Compositions and methods for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR).

Abstract

This invention provides compositions and methods that can be used to reduce the expression of the 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) gene and to treat HMGCR-related diseases and conditions. It also provides HMGCR dsRNA agents, HMGCR antisense polynucleotide agents, compositions containing HMGCR dsRNA agents, and compositions containing HMGCR antisense polynucleotide agents that can be used to reduce HMGCR expression in cells and subjects.

Description

[Technical Field]

[0001] The present invention relates in part to compositions and methods that can be used to inhibit the expression of the 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) gene. [Background technology]

[0002] High levels of cholesterol, particularly high levels of low-density lipoprotein (LDL), are recognized risk factors for developing cardiovascular disease. Certain mutations in the gene encoding the low-density lipoprotein receptor (LDLR) reduce or block LDLR-mediated removal of LDL-C from the blood. HMG-CoA reductase (also known as 3-hydroxy-3-methylglutaryl coenzyme A reductase, HMGCR, or hydroxymethylglutaryl coenzyme A reductase) is a transmembrane glycoprotein that can catalyze a critical rate-limiting step in cholesterol biosynthesis, namely the conversion of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) to mevalonic acid. Mevalonic acid is an important intermediate in the formation of cholesterol and many nonsteroidal isoprenoid compounds, and contains isopentenyl adenine, ubiquinone, polyol, and isoprenyl groups, which can modify cellular proteins post-translation (Aboushadi et al., Biochemistry, 2000, 39, 237-247; Asslan et al., Biochem. Biophys. Res. Commun., 1999, 260, 699-706; Istvan and Deisenhofer, Biochim. Biophys. Acta, 2000, 1529, 9-18). The translation and degradation rates of HMG-CoA reductase are controlled by sterol compounds and non-sterol metabolites derived from mevalonic acid, and short-term regulation is achieved by a bicyclic cascade of reversible phosphorylation by HMG-CoA reductase and reductase kinase (Asslan et al., Biochem. Biophys. Res. Commun., 1999, 260, 699-706).

[0003] The reaction catalyzed by HMG-CoA reductase is a rate-limiting step in cholesterol synthesis, and therefore this enzyme represents a major drug target for modern human cholesterol-lowering drugs. Statins are widely used cholesterol-lowering drugs that have been found to reduce cardiovascular disease and mortality in high-risk groups. However, some patients have experienced side effects from statins, including muscle pain, an increased risk of hyperlipidemia, and abnormal liver enzyme tests (Naci H, et al. (2013). Circ Cardiovasc Qual Outcomes 6 (4):390-9).

[0004] Therefore, new therapies for HMGCR are needed to treat HMGCR-related diseases such as lipid metabolism disorders. [Overview of the project]

[0005] Generally, the present disclosure features novel HMGCR gene-specific RNAi agents, compositions containing HMGCR RNAi agents, HMGCR RNAi agents, and methods for inhibiting HMGCR gene expression in vitro and / or in vivo using compositions containing HMGCR RNAi agents described herein. The HMGCR RNAi agents described herein can selectively and effectively reduce, inhibit, or silence HMGCR gene expression in subjects (e.g., human or animal subjects).

[0006] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1, 3, or 5 by 1, 2, or 3 or fewer nucleotides, and the antisense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2, 4, or 6 by 1, 2, or 3 or fewer nucleotides, wherein the sense strand and the antisense strand are partially, basically, or completely complementary to each other.

[0007] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, of which the antisense strand comprises a region partially complementary to the mRNA encoding HMGCR, and the complementary region comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides having 0, 1, 2, 3, 4, or 5 mispairs.

[0008] In some embodiments, the HMGCR RNA transcript is Sequence ID No. 1.

[0009] In some embodiments, the target region of the HMGCR mRNA transcript is one of the nucleotide sequences in SEQ ID NO: 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-121, 103-123, 105-123, 104-124, 106-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 112-130, 113-133, 115-133, 120- 140, 122~140, 150~170, 152~170, 181~201, 183~201, 185~205, 187~205, 186~206, 188~206, 188~208, 190~208, 189~209, 191~209, 191~211, 193~211, 193~213, 194~214, 195~213, 196~216, 198~216, 197~217, 199~217, 199~219, 201~219, 202~222, 204~222, 203~223, 205~223, 204~224, 206~224, 205~225, 207~225, 206~226, 208~226, 207~227, 209~227, 208~228, 210~228, 210~230, 212~230, 211~231, 213~231, 212~232, 214~232, 214~234, 216~234, 215~235, 217~235, 216~236, 218~236, 217~237, 219~237, 218~238, 220~238, 221~241, 223~241, 222~242, 224~242, 223~243, 225~243, 224~ 244, 226~244, 225~245, 227~245, 226~246, 228~246, 227~247, 229~247, 228~248, 230~248, 229~249, 231~249, 230~250, 232~250, 234~254, 236~254, 236~256, 238~256, 237~257, 239~257, 238~258, 240~258, 240~260, 242~260, 243~263, 245~263, 244~264, 246~264, 246~266, 248~266, 247~267,249~267、249~269、251~269、253~273、255~273、257~277、259~277、263~283、265~283、265~285、267~285、269~289、271~289、270~290、272~290、271~291、273~291、272~292、274~292、273~293、275~293、275~295、277~295、278~298、280~298、279~299、281~299、280~300、282~300、281~301、283~301、282~302、284~302、283~303、285~303、284~304、286~304、285~305、287~305、287~307、289~307、293~313、295~313、294~314、296~314、295~315、297~315、296~316、298~316、298~318、300~318、299~319、301~319、320~340、322~340、324~344、326~344、325~345、327~345、326~346、328~346、327~347、329~347、330~350、332~350、331~351、333~351、332~352、334~352、334~354、336~354、335~355、337~355、336~356、338~356、337~357、339~357、338~358、340~358、339~359、341~359、340~360、342~360、341~361、343~361、342~362、344~362、344~364、346~364、345~365、347~365、346~366、348~366、347~367、349~367、348~368、350~368、349~369、351~369、350~370、352~370、351~371、353~371、352~372、354~372、353~373、355~373、354~374、356~374、99~119、100~120、102~122、111~131、112~132、114~134、115~135、116~136、117~137、118~138、119~139、121~141、122~142、123~143、124~144、125~145、126~146、127~147、128~148、129~149、130~150、131~151、132~152、133~153、134~154、135~155、136~156、137~157、138~158、139~159、140~160、141~161、142~162、143~163、144~164、145~165、146~166、147~167、148~168、149~169、151~171、152~172、153~173、154~174、155~175、156~176、157~177、158~178、159~179、160~180、161~181、162~182、163~183、164~184、165~185、166~186、167~187、168~188、169~189、170~190、171~191、172~192、173~193、174~194、175~195、176~196、177~197、178~198、179~199、180~200、182~202、183~203、184~204、187~207、190~210、192~212、194~214、195~215、198~218、200~220、201~221、209~229、213~233、219~239、220~240、231~251、232~252、233~253、235~255、239~259、241~261、242~262、245~265、248~268、250~270、251~271、252~272、254~274、255~275、256~276、258~278、259~279、260~280、261~281、262~282、264~284、266~286、267~287、268~288、274~294、276~296、277~297、286~306、288~308、289~309、290~310、291~311、292~312、297~317、300~320、301~321、302~322、303~323、304~324、305~325、306~326、307~327、308~328、309~329、310~330、311~331、312~332、313~333、314~334、315~335、316~336、317~337、318~338、319~339、321~341、322~342、323~343、328~348、329~349、333~353、343~363、355~375、356~376、357~377、358~378、359~379、120~140、185~205、215~235、216~236、221~241、234~254、244~264、253~273、263~283、265~285、272~292、275~295、287~307、298~318、324~344、325~345、326~346、332~352、345~365、392~412、416~436、422~442、423~443、458~478、611~631、1063~1083、1505~1525、3088~3108、3089~3109、3100~3120、3189~3209、3201~3221、3318~3338、3458~3478、3462~3482、3465~3485、434~454、454~474、1103~1123、1283~1303、1395~1415、1474~1494、1488~1508、1544~1564、2157~2177、2412~2432、2714~2734、3090~3110、3224~3244、392~412、394~412、393~413、395~413、412~432、414~432、413~433、415~433、414~434、416~434、415~435、417~435、416~436、418~436、418~438、420~438、419~439、421~439、420~440、422~440、422~442、424~442、423~443、425~443、424~444、426~444、425~445、427~445、426~446、428~446、427~447、429~447、428~448、430~448、429~449、431~449、430~450、432~450、431~451、433~451、432~452、434~452、433~453、435~453、434~454、436~454、435~455、437~455、436~456、438~456、437~457、439~457、438~458、440~458、439~459、441~459、440~460、442~460、441~461、443~461、442~462、444~462、450~470、452~470、451~471、453~471、452~472、454~472、454~474、456~474、455~475、457~475、458~478、460~478、461~481、463~481、465~485、467~487、469~487、469~489、471~489、474~494、476~494、475~495、477~495、524~544、526~544、527~547、529~547、532~552、534~552、538~558、540~558、540~560、542~560、541~561、543~561、545~565、547~565、552~572、554~572、555~575、557~575、558~578、560~578、561~581、563~581、562~582、564~582、565~585、567~585、567~587、569~587、568~588、570~588、570~590、572~590、575~595、577~595、577~597、579~597、578~598、580~598、579~599、581~599、580~600、582~600、581~601、583~601、606~626、608~626、607~627、609~627、611~631、613~631、612~632、614~632、614~634、616~634、615~635、617~635、617~637、619~637、618~638、620~638、621~641、623~641、623~643、625~643、624~644、626~644、625~645、627~645、628~648、630~648、629~649、631~649、632~652、634~652、636~656、638~656、639~659、641~659、662~682、664~682、663~683、665~683、664~684、666~684、668~688、670~688、672~692、674~692、676~696、678~696、681~701、683~701、689~709、691~709、690~710、692~710、695~715、697~715、697~717、699~717、699~719、701~719、708~728、710~728、711~731、713~731、715~735、717~735、719~739、721~739、742~762、744~762、746~766、748~766、754~774、756~774、816、 ~836、818~836、866~886、868~886、867~887、869~887、870~890、872~890、884~904、886~904、887~907、889~907、888~908、890~908、894~914、896~914、927~947、929~947、930~950、932~950、934~954、936~954、941~961、943~961、943~963、945~963、944~964、946~964、948~968、950~968、949~969、951~969、951~971、953~971、952~972、954~972、954~974、956~974、971~991、973~991、973~993、975~993、975~995、977~995、996~1016、999~1019、1043~1063、1045~1063、1044~1064、1046~1064、1050~1070、1052~1070、1052~1072、1054~1072、1063~1083、1065~1083、1065~1085、1067~1085、1070~1090、1072~1090、1074~1094、1076~1094、1075~1095、1077~1095、1092~1112、1094~1112、1094~1114、1096~1114、1103~1123、1105~1123、1106~1126、1108~1126、1107~1127、1109~1127、1152~1172、1154~1172、1161~1181、1163~1181、1173~1193、1175~1193、1175~1195、1177~1195、1177~1197、1179~1197、1221~1241、1223~1241、1226~1246、1228~1246、1227~1247、1229~1247、1258~1278、1260~1278、1268~1288、1270~1288、1272~1292、1274~1292、1276~1296、1278~1296、1283~1303、1285~1303、1289~1309、1290~1310、1292~1310、1297~1317、1299~1317、1308~1328、1310~1328、1337~1357、1339~1357、1340~1360、1342~1360、1341~1361、1343~1361、1361~1381、1363~1381、1395~1415、1397~1415、1468~1488、1470~1488、1474~1494、1476~1494、1475~1495、1477~1495、1476~1496、1478~1496、1478~1498、1480~1498、1488~1508、1490~1508、1496~1516、1498~1516、1500~1520、1502~1520、1501~1521、1503~1521、1502~1522、1504~1522、1505~1525、1507~1525、1509~1529、1511~1529、1511~1531、1513~1531、1512~1532、1514~1532、1534~1554、1536~1554、1535~1555、1537~1555、1542~1562、1544~1562、1544~1564、1546~1564、1547~1567、1549~1567、1563~1583、1565~1583、1607~1627、1609~1627、1612~1632、1614~1632、1617~1637、1619~1637、1641~1661、1643~1661、1642~1662、1644~1662、1644~1664、1646~1664、1899~1919、1901~1919、1968~1988、1970~1988、1978~1998、1980~1998、1985~2005、1987~2005、1990~2010、1992~2010、1992~2012、1994~2012、1998~2018、2000~2018、2001~2021、2003~2021、2022~2042、2024~2042、2023~2043、2025~2043、2091~2111、2093~2111、2098~2118、2100~2118、2125~2145、2127~2145、2126~2146、2128~2146、2152~2172、2154~2172、2153~2173、2155~2173、2156~2176、2158~2176、2157~2177、2159~2177、2161~2181、2163~2181、2162~2182、2164~2182、2172~2192、2174~2192、2175~2195、2177~2195、2215~2235、2217~2235、2217~2237、2219~2237、2221~2241、2223~2241、2252~2272、2254~2272、2254~2274、2256~2274、2256~2276、2258~2276、2258~2278、2260~2278、2280~2300、2282~2300、2285~2305、2287~2305、2286~2306、2288~2306、2291~2311、2293~2311、2298~2318、2300~2318、2031~2051、2356~2376、2358~2376、2406~2426、2408~2426、2409~2429、2411~2429、2412~2432、2414~2432、2413~2433、2415~2433、2414~2434、2416~2434、2416~2436、2418~2436、2422~2442、2424~2442、2430~2450、2432~2450、2432~2452、2434~2452、2437~2457、2439~2457、2457~2477、2459~2477、2483~2503、2485~2503、2488~2508、2490~2508、2491~2511、2493~2511、2492~2512、2494~2512、2572~2592、2574~2592、2586~2606、2588~2606、2647~2667、2649~2667、2679~2699、2681~2699、2681~2701、2683~2701、2714~2734、2716~2734、2718~2738、2720~2738、2721~2741、2723~2741、2810~2830、2812~2830、2817~2837、2819~2837、2820~2840、2822~2840、2822~2842、2824~2842、2828~2848、2830~2848、2917~2937、2919~2937、2966~2986、2968~2986、2974~2994、2976~2994、2976~2996、2978~2996、3033~3053、3035~3053、3035~3055、3037~3055、3082~3102、3084~3102, 3088~3108, 3090~3108, 3089~3109, 3091~3109, 3090~3110, 3092~3110, 3098~3118, 3100~3118, 3100~3120, 3102~3120, 3103~3123, 3105~3123, 3106~3126, 3108~3126, 3109~3129, 31 11~3129, 3110~3130, 3112~3130, 3184~3204, 3186~3204, 3187~3207, 3189~3207, 3189~3209, 3191~3209, 3190~3210, 3192~3210, 3201~3221, 3203~3221, 3210~3230, 3212~3230, 3224~3244, 3226~ 3244, 3232~3252, 3234~3252, 3233~3253, 3235~3253, 3234~3254, 3236~3254, 3236~3256, 3238~3256, 3318~3338, 3320~3338, 3335~3355, 3337~3355, 3349~3369, 3351~3369, 3378~3398, 3380~339 8, 3380~3400, 3382~3400, 3445~3465, 3447~3465, 3448~3468, 3450~3468, 3458~3478, 3460~3478, 3462~3482, 3464~3482, 3463~3483, 3465~3483, 3464~3484, 3466~3484, 3465~3485 or 3467~3485.

[0010] In some embodiments, the dsRNA agent targets the corresponding portion of the HMGCR mRNA transcript disclosed in Table 1 and / or the target region of the HMGCR mRNA transcript.

