Double-stranded RNA targeting proprotein convertase subtilisin kexin type 9 (PCSK9), and method of using the same.

Abstract

This disclosure relates to isolated oligonucleotides containing a double-stranded region targeting the proprotein convertase subtilisin kexin type 9 (PCSK9), as well as delivery systems, kits, and compositions containing the same, and methods for using the same to inhibit or downcontrol PCSK9.

Description

[Technical Field]

[0001] Related applications This application claims priority and interest in PCT application PCT / CN2023 / 101925, filed on 21 June 2023, the entire contents of which are incorporated herein by reference. Sequence List

[0002] The sequence listing XML related to this application is provided electronically in XML format and is incorporated herein by reference. The filename of the XML file containing the sequence listing XML is "SANB_007_SeqList_ST26.xml". The XML file is 460,825 bytes in size, was created on June 20, 2024, and is filed electronically through the USPTO Patent Centre. [Background technology]

[0003] Proprotein convertase subtilisin kexin type 9 (PCSK9) is a member of the subtilisin serine protease family and is known to play a role in cholesterol metabolism. Mutations in the PCSK9 gene have been found to be associated with a form of autosomal dominant hypercholesterolemia. PCSK9 has been shown to play a role in regulating hepatic low-density lipoprotein receptor (LDLR)-mediated LDL uptake. Studies of PCSK9 overexpression in mice have shown elevated total cholesterol and LDL cholesterol levels. PCSK9 overexpression also results in a significant decrease in hepatic LDLR protein associated with increased plasma cholesterol levels, without affecting LDLR mRNA levels, sterol regulatory element-binding protein (SREBP) protein levels, or the SREBP protein nucleus-to-cytoplasmic ratio. Therefore, hepatic PCSK9 levels are positively correlated with circulating LDL cholesterol levels. [Overview of the project] [Problems that the invention aims to solve]

[0004] The observed effects of PCSK9 on lipid uptake and metabolism make it an attractive target for therapeutic intervention. Therefore, there is an unmet need for highly potent and well-tolerated compounds to inhibit PCSK9. This application discloses a novel, highly potent PCSK9 expression inhibitor and its therapeutic use. [Means for solving the problem]

[0005] This disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that together the sense strand and the antisense strand form a double-stranded region.

[0006] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0007] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0008] In some embodiments of the isolated oligonucleotides of this disclosure, the isolated oligonucleotides can induce the degradation of PCSK9 mRNA.

[0009] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0010] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand single-stranded RNA molecule includes a 3' overhang. In some embodiments, the sense strand single-stranded RNA molecule includes at least one nucleotide in the 3' overhang. In some embodiments, the sense strand single-stranded RNA molecule includes two nucleotides in the 3' overhang.

[0011] In some embodiments of the isolated oligonucleotides of this disclosure, the 3' overhang comprises one of the following: thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU).

[0012] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

[0013] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.

[0014] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is 19 to 21 nucleotides long. In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is 20 nucleotides long.

[0015] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region comprises an antisense strand and a sense strand, with one of the antisense strand and sense strand sequences in Tables 1-3, as described in embodiments for carrying out the invention.

[0016] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain comprises a nucleotide sequence as one of SEQ ID NOs: 2-7, 28, or 29.

[0017] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence as one of SEQ ID NOs: 8-13, 30, or 31.

[0018] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand comprises a nucleotide sequence according to one of SEQ ID NOs: 2-7, 28, or 29, and the sense strand comprises a nucleotide sequence according to one of SEQ ID NOs: 8-13, 30, or 31, wherein the antisense and sense strand sequences are sufficiently complementary to form a double-stranded region between the antisense and sense strands.

[0019] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, the double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'); ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'), iv) The antisense strand of the nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'), or v) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3').

[0020] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, the double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'); ii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'), or iii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0021] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand, the antisense strand, or both comprises one or more modified nucleotide sequences.

[0022] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand, the antisense strand, or both comprises one or more modified nucleotide sequences, wherein the antisense strand comprises a monomethyl-protected phosphate mimetic (5'-MeEP).

[0023] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand or the antisense strand or both comprises one or more modified nucleotide sequences, the antisense strand comprises a phosphate mimetic linked to a 5' terminal uracil, the phosphate mimetic being selected from the following: [ka]

[0024] In some embodiments of the isolated oligonucleotides of this disclosure, terminal or internal nucleotides in the sense strand, antisense strand, or both are ligated to a targeting ligand.

[0025] In some embodiments of the isolated oligonucleotides of this disclosure, the targeted ligand is bound to the 3' end of the sense strand (e.g., at the 3' terminal position).

[0026] In some embodiments of the isolated oligonucleotides of this disclosure, the targeted ligand comprises GalNAc.

[0027] In some embodiments of the isolated oligonucleotides of this disclosure, the targeted ligand comprises at least one GalNAc G1b moiety.

[0028] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain comprises nucleotides modified by 2'-F modification and nucleotides modified by 2'-O-methyl modification, according to the formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0029] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide modified with 2'-F modification and a nucleotide modified with 2'-O-methyl modification, according to the formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0030] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain is i) Antisense strand of nucleic acid sequence by sequence number 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3'); ii) Antisense strand of nucleic acid sequence by sequence number 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'); iii) Antisense strand of nucleic acid sequence by sequence number 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'); iv) Antisense strand of nucleic acid sequence by sequence number 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3'); v) Antisense strand of nucleic acid sequence by sequence number 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'); vi) Antisense strand of nucleic acid sequence by array index 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'); vii) Antisense strand of nucleic acid sequence by sequence number 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'); viii) Antisense strand of nucleic acid sequence by sequence number 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mA][mAs][mCs][mC] 3'); ix) Antisense strand of nucleic acid sequence by sequence number 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'); or x) Containing any one of the antisense strands of the nucleic acid sequence by Sequence ID 54 (5' [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, and "MeEPmU" is as follows: [ka] "EPmU" is as follows: [ka] "C-EPmU" is as follows: [ka]

[0031] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is i) Sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) Sense strand of nucleic acid sequence by Sequence ID No. 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Sense strand of nucleic acid sequence by Sequence ID No. 24 (5' [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); vi) Sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Sense strand of nucleic acid sequence by Sequence ID No. 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) The sense strand of the nucleic acid sequence by Sequence ID No. 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); or ix) Contains one of the sense strands of the nucleic acid sequence by sequence number 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU][mC][mA][G1b][G1b][G1b] 3'). "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, and "G1b" is the GalNac G1b portion.

[0032] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is i) Antisense strand of nucleic acid sequence by Sequence ID No. 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3') and sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) i) Antisense strand of nucleic acid sequence by Sequence ID No. 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Antisense strand of nucleic acid sequence by Sequence ID No. 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Antisense strand of nucleic acid sequence by Sequence ID No. 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 24 (5' [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); vi) Antisense strand of nucleic acid sequence by Sequence ID No. 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'), and sense strand of nucleic acid sequence by Sequence ID 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) Antisense strand of nucleic acid sequence by Sequence ID No. 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); ix) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and sense strand of nucleic acid sequence by Sequence ID No. 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU] [mC][mA][G1b][G1b][G1b] 3'); x) The antisense strand of the nucleic acid sequence by Sequence ID No. 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and the sense strand of the nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); or xi) Antisense strand of nucleic acid sequence by Sequence ID No. 54 (5' [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG] [mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3') is included. "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, "G1b" is the GalNac G1b portion, and "MeEPmU" is as follows: [ka] "EPmU" is as follows: [ka] "C-EPmU" is as follows: [ka]

[0033] This disclosure also provides vectors encoding isolated oligonucleotides disclosed herein.

[0034] This disclosure also provides a delivery system comprising isolated oligonucleotides or vectors disclosed herein.

[0035] This disclosure also provides a pharmaceutical composition comprising isolated oligonucleotides, vectors or delivery systems disclosed herein, and pharmaceutically acceptable carriers, diluents or excipients.

[0036] This disclosure also provides kits comprising isolated oligonucleotides, vectors, delivery systems, or pharmaceutical compositions disclosed herein.

