In some embodiments, the target cells are suspension HEK293 cells. There are two types of transfection: stable transfection and transient transfection. Stable transfection integrates exogenous nucleic acids into the genome of the transfected cells, while transient transfection involves exogenous nucleic acids being present in the cells for only a limited time and not integrated into the genome of the transfected cells. In some embodiments, the transfection method used is transient transfection. In some embodiments, the transfection method used is stable transfection. Transfection can be carried out by a variety of methods, including but not limited to calcium phosphate, electroporation, and / or cationic lipid-mediated methods (e.g., lipofectamine, polyethyleneimine (PEI)). In some embodiments, the transfection method uses polyethyleneimine. Transfection may require an optimal cell density based on the cell type, application, and / or transfection technique.Additional explanations regarding transfection are provided in Shin et al. Recombinant Adeno-Associated Viral Vector Production and Purification. Methods Mol Biol. 2012;798:267-284; Grieger et al. Production of Recombinant Adeno-associated Virus Vectors Using Suspension HEK293 Cells and Continuous Harvest of Vector From the Culture Media for GMP FIX and FLT1 Clinical Vector. Mol Ther. 2016 Feb;24(2):287-297; and Meier et al. The Interplay between Adeno-Associated Virus and Its Helper Viruses. Viruses. 2020 Jun;12(6):662, each of which is incorporated herein by reference in its entirety.

[0275] As used herein, “sufficient cell mass” refers to the optimal cell density for transfection. In some embodiments, suspension HEK293 cells are grown to produce sufficient cell mass to seed a bioreactor from at least a 25 L scale.To maximize the production of the desired rAAV virus particles, cells should be allowed to stand for at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 25 hours, at least 26 hours, at least 27 hours, at least 28 hours, at least 29 hours, at least 30 hours, at least 31 hours, at least 32 hours, at least 33 hours, at least 34 hours, at least 35 hours, at least 36 hours, at least 37 hours, at least 38 hours, at least 39 hours, at least 40 hours, at least 41 hours, at least 42 hours, at least 43 hours, at least 44 hours, at least 45 hours, at least 46 hours, at least 47 hours, at least 48 hours, at least 49 hours, at least 50 hours, at least 51 hours, at least 52 hours, at least 53 hours, at least 54 hours, at least 55 hours, at least 56 hours, at least 57 hours, at least 58 hours, at least 59 hours, at least 60 hours, at least 61 hours, at least 62 hours, at least 63 hours, at least 64 hours, at least 65 hours, at least 66 hours, at least 67 hours, at least 68 hours, at least 69 hours, at least 70 hours, at least 71 hours, at least 72 hours, at least 73 hours, at least 74 hours, at least 75 hours, at least 76 hours, at least It may require 77 hours, at least 78 hours, at least 79 hours, at least 80 hours, at least 81 hours, at least 82 hours, at least 83 hours, at least 84 hours, at least 85 hours, at least 86 hours, at least 87 hours, at least 88 hours, at least 89 hours, at least 90 hours, at least 91 hours, at least 92 hours, at least 93 hours, at least 94 hours, at least 95 hours, at least 96 hours, at least 97 hours, at least 98 hours, at least 99 hours, at least 100 hours, or more.

[0276] Transfection of the same cell with multiple nucleic acids may occur simultaneously, or the time between the first nucleic acid transfection and the subsequent nucleic acid transfection may be within 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 60 minutes, 65 minutes, 70 minutes, 75 minutes, 80 minutes, 85 minutes, 90 minutes, 95 minutes, 100 minutes, or 110 minutes. It may take up to 120 minutes, 130 minutes, 140 minutes, 150 minutes, 160 minutes, 170 minutes, 180 minutes, 190 minutes, 200 minutes, 210 minutes, 220 minutes, 230 minutes, 240 minutes, 250 minutes, 260 minutes, 270 minutes, 280 minutes, 290 minutes, 300 minutes, 310 minutes, 320 minutes, 330 minutes, 340 minutes, 350 minutes, 360 minutes, or longer.

[0277] In some embodiments, the host cell includes at least one nucleic acid encoding one or more helper proteins sufficient for rAAV production, at least one nucleic acid encoding the AAV Rep protein and the AAV Cap protein, and at least one nucleic acid encoding the transgene of interest.

[0278] In some embodiments, the multiple virus particles include rAAV particles.

[0279] A “packed particle” or “complete particle” (also interchangeably referred to as a “complete AAV particle,” “complete AAV capsid particle,” or “complete rAAV capsid particle”) refers to a viral particle containing an intact viral particle (e.g., a complete capsid) that includes a genome (e.g., a viral genome or recombinant genome that may contain heterologous polynucleotides, i.e., polynucleotides other than the wild-type viral genome, such as a transgene). A “packed” or “complete” particle may also be interchangeably referred to as a “packaged particle,” “packaged virus,” “packaged AAV,” or “recombinant AAV.” Note that the terms “particle” and “capsid” may be used interchangeably and / or redundantly herein.

[0280] An "empty particle," also interchangeably called an "empty AAV particle," refers to a viral particle that contains at least one viral protein but lacks its entire genome, such as a viral genome or recombinant genome. An empty particle does not, for example, contain an intact viral particle containing heterologous polynucleotides.

[0281] A “partially complete particle,” also interchangeably referred to as a “partially complete AAV particle” or “partially filled AAV particle,” refers to a viral particle that contains at least one viral protein but lacks at least a portion of its genome, such as a viral genome or recombinant genome. As used herein, a “partially complete particle” also includes particles containing DNA from a host cell or pDNA used for transfection.

[0282] The percentage of complete AAV particles in a clarified lysate produced using the nucleic acids described herein ("% complete AAV" or "% complete") can be expressed as the number of "complete" AAV particles relative to the total number of AAV particles (including "complete," "partially complete," and "empty" AAV particles).

[0283] manufacturing In several embodiments, nucleic acids comprising the stuffers of the present invention are used to produce recombinant AAV (rAAV). rAAV is produced by methods such as those described in international patent application PCT / US 2022 / 013279, published as International Publication No. 2022159679, and / or international patent application PCT / US 2021 / 013689, published as International Publication No. 2021 / 146591, the whole of which is incorporated herein by reference. In some embodiments, the nucleic acids described herein produce recombinant AAV (rAAV) by a method comprising transfecting cells with i) nucleic acids encoding the rAAV genome, ii) adenovirus helper nucleic acids, and iii) AAV capsid and helper nucleic acids encoding unstructured replication genes, allowing sufficient time for the cells to produce rAAV particles. In some embodiments, the nucleic acids used in all steps i), ii) and iii) comprise one of the short stuffer sequences described in the present invention. In some embodiments, at least one of the nucleic acids used in step i), ii), or iii) comprises any short stuffer sequence described herein. In some embodiments of any one aspect described herein, the nucleic acids used in i), ii), and iii) are plasmid DNA. In some embodiments of any one aspect described herein, the nucleic acids used in i), ii), and iii) are clDNA or neDNA. In some embodiments, the clDNA or neDNA used in i), ii), or iii) further comprises a protelomerase binding site, e.g., TelRL.

[0284] In some embodiments, nucleic acids as described herein are used to produce haploid AAVs, theoretical haploid AAVs, or theoretical polyploid AAVs, as described, for example, in U.S. Patent No. 10,550,405, International Patent Application PCT / US 2018 / 022725, and International Patent Application PCT / US 2018 / 044632 (all of which are incorporated herein by whole reference). In some embodiments, the nucleic acid (used to produce AAVs and / or recombinant AAVs) is plasmid DNA or closed-end linear double-stranded DNA (clDNA). The clDNA described herein is alternatively referred to as closed-end DNA (neDNA). In some exemplary embodiments, the clDNA described herein is closed-end DNA (neDNA). In some embodiments, the nucleic acids described herein are used to produce recombinant AAVs containing one or both ITRs that are 145 nucleotides long or less than 145 nucleotides long. In some embodiments, the nucleic acids described herein are used to produce recombinant AAVs comprising one or both ITRs that are 140 nucleotides long, 135 nucleotides long, 130 nucleotides long, 125 nucleotides long, or less than 125 nucleotides long.

[0285] In some embodiments, the nucleic acids described herein are recombinant AAV (rAAV) produced by a method comprising transfecting cells with i) the Ad helper nucleic acid of the present invention, ii) the rAAV genome, and iii) the AAV capsid and unstructured replication gene, allowing sufficient time for the cells to produce rAAV particles, and producing a clarified lysate containing rAAV capsid particles, wherein the rAAV capsid particles in the clarified lysate contain at least about 15% complete capsid particles. In certain embodiments, the rAAV in the clarified lysate contains at least about 15% complete capsid particles, at least about 18% complete capsid particles, at least about 20% complete capsid particles, at least about 22% complete capsid particles, at least about 25% complete capsid particles, at least about 30% complete capsid particles, at least about 35% complete capsid particles, or a higher proportion of complete capsid particles.

[0286] In certain embodiments of the embodiments, the copy number of the nucleic acid described herein used to produce rAAV is at least about 2,000 copies per cell to at least about 20,000 copies per cell. In some embodiments, the nucleic acid described herein is at least about 1,000 copies per cell, at least about 1,500 copies per cell, at least about 2,000 copies per cell, at least about 2,500 copies per cell, at least about 3,000 copies per cell, at least about 3,500 copies per cell, at least about 4,000 copies per cell, at least about 4,500 copies per cell, at least about 5,000 copies per cell, at least about 5,500 copies per cell, at least about 6,000 copies per cell, and at least about 6 500 copies, at least approximately 7000 copies per cell, at least approximately 7500 copies per cell, at least approximately 8000 copies per cell, at least approximately 8500 copies per cell, at least approximately 9000 copies per cell, at least approximately 9500 copies per cell, at least approximately 10000 copies per cell, at least approximately 12000 copies per cell, at least approximately 14000 copies per cell, at least approximately 16000 copies per cell, at least approximately 18000 copies per cell, and at least approximately 20000 copies or more per cell.

