Oligonucleotides for treating neuromuscular diseases
A gene therapy using oligonucleotides to downregulate the COL6A1 c.877G>A mutation addresses the lack of treatment for collagen VI-related dystrophy, effectively reducing mutant allele expression and improving symptoms in neuromuscular diseases.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ホスピタル サン ジョアン デ デウ
- Filing Date
- 2024-06-26
- Publication Date
- 2026-07-07
AI Technical Summary
There is currently no effective treatment for neuromuscular diseases caused by the COL6A1 c.877G>A mutation, which leads to collagen VI-related dystrophy with an intermediate phenotype, characterized by muscle weakness and respiratory insufficiency, and existing treatments only support orthopedic and respiratory symptoms.
Development of a gene therapy using oligonucleotides that specifically downregulate the expression of the mutant COL6A1 allele (c.877G>A) without affecting the wild-type allele, delivered via a suitable delivery agent to target the RNA transcript of the mutation.
The oligonucleotides effectively reduce the expression of the mutant COL6A1 allele by at least 20-60%, mitigating the pathological effects of the mutation and potentially improving muscle function and respiratory outcomes in patients.
Smart Images

Figure 2026522479000003 
Figure 2026522479000004 
Figure 2026522479000005
Abstract
Description
[Technical Field]
[0001] This application claims priority to European Patent Application No. 23382654.4, filed on 27 June 2023.
[0002] Technical field This disclosure relates to the field of medical treatment, and in particular to the treatment of neuromuscular diseases through gene therapy. [Background technology]
[0003] Neuromuscular diseases are a heterogeneous group of rare disorders, affecting 1 to 10 people per 100,000 population. Several genes are involved in these diseases, which complicates diagnosis. In addition, high phenotypic variability makes patient research and healthcare complex. Congenital muscular dystrophy is a group of neuromuscular disorders caused by genetic mutations occurring at birth or in infancy. Among the various types of congenital muscular dystrophy, collagen-associated dystrophy type VI (COL6-RD) is one of the most common disorders, with a prevalence of less than 1 per 100,000 people.
[0004] Type VI collagen is synthesized in stromal fibroblasts (Zou, Zhang, Sabatelli, Chu, & Bonnemann, 2008) and is a component of microfibrils in the extracellular matrix found in various tissues such as muscle, skin, tendons, cartilage, viscera, and blood vessels. Type VI collagen is involved in the structural and mechanical stabilization of tissues and in the interaction between cells and the extracellular matrix; it links different components of the basement membrane and contributes to cell adhesion and proliferation; and it stimulates DNA synthesis in mesenchymal cells and migration of neural crest cells.
[0005] In humans, three genes encoding the three α chains that make up type VI collagen: COL6A1 (MIM) found on chromosome 21. * 120220), COL6A2(MIM * 120240) and COL6A3 (MIM) in chromosome 2* There is (120250).
[0006] VI - type collagen - related dystrophy is a congenital muscular dystrophy caused by mutations in the COL6A1, COL6A2, and COL6A3 genes. These patients show a very diverse range of phenotypes. The most severe is Ullrich congenital muscular dystrophy, and the milder one is Bethlem myopathy.
[0007] There are intermediate clinical phenotypes in between. The clinical symptoms of patients with intermediate clinical phenotypes are a mixed state between the characteristics of Ullrich congenital muscular dystrophy and those of Bethlem myopathy, such as marked muscle weakness in infancy, distal laxity of the most distal interphalangeal joints or contracture of the flexor digitorum profundus of the middle finger. Patients acquire the ability to walk but may lose it in the late teens or young adulthood. A typical characteristic of these patients is also progressive respiratory insufficiency.
[0008] Radical treatments for COL6 - RD are still in development. Currently, most patients only receive treatments to support orthopedic and respiratory symptoms. Pharmacological treatments were first studied based on the cascade of events known to cause muscle fiber degeneration in type VI collagen - deficient skeletal muscle. Now, as the mutations causing these diseases are becoming increasingly well - known, treatments based on gene - therapy approaches, such as therapies focusing on the suppression of gene expression, are being studied.
[0009] The mutation (COL6A1) het.c.877G<A, p.Gly293Arg causes COL6 - RD with an intermediate phenotype. This is found at position 19 in exon 10 and has a dominant - negative effect because it is a missense mutation that causes the substitution of glycine from the triple - helix domain by arginine. Currently, there is no treatment that can correct the course of COL6 - RD caused by this mutation, and thus, there is a need in the art for a treatment approach for this disease. [Overview of the project]
[0010] The inventors have successfully developed a gene therapy that effectively downregulates the expression of a mutant allele (COL6A1) c.877G>A, which exhibits only a single mutation compared to the wild-type allele, without affecting the translation of this wild-type allele.
[0011] Accordingly, a first aspect of the present invention is an oligonucleotide that downregulates the expression of an allele having a mutation at position 877 in the COL6A1 coding sequence (CDS), in which G is mutated to A compared to wild-type COL6A1.
[0012] In order to interact with RNA targets, the oligonucleotide must reach the intracellular interstitial space, and in this sense, a delivery agent may be used to assist in entry into the cell. Accordingly, the present invention also provides, in a second aspect, a composition comprising a delivery agent and an oligonucleotide as defined in the first aspect, wherein the oligonucleotide associates with the delivery agent.
[0013] In a third aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide as defined in the first aspect, and / or a composition as defined in the second aspect, and a pharmaceutically acceptable excipient or carrier.
[0014] A fourth aspect of the present invention is an oligonucleotide as defined in the first aspect, and / or a composition as defined in the second aspect, and / or a pharmaceutical composition as defined in the third aspect, for use as a pharmaceutical. In other words, these are for therapeutic use.
[0015] A fourth embodiment may also be formulated for use in the manufacture of pharmaceuticals, such as oligonucleotides as defined in the first embodiment and / or compositions as defined in the second embodiment and / or pharmaceutical compositions as defined in the third embodiment. This embodiment may also be devised as a method for the prevention and / or treatment of disease in a subject requiring it, the method comprising administering a therapeutically effective amount of oligonucleotides as defined in the first embodiment and / or compositions as defined in the second embodiment and / or pharmaceutical compositions as defined in the third embodiment.
[0016] A fifth aspect provided by the present invention is an oligonucleotide as defined in the first aspect, and / or a composition as defined in the second aspect, and / or a composition as defined in the third aspect, for use in the treatment of a condition associated with the mutation (COL6A1)c.877G>A. In particular, this condition is a neuromuscular disease, and more specifically, it is muscular dystrophy.
[0017] A fifth embodiment may also be formulated for use as an oligonucleotide as defined in the first embodiment and / or a composition as defined in the second embodiment and / or a pharmaceutical composition as defined in the third embodiment for the treatment of a condition associated with the mutation (COL6A1)c.877G>A. In particular, this condition is a neuromuscular disease, and more particularly, it is muscular dystrophy. This embodiment may also be devised as a method for the prevention and / or treatment of a condition associated with the mutation (COL6A1)c.877G>A. In particular, this condition is a neuromuscular disease, and more particularly, it is muscular dystrophy, and this method comprises administering a therapeutically effective amount of an oligonucleotide as defined in the first embodiment and / or a composition as defined in the second embodiment and / or a pharmaceutical composition as defined in the third embodiment to a subject in need thereof. [Brief explanation of the drawing]
[0018] [Figure 1]Figure 1 shows a chromatogram of the exon 10 sequence of COL6A1, which exhibits a heterozygous c.877G>A mutation (at the position of nucleotide (G) circled in the image). [Figure 2] Figure 2 shows (A) ddPCR results indicating the abundance (%) of wild-type (white) and mutant transcripts (black) in healthy control fibroblasts and patient primary fibroblasts, with the y-axis representing the abundance in percentage (%); and (B) ddPCR (transcript copies / μL) for total COL6A1 expression in healthy control and patient primary fibroblasts, with the y-axis representing the concentration (copies / μL). Data are expressed as mean ± SD. The x-axis is ordered so that the left side shows data for healthy controls and the right side shows data for patients. [Figure 3] Figure 3 shows allele-specific transcriptional analysis using ddPCR of patient primary fibroblasts, arranged on the x-axis from left to right: untreated (P NT), treated with scrambled oligonucleotides (P Scr), or treated with test oligonucleotides at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM (n=5). Data were normalized to P NT, expressed as mean ± SD, and statistically analyzed using two-way ANOVA (*p<0.05; **p<0.01; ***p<0.001; ****p<0.0001). The y-axis represents relative expression. [Figure 4] Figure 4 shows immunofluorescence of patient fibroblasts untreated and treated with a 150 nM test oligonucleotide: (A) HyVolution analysis of patient untreated fibroblasts (top image) and after treatment with a 150 nM test oligonucleotide (bottom image). Scale bar: 10 μm.; (B) 3D reconstruction of patient untreated fibroblasts (top image) and after treatment with a 150 nM test oligonucleotide (bottom image). Scale bar: 5 μm. [Figure 5]Figure 5 shows the percentages of mutant and wild-type transcripts from allele-specific transcriptional analysis using ddPCR of patient fibroblasts (P) treated with AON1 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM. The results are compared with untreated (NT) and scrambled (negative control). The data are represented as the mean ± SD of the abundance in percentage of each allele. Mutant (black), wild-type (white). The Y-axis represents the abundance (A) in percentage (%). [Figure 6] Concentration of copies of the mutant allele for patient fibroblasts (P) treated with AON3 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM. The results are compared with untreated P (NT) and scrambled P (negative control). The Y-axis represents the concentration (copies / μL): "C" represents concentration; "c." represents copies. [Figure 7] Concentration of copies of the mutant allele for patient fibroblasts (P) treated with AON4 at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM. The results are compared with untreated P (NT) and scrambled P (negative control). The Y-axis represents the concentration (copies / μL): "C" represents concentration; "c." represents copies. [Figure 8] Figure 8 shows, on the x-axis, in order from left to right, untreated (NT), AON2, AON5, AON6, and AON7 at a concentration of 150 nM, for allele-specific transcriptional analysis using ddPCR of primary patient fibroblasts. The ratio between the WT and MUT alleles was calculated, normalized to untreated, and represented as mean ± SD, and statistically analyzed using one-way ANOVA and Dunnett's multiple comparison test (**p < 0.01; ***p < 0.001; ****p < 0.0001). The y-axis represents relative expression, in other words: the ratio between the mutated allele (MUT) and the wild-type allele (WT).
Mode for Carrying Out the Invention
[0019] All terms used in this specification, unless otherwise specified, should be understood in their ordinary meaning as known in the art. Other more specific definitions for particular terms used in this application are as set forth below and are uniformly applied throughout this application and the claims, providing a broader definition unless otherwise clearly indicating a definition.
[0020] As used in this specification, the indefinite articles "a" and "an" are synonymous with "at least one" or "one or more". Unless otherwise indicated, definite articles such as "the" used in this specification also include plural nouns.
[0021] Oligonucleotide As already mentioned, the first aspect provided by the present invention is an oligonucleotide that downregulates the expression of an allele carrying the mutation (COL6A1) c.877G>A.
[0022] In a specific embodiment of the first aspect, the downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of the mutation. More particularly, this either does not downregulate the expression of the COL6A1 wild-type allele or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.
[0023] Therefore, in a more specific embodiment, the oligonucleotide of the first aspect downregulates the expression of an allele carrying a mutation at position 877 in the COL6A1 coding sequence (CDS) where G is mutated to A compared to the wild-type COL6A1, and the downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of the mutation, which either does not downregulate the expression of the COL6A1 wild-type allele or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation.
[0024] In this disclosure, the term “wild-type allele” refers to both COL6A1 alleles with reference sequences (NM_001848 version NM_001848.3 as of August 31, 2019). Experts will also understand from this disclosure that oligonucleotides of the first aspect will not downregulate the expression of a COL6A1 allele that is different from the COL6A1 wild-type allele and does not carry the (COL6A1)c.877G>A mutation, or will downregulate that allele to a lesser extent than it would downregulate the expression of an allele that carries the mutation.