[0037] This disclosure also provides methods for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, the methods comprising administering an effective amount of an isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein to the subject.

[0038] In some embodiments of methods for inhibiting or downregulating PCSK9 expression or levels in subjects requiring it, the subjects have hypercholesterolemia, coronary heart disease, peripheral artery disease, stroke, type 2 diabetes, obesity, hypertension, or a combination thereof.

[0039] In some embodiments of methods for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, the method comprises administering an isolated oligonucleotide, vector, delivery system, or pharmaceutical composition in combination with at least a second therapeutic agent.

[0040] This disclosure also provides a method for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, the method comprising administering an effective amount of a first and at least second oligonucleotide disclosed herein to the subject, the first and at least second oligonucleotides comprising different sequences.

[0041] This disclosure also provides methods for treating or preventing diseases or disorders related to abnormal or increased expression or activity of PCSK9, or diseases or disorders involving PCSK9, in subjects requiring such treatment, the methods comprising administering an effective amount of an isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein to a subject. [Brief explanation of the drawing]

[0042] [Figure 1A] Figures 1A and 1B are a series of graphs showing the in vivo efficacy of siRNA compounds listed in Table 2, which have a GalNac conjugate, in reducing human PCSK9 mRNA in the liver of HDI mice after subcutaneous administration of multiple doses of the siRNA compound, as shown. Figure 1A is a graph showing the residual human PCSK9 mRNA in the liver of HDI mice using a single dose of 1 mg / kg. Figure 1B is a graph showing the residual human PCSK9 mRNA in the liver of HDI mice using doses of 0.25 mg / kg (black), 0.5 mg / kg (gray), and 1 mg / kg (white). Data are expressed as the percentage of residual human PCSK9 mRNA relative to the PBS group, normalized to neomycin resistance (NeoR) gene mRNA levels (mean, ±SD). [Figure 1B] Figures 1A and 1B are a series of graphs showing the in vivo efficacy of siRNA compounds listed in Table 2, which have a GalNac conjugate, in reducing human PCSK9 mRNA in the liver of HDI mice after subcutaneous administration of multiple doses of the siRNA compound, as shown. Figure 1A is a graph showing the residual human PCSK9 mRNA in the liver of HDI mice using a single dose of 1 mg / kg. Figure 1B is a graph showing the residual human PCSK9 mRNA in the liver of HDI mice using doses of 0.25 mg / kg (black), 0.5 mg / kg (gray), and 1 mg / kg (white). Data are expressed as the percentage of residual human PCSK9 mRNA relative to the PBS group, normalized to neomycin resistance (NeoR) gene mRNA levels (mean, ±SD). [Figure 2A] Figures 2A–2C are a series of graphs showing the in vivo efficacy of siRNA compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous administration of 3 mg / kg. Figure 2A shows the efficacy of siRNA in lowering serum LDL cholesterol in cynomolgus monkeys. Figure 2B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 2C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 2B] Figures 2A–2C are a series of graphs showing the in vivo efficacy of siRNA compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous administration of 3 mg / kg. Figure 2A shows the efficacy of siRNA in lowering serum LDL cholesterol in cynomolgus monkeys. Figure 2B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 2C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 2C] Figures 2A–2C are a series of graphs showing the in vivo efficacy of siRNA compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous administration of 3 mg / kg. Figure 2A shows the efficacy of siRNA in lowering serum LDL cholesterol in cynomolgus monkeys. Figure 2B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 2C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 3A]Figures 3A–3C are a series of graphs showing the in vivo efficacy of the siRNA compounds listed in Table 3 in cynomolgus monkeys after a single subcutaneous administration of 3 mg / kg. Figure 3A shows the efficacy of siRNA in lowering serum LDL-cholesterol in cynomolgus monkeys. Figure 3B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 3C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 3B] Figures 3A–3C are a series of graphs showing the in vivo efficacy of the siRNA compounds listed in Table 3 in cynomolgus monkeys after a single subcutaneous administration of 3 mg / kg. Figure 3A shows the efficacy of siRNA in lowering serum LDL-cholesterol in cynomolgus monkeys. Figure 3B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 3C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 3C] Figures 3A–3C are a series of graphs showing the in vivo efficacy of the siRNA compounds listed in Table 3 in cynomolgus monkeys after a single subcutaneous administration of 3 mg / kg. Figure 3A shows the efficacy of siRNA in lowering serum LDL-cholesterol in cynomolgus monkeys. Figure 3B shows the efficacy of siRNA in lowering serum PCSK9 protein in cynomolgus monkeys. Figure 3C shows the effect of siRNA in lowering liver PCSK9 mRNA in cynomolgus monkeys. Data are expressed as residual percentage relative to the PBS group, normalized to pre-administration levels on day 1 (mean, ±SD). [Figure 4A]Figures 4A and 4B are a series of graphs showing the ex vivo potency of the siRNA compounds listed in Table 3 in silencing human PCSK9 mRNA in primary human hepatocytes (PHH) compared to a PBS control. As shown, the compounds were added directly to cultured PHH in multiple doses. Figure 4A shows the compounds tested through a free uptake assay at 10 nM. Figure 4B shows the compounds tested through a free uptake assay at eight doses (0.5 nM, 1 nM, 2 nM, 5 nM, 10 nM, 50 nM, 100 nM, and 500 nM). Data are expressed as the percentage of residual PCSK9 mRNA when normalized to the PBS control (mean, ± SD). [Figure 4B] Figures 4A and 4B are a series of graphs showing the ex vivo potency of the siRNA compounds listed in Table 3 in silencing human PCSK9 mRNA in primary human hepatocytes (PHH) compared to a PBS control. As shown, the compounds were added directly to cultured PHH in multiple doses. Figure 4A shows the compounds tested through a free uptake assay at 10 nM. Figure 4B shows the compounds tested through a free uptake assay at eight doses (0.5 nM, 1 nM, 2 nM, 5 nM, 10 nM, 50 nM, 100 nM, and 500 nM). Data are expressed as the percentage of residual PCSK9 mRNA when normalized to the PBS control (mean, ± SD). [Figure 5A] Figures 5A to 5C are a series of graphs showing the efficacy of specific siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the standard solid diet described herein. Figure 5A shows the level of human PSCK9 (hPSCK9) protein in mice during the test period. Figure 5B shows the level of LDL-C in mice during the test period. Figure 5C shows the percentage of residual hPCSK9 mRNA at the end of the test. [Figure 5B]Figures 5A to 5C are a series of graphs showing the efficacy of specific siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the standard solid diet described herein. Figure 5A shows the level of human PSCK9 (hPSCK9) protein in mice during the test period. Figure 5B shows the level of LDL-C in mice during the test period. Figure 5C shows the percentage of residual hPCSK9 mRNA at the end of the test. [Figure 5C] Figures 5A to 5C are a series of graphs showing the efficacy of specific siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the standard solid diet described herein. Figure 5A shows the level of human PSCK9 (hPSCK9) protein in mice during the test period. Figure 5B shows the level of LDL-C in mice during the test period. Figure 5C shows the percentage of residual hPCSK9 mRNA at the end of the test. [Figure 6A] Figures 6A to 6C are a series of graphs showing the evaluation of the efficacy of the siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the high-fat diet described herein. Figure 6A shows the level of hPSCK9 protein in mice during the study period. Figure 6B shows the level of LDL-C in mice during the study period. Figure 6C shows the percentage of residual hPCSK9 mRNA at the end of the study. [Figure 6B] Figures 6A to 6C are a series of graphs showing the evaluation of the efficacy of the siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the high-fat diet described herein. Figure 6A shows the level of hPSCK9 protein in mice during the study period. Figure 6B shows the level of LDL-C in mice during the study period. Figure 6C shows the percentage of residual hPCSK9 mRNA at the end of the study. [Figure 6C]Figures 6A to 6C are a series of graphs showing the evaluation of the efficacy of the siRNA compounds listed in Table 3 in a humanized PCSK9 gene-transfected mouse model fed the high-fat diet described herein. Figure 6A shows the level of hPSCK9 protein in mice during the study period. Figure 6B shows the level of LDL-C in mice during the study period. Figure 6C shows the percentage of residual hPCSK9 mRNA at the end of the study. [Figure 7A] Figures 7A and 7B are a series of graphs illustrating the evaluation of the efficacy of the siRNA compounds listed in Table 3 in a cynomolgus monkey (Macaca fascicularis) model of spontaneously occurring hypercholesterolemia as described herein. Figure 7A shows the percentage of residual serum PCSK9 protein during the study period in monkeys administered PBS (control) or the compounds in Table 3. Figure 7B shows the percentage of residual serum LDL-C during the study period in monkeys administered PBS (control) or the compounds in Table 3. [Figure 7B] Figures 7A and 7B are a series of graphs illustrating the evaluation of the efficacy of the siRNA compounds listed in Table 3 in a cynomolgus monkey (Macaca fascicularis) model of spontaneously occurring hypercholesterolemia as described herein. Figure 7A shows the percentage of residual serum PCSK9 protein during the study period in monkeys administered PBS (control) or the compounds in Table 3. Figure 7B shows the percentage of residual serum LDL-C during the study period in monkeys administered PBS (control) or the compounds in Table 3. [Modes for carrying out the invention]