[0287] In some embodiments, the nucleic acids described herein are present in quantities of at least about 5,000 copies to at least about 12,000 copies per cell. In some embodiments, rAAV particles containing at least about 20% to at least about 35% full capsid particles are produced using the nuclei described herein. In an exemplary method for producing recombinant AAV, the method comprises: A) first transfecting cells with (i) the helper nucleic acids described herein, (ii) a recombinant AAV genome consisting of an AAV endogenous genome flanked by left-inverted-end repeats (L-ITRs) or nucleic acids encoding any transgene flanked by left and right ITRs, and (iii) AAV capsid and unstructured replication (AAVRep-Cap) nucleic acids; B) preparing a clarified lysate from a bioreactor, wherein the clarified lysate contains rAAV particles; and C) concentrating (or purifying) the rAAV in the clarified lysate (e.g., by chromatographic purification).

[0288] In some embodiments, the concentration step increases the proportion of complete virus particles (e.g., by removing at least some of the partially complete or empty virus particles). While we do not wish to be bound by theory, a concentrated solution containing complete virus particles (e.g., measured by % complete AAV particles, % complete rAAV particles) may still contain partially complete virus particles and / or empty virus particles. However, the proportion of partially complete virus particles and / or empty virus particles is substantially reduced compared to an unconcentrated clarified lysate.

[0289] In some embodiments, the nucleic acids described herein produce purified recombinant AAV (rAAV) particles by a method comprising: A) i) transfecting cells with Ad helper nucleic acid, ii) rAAV genome, and iii) AAV capsid and unstructured replication genes; B) giving the cells sufficient time to produce rAAV particles; C) producing a clarified lysate; and D) purifying (or concentrating) the clarified lysate (e.g., using a chromatographic purification method) to produce concentrated or purified rAAV particles. In some embodiments, the purified or concentrated rAAV particles contain at least about 65% complete capsid particles. In certain embodiments, the purified or concentrated rAAV particles contain at least about 70% complete capsid particles, at least about 75% complete capsid particles, at least about 80% complete capsid particles, at least about 85% complete capsid particles, at least about 90% complete capsid particles, at least about 95% complete capsid particles, at least about 98% complete capsid particles, at least about 99% complete capsid particles, or at least about 99.5% or more complete capsid particles. In certain embodiments, the purified or concentrated rAAV particles contain 100% complete capsid particles. In certain embodiments, the purified or concentrated rAAV particles consist of approximately less than 10% empty capsid particles, approximately less than 8% empty capsid particles, approximately less than 6% empty capsid particles, approximately less than 5% empty capsid particles, approximately less than 5% empty capsid particles, approximately less than 3% empty capsid particles, approximately less than 2% empty capsid particles, approximately less than 1% empty capsid particles, approximately less than 0.8% empty capsid particles, approximately less than 0.6% empty capsid particles, approximately less than 0.5% empty capsid particles, and approximately Includes less than 0.4% empty capsid particles, less than approximately 0.3% empty capsid particles, less than approximately 0.2% empty capsid particles, less than approximately 0.1% empty capsid particles, less than approximately 0.08% empty capsid particles, less than approximately 0.06% empty capsid particles, less than approximately 0.05% empty capsid particles, less than approximately 0.03% empty capsid particles, less than approximately 0.02% empty capsid particles, or less than approximately 0.01% empty capsid particles, or less than a certain percentage of empty capsid particles.In some embodiments, the purified or concentrated rAAV is substantially devoid of empty capsid particles.

[0290] Residual DNA The residual DNA used herein is a non-viral genome detected in a viral population or multiple viral particles. The residual DNA may be part of the backbone of plasmid DNA, precursor plasmid DNA, or clDNA used to produce a viral vector. Non-limiting examples include: DNA encoding the Rep gene necessary for viral replication, or a fragment thereof; part of a promoter operably linked to the Rep gene; DNA encoding a helper viral protein necessary for viral replication, or a fragment thereof; and antibiotic resistance genes, such as bacterial sequences. The short stuffer sequences described herein can be used to detect residual DNA in a population of any viral vector known in the art. In one embodiment, residual DNA in a population of viral vectors is detected using sequence numbers 1-6, or sequences having at least 85% identity thereto, or a contiguous fragment of about 75-250 nucleotides from any one of sequence numbers 7-9. Non-limiting examples of viral vectors include lentiviral vectors, retroviral vectors, adenovirus vectors, adeno-associated virus vectors (AAV), herpes simplex virus vectors (HSV), or any chimeric or hybrid viral vector known in the art. The residual DNA can be expressed as copies / ml of the viral vector population.

[0291] The present invention, as described herein, further describes a method for detecting residual DNA by using an oligonucleotide primer or probe that can anneal to and thereby detect either a short stuffer sequence in a viral vector preparation or a viral vector population. In one embodiment, the oligonucleotide primer or probe anneals to any of the sequences in the viral population selected from sequence numbers 1-6, or sequences having at least 85% identity thereto, fragments thereof, or a continuous fragment of about 75-250 nucleotides from any one of sequence numbers 7-9, and thereby detects them.

[0292] The oligonucleotide primer or probe sequence is unique to the present invention, annealing to the specific short stuffer sequence described herein. The oligonucleotide primers and / or probes described herein are about 15 to about 35 nucleotides in length. A method for detecting residual DNA in a viral preparation comprises providing two or more oligonucleotide primers or probes.

[0293] A further aspect of the present invention includes providing a kit for detecting residual DNA, or in other words, for detecting the purity of a viral preparation, the kit comprising at least one oligonucleotide primer and / or probe for annealing to any sequence of SEQ ID NOs: 1-6 in a viral population, a fragment of a sequence having at least 85% identity thereto, a sequence having at least identity thereto, or a continuous fragment of about 75-250 nucleotides of any one of SEQ ID NOs: 7-9, thereby detecting any sequence. The kit further comprises at least one helper nucleic acid comprising the short stuffer sequence and / or long stuffer sequence described herein for producing a viral vector. [Table 2] Several exemplary aspects of this disclosure are illustrated by one or more of the following numbered embodiments.

[0294] Embodiment 1: A nucleic acid comprising a short stuffer sequence having at least 85% identity with one of the nucleotide sequences of SEQ ID NOs: 1 to 6.

[0295] Embodiment 2: The nucleic acid according to Embodiment 1, wherein the nucleic acid is linear DNA.

[0296] Embodiment 3: The nucleic acid according to Embodiment 1 or 2, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

[0297] Embodiment 4: The nucleic acid according to any one of Embodiments 1 to 3, wherein the nucleic acid further comprises at least one protelomerase binding site.

[0298] Embodiment 5: The nucleic acid according to Embodiment 4, wherein the short stuffer is located downstream of the protelomerase binding site.

[0299] Embodiment 6: The nucleic acid according to Embodiment 4, wherein the short stuffer is located upstream of the protelomerase binding site.

[0300] Embodiment 7: The nucleic acid according to Embodiment 4, wherein the nucleic acid comprises two protelomerase binding sites and a short stuffer is located between the two protelomerase binding sites.

[0301] Embodiment 8: The nucleic acid according to any one of Embodiments 1 to 7, further comprising a heterologous transgene in which the nucleic acid is operably linked to one or more regulatory elements.

[0302] Embodiment 9: The nucleic acid according to Embodiment 8, wherein the short stuffer is located upstream of the xenotransfer gene.

[0303] Embodiment 10: The nucleic acid according to Embodiment 9, wherein the short stuffer is located downstream of the xenotransfer gene.

[0304] Embodiment 11: The nucleic acid according to any one of Embodiments 8 to 10, wherein the nucleic acid further comprises at least one adeno-associated virus (AAV) reverse terminal repeat (ITR) sequence.

[0305] Embodiment 12: The nucleic acid according to Embodiment 11, wherein the short stuffer is upstream of at least one ITR sequence.

[0306] Embodiment 13: The nucleic acid according to Embodiment 11, wherein the short stuffer is downstream of at least one ITR sequence.

[0307] Embodiment 14: The nucleic acid according to any one of Embodiments 11 to 13, wherein at least one ITR sequence is located between the short stuffer and the xenotransgene.

[0308] Embodiment 15: The nucleic acid according to any one of Embodiments 10 to 13, wherein the nucleic acid further comprises at least one protelomerase binding site, and the short stuffer is located between at least one protelomerase binding site and at least one ITR.

[0309] Embodiment 16: A nucleic acid according to any one of Embodiments 11 to 15, wherein the nucleic acid comprises at least two ITRs and short stuffers located outside the two ITRs.

[0310] Embodiment 17: The nucleic acid according to Embodiment 16, wherein the nucleic acid is a heterologous introduced gene located between two ITRs.

[0311] Embodiment 18: The nucleic acid according to Embodiment 16, wherein the xenotransferred gene is located between two ITRs, and one of the ITRs is located between a short stuffer and the xenotransferred gene.