[0025] The term "COL6A1" refers to both the alpha-1 chain gene of type VI collagen, with genome NCBI reference number NG_008674 version NG_008674.1 as of May 4, 2006, and its mRNA transcript, with NCBI reference number NM_001848 version NM_001848.3 as of August 31, 2019. COL6A1 encodes one of the three α chains that make up type VI collagen in humans, and is found on chromosome 21. The encoded peptide is the alpha-1 subunit of type VI collagen, with protein NCBI reference number NP_001839.2 (as of February 11, 2006) or UniProt KB acceptance number P12109, version 3 as of February 6, 2007, and database release version 222. The encoded peptide is a short α chain domain flanked by N-terminal and C-terminal globular domains of the "von Willebrand factor A" type. This exhibits a bead-like filamentous structure. The central domain is a triple helix (TH) formed by conserved Gly-XY repeats. These glycine residues are essential for the precise construction of type VI collagen chains. The linkage of the three α chains (α1, α2, and α3) through the glycine residues of the triple helix domain forms a heterotrimer α1[VI]α2[VI]α3[VI] monomer, which is linked by antiparallel dimers, and two of these associate to form a tetramer. After construction, the tetramer is secreted into the extracellular space, and higher-order structures are formed by their association, resulting in functional type VI collagen.
[0026] The term "(COL6A1)c.877G>A" is a standard nomenclature established by the Human Genome Variation Society (HGVS) (Ogino, S., et al. (2007)) to refer to a mutation at position 877 of the COL6A1 CDS in which a guanine (G) nucleotide present in the reference nucleotide sequence (NCBI reference sequence: NM_001848 as of August 31, 2019, version NM_001848.3) is substituted with adenine (A). The preferred name in NCBI for the mutation or single nucleotide mutation is NM_001848.3(COL6A1):c.877G>A(p.Gly293Arg). It can also be expressed that the term (COL6A1)c.877G>A refers to a mutation in which guanine (G) at position 877 of the COL6A1 CDS reference nucleotide sequence (SEQ ID NO: 24) is substituted with adenine (A). The nucleotide at position 877 of the COL6A1 CDS corresponds to the nucleotide at position 958 of the full-length sequence of the COL6A1 mRNA transcript (with NCBI reference number NM_001848.3), which is also a reference. The (COL6A1)c.877G>A mutant gene contains a CDS consisting of the sequence of SEQ ID NO: 25. Therefore, the mRNA transcript of the (COL6A1)c.877G>A mutant gene contains a CDS with the sequence of SEQ ID NO: 25. This mutation causes arginine to substitute glycine from the triple helix domain (p.Gly293Arg), thus affecting the precise construction of the type VI collagen chain. This mutation is one of two single nucleotide polymorphisms identified with reference number rs398123643 (build 156, released September 21, 2022) at position chr21:45989626 (GRCh38.p14) in Homo sapiens.
[0027] To “downregulate” gene expression means that the expression of the protein encoded by the gene is reduced so that it is produced at a lower level compared to basal expression (i.e., not treated with the oligonucleotide in this invention). In certain embodiments, the expression of the encoded protein is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%. In more specific embodiments, the expression of the encoded protein is reduced by approximately 10% to approximately 60%, approximately 20% to approximately 50%, or approximately 30% to approximately 40%. In more specific embodiments, the expression of the encoded protein is reduced by at least 40%, at least 50%, at least 55%, or at least 60%. In more specific embodiments, this is reduced by at least 55%. In more specific embodiments, this is reduced by at least 60%. Therefore, by using the oligonucleotides of this disclosure, the pathological effects of overexpression of mutated alleles are mitigated.In certain embodiments, the oligonucleotides of the present invention downregulate the expression of an allele carrying the mutant allele (COL6A1) c.877G>A by at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, or at least 45%, and this downregulation occurs through the hybridization of the oligonucleotides to the RNA transcript of the allele at the site of mutation, and it either does not downregulate the expression of the COL6A1 wild-type allele or downregulates the expression of the COL6A1 wild-type allele to a lower degree than it would downregulate the expression of the allele carrying the mutation. In more specific embodiments, the oligonucleotide downregulates expression by at least 20%, and more particularly, at least 25%. In more specific embodiments, the oligonucleotide of the present invention downregulates the expression of the mutated allele (COL6A1) c.877G>A by at least 30%, and this downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of mutation, and it either does not downregulate the expression of the COL6A1 wild-type allele or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it does downregulate the expression of the mutated allele. In more specific embodiments, the oligonucleotide downregulates the expression of an allele carrying the mutation (COL6A1) c.877G>A by at least 40%, and this downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of mutation, and it either does not downregulate the expression of the COL6A1 wild-type allele or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it does downregulate the expression of the allele carrying the mutation. More specifically, it reduces it by at least 45%.
[0028] A decrease in the expression of an encoded protein can be measured by any suitable technique known in the art. For example, reverse transcription, Sanger sequencing, and / or quantitative real-time PCR are frequently used techniques. The following examples illustrate methods for determining gene expression in more detail.
[0029] In light of this disclosure, the term “oligonucleotide” refers to an oligomer of a nucleotide. A nucleotide consists of a naturally occurring nitrogen-containing base or nucleic acid base (purine (adenine and guanine) and pyrimidine (cytosine, uracil, and thymine)) which is covalently bonded to the 1' position of a 5-carbon sugar (deoxyribose or ribose) and then covalently bonded to a phosphate group at its 5' position. Oligonucleotides are generally classified as deoxyribooligonucleotides or ribooligonucleotides, which are oligomers of “deoxyribonucleotide” or “ribonucleotide,” respectively. Oligonucleotides formed by deoxyribonucleotides may be called “DNA oligonucleotides,” “DNA molecules,” or simply “DNA”; oligonucleotides formed by ribonucleotides may be called “RNA oligonucleotides,” “RNA molecules,” or simply “RNA.” Deoxyribooligonucleotides consist of repeating structures of deoxyribonucleotides (containing adenine or guanine as a purine or cytosine or thymine as a pyrimidine), where the phosphate group of one deoxyribonucleotide is covalently bonded to the 3' carbon of the deoxyribose of another deoxyribonucleotide, forming an alternating, unbranched polymer. Ribooligonucleotides (containing adenine or guanine as a purine or cytosine or uracil as a pyrimidine) consist of similar repeating structures, where the 5-carbon sugar is ribose. The structure produced by the bonding of phosphate groups of different nucleotides and sugars in an oligonucleotide is called a sugar-phosphate skeleton; that is, oligonucleotides contain a sugar-phosphate skeleton or a phosphate skeleton. In this disclosure, “thymine nucleotide,” “uracil nucleotide,” “guanine nucleotide,” “cytosine nucleotide,” or “adenine nucleotide” refers to nucleotides containing the corresponding nitrogen-containing base, in particular nucleotides containing these bases and being part of DNA or RNA.
[0030] In light of this disclosure, the oligonucleotide sequence is represented by a chain from left to right in the 5' to 3' direction, and the first nucleotide shown in this sequence is at residue position 1.
[0031] The term “oligonucleotide” also includes monomers other than deoxyadenosine 3'-monophosphate, deoxyguanosine 3'-monophosphate, deoxycytidine 3'-monophosphate, deoxythymidine 3'-monophosphate, adenosine 3'-monophosphate, guanosine 3'-monophosphate, cytidine 3'-monophosphate, or uridine 3'-monophosphate, but also oligomers that are functionally and structurally similar to them. These are also called oligonucleotide analogs, modified oligonucleotides, or DNA / RNA-like oligonucleotides. Such oligonucleotides may or may not be native and may be preferred over native forms due to properties such as enhanced binding ability, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases.
[0032] Oligonucleotide analogs are actually composed of nucleotide analogs (or modified nucleotides or RNA / DNA-like nucleotides) that may have one or more of their three moieties (phosphate group, pentose sugar, or nucleic acid base) modified compared to the “standard” nucleotide described above. The following paragraphs describe non-limiting modifications to oligonucleotides according to a first aspect of the present invention.
[0033] The oligonucleotide skeleton can be modified. A common modification is the substitution of the phosphate backbone for a phosphorotiated backbone. In some embodiments, the oligonucleotide contains a phosphorotiated skeleton (i.e., the phosphodiester bond of the sugar-phosphate skeleton is modified to a phosphorotiate). In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or all of the oligonucleotide bases have a phosphorotiated skeleton. In certain embodiments, 1-31, 2-30, 3-29, 4-28, 5-27, 6-26, 7-25, 8-24, 9-23, 10-22, 11-21, 12-20, 13-19, 14-18, or 15-17 bases have a phosphorothioate skeleton. In more specific embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides have a phosphorothioate skeleton. More particularly, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotides have a phosphorothioate skeleton. More particularly, all deoxyribonucleotides have a phosphorothioate skeleton. Oligonucleotides containing a phosphorothioate-type skeleton exhibit improved resistance to nucleases compared to unmodified oligonucleotides (containing 100% phosphodiester skeletons).
[0034] In some embodiments, the oligonucleotides include modifications to help enhance their properties. Therefore, in some embodiments, the oligonucleotides may be modified by substitution of at least one nucleotide with at least one modified nucleotide, ideally thereby enhancing the in vivo and in vitro stability of the oligonucleotides compared to the corresponding unmodified oligonucleotides. In some embodiments, the oligonucleotides include 2'-deoxyguanosine, 2'-deoxyadenosine, 2'-O-methylguanosine, 2'-O-methyl (e.g., 2'-O-methylcytidine, 2'-O-methylpseudridine, 2'-O-methyluridine, 2'-O-methyladenosine (as mentioned in the sequence listing), 2'-O-methylguanosine) ribonucleotides, 2'-amino, 2'-thio and 2'-fluoro-modified ribonucleotides, 2'-fluorocytidine, 2'-fluoro- This includes oro-uridine, 2'-fluoroguanosine, 2'-fluoroadenosine, 2'-aminocytidine, 2'-aminouridine, 2'-aminoadenosine, 2'-aminoguanosine, 2'-aminobutyrylpyreneuridine, 2'-aminoadenosine, 5-iodouridine, ribothymidine, 5-bromouridine, 2-aminopurine, 5-methylcytidine, 5-fluorocytidine and 5-fluorouridine, 2,6-diaminopurine, 4-thiouridine and / or 5-aminoallyluridine.
[0035] In some embodiments, the oligonucleotide includes a 5-position derivatization selected from, for example, 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, and 5-propenyluridine; a 6-position derivatization, for example, 6-(2-amino)propyluridine; and an 8-position derivatization of adenosine and / or guanosine, for example, 8-bromoguanosine, 8-chloroguanosine, or 8-fluoroguanosine. In other embodiments, the oligonucleotide includes deazanucleotides, such as nucleotide analogs such as 7-deaza-adenosine; O- and N-modified (e.g., alkylated, such as N6-methyladenosine) nucleotides; and other heterocyclically modified nucleotide analogs.
[0036] In other embodiments, the oligonucleotide comprises a modified sugar moiety. Examples of modifications to the sugar moiety of the nucleotide that can be used include a 2'OH- group that is replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, H2, NHR, NR2, COOR, or OR (where R is a substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc.). The phosphate group of the nucleotide may also be modified by substituting one or more oxygens of the phosphate group with sulfur (e.g., by using a phosphorothioate). The modification may reduce the rate of hydrolysis of the polynucleotide containing the modified base, for example, by inhibiting degradation by exonucleases. In one preferred example, the oligonucleotide is resistant to ribonucleases. The oligonucleotides that can be used include those with modifications to promote such resistance, and for example, the oligonucleotides of the present invention may be particularly modified with a 2'-O-methyl group (e.g., 2'-O-methylcytidine, 2'-O-methylpseudridine, 2'-O-methylguanosine, 2'-O-methyluridine, 2'-O-methyladenosine, 2'-O-methyl). In certain embodiments, the oligonucleotide contains modifications to improve resistance to ribonucleases and a phosphorothioate skeleton.