[0043] This disclosure provides isolated oligonucleotides (or oligonucleotides) that form double-stranded regions, preferably small interfering RNAs (siRNAs), which can reduce PCSK9 mRNA expression and, consequently, the expression level of the PCSK9 protein in target cells. The oligonucleotides disclosed herein may have therapeutic applications in regulating PCSK9 expression for the treatment of diseases including, but not limited to, cardiovascular disease (CVD), atherosclerosis, hypercholesterolemia, hyperlipidemia, or hypertriglyceridemia.

[0044] This disclosure identifies a specific region within PCSK9 mRNA that provides a target for binding to double-stranded oligonucleotides, such as siRNA, resulting in a decrease in PCSK9 mRNA expression levels.

[0045] The PCSK9 mRNA sequence described in this specification is Accession No. NM_174936.4: AGCGACGTCGAGGCGCTCATGGTTGCAGGCGGGCGCCGCCGTTCAGTTCAGGGT CTGAGCCTGGAGGAGTGAGCCAGGCAGTGAGACTGGCTCGGGCGGGCCGGGAC GCGTCGTTGCAGCAGCGGCTCCCAGCTCCCAGCCAGGATTCCGCGCGCCCCTTCA CGCGCCCTGCTCCTGAACTTCAGCTCCTGCACAGTCCTCCCCACCGCAAGGCTCA AGGCGCCGCCGGCGTGGACCGCGCACGGCCTCTAGGTCTCCTCGCCAGGACAGC AACCTCTCCCCTGGCCCTCATGGGCACCGTCAGCTCCAGGCGGTCCTGGTGGCCG CTGCCACTGCTGCTGCTGCTGCTGCTGCTCCTGGGTCCCGCGGGCGCCCGTGCGC AGGAGGACGAGGACGGCGACTACGAGGAGCTGGTGCTAGCCTTGCGTTCCGAGG AGGACGGCCTGGCCGAAGCACCCGAGCACGGAACCACAGCCACCTTCCACCGCT GCGCCAAGGATCCGTGGAGGTTGCCTGGCACCTACGTGGTGGTGCTGAAGGAGG AGACCCACCTCTCGCAGTCAGAGCGCACTGCCCGCCGCCTGCAGGCCCAGGCTG CCCGCCGGGGATACCTCACCAAGATCCTGCATGTCTTCCATGGCCTTCTTCCTGG CTTCCTGGTGAAGATGAGTGGCGACCTGCTGGAGCTGGCCTTGAAGTTGCCCCAT GTCGACTACATCGAGGAGGACTCCTCTGTCTTTGCCCAGAGCATCCCGTGGAACC TGGAGCGGATTACCCCTCCACGGTACCGGGCGGATGAATACCAGCCCCCCGACG GAGGCAGCCTGGTGGAGGTGTATCTCCTAGACACCAGCATACAGAGTGACCACC GGGAAATCGAGGGCAGGGTCATGGTCACCGACTTCGAGAATGTGCCCGAGGAGGACGGGACCCGCTTCCACAGACAGGCCAGCAAGTGTGACAGTCATGGCACCCACC TGGCAGGGGTGGTCAGCGGCCGGGATGCCGGCGTGGCCAAGGGTGCCAGCATGC GCAGCCTGCGCGTGCTCAACTGCCAAGGGAAGGGCACGGTTAGCGGCACCCTCA TAGGCCTGGAGTTTATTCGGAAAAGCCAGCTGGTCCAGCCTGTGGGGCCACTGGT GGTGCTGCTGCCCCTGGCGGGTGGGTACAGCCGCGTCCTCAACGCCGCCTGCCAG CGCCTGGCGAGGGCTGGGGTCGTGCTGGTCACCGCTGCCGGCAACTTCCGGGAC GATGCCTGCCTCTACTCCCCAGCCTCAGCTCCCGAGGTCATCACAGTTGGGGCCA CCAATGCCCAAGACCAGCCGGTGACCCTGGGGACTTTGGGGACCAACTTTGGCC GCTGTGTGGACCTCTTTGCCCCAGGGGAGGACATCATTGGTGCCTCCAGCGACTG CAGCACCTGCTTTGTGTCACAGAGTGGGACATCACAGGCTGCTGCCCACGTGGCT GGCATTGCAGCCATGATGCTGTCTGCCGAGCCGGAGCTCACCCTGGCCGAGTTGA GGCAGAGACTGATCCACTTCTCTGCCAAAGATGTCATCAATGAGGCCTGGTTCCC TGAGGACCAGCGGGTACTGACCCCCAACCTGGTGGCCGCCCTGCCCCCCAGCAC CCATGGGGCAGGTTGGCAGCTGTTTTGCAGGACTGTATGGTCAGCACACTCGGG GCCTACACGGATGGCCACAGCCGTCGCCCGCTGCGCCCCAGATGAGGAGCTGCT GAGCTGCTCCAGTTTCTCCAGGAGTGGGAAGCGGCGGGGCGAGCGCATGGAGGC CCAAGGGGGCAAGCTGGTCTGCCGGGCCCACAACGCTTTTGGGGGTGAGGGTGT CTACGCCATTGCCAGGTGCTGCCTGCTACCCCAGGCCAACTGCAGCGTCCACACAGCTCCACCAGCTGAGGCCAGCATGGGGACCCGTGTCCACTGCCACCAACAGGGC CACGTCCTCACAGGCTGCAGCTCCCACTGGGAGGTGGAGGACCTTGGCACCCAC AAGCCGCCTGTGCTGAGGCCACGAGGTCAGCCCAACCAGTGCGTGGGCCACAGG GAGGCCAGCATCCACGCTTCCTGCTGCCATGCCCCAGGTCTGGAATGCAAAGTCA AGGAGCATGGAATCCCGGCCCCTCAGGAGCAGGTGACCGTGGCCTGCGAGGAGG GCTGGACCCTGACTGGCTGCAGTGCCCTCCCTGGGACCTCCCACGTCCTGGGGGC CTACGCCGTAGACAACACGTGTGTAGTCAGGAGCCGGGACGTCAGCACTACAGG CAGCACCAGCGAAGGGGCCGTGACAGCCGTTGCCATCTGCTGCCGGAGCCGGCA CCTGGCGCAGGCCTCCCAGGAGCTCCAGTGACAGCCCCATCCCAGGATGGGTGT CTGGGGAGGGTCAAGGGCTGGGGCTGAGCTTTAAAATGGTTCCGACTTGTCCCTC TCTCAGCCCTCCATGGCCTGGCACGAGGGGATGGGGATGCTTCCGCCTTTCCGGG GCTGCTGGCCTGGCCCTTGAGTGGGGCAGCCTCCTTGCCTGGAACTCACTCACTC TGGGTGCCTCCTCCCCAGGTGGAGGTGCCAGGAAGCTCCCTCCCTCACTGTGGGG CATTTCACCATTCAAACAGGTCGAGCTGTGCTCGGGTGCTGCCAGCTGCTCCCAA TGTGCCGATGTCCGTGGGCAGAATGACTTTTATTGAGCTCTTGTTCCGTGCCAGG CATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGA GGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGG TGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGAThe mRNA sequence of PCSK9 according to [[SEQ ID NO:1]]: TTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTG CGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTC TATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCT AGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCC ACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGG AACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGAGCCAGAAAC GCAGATTGGGCTGGCTCTGAAGCCAAGCCTCTTCTTACTTCACCCGGCTGGGCTC CTCATTTTTACGGGTAACAGTGAGGCTGGGAAGGGGAACACAGACCAGGAAGCT CGGTGAGTGATGGCAGAACGATGCCTGCAGGCATGGAACTTTTTCCGTTATCACC CAGGCCTGATTCACTGGCCTGGCGGAGATGCTTCTAAGGCATGGTCGGGGGAGA GGGCCAACAACTGTCCCTCCTTGAGCACCAGCCCCACCCAAGCAAGCAGACATT TATCTTTTGGGTCTGTCCTCTCTGTTGCCTTTTTACAGCCAACTTTTCTAGACCTGT TTTGCTTTTGTAACTTGAAGATATTTATTCTGGGTTTTGTAGCATTTTTATTAATAT GGTGACTTTTTAAAATAAAAACAAACAAACGTTGTCCTAA.