[0312] Embodiment 19: The nucleic acid according to Embodiment 16, comprising a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, wherein a heterogeneous polynucleotide sequence is located between the first ITR sequence and the second ITR sequence, and a short stuffer is located upstream of the first ITR sequence.

[0313] Embodiment 20: The nucleic acid according to Embodiment 16, wherein the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, a heterogeneous polynucleotide sequence is located between the first and second ITR sequences, a short stuffer is located upstream of the first ITR sequence, and the nucleic acid does not contain a short stuffer downstream of the second ITR sequence.

[0314] Embodiment 21: The nucleic acid according to Embodiment 16, comprising a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, wherein a short stuffer is located upstream of the 5' ends of the first and second ITRs.

[0315] Embodiment 22: Each ITR sequence is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA Nucleic acids according to any one of Embodiments 7 to 21, independently selected from the ITR sequences of P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimeric thereof.

[0316] Embodiment 23: The nucleic acid according to Embodiment 22, wherein the ITR sequences are derived from the same AAV serotype.

[0317] Embodiment 24: The nucleic acid according to Embodiment 22, derived from AAV serotypes with different ITR sequences.

[0318] Embodiment 25: The nucleic acid according to any one of Embodiments 1 to 7, wherein the nucleic acid comprises a nucleic acid sequence encoding one or more helper proteins that assist in rAAV replication.

[0319] Embodiment 26: The nucleic acid according to Embodiment 25, wherein the nucleic acid comprises at least one protelomerase-binding site, and a short stuffer is located between the protelomerase-binding site and a nucleic acid sequence encoding one or more helper proteins.

[0320] Embodiment 27: The nucleic acid according to Embodiment 26, wherein the short stuffer is located upstream of the 5' end of a nucleic acid sequence encoding one or more helper proteins.

[0321] Embodiment 28: The nucleic acid according to Embodiment 26, wherein the short stuffer is located downstream of the 3' end of a nucleic acid sequence encoding one or more helper proteins.

[0322] Embodiment 29: The nucleic acid according to any one of Embodiments 25 to 28, wherein the helper protein sufficient for rAAV replication may include one or more E2A regions, E4 regions, and virus-associated (VA)RNA regions, as well as the E1 region, E3 region, and / or major late promoter (MLP) region.

[0323] Embodiment 30: The nucleic acid according to any one of Embodiments 25 to 29, wherein the nucleic acid sequence encoding one or more helper proteins comprises one nucleotide sequence from any one of SEQ ID NOs. 67 to 70.

[0324] Embodiment 31: The nucleic acid according to any one of Embodiments 1 to 7, wherein the nucleic acid further comprises nucleic acid sequences encoding AAV rep protein and AAV cap protein.

[0325] Embodiment 32: The nucleic acid according to Embodiment 31, wherein the nucleic acid comprises at least one protelomerase binding site, and a short stuffer is located between the protelomerase binding site and the nucleic acid sequences encoding the AAV rep protein and the AAV cap protein.

[0326] Embodiment 33: The nucleic acid according to Embodiment 31, wherein the short stuffer is located upstream of the 5' end of the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

[0327] Embodiment 34: The nucleic acid according to Embodiment 31, wherein the short stuffer is located downstream of the 3' end of the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

[0328] Embodiment 35: The AAV Rep protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 The nucleic acids according to any one of embodiments 31 to 34, which are derived from 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

[0329] Embodiment 36: The AAV Cap protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA The nucleic acids according to any one of embodiments 31 to 35, which are derived from P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E and AAV4A and / or any chimera thereof.

[0330] Embodiment 37: The nucleic acid according to any one of Embodiments 31 to 36, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

[0331] Embodiment 38: The nucleic acid according to any one of Embodiments 31 to 36, wherein the AAV Rep protein and AAV Cap protein are derived from different AAV serotypes.

[0332] Embodiment 39: The nucleic acid according to any one of Embodiments 1 to 6, wherein the nucleic acid comprises an ITR sequence and a protelomerase binding site upstream of the ITR sequence, and the nucleic acid comprises the sequence of SEQ ID NO: 1 or 4 between the ITR and the protelomerase binding site.

[0333] Embodiment 40: The nucleic acid according to any one of Embodiments 1 to 6, wherein the nucleic acid comprises an ITR sequence and a protelomerase binding site downstream of the ITR sequence, and the nucleic acid comprises the sequence of SEQ ID NO: 1 or 4 between the ITR and the protelomerase binding site.

[0334] Embodiment 41: The nucleic acid according to any one of Embodiments 1 to 40, wherein the nucleic acid further comprises a stop codon (e.g., TAA, TAG, or TGA) upstream of the short stuffer.

[0335] Embodiment 42: The nucleic acid according to any one of Embodiments 1 to 40, wherein the nucleic acid further comprises a stop codon (e.g., TAA, TAG, or TGA) downstream of the short stuffer.

[0336] Embodiment 43: The nucleic acid according to any one of Embodiments 1 to 42, wherein the nucleic acid is a vector.

[0337] Embodiment 44: The nucleic acid according to any one of Embodiments 1 to 43, wherein the nucleic acid is a plasmid.

[0338] Embodiment 45: A host cell containing the nucleic acid described in any one of Embodiments 1 to 44.

[0339] Embodiment 46: The host cell according to Embodiment 45, wherein the host cell is an insect cell or a mammalian cell.

[0340] Embodiment 47: The host cell according to Embodiment 46, wherein the mammalian cell is a HEK293 cell or a HeLa cell.

[0341] Embodiment 48: Use of nucleic acid according to any one of Embodiments 1 to 44 in a method for producing multiple viral particles.

[0342] Embodiment 49: Use of Embodiment 48, wherein the virus particles are recombinant AAV (rAAV) particles.

[0343] Embodiment 50: A method for producing a plurality of virus particles, the method comprising the step of culturing the host cells of Embodiment 46 or 47 in a culture medium under conditions that produce virus particles.

[0344] Embodiment 51: A method for producing a plurality of virus particles, comprising the step of culturing a host cell containing the nucleic acid of any one of Embodiments 1 to 44 in a culture medium under conditions that produce virus particles.

[0345] Embodiment 52: The method according to Embodiment 50 or 51, wherein the host cell comprises at least one nucleic acid encoding one or more helper proteins sufficient for rAAV replication, at least one nucleic acid encoding AAV rep protein and AAV cap protein, and at least one nucleic acid encoding the transgene of interest.

[0346] Embodiment 53: The method according to any one of Embodiments 50 to 52, wherein the host cell contains at least one nucleic acid as described in any one of Embodiments 7 to 24.

[0347] Embodiment 54: The method according to any one of Embodiments 50 to 53, wherein the host cell contains at least one nucleic acid as described in any one of Embodiments 25 to 30.

[0348] Embodiment 55: The method according to any one of Embodiments 50 to 54, wherein the host cell contains at least one nucleic acid described in any one of Embodiments 31 to 38.

[0349] Embodiment 56: The method according to any one of Embodiments 50 to 55, wherein the host cell comprises at least one nucleic acid described in any one of Embodiments 7 to 24, at least one nucleic acid described in any one of Embodiments 25 to 30, and at least one nucleic acid described in any one of Embodiments 31 to 38.

[0350] Embodiment 57: The method according to any one of Embodiments 50 to 56, wherein the plurality of virus particles include rAAV particles.

[0351] Embodiment 58: A nucleic acid comprising a large stuffer, comprising a nucleotide sequence having at least 85% identity with the nucleotide sequence described in any one of SEQ ID NOs: 7 to 9.

[0352] Embodiment 59: The nucleic acid according to Embodiment 58, further comprising a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter.

[0353] Embodiment 60: The nucleic acid according to Embodiment 59, wherein the large stuffer is located in the nucleic acid sequence encoding the AAV Rep protein.

[0354] Embodiment 61: The nucleic acid according to Embodiment 60, wherein the large stuffer is located in the intron encoding the AAV Rep protein.

[0355] Embodiment 62: The nucleic acid according to any one of Embodiments 59 to 61, wherein a large stuffer is located upstream of the promoter.

[0356] Embodiment 63: The nucleic acid according to any one of Embodiments 59 to 61, wherein a large stuffer is located downstream of the promoter.

[0357] Embodiment 64: The nucleic acid according to any one of Embodiments 59 to 63, wherein the promoter is a p19 promoter.

[0358] Embodiment 65: The nucleic acid according to any one of Embodiments 59 to 64, wherein the AAV Rep is a large Rep.

[0359] Embodiment 66: The nucleic acid according to any one of Embodiments 59 to 65, wherein the AAV Rep is Rep68 or Rep78.

[0360] Embodiment 67: The nucleic acid according to any one of Embodiments 59 to 66, wherein the AAV Rep is Rep68.

[0361] Embodiment 68: AAV Rep protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 The nucleic acids according to any one of embodiments 59 to 67, which are derived from 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

[0362] Embodiment 69: The nucleic acid according to any one of Embodiments 59 to 68, wherein the AAV Rep protein is a modified Rep protein.

[0363] Embodiment 70: The nucleic acid according to any one of Embodiments 59 to 69, further comprising a nucleic acid sequence encoding the AAV Cap protein.

[0364] Embodiment 71: The nucleic acid according to Embodiment 70, wherein the nucleic acid sequence encoding the AAV Cap protein is downstream of the nucleic acid sequence encoding the AAV Rep protein.

[0365] Embodiment 72: The nucleic acid according to Embodiment 70, wherein the nucleic acid sequence encoding the AAV Cap protein is upstream of the nucleic acid sequence encoding the AAV Rep protein.