[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprising a region complementary to the mRNA encoding HMGCR, the complementary region comprising at least 15 consecutive nucleotide sequences, each having a difference of 1, 2, or 3 or fewer nucleotides from the sequence complementary to any one of the following nucleotide sequences in SEQ ID NO: 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-1 21, 103-123, 105-123, 104-124, 106-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 1 12-130, 113-133, 115-133, 120-140, 122-140, 150-170, 152-170, 181-201, 183-201, 185-205, 187-205, 186-206, 188-206, 188-208, 190-208, 189-20 9, 191-209, 191-211, 193-211, 193-213, 194-214, 195-213, 196-216, 198-216, 197-217, 199-217, 199-219, 201-219, 202-222, 204-222, 203-223, 20 5-223, 204-224, 206-224, 205-225, 207-225, 206-226, 208-226, 207-227, 209-227, 208-228, 210-228, 210-230, 212-230, 211-231, 213-231, 212-232 , 214~232, 214~234, 216~234, 215~235, 217~235, 216~236, 218~236, 217~237, 219~237, 218~238, 220~238, 221~241, 223~241, 222~242, 224~242, 223 ~243, 225~243, 224~244, 226~244, 225~245, 227~245, 226~246, 228~246, 227~247, 229~247, 228~248, 230~248, 229~249, 231~249, 230~250, 232~250,234~254、236~254、236~256、238~256、237~257、239~257、238~258、240~258、240~260、242~260、243~263、245~263、244~264、246~264、246~266、248~266、247~267、249~267、249~269、251~269、253~273、255~273、257~277、259~277、263~283、265~283、265~285、267~285、269~289、271~289、270~290、272~290、271~291、273~291、272~292、274~292、273~293、275~293、275~295、277~295、278~298、280~298、279~299、281~299、280~300、282~300、281~301、283~301、282~302、284~302、283~303、285~303、284~304、286~304、285~305、287~305、287~307、289~307、293~313、295~313、294~314、296~314、295~315、297~315、296~316、298~316、298~318、300~318、299~319、301~319、320~340、322~340、324~344、326~344、325~345、327~345、326~346、328~346、327~347、329~347、330~350、332~350、331~351、333~351、332~352、334~352、334~354、336~354、335~355、337~355、336~356、338~356、337~357、339~357、338~358、340~358、339~359、341~359、340~360、342~360、341~361、343~361、342~362、344~362、344~364、346~364、345~365、347~365、346~366、348~366、347~367、349~367、348~368、350~368、349~369、351~369、350~370、352~370、351~371、353~371、352~372、354~372、353~373、355~373、354~374、356~374、99~119、100~120、102~122、111~131、112~132、114~134、115~135、116~136、117~137、118~138、119~139、121~141、122~142、123~143、124~144、125~145、126~146、127~147、128~148、129~149、130~150、131~151、132~152、133~153、134~154、135~155、136~156、137~157、138~158、139~159、140~160、141~161、142~162、143~163、144~164、145~165、146~166、147~167、148~168、149~169、151~171、152~172、153~173、154~174、155~175、156~176、157~177、158~178、159~179、160~180、161~181、162~182、163~183、164~184、165~185、166~186、167~187、168~188、169~189、170~190、171~191、172~192、173~193、174~194、175~195、176~196、177~197、178~198、179~199、180~200、182~202、183~203、184~204、187~207、190~210、192~212、194~214、195~215、198~218、200~220、201~221、209~229、213~233、219~239、220~240、231~251、232~252、233~253、235~255、239~259、241~261、242~262、245~265、248~268、250~270、251~271、252~272、254~274、255~275、256~276、258~278、259~279、260~280、261~281、262~282、264~284、266~286、267~287、268~288、274~294、276~296、277~297、286~306、288~308、289~309、290~310、291~311、292~312、297~317、300~320、301~321、302~322、303~323、304~324、305~325、306~326、307~327、308~328、309~329、310~330、311~331、312~332、313~333、314~334、315~335、316~336、317~337、318~338、319~339、321~341、322~342、323~343、328~348、329~349、333~353、343~363、355~375、356~376、357~377、358~378、359~379、120~140、185~205、215~235、216~236、221~241、234~254、244~264、253~273、263~283、265~285、272~292、275~295、287~307、298~318、324~344、325~345、326~346、332~352、345~365、392~412、416~436、422~442、423~443、458~478、611~631、1063~1083、1505~1525、3088~3108、3089~3109、3100~3120、3189~3209、3201~3221、3318~3338、3458~3478、3462~3482、3465~3485、434~454、454~474、1103~1123、1283~1303、1395~1415、1474~1494、1488~1508、1544~1564、2157~2177、2412~2432、2714~2734、3090~3110、3224~3244,392~412、394~412、393~413、395~413、412~432、414~432、413~433、415~433、414~434、416~434、415~435、417~435、416~436、418~436、418~438、420~438、419~439、421~439、420~440、422~440、422~442、424~442、423~443、425~443、424~444、426~444、425~445、427~445、426~446、428~446、427~447、429~447、428~448、430~448、429~449、431~449、430~450、432~450、431~451、433~451、432~452、434~452、433~453、435~453、434~454、436~454、435~455、437~455、436~456、438~456、437~457、439~457、438~458、440~458、439~459、441~459、440~460、442~460、441~461、443~461、442~462、444~462、450~470、452~470、451~471、453~471、452~472、454~472、454~474、456~474、455~475、457~475、458~478、460~478、461~481、463~481、465~485、467~487、469~487、469~489、471~489、474~494、476~494、475~495、477~495、524~544、526~544、527~547、529~547、532~552、534~552、538~558、540~558、540~560、542~560、541~561、543~561、545~565、547~565、552~572、554~572、555~575、557~575、558~578、560~578、561~581、563~581、562~582、564~582、565~585、567~585、567~587、569~587、568~588、570~588、570~590、572~590、575~595、577~595、577~597、579~597、578~598、580~598、579~599、581~599、580~600、582~600、581~601、583~601、606~626、608~626、607~627、609~627、611~631、613~631、612~632、614~632、614~634、616~634、615~635、617~635、617~637、619~637、618~638、620~638、621~641、623~641、623~643、625~643、624~644、626~644、625~645、627~645、628~648、630~648、629~649、631~649、632~652、634~652、636~656、638~656、639~659、641~659、662~682、664~682、663~683、665~683、664~684、666~684、668~688、670~688、672~692、674~692、676~696、678~696、681~701、683~701、689~709、691~709、690~710、692~710、695~715、697~715、697~717、6、 99~717、699~719、701~719、708~728、710~728、711~731、713~731、715~735、717~735、719~739、721~739、742~762、744~762、746~766、748~766、754~774、756~774、816~836、818~836、866~886、868~886、867~887、869~887、870~890、872~890、884~904、886~904、887~907、889~907、888~908、890~908、894~914、896~914、927~947、929~947、930~950、932~950、934~954、936~954、941~961、943~961、943~963、945~963、944~964、946~964、948~968、950~968、949~969、951~969、951~971、953~971、952~972、954~972、954~974、956~974、971~991、973~991、973~993、975~993、975~995、977~995、996~1016、999~1019、1043~1063、1045~1063、1044~1064、1046~1064、1050~1070、1052~1070、1052~1072、1054~1072、1063~1083、1065~1083、1065~1085、1067~1085、1070~1090、1072~1090、1074~1094、1076~1094、1075~1095、1077~1095、1092~1112、1094~1112、1094~1114、1096~1114、1103~1123、1105~1123、1106~1126、1108~1126、1107~1127、1109~1127、1152~1172、1154~1172、1161~1181、1163~1181、1173~1193、1175~1193、1175~1195、1177~1195、1177~1197、1179~1197、1221~1241、1223~1241、1226~1246、1228~1246、1227~1247、1229~1247、1258~1278、1260~1278、1268~1288、1270~1288、1272~1292、1274~1292、1276~1296、1278~1296、1283~1303、1285~1303、1289~1309、1290~1310、1292~1310、1297~1317、1299~1317、1308~1328、1310~1328、1337~1357、1339~1357、1340~1360、1342~1360、1341~1361、1343~1361、1361~1381、1363~1381、1395~1415、1397~1415、1468~1488、1470~1488、1474~1494、1476~1494、1475~1495、1477~1495、1476~1496、1478~1496、1478~1498、1480~1498、1488~1508、1490~1508、1496~1516、1498~1516、1500~1520、1502~1520、1501~1521、1503~1521、1502~1522、1504~1522、1505~1525、1507~1525、1509~1529、1511~1529、1511~1531、1513~1531、1512~1532、1514~1532、1534~1554、1536~1554、1535~1555、1537~1555、1542~1562、1544~1562、1544~1564、1546~1564、1547~1567、1549~1567、1563~1583、1565~1583、1607~1627、1609~1627、1612~1632、1614~1632、1617~1637、1619~1637、1641~1661、1643~1661、1642~1662、1644~1662、1644~1664、1646~1664、1899~1919、1901~1919、1968~1988、1970~1988、1978~1998、1980~1998、1985~2005、1987~2005、1990~2010、1992~2010、1992~2012、1994~2012、1998~2018、2000~2018、2001~2021、2003~2021、2022~2042、2024~2042、2023~2043、2025~2043、2091~2111、2093~2111、2098~2118、2100~2118、2125~2145、2127~2145、2126~2146、2128~2146、2152~2172、2154~2172、2153~2173、2155~2173、2156~2176、2158~2176、2157~2177、2159~2177、2161~2181、2163~2181、2162~2182、2164~2182、2172~2192、2174~2192、2175~2195、2177~2195、2215~2235、2217~2235、2217~2237、2219~2237、2221~2241、2223~2241、2252~2272、2254~2272、2254~2274、2256~2274、2256~2276、2258~2276、2258~2278、2260~2278、2280~2300、2282~2300、2285~2305、2287~2305、2286~2306、2288~2306、2291~2311、2293~2311、2298~2318、2300~2318、2031~2051、2356~2376、2358~2376、2406~2426、2408~2426、2409~2429、2411~2429、2412~2432、2414~2432、2413~2433、2415~2433、2414~2434、2416~2434、2416~2436、2418~2436、2422~2442、2424~2442、2430~2450、2432~2450、2432~2452、2434~2452、2437~2457、2439~2457、2457~2477、2459~2477、2483~2503、2485~2503、2488~2508、2490~2508、2491~2511、2493~2511、2492~2512、2494~2512、2572~2592、2574~2592、2586~2606、2588~2606、2647~2667、2649~2667、2679~2699、2681~2699、2681~2701、2683~2701、2714~2734、2716~2734、2718~2738、2720~2738、2721~2741、2723~2741、2810~2830、2812~2830、2817~2837、2819~2837、2820~2840、2822~2840、2822~2842、2824~2842、2828~2848、2830~2848, 2917~2937, 2919~2937, 2966~2986, 2968~2986, 2974~2994, 2976~2994, 2976~2996, 2978~2996, 3033~3053, 3035~3053, 3035~3055, 3037~3055, 3082~3102, 3084~3102, 3088~3108, 3090~3108, 3089~3109, 3091~3109, 3090~31 10, 3092~3110, 3098~3118, 3100~3118, 3100~3120, 3102~3120, 3103~3123, 3105~3123, 3106~3126, 3108~3126, 3109~3129, 3111~3129, 3110~3130, 3112~3130, 3184~3204, 3186~3204, 3187~3207, 3189~3207, 3189~3209, 3191~3209, 3190~ 3210, 3192~3210, 3201~3221, 3203~3221, 3210~3230, 3212~3230, 3224~3244, 3226~3244, 3232~3252, 3234~3252, 3233~3253, 3235~3253, 3234~3254, 3236~3254, 3236~3256, 3238~3256, 3318~3338, 3320~3338, 3335~3355, 3337~3355, 334 9~3369, 3351~3369, 3378~3398, 3380~3398, 3380~3400, 3382~3400, 3445~3465, 3447~3465, 3448~3468, 3450~3468, 3458~3478, 3460~3478, 3462~3482, 3464~3482, 3463~3483, 3465~3483, 3464~3484, 3466~3484, 3465~3485 or 3467~3485.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprising a region complementary to the mRNA encoding HMGCR, the complementary region comprising at least 15, 16, 17, 18, or 19 consecutive nucleotides in the complementary sequence of any one of the following nucleotide sequences in SEQ ID NO: 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-121, 103-123, 105-123, 104-124, 10 6-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 112-130, 113-133, 115-133, 120-140 , 122~140, 150~170, 152~170, 181~201, 183~201, 185~205, 187~205, 186~206, 188~206, 188~208, 190~208, 189~209, 191~209, 191~211, 193~211, 193~ 213, 194~214, 195~213, 196~216, 198~216, 197~217, 199~217, 199~219, 201~219, 202~222, 204~222, 203~223, 205~223, 204~224, 206~224, 205~225, 2 07~225, 206~226, 208~226, 207~227, 209~227, 208~228, 210~228, 210~230, 212~230, 211~231, 213~231, 212~232, 214~232, 214~234, 216~234, 215~23 5, 217~235, 216~236, 218~236, 217~237, 219~237, 218~238, 220~238, 221~241, 223~241, 222~242, 224~242, 223~243, 225~243, 224~244, 226~244, 225 ~245, 227~245, 226~246, 228~246, 227~247, 229~247, 228~248, 230~248, 229~249, 231~249, 230~250, 232~250, 234~254, 236~254, 236~256, 238~256,237~257、239~257、238~258、240~258、240~260、242~260、243~263、245~263、244~264、246~264、246~266、248~266、247~267、249~267、249~269、251~269、253~273、255~273、257~277、259~277、263~283、265~283、265~285、267~285、269~289、271~289、270~290、272~290、271~291、273~291、272~292、274~292、273~293、275~293、275~295、277~295、278~298、280~298、279~299、281~299、280~300、282~300、281~301、283~301、282~302、284~302、283~303、285~303、284~304、286~304、285~305、287~305、287~307、289~307、293~313、295~313、294~314、296~314、295~315、297~315、296~316、298~316、298~318、300~318、299~319、301~319、320~340、322~340、324~344、326~344、325~345、327~345、326~346、328~346、327~347、329~347、330~350、332~350、331~351、333~351、332~352、334~352、334~354、336~354、335~355、337~355、336~356、338~356、337~357、339~357、338~358、340~358、339~359、341~359、340~360、342~360、341~361、343~361、342~362、344~362、344~364、346~364、345~365、347~365、346~366、348~366、347~367、349~367、348~368、350~368、349~369、351~369、350~370、352~370、351~371、353~371、352~372、354~372、353~373、355~373、354~374、356~374、100~120、102~122、111~131、112~132、114~134、115~135、116~136、117~137、118~138、119~139、121~141、122~142、123~143、124~144、125~145、126~146、127~147、128~148、129~149、130~150、131~151、132~152、133~153、134~154、135~155、136~156、137~157、138~158、139~159、140~160、141~161、142~162、143~163、144~164、145~165、146~166、147~167、148~168、149~169、151~171、152~172、153~173、154~174、155~175、156~176、157~177、158~178、159~179、160~180、161~181、162~182、163~183、164~184、165~185、166~186、167~187、168~188、169~189、170~190、171~191、172~192、173~193、174~194、175~195、176~196、177~197、178~198、179~199、180~200、182~202、183~203、184~204、187~207、190~210、192~212、194~214、195~215、198~218、200~220、201~221、209~229、213~233、219~239、220~240、231~251、232~252、233~253、235~255、239~259、241~261、242~262、245~265、248~268、250~270、251~271、252~272、254~274、255~275、256~276、258~278、259~279、260~280、261~281、262~282、264~284、266~286、267~287、268~288、274~294、276~296、277~297、286~306、288~308、289~309、290~310、291~311、292~312、297~317、300~320、301~321、302~322、303~323、304~324、305~325、306~326、307~327、308~328、309~329、310~330、311~331、312~332、313~333、314~334、315~335、316~336、317~337、318~338、319~339、321~341、322~342、323~343、328~348、329~349、333~353、343~363、355~375、356~376、357~377、358~378、359~379、185~205、215~235、216~236、221~241、234~254、244~264、253~273、263~283、265~285、272~292、275~295、287~307、298~318、324~344、325~345、326~346、332~352、345~365、392~412、416~436、422~442、423~443、458~478、611~631、1063~1083、1505~1525、3088~3108、3089~3109、3100~3120、3189~3209、3201~3221、3318~3338、3458~3478、3462~3482、3465~3485、434~454、454~474、1103~1123、1283~1303、1395~1415、1474~1494、1488~1508、1544~1564、2157~2177、2412~2432、2714~2734、3090~3110、3224~3244、392~412、394~412、393~413、395~413、412~432、414~432、413~433、415~433、414~434、416~434、415~435、417~435、416~436、418~436、418~438、420~438、419~439、421~439、420~440、422~440、422~442、424~442、423~443、425~443、424~444、426~444、425~445、427~445、426~446、428~446、427~447、429~447、428~448、430~448、429~449、431~449、430~450、432~450、431~451、433~451、432~452、434~452、433~453、435~453、434~454、436~454、435~455、437~455、436~456、438~456、437~457、439~457、438~458、440~458、439~459、441~459、440~460、442~460、441~461、443~461、442~462、444~462、450~470、452~470、451~471、453~471、452~472、454~472、454~474、456~474、455~475、457~475、458~478、460~478、461~481、463~481、465~485、467~487、469~487、469~489、471~489、474~494、476~494、475~495、477~495、524~544、526~544、527~547、529~547、532~552、534~552、538~558、540~558、540~560、542~560、541~561、543~561、545~565、547~565、552~572、554~572、555~575、557~575、558~578、560~578、561~581、563~581、562~582、564~582、565~585、567~585、567~587、569~587、568~588、570~588、570~590、572~590、575~595、577~595、577~597、579~597、578~598、580~598、579~599、581~599、580~600、582~600、581~601、583~601、606~626、608~626、607~627、609~627、611~631、613~631、612~632、614~632、614~634、616~634、615~635、617~635、617~637、619~637、618~638、620~638、621~641、623~641、623~643、625~643、624~644、626~644、625~645、627~645、628~648、630~648、629~649、631~649、632~652、634~652、636~656、638~656、639~659、641~659、662~682、664~682、663~683、665~683、664~684、666~684、668~688、670~688、672~692、674~692、676~696、678~696、681~701、683~701、689~709、691~709、690~710、692~710、695~715、697~715、697~717、699~717、699~719、701~719、708~728、710~728、711~、 731、713~731、715~735、717~735、719~739、721~739、742~762、744~762、746~766、748~766、754~774、756~774、816~836、818~836、866~886、868~886、867~887、869~887、870~890、872~890、884~904、886~904、887~907、889~907、888~908、890~908、894~914、896~914、927~947、929~947、930~950、932~950、934~954、936~954、941~961、943~961、943~963、945~963、944~964、946~964、948~968、950~968、949~969、951~969、951~971、953~971、952~972、954~972、954~974、956~974、971~991、973~991、973~993、975~993、975~995、977~995、996~1016、999~1019、1043~1063、1045~1063、1044~1064、1046~1064、1050~1070、1052~1070、1052~1072、1054~1072、1063~1083、1065~1083、1065~1085、1067~1085、1070~1090、1072~1090、1074~1094、1076~1094、1075~1095、1077~1095、1092~1112、1094~1112、1094~1114、1096~1114、1103~1123、1105~1123、1106~1126、1108~1126、1107~1127、1109~1127、1152~1172、1154~1172、1161~1181、1163~1181、1173~1193、1175~1193、1175~1195、1177~1195、1177~1197、1179~1197、1221~1241、1223~1241、1226~1246、1228~1246、1227~1247、1229~1247、1258~1278、1260~1278、1268~1288、1270~1288、1272~1292、1274~1292、1276~1296、1278~1296、1283~1303、1285~1303、1289~1309、1290~1310、1292~1310、1297~1317、1299~1317、1308~1328、1310~1328、1337~1357、1339~1357、1340~1360、1342~1360、1341~1361、1343~1361、1361~1381、1363~1381、1395~1415、1397~1415、1468~1488、1470~1488、1474~1494、1476~1494、1475~1495、1477~1495、1476~1496、1478~1496、1478~1498、1480~1498、1488~1508、1490~1508、1496~1516、1498~1516、1500~1520、1502~1520、1501~1521、1503~1521、1502~1522、1504~1522、1505~1525、1507~1525、1509~1529、1511~1529、1511~1531、1513~1531、1512~1532、1514~1532、1534~1554、1536~1554、1535~1555、1537~1555、1542~1562、1544~1562、1544~1564、1546~1564、1547~1567、1549~1567、1563~1583、1565~1583、1607~1627、1609~1627、1612~1632、1614~1632、1617~1637、1619~1637、1641~1661、1643~1661、1642~1662、1644~1662、1644~1664、1646~1664、1899~1919、1901~1919、1968~1988、1970~1988、1978~1998、1980~1998、1985~2005、1987~2005、1990~2010、1992~2010、1992~2012、1994~2012、1998~2018、2000~2018、2001~2021、2003~2021、2022~2042、2024~2042、2023~2043、2025~2043、2091~2111、2093~2111、2098~2118、2100~2118、2125~2145、2127~2145、2126~2146、2128~2146、2152~2172、2154~2172、2153~2173、2155~2173、2156~2176、2158~2176、2157~2177、2159~2177、2161~2181、2163~2181、2162~2182、2164~2182、2172~2192、2174~2192、2175~2195、2177~2195、2215~2235、2217~2235、2217~2237、2219~2237、2221~2241、2223~2241、2252~2272、2254~2272、2254~2274、2256~2274、2256~2276、2258~2276、2258~2278、2260~2278、2280~2300、2282~2300、2285~2305、2287~2305、2286~2306、2288~2306、2291~2311、2293~2311、2298~2318、2300~2318、2031~2051、2356~2376、2358~2376、2406~2426、2408~2426、2409~2429、2411~2429、2412~2432、2414~2432、2413~2433、2415~2433、2414~2434、2416~2434、2416~2436、2418~2436、2422~2442、2424~2442、2430~2450、2432~2450、2432~2452、2434~2452、2437~2457、2439~2457、2457~2477、2459~2477、2483~2503、2485~2503、2488~2508、2490~2508、2491~2511、2493~2511、2492~2512、2494~2512、2572~2592、2574~2592、2586~2606、2588~2606、2647~2667、2649~2667、2679~2699、2681~2699、2681~2701、2683~2701、2714~2734、2716~2734、2718~2738、2720~2738、2721~2741、2723~2741、2810~2830、2812~2830、2817~2837、2819~2837、2820~2840、2822~2840、2822~2842、2824~2842、2828~2848、2830~2848、2917~2937、2919~2937、2966~2986、2968~2986, 2974~2994, 2976~2994, 2976~2996, 2978~2996, 3033~3053, 3035~3053, 3035~3055, 3037~3055, 3082~3102, 3084~3102, 3088~3108, 3090~3108, 3089~3109, 3091~3109, 3090~3110, 3092~3110, 3098~3118, 3100~31 18, 3100~3120, 3102~3120, 3103~3123, 3105~3123, 3106~3126, 3108~3126, 3109~3129, 3111~3129, 3110~3130, 3112~3130, 3184~3204, 3186~3204, 3187~3207, 3189~3207, 3189~3209, 3191~3209, 3190~3210, 3192~3210, 3201~ 3221, 3203~3221, 3210~3230, 3212~3230, 3224~3244, 3226~3244, 3232~3252, 3234~3252, 3233~3253, 3235~3253, 3234~3254, 3236~3254, 3236~3256, 3238~3256, 3318~3338, 3320~3338, 3335~3355, 3337~3355, 3349~3369, 335 1-3369, 3378-3398, 3380-3398, 3380-3400, 3382-3400, 3445-3465, 3447-3465, 3448-3468, 3450-3468, 3458-3478, 3460-3478, 3462-3482, 3464-3482, 3463-3483, 3465-3483, 3464-3484, 3466-3484, 3465-3485, or 3467-3485.

[0013] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprising a region complementary to the mRNA encoding HMGCR, which comprises at least 15 consecutive nucleotides that differ by 1, 2, or 3 or fewer nucleotides from any one antisense sequence listed in any one of Tables 1 to 3.

[0014] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotide positions 2-18 of the antisense strand include a region complementary to the HMGCR RNA transcript, and the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally includes a target ligand.

[0015] In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. In some embodiments, the dsRNA agent includes a sequence listed as a double-stranded sequence in any one of Tables 1 to 3.

[0016] In some embodiments, the dsRNA agent contains at least one modified nucleotide. In some embodiments, all or essentially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, all or essentially all nucleotides of the sense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, ring-open nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannide nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, 5'-phosphonate modified nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecaneamide group, 2'-amino modified nucleotide, phosphoramidite, or a nucleotide containing a non-natural base. In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5' end of the guide strand. In some embodiments, the dsRNA agent contains at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the antisense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, all or essentially all nucleotides of the sense strand and the antisense strand are modified nucleotides.In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, of which fewer than 6 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which fewer than 4 modified nucleotides are 2'-fluoronucleotides. In one embodiment, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which at least 14 modified nucleotides are 2'-O-methylnucleotides, and positions 2, 5, 7, 12, 14, 16 and / or 18, counted from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, calculated from the first matching position at the 5' end of the antisense strand, the antisense strand comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 16, and 2'-O-methylnucleotides at the remaining positions. In some embodiments, the antisense chain comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16, calculated from the first matching position at the 5' end, and 2'-O-methylnucleotides at the remaining positions.In some embodiments, the sense strand independently comprises 15 or more modified nucleotides selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably, of which at least 18 modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 9, 11, and / or 13, counted from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the modified sense strand is one of the modified sense strand sequences listed in Tables 2-3. In some embodiments, the modified antisense strand is one of the modified antisense strand sequences listed in Tables 2-3.

[0017] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. In some embodiments, the one or more target groups or binding groups are conjugated to a sense strand. In some embodiments, the target groups or binding groups comprise N-acetyl-galactosamine (GalNAc).

[0018] In some embodiments, the target group has a structure represented by formula (X), [ka] Each n'' is independently either 1 or 2.

[0019] In some embodiments, the target group has the following structure. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] Table 1-5

[0020] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense strand includes one reverse debase residue. In some embodiments, the 3' end of the sense strand includes one reverse debase residue. In some embodiments, each end of the sense strand includes one imann residue. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides.In one embodiment, the dsRNA includes a double-stranded body selected from the group consisting of: AD00608, AD00609, AD00610, AD00611, AD00612, AD00613, AD00614, AD00615, AD00616, AD00617, AD00618, AD00619, AD00620, AD00621, AD00622, AD00623, AD00624, AD00625, AD00626, AD00627, AD00628, AD00629, AD00630, AD00631, AD00632, AD00842, AD00843, AD00844, AD00845, AD00846, AD00847, AD00 848, AD00849, AD00850, AD00851, AD00852, AD00853, AD00854, AD00855, AD00856, AD008 57, AD00858, AD00859, AD00860, AD00861, AD00862, AD00863, AD01021, AD01022, AD0102 3, AD01024, AD01025, AD01026, AD02602, AD02603, AD02604, AD02605, AD02606, AD02607 , AD02608, AD02609, AD02610, AD02611, AD02612, AD02613, AD02614, AD02615, AD02616.

[0021] In several embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to a portion of the mRNA encoding HMGCR, and each strand having a length of approximately 15 to 30 nucleotides, the sense strand sequence of which may be represented by formula (I): 5'-(N' L ) n’ N' L N' L N' N1 N' N2 N' N3 N' N4 N'L N' F N' L N' N5 N' N6 N' L N' L N' L (N' L ) m’ -3' (I) Among them, each N' F represents a 2'-fluoro-modified nucleotide, and each N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 independently represent a modified or unmodified nucleotide, and each N' L independently represents a modified or unmodified nucleotide, but does not represent a 2'-fluoro-modified nucleotide, and m' and n' are each independently an integer from 0 to 7.

[0022] In some embodiments, N' N2 and N' N4 each independently represent a 2'-fluoro-modified nucleotide.

[0023] In some embodiments, m' is 2 and n' is 3, or m' is 2 and n' is 4, or m' is 2 and n' is 5.

[0024] In some embodiments, the dsRNA agent comprises a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably GLS-15*. In one embodiment, the dsRNA agent comprises a target group conjugated to the 3' end of the sense strand. In one embodiment, the antisense strand comprises one reverse debase residue at the 3' end. In one embodiment, the sense strand comprises one or two reverse debase residues and / or one or two imann residues at the 3' and / or 5' ends. In one embodiment, the 3' end of the sense strand independently comprises one reverse debase residue. In one embodiment, each of the 3' and 5' ends of the sense strand independently comprises a reverse debase residue. In one embodiment, each of the 3' and 5' ends of the sense strand independently comprises an imann residue. In one embodiment, the 3' end of the sense chain preferably contains a reverse debase residue, and the 5' end is conjugated to a target group, which is preferably GLS-15*. In another embodiment, each end of the sense chain preferably contains a reverse debase residue, and the residue at the 3' or 5' end is further conjugated to a target group, which is preferably GLS-15*. In yet another embodiment, each end of the sense chain preferably contains an imann residue, and the residue at the 3' or 5' end is further conjugated to a target group, which is preferably GLS-15*.

[0025] In several examples, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to a portion of the mRNA encoding HMGCR, and each strand having a length of approximately 18 to 30 nucleotides, the antisense strand sequence of which may be represented by formula (II): 3'-(N L ) n NM1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (II) Of these, each N F This indicates a 2'-fluoromodified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 This independently indicates modified or unmodified nucleotides, and each N L The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and n is an integer from 0 to 7.

[0026] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0027] In some embodiments, N M2 , N M3 and N M7 Each of these independently shows a 2'-fluoromodified nucleotide, and N M6 This indicates a UNA-modified nucleotide.

[0028] In some embodiments, n is 1, or n is 2, or n is 3.

[0029] In some embodiments, N M6 , N M3 and N M2They are all 2'-fluoro modified nucleotides.

[0030] In some embodiments, provided is a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the mRNA encoding HMGCR, wherein the complementary region comprises at least 15 consecutive nucleotides, and wherein the dsRNA duplex is represented by formula (III): Sense strand: 5'-(N' L ) n’ N' L N' L N' L N' N1 N' <000... Formula (III) Among them, ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​Each chain independently consists of approximately 17 to 30 nucleotides. each N F and N' F This independently shows a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 Each N independently represents a modified or unmodified nucleotide. L and N' L The terms *,

[0031] In some embodiments, m' is 2 and n' is 3, or m' is 2 and n' is 4, or m' is 2 and n' is 5.

[0032] In some embodiments, N' N2 and N' N4 These independently represent 2'-fluoromodified nucleotides.

[0033] In some embodiments, n is 1, or n is 2, or n is 3.

[0034] In some embodiments, N M2 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and in one embodiment, N M2 , N M3 and N M6 All of these are 2'-fluoromodified nucleotides.

[0035] In some embodiments, NM2 , N M3 and N M7 Each of these independently shows a 2'-fluoromodified nucleotide, and N M6 This indicates a UNA-modified nucleotide.

[0036] In some embodiments, the dsRNA agent comprises a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably GLS-15*. In one embodiment, the dsRNA agent comprises a target group conjugated to the 5' end of the sense strand. In one embodiment, the antisense strand comprises one reverse debase residue at the 3' end. In one embodiment, the sense strand comprises one or two reverse debase residues and / or one or two imann residues at the 3' and / or 5' ends. In one embodiment, the 3' end of the sense strand independently comprises one reverse debase residue. In one embodiment, each of the 3' and 5' ends of the sense strand independently comprises a reverse debase residue. In one embodiment, each of the 3' and 5' ends of the sense strand independently comprises an imann residue. In one embodiment, each 3' and 5' end of the sense strand contains a reverse debase residue, and the residue at the 3' or 5' end is further conjugated to a target group, which is preferably GLS-15*. In one embodiment, the 3' end of the sense strand contains a reverse debase residue, and the 5' end is conjugated to a target group, which is preferably GLS-15*. In one embodiment, each 3' and 5' end of the sense strand contains an imann residue, and either one of the residues at the 3' or 5' end is further conjugated to a target group, which is preferably GLS-15*. In one embodiment, the dsRNA agent has two blunt ends. In one embodiment, at least one strand contains a 3' overhang of at least one nucleotide. In one embodiment, at least one strand contains a 3' overhang of at least two nucleotides.

[0037] In some embodiments, at least one linkage in the sense strand and / or antisense strand is a phosphodiester (PO) linkage. In some embodiments, at least one linkage in the sense strand and / or antisense strand is a modified linkage. In some embodiments, at least one linkage in the sense strand and / or antisense strand is a phosphorothioate (PS) linkage. In some embodiments, at least one phosphorothioate (PS) linkage is introduced to the 5'-terminus, 3'-terminus, or both ends of the sense strand and / or antisense strand. In some embodiments, one, two, three, four, five, or six phosphorothioate (PS) links are introduced to the 5'-terminus, 3'-terminus, or both ends of the sense strand and / or antisense strand. In some embodiments, at least two terminally modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphorothioate links. In some embodiments, three terminally modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphorothioate bonds. In some embodiments, at least two terminally modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphorothioate bonds. In some embodiments, three terminally modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphorothioate bonds. In some embodiments, three terminally modified or unmodified nucleotides at the 5' end of the sense strand are linked by phosphorothioate bonds, and two terminally modified or unmodified nucleotides at the 3' end of the sense strand are linked by phosphorothioate bonds. In some embodiments, the sense strand includes phosphorothioate bonds between the target group and the reverse debasing residue or imann residue, and between the reverse debasing residue or imann residue and the terminally modified or unmodified nucleotides at the 5' end of the sense strand.

[0038] In some embodiments, any one of the sense strands in Table 1 may be modified in the mode shown by formula (I) or (III). In some embodiments, any one of the antisense strands in Table 1 may be further modified in the mode shown by formula (II) or (III). In some embodiments, any one of the double-stranded bodies in Table 1 may be further modified in the mode shown by formula (III). In some embodiments, the modified sense strand has one of the modification modes listed in Tables 2-3. In some embodiments, the modified antisense strand has one of the modification modes listed in Tables 2-3.

[0039] According to one aspect of the present invention, a composition is provided that includes any embodiment relating to the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more other therapeutic agents. In some embodiments, the composition is packaged in a reagent kit, container, packaging bag, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous (IV) administration.

[0040] According to another aspect of the present invention, cells are provided, including any embodiment of the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0041] Another aspect of the present invention provides a method for inhibiting HMGCR gene expression in cells, the method comprising (i) producing cells comprising an effective amount of any one embodiment of the above-described embodiment of the dsRNA agent of the present invention or any one embodiment of the above-described composition of the present invention. In some embodiments, the method further comprises (ii) inhibiting HMGCR gene expression in cells by maintaining the produced cells for a time sufficient to obtain degradation of the mRNA transcript of the HMGCR gene. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered to the subject by method IV. In some embodiments, the method further comprises evaluating the inhibition of the HMGCR gene after administering a dsRNA agent to a subject, wherein the means for evaluation include (i) determining one or more physiological features of an HMGCR-related disease or condition, or (ii) comparing the determined physiological features with baseline physiological features of an HMGCR-related disease or condition before treatment and / or control physiological features of an HMGCR-related disease or condition, wherein the comparison indicates one or more of the presence or absence of inhibition of HMGCR gene expression in the subject. In some embodiments, the physiological features are one or more of HMGCR mRNA levels and HMGCR protein levels. A reduction in HMGCR expression can be indirectly assessed by measuring a reduction in one or more of the following biological activities of HMGCR: cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), free fatty acid and lipid levels in blood or serum, and the cytoplasmic expression level of 3-hydroxy-3-methylglutaryl coenzyme A reductase.Furthermore, HMGCR expression can be indirectly assessed by other variables related to HMGCR gene expression, such as the nuclear localization of 3-hydroxy-3-methylglutaryl coenzyme A reductase, or the expression of certain target genes (e.g., Jun, c-Myc, and CyclinD-1), or other oncogenic genes involved in the transcriptional regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase.