[0046] Please note that in the translation, "配列番号1" is translated as "[[SEQ ID NO:1]]" as per the requirement to preserve the specific format. Also, the original text seems to have some inconsistent or unclear parts in terms of proper biological sequence presentation and grammar, but the translation adheres to the given rules.This disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0047] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0048] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1.

[0049] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0050] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0051] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0052] The PCSK9 mRNA sequence according to Sequence ID No. 1 described herein is any heterologous mRNA sequence having sufficient identity with PCSK9 according to accession number NM_174936.4 described herein, enabling binding to the sense strand of the oligonucleotide of this disclosure.

[0053] In some embodiments of the isolated oligonucleotides of this disclosure, the isolated oligonucleotides can induce the degradation of PCSK9 mRNA.

[0054] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0055] In some embodiments, the isolated oligonucleotides of the present disclosure are small interfering RNAs (siRNAs). Accordingly, the present disclosure provides siRNAs comprising a sense region and an antisense region complementary to the sense region, wherein the sense region comprises a sequence at least 70% to 100% identical to the PCSK9 mRNA sequence. definition

[0056] "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). Double-stranded RNA molecules such as siRNA (small interfering RNA), miRNA (microRNA), shRNA (small hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-binding RNA), or rasiRNA (repeat-associated siRNA), and their modified forms, can all mediate RNA interference. These dsRNA molecules may be commercially available, but they may also be designed and prepared based on known sequence information, etc. The antisense strands of these molecules may include RNA, DNA, PNA, or a combination thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene. These dsRNA molecules may also contain one or more modified nucleotides, as described herein, which may be incorporated into either strand.

[0057] In the RNAi gene silencing or knockdown process, a dsRNA containing a first (antisense) strand complementary to a portion of the target gene and a second (sense) strand fully or partially complementary to the first antisense strand is introduced into the organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNAs), which are then distributed throughout the organism, reducing the messenger RNA of the target gene and potentially resulting in a phenotype that closely resembles the phenotype resulting from the complete or partial deletion of the target gene.

[0058] Certain dsRNAs within a cell can be subjected to the action of the dicer enzyme, a ribonuclease III enzyme. Dicer can process dsRNAs into smaller molecules, namely siRNAs. RNAi also contains an endonuclease complex known as the RNA-induced silencing complex (RISC). After cleavage by dicer, the siRNA enters the RISC complex and directly cleaves a single-stranded RNA target having a sequence complementary to the antisense strand of the siRNA double helix. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA occurs in the center of the region complementary to the antisense strand of the siRNA double helix. Thus, siRNAs can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0059] As used herein, “target gene” or “target sequence” refers to a gene or gene sequence whose corresponding RNA is targeted for degradation via the RNAi pathway using the dsRNA or siRNA described herein. For example, to target a gene using siRNA, the siRNA comprises an antisense region complementary or substantially complementary to at least a portion of the target gene or sequence, and a sense strand complementary to the antisense strand. Once introduced into a cell, the siRNA directs the RISC complex to cleave the RNA containing the target sequence, thereby degrading the RNA.

[0060] As used herein, “oligonucleotide,” “nucleic acid,” “nucleotide sequence,” and “polynucleotide” are interchangeable and encompass both cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, as well as RNA and DNA chimeras. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides, regardless of the length of the chain. Nucleic acids may be double-stranded or single-stranded. If single-stranded, the nucleic acid may be a sense strand or an antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Using such oligonucleotides, nucleic acids with altered base-pairing ability or increased resistance to nucleases can be prepared, for example. The Disclosure further provides nucleic acids that are complements (which may be either full complement or partial complement) of the nucleic acids, nucleotide sequences, or polynucleotides of the Disclosure. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, and hypoxanthine may also be used for antisense, dsRNA, and ribozyme pairing. Other modifications are also possible, such as modifications to the phosphodiester backbone of the ribose sugar group of RNA, or modifications to 2'-fluoro, 2'-hydroxy, or 2'-O-methyl.

[0061] The term “isolated” may refer to nucleic acids, nucleotide sequences, or polypeptides (if produced by recombinant DNA technology) or chemical precursors or other chemical substances (if chemically synthesized) substantially free of cellular material, viral material, and / or culture medium. Furthermore, “isolated fragments” are fragments of nucleic acids, nucleotide sequences, or polypeptides that do not occur naturally as fragments and are not found in their natural state. “Isolated” does not mean that the preparation is technically pure (homogeneous), but is pure enough to provide a polypeptide or nucleic acid in a form that can be used for its intended purpose.

[0062] The terms "region" or "fragment" are used interchangeably and apply to oligonucleotides.

[0063] The PCSK9 mRNA sequences described herein will be understood to mean the full-length PCSK9 mRNA nucleotide sequence, unless otherwise indicated. In some embodiments, the PCSK9 mRNA sequence is a nucleotide sequence that is identical or substantially identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to a reference nucleic acid or nucleotide sequence, consisting essentially of, and / or consisting of a nucleotide sequence of a contiguous nucleotide of a length shorter than that of the reference nucleic acid or nucleotide sequence of the PCSK9 mRNA sequence. Such nucleic acid fragments according to the present disclosure may, where appropriate, be included in larger polynucleotides of which they are components. In some embodiments, such fragments may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more contiguous nucleotides of the nucleic acid sequence or nucleotide sequence according to the present disclosure.

[0064] As used herein, "complementary" polynucleotides are those that can base pair according to the standard Watson-Crick complementarity rules. Specifically, purines form base pairs with pyrimidines to form combinations of guanine-cytosine pairing (G:C), and in the case of DNA, adenine-thymine pairing (A:T), or in the case of RNA, adenine-uracil pairing (A:U). For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". It is understood that two polynucleotides can hybridize to each other as long as each has at least one region that is substantially complementary to the other, even if they are not completely complementary to each other.

[0065] As used herein, the term “substantially complementary” means that the sense strand is substantially identical to the nucleotide sequence within the defined region of Sequence ID No. 1 and is at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to it. As used herein, the term “substantially complementary” means that two nucleic acid sequences are complementary to at least 90%, 95%, or 99% of their nucleotides.

[0066] In some embodiments, two nucleic acid sequences may be complementary to at least 90%, 95%, 96%, 97%, 98%, 99%, or more of their nucleotides. In some embodiments, two nucleic acid sequences may be 90%-95% complementary, 70%-100% complementary, 95%-96% complementary, 90%-100% complementary, 96%-97% complementary, 60%-80% complementary, 97%-98% complementary, 70%-90% complementary, 98%-99% complementary, 80%-100% complementary, or 99%-100% complementary.

[0067] The term "substantially complementary" may also mean that two nucleic acid sequences, a sense strand and an antisense strand, are sufficiently complementary to link the sense and antisense strands together to form a double-stranded region containing 19–25 nucleotides in length. The term "substantially complementary" may also mean that two nucleic acid sequences can hybridize under high stringency conditions, such conditions are well known in the art.