[0366] Embodiment 73: The nucleic acid sequence encoding the AAV Cap protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 The nucleic acids according to any one of embodiments 70 to 72, which are derived from 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

[0367] Embodiment 74: The nucleic acid according to any one of Embodiments 70 to 73, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

[0368] Embodiment 75: The nucleic acid according to any one of Embodiments 70 to 73, wherein the AAV Rep protein and the AAV Cap protein are derived from different AAV serotypes.

[0369] Embodiment 76: The nucleic acid according to any one of Embodiments 70 to 75, wherein the nucleic acid sequence encoding the AAV Rep protein is upstream of the nucleic acid sequence encoding the AAV Cap protein.

[0370] Embodiment 77: The nucleic acid according to any one of Embodiments 70 to 75, wherein the nucleic acid sequence encoding the AAV Rep protein is downstream of the nucleic acid sequence encoding the AAV Cap protein.

[0371] Embodiment 78: The nucleic acid according to any one of claims 58 to 77, wherein the large stuffer does not contain a mammalian nucleotide sequence.

[0372] Embodiment 79: The nucleic acid according to any one of claims 58 to 78, wherein the large stuffer contains a nucleotide sequence of non-mammalian origin.

[0373] Embodiment 80: The nucleic acid according to any one of claims 58 to 79, wherein the large stuffer is synthetic.

[0374] Embodiment 81: A nucleic acid according to any one of claims 58 to 80, wherein the large stuffer does not include two or more of the following: (a) a transcription factor binding site; (b) a regulatory element; (c) an AAV Rep binding site; (d) a donor or acceptor splicing site; (e) an endonuclease cleavage site, where the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; (f) a repeat sequence or palindromic sequence longer than 5 nucleotides; (g) a strong secondary structure; and / or (h) a repeat sequence or palindromic sequence longer than 5 nucleotides, which may be a repeat sequence or palindromic sequence;

[0375] Embodiment 82: The nucleic acid according to any one of Embodiments 58 to 81, wherein the large stuffer has a GC content of less than about 50%, for example, less than about 45%, or less than about 40%.

[0376] Embodiment 83: The nucleic acid according to any one of Embodiments 58 to 82, wherein the nucleic acid is longer than 5.5 kb.

[0377] Embodiment 84: The nucleic acid according to any one of Embodiments 58 to 83, comprising a sequence MAG in which M is A or C upstream of a large stuffer.

[0378] Embodiment 85: The nucleic acid according to any one of Embodiments 58 to 84, wherein the nucleic acid is a vector.

[0379] Embodiment 86: The nucleic acid according to any one of Embodiments 58 to 85, wherein the nucleic acid is a plasmid.

[0380] Embodiment 87: The nucleic acid according to any one of Embodiments 58 to 86, wherein the nucleic acid is linear DNA.

[0381] Embodiment 88: The nucleic acid according to any one of Embodiments 58 to 87, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

[0382] Embodiment 89: A host cell containing the nucleic acid described in any one of Embodiments 58 to 88.

[0383] Embodiment 90: The host cell according to Embodiment 89, wherein the host cell is an insect cell or a mammalian cell, and the mammalian cell may be a HEK293 cell or a HeLa cell.

[0384] Embodiment 91: A method for preventing the production of replication-competent rAAV, using nucleic acids according to any one of Embodiments 59 to 88 or host cells according to Embodiment 89 or 90.

[0385] Embodiment 92: A nucleic acid comprising a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 and a large stuffer of at least 2 kb in size.

[0386] Embodiment 93: The nucleic acid according to Embodiment 92, comprising one or more nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10.

[0387] Embodiment 94: The nucleic acid according to Embodiment 93, comprising approximately 10 to approximately 10,000 nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10.

[0388] Embodiment 95: The nucleic acid according to Embodiment 94, comprising approximately 2,000 to approximately 5,000 nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10.

[0389] Embodiment 96: The nucleic acid according to any one of Embodiments 92 to 95, wherein the large stuffer is located between positions 44 and 45 of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10.

[0390] Embodiment 97: The nucleic acid according to any one of Embodiments 92 to 96, wherein the large stuffer comprises a nucleotide sequence having at least 85% identity with the nucleotide sequence described in any one of Sequence IDs 7 to 9.

[0391] Embodiment 98: The nucleic acid according to any one of Embodiments 92 to 97, further comprising a nucleic acid sequence encoding an AAV Rep protein in which the nucleic acid is operably linked to a promoter.

[0392] Embodiment 99: The nucleic acid according to Embodiment 98, wherein a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in the nucleic acid sequence encoding the AAV Rep protein.

[0393] Embodiment 100: The nucleic acid according to Embodiment 98 or 99, wherein a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located in an intron within the nucleic acid sequence encoding the AAV Rep protein.

[0394] Embodiment 101: The nucleic acid according to any one of Embodiments 98 to 100, wherein a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located upstream of the promoter.

[0395] Embodiment 102: The nucleic acid according to any one of Embodiments 98 to 100, wherein a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is located downstream of the promoter.

[0396] Embodiment 103: The nucleic acid according to any one of Embodiments 98 to 102, wherein the promoter is a p19 promoter.

[0397] Embodiment 104: The nucleic acid according to any one of Embodiments 98 to 103, wherein the AAV Rep is a large Rep (Rep68).

[0398] Embodiment 105: AAV Rep protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 Nucleic acids according to any one of embodiments 98 to 104, derived from 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

[0399] Embodiment 106: The nucleic acid according to any one of Embodiments 98 to 105, wherein the AAV Rep protein is a modified Rep protein.

[0400] Embodiment 107: The nucleic acid according to any one of Embodiments 98 to 106, further comprising a nucleic acid sequence encoding the AAV Cap protein.

[0401] Embodiment 108: The nucleic acid according to Embodiment 107, wherein the nucleic acid sequence encoding the AAV Cap protein is downstream of the nucleic acid sequence encoding the AAV Rep protein.

[0402] Embodiment 109: The nucleic acid according to Embodiment 107, wherein the nucleic acid sequence encoding the AAV Cap protein is upstream of the nucleic acid sequence encoding the AAV Rep protein.

[0403] Embodiment 110: The nucleic acid sequence encoding the AAV Cap protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 Nucleic acids according to any one of embodiments 107 to 109, derived from 3xA P2i, AAVDJ P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

[0404] Embodiment 111: The nucleic acid according to any one of Embodiments 107 to 110, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

[0405] Embodiment 112: The nucleic acid according to any one of Embodiments 107 to 110, wherein the AAV Rep protein and AAV Cap protein are derived from different AAV serotypes.

[0406] Embodiment 113: A nucleic acid according to any one of Embodiments 92 to 112, longer than 5.5 kb.

[0407] Embodiment 114: The nucleic acid according to any one of claims 92 to 113, wherein the large stuffer does not contain a mammalian nucleotide sequence.

[0408] Embodiment 115: The nucleic acid according to any one of claims 92 to 114, wherein the large stuffer contains a nucleotide sequence of non-mammalian origin.

[0409] Embodiment 166: The nucleic acid according to any one of claims 92 to 115, wherein the large stuffer is synthetic.

[0410] Embodiment 117: A nucleic acid according to any one of claims 92 to 116, wherein the large stuffer does not include two or more of the following: (a) a transcription factor binding site; (b) a regulatory element; (c) an AAV Rep binding site; (d) a donor or acceptor splicing site; (e) an endonuclease cleavage site, where the endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI; (f) a repeat sequence or palindromic sequence longer than 5 nucleotides; (g) a strong secondary structure; and / or (h) a repeat sequence or palindromic sequence longer than 5 nucleotides, optionally a repeat sequence or palindromic sequence.

[0411] Embodiment 118: The nucleic acid according to any one of Embodiments 92 to 117, wherein the large stuffer contains less than 50%, for example, less than 45%, or less than 40% GC content.

[0412] Embodiment 119: The nucleic acid according to any one of Embodiments 92 to 118, wherein the nucleic acid is longer than 5.5 kb.

[0413] Embodiment 120: The nucleic acid according to any one of Embodiments 92 to 119, wherein the 5' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to sequence MAG, and M is A or C.

[0414] Embodiment 121: The nucleic acid according to any one of Embodiments 92 to 120, wherein the 3' end of a nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to A or G.

[0415] Embodiment 122: The nucleic acid according to any one of Embodiments 92 to 121, wherein the large stuffer is located downstream of sequence MAG and M is A or C.

[0416] Embodiment 123: The nucleic acid according to any one of Embodiments 92 to 122, wherein the nucleic acid comprises a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of SEQ ID NOs: 11 to 13.

[0417] Embodiment 124: The nucleic acid according to Embodiment 123, wherein the 5' end of a nucleotide sequence having at least 85% identity with any of SEQ ID NOs: 11 to 13 is ligated to sequence MAG, and M is A or C.

[0418] Embodiment 125: The nucleic acid according to Embodiment 123 or 124, wherein the 3' end of a nucleotide sequence having at least 85% identity with any of SEQ ID NOs: 11 to 13 is ligated to A or G.

[0419] Embodiment 126: The nucleic acid according to any one of Embodiments 92 to 125, wherein the nucleic acid comprises a nucleotide sequence having at least 85% identity with SEQ ID NO: 11.

[0420] Embodiment 127: The nucleic acid according to any one of Embodiments 92 to 126, wherein the nucleic acid interferes with the production of a replication-competent rAAV vector.

[0421] Embodiment 128: The nucleic acid according to any one of Embodiments 92 to 127, wherein the nucleic acid is a vector.