[0042] Another aspect of the present invention provides a method for inhibiting HMGCR gene expression in a subject, the method comprising administering to the subject an effective amount of an embodiment of the dsRNA agent of the present invention or the composition of the present invention. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered to the subject by method IV. In some embodiments, the method further comprises evaluating the inhibition of the HMGCR gene after administration of the dsRNA agent, the means for evaluation comprising (i) determining one or more physiological features of HMGCR-related disease or condition; and (ii) comparing the determined physiological features with baseline physiological features of HMGCR-related disease or condition and / or control physiological features of HMGCR-related disease or condition, the comparison indicating one or more of the presence or absence of inhibition of HMGCR gene expression in the subject. In some embodiments, HMGCR gene expression can be assessed based on the level or level change of any variable related to HMGCR gene expression, such as HMGCR mRNA levels and HMGCR protein levels. A reduction in HMGCR expression can be further assessed indirectly by measuring a reduction in the biological activity of HMGCR, such as a reduction in one or more of the following: cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum.

[0043] According to another aspect of the present invention, a method is provided for treating a disease or condition associated with the presence of an HMGCR protein, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent of the present invention, or any embodiment of the composition of the present invention, in order to inhibit HMGCR gene expression. In some embodiments, the diseases, conditions, or states associated with HMGCR are selected from hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or decreased activity, familial partial lipodystrophy type 1 (FPLD1), polycystic ovary syndrome associated with insulin resistance, kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disease and Addison's disease, or other lipid metabolism disorders associated with HMGCR.

[0044] In some embodiments, the method further includes administering a different treatment scheme to a subject. In some embodiments, the different treatment scheme includes treatment for HMGCR-related diseases or conditions. In one embodiment, the different treatment scheme includes administering one or more HMGCR antisense polynucleotides of the present invention to a subject, administering a non-HMGCR dsRNA therapeutic agent to a subject, and behavioral changes in the subject. In some embodiments, non-HMGCR dsRNA therapeutic agents include HMG-CoA reductase inhibitors (e.g., statins), fibrates, bile acid chelators, nicotinic acid, antiplatelet agents, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists (e.g., losartan potassium, e.g., Cozaar® by Merck & Co.), acyl coenzyme A cholesterol acetyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesterol ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol regulators, bile acid regulators, peroxisome proliferation-activating receptor (PPAR) agonists, gene-based therapies, complex vascular protective agents (e.g., AGT 1067 by Atherogenics), glycoprotein IIb / IIIa inhibitors, aspirin or aspirin-like compounds, and IB The HMG-CoA reductase inhibitors are atorvastatin (e.g., S-8921, by Shionogi), squalene synthase inhibitors, or monocyte chemotactic protein (MCP)-I inhibitors, or one or more of any combination thereof. Among these, HMG-CoA reductase inhibitors include atorvastatin (Pfizer's Lipitor® / Tahor / Sortis / Torvast / Cardyl), pravastatin (Bristol-Myers Squibb's Pravachol, Sankyo's Mevalotin / Sanaprav), simvastatin (Merck's Zocor® / Sinvacor, Boehringer Ingelheim's Denan, Banyu's Lipovas), lovastatin (Merck's Mevacor / Mevinacor, Bexal's Lovastatina, Cepa, and Schwarz)Pharma's Liposcler), fluvastatin (Novartis' Lescol® / Locol / Lochol, Fujisawa's Cranoc, Solvay's Digaril), cerivastatin (Bayer's Lipobay / GlaxoSmithKline's Baycol), rosuvastatin (AstraZeneca's Crestor®), and pitavastatin (itavastatin / risivastatin) (Nissan Chemical, Kowa This includes, but is not limited to, Kogyo, Sankyo, and Novartis, and among them, fibrate drugs include bezafibrate (e.g., Roche's Befizal® / Cedur® / Bezalip®, Kissei's Bezatol), clofibrate (e.g., Wyeth's Atromid-S®), fenofibrate (e.g., Founder's Lipidil / Lipantil, Abbott's Tricor®, Takeda's Lipantil, generic drugs), gemfibrozil (e.g., Pfizer's Lopid / Lipur) and ciprofibrate (Sanofi-Synthelabo's Modalim®), but is not limited to these, and among them, bile acid chelators include cholestyramine (Bristol-Myers Squibb's Questran® and Questran Light®), cholestipol (e.g., Pharmacia's This includes, but is not limited to, Colestid and Coleseveram (Genzyme / Sankyo's WelChol™), among which nicotinic acid therapy includes, but is not limited to, immediate-release formulations such as Nicobid of Aventis, Niacor of Upsher-Smith, Nicolar of Aventis and Perycit of Sanwakagaku, among which sustained-release nicotinic acid formulations include, for example, Niaspan of Kos Pharmaceuticals and SIo-nicotinic acid of Upsher-Smith, among which antiplatelet agents include aspirin (e.g., Bayer's aspirin) and clopidogrel (Sanofi-Synthelabo / Bristol-Myers).This includes, but is not limited to, Squibb's Plavix and ticlopidine (e.g., Sanofi-Synthelabo's Ticlid and Daiichi's Panaldine), among which aspirin-like compounds include, but is not limited to, Asacard (sustained-release aspirin, Pharmacia) and pamicogrel (Kanebo / Angelini Ricerche / CEPA), among which angiotensin-converting enzyme inhibitors include, but is not limited to, ramipril (e.g., Aventis' Altace) and enalapril (e.g., Merck & Co.'s Vasotec), among which acyl coenzyme A cholesterol acetyltransferase (ACAT) inhibitors include abasimib (Pfizer) and eflusimib (BioMsrieux Pierre Fabre / Eli). This includes, but is not limited to, Lilly, CS-505 (Sankyo and Kyoto) and SMP-797 (Sumito), among which cholesterol absorption inhibitors include, but are not limited to, ezetimibe (Merck / Schering-Plough Pharmaceuticals Zetia®) and Pamaqueside (Pfizer), among which CETP inhibitors include, but are not limited to, Torcetrapib (CP-529414, also known as Pfizer), JTT-705 (Japan Tobacco) and CETi-I (Avant Immunotherapeutics), among which microsomal triglyceride transfer protein (MTTP) inhibitors include, but are not limited to, Impritapide (Bayer), R-103757 (Janssen) and CP-346086 (Pfizer), among which cholesterol regulators include NO-1886 (Otsuka / TAP Pharmaceutical), CT This includes, but is not limited to, 1027 (Pfizer) and WAY-135433 (Wyeth-Ayerst), among which bile acid regulators include HBS-107 (Hisamitsu / Banyu) and Btg-511 (British TechnologyThis includes, but is not limited to, peroxisome proliferation-activating receptor (PPAR) agonists such as tesaglitasal (AZ-242) (AstraZeneca), netoglitazone (MCC-555) (Mitsubishi / Johnson & Johnson), GW-409544 (Ligand Pharmaceuticals / GlaxoSmithKline), GW-501516 (Ligand Pharmaceuticals / GlaxoSmithKline), LY-929 (Ligand Pharmaceuticals and Eli Lilly), LY-465608 (Ligand Pharmaceuticals and Eli Lilly), and LY-518674 (Ligand Pharmaceuticals and Eli Lilly). This includes, but is not limited to, Lilly) and MK-767 (Merck and Kyorin), among which gene-based therapies include, but are not limited to, AdGWEGF 121.10 (GenVec), ApoAl (UCB Pharma / Groupe Fournier), EG-004 (Trinam) (Ark Therapeutics) and ATP-binding cassette transporter-Al (ABCA1) (CV Therapeutics / Incyte), Aventis, Xenon), among which glycoprotein IIb / IIIa inhibitors include, but are not limited to, roxifiban (DMP754, also known as Bristol-Myers Squibb), Gantofiban (Merck KGaA / Yamanouchi) and Cromafiban (Millennium Pharmaceuticals), among which squalene synthase inhibitors include BMS-1884941 (Bristol-Myers This includes, but is not limited to, Squibb, CP-210172 (Pfizer), CP-295697 (Pfizer), CP-294838 (Pfizer), and TAK-475 (Takeda), among which the MCP-I inhibitors include, but is not limited to, RS-504393 (Roche Bioscience), among which the anti-atherosclerotic agents include BO-653 (ChugaiThis includes, but is not limited to, pharmaceuticals, of which nicotinic acid derivatives include, but are not limited to, Nyclin (Yamanouchi Pharmaceuticals). Exemplary combination therapies suitable for administration with HMGCR-targeting dsRNAs include, but are not limited to, advicor (nicotinic acid / lovastatin from Kos Pharmaceuticals), amlodipine / atorvastatin (Pfizer), and ezetimibe / simvastatin (e.g., Vytorin® 10 / 10, 10 / 20, 10 / 40, and 10 / 80 tablets from Merck / Schering-Plough Pharmaceuticals). In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered to the subject by method IV. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, a method for determining therapeutic efficacy in a subject includes (i) determining one or more physiological characteristics of an HMGCR-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline physiological characteristics of the HMGCR-related disease or condition prior to treatment, wherein the comparison indicates one or more of the presence, absence, and level of efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, HMGCR gene expression can be evaluated based on the level or level change of any variable related to HMGCR gene expression, such as HMGCR mRNA level, HMGCR protein level, or cholesterol ester (CE) level, triglyceride level, cholesterol level (e.g., high-density lipoprotein cholesterol (HDL-C) level, medium-density lipoprotein cholesterol (IDL-C) level, low-density lipoprotein cholesterol (LDL-C) level, very low-density lipoprotein cholesterol (VLDL-C) level), and lipid level in blood or serum.

[0045] Another aspect of the present invention provides a method for reducing the level of HMGCR protein in a subject compared to a pre-treatment baseline level of HMGCR protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent or any embodiment of the composition of the present invention to reduce the level of HMGCR gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by method IV.

[0046] Another aspect of the present invention provides a method for altering the physiological characteristics of an HMGCR-related disease or disorder in a subject compared to a baseline of pre-treatment physiological characteristics in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention to alter the physiological characteristics of the HMGCR-related disease or disorder in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by method IV. In some embodiments, the physiological characteristics are one or more of the following in the subject: HMGCR mRNA levels, HMGCR protein levels, or cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum.

[0047] Another aspect of the present invention provides a method of using the above-mentioned dsRNA agent to treat a disease or condition associated with the presence of the HMGCR protein. In some embodiments, the disease or condition is one or more of the following: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or dysfunction, familial partial lipodystrophy type 1 (FPLD1), polycystic ovary syndrome associated with insulin resistance, kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disease and Addison's disease, or other lipid metabolism disorders associated with HMGCR.

[0048] According to another aspect of the present invention, an antisense polynucleotide reagent for inhibiting the expression of HMGCR protein is provided, the reagent comprising 10 to 30 consecutive nucleotides, of which at least one of the consecutive nucleotides is a modified nucleotide, and of which the nucleotide sequence of the reagent is approximately 80% complementary in its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one target region of SEQ ID NO: 1, and the complementary sequence is any one sequence provided in one of Tables 1 to 3. In some embodiments, the antisense polynucleotide reagent comprises one of the antisense sequences provided in one of Tables 1 to 3.

[0049] Another aspect of the present invention provides compositions comprising any embodiment of the above-described antisense polynucleotide reagent. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more other therapeutic agents for treating HMGCR-related diseases or conditions. In some embodiments, the composition is packaged in reagent kits, containers, packaging bags, dispensers, pre-filled syringes or vials. In some embodiments, the composition is prepared for use in subcutaneous or intravenous administration.

[0050] According to another aspect of the present invention, cells comprising any embodiment of the antisense polynucleotide reagent described above are provided. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0051] Another aspect of the present invention provides a method for inhibiting HMGCR gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the antisense polynucleotide reagent described above. In some embodiments, the method further comprises (ii) inhibiting HMGCR gene expression in cells by maintaining the cells produced in (i) for a time sufficient to obtain degradation of the mRNA transcript of the HMGCR gene.

[0052] Another aspect of the present invention provides a method for inhibiting HMGCR gene expression in a subject, the method comprising administering an effective amount of any embodiment of the antisense polynucleotide reagent to the subject.

[0053] According to another aspect of the present invention, a method for treating a disease or condition associated with the presence of an HMGCR protein, the method comprising administering to a subject an effective amount of any embodiment of any antisense polynucleotide reagent or any composition of the present invention in order to inhibit HMGCR gene expression. In one embodiment, the above-mentioned disease or condition is one or more of the following: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or dysfunction, familial partial lipodystrophy type 1 (FPLD1), polycystic ovary syndrome associated with insulin resistance, kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disease, and Addison's disease, or other lipid metabolism disorders associated with HMGCR.

[0054] Another aspect of the present invention provides a method for reducing the level of HMGCR protein in a subject compared to a pre-treatment baseline level of HMGCR protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of any of the above antisense polynucleotide reagents or any embodiment of any of the above compositions of the present invention in order to reduce the level of HMGCR gene expression. In one embodiment, the antisense polynucleotide reagent is administered to the subject subcutaneously or by method IV.

[0055] According to another aspect of the present invention, an antisense polynucleotide reagent for inhibiting HMGCR gene expression is provided, the reagent comprising 10 to 30 consecutive nucleotides, of which at least one of the consecutive nucleotides is a modified nucleotide, and of which the nucleotide sequence of the reagent has about 80% or about 85% complementarity with the equivalent region of the nucleotide sequence of SEQ ID NO: 1 in its entire length.

[0056] Another aspect of the present invention provides a method for altering the physiological characteristics of an HMGCR-related disease or disorder in a subject compared to a baseline of pre-treatment physiological characteristics in the subject, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide reagent or any embodiment of the composition of the present invention to alter the physiological characteristics of the HMGCR-related disease or disorder in the subject. In some embodiments, the antisense polynucleotide reagent is administered to the subject subcutaneously or by Method IV. In some embodiments, the physiological characteristics are one or more of the following in the subject: HMGCR mRNA levels, HMGCR protein levels, or cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum.

[0057] Sequence IDs 1 and 2 (reverse complement) are the mRNA of modern human 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) [NCBI reference sequence: NM_000859.3].

[0058] Sequence IDs 3 and 4 (reverse complement) are the predicted cynomolgus monkey 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) mRNA [NCBI reference sequence: XM_005557177.3].

[0059] Sequence IDs 5 and 6 (reverse complement) are macaque 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) mRNA [NCBI reference sequence: XM_001104607.4].

[0060] Sequence numbers 7-876, 3157-3164, and 3181-3388 are shown in Table 1 and are sense strand sequences.

[0061] Sequence numbers 877-1746, 3165-3172, and 3389-3596 are shown in Table 1 and are antisense strand sequences.

[0062] Sequence IDs 1747-2616, 2723-3024, and 3173-3180 are shown in Table 2 and have chemical modifications. As can be understood by those skilled in the art, the asterisk (*) is a symbol indicating a linking relationship. The presence of the asterisk indicates that the monomers are linked by a thiophosphodiester bond, and the absence of the asterisk between two monomers indicates that the monomers are linked by a phosphodiester bond.

[0063] Sequence IDs 2617-2722 and 3025-3156 are shown in Table 3. The delivery molecule is indicated as "GLX-_" at the 3' or 5' end of each sense chain, and as can be understood by those skilled in the art, "*" is a symbol indicating a linkage, where the presence of "*" indicates that the monomers are linked by a thiophosphodiester bond, and the absence of "*" between two monomers indicates that the monomers are linked by a phosphodiester bond. <Detailed explanation>

[0064] The present invention partially comprises an RNAi agent capable of inhibiting the expression of the 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) gene, for example, a double-stranded (ds) RNAi agent. The present invention further partially comprises a composition comprising an HMGCR RNAi agent and a method of using the composition. The HMGCR RNAi agents disclosed herein can be attached to a delivery compound so as to be delivered to cells, including hepatocytes. The pharmaceutical composition of the present invention may comprise at least one dsRNA HMGCR agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a delivery compound containing GalNAc. The HMGCR RNAi agent delivered to cells can reduce the activity of the HMGCR protein product of the gene in the cells by inhibiting HMGCR gene expression. The dsRNAi agents of the present invention can be used to treat HMGCR-related diseases and conditions.

[0065] In some embodiments of the present invention, HMGCR expression in cells or subjects is reduced to treat diseases or conditions associated with HMGCR expression in cells or subjects. Non-limiting examples of diseases and conditions treatable by reducing HMGCR activity include hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, acute pancreatitis associated with atherosclerosis, dyslipidemia, hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or dysfunction, familial partial lipodystrophy type 1 (FPLD1), polycystic ovary syndrome associated with insulin resistance, kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disease, Addison's disease, or other diseases for which a reduction in HMGCR protein levels and activity would be medically beneficial.

[0066] As used herein, “G,” “C,” “A,” and “U” typically refer to nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, the terms “ribonucleotide” or “nucleotide” should be understood to refer to modified nucleotides or substitutional portions of substitutes, as described in more detail below. It will be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted with other portions without fundamentally altering the base-pairing properties of oligonucleotides containing such substitutional portions. For example, a nucleotide containing inosine as its base can pair with a nucleotide base containing adenine, cytosine, or uracil, but is not limited to these. Therefore, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine may be substituted with, for example, a nucleotide containing inosine. Sequences containing such substitutional portions are embodiments of the present invention.

[0067] As used herein, the term “3-hydroxy-3-methylglutaryl coenzyme A reductase” is interchangeable with the term “HMGCR” and refers to a naturally occurring gene encoding the 3-hydroxy-3-methylglutaryl coenzyme A reductase protein from any vertebrate or mammal, the above origins including, but not limited to, humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise specified. The term further refers to fragments and variants of natural HMGCR that retain at least one in vivo or in vitro activity of natural HMGCR. The amino acid and complete coding sequences of the human HMGCR gene reference sequence can be found, for example, in GenBank Ref Seq registration number NM_000859.3 (SEQ ID NO: 1 and SEQ ID NO: 2). The human mammalian ortholog, the HMGCR gene, can be found, for example, in cynomolgus monkeys (SEQ ID NOs. 3 and 4) with GenBank reference sequence registration number XM_005557177.3, and in rhesus monkeys (SEQ ID NOs. 5 and 6) with GenBank reference sequence registration number XM_001104607.4. Other examples of HMGCR mRNA sequences can be readily obtained using publicly available databases, such as GenBank, UniProt, Ensembl, and OMIM.

[0068] The following describes how to prepare and use compositions containing HMGCR single-strand (ssRNA) and dsRNA reagents to inhibit HMGCR gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by HMGCR gene expression. The term "RNAi" is also known in this field, and may also be called "siRNA".

[0069] As used herein, the term “RNAi” refers to RNA and reagents that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in this art, an RNAi target region (also called a target region or target segment) refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, and includes messenger RNA (mRNA), which is a processed product of primary transcript RNA. The target segment of the sequence is at least long enough to function as a substrate for RNAi directed cleavage in or near that segment. The target sequence may be 8–30 nucleotides long (inclusive), 10–30 nucleotides long (inclusive), 12–25 nucleotides long (inclusive), 15–23 nucleotides long (inclusive), 16–23 nucleotides long (inclusive), or 18–23 nucleotides long (inclusive), and includes all relatively short lengths within each specified range. In some embodiments of the present invention, the length of the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the length of the target sequence is between 9 and 26 nucleotides (including both endpoints), encompassing all subranges and integers within that range. For example, but not intended to be limiting, in some embodiments of the present invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, and its sequence is completely or at least fundamentally complementary to at least a portion of the RNA transcript of the HMGCR gene. Some aspects of the present invention include a pharmaceutical composition comprising one or more HMGCR dsRNA agents and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the HMGCR RNAi described herein inhibits the expression of the HMGCR protein.

[0070] As used herein, “dsRNA reagent” refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or inhibiting the translation of a target mRNA transcript. While not intending to limit ourselves to any particular theory, the dsRNA reagents of the present invention may function by an RNA interference mechanism (i.e., inducing the production of RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Methods for achieving gene silencing in plant, invertebrate, and vertebrate cells are known in the art (see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the respective disclosures of which are incorporated herein by reference in their entirety. Gene silencing procedures known in this field can be used in combination with the disclosures provided herein to inhibit HMGCR expression.

[0071] The dsRNA reagents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, short interfering RNAs (siRNAs), RNAi reagents, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and Dicer substrates. The antisense strand of the dsRNA reagents described herein is at least partially complementary to the target mRNA. In this art, it should be understood that dsRNA double-stranded structures of different lengths can be used to inhibit target gene expression. For example, dsRNAs with double-stranded structures having 19, 20, 21, 22, and 23 base pairs are known to be able to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in this art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. It is also known in this art that even shorter or longer RNA double-stranded structures can effectively induce RNA interference. As used herein, the terms “double-stranded region,” “double-stranded region,” and “complementary region” are interchangeable and refer to regions known in the art in which the sense strand is complementary or essentially complementary to the antisense strand. In some embodiments, the sense strand and antisense strand may be the same length or of different lengths. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 25 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the length of each strand is 21 nucleotides or less. In some embodiments, the length of the sense strand and antisense strand of the RNAi agent may each be 15 to 49 nucleotides. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.In some embodiments, the sense strand length is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the sense strand and the antisense strand are complementary or basically complementary, and the length of the complementary region is between 15 and 23 nucleotides. In some embodiments, the length of the complementary region is between 19 and 21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. It is also known in this field that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. In some embodiments of the present invention, the HMGCR dsRNA may contain at least one strand of 21 nt or longer, or it may have a shorter double-stranded structure based on one of the sequences listed in any one of Tables 1-3, with 1, 2, 3, or 4 nucleotides reduced at one or both ends, which may be more effective than the dsRNAs listed in Tables 1-3, respectively. In some embodiments of the present invention, the HMGCR dsRNA agent may have a partial sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and their HMGCR gene expression inhibitory ability is 5%, 10%, 15%, 20%, 25%, or 30% or less compared to the inhibition level of dsRNA containing the complete sequence. The sense sequences, antisense sequences, and double-stranded bodies disclosed in Tables 1-3 may be referred to herein as “parent” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, and extended, and may include substitutions. As described herein, the obtained sequences retain the effectiveness of all or at least part of their parent sequences in the methods and compositions of the present invention.The sense strand and antisense strand included in the dsRNA of the present invention can be selected independently. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of other elements. For example, though not intended to be limiting, when producing the dsRNA of the present invention, two strands of “elements” may be selected to be included in a double-stranded body. One selected element may have a sense sequence of SEQ ID NO: 1747 (shown in Table 2), while another selected element may have an antisense sequence of SEQ ID NO: 2182, or a modified SEQ ID NO: 2182, which, compared to its parent sequence SEQ ID NO: 2182, is shortened, lengthened, and / or contains one, two, or three substitutions. It should be understood that the double-stranded body of the present invention does not need to contain both the sense sequence and antisense sequence shown in the pairings in the double-stranded bodies in Tables 1-3. Each sense strand and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.

[0072] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or single-stranded RNA administered to a subject. For example, an antisense strand, such as any one of the antisense strands listed in Tables 1 to 3, may be part of the composition or administered to a subject in the composition to reduce HMGCR polypeptide activity and / or HMGCR gene expression in the subject. Table 1 shows the core extension sequences of the antisense and sense strands of a certain HMGCR dsRNA agent. A single-stranded antisense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred to herein as a “single-stranded antisense agent” or “antisense polynucleotide agent.” A single-stranded sense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein as a “single-stranded sense reagent” or “sense polynucleotide reagent.” The term “nucleotide sequence” as used herein refers to a polynucleotide sequence that is free from chemical modifications or delivery compounds. For example, the sense strand GUUGUCAAGACUUUUUCGAAA (SEQ ID NO: 7) shown in Table 1 is the nucleotide sequence of SEQ ID NO: 1747 in Table 2 and SEQ ID NO: 2642 in Table 3, of which SEQ ID NO: 1747 and SEQ ID NO: 2642 represent their chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be labeled with "sense strand SS#", a single-stranded antisense sequence may be labeled with "antisense strand AS#", and a double-stranded compound containing the sense strand and antisense strand may be labeled with "double-stranded compound AD# / AV#".

[0073] Table 1 includes a sense strand and an antisense strand, and provides the label numbers for the double-stranded bodies formed by the sense strand and antisense strand in the same row in Table 1. In one embodiment of the present invention, the antisense sequence includes a sequence of nucleic acid bases u or a at position 1 of the antisense. In one embodiment of the present invention, the antisense sequence includes nucleic acid base u located at position 1 of the antisense sequence. As used herein, the term “matching position” in the sense strand and antisense strand is a position that “pairs” in each strand when the two strands form a double-stranded body. For example, in a sense strand of 21 nucleic acid bases and an antisense strand of 21 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 21 of the antisense strand are in a “matching position”. In another non-limiting example, in a sense strand of 23 nucleic acid bases and an antisense strand of 23 nucleic acid bases, nucleic acid base 2 of the sense strand and position 22 of the antisense strand are in a matching position. In yet another non-limiting example, in a sense strand of 18 nucleic acid bases and an antisense strand of 18 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and nucleic acid base 18 in the antisense strand are in a matching position, and nucleic acid base 4 in the sense strand and nucleic acid base 15 in the antisense strand are in a matching position. Those skilled in the art should understand how to identify, or become, a matching position in the sense strand and antisense strand of a double-stranded body and its paired strand.