[0068] As used herein, the terms “substantially identical” or “sufficiently identical” as used interchangeably herein mean that the nucleotide sequence in the defined region of SEQ ID NO: 1 is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., 70%–80%, 80%–90%, 90%–95%, 95%–99%, or 99%–100%) identical to that of the nucleotide sequence in the defined region of SEQ ID NO: 1.

[0069] Unless otherwise specified, the terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein.

[0070] As used herein, the term “identity” means that sequences are compared to each other as follows: To determine the percentage of identity between two nucleic acid sequences, the sequences can first be aligned to each other, and then the comparison of these sequences can be made. For this purpose, for example, a gap can be inserted into the sequence of the first nucleic acid sequence, and a nucleotide can be compared to the corresponding position in the second nucleic acid sequence. The two sequences are identical at this position if the position in the first nucleic acid sequence is occupied by the same nucleotide as the position in the second sequence. The percentage of identity between two sequences is a function of the number of identical positions divided by the total number of positions compared in all the sequences examined.

[0071] As used interchangeably herein for aligned segments of test sequences and reference sequences, “percent identity” or “% identity” is the percentage of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined portion of the reference sequence.

[0072] The percentage of identity between two sequences can be determined using mathematical algorithms. A preferred but not limited example of a mathematical algorithm that may be used to compare two sequences is the algorithm described in Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated into an NBLAST program that can identify sequences having the desired identity with the sequences of this disclosure. To obtain gap alignment as described herein, the “Gapped BLAST” program described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402 can be used. When using the BLAST and Gapped BLAST programs, pre-configured parameters of a specific program (e.g., NBLAST) can be used. The sequences may be further aligned using version 9 of the Genetic Computing Group's GAP (Global Alignment Program), which uses a pre-configured (BLOSUM62) matrix (values ​​-4 to +11), a gap-opening penalty of -12 (for the first zero in the gap), and a gap-extending penalty of -4 (for each additional consecutive zero in the gap). After alignment, the percentage of identity is calculated by expressing the number of matches as the percentage of nucleic acid content in the claimed sequences. The method described for determining the percentage of identity of two nucleic acid sequences may also be used in correspondence on the encoded amino acid sequences, if necessary.

[0073] Useful methods for determining sequence identity are disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)) and Carillo, H., and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center Biotechnology Information (NCBI) at the National Library of Medicine, National Institute of Health, Bethesda, Md. 20894. See BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)). BLAST program versions 2.0 and above allow for the introduction of gaps (deletions and insertions) into the alignment. For peptide sequences, sequence identity can be determined using BLASTX. For polynucleotide sequences, sequence identity can be determined using BLASTN. Percent identity can be 70% or higher, for example, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0074] As used herein, “heterogeneous” refers to a nucleic acid sequence that originates from a different species, or from the same species or organism but is modified from either its original form or the form primarily expressed within the cell. Thus, a nucleotide sequence that originates from a different organism or species than the cell into which it is introduced is heterogeneous with respect to that cell and its offspring. Furthermore, heterogeneous nucleotide sequences may originate from the same natural original cell type and contain the nucleotide sequence to be inserted therein, but exist in a non-natural state, for example, at a different copy number and / or under the control of regulatory sequences different from those found in nature.

[0075] Double-stranded RNA targeting PCSK9

[0076] This disclosure provides isolated oligonucleotides comprising a double-stranded RNA (dsRNA) region that targets the PCSK9 mRNA sequence for degradation. The double-stranded RNA molecule of this disclosure may be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a small hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a dicer substrate that is processed in a cell to produce siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.

[0077] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets the PCSK9 mRNA sequence for degradation. In some embodiments, the PCSK9-targeting siRNA is packaged into a delivery system described herein (e.g., nanoparticles).

[0078] The isolated oligonucleotides of this disclosure that target PCSK9 for degradation may include a sense strand that is at least 70% identical to any fragment of PCSK9 mRNA, e.g., the PCSK9 mRNA of SEQ ID NO: 1. In some embodiments, the sense strand includes, or is essentially derived from, a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. The siRNAs that target PCSK9 for degradation may include an antisense strand that is at least 70% identical to any fragment of PCSK9 mRNA, e.g., a sequence complementary to the PCSK9 mRNA of SEQ ID NO: 1. In some embodiments, the antisense strand includes, or is essentially derived from, a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense region and the antisense region are complementary and base-pair to form an RNA double-strand structure. A fragment of PCSK9 mRNA that has percent identity with the sense region of siRNA and is complementary to the antisense region of siRNA may be the protein-coding sequence of mRNA, the untranslated region (UTR) (5'UTR or 3'UTR), or both.

[0079] In some embodiments, the isolated oligonucleotides of the Disclosure include a sense region and an antisense region complementary to the sense region, which together form an RNA double helix, and the sense region contains a sequence that is at least 70% identical to the PCSK9 mRNA sequence. In some embodiments, the sense region is identical to the PCSK9 mRNA sequence.

[0080] As used herein, the terms “sense strand” or “sense region” refer to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of an isolated oligonucleotide of the disclosed molecule may contain a nucleic acid sequence having some percentage of identity with a target nucleic acid sequence, such as a PCSK9 mRNA sequence. In some cases, the sense region may have 100% identity, i.e., complete identity or homology, with the target nucleic acid sequence. In other cases, there may be one or more mismatches between the sense region and the target nucleic acid sequence. For example, there may be one, two, three, four, five, six, or seven mismatches between the sense region and the target nucleic acid sequence.

[0081] As used herein, the terms “antisense strand” or “antisense region” refer to a nucleotide sequence of an isolated oligonucleotide of the disclosed herein that is partially or fully complementary to at least a portion of the target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of the disclosed molecule may include a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0082] In some embodiments, the sense region includes a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence or region of sequence number 1, as disclosed herein. In some embodiments, the sense region is essentially made up of a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence or region of sequence number 1, as disclosed herein. In some embodiments, the sense region includes a sequence that is identical to the sequence or region of sequence number 1, as disclosed herein. In some embodiments, the sense region is essentially made up of a sequence that is identical to the sequence or region of sequence number 1, as disclosed herein.

[0083] In some embodiments, the sense region of an isolated oligonucleotide of this disclosure targeting PCSK9 has one or more mismatches between the sequence of the isolated oligonucleotide and the PCSK9 sequence. For example, the sense region sequence may have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the PCSK9 sequence. In some embodiments, the PCSK9 sequence is the PCSK9 3' untranslated region sequence (3'UTR). While we do not wish to be bound by theory, siRNAs targeting the 3'UTR are thought to exhibit increased mismatch resistance compared to isolated oligonucleotides targeting the coding region of a gene. Furthermore, isolated oligonucleotide RNAs may be resistant to mismatches outside the seed region. As used herein, the “seed region” of an isolated oligonucleotide refers to base pairs 2-8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes with the target mRNA.

[0084] In some embodiments, the antisense region comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence of SEQ ID NO: 1 or a sequence complementary to the region of SEQ ID NO: 1 as disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence of SEQ ID NO: 1 or a sequence complementary to the region of SEQ ID NO: 1. In some embodiments, the antisense region comprises a sequence that is identical to the sequence of SEQ ID NO: 1 or a sequence complementary to the region of SEQ ID NO: 1. In some embodiments, the sense region consists essentially of a sequence that is complementary to the sequence of SEQ ID NO: 1 or the region of SEQ ID NO: 1.

[0085] The antisense region of the isolated oligonucleotide targeting PCSK9 of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are completely complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0086] Generally, the isolated oligonucleotide of the present disclosure comprises an RNA duplex that is about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is about 17 to about 24 nucleotides in length, about 18 to about 23 nucleotides in length, or about 19 to about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.

[0087] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules. In some embodiments of the isolated oligonucleotides of this disclosure, the PCSK9-targeting siRNA comprises two distinct single-stranded RNAs: a first single-stranded RNA containing a sense region and a second single-stranded RNA containing an antisense region, which hybridize to form an RNA double helix.