[0422] Embodiment 129: The nucleic acid according to any one of Embodiments 92 to 128, wherein the nucleic acid is a plasmid.

[0423] Embodiment 130: The nucleic acid according to any one of Embodiments 92 to 129, wherein the nucleic acid is linear DNA.

[0424] Embodiment 131: The nucleic acid according to any one of Embodiments 92 to 130, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

[0425] Embodiment 132: A host cell containing the nucleic acid described in any one of Embodiments 92 to 131.

[0426] Embodiment 133: The host cell according to Embodiment 132, wherein the host cell is an insect cell or a mammalian cell, and the mammalian cell may be a HEK293 cell or a HeLa cell.

[0427] Embodiment 134: A method for preventing the production of replication-competent rAAV, using a nucleic acid according to any one of Embodiments 92 to 131 or a host cell according to any one of Embodiments 132 to 133.

[0428] Embodiment 135: A method for detecting residual DNA in a population of viral particles, comprising using at least one oligonucleotide sequence that anneals to any one of the nucleic acid sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0429] Embodiment 136: The method according to Embodiment 135, wherein the method includes using at least two oligonucleotide sequences that anneal to any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0430] Embodiment 137: The method according to Embodiment 136, wherein the oligonucleotide is approximately 20 nucleotides long.

[0431] Embodiment 138: The method according to Embodiment 136, wherein the oligonucleotide is approximately 25 nucleotides long.

[0432] Selected definition Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have meanings generally understood by those skilled in the art. Terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the invention as defined solely by the claims. Definitions of common terms in cell biology, immunology, and molecular biology are all incorporated herein by reference: The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier,2006;Janeway's Immunobiology,Kenneth Murphy,Allan Mowat,Casey Weaver(eds.),WWNorton&Company,2016(ISBN 0815345054,978-0815345053);Lewin's Genes XI,published by Jones&Bartlett Publishers,2014(ISBN-1449659055);Michael Richard Green and Joseph Sambrook,Molecular Cloning:A Laboratory Manual,4th ed.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,NY,USA(2012)(ISBN 1936113414);Davis et al.,Basic Methods in Molecular Biology,Elsevier Science Publishing,Inc.,New York,USA(2012)(ISBN 044460149X);Laboratory Methods in Enzymology:DNA,Jon Lorsch(ed.)Elsevier,2013(ISBN 0124199542);Current Protocols in Molecular Biology(CPMB),Frederick M.Ausubel(ed.),John Wiley and Sons,2014(ISBN 047150338X,9780471503385),Current Protocols in Protein Science(CPPS),John E.Coligan(ed.), John Wiley and This is described in Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737)).

[0433] Furthermore, unless otherwise specified by the context, singular terms shall include plural forms, and plural terms shall include singular forms.

[0434] In some embodiments of any aspect, the disclosures described herein do not relate to processes for cloning humans, processes for altering the genetic identity of human germlines, the use of human embryos for industrial or commercial purposes, or processes for altering the genetic identity of animals which are likely to cause suffering to animals without providing substantial medical benefit to humans or animals, or to animals resulting from such processes.

[0435] The grouping of alternative elements or embodiments disclosed herein should not be construed as limitation. Each group member may be referenced and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in or excluded from a group for convenience and / or patentability reasons. In the event of such inclusion or exclusion, this specification shall be deemed to include the modified group and thus satisfy the description of all Markush groups used in the appended claims.

[0436] The abbreviation "e.g.," derives from the Latin "exempli gratia" and is used herein to indicate non-restrictive examples. Therefore, the abbreviation "eg," is synonymous with the term "e.g.,."

[0437] Unless otherwise stated in the Examples, all numerical values ​​representing the amounts of components or reaction conditions used herein should be understood to be modified by the term "approximately." When used to describe the present invention, the term "approximately" means ±1% in relation to a percentage.

[0438] When used in the context of polynucleotide sequences, the term "variant" may encompass polynucleotide sequences related to wild-type genes. This definition may also include, for example, "allelic," "splice," "species," or "polymorphic" variants. Splice variants may have significant identity with respect to a reference molecule, but generally have more or fewer polynucleotides due to alternating splicing of exons during mRNA processing. The corresponding polypeptide may have additional functional domains or the absence of domains. Species variants are polynucleotide sequences that differ from species to species. Of particular use in this technology are variants of wild-type gene products. Variants may arise from at least one mutation in a nucleic acid sequence, resulting in altered mRNA or polypeptides whose structure or function may or may not be altered. Any given native or recombinant gene may not have alleles, and may have one or more. Common mutations that result in variants generally result from native deletions, additions, or substitutions of nucleotides. Each of these types of changes can occur one or more times within a given sequence, either alone or in combination with others.

[0439] As used herein, the term “nucleic acid” typically refers to oligomers or polymers of any length (preferably linear polymers) that are essentially composed of nucleotides. A nucleotide unit generally includes a heterocyclic base, a sugar group, and at least one, e.g., one, two, or three phosphate groups, including a modified or substituted phosphate group. Heterocyclic bases may include, among others, purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely present in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), unnatural, or derivatized bases. Sugar groups may include pentose (pentofuranose) groups, e.g., ribose and / or 2-deoxyribose, which are common in naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, and modified or substituted sugar groups. Nucleic acids as used herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or any other useful properties. The term “nucleic acid” more preferably includes DNA, RNA, and DNA-RNA hybrid molecules. “Nucleic acid” may be double-stranded, partially double-stranded, or single-stranded. In the case of single-stranded nucleic acid, the nucleic acid may be a sense strand or an antisense strand. Furthermore, nucleic acid may be cyclic or linear.

[0440] A variant amino acid or DNA sequence may be identical to the native sequence or reference sequence by at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more. The degree of homology (identity percentage) between the native sequence and the mutant sequence can be determined, for example, by comparing the two sequences using a freely available computer program commonly used for this purpose on the World Wide Web (e.g., BLASTp or BLASTn with default settings).

[0441] Terms such as "identity" and "identity" refer to sequence similarity between two polymer molecules, for example, between two nucleic acid molecules, or for example, between two DNA molecules. Sequence alignment and sequence identity can be determined using, for example, the Basic Local Alignment Search Tool (BLAST), first described by Altschul et al. in 1990 (J Mol Biol 215:403-10), or the "Blast 2 sequences" algorithm described by Tatusova and Madden in 1999 (FEMS Microbiol Lett 174:247-250).

[0442] Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are available, for example, from Smith and Waterman (1981) Adv.Appl.Math.2:482; Needleman and Wunsch (1970) J.Mol.Biol.48:443; Pearson and Lipman (1988) Proc.Natl.Acad.Sci.USA85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res.16:10881-90; Huang et al. (1992) Comp.Appl.Biosci.8:155-65; Pearson et al. (1994) Methods This is described in Mol.Biol.24:307-31 and Tatiana et al.(1999)FEMS Microbiol.Lett.174:247-50. Detailed discussions on sequence alignment methods and homology calculations are described, for example, in Altschul et al.(1990)J.Mol.Biol.215:403-10.

[0443] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST®; Altschul et al (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD), and can be used in conjunction with several sequence analysis programs on the internet. Instructions on how to determine sequence identity using this program are available online under the "Support" section of BLAST®. For comparing nucleic acid sequences, the "Blast2 Sequences" function of the BLAST® (Blastn) program can be used with default parameters. Nucleic acid sequences with greater similarity to a reference sequence will show an increased percentage of identity when evaluated by this method. Typically, the percentage of sequence identity is calculated over the entire length of the sequence.

[0444] For example, the Needleman-Wunsch algorithm can appropriately find the optimal overall alignment using the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extension 2. The percentage of identity of the obtained optimal overall alignment is appropriately calculated by multiplying the ratio of the number of aligned bases to the total length of the alignment (the alignment length includes both matches and mismatches) by 100.

[0445] The nucleic acids described herein may be synthetic. In this application, “synthetic” means nucleic acid molecules that do not exist in nature. Synthetic nucleic acids are typically produced artificially by recombinant techniques. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but these may be present in circumstances not found in nature. For example, a synthetic gene (or part of a gene) typically contains one or more non-contiguous nucleic acid sequences (chimeric sequences) and / or may include substitutions, insertions, deletions, and combinations thereof. As used herein, the term “synthetic promoter” refers to a promoter that does not exist in nature.

[0446] Where used herein, the singular forms “a,” “an,” and “the” are intended to include the plural form unless the context clearly indicates otherwise. Furthermore, wherever the terms “including,” “includes,” “having,” “has,” and “with,” or their variants, are used in either the detailed description and / or the claims, such terms are intended to be as comprehensive as the term “comprising.” Note that where used herein and in the appended claims, the singular forms “a,” “an,” and “the” include the plural form unless the context clearly indicates otherwise.

[0447] As used herein, the terms “comprising,” “comprise,” or “comprised,” and their variations, referring to elements of a defined or described item, composition, apparatus, method, process, system, etc., mean comprehensive or open-ended, allowing for additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc., includes its specified elements—or, where appropriate, their equivalents—and may include other elements, and falls within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.

[0448] As used herein and in the appended claims, the term “or” is generally used to include “and / or” unless the context clearly indicates otherwise.

[0449] Certain elements of any of the embodiments described above can be combined with or replaced by elements of other embodiments. Furthermore, while the advantages related to specific embodiments of this disclosure have been described in the context of those embodiments, other embodiments may also demonstrate such advantages, and not all embodiments are required to demonstrate such advantages in order to fall within the scope of this disclosure.