[0074] The first column in Table 1 indicates a double-stranded body AD# which contains both a sense sequence and an antisense sequence in the same row of the table. For example, Table 1 discloses a double-stranded body designated AD#AD00810.um which contains sense sequence number 7 and antisense sequence number 877. Accordingly, each row in Table 1 labels a double-stranded body of the present invention, the sense and antisense sequences contained in each row are shown in the same row, and the designating identifier for each double-stranded body is shown in the first column of that row.

[0075] In some embodiments of the method of the present invention, an RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is administered to the subject.

[0076] In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body containing at least one of the nucleotide sequences listed in Table 1 and comprising 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1 to 3 is ligated to a delivery molecule, non-limiting examples of which are delivery compounds containing a GalNAc compound or GLS-15* compounds.

[0077] Table 1 shows the antisense and sense strand sequences of unmodified HMGCR RNAi agents. All sequences are shown in the 5'-3' direction. The double-stranded body AD# is the number assigned to the double-stranded bodies of the two strands in the same row in the table. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22 Table 2-23 Table 2-24 Table 2-25 Table 2-26 Table 2-27 Table 2-28 Table 2-29 Table 2-30 Table 2-31 Table 2-32 Table 2-33 Table 2-34 Table 2-35 Table 2-36 Table 2-37 Table 2-38 Table 2-39 Table 2-40 Table 2-41 Table 2-42 Table 2-43 Table 2-44 Table 2-45 Table 2-46 Table 2-47 Table 2-48 Table 2-49 Table 2-50 Table 2-51 Table 2-52 Table 2-53 Table 2-54 Table 2-55 Table 2-56 Table 2-57 Table 2-58 Table 2-59 Table 2-60 Table 2-61 Table 2-62 Table 2-63 Table 2-64 Table 2-65 Table 2-66 Table 2-67 Table 2-68 Table 2-69 Table 2-70 Table 2-71 Table 2-72 Table 2-73 Table 2-74 Table 2-75 Table 2-76 Table 2-77 Table 2-78 Table 2-79 Table 2-80 Table 2-81 Table 2-82 Table 2-83 Table 2-84

[0078] Table 2 shows the antisense and sense strand sequences of a certain chemically modified HMGCR RNAi agent of the present invention. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject includes a double-stranded molecule in the first row labeled in the first column of Table 2, and includes the sequence modifications shown in the sense strand sequence in the third column and the antisense strand sequence in the sixth column of the same row in Table 2. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be conjugated (also referred to herein as "conjugated") to a compound that can deliver the RNAi agent to cells and / or tissues in the subject. Non-limiting examples of deliverable compounds that can be used in some embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15*. In Table 2, the first column shows the double-stranded molecule AV# of the nucleotide sequence as shown in Table 1. Table 2 discloses the double-stranded AV# and further shows the chemical modifications included in the sense and antisense sequences of the double-stranded AV#. For example, Table 1 shows the single-base sequences SEQ ID NO: 7 (sense) and SEQ ID NO: 877 (antisense), which together form a double-stranded AV# labeled as AD#AD00810.um, and Table 2 lists the double-stranded AV#AV00810, in which the double-stranded AV# of SEQ ID NO: 1747 and SEQ ID NO: 2182 contain the base sequences of SEQ ID NO: 7 and SEQ ID NO: 877, respectively, and have the chemical modifications shown in the sense sequence in the third column and the antisense sequence in the sixth column. In the second column of Table 2, "Sense strand SS#" is an identifier assigned to the sense sequence (including modifications) shown in the third column in the same row. In the fifth column of Table 2, "Antisense strand AS#" is an identifier assigned to the antisense sequence (including modifications) shown in the sixth column.

[0079] Table 2 provides the antisense and sense strand sequences of the chemically modified HMGCR RNAi agents. All sequences are shown 5’ to 3’. These sequences are used in certain in vitro test studies described herein.

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

[0080] Table 3 lists the sense and antisense strand sequences of a certain chemically modified HMGCR RNAi agent of the present invention. In some embodiments of the method of the present invention, the RNAi agent shown in Table 3 is administered to cells and / or subjects. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a double-stranded body in the first row labeled in the first column of Table 3, and a sequence modification and / or delivery compound shown in the sense strand in the third column and the antisense strand in the sixth column of the same row in Table 3. The sequence is used in certain in vivo studies described elsewhere in this specification. In some embodiments of the method of the present invention, the sequence shown in Table 3 may be conjugated to a compound used for delivery, a non-limiting example of which is a compound containing GalNAc, which is a delivery compound labeled "GLX-n" in the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to indicate a "GLS-n*" or "GLO-n" delivery compound (where "X" may be "S" or "O"), and GLX-0 may be either one of the "GLS-n*" or "GLO-n" delivery compounds that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and as shown in Table 3, "GLX-n" is used to indicate that the linked GalNAc-containing compound is one of the compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of which are provided elsewhere in this specification.Those skilled in the art can manufacture and use the dsRNA compounds of the present invention, the ligated delivery compound being any one of the following compounds: GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-stranded AD# assigned to the double-stranded sense and antisense sequences in the corresponding row of the table. For example, double-stranded AD#AD00842 is the double-stranded sequence of sense strand SEQ ID NO: 2642 and antisense strand SEQ ID NO: 2695. Each row in Table 3 provides a sense strand and an antisense strand and discloses the double-stranded sequences of the sense strand and antisense strand. The "sense strand SS#" in the second column of Table 3 is the identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The "antisense strand AS#" in the fifth column of Table 3 is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column. The identifier of a certain linked GalNAc-containing "GLO-n" or "GLS-n*" compound is shown as GLS-5*, GLS-15*, or GLX-0, and another "GLO-n" or "GLS-n*" compound may replace the compound shown as GLO-0, and the resulting compound should be understood to be included in embodiments of the methods and / or compositions of the present invention.

[0081] Table 3 provides the antisense and sense strand sequences of chemically modified HMGCR RNAi agents. All sequences are shown from 5' to 3'. These sequences are used in in vivo studies described elsewhere in this specification. The delivery molecules used in the in vivo studies are indicated as "GLO-n" or "GLS-n*" at the 3' or 5' end of each sense strand. [Table 4-1] Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11 Table 4-12 Table 4-13 Table 4-14

[0082] Table 5-1 [Table 5-2]

[0083] In one embodiment of the present invention, the dsRNA (also referred to herein as the “double-stranded RNA”) is a dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a double-stranded RNA comprising the sense strand sequence and antisense strand sequence in that row of the table. In addition to the double-stranded RNAs disclosed in Tables 1-3, in some embodiments, the double-stranded RNA of the present invention may include the sense and antisense sequences shown in Tables 1-3, which differ from the sequences shown in Tables 1-3 by 0, 1, 2, or 3 nucleotides. Accordingly, as a non-limiting example, in some embodiments, the antisense strand in the double-stranded body of the present invention may be SEQ ID NOs. 2670, 2671, 2672, 2673, 2674, 2675, 2676, 2677, or 2678, each having 0, 1, 2, or 3 nucleotides that differ from the nucleotides in SEQ ID NOs. 2670, 2671, 2672, 2673, 2674, 2675, 2676, 2677, or 2678, respectively.

[0084] It should be understood that the sense strand sequence and antisense strand sequence in the double-stranded DNA of the present invention can be selected independently. Accordingly, the dsRNA of the present invention may include the sense strand and antisense strand of the double-stranded DNA disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense strand and antisense strand in the dsRNA may include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense strand may include one, two, three or more nucleic acid base substitutions derived from the parent sequence. In some embodiments, the selected sequences may be longer or shorter than their parent sequences. Accordingly, the dsRNA reagents included in the present invention may, but do not need to include, the exact sequences of the paired sense strand and antisense strand disclosed as double-stranded DNA in Tables 1-3.

[0085] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the HMGCR RNA transcript, the complementary region comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprising a target ligand. In some cases, the region complementary to the HMGCR RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 3 or fewer nucleotides from one of the antisense sequences listed in Tables 1-3. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is essentially complementary to at least one target region of Sequence ID No. 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is fully complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence listed in any one of Tables 1 to 3. Some embodiments of the dsRNA agent of the present invention include a sense strand and an antisense strand disclosed as a double-stranded body in any one of Tables 1 to 3. As described herein, it should be understood that the sense strand and antisense strand in the double-stranded body of the present invention can be independently selected.

[0086] Mismatch It is known to those skilled in the art that mispairs in dsRNA, particularly in the terminal region of dsRNA, are acceptable for efficacy. Some mispairs have better resistance; for example, the G:U and A:C mispairs, which are fluctuation base pairs, have better resistance for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the HMGCR dsRNA agent may contain one or more mispairs with the HMGCR target sequence. In some embodiments, the HMGCR dsRNA agent of the present invention does not contain mispairs. In some embodiments, the HMGCR dsRNA agent of the present invention contains one or fewer mispairs. In some embodiments, the HMGCR dsRNA agent of the present invention contains two or fewer mispairs. In some embodiments, the HMGCR dsRNA agent of the present invention contains three or fewer mispairs. In some embodiments of the present invention, the antisense strand of the HMGCR dsRNA agent contains a mispair with an HMGCR target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of the HMGCR dsRNA agent contains one, two, three, four or more mispairs located at the last 5, 4, 3, 2, or 1 nucleotide of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether an HMGCR dsRNA agent containing mispairs with an HMGCR target sequence effectively inhibits HMGCR gene expression.

[0087] Complementarity As used herein, unless otherwise specified, the term “complementary” means, when used to describe a first nucleotide sequence (e.g., the sense strand of an HMGCR dsRNA agent or a target HMGCR mRNA) related to a second nucleotide sequence (e.g., the antisense strand of an HMGCR dsRNA agent or a single-stranded antisense polynucleotide), the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence under certain conditions [forming interbase-pair hydrogen bonds under mammalian physiological conditions (or in vitro-similar conditions)] and to form a double-stranded or double-helical structure. Other conditions can be applied, for example, physiologically relevant conditions that may be encountered within an organism. Those skilled in the art can determine the optimal set of conditions for testing the complementarity of the two sequences from the final application of the nucleotides to be hybridized. The complementary sequence includes a Watson-Crick base pair or a non-Watson-Crick base pair and includes a natural or modified nucleotide or nucleotide mime that reaches at least the extent to satisfy the above hybridization requirement. Sequence identity or complementarity is not related to modification.

[0088] For example, a complementary sequence in an HMGCR dsRNA described herein includes a base pairing of one or two nucleotide sequences over the full length of an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence. Such sequences may be referred to herein as “fully complementary.” In embodiments where two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should be understood herein as not being mispairs in terms of confirming complementarity. For example, an HMGCR dsRNA agent containing one oligonucleotide with a 19-nucleotide length and another oligonucleotide with a 20-nucleotide length, in which the relatively longer oligonucleotide contains a 19-nucleotide sequence that is fully complementary to the relatively shorter oligonucleotide, may be referred to herein as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The continuous sequence may contain all or part of the first or second nucleotide sequence.

[0089] As used herein, the term “basically complementary” means that in the pair of nucleic acid base sequences being hybridized, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of, but not all, of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The term "basically complementary" can be used to mean that when two sequences hybridize, they contain one or more mispaired base pairs, e.g., at least 1, 2, 3, 4, or 5 mispaired base pairs, the first sequence forms a double-stranded structure with 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) compared to the second sequence, while simultaneously retaining the ability to hybridize under conditions most relevant to its final application, such as the inhibition of HMGCR gene expression via the RISC pathway.

[0090] The term “partially complementary” can be used herein to refer to a pair of nucleic acid base sequences that are hybridized, of which at least 75%, but not all, of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. In some embodiments, “partially complementary” means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide.

[0091] The terms “complementary,” “fully complementary,” “basically complementary,” and “partially complementary” are used herein to refer to base matching between the sense and antisense strands of an HMGCR dsRNA reagent, between the antisense strand of an HMGCR dsRNA reagent and the sequence of the target HMGCR mRNA, or between a single-stranded antisense oligonucleotide and the sequence of the target HMGCR mRNA. The term “antisense strand of HMGCR dsRNA reagent” should be understood to refer to the same sequence of “HMGCR antisense polynucleotide reagent.”

[0092] As used herein, the terms “essentially the same” or “essentially identical” as used with nucleic acid sequences mean that a nucleic acid sequence has at least about 85% or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to a reference sequence. The percentage of sequence identity is determined by comparing the optimal alignment of two sequences in an alignment window. The percentage can be calculated by determining the number of positions in which the same nucleic acid bases appear in the two sequences to generate the number of matching positions, dividing the number of matching positions by the total number of positions in the alignment window, and then multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein include nucleotide sequences that are essentially the same as those disclosed herein. For example, these are shown in Tables 1-3. In some embodiments, the sequences disclosed herein are identical in all respects to, for example, the sequences disclosed in Tables 1-3 herein, or have at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0093] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing a nucleotide chain described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term “double-stranded RNA” or “dsRNA” refers to an RNAi containing an RNA molecule or molecular complex having a hybridization double-stranded region, the hybridization double-stranded region comprising two antiparallel and essentially or completely complementary nucleic acid strands, which are said to have “sense” and “antisense” directions with respect to the target HMGCR RNA. The double-stranded region may have any length that allows for the specific degradation of the desired target HMGCR RNA by the RISC pathway, but typically ranges in length from 9 to 30 base pairs, for example, 15 to 30 base pairs. Considering the double-stranded bodies between 9 and 30 base pairs, the double-stranded bodies may be of any length within that range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range thereof, such as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 This includes, but is not limited to, base pairs of 1, 18-22, 18-21, 18-20, 19-30, 19-26, 19-23, 19-22, 19-21, 19-20, 20-30, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-26, 21-25, 21-24, 21-23, or 21-22. The length of HMGCR dsRNA reagents produced in cells by treatment with Dicer and similar enzymes is typically in the range of 19-22 base pairs.One strand of the double-stranded region of the HMGCR dsDNA agent contains a sequence that is essentially complementary to the region of the target HMGCR RNA. The two strands forming the double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be formed from two or more individual RNA molecules. If the double-stranded region is formed from a single molecule, the molecule may have a double-stranded structure (referred to herein as a "hairpin ring") formed from one strand at the 3'-end of a single-stranded nucleotide chain and another strand at the corresponding 5'-end. In some embodiments of the present invention, the hairpin configuration contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. If the two essentially complementary strands of the HMGCR dsRNA agent consist of individual RNA molecules, these molecules do not need to be covalently bonded, but can be. When two strands are covalently joined in a manner other than a hairpin ring, the linking structure is called a “linker.” The term “siRNA” is also used herein to refer to the dsRNA agents described herein.

[0094] In some embodiments of the present invention, the HMGCR dsRNA reagent may contain sense and antisense sequences that do not have unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA reagent. Ends without unpaired nucleotides are called "blunt ends" and do not have nucleotide overhangs. When both ends of a dsRNA reagent are blunt ends, the dsRNA is called a "blunt-ended" dsRNA. In some embodiments of the present invention, the first end of the dsRNA reagent is blunt, in some embodiments, the second end of the dsRNA reagent is blunt, and in one embodiment of the present invention, both ends of the HMGCR dsRNA reagent are blunt.

[0095] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, there is at least one unpaired nucleotide at the end of the dsRNA strand. For example, if the 3' end of one strand of the dsRNA extends from the 5' end of the other strand, a nucleotide overhang is present, or vice versa. The dsRNA may contain at least one, two, three, four, five, six or more nucleotide overhangs. The nucleotide overhangs may contain or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. In some embodiments, the nucleotide overhangs are located on the sense strand of the dsRNA agent, the antisense strand of the dsRNA agent, or both ends of the dsRNA agent, and the nucleotides at the overhangs may be located at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides at the overhangs are substituted with phosphorothioate nucleosides.

[0096] As used herein, the terms “antisense strand” or “guide strand” refer to a strand of the HMGCR dsRNA agent containing a region that is essentially complementary to the HMGCR target sequence. As used herein, the terms “sense strand” or “passenger strand” refer to a strand of the HMGCR dsRNA agent containing a region that is essentially complementary to the region of the antisense strand of the HMGCR dsRNA agent.

[0097] qualification In some embodiments of the present invention, the RNA of the HMGCR RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in Nucleic Acid Chemistry," Beaucage, S. Let al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which are incorporated herein by reference. Modifications that may be present in certain embodiments of the HMGCR dsRNA agent of the present invention include, for example, (a) terminal modifications such as 5'-end modifications (phosphorylation, conjugate, reverse ligation, etc.) and 3'-end modifications (conjugate, DNA nucleotide, reverse ligation, etc.); (b) base modifications such as the use of stable bases, unstable bases, or bases that base-pair with an extended partner repertoire, base removal (debasing nucleotide), or base conjugate; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and (d) main chain modifications including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds that can be used in certain embodiments of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and HMGCR sense polynucleotide of the present invention include, but are not limited to, RNAs that include a modified main chain or RNAs that do not include natural nucleoside bonds. As a non-limiting example, RNA having a modified main chain may not have phosphorus atoms in the main chain. RNA that does not have a phosphorus atom in its internucleoside backbone may be called an oligonucleoside. In one embodiment of the present invention, the modified RNA has a phosphorus atom in its internucleoside backbone.

[0098] The terms “RNA molecule” or “RNA” or “ribonucleic acid molecule” should be understood to cover not only naturally expressed or discovered RNA molecules, but also RNA analogs and derivatives, including one or more ribonucleotide / ribonucleoside analogs or derivatives, as described herein or known in the art. The terms “ribonucleoside” and “ribonucleotide” are interchangeable herein. RNA molecules can be modified in their nucleic acid base structure or ribose-phosphate backbone structure, for example, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double-stranded structures. As a non-limiting example, an RNA molecule may further contain at least one modified ribonucleoside, which includes, but is not limited to, 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino nucleosides, phosphoramidates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the present invention, the RNA molecule contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at most the full length of the modified ribonucleoside of the HMGCR dsRNA agent molecule. The modifications of each of these multiple modified ribonucleosides in the RNA molecule do not need to be the same.

[0099] In some embodiments, the dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the present invention may comprise one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester bonds. As used herein, the terms “nucleotide-nucleotide bond,” “nucleoside bond,” “linking bond,” and “linker” are interchangeable and refer to binding groups between unmodified or modified nucleosides in an oligonucleotide chain and / or between unmodified or modified nucleosides and one or more target groups. In some embodiments, the bond may be independently selected from phosphodiester (PO) bonds, phosphorothioate (PS) bonds, and / or phosphorodithioate (PS2) bonds of dinucleotides at any position in a single-stranded or double-stranded oligonucleotide. As used herein, the term “independently selected” is used to refer to the selected elements, such as modified nucleotides and non-phosphodiester bonds, and means that two or more selected elements may be the same as, but do not need to be the same as, one of the selected elements.

[0100] As used herein, “nucleotide base,” “nucleotide,” or “nucleic acid base” are heterocyclic pyrimidines or purine compounds that are standard components of all nucleic acids and include adenine, guanine, cytosine, thymine, and uracil, which form nucleotides. Nucleic acid bases may be further modified to include universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases, but this is not intended to limit them. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to unmodified nucleotides, modified nucleotides, or substituted portions of alternatives. It will be recognized by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other portions without fundamentally altering the base-pairing properties of oligonucleotides containing nucleotides having such substituted portions.

[0101] In one embodiment, the modified RNA expected to be used in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and enables or mediates the specific degradation of the target RNA by the RISC pathway. In one embodiment of the present invention, the HMGCR RNA interference reagent comprises a single-stranded RNA that interacts with the HMGCR RNA target sequence to guide the cleavage of the HMGCR RNA target.

[0102] The modified RNA backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkyl phosphotryesters, methylphosphonates, and other alkylphosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thiophosphoramidates, thioalkylphosphonates, and borate phosphates (having normal 3'-5' linkages and their 2'-5' linkage analogs, as well as those with polarity reversal, where adjacent nucleoside unit pairs are linked in a 3'-5'~5'-3' or 2'-5'~5'-2' configuration). It further includes various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing ligatures are commonly practiced in this field, and such methods can be used to produce certain modified HMGCR dsRNA reagents, certain modified HMGCR antisense polynucleotides, and / or certain modified HMGCR sense polynucleotides according to the present invention.

[0103] Among these, modified RNA backchains that do not contain phosphorus atoms have backchains formed by short-chain alkyl or cycloalkyl nucleotide interbonding, mixed heteroatoms and alkyl or cycloalkyl nucleotide interbonding, or one or more short-chain heteroatoms or heterocyclyl nucleotide interbonding. These include those having morpholino bonds (partially formed from the sugar portion of a nucleoside), siloxane backchains, sulfides, sulfoxides and sulfone backchains, methylacetyl and thiomethylacetyl backchains, methylenemethylacetyl and thiomethylacetyl backchains, olefin-containing backchains, sulfamate ester backchains, methyleneimino and methylenehydrazino backchains, sulfonates and sulfonamide backchains, amide backchains, and others having a portion with mixed N, O, S and CH2 components. Methods for producing modified RNA backchains that do not contain phosphorus atoms are commonly practiced in the art, and such methods can be used to produce certain modified HMGCR dsRNA reagents, certain modified HMGCR antisense polynucleotides and / or certain modified HMGCR sense polynucleotides of the present invention.

[0104] In some embodiments of the present invention, the RNA mimetic comprises, for example, HMGCR dsRNA, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide, in which the sugar-nucleoside bonds (i.e., the backbone) of the nucleotide units are replaced with new groups. In such embodiments, the base units are maintained for hybridization with a suitable HMGCR nucleic acid target compound. Such oligomeric compounds, i.e., RNA mimetic compounds, have been shown to have excellent hybridization properties and are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleic acid bases are retained and directly or indirectly bound to the aza nitrogen atoms of the backbone amide moiety. Methods for producing RNA mimetic compounds are commonly practiced in the art, and such methods can be used to produce certain modified HMGCR dsRNA agents of the present invention.

[0105] Some embodiments of the present invention include RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as the methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2- [of which the natural phosphodiester backbone is represented by -OPO-CH2-]. Methods for producing RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are commonly practiced in the art, and such methods can be used to produce certain modified HMGCR dsRNA reagents, certain HMGCR antisense polynucleotides and / or certain HMGCR sense polynucleotides of the present invention.

[0106] Modified RNAs may contain one or more substituted sugar moieties. The HMGCR dsRNA, HMGCR antisense polynucleotide and / or HMGCR sense polynucleotide of the present invention may contain one of the following at the 2' position: OH, F, O-, S-, or N-alkyl group, O-, S-, or N-alkenyl group, O-, S-, or N-alkynyl group, or O-alkyl-O-alkyl group, of which alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C1-C 10 Alkyl alkyl group or C2-C 10 The group may be an alkenyl group or an alkynyl group. An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n It contains CH3)2, of which n and m are 1 to about 10. In other embodiments, dsRNA has C1-C at the 2' position. 10The group comprises a lower alkyl group, a substituted lower alkyl group, an alkylaryl group, an arylalkyl group, an O-alkylaryl group or an O-aralkyl group, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, a heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleavage group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an HMGCR dsRNA agent, or one of the groups for improving the pharmacokinetic properties of an HMGCR dsRNA agent, an HMGCR antisense polynucleotide and / or an HMGCR sense polynucleotide and another substituent having similar properties. In some embodiments, the modifications include a 2'-methoxyethoxy group (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Other exemplary modifications include a 2'-dimethylaminoethoxyethoxy group, also known as 2'-DMAOE, i.e., an O(CH2)2ON(CH3)2 group, and a 2'-dimethylaminoethoxyethoxy group (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2, as described in the examples below. Methods for producing such modified RNAs are commonly practiced in the art and can be used to produce certain modified HMGCR dsRNA agents of the present invention.

[0107] Other modifications include 2'-methoxy(2'-OCH3), 2'-aminopropoxy(2'-OCH2CH2CH2NH2), and 2'-fluoro(2'-F). Similar modifications may occur at other positions on the RNA of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the present invention, particularly on the 3' terminal nucleotide, or at the 3' position of the sugar in the HMGCR dsRNA, HMGCR antisense polynucleotide, or HMGCR sense polynucleotide linked from 2' to 5', and at the 5' position of the 5' terminal nucleotide. The HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide may have a cyclobutyl group moiety that replaces a sugar mimetic, such as pentofuranose sugar. Methods for producing modified RNA, such as those described, are commonly practiced in this art, and such methods can be used to produce certain modified HMGCR dsRNA reagents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides according to the present invention.