[0037] In other embodiments, the oligonucleotide contains peptide nucleic acid (PNA), morpholino nucleic acid, glycol nucleic acid (GNA), threose nucleic acid (TNA), and hexitol nucleic acid (HNA). In other embodiments, the oligonucleotide contains locked nucleic acid (LNA) (an oligonucleotide containing at least one 2'-C,4'-C-oxymethylene-linked bicyclic ribonucleotide monomer), 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, and 5-carboxymethylaminomethyl Chiluracil, Dihydrouracil, Beta-D-Galactosyl Quosin, Inosine, N6-Isopentenyl Adenine, 1-Methylguanine, 1-Methylinosine, 2,2-Dimethylguanine, 2-Methyladenine, 2-Methylguanine, 3-Methylcytosine, 5-Methylcytosine, N6-Adenine, 7-Methylguanine, 5-Methylaminomethyluracil, 5-Methoxyaminomethyl-2-Thiouracil, Beta-D-Mannosyl Quosin, 5'-Methoxycarboxymethyluracil It contains 1,5-methoxyuracil (5'-methoxycarboxymethyluracil 1,5-methoxyuracil), 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), weybutoxosin, pseudouracil, cuosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.
[0038] In some embodiments, the oligonucleotide includes modifications to the phosphate backbone, such as methylphosphonate, methylphosphonothioate, phosphoromorpholide, phosphoropiperazide, and phosphoramidate. In some embodiments, the oligonucleotide contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl).
[0039] The oligonucleotides of the present invention are complementary to (and thus hybridize with) a region of an RNA transcript from this gene, particularly the mRNA. In one embodiment, an oligonucleotide is provided that is complementary to a target sequence of COL6A1 transcript mRNA having the (COL6A1)c.877G>A mutation. In a particular embodiment, the target mRNA transcript is NM_001848.3 (NCBI reference number) with the (COL6A1)c.877G>A mutation. In another embodiment, the target mRNA transcript comprises a CDS of SEQ ID NO 25. By hybridizing with the target transcript, the oligonucleotides of the present disclosure can reduce the expression of the encoded gene.
[0040] In one embodiment, the oligonucleotide is complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 nucleotides of the target sequence in the transcript; in particular, it is complementary to at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides; more specifically, it is complementary to at least 13, 14, 15, 16, 17, 18, or 19 nucleotides; and even more specifically, it is complementary to at least 17 nucleotides of the target transcript.
[0041] In one embodiment, the oligonucleotide is complementary to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 nucleotides of the target sequence in the transcript; in particular, it is complementary to 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides; more specifically, it is complementary to 13, 14, 15, 16, 17, 18, or 19 nucleotides; and even more specifically, it is complementary to 17 nucleotides of the target transcript.
[0042] In one embodiment, the oligonucleotide is complementary to nucleotides 9–31, 10–30, 11–29, 12–28, 13–27, 14–26, 15–25, 16–24, or 17–23 of the target sequence in the transcript, particularly nucleotide 13–31; in particular, it is complementary to nucleotides 13–25, 14–24, 15–23, 16–22, or 17–21 of the target transcript; more specifically, it is complementary to nucleotides 13–19, 14–18, or 15–17.
[0043] In more specific embodiments, the target sequence includes a sequence defined by nucleotides at positions 862-892 of SEQ ID NO: 25; particularly positions 865-889 of SEQ ID NO: 25; more specifically positions 868-886 of SEQ ID NO: 25; and more specifically positions 869-885 of SEQ ID NO: 25.
[0044] In another specific embodiment, the target sequence consists of a sequence defined by nucleotides at positions 862-892 of SEQ ID NO: 25; more specifically, positions 865-889 of SEQ ID NO: 25; more specifically, positions 868-886 of SEQ ID NO: 25; and more specifically, positions 869-885 of SEQ ID NO: 25.
[0045] In one embodiment, the oligonucleotide is 9-31, 10-30, 11-29, 12-28, 13-27, 14-26, 15-25, 16-24, 17-23, 18-22, or 19-21 nucleotides long, particularly 13-31, more specifically 13-19, and more specifically 15-19 or 16-18 nucleotides long. In a particular embodiment, the oligonucleotide is 17-25 nucleotides long. In another particular embodiment, the oligonucleotide is 17-20 nucleotides long.
[0046] The region of the oligonucleotide that can hybridize with the target transcript is of the length described herein, or at least that length, but may also have additional nucleotides (overhangs) at the 5' and / or 3' ends of the oligonucleotide; however, in other examples, there may be no overhangs, and the entire length of the oligonucleotide hybridizes with the target. Generally, oligonucleotide sequences that are 100% complementary to the portion of the target RNA may be particularly used. In some examples, however, sequence variations, strain polymorphisms, or evolutionary divergences that can be expected due to gene mutations may be present. For example, oligonucleotide sequences with insertions, deletions, and single point mutations compared to the target sequence may also be effective in reducing target gene expression. In some embodiments, the oligonucleotide is at least approximately 80%, approximately 81%, approximately 82%, approximately 83%, approximately 84%, approximately 85%, approximately 86%, approximately 87%, approximately 88%, approximately 89%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99%, or even more approximately 100% complementary to the target sequence in the mRNA transcript. In certain embodiments, the oligonucleotide is at least approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, or approximately 99% complementary to the target sequence. In more specific embodiments, the oligonucleotide is approximately 100% complementary to the target sequence.
[0047] In one embodiment, the oligonucleotide is at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 nucleotides long, and in particular at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides long. In a more specific embodiment, the oligonucleotide is at least 13 nucleotides long. In a more specific embodiment, the oligonucleotide is at least 17 nucleotides long.
[0048] In one embodiment, the oligonucleotide is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 nucleotides long, particularly 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides long, more specifically 13, 14, 15, 16, 17, 18, or 19 nucleotides long, particularly 16, 17, or 18 nucleotides long. More specifically, the oligonucleotide is 17 nucleotides long.
[0049] Terms such as “hybridizes,” “hybridize,” and “hybridize to” are terms in the art referring to the pairing of nucleic acid bases in the complementary strand of an oligonucleotide (e.g., an antisense oligomer and a selected / target sequence in a premRNA molecule). While embodiments of this disclosure are not limited to specific pairing mechanisms, the most common mechanisms of pairing involve hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between complementary nucleic acid bases or nitrogen-containing bases. For example, the natural nucleic acid base adenine is complementary to the natural nucleic acid bases thymidine and uracil, which pair through the formation of hydrogen bonds. Similarly, the natural base guanine is complementary to the natural nucleic acid bases cytosine and 5-methylcytosine. An oligonucleotide complementary to a particular target sequence is understood as an oligonucleotide having a sequence that binds to the target sequence. Complementarity may be 100% or less, if all nucleotides bind to the target sequence. Accordingly, the above embodiments may also be expressed as oligonucleotides containing sequences that have identity with respect to the reverse complementarity of the target sequence in the transcript mRNA. The identity is 100% or at least approximately 80%, approximately 81%, approximately 82%, approximately 83%, approximately 84%, approximately 85%, approximately 86%, approximately 87%, approximately 88%, approximately 89%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, or approximately 99% with respect to the reverse complementarity of the target sequence in the transcript mRNA.
[0050] Sequence identity, including the determination of sequence complementarity for nucleic acid sequences, can be determined by sequence comparison and alignment algorithms known in the art. To determine the percentage identity of two nucleic acid sequences, the sequences are aligned for the purpose of optimal comparison (for example, gaps may be introduced in the first or second sequence for optimal alignment). Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions). *100), optionally, a penalty is imposed on the score for the number and / or length of introduced gaps. Sequence comparison and determination of percentage identity between two sequences can be performed using mathematical algorithms. In one embodiment, alignment is performed over certain portions of sequences that are aligned with sufficient identity, but not over portions with a low degree of identity (i.e., local alignment). A preferred non-restrictive example of a local alignment algorithm used for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc.Natl.Acad.Sci.USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc.Natl.Acad.Sci.USA 90:5873-77. Such algorithms are incorporated into the BLAST program (version 2.0) in Altschul, et al. (1990) J.Mol.Biol.215:403-10. In another embodiment, the alignment is optimized by introducing appropriate gaps, and percentage identity is determined over the length of the aligned sequence (i.e., the gapped alignment). To obtain a gapped alignment for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res.25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps, and percentage identity is determined over the entire length of the aligned sequence (i.e., the comprehensive alignment). A preferred non-restrictive example of a mathematical algorithm used for comprehensive comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such algorithms are incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package.When using the ALIGN program to compare amino acid sequences, the PAM120 weight residue table, a gap length penalty of 12, and a gap length penalty of 4 may be used.
[0051] Skilled individuals can determine, by methods well known in the art, whether an oligonucleotide downregulates the expression of an allele carrying a mutation at position 877 of the COL6A1 coding sequence (CDS) and does not downregulate the expression of the COL6A1 wild-type allele (or downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it downregulates the expression of the allele carrying the mutation). For example, this can be done or achieved by Droplet Digital PCT (ddPCR) technique, as shown in the examples.
[0052] The oligonucleotides described herein may be single-stranded or double-stranded. In some embodiments, the oligonucleotides of the first embodiment are double-stranded. Examples of double-stranded RNA include siRNA, short hairpin RNA (shRNA), and other RNAi agents such as pre-miRNA.
[0053] In one embodiment, the oligonucleotide is a small interfering RNA (siRNA). The siRNA acts by activating an RNAi-induced silencing complex. When the siRNA molecule according to this disclosure enters a cell, it is incorporated into other proteins to form a RISC complex. Once this siRNA becomes part of the complex, it unwinds to form a single-stranded siRNA (the strand that is less thermodynamically stable due to its base pairing at the 5' end is selected to remain part of the RISC complex). The single-stranded siRNA, now part of the RISC complex, can scan for and locate a complementary mRNA, hybridize to it, and induce its cleavage and post-degradation, thereby repressing the expression of the gene encoding that mRNA. Thus, the siRNA according to the present invention actually downregulates the expression of the mutant allele (COL6A1) c.877G>A by hybridizing to its mRNA. Therefore, it is considered that the siRNA of the present invention downregulates the expression of the mutant allele by hybridizing to the target mRNA. siRNA sequences may have overhanging or blunt ends. In certain embodiments, the siRNA sequence has an overhang. Suitable siRNA sequences can be identified using any means known in the art.
[0054] In other embodiments, the oligonucleotides, as defined in the first embodiment, are single-stranded. Single-stranded oligonucleotides include, for example, ribozymes, mature miRNAs, guide RNAs and triplex-forming oligonucleotides and antisense oligonucleotides (AONs or ASOs) such as gapmers.
[0055] In one embodiment, the oligonucleotide is a miRNA. miRNAs are involved in RNA silencing and post-transcriptional regulation of gene expression. miRNAs base-pair with complementary sequences in an mRNA molecule and then repress the mRNA molecule or repress the translation of the mRNA into a protein by one or more processes of cleaving the mRNA strand into two pieces, destabilizing the mRNA by shortening its poly(A) tail. Thus, in certain embodiments, the sequence of the miRNA includes a portion corresponding to a part of the mRNA transcript. In particular, this portion is usually 100% complementary to the target portion within the allele containing the mutation, but lower levels of complementarity (e.g., 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more) may also be used. In certain embodiments, the microRNA (miRNA) consists of 16 to 27 nucleotides, particularly 20 to 24 nucleotides, and even more particularly 21 to 23 nucleotides.