[0450] It should be understood that the present invention is not limited to, and is therefore subject to change, the specific methodologies, protocols, and reagents described herein. The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the present invention as defined solely by the claims.

[0451] [Examples] The following non-limiting examples are provided for illustrative purposes only to facilitate a more complete understanding of the representative embodiments currently being considered.

[0452] Example 1: Helper adenovirus plasmid The stuffer sequences of SEQ ID NO: 1 and SEQ ID NO: 4 may be included in the nucleic acids described herein, for example, the pxx85 sequences described herein. If stuffer sequences 2 and 7 are included in such sequences, they will not induce gene expression of, for example, E2 or E4 proteins.

[0453] Adenovirus 5 (hAd5)-based nucleic acids described herein, e.g., XX85, further comprising stuffer 2 and / or 7 (SEQ ID NOs: 1 and 4), can be hydrodynamically injected into mice, and the expression of E2 and / or E4 in the liver can be measured. A plasmid containing any one of the stuffer sequences can be administered to 7-week-old C57BL / 6JOlaHsd male mice by hydrodynamic tail vein injection. Twenty-four hours after injection, the animals can be euthanized, and gene expression in the liver can be quantified (at mRNA and protein levels). Plasmid copy number (PCN) can also be determined in the liver to normalize the expression levels. The levels of gene and protein expression from plasmids containing one or both stuffers are similar to those observed in a control construct without stuffers.

[0454] Sequence ID 1 and / or Sequence ID 4 may be included in the nucleic acid sequence described herein, for example, XX85 which further includes a protelomerase site. In particular, stuffer sequences 2 and / or 7 (Sequence IDs 1 and 4) may be included upstream of the 5' end of the E4 region (i.e., the 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., the 3' stuffer). Furthermore, the 5' stuffer may be located at the AscI site 5' of the E4 region, and / or the 3' stuffer may be located at the NotI site 3' of the E2A region. These positions are schematically shown in Figure 29. Nucleic acids containing one or both of the stuffers at the 5' and / or 3' positions may be tested, for example, as shown in the table below. Nucleic acids containing only the 5' stuffer may show good performance, and nucleic acids containing only the 5' stuffer 7 may show particularly good performance. For example, XX85 Ad helper nucleic acid, which further contains stuffer 7 at the 5' end, produces rAAV with a higher titer compared to rAAV produced using stuffer 7 at the 5' end and stuffer 2 at the 3' end. [Table 3] Adeno-associated viruses are depedoviruses that naturally require co-infection with helper viruses, such as adenoviruses or herpesviruses, to efficiently complete their life cycle. However, only a small fraction of the helper virus genes are necessary to achieve efficient AAV genome replication and capsid formation (see Meier et al. Viruses 2020 for review for a review).

[0455] Recombinant AAV vectors used for gene transfer are constructed with a target DNA sequence (transgene) adjacent to the AAV reverse terminal repeat (ITR) and packaged in an AAV capsid made of AAV structural proteins. A widely used method for rAAV production involves transfecting HEK293 cells with three plasmids: the first plasmid contains the transgene adjacent to the AAV ITR; the second plasmid encodes the AAV Rep and capsid proteins; and the third plasmid encodes adenovirus type 5 (Ad5) helper proteins, such as VA RNA (virus-associated small non-coding RNA), E2A (single-stranded DNA-binding protein), and E4 helper function, with the host cell, such as Pro10 cells, providing E1 helper function. In certain methods, rAAV is produced using two nucleic acids instead of three, for example, one nucleic acid encoding the AAV helper Rep-Cap gene and the hAd5-based helper nucleic acid of the present invention. In this case, rAAV is produced using i) a single nucleic acid encoding the Ad helper function and the AAV helper Rep-Cap gene, and ii) an rAAV genome (e.g., an ITR from an AAV ITR containing the transgene) as a method using two plasmids, for example, as described in European Patent EP1412510B1.

[0456] The adenovirus helper plasmids available to date are as follows (this is not necessarily an exhaustive list): pXX6-80, constructed by serial deletions of the Ad5 genome, maintains the expression of small virus-associated RNAs (VA RNA I and VA RNA II), single-stranded DNA-binding proteins (E2A or DBP), and E4 proteins while avoiding the expression of adenovirus capsid structural proteins (Xiao et al. J Virol 1998). Therefore, the plasmid maintains the relative orientation of different sequence elements from the Ad5 viral genome. It contains the following nucleotide positions of Ad5 (RefSeq#AC_000008): 9847-13258, 21444-28119, and 30819-35919. One drawback of this plasmid is its large size (almost 19kb), which poses significant costs to production and quality control. Furthermore, this plasmid still contains full-length coding sequences of several structural proteins, particularly adenovirus fibers, which, if expressed in treated patients, can lead to toxicity and immune responses. In non-limiting embodiments of the present invention, the adenovirus helper XX-680 plasmid, or XX-680 neDNA, comprises a nucleotide sequence consisting of a short stuffer sequence, SEQ ID NOs. 1-6, or 85% identity thereof, or one of SEQ ID NOs. 7-9, a continuous fragment ranging from approximately 75 to approximately 250 nucleotides.

[0457] Recently developed by Asklepios BioPharmaceutical, Inc., pXX85 has a smaller size (10.6 kb) and does not contain fiber sequences. The relative orientation of the Ad5 sequence elements is also altered in this plasmid compared to the wild-type Ad5 viral genome. This includes the following nucleotide positions of Ad5 (RefSeq#AC_000008): 32721-35915, 10562-11072 and 22316-27173. In a non-limiting example of the present invention, the adenovirus helper XX-85 plasmid (SEQ ID NO: 69) or XX-85 clDNA (SEQ ID NO: 70) contains SEQ ID NOs. 1-6, or short stuffer sequences of 85% identity thereto, or a nucleotide sequence of a continuous fragment of approximately 75-250 nucleotides from any one of SEQ ID NOs. 7-9.

[0458] Example 2: Short stuffers used in molecules used for recombinant AAV (rAAV) production and detection of residual DNA in viral preparations: The objective of this study was to prepare novel stuffer sequences to confirm the inactivity of stuffer candidates both in vitro and in vivo. rAAV was produced by transfecting cells with i) a nucleic acid encoding the rAAV genome, e.g., an neDNA molecule containing a transgene sequence adjacent to the AAV ITR; ii) an adenovirus helper nucleic acid, e.g., an neDNA molecule containing a sequence encoding the adenovirus helper protein; and iii) a helper nucleic acid, e.g., an neDNA molecule containing sequences encoding the AAV capsid and non-structural replication genes, allowing sufficient time for the cells to produce rAAV particles. Residual neDNA in the rAAV preparation was measured by qPCR or ddPCR assays designed to target the stuffer sequences.

[0459] A method for detecting residual neDNA stuffer sequences in purified AAV preparations.

[0460] First, 10 microliters of purified AAV sample is diluted to a final volume of 100 μL with 1.25 × DNase I Incubation Buffer (Roche) and 0.0625% Pluronic F-68. 50 microliters of the diluted sample is added to 50 μL of 2 mM Tris pH 8.0, 2 mM EDTA, 0.2% SDS, and 1 mg / mL proteinase K. 100 μL of the reaction mixture is incubated at 55°C for 1 hour, followed by 80°C for 10 minutes. The proteinase K digested sample is then subjected to six 10-fold dilutions (1 / 10 to 1 / 10) in ddPCR dilution buffer prepared using 1X GeneAmp PCR Buffer I (Applied Biosystems) containing 0.05% Pluronic F-68 and 2 μg / mL of sheared salmon sperm DNA. 6 The samples a...

Claims

1. A nucleic acid comprising a short stuffer sequence, wherein the short stuffer sequence comprises (i) a nucleotide sequence described in any one of SEQ ID NOs: 1 to 6, or a nucleotide sequence complementary to the sequence described in any one of SEQ ID NOs: 1 to 6; or (ii) a nucleotide sequence having at least 85% identity with a nucleotide sequence of a continuous fragment of about 250 to about 1500 nucleotides described in any one of SEQ ID NOs: 7 to 9, 81, or a nucleotide sequence complementary to a continuous fragment of about 250 to about 1500 nucleotides described in any one of SEQ ID NOs: 7 to 9, 81.

2. The nucleic acid according to claim 1, wherein the nucleic acid is linear DNA.

3. The nucleic acid according to claim 1 or 2, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

4. The nucleic acid according to any one of claims 1 to 3, wherein the nucleic acid further comprises at least one protelomerase binding site.

5. The nucleic acid according to claim 4, wherein the short stuffer is located downstream of the protelomerase binding site.

6. The nucleic acid according to claim 4, wherein the short stuffer is located upstream of the protelomerase binding site.

7. The nucleic acid according to claim 4, wherein the nucleic acid comprises two protelomerase binding sites, and the short stuffer is located between the two protelomerase binding sites.

8. The nucleic acid according to any one of claims 1 to 7, further comprising a heterologous transgene operably linked to one or more regulatory elements.

9. The nucleic acid according to claim 8, wherein the short stuffer is located upstream of the heterologous introduced gene.

10. The nucleic acid according to claim 9, wherein the short stuffer is located downstream of the heterologous introduced gene.

11. The nucleic acid according to any one of claims 8 to 10, wherein the nucleic acid further comprises at least one adeno-associated virus (AAV) reverse terminal repeat (ITR) sequence.

12. The nucleic acid according to claim 11, wherein the short stuffer is located upstream of the at least one ITR sequence.