[0088] In some embodiments, the isolated oligonucleotides of the present disclosure may have one or more overhangs from the double-stranded region. The overhangs, which are non-base-pair single-stranded regions, may be 1 to 8 nucleotides or longer in length. The overhang may be a 3' overhang having a single-stranded region of 1 to 8 nucleotides in length at the 3' end of the chain. The overhang may be a 5' overhang having a single-stranded region of 1 to 8 nucleotides in length at the 5' end of the chain.

[0089] The overhangs of the isolated oligonucleotides in this disclosure may be of the same length or may be of different lengths.

[0090] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand single-stranded RNA molecule includes a 3' overhang. In some embodiments, the sense strand single-stranded RNA molecule includes at least one nucleotide. In some embodiments, the sense strand single-stranded RNA molecule includes two nucleotides.

[0091] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense single-stranded RNA molecule includes a 3' overhang. In some embodiments, the 3' overhang in the antisense single-stranded RNA molecule includes at least one nucleotide. In some embodiments, the 3' overhang in the antisense single-stranded RNA molecule includes two nucleotides.

[0092] In additional embodiments, the isolated oligonucleotides of the present disclosure have overhangs at each end, for example, 3'-dinucleotide overhangs. The 5'-terminal and 3'-terminal overhangs may be of different lengths or the same length.

[0093] The overhangs of isolated oligonucleotides of this disclosure may contain one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both of the overhang nucleotides of the siRNA may be 2'-deoxyribonucleotides.

[0094] In some embodiments, the first single-stranded RNA molecule includes a first 3' overhang. In some embodiments, the second single-stranded RNA molecule includes a second 3' overhang. In some embodiments, the first and second 3' overhangs include dinucleotides.

[0095] In some embodiments of the isolated oligonucleotides of this disclosure, the 3' overhang comprises one of the following: thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the isolated oligonucleotides of this disclosure have a 3' overhang comprising a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. While we do not wish to be bound by theory, it is thought that 3' overhangs, such as dinucleotide overhangs, enhance siRNA-mediated mRNA degradation by enhancing siRNA-RISC complex formation and / or the rate of target mRNA cleavage by the siRNA-RISC complex.

[0096] In some embodiments, the isolated oligonucleotides of the Disclosure may have one or more blunt ends where the double-stranded region terminates without an overhang, and the chain is a base paired with the end of the double-stranded region. In some embodiments, the isolated oligonucleotides of the Disclosure may have one or more blunt ends, or one or more overhangs, or a combination of blunt and overhang ends. For example, the 5' end of an siRNA may be blunt, and the 3' end of the same isolated oligonucleotide may include an overhang, or vice versa.

[0097] In some embodiments, the isolated oligonucleotides of this disclosure have blunt ends.

[0098] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region comprises an antisense strand and a sense strand, with one of the antisense strand and sense strand sequences in Table 1, as described below.

[0099] [Table 1]

[0100] In some embodiments, the sense region includes a sequence selected from any one of the sense strand / passenger strand sequences listed in Tables 1-3. In some embodiments, the antisense region includes a sequence selected from any one of the antisense strand / guide strand sequences listed in Tables 1-3. In some embodiments, the sense region and antisense region include complementary sequences selected from the groups listed in Tables 1-3.

[0101] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain comprises a nucleotide sequence as one of SEQ ID NOs: 2-7, 28, or 29.

[0102] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence as one of SEQ ID NOs: 8-13, 30, or 31.

[0103] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand comprises a nucleotide sequence according to one of SEQ ID NOs: 2-7, 28, or 29, and the sense strand comprises a nucleotide sequence according to one of SEQ ID NOs: 8-13, 30, or 31, wherein the antisense and sense strand sequences are sufficiently complementary to form a double-stranded region between the antisense and sense strands.

[0104] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides include (a) a sense strand comprising an X1 nucleotide, wherein at least one nucleotide is modified with a first modification, each of the remaining nucleotides is independently modified with a second modification, X1 is an integer selected from 13 to 36, and the first and second modifications are different; and (b) an antisense strand comprising an X2 nucleotide, wherein at least one nucleotide is modified with a third modification, each of the remaining nucleotides is independently modified with a fourth modification, X2 is an integer selected from 18 to 31, and the third and fourth modifications are different.

[0105] In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 18 to 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 20 to 23. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 20 or 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 22 or 23. In some embodiments, the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is equal to the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure plus 2. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 23. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 20, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 22.

[0106] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides include (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification, and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are identical or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification, and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are identical or different.

[0107] In some embodiments, the sense chain of an isolated oligonucleotide of the Disclosure comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense chain of an isolated oligonucleotide of the Disclosure comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, in the sense chain or antisense chain, or in both the sense and antisense chains, the modified phosphate backbone comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by partial substitution of one or more oxygen atoms, the portion of which is bonded to the phosphorus atom in the phosphodiester bond by a carbon, nitrogen, or sulfur atom in the portion, or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramide diester, mesylphosphoamide, or phosphonoacetate.

[0108] In some embodiments, the isolated oligonucleotides of the Disclosure comprise one or more non-natural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the isolated oligonucleotides of the Disclosure comprise a phosphate mimetic at the 5' terminal nucleotide. In some embodiments, the 5'-phosphate mimetic is an ethyl phosphonate, a vinyl phosphonate, or an analog thereof.

[0109] In some embodiments, the antisense strand of the isolated oligonucleotide of the Disclosure contains at least two single-stranded nucleotides at its 3'-terminus.

[0110] This disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0111] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0112] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1.

[0113] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, the double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'), iv) The antisense strand of the nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'), or v) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3').

[0114] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, the double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), ii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'), or iii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0115] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0116] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0117] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1.

[0118] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3569–3593 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, the double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), ii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'), or iii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0119] At least 50% at 0.02 nM

[0120] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates PCSK9 mRNA expression by 20%–50% (e.g., 20%–25%, 25%–30%, 30%–35%, 35%–40%, 40%–45%, or 45%–50%) at a dose of 0.02 nM.

[0121] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and antisense strand form a double-stranded region, and at a dose of 0.02 nM, attenuates PCSK9 mRNA expression by 20%–50%, the double-stranded region i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), iv) Antisense strand of nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); v) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'), vi) Antisense strand of nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); vii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'), or viii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0122] At least 50% at 0.1 nM

[0123] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates PCSK9 mRNA expression by 20%–50% (e.g., 20%–25%, 25%–30%, 30%–35%, 35%–40%, 40%–45%, or 45%–50%) at a dose of 0.1 nM.

[0124] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and antisense strand form a double-stranded region, and at a dose of 0.1 nM, attenuates PCSK9 mRNA expression by 20%–50%, and the double-stranded region i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), iv) Antisense strand of nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); v) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'); vi) Antisense strand of nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); vii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'), or viii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0125] At least 50% at 0.5 nM

[0126] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates PCSK9 mRNA expression by 20%–50% (e.g., 20%–25%, 25%–30%, 30%–35%, 35%–40%, 40%–45%, or 45%–50%) at a dose of 0.5 nM.

[0127] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and antisense strand form a double-stranded region, and at a dose of 0.5 nM, attenuates PCSK9 mRNA expression by 20%–50%, and the double-stranded region i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), iv) Antisense strand of nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); v) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'); vi) Antisense strand of nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); vii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'), or viii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0128] At least 50% at 1.5 nM

[0129] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates PCSK9 mRNA expression by 20%–50% (e.g., 20%–25%, 25%–30%, 30%–35%, 35%–40%, 40%–45%, or 45%–50%) at a dose of 1.5 nM.