[0056] In certain embodiments, the oligonucleotide as defined in the first embodiment is an antisense oligonucleotide (AON or ASO). AONs act by binding to target premRNA or mRNA via Watson-Crick base pairing, and by inducing downregulation of gene expression through different mechanisms such as mRNA cleavage, RNase H-mediated mRNA degradation, or steric hindrance.
[0057] The oligonucleotides of the present invention may contain deoxyribonucleotides or ribonucleotides. In some embodiments, the oligonucleotide comprises DNA or RNA. In more specific embodiments, the oligonucleotide consists of DNA or RNA.
[0058] The oligonucleotides of the present invention may also contain both deoxyribonucleotides and ribonucleotides. Therefore, in certain embodiments, the oligonucleotide is a DNA-RNA chimera. In other words, the oligonucleotide comprises deoxyribonucleotides and ribonucleotides. More specifically, the oligonucleotide consists of deoxyribonucleotides and ribonucleotides.
[0059] In a more specific embodiment, the oligonucleotide of the first embodiment comprises the deoxyribonucleotide sequence GCTGAG. In an even more specific embodiment, the oligonucleotide consists of the deoxyribonucleotide sequence GCTGAG. In an even more specific embodiment, the oligonucleotide consists of the deoxyribonucleotide sequence GCTGAG and one or more ribonucleotides.
[0060] A gapmer is a chimeric single-stranded AON formed by the central block (DNA gap) of DNA nucleotides adjacent to an RNA strand. Therefore, in certain embodiments, this oligonucleotide is a gapmer. In other words, the oligonucleotide of the first embodiment consists of nucleotides arranged in the structure 5'-ABC-3', where "B" is the DNA gap of the deoxyribonucleotide and "A" and "C" are adjacent RNA blocks of ribonucleotides.
[0061] RNase H is a family of enzymes that degrade DNA-RNA hybrids in almost all organisms as a defense against viral infection. The gapmer mechanism of gene silencing relies on degradation through the action of RNase-H during protein synthesis: the DNA sequence of a gene is first transcribed into mRNA, a gapmer binds to the mRNA target, and the "gapmer DNA"-"mRNA" double strand is degraded by RNase H1, which prevents translation into protein (i.e., suppresses the expression of the corresponding gene).
[0062] The inventors have found that gapmer oligonucleotides having a DNA gap of at least seven nucleotides and two adjacent RNA blocks, each at least five nucleotides long, surprisingly reduce the expression of the pathogenic allele (COL6A1) c.877G>A and downregulate the expression of the wild-type allele to a lower degree, as detailed in Examples 1 and 2.
[0063] In one embodiment, the oligonucleotide has the structure 5'-ABC-3', where "B" is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotide lengths, and "A" and "C" are each at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 ribonucleotide lengths. In a more specific embodiment, "B" is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotide lengths, and "A" and "C" are each at least 3, 4, 5, or 6 ribonucleotide lengths. In a more specific embodiment, "B" is 7 deoxyribonucleotide lengths, and "A" and "C" are each at least 3 ribonucleotide lengths. In a more specific embodiment, "B" is 7 deoxyribonucleotide lengths, and "A" and "C" are each at least 4 ribonucleotide lengths. In particular, "B" is the length of 7 deoxyribonucleotides, and "A" and "C" are each the length of at least 5 ribonucleotides.
[0064] In one embodiment, the oligonucleotide has a structure 5'-ABC-3', where "B" is 7-13 or 6-12 deoxyribonucleotide lengths, and "A" and "C" are 1-9, 2-8, 3-7, or 4-6 ribonucleotide lengths, respectively. In a more specific embodiment, "B" is 7-13 deoxyribonucleotide lengths, and "A" and "C" are 3-6 ribonucleotide lengths, respectively. In an even more specific embodiment, "B" is 7-8 deoxyribonucleotide lengths, and "A" and "C" are 4-5 ribonucleotide lengths, respectively.
[0065] In one embodiment, the oligonucleotide has the structure 5'-ABC-3', where "B" is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotide lengths, and "A" and "C" are each 1, 2, 3, 4, 5, 6, 7, 8, or 9 ribonucleotide lengths. In a more specific embodiment, "B" is 7, 8, 9, 10, 11, 12, or 13 deoxyribonucleotide lengths, and "A" and "C" are each 3, 4, 5, or 6 ribonucleotide lengths. In a more specific embodiment, "B" is 7 deoxyribonucleotide lengths, and "A" and "C" are each 3 ribonucleotide lengths. In a more specific embodiment, "B" is 7 deoxyribonucleotide lengths, and "A" and "C" are each 4 ribonucleotide lengths. In particular, "B" is 7 deoxyribonucleotide lengths, and "A" and "C" are each 5 ribonucleotide lengths.
[0066] In another specific embodiment, the oligonucleotide is arranged in the structure 5'-ABC-3', where, - "B" is the length of 7 to 13 deoxyribonucleotides. - "A" and "C" are each the length of 3 to 9 ribonucleotides; Here, this nucleotide is, (a) Array {GGT}[ACCCAACAG](GTCTGAG)[GT * CCCCGGG]{TCT}(Sequence ID 1) (where, -The nucleotides in parentheses ( ) are deoxyribonucleotides, - Nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, T * If the nucleotide is a deoxyribonucleotide, it is a thymine nucleotide, or if the nucleotide is a ribonucleotide, it is a uracil nucleotide. - Nucleotides in curvilinear brackets {} are ribonucleotides); or (b) Fragment of (a) lacking 1 to 9 nucleotides from the 5' end and / or 1 to 9 nucleotides from the 3' end It consists of.
[0067] That is, the oligonucleotide consists of sequence (a) or fragments of sequence (a) lacking certain nucleotides from its terminals. In other words, the oligonucleotide may consist of fragments of sequence (a) lacking the sequence of nucleotides that begin to be deleted from the terminals (5' and / or 3') of sequence (a). For example, the oligonucleotide may consist of sequence (a) "123456" or fragments of (a), in particular, for example, "23456", "12345", "2345", "345", etc.; however, the oligonucleotide does not consist of fragments of (a) such as "13456", "12346", "246", "135", "36", "16", "14", etc. All of this is based on the premise that the oligonucleotide is arranged in structure ABC as described in the embodiments.
[0068] The previous embodiment also, (a) Sequence GGTACCCAACAGGTCTGAGGTCCCCGGGTCT (Sequence ID 1) (where, - Nucleotides at positions 13-20 are deoxyribonucleotides. - Nucleotides at positions 4-12 and 20-28 are deoxyribonucleotides or ribonucleotides, where the nucleotide at position 21 is a thymine nucleotide if the nucleotide is a deoxyribonucleotide, or a uracil nucleotide if the nucleotide is a ribonucleotide. - Nucleotides at positions 1-3 and 29-31 are ribonucleotides); or (b) Fragment of (a) lacking 1 to 9 consecutive nucleotides from the 5' end and / or 1 to 9 consecutive nucleotides from the 3' end It can be represented as an oligonucleotide consisting of [the specified components].
[0069] In a more specific embodiment, the oligonucleotide is arranged in the structure 5'-ABC-3', where - "B" is the length of 7 to 13 deoxyribonucleotides. - "A" and "C" are each the length of 3 to 6 ribonucleotides; Here, this nucleotide is, (a) Array {ACC}[CAACAG](GTCTGAG)[GT * CCCC]{GGG}(Sequence ID 2) (where, -The nucleotides in parentheses ( ) are deoxyribonucleotides, - Nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, where T * If the nucleotide is a deoxyribonucleotide, it is a thymine nucleotide, or if the nucleotide is a ribonucleotide, it is a uracil nucleotide. - Nucleotides in curvilinear brackets {} are ribonucleotides); or (b) Fragment of (a) lacking 1 to 6 consecutive nucleotides from the 5' end and / or 1 to 6 consecutive nucleotides from the 3' end It consists of.
[0070] The previous embodiment also, (a) Sequence ACCCAACAGGTCTGAGGTCCCCGGG (Sequence ID 2) (where, - Nucleotides at positions 10-16 are deoxyribonucleotides. - Nucleotides at positions 4-9 and 17-22 are deoxyribonucleotides or ribonucleotides, where the nucleotide at position 18 is a thymine nucleotide if the nucleotide is a deoxyribonucleotide, or a uracil nucleotide if the nucleotide is a ribonucleotide. - Nucleotides at positions 1-3 and 23-25 are ribonucleotides); or (b) Fragment of (a) lacking 1 to 6 consecutive nucleotides from the 5' end and / or 1 to 6 consecutive nucleotides from the 3' end It can be represented as an oligonucleotide consisting of [the specified components].
[0071] In a more specific embodiment, the oligonucleotide is of the sequence [ACCCAAC](AGGTCTGAGGT)[CCCCGGG](SEQ ID NO: 3), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence ACCAACAGGTCTGAGGTCCCCGGG(SEQ ID NO: 3), where the nucleotides at positions 8-18 are deoxyribonucleotides and the nucleotides at positions 1-7 and 19-25 are ribonucleotides.
[0072] In another specific embodiment, the oligonucleotide is of the sequence [ACCCAACA](GGTCTGAGG)[UCCCCGGG](SEQ ID NO: 4), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence ACCCAACAGGTCTGAGGUCCCCGGG(SEQ ID NO: 4), where the nucleotides at positions 9-17 are deoxyribonucleotides and the nucleotides at positions 1-8 and 18-25 are ribonucleotides.
[0073] In another specific embodiment, the oligonucleotide is of the sequence [CCAACA](GGTCTGAGG)[UCCCCG](SEQ ID NO: 5), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence CCAACAGGTCTGAGGUCCCCG(SEQ ID NO: 5), where the nucleotides at positions 7-15 are deoxyribonucleotides and the nucleotides at positions 1-6 and 16-21 are ribonucleotides.
[0074] In a more specific embodiment, the oligonucleotide is arranged in the structure 5'-ABC-3', where, - "B" is the length of 7 to 10 deoxyribonucleotides. - "A" and "C" are each the length of 5 ribonucleotides; Here, this nucleotide is, (a) Sequence {CCAAC}[AG](GTCTGAG)[G]{UCCCC}(Sequence No. 41) (where, -The nucleotides in parentheses ( ) are deoxyribonucleotides, - Nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides. - Nucleotides in curvilinear brackets {} are ribonucleotides); or (b) Fragment (a) lacking one or two consecutive nucleotides from the 5' end and / or one nucleotide from the 3' end. It consists of.
[0075] The previous embodiment also, (a) Sequence CCAACAGGTCTGAGGUCCCC (Sequence No. 41) (where, - Nucleotides at positions 8-14 are deoxyribonucleotides. - Nucleotides at positions 6-7 and 15 are deoxyribonucleotides or ribonucleotides. - Nucleotides at positions 1-5 and 16-20 are ribonucleotides); or (b) Fragment of (a) lacking 1-2 consecutive nucleotides from the 5' end and / or 1 nucleotide from the 3' end It can be represented as an oligonucleotide consisting of [the specified components].
[0076] In another specific embodiment, the oligonucleotide is of the sequence [CCAAC](AGGTCTGAGG)[UCCCC](SEQ ID NO: 37), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence CCAACAGGTCTGAGGUCCCC(SEQ ID NO: 37), where the nucleotides at positions 6-15 are deoxyribonucleotides and the nucleotides at positions 1-5 and 16-20 are ribonucleotides.
[0077] In another specific embodiment, the oligonucleotide is of the sequence [CAACA](GGTCTGAGG)[UCCCC](SEQ ID NO: 6), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence CAACAGGTCTGAGGUCCCC(SEQ ID NO: 6), where the nucleotides at positions 6-14 are deoxyribonucleotides and the nucleotides at positions 1-5 and 15-19 are ribonucleotides.