13. The nucleic acid according to claim 11, wherein the short stuffer is located downstream of the at least one ITR sequence.

14. The nucleic acid according to any one of claims 11 to 13, wherein the at least one ITR sequence is located between the short stuffer and the heterologous introduced gene.

15. The nucleic acid according to any one of claims 10 to 13, wherein the nucleic acid further comprises at least one protelomerase binding site, and the short stuffer is located between the at least one protelomerase binding site and the at least ITR.

16. The nucleic acid according to any one of claims 11 to 15, wherein the nucleic acid comprises at least two ITRs and the short stuffers located outside the two ITRs.

17. The nucleic acid according to claim 16, wherein the heterologous introduced gene is located between the two ITRs.

18. The nucleic acid according to claim 16, wherein the heterologous introduced gene is located between the two ITRs, and one of the ITRs is located between the short stuffer and the heterologous introduced gene.

19. The nucleic acid according to claim 16, wherein the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterologous transgene sequence is located between the first and second ITR sequences, and the short stuffer is located upstream of the first ITR sequence.

20. The nucleic acid according to claim 16, wherein the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, the heterogeneous polynucleotide sequence is located between the first and second ITR sequences, the short stuffer is upstream of the first ITR sequence, and the nucleic acid does not contain a short stuffer downstream of the second ITR sequence.

21. The nucleic acid according to claim 16, wherein the nucleic acid comprises a first ITR (e.g., left ITR) sequence and a second ITR (e.g., right ITR) sequence, and the short stuffer is located upstream of the 5' ends of the first and second ITRs.

22. Each ITR sequence is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP. B. AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ A nucleic acid according to any one of claims 7 to 21, independently selected from the ITR sequences of P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A and / or any chimera thereof.

23. The nucleic acid according to claim 22, wherein the ITR sequence is derived from the same AAV serotype.

24. The nucleic acid according to claim 22, wherein the ITR sequence is derived from the different AAV serotypes.

25. The nucleic acid according to any one of claims 1 to 7, wherein the nucleic acid comprises a nucleic acid sequence encoding one or more helper proteins that support AAV replication in rAAV production.

26. The nucleic acid according to claim 25, wherein the nucleic acid comprises at least one protelomerase binding site, and the short stuffer is located between the protelomerase binding site and a nucleic acid sequence encoding one or more helper proteins.

27. The nucleic acid according to claim 26, wherein the short stuffer is located upstream of the 5' end of the nucleic acid sequence encoding one or more helper proteins.

28. The nucleic acid according to claim 26, wherein the short stuffer is located downstream of the 3' end of the nucleic acid sequence encoding one or more helper proteins.

29. The nucleic acid according to any one of claims 25 to 28, wherein the helper protein sufficient for AAV replication may include one or more E2A regions, E4 regions, and virus-associated (VA) RNA regions, as well as E1 regions, E3 regions, and / or major late promoter (MLP) regions.

30. The nucleic acid according to any one of claims 25 to 29, wherein the nucleic acid sequence encoding one or more helper proteins includes one of the nucleotide sequences of sequence numbers 67 to 70.

31. The nucleic acid according to any one of claims 1 to 7, further comprising the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

32. The nucleic acid according to claim 31, wherein the nucleic acid comprises at least one protelomerase binding site, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

33. The nucleic acid according to claim 31, wherein the short stuffer is located upstream of the 5' end of the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

34. The nucleic acid according to claim 31, wherein the short stuffer is located downstream of the 3' end of the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein, and the short stuffer is located between the protelomerase binding site and the nucleic acid sequence encoding the AAV rep protein and the AAV cap protein.

35. AAV Rep proteins include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, and AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 31 to 34, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E and AAV4A and / or any chimera thereof.

36. AAV Cap protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP. B. AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 31 to 35, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

37. The nucleic acid according to any one of claims 31 to 36, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

38. The nucleic acid according to any one of claims 31 to 36, wherein the AAV Rep protein and the AAV Cap protein are derived from different AAV serotypes.

39. The nucleic acid according to any one of claims 1 to 6, wherein the nucleic acid comprises an ITR sequence and a protelomerase binding site located upstream of the ITR sequence, and the sequence of SEQ ID NO: 1 or 4 is included between the ITR and the protelomerase binding site.

40. The nucleic acid according to any one of claims 1 to 6, wherein the nucleic acid comprises an ITR sequence and a protelomerase bound downstream of the ITR sequence, and the sequence of SEQ ID NO: 1 or 4 is included between the ITR and the protelomerase binding site.

41. The nucleic acid according to any one of claims 1 to 40, wherein the nucleic acid further comprises a stop codon (e.g., TAA, TAG, or TGA) upstream of the short stuffer.

42. The nucleic acid according to any one of claims 1 to 40, wherein the nucleic acid further comprises a stop codon (e.g., TAA, TAG, or TGA) downstream of the short stuffer.

43. The nucleic acid according to any one of claims 1 to 42, wherein the nucleic acid is a vector.

44. The nucleic acid according to any one of claims 1 to 43, wherein the nucleic acid is a plasmid.

45. A host cell comprising the nucleic acid according to any one of claims 1 to 44.

46. The host cell according to claim 45, wherein the host cell is an insect cell or a mammalian cell.

47. The host cell according to claim 46, wherein the mammalian cell is a HEK293 cell or a HeLa cell.

48. Use of nucleic acid according to any one of claims 1 to 44 in a method for producing multiple virus particles.

49. The use according to claim 48, wherein the virus particles are recombinant AAV (rAAV) particles.

50. A method for producing a plurality of virus particles, the method comprising culturing a host cell according to claim 46 or 47 in a culture medium under conditions that produce virus particles.

51. A method for producing multiple virus particles, the method comprising culturing a host cell containing the nucleic acid described in any one of claims 1 to 44 in a culture medium under conditions that produce virus particles.

52. The method according to claim 50 or 51, wherein the host cell comprises at least one nucleic acid encoding one or more helper proteins sufficient for AAV replication, at least one nucleic acid encoding the AAV rep protein and the AAV cap protein, and at least one nucleic acid encoding the target transgene.

53. The method according to any one of claims 50 to 52, wherein the host cell contains at least one nucleic acid as described in any one of claims 7 to 24.

54. The method according to any one of claims 50 to 53, wherein the host cell contains at least one nucleic acid as described in any one of claims 25 to 30.

55. The method according to any one of claims 50 to 54, wherein the host cell comprises at least one nucleic acid as described in any one of claims 31 to 38.

56. The method according to any one of claims 50 to 55, wherein the host cell comprises at least one nucleic acid according to any one of claims 7 to 24, at least one nucleic acid according to any one of claims 25 to 30, and at least one nucleic acid according to any one of claims 31 to 38.

57. The method according to any one of claims 50 to 56, wherein the plurality of virus particles include rAAV particles.

58. A nucleic acid comprising a large stuffer, wherein the large stuffer contains a nucleotide sequence having at least 85% identity with one of the nucleotide sequences of sequence numbers 7-9 or 81.

59. The nucleic acid according to claim 58, further comprising the nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter.

60. The nucleic acid according to claim 59, wherein the large stuffer is located in the nucleic acid sequence encoding the AAV Rep protein.

61. The nucleic acid according to claim 60, wherein the large stuffer is located in the intron of the nucleic acid encoding the AAV Rep protein.

62. The nucleic acid according to any one of claims 59 to 61, wherein the large stuffer is located upstream of the promoter.

63. The nucleic acid according to any one of claims 59 to 61, wherein the large stuffer is located downstream of the promoter.

64. The nucleic acid according to any one of claims 59 to 63, wherein the promoter is a p19 promoter.

65. The nucleic acid according to any one of claims 59 to 64, wherein the AAV Rep is a large Rep.

66. The nucleic acid according to any one of claims 59 to 65, wherein the AAV Rep is Rep68 or Rep78.

67. The nucleic acid according to any one of claims 59 to 66, wherein the AAV Rep is Rep 68.

68. The aforementioned AAV Rep proteins are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, and AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 59 to 67, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E and AAV4A and / or any chimera thereof.

69. The nucleic acid according to any one of claims 59 to 68, wherein the AAV Rep protein is a modified Rep protein.

70. The nucleic acid according to any one of claims 59 to 69, wherein the nucleic acid further comprises a nucleic acid sequence encoding the AAV Cap protein.

71. The nucleic acid according to claim 70, wherein the nucleic acid sequence encoding the AAV Cap protein is downstream of the nucleic acid sequence encoding the AAV Rep protein.

72. The nucleic acid according to claim 70, wherein the nucleic acid sequence encoding the AAV Cap protein is upstream of the nucleic acid sequence encoding the AAV Rep protein.

73. The nucleic acid sequences encoding the AAV Cap protein are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 70 to 72, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E and AAV4A and / or any chimera thereof.

74. The nucleic acid according to any one of claims 70 to 73, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

75. The nucleic acid according to any one of claims 70 to 73, wherein the AAV Rep protein and the AAV Cap protein are derived from different AAV serotypes.

76. The nucleic acid according to any one of claims 70 to 75, wherein the nucleic acid sequence encoding the AAV Rep protein is upstream of the nucleic acid sequence encoding the AAV Cap protein.

77. The nucleic acid according to any one of claims 70 to 75, wherein the nucleic acid sequence encoding the AAV Rep protein is downstream of the nucleic acid sequence encoding the AAV Cap protein.

78. The large stuffer is a nucleic acid according to any one of claims 58 to 77, wherein the large stuffer does not contain a mammalian nucleotide sequence.