[0108] In some embodiments, the HMGCR dsRNA agent, HMGCR antisense polynucleotide and / or HMGCR sense polynucleotide may include modifications or substitutions of nucleic acid bases (usually abbreviated as “bases” in this art). As used herein, “unmodified” or “natural” nucleic acid bases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleic acid bases include other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, the 6-methyl group and other alkyl derivatives of adenine and guanine, the 2-propyl group and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine This includes 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino groups, 8-thiols, 8-thioalkyl groups, 8-hydroxyaldehydes, other 8-substituted adenines and guanines, 5-halogens, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils, cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-azaadenine, and 3-deazaguanine and 3-deazaadenine.Other nucleic acid bases that may be included in certain embodiments of the HMGCR dsRNA agent of the present invention are known in the art, see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, STand Lebleu, B., Ed., CRC Press, 1993. The nuclear base modifications and / or substitutions (e.g., those described herein) included in methods for producing dsRNA, HMGCR antisense strand polynucleotides and / or HMGCR sense strand polynucleotides are commonly practiced in the art, and such methods can be used to produce certain modified HMGCR dsRNA agents, HMGCR sense polynucleotides, and / or HMGCR antisense polynucleotides of the present invention. Teachings for the synthesis of specific modified oligonucleotides can be found in the following U.S. patents: U.S.Pat. No. 5,218,105 describes polyamine-conjugated oligonucleotides; U.S.Pat. No. 5,541,307 describes oligonucleotides with skeletal modifications; U.S.Pat. No. 5,521,302 describes a process for producing oligonucleotides with chiral phosphorus links; U.S.Pat. No. 5,539,082 describes peptide nucleic acids; U.S.Pat. No. 5,554,746 describes oligonucleotides with a trilactam skeleton. USPat. No. 5,571,902 describes the synthesis methods and materials for oligonucleotides.USPat. No. 5,578,718 describes nucleosides having alkylthio groups, which can be used as linkers to other parts attached at any position on the nucleoside. USPat. No. 5,587,361 describes oligonucleotides with phosphorothioate linkages having high chiral purity. USPat. No. 5,506,351 describes the manufacturing process of 2'-O-alkylguanosine and related compounds, including 2,6-diaminopurine compounds. USPat. No. 5,587,469 describes oligonucleotides containing N-2 substituted purines. USPat. No. 5,587,470 describes oligonucleotides containing 3-deazapurine. USPat. No. 5,608,046 describes conjugated 4'-desmethyl nucleoside analogs. USPat. No. 5,610,289 describes oligonucleotide analogs with skeletal modifications. USPat. No. 6,262,241 describes methods for synthesizing 2'-fluoro-oligonucleotides and other related matters.

[0109] Some embodiments of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the present invention include RNA modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety that includes additional crosslinks linked to the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. By adding locked nucleic acids to the HMGCR dsRNA reagent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the present invention, their stability in serum can be increased and off-target effects can be reduced (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447, Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843, Grunweller, A. et al., (2003). Methods for producing dsRNA reagents containing locked nucleic acids, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides are commonly practiced in this art, and such methods can be used to produce certain modified HMGCR dsRNA reagents of the present invention.

[0110] A certain embodiment of the HMGCR dsRNA compound, sense polynucleotide and / or antisense polynucleotide of the present invention comprises at least one modified nucleotide, of which the at least one modified nucleotide is 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, nucleotide containing a vinyl phosphonate, adenosine glycol nucleic acid ( The compounds include nucleotides containing GNA, nucleotides containing thymidine glycol nucleic acid (GNA) s-isomers, nucleotides containing 2-hydroxymethyltetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3'-phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or nucleotides containing cholesterol derivatives or terminal nucleotides linked to a dodecanoic acid bisdecanamide group, 2'-amino-modified nucleotides, phosphoramidates, or nucleotides containing non-natural bases. In some embodiments, the HMGCR dsRNA compound contains an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0111] In some embodiments of the HMGCR dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide include at least one modified nucleotide, of which the at least one modified nucleotide includes a debased nucleotide, a ribitol, a reverse nucleotide, a reverse debased nucleotide, a reverse 2'-OMe nucleotide, and a reverse 2'-deoxynucleotide. It is known to those skilled in the art that stability can be enhanced by including a debased or reverse debased nucleotide at the oligonucleotide terminus (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the HMGCR dsRNA compound includes one or more reverse debased residues (invab) at the 3'-terminus or 5'-terminus, or both the 3'-terminus and 5'-terminus. Exemplary invab residues include, but are not limited to, the following:

[0112] [ka] In some embodiments of the HMGCR dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide comprises at least one modified nucleotide, of which the at least one modified nucleotide comprises an isomannide nucleotide or an isomannide nucleotide described in the stereoisomers. Specific examples of isomannide nucleotides or stereoisomers of the isomannide nucleotide are: [ka] , [ka] , [ka] , [ka] , [ka] , [ka] , [ka] , [ka] , [ka] , [ka] , [ka] and [ka] This includes, but is not limited to, the following, where the term "Olig" independently refers to a polynucleotide portion. Exemplary isomannose residues (imann) include, but are not limited to, the following:

[0113] [ka] or [ka] This includes, but is not limited to, the following:

[0114] In one embodiment, the isomannide nucleotide may be further conjugated with one or more target groups or delivery molecules, such as the GalNAc moiety.

[0115] One embodiment of the HMGCR dsRNA compound, antisense polynucleotide of the present invention comprises at least one modified nucleotide, of which at least one modified nucleotide comprises an open-ring nucleic acid nucleotide (UNA) and / or an ethylene glycol nucleic acid nucleotide (GNA). UNA and GNA are thermally unstable chemical modifications and are known to those skilled in the art to significantly improve the off-target profile of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723.doi:10.1038 / s41467-018-02989-4; Laurens et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862-70).

[0116] Another modification that may be included in the RNA of certain embodiments of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the present invention includes chemically linking one or more ligands, moieties, or conjugates to the RNA that enhance one or more functions, respectively. These are features of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide. Non-limiting examples of features that can be enhanced are the activity, cell distribution, delivery of the HMGCR dsRNA agent, the pharmacokinetic properties of the HMGCR dsRNA agent, and the cell uptake of the HMGCR dsRNA agent. In some embodiments of the present invention, the HMGCR dsRNA agent includes one or more target groups or binding groups that are conjugated to the sense strand in certain embodiments of the HMGCR dsRNA agent of the present invention. Non-limiting examples of target groups are compounds containing N-acetyl-galactosamine (GalNAc). The terms “target group,” “targeting agent,” “conjugate,” “target compound,” “delivery molecule,” “delivery compound,” and “target ligand” are interchangeable herein. In some embodiments of the present invention, the HMGCR dsRNA agent comprises a target compound conjugated to the 5'-terminus of the sense strand. In some embodiments of the present invention, the HMGCR dsRNA agent comprises a target compound conjugated to the 3'-terminus of the sense strand. In some embodiments of the present invention, the HMGCR dsRNA agent comprises a target group containing GalNAc. In some embodiments of the present invention, the HMGCR dsRNA agent does not contain a target compound conjugated to either or both of the 3'-terminus and 5'-terminus of the sense strand. In some embodiments of the present invention, the HMGCR dsRNA agent does not contain a target compound containing GalNAc conjugated to either or both of the 5'-terminus and 3'-terminus of the sense strand.

[0117] Other targeting agents and binders are well known in this field, and for example, targeting agents and binders usable in certain embodiments of the present invention include lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-trityl mercaptan (Manoharan et al., Ann. NYAcad. Sci., 1992, 660:306-309, Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Fatty acids such as Res., 1992, 20:533-538, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118, Kabanov et al., FEBS Lett., 1990, 259:327-330, Svinarchuk et al., Biochimie, 1993, 75:49-54), dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654, Shea et al., Nucl. Acids Phospholipids such as Res., 1990, 18:3777-3783, polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.This includes, but is not limited to, those listed in Ther., 1996, 277:923-937.

[0118] Some embodiments of compositions comprising an HMGCR dsRNA agent, an HMGCR antisense polynucleotide, and / or an HMGCR sense polynucleotide may include ligands that alter the distribution, targeting, etc., of the HMGCR dsRNA agent. In some embodiments of compositions comprising the HMGCR dsRNA agent of the present invention, for example, the ligand increases affinity to selected targets (e.g., molecules, cells or cell types, compartments, e.g., cell or organ compartments, tissues, organs or body regions) compared to species in which such ligands are absent. Ligands usable in the compositions and / or methods of the present invention may be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. The ligands may further be recombinant or synthetic molecules such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-ethylene glycol) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, peptide-mimicking polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.

[0119] Ligands included in the compositions and / or methods of the present invention may include target groups, non-limiting examples of which are cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, such as antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). Target groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0120] Other examples of ligands include dyes, intercalators (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texafrin, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3- (Oleoyl)cholic acid, dimethoxytrityl chloride group or phenoxazine and peptide conjugate (e.g., Antenna peptide, Tat peptide), alkylating agent, phosphate, amino group, mercapto group, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino group, alkyl group, substituted alkyl group, radiolabeled substance, enzyme, hapten (e.g., biotin), transport / absorption enhancer (e.g., aspirin, vitamin E, folic acid), synthetic ribonuclease (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl group, HRP or AP.

[0121] The ligands included in the compositions and / or methods of the present invention may be proteins such as glycoproteins, peptides such as molecules having specific affinity for coligands, or antibodies such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, cardiomyocytes, or osteocytes). Ligands usable in embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Ligands useful in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention may be substances that can increase the uptake of HMGCR dsRNA agents into cells, for example, by disrupting the cytoskeleton of cells, for example, by disrupting microtubules, microfilaments, and / or intermediate filaments of cells. Non-exclusive examples of such drugs include taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanosine, and myoservin.

[0122] In some embodiments, ligands linked to the HMGCR dsRNA agent of the present invention are used as pharmacokinetic (PK) modifiers. Examples of PK modifiers usable in the compositions and methods of the present invention include, but are not limited to, lipophilic agents, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and aptamers that bind to serum proteins. Furthermore, since oligonucleotides containing multiple phosphorothioate bonds are known to bind to serum proteins, short oligonucleotides containing multiple phosphorothioate bonds in their main chain, such as oligonucleotides with about 5 bases, 10 bases, 15 bases, or 20 bases, can also be used as ligands in the compositions and / or methods of the present invention.

[0123] HMGCR dsRNA formulation In some embodiments of the present invention, the HMGCR dsRNA agent is in a composition. The composition of the present invention may include one or more HMGCR dsRNA agents and one or more optionally pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. As a non-limiting example of a usable targeting agent, according to some embodiments of the methods of the present invention, "HMGCR dsRNA" is a reagent that introduces and / or enters the HMGCR dsRNA reagent of the present invention into cells to be treated. The selection of the targeting agent depends on factors such as the nature of the HMGCR-related disease or condition and the cell type to be targeted. In non-limiting examples, in some embodiments of the present invention, it may be necessary to target the HMGCR dsRNA agent into hepatocytes and / or into hepatocytes. In some embodiments of the methods of the present invention, the therapeutic agent should be understood to include an HMGCR dsRNA agent having only a delivery agent without any additional adhesion elements, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, the HMGCR dsRNA agent can be administered to cells or subjects without any detectable label or targeting agent linked to the HMGCR dsRNA reagent, and can be contained in a composition that includes a delivery compound containing GalNAc and a pharmaceutically acceptable carrier.

[0124] When the HMGCR dsRNA agent of the present invention is administered together with one or more delivery agents, targeting agents, labeling agents, etc., and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will be able to recognize, select, and use appropriate reagents for use in the methods of the present invention. Labeling agents can be used in certain methods of the present invention to locate the HMGCR dsRNA agent in cells and tissues, and can be used to locate the cells, tissues, or organs of a therapeutic composition containing the HMGCR dsRNA reagent administered in the methods of the present invention. Means for linking and using labeling reagents such as enzyme labeling, dyes, and radiolabeling are well known in the art. In some embodiments of the compositions and methods of the present invention, it should be understood that the labeling agent is linked to one or both of the sense polynucleotides and antisense polynucleotides contained in the HMGCR dsRNA agent.

[0125] Delivery of HMGCR dsRNA reagent and HMGCR antisense polynucleotide reagent One embodiment of the method of the present invention involves delivering an HMGCR dsRNA agent to cells. As used herein, the term “delivery” means promoting or influencing cellular uptake or absorption. Absorption or uptake of the HMGCR dsRNA agent may occur by independent diffusion or activation of cellular processes, or by the use of a delivery agent, targeting agent, etc., that can be associated with the HMGCR dsRNA agent of the present invention. Delivery methods applicable to the method of the present invention include, but are not limited to, intracellular delivery, in which the HMGCR dsRNA agent is administered by injection to a tissue site or systemically. In some embodiments of the present invention, the HMGCR dsRNA agent is ligated to a delivery agent.

[0126] Non-limiting examples of methods usable for delivering HMGCR dsRNA reagents to cells, tissues, and / or subjects include HMGCR dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in this field for the delivery of therapeutic RNAi agents to treat various diseases and conditions, including, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, and pulmonary fibrosis. Detailed information on the study of various delivery methods can be found in publications such as Nikam, RR & KRGore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018, Springer AD & SFDowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118, Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874, and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, all of which are incorporated herein by reference.

[0127] Some embodiments of the present invention involve delivering the HMGCR dsRNA agent of the present invention to cells, tissues, and / or subjects using lipid nanoparticles (LNPs). LNPs are typically used for the in vivo delivery of HMGCR dsRNA reagents, including therapeutic HMGCR dsRNA reagents. One advantage of using LNPs or other delivery agents is that the stability of the HMGCR RNA agent is increased when the HMGCR RNA agent is delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs include cationic LNPs supported with one or more HMGCR RNAi molecules of the present invention. LNPs containing HMGCR RNAi molecules are administered to a subject, and the LNPs and the HMGCR RNAi molecules attached to them are taken up by cells via endocytosis, and their presence leads to the release of RNAi-mediated RNAi trigger molecules.

[0128] In embodiments of the present invention, another non-limiting example of a delivery agent that can be used to deliver the HMGCR dsRNA agent of the present invention to cells, tissues and / or subjects is a reagent containing GalNAc linked to the HMGCR dsRNA agent described below, and which delivers the HMGCR dsRNA agent to cells, tissues and / or subjects in the present invention. Another example of a GalNAc-containing delivery agent that can be used in certain embodiments of the methods and compositions of the present invention is disclosed in PCT application:WO2020191183A1 (the entirety of which is incorporated herein). A non-limiting example of a GalNAc target ligand that can be used in the compositions and methods of the present invention to deliver the HMGCR dsRNA agent to cells is a target ligand cluster. Examples of target ligand clusters proposed herein are called phosphodiester-linked (GLO) GalNAc ligands and phosphorothioate-linked (GLS) GalNAc ligands. In this specification, the term "GLX-n" refers to the linked GalNAc-containing compound, which is GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GL This can be used to indicate that the compound is one of the following compounds: O-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of each of these compounds are as follows, and the linkage position between the GalNAc target ligand and the RNAi agent of the present invention is the rightmost position in each of these compounds. [ka] It should be understood that any RNAi and dsRNA molecule of the present invention can attach to GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, and the structures of GLO-1 to GLO-16 and GLS-1* to GLS-16* are as follows.

[0129] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4]

[0130] In one embodiment, the isomannide nucleotide may be further conjugated to one or more GalNAc target ligands. Specific examples of isomannide nucleotides conjugated to GalNAc target ligands are: [ka] [ka] This includes, but is not limited to, the terms "olig" each independently represent a polynucleotide portion.

[0131] In some embodiments of the present invention, intracellular delivery may also be carried out by a β-glucan delivery system, for example, as described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, the entirety of which is incorporated herein by reference. Alternatively, HMGCR RNAi agents may be introduced extracellularly into cells by methods known in the art, such as electroporation and lipofection. In some embodiments of the methods of the present invention, HMGCR dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. In non-limiting examples, the HMGCR dsRNA of the present invention may be administered to a subject in a pharmaceutical composition containing an RNAi agent but without a targeting agent (e.g., a GalNAc targeting compound) to treat an HMGCR-related disease or condition in the subject, such as hyperlipidemia.

[0132] In addition to certain delivery methods described herein, RNAi delivery methods, including but not limited to those described herein and those used in the art, can be used in combination with embodiments of HMGCR RNAi agents and therapeutic methods described herein.

[0133] The HMGCR dsRNA agents of the present invention can be administered to a subject in an amount and manner that effectively reduces the level and activity of HMGCR polypeptides in cells and / or the subject. In some embodiments of the method of the present invention, one or more HMGCR dsRNA agents are administered to cells and / or the subject to treat a disease or condition associated with HMGCR expression and activity. In some embodiments, the method of the present invention includes administering one or more HMGCR dsRNA agents to a subject requiring such treatment in order to alleviate a disease or condition associated with HMGCR expression in the subject. The HMGCR dsRNA agents or HMGCR antisense polynucleotide agents of the present invention can be administered to reduce HMGCR expression and / or activity in one or more of the following: in vitro, ex vivo, and in vivo cells.

[0134] In some embodiments of the present invention, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents are delivered (e.g., introduced) to cells to reduce the level of HMGCR polypeptides in the cells and thereby reduce their activity. Targeting agents and methods can be used to help deliver HMGCR dsRNA agents or HMGCR antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions and / or intracellular subcellular regions in a subject. HMGCR dsRNA agents can be administered alone in some methods of the present invention or in combination with one or more other HMGCR dsRNA agents. In some embodiments, two, three, four or more independently selected HMGCR dsRNA agents are administered to the subject.

[0135] In one embodiment of the present invention, an HMGCR dsRNA agent is administered to a subject in combination with one or more other therapeutic schemes for treating an HMGCR-related disease or condition. Non-limiting examples of other therapeutic schemes include administration of one or more HMGCR antisense polynucleotides of the present invention, administration of non-HMGCR dsRNA therapeutic agents, and behavioral changes. Additional therapeutic schemes may be administered at one or more time points before, during, and after administration of the HMGCR dsRNA agent of the present invention. As used herein, “time zero” should be understood to be the time when the subject is administered the HMGCR dsRNA agent of the present invention, such as within 5 minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero. Non-HMGCR dsRNA therapeutic agents include, but are not limited to, HMG-CoA reductase inhibitors (e.g., statins), fibrates, bile acid chelators, nicotinic acid, antiplatelet agents, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists (e.g., losartan potassium, e.g., Merck & Co.'s Cozaar®), acyl coenzyme A cholesterol acetyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesterol ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol regulators, bile acid regulators, peroxisome proliferation-activating receptor (PPAR) agonists, gene-based therapies, complex vascular protective agents (e.g., AGT 1067 by Atherogenics), glycoprotein IIb / IIIa inhibitors, aspirin or aspirin-like compounds, and IB AT inhibitors (e.g., S-8921, by Shionogi), squalene synthase inhibitors, or monocyte chemotactic protein (MCP)-I inhibitors, or any combination of the above, of which HMG-CoA reductase inhibitors include atorvastatin (Pfizer's Lipitor® / Tahor / Sortis / Torvast / Cardyl), pravastatin (Bristol-Myers Squibb's Pravachol, Sankyo's)Mevalotin / Sanaprav), simvastatin (Merck's Zocor® / Sinvacor, Boehringer Ingelheim's Denan, Banyu's Lipovas), lovastatin (Merck's Mevacor / Mevinacor, Bexal's Lovastatin, Sepa, Schwarzpharma's Liposcler), fluvastatin (Novartis' Lescol® / Locol / Lochol, Fujisawa's Cranoc, Solvay's Digaril), cerivastatin (Bayer's Lipobay / GlaxoSmithKline's Baycol), rosuvastatin (AstraZeneca's Crestor®), and pitavastatin (itavastatin / risivastatin) (Nissan Chemical, Kowa This includes, but is not limited to, Kogyo, Sankyo, and Novartis, and among them, fibrate drugs include bezafibrate (e.g., Roche's Befizal® / Cedur® / Bezalip®, Kissei's Bezatol), clofibrate (e.g., Wyeth's Atromid-S®), fenofibrate (e.g., Founder's Lipidil / Lipantil, Abbott's Tricor®, Takeda's Lipantil, generic drugs), gemfibrozil (e.g., Pfizer's Lopid / Lipur), and ciprofibrate (Sanofi-Synthelabo's Modalim®), but is not limited to these, and among them, bile acid chelators include cholestyramine (Bristol-Myers Squibb's Questran® and Questran Light). (商標)), including but not limited to colestidol (e.g., Colestid from Pharmacia) and coleseveram (WelChol® from Genzyme / Sankyo), among which nicotinic acid therapy includes but not limited to immediate-release formulations such as Aventis' Nicobid, Upsher-Smith's Niacor, Aventis' Nicolar, and Sanwakagaku's Perycit, among which sustained-release nicotinic acid formulations include, for example, Kos Pharmaceuticals' Niaspan and Upsher-Smith's SIo-nicotinic acid, among which antiplatelet agents include aspirin (e.g., Bayer's aspirin) and clopidogrel (Sanofi-Synthelabo / Bristol-Myers Squibb's This includes, but is not limited to, Plavix and ticlopidine (e.g., Ticlid from Sanofi-Synthelabo and Panaldine from Daiichi), among which aspirin-like compounds include, but is not limited to, Asacard (sustained-release aspirin, by Pharmacia) and pamicogrel (Kanebo / Angelini Ricerche / CEPA), among which angiotensin-converting enzyme inhibitors include, but is not limited to, ramipril (e.g., Altace from Aventis) and enalapril (e.g., Vasotec from Merck & Co.), among which acyl coenzyme A cholesterol acetyltransferase (ACAT) inhibitors include avasimibe (Pfizer) and eflucimibe (BioMsrieux Pierre Fabre / Eli). This includes, but is not limited to, Lilly, CS-505 (Sankyo and Kyoto) and SMP-797 (Sumito), among which cholesterol absorption inhibitors include, but is not limited to, ezetimibe (Merck / Schering-Plough Pharmaceuticals Zetia®) and Pamaqueside (Pfizer), among which CETP inhibitors include Torcetrapib (CP-529414, also known as Pfizer) and JTT-705 (JapanThis includes, but is not limited to, Tobacco, and CETi-1 (AvantImmunotherapeutics), among which microsomal triglyceride transfer protein (MTTP) inhibitors include, but are not limited to, Impritapide (Bayer), R-103757 (Janssen), and CP-346086 (Pfizer), among which cholesterol regulators include, but are not limited to, NO-1886 (Otsuka / TAP Pharmaceutical), CT 1027 (Pfizer), and WAY-135433 (Wyeth-Ayerst), among which bile acid regulators include HBS-107 (Hisamitsu) / Banyu), Btg-511 (British Technology This includes, but is not limited to, BARI-1453 (Aventis), S-8921 (Shionogi), SD-5613 (Pfizer), and AZD-7806 (AstraZeneca), among which peroxisome proliferation-activating receptor (PPAR) agonists include tesaglitasal (AZ-242) (AstraZeneca), netoglitazone (MCC-555) (Mitsubishi / Johnson & Johnson), GW-409544 (Ligand Pharmaceuticals / GlaxoSmithKline), GW-501516 (Ligand Pharmaceuticals / GlaxoSmithKline), LY-929 (Ligand Pharmaceuticals and Eli Lilly), LY-465608 (Ligand Pharmaceuticals and Eli Lilly), and LY-518674 (Ligand Pharmaceuticals and Eli Li Lilly). This includes, but is not limited to, Lilly, and MK-767 (Merck and Kyorin), among which gene-based therapies include AdGWEGF 121.10 (GenVec), ApoAl (UCB Pharma / Groupe Fournier), and EG-004 (Trinam) (ArkTherapeutics) and ATP-binding cassette transporter Al(ABCA1) (CV therapeutic agents / Incyte, Aventis, Xenon) are included, but are not limited to these. Among them, glycoprotein IIb / IIIa inhibitors include, but are not limited to these, Roxifiban (DMP754, also known as Bristol-Myers Squibb), Gantofibane (Merck KGaA / Yamanouchi), and Cromafiban (Millennium Pharmaceuticals). Among them, squalene synthase inhibitors include, but are not limited to these, BMS-1884941 (Bristol-Myers Squibb), CP-210172 (Pfizer), CP-295697 (Pfizer), CP-294838 (Pfizer), and TAK-475 (Takeda). Among them, MCP-1 inhibitors include RS-504393 (Roche This includes, but is not limited to, biosciences, of which anti-atherosclerotic agents include, but is not limited to, BO-653 (Chugai Pharmaceuticals), and of which nicotinic acid derivatives include, but is not limited to, Nyclin (Yamanouchi Pharaiacuticals). Exemplary combination therapies suitable for administration with dsRNAs targeting HMGCR include, but are not limited to, advicor (nicotinic acid / lovastatin by Kos Pharmaceuticals), amlodipine / atorvastatin (Pfizer), and ezetimibe / simvastatin (e.g., Vytorin® 10 / 10, 10 / 20, 10 / 40, and 10 / 80 tablets, manufactured by Merck / Schering-Plough Pharmaceuticals). Non-limiting examples of behavioral changes include dietary plans, consultations, and exercise plans. These and other therapeutic agents and behavioral alterations are known in the field and have been used to treat HMGCR-related diseases or conditions in subjects, and can be administered to subjects in combination with one or more HMGCR dsRNA agents of the present invention to treat HMGCR-related diseases or conditions. The HMGCR dsRNA of the present invention is administered to cells or subjects to treat HMGCR-related diseases or conditions.dsRNA agents can increase the efficacy of one or more other therapeutic agents or active ingredients by acting synergistically with one or more other therapeutic agents or active ingredients, and / or increase the efficacy of treating HMGCR-related diseases or conditions with HMGCR dsRNA reagents.

[0136] The therapeutic method of the present invention, comprising the administration of an HMGCR dsRNA agent, can be used before the onset of an HMGCR-related disease or condition and / or during the presence of an HMGCR-related disease or condition, including the early, middle, and late stages of the disease or condition, and all time before and after any of these stages. The method of the present invention can also treat subjects who have previously been treated with one or more other therapeutic agents and / or therapeutic active ingredients for an HMGCR-related disease or condition, but which have not been successful in treating the subject's HMGCR-related disease or condition, achieved minimal success, and / or have become unsuccessful again.