[0078] In another specific embodiment, the oligonucleotide is of the sequence [CAACA](GGTCTGAG)[GUCCC](SEQ ID NO: 30), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence CAACAGGTCTGAGGUCCC(SEQ ID NO: 30), where the nucleotides at positions 6-13 are deoxyribonucleotides and the nucleotides at positions 1-5 and 14-18 are ribonucleotides.
[0079] In a more specific embodiment, the oligonucleotide is arranged in the structure 5'-ABC-3', where, - "B" is the length of 7 deoxyribonucleotides, - "A" and "C" are each the length of 5 to 9 ribonucleotides; Here, this nucleotide is, (a) Sequence [ACCCAACAG](GTCTGAG)[GUCCCCGGG](Sequence ID 7) (where, -The nucleotides in parentheses ( ) are deoxyribonucleotides, - Nucleotides in square brackets [ ] are ribonucleotides); or (b) Fragment of (a) lacking 1 to 4 consecutive nucleotides from the 5' end and / or 1 to 4 consecutive nucleotides from the 3' end It consists of.
[0080] The previous embodiment also, (a) Sequence ACCCAACAGGTCTGAGGUCCCCGGG (Sequence ID 7) (where, - Nucleotides at positions 10-16 are deoxyribonucleotides. - Nucleotides at positions 1-9 and 17-25 are ribonucleotides); or (b) Fragment of (a) lacking 1 to 4 consecutive nucleotides from the 5' end and / or 1 to 4 consecutive nucleotides from the 3' end It can be represented as an oligonucleotide consisting of [the specified components].
[0081] In a more specific embodiment, the oligonucleotide is the one specified by Sequence ID No. 7.
[0082] In another specific embodiment, the oligonucleotide is of the sequence [CAACAG](GTCTGAG)[GUCCCC](SEQ ID NO: 8), where the nucleotide in parentheses ( ) is a deoxyribonucleotide and the nucleotide in square brackets [ ] is a ribonucleotide. In other words, the oligonucleotide is of the sequence CAACAGGTCTGAGGUCCCC(SEQ ID NO: 8), where the nucleotides at positions 7-13 are deoxyribonucleotides and the nucleotides at positions 1-6 and 14-19 are ribonucleotides.
[0083] In another specific embodiment, the oligonucleotide is of the sequence [AACAG](GTCTGAG)[GUCCCC](SEQ ID NO: 9), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence AACAGGTCTGAGGUCCCC(SEQ ID NO: 9), where the nucleotides at positions 6-12 are deoxyribonucleotides and the nucleotides at positions 1-5 and 13-18 are ribonucleotides.
[0084] In another specific embodiment, the oligonucleotide is of the sequence [CAACAG](GTCTGAG)[GUCCC](SEQ ID NO: 10), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence CAACAGGTCTGAGGUCCC(SEQ ID NO: 10), where the nucleotides at positions 7-13 are deoxyribonucleotides and the nucleotides at positions 1-6 and 14-18 are ribonucleotides.
[0085] In another specific embodiment, the oligonucleotide is of the sequence [ACAG](GTCTGAG)[GUCCC](SEQ ID NO: 11), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence ACAGGTCTGAGGUCCC(SEQ ID NO: 11), where the nucleotides at positions 5-11 are deoxyribonucleotides and the nucleotides at positions 1-4 and 12-16 are ribonucleotides.
[0086] In another specific embodiment, the oligonucleotide is of the sequence [AACAG](GTCTGAG)[GUCC](SEQ ID NO: 12), where the nucleotide in parentheses ( ) is a deoxyribonucleotide and the nucleotide in square brackets [ ] is a ribonucleotide. In other words, the oligonucleotide is of the sequence AACAGGTCTGAGGUCC(SEQ ID NO: 12), where the nucleotides at positions 6-12 are deoxyribonucleotides and the nucleotides at positions 1-5 and 13-16 are ribonucleotides.
[0087] In another specific embodiment, the oligonucleotide is of the sequence [ACAG](GTCTGAG)[GUCC](SEQ ID NO: 13), where the nucleotide in parentheses ( ) is a deoxyribonucleotide and the nucleotide in square brackets [ ] is a ribonucleotide. In other words, the oligonucleotide is of the sequence ACAGGTCTGAGGUCC(SEQ ID NO: 13), where the nucleotides at positions 5-11 are deoxyribonucleotides and the nucleotides at positions 1-4 and 12-15 are ribonucleotides.
[0088] In another specific embodiment, the oligonucleotide is of the sequence [AACAG](GTCTGAG)[GUCCC](SEQ ID NO: 14), where the nucleotides in parentheses ( ) are deoxyribonucleotides and the nucleotides in square brackets [ ] are ribonucleotides. In other words, the oligonucleotide is of the sequence AACAGGTCTGAGGUCCC(SEQ ID NO: 14), where the nucleotides at positions 6-12 are deoxyribonucleotides and the nucleotides at positions 1-5 and 13-17 are ribonucleotides.
[0089] In certain embodiments, the oligonucleotide of the present invention is a sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 30, SEQ ID NO: 6, and SEQ ID NO: 37. More specifically, it is the sequence of SEQ ID NO: 14.
[0090] In certain embodiments, the gapmers disclosed herein preferably contain modified nucleotides (nucleotide analogs). In particular, the DNA gap of the gapmer is usually modified with deoxyribonucleotides having a phosphorothioate-type backbone, which results in improved resistance to nucleases. Thus, in certain embodiments, some or all of the deoxyribonucleotides of the oligonucleotide as defined in the first embodiment have a phosphorothioate-type backbone. In more specific embodiments, all of the deoxyribonucleotides of the oligonucleotide as defined in the first embodiment have a phosphorothioate-type backbone.
[0091] Regarding the adjacent RNA segment of a gapmer, the most common nucleotide modification is at the 2'-O position of the ribose moiety, aimed at protecting the oligonucleotide from degradation, particularly to protect the internal DNA gap from nuclease degradation, and to improve binding affinity to the RNA target sequence. In certain embodiments, the oligonucleotide includes modifications to help enhance the oligonucleotide's properties. The most common modified nucleotides used are 2'-O-methyl (2'O-Me), locked nucleic acid (LNA) bases, or 2'-deoxy-2'-fluorobeta-D-arabinonucleotide (2'FANA). 2'-O-methyl, 2'O-Me, or 2'-O-methylation is a nucleoside modification of RNA in which a methyl group is added to the 2'-hydroxyl group of the ribose moiety of the nucleoside, producing a methoxy group. Another modified ribonucleotide used is 2'-MOE (2'-methoxyethyl). Accordingly, in certain embodiments, some or all of the ribonucleotides of the oligonucleotide as defined in the first embodiment are 2'-O-methyl (2'O-Me), locked nucleic acid (LNA) bases, 2'-deoxy-2'-fluorobeta-D-arabino nucleic acid (2'FANA), or 2'-methoxyethyl (2'-MOE)RNA nucleotides. In more specific embodiments, some or all of the ribonucleotides are selected from the group consisting of 2'-O-methyl (2'O-Me)RNA nucleotides, 2'-methoxyethyl (2'-MOE)RNA nucleotides, and combinations thereof. In even more specific embodiments, all of the ribonucleotides are 2'-O-methyl (2'O-Me)RNA nucleotides. In particular, adenine ribonucleotides contain 2'O-methyladenosine nucleoside, guanine ribonucleotides contain 2'O-methylguanosine nucleoside, cytosine ribonucleotides contain 2'O-methylcytidine nucleoside, and uracil ribonucleotides contain 2'O-methyluridine nucleoside. In another specific embodiment, all ribonucleotides are 2'-methoxyethyl (2'-MOE)RNA nucleotides.In particular, adenine ribonucleotide contains 2'-MOE-adenosine nucleoside, guanine ribonucleotide contains 2'-MOE-guanosine nucleoside, cytosine ribonucleotide contains 2'-MOE-cytidine nucleoside, and uracil ribonucleotide contains 2'-MOE-uridine nucleoside.
[0092] In certain embodiments, the deoxyribonucleotide of the oligonucleotide as defined in the first embodiment is a deoxyribonucleotide linked by a phosphorothioate bond.
[0093] In another specific embodiment, the ribonucleotide of the oligonucleotide, as defined in the first embodiment, is modified at the 2'-O position of the ribose moiety. In a more specific embodiment, the ribonucleotide is selected from the group consisting of 2'-O-methylRNA nucleotides, 2'-methoxyethyl (2'-MOE)RNA nucleotides, and combinations thereof.
[0094] In another specific embodiment, the oligonucleotide as defined in the first embodiment comprises a ribonucleotide modified at the 2'-O position of the ribose moiety and a deoxyribonucleotide having a phosphorothioate bond. In a more specific embodiment, the oligonucleotide comprises a ribonucleotide selected from the group consisting of 2'-O-methylRNA nucleotide, 2'-methoxyethyl (2'-MOE)RNA nucleotide and combinations thereof; and deoxyribonucleotide having a phosphorothioate bond. More specifically, the oligonucleotide comprises a 2'-O-methylRNA nucleotide and a deoxyribonucleotide having a phosphorothioate bond. In another specific embodiment, the oligonucleotide comprises a 2'-methoxyethyl (2'-MOE)RNA nucleotide and a deoxyribonucleotide having a phosphorothioate bond.
[0095] In another specific embodiment, the oligonucleotide, as defined in the first embodiment, comprises a ribonucleotide modified at the 2'-O position of the ribose moiety and a deoxyribonucleotide having a phosphorothioate bond. In a more specific embodiment, the oligonucleotide comprises a ribonucleotide selected from the group consisting of 2'-O-methylRNA nucleotide, 2'-methoxyethyl (2'-MOE)RNA nucleotide and combinations thereof; and deoxyribonucleotide having a phosphorothioate bond. More specifically, the oligonucleotide comprises a 2'-O-methylRNA nucleotide and a deoxyribonucleotide having a phosphorothioate bond. In another specific embodiment, the oligonucleotide comprises a 2'-methoxyethyl (2'-MOE)RNA nucleotide and a deoxyribonucleotide having a phosphorothioate bond.
[0096] In certain embodiments, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence AACAG(GTCTGAG)GUCCC (SEQ ID NO: 15), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond.
[0097] In certain embodiments, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence [AACAG]GTCTGAG[GUCCC] (SEQ ID NO: 16), where the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification.
[0098] In more specific embodiments, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence [AACAG](GTCTGAG)[GUCCC](SEQ ID NO: 17), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond, and the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification.
[0099] In other words, in certain embodiments, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence AACAGGTCTGAGGUCCC, where the nucleotides at positions 6-12 are deoxyribonucleotides having a phosphorothioate bond.
[0100] In certain embodiments, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence AACAGGTCTGAGGUCCC, where the nucleotides at positions 1-5 and 13-17 are ribonucleotides having a 2'-O-methyl modification.
[0101] In a more specific embodiment, an oligonucleotide as defined in the first embodiment comprises or consists of the sequence AACAGGTCTGAGGUCCC SEQ ID NO: 17, where the nucleotides at positions 6-12 are deoxyribonucleotides having a phosphorothioate bond, and the nucleotides at positions 1-5 and 13-17 are ribonucleotides having a 2'-O-methyl modification.
[0102] In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence CAACA(GGTCTGAG)GUCCC (SEQ ID NO: 31), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond. In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CAACA]GGTCTGAG[GUCCC] (SEQ ID NO: 32), where the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification. In more specific embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CAACA](GGTCTGAG)[GUCCC] (SEQ ID NO: 33), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond, and the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification.
[0103] In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence CAACA(GGTCTGAGG)UCCCC (SEQ ID NO: 34), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond. In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CAACA]GGTCTGAGG[UCCCC] (SEQ ID NO: 35), where the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification. In more specific embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CAACA](GGTCTGAGG)[UCCCC] (SEQ ID NO: 36), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond, and the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification.