[0130] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and antisense strand form a double-stranded region, attenuating PCSK9 mRNA expression by 20%–50% at a dose of 1.5 nM, and the double-stranded region i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), iii) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), iv) Antisense strand of nucleic acid sequence by SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); v) Antisense strand of nucleic acid sequence by SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'); vi) Antisense strand of nucleic acid sequence by SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3'), and sense strand of nucleic acid sequence by SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); vii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 28 (5' UAUGCUACAAAACCCAGAAUAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'), or viii) Includes the antisense strand of the nucleic acid sequence by SEQ ID NO: 29 (5' UUAAUAAAAAUGCUACAAAACC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0131] In some embodiments, the isolated oligonucleotides of this disclosure may include a linker, sometimes referred to as a loop. siRNAs containing a linker or loop are sometimes referred to as small hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of the siRNA are encoded by a single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a double-stranded region. The sense and antisense regions are joined by a linker sequence to form a “hairpin” or “stem-loop” structure. The siRNA may have complementary sense and antisense regions at opposite ends of a single-stranded molecule, so that the molecule can form a complementary sequence portion and a double-stranded region, with the strands linked at one end of the double-stranded region by a linker. The linker may be a nucleotide or a non-nucleotide linker, or a combination thereof. The linker may interact with the first strand and optionally the second strand via covalent or non-covalent interactions.

[0132] Any suitable nucleotide linker sequence is assumed to be within the scope of this disclosure. The siRNAs of this disclosure may include nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkers that link the sense region of the nucleic acid to the antisense region of the nucleic acid. The nucleotide linkers may be 2-nucleotide length linkers, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16-nucleotide length linkers.

[0133] Examples of non-nucleotide linkers include unbasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymer agents, such as polyethylene glycol, for example, those having 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910; and Ferentz et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 4000-4002.

[0134] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0135] In some embodiments, the isolated oligonucleotides of this disclosure are siRNAs that may be dsRNAs of a suitable length for use as a Dicer substrate, and can be processed to produce RISC-active siRNA molecules. See, for example, Rossi et al., US2005 / 0244858.

[0136] The dicer substrate double-stranded RNA (dsRNA) may be long enough to be processed by the dicer to produce active siRNA, and may further include one or more of the following characteristics: (i) the dicer substrate dsRNA may be asymmetric, e.g., having a 3' overhang on the antisense strand; (ii) the dicer substrate dsRNA may have a modified 3' end on the sense strand, e.g., incorporating one or more DNA nucleotides, to direct the dicer to binding and processing the dsRNA into active siRNA; and (iii) the first and second strands of the dicer substrate dsRNA may be 19–30 bp in length.

[0137] In some embodiments, the isolated oligonucleotide of the Disclosure comprises at least one modified nucleotide. In some embodiments of the isolated oligonucleotide of the Disclosure, the sense strand, the antisense strand, or both comprises one or more modified nucleotide sequences. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotide is partially chemically modified. In some embodiments, the isolated oligonucleotide is fully chemically modified.

[0138] In some embodiments, the isolated oligonucleotide contains at least two modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least three modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least four modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least five modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least six modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least sixteen modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least 17 modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least 18 modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least 19 modified nucleotides. In some embodiments, the isolated oligonucleotide contains at least 20 modified nucleotides. In some embodiments, the isolated oligonucleotide contains more than 20 modified nucleotides.In some embodiments, the isolated oligonucleotide contains 20 to 30 modified nucleotides. In some embodiments, the isolated oligonucleotide contains 30 to 40 modified nucleotides. In some embodiments, the isolated oligonucleotide contains 40 to 50 modified nucleotides.

[0139] In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least one modified nucleotide. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least two modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least three modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least four modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least five modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least six modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least seven modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least eight modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least nine modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 10 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 11 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 12 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 13 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 14 modified nucleotides.In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 15 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 16 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 17 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 18 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 19 modified nucleotides. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 20 modified nucleotides.

[0140] In some embodiments, the isolated oligonucleotide comprises two or more modified nucleotides, where at least the first nucleotide comprises the first modification and at least the second nucleotide comprises the second modification. In some embodiments, the first and second modifications are different. In some embodiments, at least the first and at least the second nucleotides are located on different chains of the isolated oligonucleotide. In some embodiments, at least the first and at least the second nucleotides are located on the same chain of the isolated oligonucleotide.

[0141] In some embodiments of isolated oligonucleotides, the isolated oligonucleotide comprises two or more modified nucleotides, wherein at least one modified nucleotide comprises a first modification, at least one modified nucleotide comprises a second modification, and at least one modified nucleotide comprises a third modification. In some embodiments, the isolated oligonucleotide comprises first, second, third, and fourth modifications. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of modification positions between the sense strand and the antisense strand is assumed within the isolated oligonucleotides of this disclosure.

[0142] In some embodiments, the modified nucleotides are located consecutively on the sense strand, the antisense strand, or both. In some embodiments, some but not all of the modified nucleotides are located consecutively on the sense strand, the antisense strand, or both. In some embodiments, the modified nucleotides on the sense strand, the antisense strand, or both are not located consecutively.

[0143] Conceived in this disclosure are isolated oligonucleotides in which any nucleotide on the sense strand or antisense strand may be modified. In some embodiments, any nucleotide on the antisense strand may be modified. In some embodiments, any nucleotide on the antisense strand may be modified.

[0144] In some embodiments, the isolated oligonucleotides of this disclosure include at least one modified nucleotide. In some embodiments, one or more modified nucleotides increase the stability or potency, or both, of the isolated oligonucleotide. In some embodiments, one or more modified nucleotides increase the stability of the RNA duplex and the siRNA.

[0145] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term “locked nucleic acid” or “LNA” includes, but is not limited to, modified RNA nucleotides that include a methylene crosslink in which the ribose portion links the 2' oxygen and 4' carbon. This methylene crosslink locks the ribose into the 3'-end conformation, also known as the North conformation, which is found in type A RNA double helix. The term inaccessible RNA can be used interchangeably with LNA. LNA has a 2'-4' cyclic linkage as described in International Patent Applications WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604 (the contents of which are incorporated herein by reference).

[0146] In some embodiments of the isolated oligonucleotides of this disclosure, the sense chain, the antisense chain, or both comprises at least one nucleotide having a modified phosphate skeleton. In some embodiments, the sense chain of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate skeleton. In some embodiments, the antisense chain of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate skeleton. In some embodiments, the isolated oligonucleotides of this disclosure comprise a modified phosphate skeleton, and the modified phosphate skeleton comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by partial substitution of one or more oxygen atoms, the portion of which is bonded to the phosphorus atom in the phosphodiester bond by a carbon, nitrogen, or sulfur atom in the portion, or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramide diester, mesylphosphoamide, or phosphonoacetate.

[0147] In some embodiments, the isolated oligonucleotides of the Disclosure comprise one or more non-natural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, one or more modified nucleotides comprise phosphorothioate derivatives or acridine-substituted nucleotides. In some embodiments, the isolated oligonucleotides of the Disclosure comprise a phosphate mimetic at the 5'-terminus of an antisense chain, but not limited to vinyl phosphonates or other phosphate analogs. In some embodiments, the 5'-phosphate mimetic is ethyl phosphonate, vinyl phosphonate, or an analog thereof.

[0148] In some embodiments, the modified nucleotides are 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminometho-hyaluracil, dihydrouracil, beta-D-galactosylkeosin, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methyl Contains 2-aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentene-yladenine, uracil-5-oxyacetic acid(v), weibtoxosin, pseudouracil, keosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, or 2,6-diaminopurine.

[0149] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand, antisense strand, or both include a terminal or internal nucleotide linked to one or more targeted ligands. In some embodiments, the terminal or internal nucleotide is directly linked to one or more targeted ligands. In some embodiments, the terminal or internal nucleotide is indirectly linked to one or more targeted ligands by a linker. In some embodiments, the one or more targeted ligands directly or indirectly linked to the terminal or internal nucleotide may further include PK modulators. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeted ligand is selected from one or more of carbohydrates, peptides, lipids, antibodies or fragments thereof, aptamers, albumin, fibrinogen, and folic acid.

[0150] Nucleotide modification

[0151] The isolated oligonucleotides provided herein include (a) a sense strand comprising an X1 nucleotide, wherein at least one nucleotide is modified with a first modification, each of the remaining nucleotides is independently modified with a second modification, X1 is an integer selected from 13 to 36, and the first and second modifications are different; and (b) an antisense strand comprising an X2 nucleotide, wherein at least one nucleotide is modified with a third modification, each of the remaining nucleotides is independently modified with a fourth modification, X2 is an integer selected from 18 to 31, and the third and fourth modifications are different.