[0137] dsRNA encoded by a vector In one embodiment of the present invention, an HMGCR dsRNA agent can be delivered to cells using a vector. The transcription units of the HMGCR dsRNA reagent may be contained in a DNA or RNA vector. The manufacture and use of such vectors encoding transgenes for delivering sequences to cells and / or subjects is well known in the art. The vector can be used in the method of the present invention, which induces transient expression of HMGCR dsRNA for, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or longer, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or longer. The length of transient expression can be determined by a conventional method based on elements, which are, for example, a selected specific vector construct and target cells and / or tissues, but are not limited to these. Such transgenes can be introduced as a linear construct, a circular plasmid or a viral vector, and may be integrated or unintegrated vectors. Transgenes can also be constructed to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0138] One or more single strands of the HMGCR dsRNA agent can be transcribed from a promoter in an expression vector. For example, when expressing two individual strands to produce dsRNA, two individual expression vectors can be co-introduced into cells by means such as transfection or infection. In one embodiment, each individual strand of the HMGCR dsRNA agent of the present invention can be transcribed by a promoter contained in the same expression vector. In one embodiment of the present invention, the HMGCR dsRNA agent is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence such that the HMGCR dsRNA agent has a stem-loop structure.

[0139] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. Expression vectors usable in the embodiments of the present invention may be compatible with eukaryotic cells. Eukaryotic cell expression vectors are commonly used in this field and are available from many commercial sources. Delivery of the HMGCR dsRNA expression vector may be systemic, for example, by intravenous or intramuscular administration to target cells extruded from the subject and then reintroduced into the subject's body, or by any other method that enables introduction into desired target cells.

[0140] Viral vector systems that may be included in embodiments of the method of the present invention include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors including, but not limited to, lentivirus vectors, Moloney's mouse leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV 40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors including, for example, orthopox such as vaccinia virus vectors, or avianpox such as canarypox or avianpox, and (j) helper-dependent or enteric free adenoviruses. Constructs used for recombinant expression of HMGCR dsRNA agents may include regulatory elements such as promoters and enhancers, which can be selected to provide constitutive or regulatory / inducible expression. The use of viral vector systems, promoters, and enhancers is common in the art and can be used in combination with the methods and compositions described herein.

[0141] One embodiment of the present invention involves delivering an HMGCR dsRNA reagent to cells using a viral vector. Many adenovirus-based delivery systems are commonly used in this field for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscles. Non-limiting examples of viral vectors usable in the methods of the present invention include AAV vectors, poxviruses such as vaccinia virus, modified Ankara virus (MVA), poxviruses such as NYVAC, and avianpox such as fowlpox or canarypox.

[0142] One embodiment of the present invention includes a method for delivering an HMGCR dsRNA reagent to cells using a vector, wherein such a vector may be located in a pharmaceutically acceptable carrier, and the carrier may, but is not required to, include a sustained-release matrix in which the gene delivery vector is embedded. In some embodiments, the vector for delivering HMGCR dsRNA can be produced by recombinant cells, and the pharmaceutical composition of the present invention may include one or more types of cells that produce the HMGCR dsRNA delivery system.

[0143] Pharmaceutical composition containing HMGCR dsRNA or ssRNA agent One embodiment of the present invention involves the use of a pharmaceutical composition containing an HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the HMGCR dsRNA agent or the HMGCR antisense polynucleotide agent can be used in the method of the present invention to reduce HMGCR gene expression and HMGCR activity in cells, and can be used to treat HMGCR-related diseases or conditions. Such pharmaceutical compositions can be prepared by delivery methods. Non-limiting examples of formulations for delivery methods include compositions prepared for subcutaneous delivery, compositions prepared for systemic administration by parenteral delivery, compositions prepared for intravenous (IV) delivery, compositions prepared for intrathecal delivery, and compositions prepared for direct delivery into the brain. Preparation of pharmaceutical compositions for administering the present invention to deliver HMGCR dsRNA agents or HMGCR antisense polynucleotide agents to cells can be carried out by one or more methods, including, for example, surface (e.g., by transdermal patch), lung, by inhalation or blowing of powder or aerosol agents, by spraying, intra-airway, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, subcutaneous administration such as by implantation devices, or intracranial, intrathecal or intraventricular administration such as intraparenchymal. HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can also be delivered directly to target tissues, such as by direct delivery to the liver or direct delivery to the kidneys. The "delivery of HMGCR dsRNA reagent" or "delivery of HMGCR antisense polynucleotide reagent" to cells should be understood to cover the direct delivery of the HMGCR dsRNA reagent or the HMGCR antisense polynucleotide reagent, respectively, and the expression of the HMGCR dsRNA reagent in cells from a coding vector delivered into the cell, or the appearance of the HMGCR dsRNA or HMGCR antisense polynucleotide reagent in cells by any appropriate method. The manufacture and use of the formulations, as well as the means for delivering the inhibitory RNA, are well known and commonly used in this art.

[0144] As used herein, “pharmaceutical composition” comprises a pharmacokinetically effective amount of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol and combinations thereof. The term explicitly excludes cell culture media. For orally administered drugs, the pharmaceutically acceptable carrier includes, but is not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid or talc. If necessary, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The drugs contained in the drug formulation are further described below.

[0145] As used herein, terms such as “pharmacologically effective dose,” “therapeutic effective dose,” and “effective dose” refer to the amount of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention that produces a desired pharmacological, therapeutic, or prophylactic outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective dose of the drug for treating the disease or condition is the amount required to reduce that parameter by at least 10%. For example, a therapeutically effective dose of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can reduce HMGCR polypeptide levels by at least 10%.

[0146] Effective amount In some embodiments, the method of the present invention involves contacting cells with an effective amount of HMGCR dsRNA or HMGCR antisense polynucleotide to reduce HMGCR gene expression in the cells being contacted. One embodiment of the method of the present invention involves administering an effective amount of HMGCR dsRNA or HMGCR antisense polynucleotide to a subject in order to reduce HMGCR gene expression in the subject and to treat an HMGCR-related disease or condition in the subject. The “effective amount” for reducing HMGCR expression and / or treating an HMGCR-related disease or condition is the amount necessary or sufficient to achieve the desired biological effect. For example, the effective amount of HMGCR dsRNA or HMGCR antisense polynucleotide to treat an HMGCR-related disease or condition may be the amount necessary to (i) alleviate or halt the progression of the disease or condition, or (ii) reverse, reduce or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, the effective dose is the amount of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent that, when administered to a subject requiring treatment for an HMGCR-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. According to some aspects of the present invention, the effective dose is the amount of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention that, when combined with or co-administered with another therapeutic treatment for an HMGCR-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. In some embodiments of the present invention, the biological effect of treating a subject with the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention may be improvement and / or absolute elimination of symptoms caused by the HMGCR-related disease or condition. In some embodiments of the present invention, the biological effect is the complete elimination of the HMGCR-related disease or condition, as demonstrated, for example, by a diagnostic test showing that the subject does not have the HMGCR-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in HMGCR levels in the liver of a subject after administration of the agent of the present invention.Other methods known in the art for evaluating the state of HMGCR-related diseases or conditions can be used to determine the effect of the agent and / or method of the present invention on HMGCR-related diseases or conditions.

[0147] Typically, clinical trials determine the effective dose of an HMGCR dsRNA reagent or HMGCR antisense polynucleotide reagent that reduces the activity of HMGCR polypeptide to a level that treats HMGCR-related diseases or conditions. Such clinical trials are blinded studies that establish effective doses for the test population and the control population. In some embodiments, the effective dose is the amount that produces the desired response, for example, the amount that reduces HMGCR-related diseases or conditions in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, the effective dose of an HMGCR dsRNA reagent or HMGCR antisense polynucleotide reagent for treating HMGCR-related diseases or conditions that can be treated by reducing the activity of HMGCR polypeptide may be an amount that, when administered, reduces the amount of HMGCR polypeptide activity in the subject to a level lower than that present in cells, tissues, and / or the subject when the HMGCR dsRNA reagent or HMGCR antisense polynucleotide agent is not administered. In one embodiment of the present invention, the level of HMGCR polypeptide activity and / or HMGCR gene expression present in cells, tissues, and / or subjects that have not been contacted with or administered the HMGCR dsRNA reagent or HMGCR antisense polynucleotide agent of the present invention is referred to as the “control” level. In some embodiments of the method of the present invention, the control level of a subject is the pre-treatment level of the subject, in other words, the level in the subject before administration of the HMGCR reagent may be the control level of the subject and is used to compare with the level of HMGCR polypeptide activity and / or HMGCR gene expression after administration of siRNA to the subject. When treating an HMGCR-related disease or condition, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in the cells, tissues, and / or subject. The reduction or elimination may be temporary or permanent. It should be understood that the state of an HMGCR-related disease or condition can be monitored using methods such as HMGCR polypeptide activity, determination of HMGCR gene expression, assessment of symptoms, and clinical trials.In some embodiments of the present invention, the desired response to the treatment of HMGCR-related diseases or conditions is the delay of the onset of the disease or condition, or even the prevention of the onset of the disease or condition.

[0148] The effective amount of a compound that reduces HMGCR polypeptide activity may also be determined by evaluating the physiological effects on cells or subjects upon administration of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent, for example, the reduction of HMGCR-related disease or symptoms after administration. Measurements and / or monitoring of symptoms in subjects can be used to determine the efficacy of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention that can be administered to the drug compound of the present invention, and to determine whether or not there is a response to treatment. A non-limiting example is one or more tests of serum cholesterol or triglyceride levels known in the art. Another non-limiting example is one or more liver function tests known in the art, which can be used to determine the state of HMGCR-related lipid imbalance in subjects before and after treatment with the HMGCR dsRNA agent of the present invention.

[0149] One embodiment of the present invention includes a method for determining the efficacy of a dsRNA agent or HMGCR antisense polynucleotide agent of the present invention administered to a subject, and for treating an HMGCR-related disease or disorder by evaluating and / or monitoring one or more "physiological features" of the HMGCR-related disease or disorder in the subject. Non-limiting examples of physiological features of an HMGCR-related disease or disorder include HMGCR mRNA levels, HMGCR protein levels, or cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum. Standard methods for determining such physiological features are known in the art and include, but are not limited to, blood tests, imaging studies, and health checkups.

[0150] It should be understood that the amount of HMGCR dsRNA agent or HMGCR antisense polynucleotide agent administered to a subject can be modified, at least in part, based on such determination of the disease and / or pathological condition and / or physiological characteristics established for the subject. The therapeutic dose can be altered, for example, by increasing or decreasing the amount of HMGCR-dsRNA agent or HMGCR antisense polynucleotide agent, by changing the composition in which the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent is administered, by changing the route of administration, or by changing the time of administration. The effective dose of HMGCR dsRNA agent or HMGCR antisense polynucleotide agent varies depending on factors such as the specific disease being treated, the age and physical condition of the subject being treated, the severity of the disease, the duration of treatment, the nature of concurrent treatment (if any), the specific route of administration, and other factors within the scope of the healthcare professional's knowledge and expertise. For example, the effective dose may depend on the desired HMGCR polypeptide activity level and / or HMGCR gene expression level to effectively treat HMGCR-related disease or pathological condition. Those skilled in the art can empirically determine an effective amount of a particular HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention for use in the methods of the present invention without performing excessive experiments. In accordance with the teachings provided herein, an effective prophylactic or therapeutic treatment can be planned to effectively treat a particular subject by selecting from the various HMGCR dsRNA agents or HMGCR antisense polynucleotide agents of the present invention and making trade-offs of factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred administration method. As used in embodiments of the present invention, the effective amount of the HMGCR dsRNA reagent or HMGCR antisense polynucleotide reagent of the present invention may be an amount that produces a desired biological effect on cells when in contact with them.

[0151] It should be recognized that HMGCR gene silencing can be performed constitutively or by genomic engineering in any cell expressing HMGCR and can be confirmed by any appropriate measurement. In some embodiments of the present invention, HMGCR gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% by administration of the HMGCR dsRNA reagent of the present invention. In some embodiments of the present invention, HMGCR gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100% by administration of the HMGCR dsRNA reagent of the present invention.

[0152] Dosage HMGCR dsRNA agents and HMGCR antisense polynucleotide agents are delivered in a pharmaceutical composition at a dose sufficient to inhibit HMGCR gene expression. In one embodiment of the present invention, the dose of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent is 0.01 to 200.0 mg / kg body weight of the recipient per day, and typically includes both extreme values, such as 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight per day. For example, HMGCR dsRNA drugs or HMGCR antisense polynucleotide drugs are available in doses of approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, and 1.8 mg / kg per unit dose. g, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2 .9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9 mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6 mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / k g, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 2 It can be administered in doses of 1 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, and 49 mg / kg to 50 mg / kg of body weight.

[0153] When determining the delivery dose and schedule of the HMGCR dsRNA agent of the present invention, various factors can be considered. The absolute amount of HMGCR dsRNA agent or HMGCR antisense polynucleotide agent delivered depends on several factors, including concurrent therapy, dose quantity, and parameters of the individual subject, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved by conventional experiments alone. In some embodiments, the maximum dose, i.e., the safest dose based on reasonable medical judgment, can be used.

[0154] In some embodiments, the method of the present invention may involve administering to a subject one, two, three, four, five, six, seven, eight, nine, ten or more doses of an HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent. In some cases, the drug compound (e.g., including an HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent) can be administered to the subject at least daily, every other day, weekly, bi-weekly, monthly, etc. The dose can be administered once or multiple times a day, for example, two, three, four, five or more times within a single 24-hour period. The pharmaceutical composition of the present invention can be administered once daily, or the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be administered in two, three or more subdoses at appropriate intervals throughout the day, or even by continuous infusion or delivery of a sustained-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention is administered to a subject once or more times a day, once or more times a week, once or more times a month, or once or more times a year.

[0155] The methods of the present invention, in some embodiments, include the administration of a drug compound alone, in combination with one or more other HMGCR dsRNA agents or HMGCR antisense polynucleotide agents, and / or in combination with other drug therapies or therapeutic activities or schemes administered to subjects suffering from HMGCR-related diseases or conditions. The drug compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may be sterile and contain a certain amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent that reduces the activity of the HMGCR polypeptide to a level sufficient to produce a desired reaction in appropriate weight or volume units. The dose of the pharmaceutical composition containing the HMGCR dsRNA reagent or HMGCR antisense polynucleotide agent administered to a subject to reduce HMGCR protein activity can be selected according to different parameters, in particular, the method of administration used and the condition of the subject. Other factors include the desired treatment time. If the subject's response to the initial dose is insufficient, a higher dose can be used (or the dose can be effectively increased by a different, more localized delivery route) within the patient's tolerance range.

[0156] treatment As used herein, “HMGCR-related disorders,” “HMGCR-related disorders and conditions,” and “disorders and conditions caused and / or regulated by HMGCR,” and “HMGCR-related conditions” include disorders, conditions, or medical conditions that benefit from reduced HMGCR gene expression, replication, or protein activity. Exemplary HMGCR-related disorders include acquired or hereditary “lipid metabolic disorders,” including any conditions associated with or caused by lipid metabolic disorders. For example, the term includes any condition, disorder, or medical condition characterized by an abnormally elevated metabolic level of any or all lipids and / or lipoproteins in the blood, or conditions that can cause an abnormally elevated level of any or all lipids and / or lipoproteins in the blood, such as hyperlipidemia and other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, and pathological conditions associated with these disorders, such as congestive heart disease (CHD) and atherosclerosis. Exemplary conditions of lipid metabolism include atherosclerosis, dyslipidemia, hypertriglyceridemia (including drug-induced hypertriglyceridemia, diuretic-induced hypertriglyceridemia, alcohol-induced hypertriglyceridemia, β-adrenergic blocker-induced hypertriglyceridemia, estrogen-induced hypertriglyceridemia, glucocorticoid-induced hypertriglyceridemia, retinoid-induced hypertriglyceridemia, cimetidine-induced hypertriglyceridemia, and familial hypertriglyceridemia), hypertriglyceridemia associated with acute pancreatitis, chylomicron syndrome, and familial chylomicron syndrome. This includes, but is not limited to, rhinosinemia, Apo-E deficiency or resistance, LPL deficiency or decreased activity, hyperlipidemia (including familial combined hyperlipidemia), familial partial lipodystrophy type 1 (FPLD1), hypercholesterolemia, mixed hyperlipidemia (or familial mixed hyperlipoproteinemia), gout associated with hypercholesterolemia, xanthomatous (subcutaneous cholesterol deposits), hyperlipidemia with heterogeneous LPL deficiency, and high LDL, hyperlipidemia with heterogeneous LPL deficiency, and induced or acquired conditions, such as disease-induced or acquired conditions. As used herein, the term “serum lipids” refers to any major lipid present in the blood.Serum lipids can be present in the blood in free form or as part of protein complexes such as lipoprotein complexes. Non-limiting examples of serum lipids include triglycerides, cholesterol, e.g., total cholesterol, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), very low-density lipoprotein cholesterol (VLDL-C), and intermediate-density lipoprotein cholesterol (IDL-C). In some embodiments, a lipid metabolic disorder is hyperlipidemia. As used herein, the term “hyperlipidemia” refers to any disorder, disease or condition characterized by an abnormally elevated level of any or all lipids (e.g., cholesterol and triglycerides, and / or lipoproteins) in the blood, or a disorder that may cause an abnormally elevated level of any or all lipids and / or lipoproteins in the blood. In one embodiment, hyperlipidemia is hypertriglyceridemia. As used herein, the term “hypertriglyceridemia” refers to a condition characterized by elevated triglyceride levels, which are typically caused or exacerbated by uncontrolled hyperlipidemia, obesity, and sedentary lifestyle. This is a risk factor for coronary artery disease. Hypertriglyceridemia is usually asymptomatic until triglycerides exceed 1000–2000 mg / dL. Signs and symptoms may include pain in the upper mid-abdomen, chest, or back, nausea, vomiting, dyspnea, xanthomas, corneal arches, and / or eyelid xanthomas. In some embodiments, hyperlipidemia is hypercholesterolemia. As used herein, the term “hypercholesterolemia” refers to a form of hyperlipidemia (elevated blood lipid levels) in which high levels of cholesterol, e.g., total cholesterol of at least about 240 mg / dL, are present in the subject’s serum. In other embodiments, hyperlipidemia is mixed hyperlipidemia. As used herein, the term “mixed hyperlipidemia,” also known as type 5 hyperlipidemia, refers to a form of hyperlipidemia in which elevated VLDL and chylomicron levels are found in the plasma of the subject’s serum, e.g., total cholesterol of at least approximately 240 mg / dL. Cardiovascular diseases associated with lipid metabolism disorders are also considered to be “lipid metabolism disorders” as defined herein.These conditions may include coronary artery disease (also known as ischemic heart disease), atherosclerosis, inflammation and restenosis associated with coronary artery disease, peripheral vascular disease, and stroke. Conditions related to body weight are also considered “lipid metabolism disorders” as defined herein. Such conditions may include obesity, metabolic syndromes, independent components of metabolic syndromes (e.g., central obesity, FBG / prehyperlipidemia / hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, and hypertension), hypothyroidism, uremia, and other conditions related to weight gain (including rapid weight gain), weight loss, maintenance of weight loss, or the risk of weight rebound after weight loss. Blood glucose disorders are also considered “lipid metabolism disorders” as defined herein. Such conditions may include polycystic ovary syndrome associated with hyperlipidemia, hypertension, and insulin resistance. Other exemplary conditions of lipid metabolism may further include kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disease, and Addison's disease.

[0157] In one embodiment of the present invention, a subject may be administered the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention at one or more time points before or after the diagnosis of an HMGCR-related disease or condition. In some embodiments of the present invention, a subject has or is at risk of developing an HMGCR-related disease or condition. A subject at risk of developing an HMGCR-related disease or condition is a subject whose likelihood of developing an HMGCR-related disease or condition is increased compared to a control risk of developing an HMGCR-related disease or condition. In some embodiments of the present invention, the risk level is statistically significant compared to the control level of risk. Subjects at risk may include, for example, subjects with a pre-existing disease and / or genetic abnormality that makes them more susceptible to HMGCR-related disease or condition than a control subject without a history of disease or genetic abnormality, subjects with a family and / or personal history of HMGCR-related disease or condition, and subjects who have previously received or will receive treatment for an HMGCR-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to HMGCR-related disease or condition may be diseases or genetic abnormalities that were previously established to be associated with a higher likelihood of having HMGCR-related disease or condition while they were present.

[0158] It should be understood that an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered to an individual subject based on the subject's medical condition. For example, the healthcare provider to the subject may assess the HMGCR level measured in a sample obtained from the subject and determine that it is necessary to reduce the subject's HMGCR level by administering the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention. In such an example, the HMGCR level may be considered a physiological characteristic of an HMGCR-related condition, even if the subject has not been diagnosed with an HMGCR-related condition, such as one of the conditions disclosed herein. The healthcare provider may monitor changes in the subject's HMGCR level as a criterion for measuring the effectiveness of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention administered. In a non-limiting example, a biological sample, such as a blood or serum sample, may be obtained from the subject, and the subject's HMGCR level may be measured in the sample. An HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent is administered to a subject, and a blood sample is obtained from the subject after administration. The HMGCR level is measured using this sample, and the result is compared to the result measured using a sample taken before administration to the subject. A reduction in HMGCR levels in the sample taken after administration to the subject, compared to the pre-administration level, indicates the effectiveness of the administered HMGCR dsRNA agent or HMGCR antisense polynucleotide agent in reducing lipid levels in the subject.

[0159] One embodiment of the method of the present invention includes a modulated treatment, which involves administering the subject a dsRNA agent or HMGCR antisense polynucleotide agent of the present invention, at least in part on an assessment of changes in one or more physiological characteristics of an HMGCR-related disease or condition caused by the treatment in the subject. For example, in some embodiments of the present invention, it can be used to determine the effect of the administered dsRNA agent or HMGCR antisense polynucleotide agent of the present invention and to assist in adjusting the amount of the dsRNA agent or HMGCR antisense polynucleotide agent of the present invention administered to the subject later. In a non-limiting example, the subject is administered a dsRNA agent or HMGCR antisense polynucleotide agent of the present invention, the subject's HMGCR level is measured after administration, and at least in part on the measured level, it is determined that a larger amount of the dsRNA agent or HMGCR antisense polynucleotide agent needs to be administered to improve the physiological effect of the administered reagent, for example, to reduce or further reduce the subject's HMGCR level. In further, non-limiting examples, it is desirable to administer the dsRNA agent or HMGCR antisense polynucleotide agent of the present invention to a subject, measure the subject's HMGCR level after administration, and administer a relatively low amount of the dsRNA agent or HMGCR antisense polynucleotide reagent to the subject, at least in part, based on the measured level.

[0160] Accordingly, some embodiments of the present invention include evaluating changes in one or more physiological characteristics caused by the subject's prior treatment in order to adjust the amount of the dsRNA reagent or HMGCR antisense polynucleotide agent of the present invention administered to the subject later. Some embodiments of the method of the present invention include measuring the physiological characteristics of an HMGCR-related disease or condition one, two, three, four, five, six or more times; evaluating and / or monitoring the effectiveness of the HMGCR dsRNA reagent or HMGCR antisense polynucleotide agent of the present invention administered; and optionally using the measured results to adjust one or more of the dose, administration scheme and / or administration frequency of the dsRNA agent or HMGCR antisense polynucleotide agent of the present invention in order to treat an HMGCR-related disease or condition in the subject. In some embodiments of the method of the present invention, the desired result of administering an effective amount of the dsRNA agent or HMGCR antisense polynucleotide agent of the present invention to a subject is a reduction in the subject's HMGCR mRNA level, HMGCR protein level in the subject, or cholesterol ester (CE) level, triglyceride level, cholesterol level (e.g., high-density lipoprotein cholesterol (HDL-C) level, medium-density lipoprotein cholesterol (IDL-C) level, low-density lipoprotein cholesterol (LDL-C) level, very low-density lipoprotein cholesterol (VLDL-C) level), and lipid levels in the blood or serum, compared to the previously established level or control level for the subject.

[0161] As used herein, the terms “treatment,” “therapeutic,” or “treated” may, when used in reference to HMGCR-related disease or condition, refer to prophylactic treatment, reducing the likelihood that a subject will develop HMGCR-related disease or condition, and may also refer to treatment performed after a subject has developed HMGCR-related disease or condition to eliminate or reduce the level of HMGCR-related disease or condition, to prevent the HMGCR-related disease or condition from becoming more severe, and / or to delay the progression of HMGCR-related disease or condition in a subject compared to a subject in which no therapy exists to reduce HMGCR polypeptide activity in the subject.

[0162] Some embodiments of the reagents, compositions, and methods of the present invention can be used to inhibit HMGCR gene expression. As used herein, the terms “inhibition,” “silencing,” “reduction,” “downregulation,” and “knockdown” with respect to HMGCR gene expression mean that, when cells, cell populations, tissues, organs, or subjects come into contact with (e.g., are treated with) the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention, the levels of RNA transcribed from the gene, the levels of HMGCR activity expressed, and the levels of HMGCR polypeptides, proteins, or protein subunits translated from mRNA in cells, cell populations, tissues, organs, or subjects from which the HMGCR gene is transcribed are reduced, compared to one or more of the following indicators: namely, the RNA control level transcribed from the HMGCR gene, the HMGCR activity level expressed, or the HMGCR level translated from mRNA, respectively. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been in contact with (e.g., treated with) the HMGCR dsRNA agent or the HMGCR antisense polynucleotide agent.