[0104] In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence CCAAC(AGGTCTGAGG)UCCCC (SEQ ID NO: 38), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond. In certain embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CCAAC]AGGTCTGAGG[UCCCC] (SEQ ID NO: 39), where the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification. In more specific embodiments, the oligonucleotide as defined in the first embodiment comprises or consists of the sequence [CCAAC](AGGTCTGAGG)[UCCCC] (SEQ ID NO: 40), where the nucleotide in parentheses ( ) is a deoxyribonucleotide having a phosphorothioate bond, and the nucleotide in square brackets [ ] is a ribonucleotide having a 2'-O-methyl modification.
[0105] The alternative expressions shown above can be equally derived for these embodiments.
[0106] In certain embodiments, the oligonucleotide of the present invention is a sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 31, SEQ ID NO: 34, and SEQ ID NO: 38. More specifically, it is the sequence of SEQ ID NO: 17.
[0107] In another specific embodiment, the oligonucleotide of the present invention is a sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 35, and SEQ ID NO: 39. More specifically, it is the sequence of SEQ ID NO: 16.
[0108] In another specific embodiment, the oligonucleotide of the present invention is a sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 33, SEQ ID NO: 36, and SEQ ID NO: 40. More specifically, it is the sequence of SEQ ID NO: 17.
[0109] The oligonucleotides of this disclosure may be prepared by any technique known to those skilled in the art, such as chemical synthesis, enzymatic preparation, or biological preparation. In certain embodiments, the oligonucleotides of the present invention are prepared by chemical synthesis. Non-limiting examples of synthetic nucleic acids (e.g., synthetic oligonucleotides) include nucleic acids prepared by chemical synthesis in vitro using phosphotriester, phosphite, or phosphoramidite chemistry and solid-phase techniques or via deoxynucleoside H-phosphonate intermediates.
[0110] Double-stranded oligonucleotides, such as siRNA molecules, can be assembled from two separate single-stranded oligonucleotides, one containing a sense strand and the other containing the antisense strand of the siRNA. For example, each strand may be synthesized separately and then joined together by hybridization or ligation after synthesis and / or deprotection. In certain other examples, the siRNA molecule may be synthesized as a single continuous oligonucleotide fragment, where self-complementary sense and antisense regions hybridize to form a double-stranded siRNA with a hairpin secondary structure.
[0111] Composition containing a delivery agent and an oligonucleotide The oligonucleotides described herein may be provided alone, in combination with a delivery agent, or in combination with other molecules that contribute to the desired therapeutic effect. The inclusion of the oligonucleotides disclosed herein in a delivery agent may be advantageous, for example, to target desired cells or tissues, to penetrate them and interact with their targets, to improve gene delivery efficiency, and / or to improve degradation resistance.
[0112] Accordingly, the present invention also provides, in a second aspect, a composition comprising a delivery agent and an oligonucleotide as defined in the first aspect, wherein the oligonucleotide is associated with the delivery agent. All of the above embodiments for oligonucleotides also apply to the compositions of the second aspect.
[0113] The term "delivery agent" should be understood as a pharmaceutically acceptable vehicle. The delivery agent may be organic, inorganic, or both. Suitable delivery agents are well known to those skilled in the art and include, but are not limited to, large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Delivery agents may also include saline, buffers, dextrose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the delivery agent may be polycationic polymers, vesicles, liposomes, or nanoparticles.
[0114] In order to bring about the expression of a sense or antisense gene construct, the expression construct must be delivered into the cell.
[0115] Several methods for the delivery of oligonucleotides are contemplated in this disclosure. These include calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, sonication of cells, gene guns using high-speed microinjection, receptor-mediated gene transfer, and the use of delivery agents such as nanoparticles, vesicles or nanovesicles, polymers, and viral particles. Some of these techniques can be successfully adapted for in vivo or ex vivo use.
[0116] In certain embodiments of this disclosure, the delivery agent of the second embodiment is a vesicle. In another particular embodiment, the vesicle is a nanovesicle.
[0117] In some embodiments, nanovesicles are extracellular vesicles. "Extracellular vesicles" and "EVs" are vesicles of cell origin, secreted by cells, and these include, as a class, exosomes, exosome-like vesicles, and ectosomes (which arise from direct vesicle budding from the plasma membrane).
[0118] Within the class of extracellular vesicles, the important component is the exosome. In certain embodiments, nanovesicles are exosomes. In more specific embodiments, the size of exosomes is in the range of 30–500 nm in diameter, particularly 40–120 nm, and particularly 50–100 nm. Exosomes are secreted by all types of cells and are also found in large quantities in bodily fluids such as saliva, blood, urine, and milk. The primary role of exosomes is in cell-cell communication via functionally active cargo (such as miRNA, mRNA, DNA, and proteins). Exosomes can be isolated from biological sources such as milk (milk exosomes), and bovine milk in particular is an abundant source for isolating bovine milk exosomes.
[0119] In more specific embodiments, nanovesicles are liposomes. Liposomes are vesicular structures characterized by a phospholipid bilayer and an internal aqueous medium. Liposome-mediated nucleic acid delivery and foreign DNA expression in vitro have been highly successful. Reagents known as Lipofectamine 2000™, which form liposomes in an aqueous environment to capture gene delivery payloads, are widely used and commercially available.
[0120] In another specific embodiment, the delivery agent is a nanovesicle containing a sterol and a non-lipid cationic surfactant, such as those described in International Publication No. 2020229469A1 (Nanovesicles and its use for nucleic acid delivery), which is incorporated herein by reference. More specifically, the delivery agent is a quatsome, such as those described in the same International Publication No. 2020229469A1.
[0121] More specifically, the sterol contains DC-cholesterol (DC-Chol), and the non-lipid cationic surfactant contains benzyldimethyltetradecylammonium chloride (MKC). More specifically, the sterol consists of DC-cholesterol (DC-Chol), and the non-lipid cationic surfactant consists of benzyldimethyltetradecylammonium chloride (MKC).
[0122] Further aspects of the present invention refer to oligonucleotides of the first embodiment associated with a delivery agent. In other words, this refers to a delivery agent containing oligonucleotides of the first embodiment. Accordingly, all embodiments described for the second embodiment apply to this further embodiment.
[0123] Pharmaceutical composition A third aspect of this disclosure refers to a composition comprising an oligonucleotide as defined above. All of the above embodiments relating to the oligonucleotide and the composition comprising the oligonucleotide and the delivery agent also apply to the composition of the third aspect.
[0124] In some embodiments, the composition is a pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide of the first embodiment and / or the composition of the second embodiment together with a pharmaceutically acceptable excipient and / or carrier.
[0125] The expression "pharmaceutically acceptable excipient or carrier" refers to a pharmaceutically acceptable substance, composition, or vehicle. Each component must be pharmaceutically acceptable in the sense that it is compatible with the other components of the pharmaceutical composition. It must also be suitable for use in contact with human and animal tissues or organs without excessive toxicity, irritation, allergic reactions, immunogenicity, or other problems or complications, with a reasonable benefit-risk ratio.
[0126] The choice of pharmaceutical formulation depends on the properties of the active compound and its route of administration. Any route of administration may be used. In some embodiments, the route of administration is parenteral, and the composition is therefore suitable for parenteral administration. In certain embodiments, the route of administration is by injection. In more specific embodiments, the route of administration is systemic, for example, intramuscular, intravenous, intra-arterial, intraperitoneal, subcutaneous, or transdermal injection. In certain embodiments, the route of administration is local, for example, intratumor injection. Local administration is also intended, and the pharmaceutical composition may be a topical composition.
[0127] The pharmaceutical composition may be in any form, including, in particular, tablets, pellets, capsules, aqueous or oily solutions, suspensions, emulsions, aerosols, or a dry powder form suitable for reconstitution before use in water or other suitable liquid solvents, for immediate or delayed release.
[0128] Appropriate excipients and / or carriers, and their amounts, can be readily determined by those skilled in the art, depending on the type of formulation being prepared. Examples of suitable pharmaceutically acceptable excipients include solvents, dispersions, diluents or other liquid vehicles, dispersants or suspension aids, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, and the like. Unless any conventional excipient medium is incompatible with the substance or its derivative, for example, by producing some undesirable biological effect or otherwise interacting adversely with any other component of the pharmaceutical composition, its use is intended to be within the scope of this disclosure.
[0129] In a particular embodiment, the pharmaceutical composition is a sterile injectable solution. This can be prepared, for example, by incorporating the oligonucleotide in the required amount in a suitable solvent, along with one or a combination of the components listed above, if necessary, and then by filtration sterilization. In the case of a sterile powder for the preparation of a sterile injectable solution, preferred methods of preparation include vacuum drying and freeze-drying, which yield a powder of the active ingredient + any further desired ingredients from the pre-filtered solution.
[0130] Typically, the pharmaceutical composition contains a therapeutically effective amount of oligonucleotide. Where used herein, the term "therapeutically effective amount" refers to an amount of the compound that, when administered, is sufficient to prevent the occurrence of one or more symptoms of the disease being treated, or to alleviate those symptoms to some extent. The specific dose of oligonucleotides or delivery agents and compositions containing oligonucleotides administered pursuant to this disclosure will be determined by the specific environment surrounding the case, including, of course, the compound administered, the route of administration, the specific condition being treated, and similar considerations. In certain embodiments, the oligonucleotides or delivery agents and compositions containing oligonucleotides of this disclosure are used in conjunction with other therapeutic agents.
[0131] In another specific embodiment, the oligonucleotide or a composition comprising the delivery agent and the oligonucleotide is used in a combined treatment. In particular, the oligonucleotide or a composition comprising the delivery agent and the oligonucleotide is used in a combined treatment with a symptomatic treatment. More specifically, the symptomatic treatment is a physiological and / or respiratory treatment.
[0132] Parts of a kit containing at least one oligonucleotide as defined above are also disclosed herein. In certain embodiments, the kit contains a plurality of oligonucleotides as defined above. In more particular embodiments, the kit contains at least two oligonucleotides, one as defined above (which reduces the expression of the pathogenic allele of COL6A1) and the other which reduces the expression of another congenital muscular dystrophy-related gene. In more particular embodiments, the kit contains at least two oligonucleotides, one as defined above (which reduces the expression of the pathogenic allele of COL6A1) and the other which reduces the expression of another COL-RD-related gene. In more particular embodiments, the kit contains at least two oligonucleotides, one as defined above which reduces the expression of COL6A1 and the other which reduces the expression of COL6A1, COL6A2, and / or COL6A3. All embodiments of oligonucleotides defined above also apply to kits. This kit may further include a delivery agent, excipients, carrier, means of administration, and / or instructions for use.
[0133] medical use A third aspect of this disclosure relates to compositions and kits comprising oligonucleotides, delivery agents, and oligonucleotides, as defined above, for use as pharmaceuticals, particularly for treating conditions associated with or caused by the (COL6A1)c.877G>A mutation. All embodiments defined above for compositions and kits comprising oligonucleotides, delivery agents, and oligonucleotides are also applicable to their use.
[0134] "Treatment" or "treatment" of any condition or disorder associated with or caused by the (COL6A1)c.877G>A mutation may be achieved by cessating the onset of any symptom of such condition, disorder, or disorder, or by reversing any symptom, including prophylactic treatment before the clinical onset of the disorder or therapeutic treatment after the clinical onset of the disorder.
[0135] Accordingly, as used herein, the terms “treatment” and “to treat” include any of the following: prevention of a disease or disorder or one or more symptoms associated with a disease or disorder; reduction or prevention of the onset or progression of a disease or disorder or symptoms; and reduction or elimination of an existing disease or disorder or symptoms.
[0136] According to this disclosure, treatment of conditions associated with the (COL6A1)c.877G>A mutation can be achieved by downregulating the expression of the allele carrying the (COL6A1)c.877G>A mutation. Accordingly, in one embodiment, oligonucleotides or compositions as defined above are for use in downregulating the expression of the allele carrying the (COL6A1)c.877G>A mutation.