79. The nucleic acid according to any one of claims 58 to 78, wherein the large stuffer contains a nucleotide sequence of non-mammalian origin.

80. The nucleic acid according to any one of claims 58 to 79, wherein the large stuffer is synthetic.

81. The aforementioned large stuffer is as follows: a. Transcription factor binding sites; b. Adjustment element; c. AAV Rep binding site; d. Donor or acceptor splicing site; e. The endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI, and the endonuclease cleavage site; f. The sequence may be a repeating sequence or a palindromic sequence, for example, a repeating sequence or palindromic sequence longer than 5 nucleotides; g. Strong secondary structure; and / or h. A repeat sequence or palindromic sequence longer than 5 nucleotides, which may be a repeat sequence or palindromic sequence; Nucleic acids as described in any one of items 58 to 80, which do not include two or more of these.

82. The nucleic acid according to any one of claims 58 to 81, wherein the large stuffer contains a GC content of less than about 50%, for example, less than about 45%, or less than about 40%.

83. The nucleic acid according to any one of claims 58 to 82, wherein the nucleic acid is longer than 5.5 kb.

84. The nucleic acid according to any one of claims 58 to 83, wherein the nucleic acid includes a sequence MAG upstream of the large stuffer, where M is A or C.

85. The nucleic acid according to any one of claims 58 to 84, wherein the nucleic acid is a vector.

86. The nucleic acid according to any one of claims 58 to 85, wherein the nucleic acid is a plasmid.

87. The nucleic acid according to any one of claims 58 to 86, wherein the nucleic acid is linear DNA.

88. The nucleic acid according to any one of claims 58 to 87, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

89. A host cell comprising the nucleic acid according to any one of claims 58 to 88.

90. The host cell according to claim 89, wherein the host cell is an insect cell or a mammalian cell, and the mammalian cell may be a HEK293 cell or a HeLa cell.

91. A method for preventing the production of replication-competent rAAV, using the nucleic acid according to any one of claims 59 to 88 or the host cell according to claim 89 or 90.

92. A nucleic acid comprising a nucleotide sequence having at least 85% identity with sequence number 10, and a large stuffer of at least 2 kb in size.

93. The nucleic acid according to claim 92, wherein the nucleic acid includes one or more nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with sequence number 10.

94. The nucleic acid according to claim 93, wherein the nucleic acid contains about 10 to about 10,000 nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with sequence number 10.

95. The nucleic acid according to claim 94, wherein the nucleic acid contains about 2,000 to about 5,000 nucleotides between positions 44 and 45 of a nucleotide sequence having at least 85% identity with sequence number 10.

96. The nucleic acid according to any one of claims 92 to 95, wherein the large stuffer is located between positions 44 and 45 of the nucleotide sequence having at least 85% identity with sequence number 10.

97. The nucleic acid according to any one of claims 92 to 96, wherein the large stuffer includes a nucleotide sequence having at least 85% identity with any one of the nucleotide sequences of sequence numbers 7 to 9 or 81.

98. The nucleic acid according to any one of claims 92 to 97, further comprising a nucleic acid sequence encoding an AAV Rep protein operably linked to a promoter.

99. The nucleic acid according to claim 98, wherein the nucleotide sequence having at least 85% identity with sequence number 10 is located in the nucleic acid sequence encoding the AAV Rep protein.

100. The nucleic acid according to claim 98 or 99, wherein the nucleotide sequence having at least 85% identity with sequence number 10 is located in an intron within the nucleic acid sequence encoding the AAV Rep protein.

101. The nucleic acid according to any one of claims 98 to 100, wherein the nucleotide sequence having at least 85% identity with sequence number 10 is located upstream of the promoter.

102. The nucleic acid according to any one of claims 98 to 100, wherein the nucleotide sequence having at least 85% identity with sequence number 10 is located downstream of the promoter.

103. The nucleic acid according to any one of claims 98 to 102, wherein the promoter is a p19 promoter.

104. The nucleic acid according to any one of claims 98 to 103, wherein the AAV Rep is a large Rep (Rep 68).

105. The aforementioned AAV Rep proteins are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, and AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 98 to 104, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E and AAV4A and / or any chimera thereof.

106. The nucleic acid according to any one of claims 98 to 105, wherein the AAV Rep protein is a modified Rep protein.

107. The nucleic acid according to any one of claims 98 to 106, wherein the nucleic acid further comprises a nucleic acid sequence encoding the AAV Cap protein.

108. The nucleic acid according to claim 107, wherein the nucleic acid sequence encoding the AAV Cap protein is downstream of the nucleic acid sequence encoding the AAV Rep protein.

109. The nucleic acid according to claim 107, wherein the nucleic acid sequence encoding the AAV Cap protein is upstream of the nucleic acid sequence encoding the AAV Rep protein.

110. The nucleic acid sequences encoding the AAV Cap protein are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6ii, AAV1P5ii, AAV4A1ii, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV 9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2ii, AAVS10P1i, AAV JEA, AAV2 3xA P2i, AAVDJ The nucleic acid according to any one of claims 107 to 109, which is derived from P2i, AAV2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A, and / or any chimera thereof.

111. The nucleic acid according to any one of claims 107 to 110, wherein the AAV Rep protein and the AAV Cap protein are derived from the same AAV serotype.

112. The nucleic acid according to any one of claims 107 to 110, wherein the AAV Rep protein and the AAV Cap protein are derived from different AAV serotypes.

113. A nucleic acid according to any one of claims 92 to 112, which is longer than 5.5 kb.

114. The large stuffer is a nucleic acid according to any one of claims 92 to 113, wherein the large stuffer does not contain a mammalian nucleotide sequence.

115. The nucleic acid according to any one of claims 92 to 114, wherein the large stuffer contains a nucleotide sequence of non-mammalian origin.

116. The nucleic acid according to any one of claims 92 to 115, wherein the large stuffer is synthetic.

117. The aforementioned large stuffer is as follows: a. Transcription factor binding sites; b. Adjustment element; c. AAV Rep binding site; d. Donor or acceptor splicing site; e. The endonuclease may be ApaLI, BamHI, ClaI, DrdI, FspI, RsrII, XbaI, NcoI, SacII, CsiI, AflII, or PacI, and the endonuclease cleavage site; f. Repeat sequences or palindromic sequences longer than 5 nucleotides; g. Strong secondary structure; and / or h. A repeat sequence or palindromic sequence longer than 5 nucleotides, which may be a repeat sequence or palindromic sequence; Nucleic acids as described in any one of items 92 to 116, which do not include two or more of these.

118. The nucleic acid according to any one of claims 92 to 117, wherein the large stuffer contains a GC content of less than about 50%, for example, less than about 45%, or less than about 40%.

119. The nucleic acid according to any one of claims 92 to 118, wherein the nucleic acid is longer than 5.5 kb.

120. The nucleic acid according to any one of claims 92 to 119, wherein the 5' end of the nucleotide sequence having at least 85% identity with sequence number 10 is ligated to the sequence MAG, and M is A or C.

121. The nucleic acid according to any one of claims 92 to 120, wherein the 3' end of the nucleotide sequence having at least 85% identity with SEQ ID NO: 10 is ligated to A or G.

122. The nucleic acid according to any one of claims 92 to 121, wherein the large stuffer is located downstream of the sequence MAG, and M is A or C.

123. The nucleic acid according to any one of claims 92 to 122, wherein the nucleic acid comprises a nucleotide sequence having at least 85% identity with respect to any one of the nucleotide sequences of sequence numbers 11 to 13.

124. The nucleic acid according to claim 123, wherein the 5' end of the nucleotide sequence having at least 85% identity with any of sequence numbers 11 to 13 is ligated to the sequence MAG where M is A or C.

125. The nucleic acid according to claim 123 or 124, wherein the 3' end of the nucleotide sequence having at least 85% identity with any of sequence numbers 11 to 13 is ligated to A or G.

126. The nucleic acid according to any one of claims 92 to 125, comprising the nucleotide sequence having at least 85% identity with SEQ ID NO:

11.

127. The nucleic acid according to any one of claims 92 to 126, wherein the nucleic acid prevents the production of a replication-competent rAAV vector.

128. The nucleic acid according to any one of claims 92 to 127, wherein the nucleic acid is a vector.

129. The nucleic acid according to any one of claims 92 to 128, wherein the nucleic acid is a plasmid.

130. The nucleic acid according to any one of claims 92 to 129, wherein the nucleic acid is linear DNA.

131. The nucleic acid according to any one of claims 92 to 130, wherein the nucleic acid is closed-end linear double-stranded DNA (clDNA).

132. A host cell comprising the nucleic acid according to any one of claims 92 to 131.

133. The host cell according to claim 132, wherein the host cell is an insect cell or a mammalian cell, and the mammalian cell may be a HEK293 cell or a HeLa cell.

134. A method for preventing the production of replication-competent rAAV, using a nucleic acid according to any one of claims 92 to 131 or a host cell according to claim 132 or 133.

135. A method for detecting residual DNA in a population of virus particles, the method comprising using at least one oligonucleotide sequence that anneals to any one of the nucleic acid sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO:

6.

136. The method according to claim 135, wherein the method comprises using at least two oligonucleotide sequences that anneal to any one of the nucleic acid sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO:

6.

137. The method according to claim 136, wherein the oligonucleotide is approximately 20 nucleotides long.

138. The method according to claim 136, wherein the oligonucleotide is approximately 25 nucleotides long.

Images