[0163] Method of administration Multiple routes of administration of HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be used in the methods of the present invention. The specific mode of delivery selected depends at least in part on the specific disease being treated and the dose required for therapeutic efficacy. Generally, the methods of the present invention can be carried out in any medically acceptable mode of administration, meaning any mode that produces an effective therapeutic level for HMGCR-related disease or condition without causing clinically unacceptable side effects. In some embodiments of the present invention, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be administered orally, intestinally, mucosally, subcutaneously and / or parenterally. The term "parenterally" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, transnasal (e.g., via a nasogastric tube), transdermal, transvaginal, transrectal, sublingual and inhalation. The routes of delivery of the present invention may include intrathecal, ventricular or intracranial. In some embodiments of the present invention, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be administered by placing them in a sustained-release matrix and placing the matrix in the body of a subject. In some embodiments of the present invention, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be delivered to subject cells using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery methods, procedures, and reagents are known in the art. Other parts of this specification further provide non-limiting examples of delivery methods and delivery agents. In some aspects of the present invention, the term “delivery” with respect to HMGCR dsRNA agents or HMGCR antisense polynucleotide agents may mean administering one or more “naked” HMGCR dsRNA agent or HMGCR antisense polynucleotide agent sequences to cells or subjects, and in some aspects of the present invention, “delivery” means delivering cells containing an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to a subject by a transfection method, thereby delivering a vector encoding the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent into the subject’s body.The delivery of HMGCR dsRNA agents or HMGCR antisense polynucleotide agents using transfection means may include administering the vector to cells and / or subjects.

[0164] In some methods of the present invention, one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be administered in a formulation, which can be administered in a pharmaceutically acceptable solution, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optional other therapeutic components. In some embodiments of the present invention, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be prepared with another therapeutic agent and used for co-administration. According to the methods of the present invention, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be administered in a pharmaceutical composition. Generally, the pharmaceutical composition comprises the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent and an optional pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the efficacy of the biological activity of the active ingredient, for example, the ability of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to inhibit HMGCR gene expression in cells or subjects. Several methods for administering and delivering dsRNA agents or HMGCR antisense polynucleotide agents for therapeutic use are known in the art and can be used in the methods of the present invention.

[0165] Pharmacokinetically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are those described in U.S. Patent No. 5,211,657 and other carriers known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and other optional therapeutic agents. While the salts described above are pharmaceutically acceptable when used in drugs, pharmaceutically unacceptable salts can be suitably used in the production of such pharmaceutically acceptable salts and are not excluded from the scope of the invention. Such pharmacokinetically and pharmaceutically acceptable salts include, but are not limited to, salts produced from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Furthermore, pharmaceutically acceptable salts can be produced as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, and calcium salts.

[0166] Some embodiments of the methods of the present invention involve directly administering one or more HMGCR dsRNA reagents or HMGCR antisense polynucleotide reagents to a tissue. In some embodiments, the tissue to which the compounds are administered is a tissue in which HMGCR-related disease or pathology is present or may manifest, a non-limiting example being the heart. Direct administration to tissue can be achieved by direct injection or by other means. Many orally delivered compounds naturally proceed to cross the liver and kidneys, and some embodiments of the therapeutic methods of the present invention involve orally administering one or more HMGCR dsRNA agents to a subject. HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be administered once, alone, or in combination with other therapeutic agents, or alternatively, they can be administered multiple times. When administered multiple times, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be administered by different routes. For example, though not intended to be limiting, the initial (or first few) doses may be administered subcutaneously, and one or more additional doses may be administered orally and / or systemically.

[0167] In embodiments of the present invention where systemic administration of an HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent is desired, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be prepared for parenteral administration by injection, for example, by bolus injection or continuous infusion. The injectable formulation can exist in unit dosage form, with or without preservatives, for example, in ampoules or multi-dose containers. The HMGCR dsRNA agent formulation (also called a pharmaceutical composition) can take the form of a suspension, solution or emulsion in an oily or aqueous medium and may contain preparing agents such as suspending agents, stabilizers and / or dispersants.

[0168] Parenteral formulations include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffering media. Parenteral carriers include sodium chloride solutions, ringer's dextrose, glucose and sodium chloride, Ringer's lactate solution, or fixative oils. Intravenous carriers include liquids and nutritional supplements, electrolyte supplements (e.g., those based on ringer's dextrose). Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may be present. Dosage can be reduced by using other methods of administration, such as intravenous administration. If the subject's response to the initial dose is insufficient, a higher dose (or a substantially higher dose via a different, more localized delivery route) may be used within the patient's tolerance tolerance. If necessary, multiple doses can be used daily to achieve appropriate systemic or local levels of one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents, and to achieve appropriate reduction of HMGCR protein activity.

[0169] In other embodiments, the method of the present invention includes the use of a delivery carrier such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into the body of a recipient (e.g., a subject). Exemplary biodegradable implants that can be used by the method are described in PCT disclosure number WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix containing a biopolymer.

[0170] Non-biodegradable and biodegradable polymer matrices can both be used in the methods of the present invention to deliver one or more HMGCR dsRNA reagents or HMGCR antisense polynucleotide reagents to a subject. In some examples, the matrix may be biodegradable. The matrix polymer may be natural or synthetic. The polymer can be selected depending on the period for which release is required, typically on the order of a few hours to one year or more. Typically, release times of a few hours to 3 to 12 months can be used. The polymer may optionally take the form of a hydrogel capable of absorbing up to about 90% of its weight in water, and may further optionally be crosslinked with polyvalent ions or other polymers.

[0171] In general, in some embodiments of the present invention, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents can be delivered by diffusion using biodegradable implants or by degradation of a polymer matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver HMGCR dsRNA agents or HMGCR antisense polynucleotide agents by methods known in the art. Bioadhesive polymers such as biodegradable hydrogels (see HSSawhney, CPPathak and JAHubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used in agents that deliver HMGCR dsRNA reagents or HMGCR antisense polynucleotides to treat HMGCR-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems can avoid repeated administration of HMGCR dsRNA agents or HMGCR antisense polynucleotide agents, thereby improving convenience for subjects and healthcare professionals. Many types of release delivery systems are available and known to those skilled in the art (see, for example, U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974 and 5,407,686, the teachings of which are incorporated herein by reference). Furthermore, pump-based hardware delivery systems can be used, some of which are suitable for implantation.

[0172] The use of long-term sustained-release implants may be suitable for the prophylactic treatment of subjects and subjects at risk of developing recurrent HMGCR-related diseases or conditions. As used herein, long-term release refers to constructing and positioning an implant to deliver therapeutic levels of HMGCR dsRNA or HMGCR antisense polynucleotide agents over a period of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or longer. Long-term sustained-release implants are well known to those skilled in the art and include some of the release systems described above.

[0173] For preservation, it is manufactured in the form of a lyophilized formulation or aqueous solution by mixing with excipients or stabilizers [Remington's Pharmaceutical Sciences, 21st edition, (2006)]. Acceptable carriers, excipients or stabilizers are nontoxic to the recipient at the dose and concentration used and include buffers such as phosphates, citrates and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (e.g., benzyldimethylstearylammonium chloride hydrate, hexamethonium, benzalkonium chloride, benzethonium chloride, phenol, butanol or benzyl alcohol, alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate, catechol, resorcinol, cyclohexanol, 3-penta) (Nol and m-cresol), low molecular weight (less than about 10 residues) polypeptides, proteins such as serum albumin, gelatin or immunoglobulin, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose or dextrin, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose or sorbitol, salt-forming counterions such as sodium, metal complexes (e.g., zinc-protein complexes), and / or TWEEN (登録商標) PLURONICS (登録商標) Alternatively, it may contain a nonionic surfactant such as polyethylene glycol (PEG).

[0174] Cells, subjects, and controls The methods of the present invention can be used in combination with cells, tissues, organs and / or subjects. In some embodiments of the present invention, the subjects are humans or vertebrate mammals, including but not limited to dogs, cats, horses, cattle, goats, mice, rats and monkeys. Accordingly, the present invention can be used for the treatment of HMGCR-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subjects may be farm animals, zoo animals, livestock or non-livestock animals, and the methods of the present invention can be used in veterinary preventive and therapeutic schemes. In some embodiments of the present invention, the subjects are humans, and the methods of the present invention can be used in preventive and therapeutic schemes for humans.

[0175] Non-limiting examples of subjects to whom the present invention can be applied are subjects who have been diagnosed with, are suspected of having, or are at risk of having, a disease or condition associated with higher-than-desired HMGCR expression and / or activity, also known as “elevated HMGCR expression levels.” Non-limiting examples of diseases and conditions associated with higher-than-desired HMGCR expression and / or activity are described elsewhere in this specification. The methods of the present invention can be applied to subjects diagnosed with, or considered to have, a disease or condition associated with higher-than-desired HMGCR expression and / or activity at the time of treatment. In some embodiments of the present invention, the disease or condition associated with higher-than-desired HMGCR expression and / or activity levels is an acute disease or condition, and in some embodiments of the present invention, the onset and / or reduction of activity of a disease or condition associated with higher-than-desired HMGCR levels is a chronic disease or condition.

[0176] In non-limiting examples, the HMGCR dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of having statin-resistant hypercholesterolemia, where the hypercholesterolemia is a disease requiring reduction of HMGCR expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to have or be at risk of developing the disease or condition.

[0177] In a further, non-limiting example, the HMGCR dsRNA agent of the present invention is administered to a subject who has been diagnosed with, is suspected of having, or is at risk of developing hyperlipidemia, where hyperlipidemia is a disease requiring reduction of HMGCR expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects who have or are considered to be at risk of developing the disease or condition.

[0178] Cells to which the methods of the present invention can be applied include in vitro, intracellular, and ex vivo cells. Cells may exist in subjects, in cultures, and / or in suspensions, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may also be liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments of the present invention, cells to which the methods of the present invention can be applied are healthy and normal cells that are not known to be diseased cells. In some embodiments of the present invention, cells to which the methods and compositions of the present invention can be applied are liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In some embodiments of the present invention, control cells are normal cells, but it should be understood that cells suffering from disease or illness may function as control cells in certain cases, for example, to compare the results of treated cells with disease or illness with untreated cells with disease or illness.

[0179] The method of the present invention allows for the measurement of HMGCR polypeptide activity levels and comparison with control levels of HMGCR polypeptide activity. The control may be a predetermined value that can take multiple forms. It may be a single cutoff value, such as a median or mean. It can be established based on comparison groups, such as a group having normal levels of HMGCR polypeptide and / or HMGCR polypeptide activity, and a group having increased levels of HMGCR polypeptide and / or HMGCR polypeptide activity. Other non-limiting examples of comparison groups may be a group having one or more symptoms or diagnoses of HMGCR-related disease or condition, a group not having one or more symptoms or diagnoses of the disease or condition, a group of subjects administered with the siRNA therapy of the present invention, and a group of subjects not administered with the siRNA therapy of the present invention. Typically, the control may be based on clearly healthy normal individuals or clearly healthy cells in an appropriate age group. In addition to predetermined values, it should be understood that the control according to the present invention may be a material sample tested in parallel with the experimental material. Examples include a sample from the control group, or a control sample manufactured and produced to be tested in parallel with the experimental sample. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted or treated with the HMGCR dsRNA agent of the present invention, in which case the control level of HMGCR polypeptide and / or HMGCR polypeptide activity can be compared to the level of HMGCR polypeptide and / or HMGCR polypeptide activity in cells or subjects that have been contacted with the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention.

[0180] In some embodiments of the present invention, the subject whose HMGCR polypeptide level is measured may be a control level, and HMGCR polypeptide levels measured at different times in the same subject are compared to the control level. In non-limiting examples, HMGCR levels are measured in biological samples obtained from subjects who have not been administered the HMGCR treatment of the present invention. In some embodiments, the biological sample is a serum sample. HMGCR polypeptide levels measured in samples obtained from subjects can serve as a baseline or control value for the subject. In the treatment method of the present invention, after administering an HMGCR dsRNA agent to a subject once or more times, one or more other serum samples can be obtained from the subject, and HMGCR polypeptide levels in one or more subsequent samples can be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of HMGCR-related disease or condition in the subject. For example, if the level of HMGCR polypeptide in a baseline sample obtained from a subject is higher than the level obtained from the same subject after administering the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention to the subject, it indicates regression of HMGCR-related disease or condition and demonstrates the efficacy of the administered HMGCR dsRNA agent of the present invention in treating HMGCR-related disease or condition.

[0181] In some embodiments of the present invention, one or more values ​​at the level of HMGCR polypeptide and / or HMGCR polypeptide activity measured in a subject can serve as a control value for subsequent comparison of HMGCR polypeptide and / or HMGCR activity levels in the same subject, thereby enabling evaluation of changes in HMGCR polypeptide activity in the subject relative to the "baseline". Accordingly, the initial HMGCR polypeptide level and / or initial HMGCR polypeptide activity level can be present in and / or determined in the subject, and the methods and compounds of the present invention can be used to reduce the HMGCR polypeptide level and / or HMGCR polypeptide activity in the subject. The initial level is considered the control level for the subject.

[0182] The HMGCR dsRNA agent and / or HMGCR antisense polynucleotide agent of the present invention can be administered to a subject using the method of the present invention. The efficacy of the administration and treatment of the present invention can be evaluated if the level of HMGCR polypeptide in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of HMGCR polypeptide in a serum sample obtained from the subject at a previous point in time, or compared to a non-contact control level, e.g., the level of HMGCR polypeptide in a control serum sample. It should be understood that both the HMGCR polypeptide level and the HMGCR polypeptide activity level correlate with the HMGCR gene expression level. One embodiment of the method of the present invention involves administering to a subject an amount effective in inhibiting HMGCR gene expression and thereby reducing HMGCR polypeptide levels and HMGCR polypeptide activity levels in the subject.

[0183] Some embodiments of the present invention involve measuring the presence, absence, and / or amount (also referred to herein as level) of HMGCR polypeptide in one or more biological samples obtained from one or more subjects. Such measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to measure the level of HMGCR polypeptide in a biological sample obtained from a subject that has been previously treated with the HMGCR dsRNA agent and / or HMGCR antisense agent of the present invention. If the HMGCR polypeptide level measured in a serum sample obtained from a treated subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-treatment level of HMGCR polypeptide measured in the subject, or compared to the level in an uncontacted control biological sample, the level of effectiveness of the treatment administered to the subject is indicated.

[0184] In some embodiments of the present invention, the physiological characteristics of an HMGCR-related disease or condition established in a subject may be control measurements, compared with measurements of physiological characteristics of the same subject at different time points. In non-limiting examples, physiological characteristics in biological samples, such as serum samples obtained from subjects not administered HMGCR treatment of the present invention, such as HMGCR mRNA levels, HMGCR protein levels, or lipid levels, triglycerides, and cholesterol levels in plasma or tissue samples, may be measured. HMGCR mRNA levels (and / or other physiological characteristics of the HMGCR disease or condition) measured in samples obtained from subjects can serve as a baseline or control value for the subject. In the treatment method of the present invention, after administering an HMGCR dsRNA agent to a subject once or more times, one or more other serum samples may be obtained from the subject, and the HMGCR mRNA levels and / or HMGCR protein levels in one or more subsequent samples may be measured. These may be compared with the subject's control / baseline levels and / or ratios, respectively. Such comparisons can be used to evaluate the onset, progression, or regression of HMGCR-related disease or condition in a subject. For example, if the HMGCR mRNA level in a baseline sample obtained from a subject is higher than the HMGCR mRNA level measured in a sample obtained from the same subject after administration of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the present invention to the subject, it indicates a regression of the HMGCR-related disease or condition as described, and demonstrates the efficacy of the administered HMGCR dsRNA agent of the present invention in treating the HMGCR-related disease or condition.

[0185] In some embodiments of the present invention, values ​​of one or more physiological characteristics of an HMGCR-related disease or condition determined from a subject can subsequently serve as control values ​​for comparison with the physiological characteristics of the same subject, thereby enabling the evaluation of changes in the "baseline" physiological characteristics from the subject. Thus, initial physiological characteristics can be present and / or determined in a subject, and the methods and compounds of the present invention can be used to reduce HMGCR polypeptide levels and / or HMGCR polypeptide activity in the subject, of which the initial physiological characteristics are measured for use as a control of the subject.

[0186] Using the method of the present invention, HMGCR disease or pathology can be treated by administering an effective amount of the HMGCR dsRNA agent and / or HMGCR antisense polynucleotide agent of the present invention to a subject. The efficacy of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of HMGCR disease or pathology. In non-limiting examples, the HMGCR mRNA level in a serum sample obtained from a subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous point in time, or compared to uncontacted control levels (e.g., HMGCR mRNA levels in a control serum sample). The HMGCR mRNA level, HMGCR protein level, or lipid levels, triglycerides, and cholesterol levels in a subject or tissue sample should be understood to be related to the HMGCR gene expression level, respectively. One embodiment of the method of the present invention involves administering the HMGCR dsRNA and / or HMGCR antisense agent of the present invention to a subject in an amount effective in inhibiting HMGCR gene expression and thereby reducing HMGCR mRNA and HMGCR protein levels in the subject, or otherwise actively influencing the physiological characteristics of the subject's HMGCR-related disease or condition.

[0187] Some embodiments of the present invention include, for example, (1) evaluating the physiological characteristics of one or more biological samples obtained from one or more subjects, (2) imaging the subjects (e.g., obtaining liver images), and (3) performing a health examination of the subjects, but not limited to these methods, to determine the presence, absence, and / or alteration of the physiological characteristics of HMGCR-related diseases or conditions. Such measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention.

[0188] kit A reagent kit comprising an HMGCR dsRNA reagent and / or an HMGCR antisense polynucleotide reagent, and instructions for use in the method of the present invention, is also within the scope of the present invention. The reagent kit of the present invention may contain one or more of the HMGCR dsRNA agent, HMGCR sense polynucleotide, and HMGCR antisense polynucleotide agent that can be used to treat HMGCR-related diseases or conditions. A reagent kit containing one or more of the HMGCR dsRNA reagent, HMGCR sense polynucleotide, and HMGCR antisense polynucleotide reagent can be prepared and used in the therapeutic method of the present invention. The components of the reagent kit of the present invention may be packaged in an aqueous medium or in a lyophilized form. The reagent kit of the present invention may include a carrier, which is partitioned to tightly house one or more container devices or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc. The first container device or series of container devices may contain one or more compounds, such as an HMGCR dsRNA agent and / or an HMGCR sense or antisense polynucleotide agent. In a therapeutic method according to one embodiment of the present invention, the second container device or series of container devices may contain a targeting agent, a labeling agent, a delivery agent, etc., which may be included as part of the HMGCR dsRNA agent and / or HMGCR antisense polynucleotide to be administered to the embodiment.

[0189] The reagent kit of the present invention may further include an instruction manual. The instruction manual is usually in written form and provides instructions for performing treatment with the reagent kit and for making decisions based on said treatment.

[0190] The following examples are provided to illustrate specific examples of the implementation of the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention can be applied to a variety of compositions and methods.

[0191] ●Specific examples Example 1. Phosphoramidite compound 1 [ka] Compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL), and the mixture was stirred at 25 °C for 1.0 hour under an N2 atmosphere at 0-5 °C. LC-MS showed that compound B was completely consumed, several new peaks were observed on LC-MS, and approximately 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 °C and poured into ice-cold (0-5 °C) saturated NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL x 2), and the combined organic layer was washed with ice-cold (0-5 °C) saturated NaHCO3 / saline solution = 1:1 (5.0 mL / 5.0 mL), dried over Na2 SO4, and vacuum concentrated to obtain the residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to obtain compound 1 (280 mg, 471 μmol, yield 42.3%), which was a white solid.

[0192] 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).

[0193] Example 2. Phosphoramidite Compound 2 [ka] A pyridine solution (400 mL) of DMTrCl (232 g, 684 mmol, 1.0 eq) was added to a pyridine solution (600 mL) of isomannitol compound A (100 g, 684 mmol, 1.0 eq), and the mixture was stirred at 25°C for 12 hours. LC-MS showed that compound A was completely consumed, and a single main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with DCM (500 mL x 2), washed with saline solution (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. Column chromatography (DCM / MeOH = 100 / 1~50 / 1, 0.1% Et3N) was performed. ) The residue was purified to obtain compound B (150 g, yield 48.9%) as a yellow solid.

[0194] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).

[0195] At 25°C under an N2 atmosphere, 2H-tetrazole (0.45M, 436mL, 1.1eq) was added dropwise to a DCM (800mL) solution of compound B (80.0g, 178 mmol, 1.0eq), and then a DCM (200mL) solution of compound C (80.6g, 267 mmol, 85.0mL, 1.5eq) was added dropwise to the mixture. The reaction mixture was stirred at 25°C for 1.0 hour, and LC-MS showed that compound B was completely consumed and a single main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500mL), extracted with DCM (500mL x 3), washed with NaHCO3 / saline solution = 1:1 (300mL / 300mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain isomannitol phosphoramidite compound 2 (77 g, 119 mmol, yield 66.5%), which was a white solid.

[0196] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

[0197] Other phosphoramidites can be produced by the procedures described herein and / or by prior art, for example, US426,220 and WO02 / 36743, and / or thereafter.

[0198] Example 3. Production of a solid support containing the phosphoramidite monomer of the present invention [ka] [ka] This shows the carrier portion of the highly porous aminomethyl polyethylene resin. A 50L glass vessel was placed under nitrogen gas protection, and dichloromethane (19.50 kg) was added to the glass vessel and stirring was started. The temperature was controlled to 20-30°C, DMTr-imann (1.47 kg) was added to the glass vessel, and triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg), and succinic anhydride (1.34 kg) were added to the reaction vessel. The system was kept warm at 20-30°C and reacted for 18 hours, after which a sample was taken and the reaction was terminated. Saturated sodium bicarbonate solution (22.50 kg) was added to the completed system, stirred for 10-20 minutes, and then allowed to stand until plate separation occurred. The organic phase was separated, the aqueous phase was extracted twice with dichloromethane, the organic phases were combined, dried with anhydrous sodium sulfate, filtered, and vacuum concentrated to obtain the residue, forming 1.83 kg of a gray to grayish-white solid.

[0199] N,N-dimethylformamide (23.50 kg) was added to a 100 L glass vessel and stirring was started. The temperature was controlled to 20-30°C and, under nitrogen gas protection, the product from the previous step, O-benzotriazole-tetramethyluronium hexafluorophosphate (0.33 kg), was added to the 100 L glass vessel via a solid input hopper, followed by the addition of N,N-diisopropylethylamine (0.13 kg). After the addition was complete, the mixture was stirred for 10-30 minutes and then transferred to a 50 L galvanized barrel for use. 3.25 kg of highly porous aminomethyl resin (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., lot number HA2X1209, loading amount 0.48 mmol / g) was added to the 100 L solid-phase synthesis vessel via a solid input hopper. The temperature was controlled to 20-30°C, and 21.00 kg of N,N-dimethylformamide and the reaction solution prepared for use in the galvanized barrel from the previous step were added to the solid-phase synthesis vessel. The system was kept warm and monitored until the solid loading amount reached ≥250 μmol / g, with UV light used for loading detection. The system was filtered under pressure with nitrogen gas, and the filtered cake was rinsed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), leaving the filtered cake in the vessel. CAP.A (50% acetonitrile and 50% anhydride acetate, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole, and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were added to an 80 L glass vessel, stirred for 3 to 8 minutes, and then prepared for use. This operation was repeated three times for capping, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis vessel. After bubbling with nitrogen gas for 10 to 30 minutes, the mixture was pressure filtered. This process was repeated four times, and the filtered cake was purged with nitrogen gas in a solid-phase synthesis vessel for 2-4 hours. Then it was transferred to a 50L filter press tank, and the temperature was controlled to 15-30°C while drying continued. After drying, a yellow to white solid product weighing 3.516 kg was obtained.

[0200] Example 4. Synthesis of HMGCR RNAi agent.

[0201] The HMGCR RNAi reagent double-stranded compounds shown in Tables 2-3 above were synthesized according to the following general procedure.

[0202] siRNA sense and antisense chain sequences were synthesized in an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain extension was achieved by a four-step cycle consisting of deprotection, coupling, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed on a solid support made from pore-controlled glass (CPG, 1000 angstroms). Monomer phosphoramidites may be purchased from commercial sources or may be the phosphoramidite compounds in Examples 1-2 or WO2023 / 045995. The phosphoramidite compounds herein may be ligated as monomeric nucleotides to the 3'-terminus of a CPG or polystyrene solid support. When ligated to the 5'-terminus, the phosphoramidite compound can be used in the final coupling reaction and may be further conjugated to a target ligand as needed.

[0203] Phosphoramidites containing GalNAc ligand clusters were synthesized according to the procedures shown in Plans 1 and 2, or according to the procedure in WO2023 / 045995 (GLPA1, GLPA2, and GLPA15 are non-limiting examples). When the GalNAc ligand (GLO-0 is a non-limiting example, of which GLO-0 refers to compound GalNAc3 in Jayaprakash, et al., (2014) J.Am.Chem.Soc., 136, 16958-16961) was ligated to the 3' end of the sense chain, a GalNAc ligand ligated to a CPG solid support was used. When the GalNAc ligand (GLS-5* or GLS-15* as non-limiting examples) was ligated to the 5' end of the sense chain, a GalNAc phosphoramidite (GLPA1, GLPA2, or GLPA15 as non-limiting examples) was used in the final coupling reaction. A 3% dichloromethane solution of trichloroacetic acid (TCA) was used to deprotect the 4,4'-dimethoxytrityl protecting group (DMT). 5-ethylthio-1H-tetrazole was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN were used for oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomers bound to the solid support were cleaved and the protecting groups removed with a 1:1 volume 40 wt% aqueous methylamine solution and a 28% ammonium hydroxide solution. The crude mixture was concentrated to synthesize siRNA for use in vitro screening. The remaining solid was dissolved in 1.0 M NaOAc, and the single-chain product as a sodium salt was precipitated by adding ice-cold EtOH, which could be used for annealing without further purification. To synthesize multi-target molecules for use in vivo testing, the crude single-chain product was further purified by ion-pair reverse-phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product obtained from IP-RP-HPLC was converted to a sodium salt by dissolving it in 1.0 M NaOAc and then precipitating it with ice-cold EtOH.Equimolar complementary sense and antisense oligonucleotides were annealed in water to form double-stranded siRNA products, which were then freeze-dried to provide a fluffy white solid. [ka]

[0204] Plan 1 [ka]

[0205] Plan 2 Example 5. In vitro screening of HMGCR siRNA double-stranded bodies Huh7 cells were trypsinized to an appropriate density and inoculated into 96-well plates with a complex of psiCHECK(TM)-2 vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019). Following the manufacturer's recommendations, cells were transfected with test siRNA or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) immediately after inoculation. siRNA was tested three times at different concentrations (0.2 nM and 1 nM, 0.5 nM and 5 nM).