[0137] In certain embodiments, the oligonucleotides or compositions defined above are for use in patients exhibiting the mutation (COL6A1)c.877G>A. In more specific embodiments, they are for use in patients exhibiting the mutation (COL6A1)c.877G>A in a heterozygous state ((COL6A1)het.c.877G>A).
[0138] In another specific embodiment, the condition associated with the (COL6A1)c.877G>A mutation is a neuromuscular disease. More specifically, this is a muscular dystrophy. In a more specific embodiment, this disease is a congenital muscular dystrophy. In a more specific embodiment, this disease is collagen-VI-associated dystrophy (COL6-RD). In a more specific embodiment, this disease is selected from Ulrich-type congenital muscular dystrophy, Bethlehem myopathy, and / or COL6-RD with an intermediate phenotype. In a more specific embodiment, this disease is COL6-RD with an intermediate phenotype.
[0139] Throughout the specification and claims, the word “comprise” and its variations are not intended to exclude other technical features, additions, components, or steps. Furthermore, the word “comprise” encompasses the case of “consisting of.” Further objects, advantages, and characteristics of the present invention may become apparent to those skilled in the art when examining the specification or may be known through the practice of the present invention. The following examples and drawings are provided for illustrative purposes and are not intended to limit the present invention. Reference numerals placed in parentheses in relation to the drawings and in the claims are for the sole purpose of attempting to improve the understanding of the claims and are not intended to be construed as limiting the claims. Furthermore, the present invention encompasses all possible combinations of the specific and preferred embodiments described herein.
[0140] Clause For completeness, various aspects of the present invention are shown in the following numbered clauses: 1. An oligonucleotide that downregulates the expression of the COL6A1 allele carrying the (COL6A1) c.877G>A mutation by at least 40%, wherein the downregulation occurs through hybridization of the oligonucleotide to the RNA transcript of the allele at the site of the mutation, and either it does not downregulate the expression of the COL6A1 wild-type allele or it downregulates the expression of the COL6A1 wild-type allele to a lower extent than it downregulates the expression of the allele carrying the mutation. 2. The oligonucleotide according to clause 1, which downregulates the expression by at least 55%. 3. The oligonucleotide according to any one of clauses 1 to 2, which is 13 to 31 nucleotides in length. 4. The oligonucleotide according to any one of clauses 1 to 3, which is a single-stranded oligonucleotide. 5. The oligonucleotide according to any one of clauses 1 to 4, which contains both deoxyribonucleotides and ribonucleotides. 6. The oligonucleotide according to any one of clauses 1 to 5, which contains the deoxyribonucleotide sequence GTCTGAG. 7. An oligonucleotide according to any one of clauses 1 to 6, having the structure 5’-A-B-C-3’ (where “B” is 7 to 13 nucleotides in length of deoxyribonucleotides, “A” and “C” are each 3 to 9 nucleotides in length of ribonucleotides) and arranged such that; (a) the sequence {GGT}[ACCCAACAG](GTCTGAG)[GT * CCCCGGG]{TCT} (SEQ ID NO: 1) (where - nucleotides in parentheses ( ) are deoxyribonucleotides, - nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, where T * is thymine nucleotide when the nucleotide is a deoxyribonucleotide or uracil nucleotide when the nucleotide is a ribonucleotide), - Nucleotides in curvilinear brackets {} are ribonucleotides) or (b) The fragment lacking 1 to 9 consecutive nucleotides from the 5' end and / or 1 to 9 consecutive nucleotides from the 3' end. An oligonucleotide consisting of [this material]. 8. An oligonucleotide as described in any one of clauses 1 to 7, comprising the sequence [AACAG](GTCTGAG)[GUCCC](SEQ ID NO: 14), where the nucleotide in parentheses ( ) is a deoxyribonucleotide and the nucleotide in square brackets [ ] is a ribonucleotide. Clause 9. An oligonucleotide according to any one of Clauses 1 to 8, wherein some or all of the above deoxyribonucleotides have a phosphorothioate-type backbone, and / or some or all of the above ribonucleotides are a 2'-O-methyl (2'O-Me), locked nucleic acid (LNA) base, or 2'deoxy-2'-fluorobeta-D-arabino nucleic acid (2'FANA)RNA nucleotide. 10. An oligonucleotide according to any one of the clauses 1 to 9, wherein all of the above deoxyribonucleotides have a phosphorothioate-type backbone, and all of the above ribonucleotides are 2'-O-methyl (2'O-Me) modified. 11. A composition comprising a delivery agent and an oligonucleotide as defined in any one of the clauses 1 to 10, wherein the oligonucleotide is associated with the delivery agent, and in particular the delivery agent is a nanovesicle comprising a sterol and a non-lipid cationic surfactant, and the sterol comprises DC-cholesterol. 12. A pharmaceutical composition comprising, together with a pharmaceutically acceptable excipient or carrier, one or more oligonucleotides as defined in any one of Clauses 1 to 10, or a therapeutically effective amount of a composition as defined in Clause 11. 13. Oligonucleotides as defined in any one of clauses 1 to 10, compositions as defined in clause 11, or pharmaceutical compositions as defined in clause 12, for use as pharmaceuticals. 14. Oligonucleotides as defined in any one of Clauses 1 to 10, compositions as defined in Clause 11, or pharmaceutical compositions as defined in Clause 12, for use in the treatment of conditions associated with the -(COL6A1)c.877G>A mutation. 15. Oligonucleotides as defined in any one of Clauses 1 to 10, compositions as defined in Clause 11, or pharmaceutical compositions as defined in Clause 12, for use as defined in Clause 14, wherein the above condition is collagen-VI related dystrophy. [Examples]
[0141] Example 1 cell culture Skin fibroblasts were obtained from patient- and age-matched healthy controls. The cells were cultured in Dulbecco's modified Eagle medium (DMEM) containing high glucose, L-glutamine 1:100, 10% fetal bovine serum (FBS), and penicillin-streptomycin and fungizone (PSF) 1:100.
[0142] All cells were maintained in an incubator at 37°C and 5% CO2. This portion of the study was approved by the Ethical Committee at Sant Joan de Deu Hospital. All experiments involving human cells were conducted according to approved protocols.
[0143] COL6A1 pathogenicity mutation and oligonucleotides The COL6A1 mutation of interest was found in the inventors' patient cohort in a heterozygous state at exon 10 ((COL6A1)c.877 G>A) and caused the missense mutation p.Gly293Arg.
[0144] The gapmer under test, having sequence number 17, was designed to suppress the mutant allele in mRNA and to be resistant to nucleases. Specifically, the gapmer design features a central gap of seven deoxynucleotides, with two adjacent regions of five ribonucleotides having 2'OMe modifications, containing the sequences AACAG and GUCCC, respectively, linked by a phosphorothioate-type bond, at the 5' and 3' ends of the DNA gap.
[0145] Gene transfer Patient fibroblasts were grown in growth medium for 24 hours, 2x10 cells per cell. 5 Cells were seeded in a 6-well plate at a concentration of cells / well. After this time, the medium was changed to Opti-MEM (1x) Gibco (Thermo Fisher®). Cells were treated with oligonucleotides at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM, and a negative control was prepared by scrambling oligonucleotides at 100 nM. Dilutions were prepared to a final volume of 100 μL using Opti-MEM as a diluent. Invitrogen Lipofectamine 2000 (Thermo Fisher Scientific), a gene transfer agent, was added in 5 μL amounts and also 100 μL of Opti-MEM to the oligonucleotide dilutions. After 20 minutes of incubation, the medium in the wells was removed, 1 mL of the total mixture was added to the corresponding wells, and the samples were incubated at 37°C and 5% CO2 for 24 hours.
[0146] Genomic DNA extraction, PCR, and sequencing Genomic DNA was extracted using the Kit DNeasy® Blood and Tissue Kit (QIAGEN) according to the manufacturer's instructions and amplified by polymerase chain reaction (PCR). The PCR components were 1X buffer, 2mM MgSO4, 0.2mM dNTPs, 0.2μM forward and reverse primers, Taq, and 200ng of DNA, to which water was added to make 25μl. The primers used were sequence CTCCTTGGCCCAAATCCTATC (SEQ ID NO: 18) (forward primer) and sequence GGACAAACATCACTGCTGAGAA (SEQ ID NO: 19) (reverse primer). PCR was performed under the following conditions: 35 cycles of 5 minutes at 95°C (initial denaturation), 20 seconds at 98°C (denaturation), 30 seconds at 55°C (annealing), 55 seconds at 72°C (extension), and finally 5 minutes of post-amplification at 72°C.
[0147] The presence of amplified DNA was confirmed using agarose gel electrophoresis consisting of 2% agarose in TBE buffer 1X, and this was visualized using iBright® CL1000 (Thermofisher®). Once confirmed, it was purified using the QIAquick® PCR purification kit (QIAGEN) according to the manufacturer's instructions and sent to Macrogen for Sanger sequencing.
[0148] RNA extraction and reverse transcription (RT) RNA was extracted 24 hours after gene transfer using the RNeasy® Mini Kit Fibrous Tissue Kit (QIAGEN) according to the manufacturer's instructions. Total RNA concentration and quality were measured using a NanoDrop-1000 UV spectrophotometer (NanodropTherapeutics®). 200-300 ng volumes of RNA were reverse transcribed. The RT (reverse transcriptase) constituted the first reaction to denature the RNA, prepared with RNA, Oligo(dT) 25 μg / mL, and random primers 25 μg / mL, and adjusted to a final volume of 7 μL with water. The mixture was placed in a thermoblock at 70°C for 5 minutes. The second reaction product carried out consisted of water, Buffer Go Script 5x, MgCl2 2 mM, PCR nucleotide mixture 0.5 mM, RNasin ribonuclease inhibitor, and Go Script reverse transcriptase. The thermoblock conditions for this reaction were 25°C for 5 minutes, 42°C for 45 minutes, and 70°C for 15 minutes.
[0149] Droplet Digital PCR The expression of wild-type and mutant alleles of exon 10 of COL6A1, as well as the expression of all COL6A1, was quantified using Droplet Digital™ PCR (ddPCR). Allele-specific ddPCR consisted of 11 μL of ddPCR Supermix for Probes (without dUTP) (Bio-Rad, United States), a 450 nM forward primer with sequence CCGGAGATCCTGGAAGA (SEQ ID NO: 20), a 450 nM reverse primer with sequence TTTTTCTCCCTTCATTCCCT (SEQ ID NO: 21), a 250 nM wild-type allele probe with sequence CGGGGACCTCGGACC, a 5'HEX-labeled (SEQ ID NO: 22) allele probe with the CGGGGACCTCAGACC mutation, a 5'FAM-labeled (SEQ ID NO: 23) allele probe, and water, with the final volume adjusted to 18 μL. 0.025 ng of cDNA was added to the mixture. For total COL6A1 expression, ddPCR was performed using 11 μL of ddPCR Supermix for Probes (without dUTP), 450 nM forward primer, 450 nM reverse primer, probe (reference number: Thermo Fished Scientific Hs01095585_m1), and water to a final volume of 17 μL. 2 ng of cDNA was added. The entire mixture, totaling 20 μL, was placed in the wells of a BioRad cartridge. 70 μL of droplet generator oil was also added. Droplets were generated using a QX200 droplet generator (Bio-Rad, United States) and transferred to a 96-well PCR plate. The PCR plate was placed in a thermocycle. Allele-specific PCR conditions were 95°C for 10 minutes, followed by 39 cycles of 95°C for 30 seconds and 50°C for 1 minute, and finally 98°C for 10 minutes. For total COL6A1, the conditions were 95°C for 10 minutes, followed by 39 cycles of 94°C for 30 seconds and 60°C for 1 minute, and finally 98°C for 10 minutes.The plate was placed in a WX200 Droplet Reader (Bio-Rad, United States), and the concentrations of the mutant and wild-type alleles or total COL6A1 were analyzed using Bio-Rad QuantaSoftTM software (v1.7.4).