[0206] Day 1, psiCHECK(TM)-2 vector transfection (1 plate): (1) Transfer 2.5 μg of psiCHECK(TM)-2 vector plasmid to an Eppendorf tube without RNASE (solution mixture #1), (2) Add trypsin to one flask to dissociate the Huh7 cells, count the cells with a Vi-Cell counter, and adjust the cell density to 1*10^5 / mL. (3) Transfer 7.5 μL of Lipofectamine 2000 (Invitrogen-11668-019) to solution mix #1 tube and mix uniformly. (4) The solution from step 3 was added to the cell suspension and mixed uniformly, and the suspension was dispensed into 96-well plates (100 μL / well).

[0207] Day 2, siRNA transfection: (1) Dilute Lipofectamine® RNAiMAX Reagent in Opti-MEM® medium, (2) Dilute the siRNA with water that does not contain RNA to prepare a 12x stock solution, (3) Equivolute diluted RNAiMax and siRNA were mixed. The mixture was incubated at RT for 15 minutes to form a complex. (4) Add 45 μL / well of the compound Lipofectamine® RNAiMAX (Opti-MEM) mixture to 225 μL / well of fresh DMEM medium, discard the supernatant in the measurement plate, and add 120 μL / well of the compound mixture to a 96-well plate. (5) The control wells without the compound were defined as cells transfected with the psiCHECK(TM)-2 vector and not treated with siRNA, while the blank control wells were cells only.

[0208] Day 3, Dual-Glo(registered trademark) luciferase measurement: (1) Add the reagent to the measurement plate and wait for 10 minutes to allow cell cleavage to occur. (2) After transferring 100 μL of cell cutting solution to a plate, measure the firefly luminescence. (3) Add 50 μL of Dual-Glo® Stop & Glo® Reagent to the measurement plate and mix, wait for 10 minutes, and then measure the Renilla luminescence. (4) The relative expression formula was calculated.

[0209] Data Analysis Sample well ratio = (Renilla luminescent sample - background blank) / (Firefly luminescent sample - background blank) Ratio of control well without compound = (Control Renilla luminescence - background blank) / (Control firefly luminescence - background blank) % inhibition = 100 - (ratio of sample wells / average ratio of control without compound) × 100% Table 5 provides experimental results from in vitro studies inhibiting HMGCR expression using various HMGCR RNAi reagents. The double-stranded sequences used correspond to those shown in Table 2. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4]

[0210] Table 6 provides experimental results from in vitro studies inhibiting HMGCR expression using various HMGCR RNAi reagents. The double-stranded sequences used correspond to those shown in Table 2. [Table 8-1] [Table 8-2]

[0211] Table 7 provides experimental results from in vitro studies inhibiting HMGCR expression using various HMGCR RNAi reagents. The double-stranded sequences used correspond to those shown in Table 2. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5]

[0212] Table 8 provides experimental results from in vitro studies inhibiting HMGCR expression using various HMGCR RNAi reagents. The double-stranded sequences used correspond to those shown in Table 2. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5]

[0213] Huh7 cells were digested with trypsin to the appropriate density and inoculated into 96-well plates. The day after inoculation, cells were transfected with a complex of psiCHECK(TM)-2 vector plasmid, blank vector pCNDNA 3.0, siRNAs, or control siRNA using Lipofectamine 2000 (Invitrogen-11668-019) as recommended by the manufacturer. siRNA was tested three times at different concentrations (0.2 nM and 1 nM).

[0214] On day 1, trypsin was added to one flask to dissociate Huh7 cells, the cells were counted using a Vi-Cell counter, the cell density was adjusted to 1*10^5 / mL, and the cells were cultured in DMEM medium.

[0215] On day 2, the psiCHECK(TM)-2 vector / blank vector pCDNA3.0 / siRNAs / Lipofectamine 2000 mixture was transfected.

[0216] (1) Appropriate Lipofectamine 2000 (Invitrogen-11668-019) was mixed with Opti-MEM® medium (solution mixture #1). Finally, 0.3 μL of Lipofectamine 2000 and 4.7 μL of Opti-MEM® medium were added to each well.

[0217] (2) Appropriate psiCHECK(TM)-2 vectors, blank pCNDNA3.0 vectors, and siRNAs were mixed with Opti-MEM(registered trademark) medium (solution mixture #2).

[0218] (3) Equal volumes of solution mix #1 and mix #2 (mix #3) were mixed to a final volume of 10 μL in each well. The mixture was incubated at RT for 15 minutes to form a complex.

[0219] (4) Remove the DMEM medium and add 10 μL of mixed solution mix #3 and 90 μL of fresh DMEM medium.

[0220] (5) The control wells without compounds were wells of cells transfected with psiCHECK(TM)-2 Vector and blank vector pCNDNA 3.0 and not treated with siRNA, while the blank controls were wells of cells only.

[0221] Day 3: Dual-Glo® luciferase measurement (1) Add the reagent to the measurement plate and wait for 10 minutes to allow cell cleavage to occur.

[0222] (2) After transferring 100 μL of cell cutting solution to a plate, the firefly bioluminescence was measured.

[0223] (3) 50 μL of Dual-Glo® Stop & Glo® Reagent was added to the measurement plate and mixed, and after waiting for 10 minutes, Renilla emission was measured.

[0224] (4) The relative expression formula was calculated. Data Analysis Sample well ratio = (Renilla luminescent sample - background blank) / (Firefly luminescent sample - background blank) Ratio of control well without compound = (Control Renilla luminescence - background blank) / (Control sample firefly luminescence - background blank) % inhibition = 100 - (ratio of sample wells / average ratio of control without compound) × 100% Table 9 provides experimental results from in vitro studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 2. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4]

[0225] Example 6. In vivo study of HMGCR siRNA double-stranded bodies On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human HMGCR and luciferase genes. On day 8, the mice received a single subcutaneous administration of 3 mg / kg of HMGCR siRNA or PBS. Blood samples were collected before siRNA administration on day 8, on day 15, and on the final day 22. Serum samples were collected, and luciferase activity in the serum samples was measured according to the manufacturer's recommended procedure. The results are shown in Table 10.

[0226] Table 10 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 12-1] [Table 12-2]

[0227] On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human HMGCR and luciferase genes. On day 8, the mice were given a single subcutaneous dose of 2 mg / kg or 1 mg / kg of HMGCR siRNA or PBS. Blood samples were collected before siRNA administration on day 8, on day 15, and on the final day 22. Serum samples were collected, and luciferase activity in the serum samples was measured according to the manufacturer's recommended procedure. The results are shown in Tables 11-16.

[0228] Table 11 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 13-1] [Table 13-2]

[0229] Table 12 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 14]

[0230] Table 13 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 15]

[0231] Table 14 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 16-1] [Table 16-2]

[0232] Table 15 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 17-1] [Table 17-2]

[0233] Table 16 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 18]

[0234] On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human HMGCR and luciferase genes. On day 8, the mice were given a single subcutaneous administration of 1 mg / kg of HMGCR siRNA or physiological saline. Blood samples were collected before siRNA administration on day 8, and on days 21 and 28. Serum samples were collected, and the luciferase activity of the serum samples was measured according to the manufacturer's recommended procedure. The results are shown in Tables 17-18.

[0235] Table 17 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 19-1] [Table 19-2]

[0236] Table 18 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 20]

[0237] On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human HMGCR and luciferase genes. On day 8, the mice were given a single subcutaneous dose of 1 mg / kg of HMGCR siRNA or physiological saline. Blood samples were collected before siRNA administration on day 8, on day 15, and on the final day 22. Plasma samples were collected, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. The results are shown in Table 19.

[0238] Table 19 provides experimental results from in vivo studies inhibiting HMGCR expression using various HMGCR RNAi agents. The double-stranded sequences used correspond to those shown in Table 3. [Table 21-1] [Table 21-2]

[0239] ●Equivalent While several embodiments of the present invention have been described and illustrated with examples in this specification, those skilled in the art will readily conceive of several other methods and / or structures to perform the functions described herein and / or to obtain the results and / or one or more advantages described herein, and each of such variations and / or modifications will be considered to fall within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and arrangements described herein are illustrative, and that actual parameters, dimensions, materials and / or arrangements will depend on one or more specific applications taught by the present invention. Those skilled in the art will recognize many equivalent forms of the specific embodiments of the present invention described herein, or can determine them simply by using ordinary experimentation. Accordingly, it should be understood that the above embodiments are shown only as examples, and within the scope of the appended claims and their equivalent forms, the present invention can be carried out in ways different from those specifically described and claimed. The present invention relates to each individual feature, system, article, material and / or method described herein. Furthermore, if such features, systems, articles, materials, and / or methods do not coincide with each other, any combination of two or more such features, systems, articles, materials, and / or methods falls within the scope of the present invention.

[0240] All definitions defined and used herein should be understood to take precedence over dictionary definitions, definitions incorporated by reference in other documents, and / or the general meanings of the terms defined.

[0241] Unless explicitly stated otherwise, nouns without quantifiers used in the specification and claims of this application should be understood to mean "at least one / kind".

[0242] The term "or" is used here in the sense of "and / or" and is interchangeable with the latter unless the context clearly excludes it. The phrase "and / or" as used in the specification and claims of this application should be understood to mean "one or both" of the elements thus linked, i.e., that the elements exist in combination in some cases and separately in other cases. If there are two or more elements separated by a comma, the comma preceding "and / or" has the same meaning as "and / or" and indicates "and" or "or" accordingly. Unless the opposite is explicitly specified, other elements may be optionally present, whether related to or unrelated to the elements explicitly defined by the phrase "and / or".

[0243] All references, patents and patent applications, and publications cited or referenced in this application are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising at least 15 consecutive nucleotides having a difference of 3 or less nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprising at least 15 consecutive nucleotides having a difference of 3 or less nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand are partially, basically, or completely complementary. Double-stranded ribonucleic acid (dsRNA) agent.

2. The antisense strand includes a region complementary to the mRNA encoding HMGCR, and the region includes at least 15 consecutive nucleotides that differ by 1, 2, or 3 or fewer nucleotides from any one of the antisense sequences listed in any one of Tables 1 to 3. The dsRNA agent according to claim 1.

3. The antisense strand includes a region complementary to the mRNA encoding HMGCR, which includes at least 15 consecutive nucleotides from any one of the antisense sequences listed in Tables 1-3. The dsRNA agent according to claim 1.

4. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region complementary to the HMGCR RNA transcript at positions 2 to 18 of the nucleotides, the complementary region comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1 to 3, and optionally comprising a target ligand. Double-stranded ribonucleic acid (dsRNA) agent.

5. The region complementary to the HMGCR RNA transcript contains at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 1-3. The dsRNA agent according to claim 4.

6. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA being basically or completely complementary to any one of the target regions of Sequence ID No. 1, and preferably the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. Double-stranded ribonucleic acid (dsRNA) agent.

7. The sense strand sequence is at least fundamentally complementary or completely complementary to the antisense strand sequence in the dsRNA agent, and preferably, the dsRNA agent contains a sense strand sequence listed in any one of Tables 1 to 3. The dsRNA agent according to claim 6.

8. The aforementioned dsRNA agent contains a sequence listed as a double-stranded sequence in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 7.

9. The dsRNA agent comprises at least one modified nucleotide. A dsRNA agent according to any one of claims 1 to 8.

10. All or essentially all nucleotides of the sense strand and / or antisense strand are modified nucleotides. A dsRNA agent according to any one of claims 1 to 9.

11. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to a portion of the mRNA encoding HMGCR, and each strand having a length of approximately 15 to 30 nucleotides, the sense strand sequence of which may be represented by formula (I): 5'-(N' Ｌ ) ｎ’ N' Ｌ N' Ｌ N' Ｎ１ N' Ｎ２ N' Ｎ３ N' Ｎ４ N' Ｌ N' Ｆ N' Ｌ N' Ｎ５ N' Ｎ６ N' Ｌ N' Ｌ N' Ｌ (N' Ｌ ) ｍ’ -3' Formula (I) Eventually, Each N' Ｆ This indicates a 2'-fluoromodified nucleotide, Each N' Ｎ１ , N' Ｎ２ , N' Ｎ３ , N' Ｎ４ , N' Ｎ５ and N' Ｎ６ This independently shows modified or unmodified nucleotides, Each N' Ｌ This independently shows modified or unmodified nucleotides, but does not show 2'-fluoromodified nucleotides. m' and n' are each independent integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

12. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to a portion of the mRNA encoding HMGCR, each strand having a length of approximately 18 to 30 nucleotides, and the antisense strand sequence may be represented by formula (II): 3'- (N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｌ N Ｍ４ N Ｌ N Ｍ５ N Ｍ６ N Ｌ N Ｍ７ N Ｍ８ N Ｌ N Ｆ N Ｌ - 5' formula (II) Eventually, Each N Ｆ This indicates a 2'-fluoromodified nucleotide, Each N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ , N Ｍ６ , N Ｍ７ and N Ｍ８ This independently shows modified or unmodified nucleotides, Each N Ｌ This independently shows modified or unmodified nucleotides, but does not show 2'-fluoromodified nucleotides. n is an integer between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

13. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a dsRNA duplex, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the mRNA encoding HMGCR, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III): Sense strand: 5'-(N' Ｌ ) ｎ’ N' Ｌ N' Ｌ N' Ｌ N' Ｎ１ N' Ｎ２ N' Ｎ３ N' Ｌ N' Ｆ N' Ｌ N' Ｎ４ N' Ｎ５ N' Ｎ６ N' Ｌ N' Ｌ N' Ｌ (N' Ｌ ) ｍ’ -3' Antisense strand: 3'-(N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｌ N Ｍ４ N Ｌ N Ｍ５ N Ｍ６ N Ｌ N Ｍ７ N Ｍ８ N Ｌ N Ｆ N Ｌ -5' Formula (III) Eventually, Each chain independently consists of approximately 17 to 30 nucleotides. Each N Ｆ and N' Ｆ independently represent a 2'-fluoro-modified nucleotide, N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ , N Ｍ６ , N Ｍ７ , N Ｍ８ , N' Ｎ１ , N' Ｎ２ , N' Ｎ３ , N' Ｎ４ , N' Ｎ５ and N' Ｎ６ This independently indicates modified or unmodified nucleotides, Each N Ｌ and N' Ｌ This independently indicates modified or unmodified nucleotides, but not 2'-fluoromodified nucleotides. m', n', and n are each independent integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

14. The one or more types of modified nucleotides are independently selected from 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seconucleotide mimetic, locked nucleotide, ring-open nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, isomannide nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, cholesterol derivative or terminal nucleotide linked to a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphoramidate, or nucleotide containing a non-natural base. A dsRNA agent according to any one of claims 9 to 13.

15. The guide chain contains an E-vinylphosphonate nucleotide at its 5' end. A dsRNA agent according to any one of claims 1 to 14.

16. The dsRNA agent comprises at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 15.

17. The sense strand includes at least one phosphorothioate nucleotide interlink, A dsRNA agent according to any one of claims 1 to 15.

18. The antisense chain includes at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 15.

19. The sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 15.

20. The antisense chain comprises 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 15.

21. The aforementioned modified sense strand is one of the modified sense strand sequences listed in Tables 2-3. A dsRNA agent according to any one of claims 1 to 20.

22. The modified antisense chain is one of the modified antisense chain sequences listed in Tables 2-3. A dsRNA agent according to any one of claims 1 to 20.

23. The sense strand is complementary or basically complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides. A dsRNA agent according to any one of claims 1 to 22.

24. The length of the complementary region is 19 to 21 nucleotides. A dsRNA agent according to any one of claims 1 to 23.

25. Each chain has a length of 30 nucleotides or less. A dsRNA agent according to any one of claims 1 to 24.

26. Each chain has a length of 25 nucleotides or less. A dsRNA agent according to any one of claims 1 to 24.

27. Each chain has a length of 23 or fewer nucleotides. A dsRNA agent according to any one of claims 1 to 24.

28. The dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. A dsRNA agent according to any one of claims 1 to 27.

29. The one or more target groups or binding groups are conjugated to the sense chain. The dsRNA agent according to claim 28.

30. The aforementioned target group or binding group includes N-acetyl-galactosamine (GalNAc). The dsRNA agent according to claim 28 or 29.

31. The target group has the following structure: The dsRNA agent according to claim 28 or 29. Table 1 Table 2 Table 3 Table 4

32. The dsRNA agent comprises a target group conjugated to the 5'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 31.

33. The dsRNA agent comprises a target group conjugated to the 3'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 31.

34. The antisense chain contains one reverse debase residue at its 3'-terminus. A dsRNA agent according to any one of claims 1 to 31.

35. The sense strand includes one or two reverse debase residues or imann residues at its 3' or / and 5' end. A dsRNA agent according to any one of claims 1 to 31.

36. The dsRNA agent has two blunt ends, A dsRNA agent according to any one of claims 1 to 35.

37. At least one strand contains the 3' overhang of at least one nucleotide. A dsRNA agent according to any one of claims 1 to 35.

38. At least one strand contains the 3' overhanging ends of at least two nucleotides. A dsRNA agent according to any one of claims 1 to 35.

39. A dsRNA agent comprising any one of claims 1 to 38, composition.

40. Further comprising a pharmaceutically acceptable carrier, The composition according to claim 39.

41. Further comprising one or more other therapeutic agents, The composition according to claim 40.

42. The composition is packaged in a reagent kit, container, packaging bag, dispenser, pre-filled syringe, or vial. The composition according to claim 41.

43. The composition is prepared for use in subcutaneous or intravenous (IV) administration. The composition according to any one of claims 39 to 42.

44. A cell comprising a dsRNA agent according to any one of claims 1 to 38, wherein the cell is selectively a mammalian cell and selectively a human cell. cell.

45. A method for inhibiting HMGCR gene expression in cells, wherein the method is (i) Producing cells containing an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 38 or a composition according to any one of claims 39 to 43, method.

46. (ii) Further comprising inhibiting HMGCR gene expression in cells by maintaining the cells produced in step (i) of claim 45 for a time sufficient to obtain degradation of the mRNA transcript of the HMGCR gene, The method according to claim 45.

47. The cells are located within the body of the subject, and the dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 45 to 46.

48. The cells are located within the body of the subject, and the dsRNA agent is administered to the subject via IV administration. The method according to any one of claims 45 to 46.

49. The method further includes evaluating the inhibition of the HMGCR gene after administering a dsRNA agent to the subject, wherein the means for evaluation are: (i) To determine the physiological characteristics of one or more HMGCR-related diseases or conditions in the subject, (ii) Comparing the established physiological features with baseline and / or control physiological features of HMGCR-related disease or condition prior to treatment, Of these, the comparison indicates one or more of the presence or absence of inhibition of HMGCR gene expression in the subject. The method according to claim 47 or 48.

50. The established physiological characteristics are one or more of the following in the subject: HMGCR mRNA level, HMGCR protein level, cholesterol ester (CE) level, triglyceride level, cholesterol level (e.g., high-density lipoprotein cholesterol (HDL-C) level, medium-density lipoprotein cholesterol (IDL-C) level, low-density lipoprotein cholesterol (LDL-C) level, very low-density lipoprotein cholesterol (VLDL-C) level), and lipid levels in blood or serum. The method according to claim 49.

51. A decrease in one or more of the following in the subject: HMGCR mRNA levels, HMGCR protein levels in the subject, and / or a decrease in one or more of the following in the subject: cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum, indicates a decrease in HMGCR gene expression in the subject. The method according to claim 50.

52. A method for inhibiting HMGCR gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 38 or a composition according to any one of claims 39 to 43. method.

53. The dsRNA agent is administered subcutaneously to the subject. The method according to claim 52.

54. The dsRNA agent is administered to the subject by method IV. The method according to claim 52.

55. The method further includes evaluating the inhibition of the HMGCR gene after administering the dsRNA agent, wherein the means for evaluation are: (i) To determine the physiological characteristics of one or more HMGCR-related diseases or conditions in the subject, (ii) Comparing the established physiological features with baseline and / or control physiological features of HMGCR-related disease or condition prior to treatment, Of these, the comparison indicates one or more of the presence or absence of inhibition of HMGCR gene expression in the subject. The method according to any one of claims 52 to 54.

56. The established physiological characteristics are one or more of the following in the subject: HMGCR mRNA level, HMGCR protein level, cholesterol ester (CE) level, triglyceride level, cholesterol level (e.g., high-density lipoprotein cholesterol (HDL-C) level, medium-density lipoprotein cholesterol (IDL-C) level, low-density lipoprotein cholesterol (LDL-C) level, very low-density lipoprotein cholesterol (VLDL-C) level), and lipid levels in blood or serum. The method according to claim 55.

57. A decrease in one or more of the following in the subject: HMGCR mRNA levels, HMGCR protein levels in the subject, and / or a decrease in one or more of the following in the subject: cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum, indicates a decrease in HMGCR gene expression in the subject. The method according to claim 56.

58. A method for treating a disease or condition associated with the presence of the HMGCR protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 38 or a composition according to any one of claims 39 to 43 in order to inhibit HMGCR gene expression. method.

59. The aforementioned diseases or conditions are one or more of the following: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or decreased activity, familial partial lipodystrophy type 1 (FPLD1), polycystic ovary syndrome associated with insulin resistance, kidney transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, globulinemia, lipodystrophy, type I glycogen storage disorder and Addison's disease, or other lipid metabolism disorders associated with HMGCR. The method according to claim 58.

60. The further step is to administer another treatment plan to the subject. The method according to claim 59.

61. The aforementioned alternative treatment plan includes administering one or more HMGCR antisense polynucleotides of the present invention to the subject, administering a non-HMGCR dsRNA therapeutic agent to the subject, and inducing behavioral changes in the subject. The method according to claim 60.

62. The non-HMGCR dsRNA therapeutic agent is one or more of the following: statins, bile chelators, VLDL secretion inhibitors, lipophilic antioxidants, acyl coenzyme A cholesterol acyltransferase inhibitors, farnesol X receptor antagonists, sterol regulatory binding protein cleavage activator (SCAP) activators, microsomal triglyceride transfer protein (MTP) inhibitors, ApoE-related peptides, cholesterol ester transfer protein (CETP) inhibitors, therapeutic antibodies against HMGCR, and any one combination thereof. The method according to claim 61.

63. The dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 58 to 62.

64. The dsRNA agent is administered to the subject by method IV. The method according to any one of claims 58 to 62.

65. The further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject, The method according to any one of claims 58 to 64.

66. A method for determining the effectiveness of the aforementioned treatment in the subject is: (i) To determine the physiological characteristics of one or more HMGCR-related diseases or conditions in the subject, (ii) Comparing the established physiological characteristics to baseline physiological characteristics of HMGCR-related disease or condition before treatment, Of these, the comparison indicates one or more of the presence, absence, and level of efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject. The method according to claim 65.

67. The established physiological characteristics include HMGCR mRNA levels, HMGCR protein levels, cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in the subject's blood or serum. The method according to claim 66.

68. A reduction in one or more of the following in a subject: HMGCR mRNA levels, HMGCR protein levels, and / or a reduction in one or more of the following: cholesterol ester (CE) levels, triglyceride levels, cholesterol levels (e.g., high-density lipoprotein cholesterol (HDL-C) levels, medium-density lipoprotein cholesterol (IDL-C) levels, low-density lipoprotein cholesterol (LDL-C) levels, very low-density lipoprotein cholesterol (VLDL-C) levels), and lipid levels in blood or serum, indicates the effectiveness of administering double-stranded ribonucleic acid (dsRNA) agents to the subject. The method according to claim 66.

69. A method for reducing the HMGCR protein level in a subject compared to a pre-treatment baseline level of HMGCR protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 38, or a composition according to any one of claims 39 to 43, in order to reduce the HMGCR gene expression level. method.

70. The dsRNA agent is administered to the subject subcutaneously or by the IV method. The method according to claim 69.

71. A method for altering the physiological characteristics of an HMGCR-related disease or condition in a subject compared to baseline physiological characteristics of the HMGCR-related disease or condition in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 38 or a composition according to any one of claims 39 to 43 in order to alter the physiological characteristics of the HMGCR-related disease or condition in the subject. method.

72. The dsRNA agent is administered to the subject subcutaneously or by method IV. The method according to claim 71.

73. The aforementioned physiological characteristics are one or more of the following in the subject: HMGCR mRNA level, HMGCR protein level, cholesterol ester (CE) level, triglyceride level, cholesterol level (e.g., high-density lipoprotein cholesterol (HDL-C) level, medium-density lipoprotein cholesterol (IDL-C) level, low-density lipoprotein cholesterol (LDL-C) level, very low-density lipoprotein cholesterol (VLDL-C) level), and lipid levels in the blood or serum. The method according to any one of claims 71 to 72.

Images