[0150] Results Primary fibroblasts from the patient showed the het.c.877G<A, p.Gly293Arg COL6A1 mutation. Primary skin fibroblasts from the patient were sequenced to confirm the presence of the c.877G<A mutation in exon 10 of COL6A1, which was detected in the patient during genetic diagnosis. Exon 10 of COL6A1 was sequenced by the Sanger method using specific primers. The double pick observed in the chromatogram (Figure 1) corresponded to the heterozygosity of the mutation carried by the patient. One guanine of the allele was changed to adenine, resulting in a missense mutation. Figure 1 shows SEQ ID NO: 26.
[0151] To examine the characteristics of the patient-derived cell lines, the specific expression of each allele, as well as the total COL6A1 expression, were analyzed. It was clearly observed that healthy controls showed 100% wild-type transcripts, while the patient showed approximately 53% mutant transcripts and 47% wild-type (Figure 2.A). Comparison of COL6A1 expression between healthy controls and the patient's primary fibroblasts showed that healthy controls had lower COL6A1 expression compared to the patient's primary fibroblasts (Figure 2.B).
[0152] Treatment with this oligonucleotide significantly downregulated mutant allele expression in the patient's primary fibroblasts. Dose-response analysis of the oligonucleotide was performed at five different concentrations from 25 nM to 200 nM to examine how treatment affected the relative expression at the transcriptional level of the allele. Treatment with this oligonucleotide showed a surprising effect at 50 nM, 150 nM, and 200 nM (p<0.0001) without suppressing the wild-type allele (Figure 3).
[0153] Extracellular type VI collagen in the patient's primary fibroblasts is significantly restored after treatment with 150 nM of this oligonucleotide. The expression and organization of type VI collagen in the extracellular matrix (ECM) of primary fibroblasts from patients before and after treatment were analyzed by immunofluorescence staining and confocal microscopy. Unlike healthy control fibroblasts, which showed a linear type VI collagen pattern of fibrils, the ECM in patient fibroblasts exhibited a discontinuous, disordered, and mottled structure due to the secretion of non-functional tetramers. After oligonucleotide treatment, the restoration of the pattern in primary fibroblasts was detected, particularly at 150 nM. ECMs achieving a linear arrangement of fibrils and improved type VI collagen strength, similar to that of healthy fibroblasts, were detected (Figures 4.A and 4.B).
[0154] Example 2 Results of suppression of the pathogenic variant COL6A1 c.877G>A by gene transfer of an alternative AON with modifications to the DNA core length and total number of nucleotides. With respect to the oligonucleotide of Example 1 (i.e., AON2), AON1, 3, 4, 5, 6, and 7 are gapmers designed to have a central core of deoxynucleotide linked by a phosphorothioate-type bond, and two adjacent regions of 5 ribonucleotides with 2'OMe modification.
[0155] Lipofectamine gene transfer of different AONs was performed in fibroblasts obtained from skin samples of patients carrying the pathogenic variant COL6A1 c.877G>A. Total RNA was then extracted from these cells, and reverse transcription and subsequent digital droplet PCR were performed to detect specific expression of mutant and wild-type transcripts. The method followed to carry out Example 2 is the same as that described in Example 1, except that the oligonucleotides tested were different. [Table 1]
[0156] AON1 Cells were transfused with AON1 (SEQ ID NO: 27) at concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM. AON1 differs from the gapmer tested in Example 1 in the shorter DNA core of two deoxyribonucleotides.
[0157] The results showed that AON1 did not significantly reduce the expression of the mutant allele (Figure 5).
[0158] AON3 and AON4 Cells were treated with AON 3 (SEQ ID NO: 28) and AON 4 (SEQ ID NO: 29) at the same concentrations as those tested for AON 1. AON 3 differs from AON in that one deoxyribonucleotide is shorter in the DNA core.
[0159] The results showed that neither AON3 nor AON4 significantly reduced the expression of the mutant allele (Figures 6 and 7).
[0160] AON5, AON6, and AON7 Patient-derived fibroblasts were also transfused with alternative AONs whose overall length and DNA core length were both longer than AON2. Specifically, AON5 (SEQ ID NO: 33), AON6 (SEQ ID NO: 36), and AON7 (SEQ ID NO: 40) have DNA cores that are 1, 2, and 3 oligonucleotides longer than AON2, respectively.
[0161] Allele-specific transcriptional analysis was performed using ddPCR on primary fibroblasts from patients treated with AON2, AON5, AON6, and AON7 at 150 nM concentrations, as well as untreated (NP) cells.
[0162] The results showed a significant reduction in the expression of mutant alleles (MUT) compared to wild-type (WT) when treated with various AONs (Figure 8).
[0163] Following the method described above, the mean downregulation of COL6A1 alleles carrying the (COL6A1)c.877G>A mutation was calculated for each of AON1 to AON7 and is shown in Table 2 below. [Table 2]
[0164] List of citations Patent Documents International Publication No. 2020229469A1 - Nanovesicles and its use for nucleic acid delivery Non-patent literature Karlin S,Altschul SF. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes.Proc Natl Acad Sci USA.1990 Mar;87(6):2264-8. doi:10.1073 / pnas.87.6.2264.PMID:2315319;PMCID: PMC53667. Karlin S and Altschul SF.Applications and statistics for multiple high-scoring segments in molecular sequences.Proc Natl Acad Sci USA.1993 Jun 15;90(12):5873-7.doi:10.1073 / pnas.90.12.5873.PMID:8390686;PMCID:PMC46825. Altschul,et al.Basic local alignment search tool.Journal of Molecular Biology,Volume 215,Issue 3,1990,Pages 403-410,ISSN 0022-2836、doi.org / 10.1016 / S0022-2836(05)80360-2 Altschul SF,et al.Gapped BLAST and PSI-BLAST:a new generation of protein database search programs.Nucleic Acids Res.1997 Sep 1;25(17):3389-402.doi:10.1093 / nar / 25.17.3389.PMID:9254694;PMCID:PMC146917. Konermann S,et al.Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.Nature.2015 Jan 29;517(7536):583-8.doi:10.1038 / nature14136.Epub 2014 Dec 10.PMID:25494202;PMCID:PMC4420636. Ogino,S.,Gulley,M.L.,den Dunnen、J.T.,Wilson、R.B.,&Association for Molecular Patholpogy Training and Education Committtee(2007).Standard mutation nomenclature in molecular diagnostics:practical and educational challenges.The Journal of molecular diagnostics:JMD,9(1),1-6. https: / / doi.org / 10.2353 / jmoldx.2007.060081
Claims
1. (COL6A1) c. An oligonucleotide that downregulates the expression of the COL6A1 allele carrying the 877G>A mutation, They are 13 to 31 nucleotides long; It is single-stranded; Containing both deoxyribonucleotides and ribonucleotides; The deoxyribonucleotide sequence CTCTGAG is included. Oligonucleotides.
2. The oligonucleotide according to claim 1, wherein the downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of the mutation.
3. The oligonucleotide according to any one of claims 1 to 2, wherein the downregulation occurs through the hybridization of the oligonucleotide to the RNA transcript of the allele at the site of the mutation, and either it does not downregulate the expression of the COL6A1 wild-type allele or it downregulates the expression of the COL6A1 wild-type allele to a lesser extent than it would downregulate the expression of the allele carrying the mutation.
4. The oligonucleotide according to any one of claims 1 to 3, which controls early expression down by at least 25%.
5. The oligonucleotide according to any one of claims 1 to 4, which controls early expression down by at least 30%.
6. The oligonucleotide according to any one of claims 1 to 5, which controls early expression down by at least 40%.
7. An oligonucleotide according to any one of claims 1 to 6, arranged in structure 5'-A-B-C-3', "B" has a length of 7 to 13 deoxyribonucleotides. "A" and "C" each have a length of 3 to 9 ribonucleotides. The aforementioned nucleic acid is (a) Sequence {GGT} [ACCCAACAG] (GTCTGAG) [GT * CCCCGGGG]{TCT} (Sequence No. 1) (Here, The nucleotides in parentheses ( ) are deoxyribonucleotides. Nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides, T * If the nucleotide is a deoxyribonucleotide, it is a thymine nucleotide, or if the nucleotide is a ribonucleotide, it is a uracil nucleotide. (The nucleotides in curvilinear brackets {} are ribonucleotides); or (b) the fragment lacking 1 to 9 consecutive nucleotides from the 5' end and / or 1 to 9 consecutive nucleotides from the 3' end; Consists of, Oligonucleotides.
8. An oligonucleotide according to any one of claims 1 to 7, having a length of 17 to 20 nucleotides.
9. An oligonucleotide according to any one of claims 1 to 8, arranged in structure 5'-A-B-C-3', "B" has a length of 7 to 10 deoxyribonucleotides. "A" and "C" each have a length of 5 ribonucleotides. The aforementioned nucleic acid is (a) Sequence {CCAAC}[AG](GTCTGAG)[G]{UCCCCC}(Sequence No. 41) (where, The nucleotides in parentheses ( ) are deoxyribonucleotides. Nucleotides in square brackets [ ] are deoxyribonucleotides or ribonucleotides. (The nucleotides in curvilinear brackets {} are ribonucleotides); or (b) Fragment of (a) lacking one or two consecutive nucleotides from the 5' end and / or one nucleotide from the 3' end Consists of, Oligonucleotides.
10. An oligonucleotide according to any one of claims 1 to 9, comprising a sequence selected from the group consisting of the sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 14), the sequence [CAACA](GGTCTGAG)[GUCCC] (SEQ ID NO: 30), the sequence [CAACA](GGTCTGAG)[UCCCCC] (SEQ ID NO: 6), and the sequence [CCAAC](AGGTCTGAGG)[UCCCCC] (SEQ ID NO: 37), wherein the nucleotide in parentheses ( ) is a deoxyribonucleotide and the nucleotide in square brackets [ ] is a ribonucleotide.
11. An oligonucleotide according to any one of claims 1 to 10, comprising the sequence [AACAG](GTCTGAG)[GUCCC] (SEQ ID NO: 14).
12. Some or all of the deoxyribonucleotides have a phosphorothioate-type skeleton; and / or Some or all of the ribonucleotides are 2'-O-methyl (2'O-Me), 2'-MOE, locked nucleic acid (LNA) bases, or 2'deoxy-2'-fluorobeta-D-arabino nucleic acid (2'FANA)RNA nucleotides. The oligonucleotide according to any one of claims 1 to 11.
13. The oligonucleotide according to any one of claims 1 to 12, wherein all of the deoxyribonucleotides have a phosphorothioate-type skeleton, and all of the ribonucleotides are selected from the group consisting of 2'-O-methyl (2'O-Me) ribonucleotides and 2'-MOE ribonucleotides.
14. A composition comprising a delivery agent and an oligonucleotide according to any one of claims 1 to 13, wherein the oligonucleotide is associated with the delivery agent, and in particular the delivery agent is a nanovesicle containing a sterol and a non-lipid cationic surfactant, and the sterol contains DC-cholesterol.
15. A pharmaceutical composition comprising, together with a pharmaceutically acceptable excipient or carrier, a therapeutically effective amount of one or more oligonucleotides according to any one of claims 1 to 13 or the composition according to claim 14.
16. An oligonucleotide according to any one of claims 1 to 13, the composition according to claim 14, or the pharmaceutical composition according to claim 15, for use as a pharmaceutical.
17. (COL6A1)c. Oligonucleotides according to any one of claims 1 to 13, the composition according to claim 14, or the pharmaceutical composition according to claim 15 for use in the treatment of a condition associated with the 877G>A mutation, wherein the condition is collagen-VI related dystrophy.