[0152] In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 18 to 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 20 to 23. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 20 or 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 22 or 23. In some embodiments, the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is equal to the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure plus 2. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 21, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 23. In some embodiments, the X1 nucleotide of the sense strand of the isolated oligonucleotide of the disclosure is 20, and the X2 nucleotide of the antisense strand of the isolated oligonucleotide of the disclosure is 22.

[0153] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides include (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification, and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are identical or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification, and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are identical or different.

[0154] In some embodiments, the first modification is a modification of the sugar moiety of at least one nucleotide at the 2' position, selected from 2'-F modification, 2'-CN modification, 2'-N3 modification, 2'-deoxy modification, and their equivalents, and combinations thereof. In some embodiments, the first modification is a 2'-F modification, 2'-CN modification, 2'-N3 modification, or 2'-deoxy modification or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, 2'-CN modification, or 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof.

[0155] In some embodiments, the second modification is a modification of one or more sugar moieties of the remaining nucleotide at the 2' position, selected from 2'-C1-C6 alkyl, 2'-OR modification (wherein R is a C1-C6 alkyl which may be substituted with a heteroaryl comprising a C1-C6 alkoxy, acetamide, phenyl, or a 5 or 6-membered ring, and one or two heteroatoms selected from N, O, and S), 2'-amino, and morpholino substitution, and their equivalents, and combinations thereof. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0156] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification.

[0157] In some embodiments, the third modification is a modification of the sugar moiety of at least one nucleotide at the 2' position, selected from 2'-F modification, 2'-CN modification, 2'-N3 modification, 2'-deoxy modification, and their equivalents, as well as combinations thereof. In some embodiments, the third modification is a 2'-F modification, 2'-CN modification, 2'-N3 modification, or 2'-deoxy modification or its stereoisomer. In some embodiments, the third modification is a 2'-F modification, 2'-CN modification, or 2'-N3 modification, or its stereoisomer. In some embodiments, the third modification is a 2'-F modification or its stereoisomer.

[0158] In some embodiments, the fourth modification is a modification of one or more sugar moieties of the remaining nucleotide at the 2' position, selected from 2'-C1-C6 alkyl, 2'-OR modification (wherein R is a C1-C6 alkyl which may be substituted with a heteroaryl comprising a C1-C6 alkoxy, acetamide, phenyl, or a 5 or 6-membered ring, and one or two heteroatoms selected from N, O, and S), 2'-amino, and morpholino substitution, and their equivalents, and combinations thereof. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0159] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification.

[0160] Sense chain

[0161] In some embodiments of the isolated oligonucleotides of the Disclosure, including a sense strand and an antisense strand, at least three nucleotides in the sense strand of the isolated oligonucleotide of the Disclosure are modified by the first modification. In some embodiments, at least two of the at least three nucleotides modified by the first modification are located consecutively in the sense strand of the isolated oligonucleotide of the Disclosure. In some embodiments, at least three of the at least three nucleotides modified by the first modification are located consecutively in the sense strand of the isolated oligonucleotide of the Disclosure.

[0162] In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least four nucleotides are modified by the first modification. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least three of the at least four nucleotides modified by the first modification are located consecutively. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least four of the at least four nucleotides modified by the first modification are located consecutively.

[0163] In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least five nucleotides are modified by the first modification. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least three of the at least five nucleotides modified by the first modification are located consecutively. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least four of the at least five nucleotides modified by the first modification are located consecutively.

[0164] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three nucleotides, at least four nucleotides, or at least five nucleotides modified by the first modification are located at positions 10 to 15 of the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0165] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, two of the at least three nucleotides modified by the first modification are located at positions selected from 10, 11, 12, and 13 of the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified by the first modification are located at positions selected from 10, 11, 12, and 13 of the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least three nucleotides modified by the first modification is located at position 11 of the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0166] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified by the first modification are located at positions 11, 12, and 13 of the antisense strand, from the nucleotide complementary to the first nucleotide at the 5' end. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified by the first modification are located at positions 12, 13, and 14 of the antisense strand, from the nucleotide complementary to the first nucleotide at the 5' end. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified by the first modification are located at positions 10, 11, and 12 of the antisense strand, from the nucleotide complementary to the first nucleotide at the 5' end.

[0167] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least four nucleotides modified by the first modification is located at position 10 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least four nucleotides modified by the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least four nucleotides modified by the first modification is located at position 12 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least four nucleotides modified by the first modification is located at position 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, one of the at least four nucleotides modified by the first modification is located at position 14 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, one of the at least four nucleotides modified by the first modification is located at position 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0168] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four nucleotides modified by the first modification are located at positions 10, 11, 12, and 13 of the antisense strand, from the nucleotide complementary to the first nucleotide at the 5' end.

[0169] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least five nucleotides modified by the first modification are located at positions 10, 11, 12, 13, and 15, from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0170] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified by a first modification, the five nucleotides modified by the first modification being located at positions 10, 11, 12, 13, and 15 of the antisense strand, from the nucleotide complementary to the first nucleotide at the 5'-terminus.

[0171] In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, not all of the at least three, at least four, or at least five nucleotides modified by the first modification are located consecutively. In some embodiments, in the sense strand of the isolated oligonucleotide of the Disclosure, at least three, at least four, or at least five nucleotides are modified by the 2'-F modification.

[0172] In some embodiments, the sense strand of the isolated oligonucleotide of this disclosure is of formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0173] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', and includes nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are each any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0174] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', and includes nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are each any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand includes a nucleotide sequence according to any one of SEQ ID NOs: 8 to 13, 30, or 31.

[0175] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) A aThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 8.

[0176] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 8, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 2.

[0177] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence by SEQ ID NO: 9.

[0178] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16. The sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 9, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 3.

[0179] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 10.

[0180] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16. The sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 10, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 4.

[0181] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 11.

[0182] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 11, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 5.

[0183] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aContaining nucleotides modified with 2'-F modification (「F」) and nucleotides modified with 2'-O-methyl modification (「M」) by 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f and g are any one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO: 12.

[0184] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a Containing nucleotides modified with 2'-F modification (「F」) and nucleotides modified with 2'-O-methyl modification (「M」) by 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f and g are any one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 12, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 6.

[0185] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 13.

[0186] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 13, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 7.

[0187] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b(M)a 3' contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 30.

[0188] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F)d(M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 30, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 28.

[0189] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence of SEQ ID NO: 31.

[0190] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are one of 0 to 16, the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand contains the nucleotide sequence according to SEQ ID NO: 31, and the antisense strand contains the nucleotide sequence according to SEQ ID NO: 29.

[0191] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UUAUCUUCAAGUUACAAAAGCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'), and the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M)c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0192] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UGAAUAAAUAUCUUCAAGUUAC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'), and the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0193] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UAAAAAUGCUACAAAACCCAGA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'), and the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0194] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAAUAAAAAUGCUACAAAACCC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'), and the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0195] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UUUAAUAAAAAUGCUACAAAAC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'), and the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0196] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UUAUUAAUAAAAAUGCUACAAA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'), and the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0197] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UUUAAUAAAAAUGCUACAAAAC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUUGUAGCAUUUUUAUUAAA 3'), and the sense strand of the isolated oligonucleotide is given by formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) aThe formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0198] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UUAUUAAUAAAAAUGCUACAAA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UGUAGCAUUUUUAUUAAUAA 3'), and the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0199] Antisense chain

[0200] In some embodiments, the antisense chain of the isolated oligonucleotides of this disclosure has up to seven nucleotides modified by a third modification.

[0201] In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosed, up to four of the up to seven nucleotides modified by the third modification are located at positions 2 through 8 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosed, at least one of the up to seven nucleotides modified by the third modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand.

[0202] In some embodiments, in the antisense strand of the isolated oligonucleotide of the Disclosure, up to two of the up to seven nucleotides modified by the third modification are located consecutively. In some embodiments, in the antisense strand of the isolated oligonucleotide of the Disclosure, up to two of the up to seven nucleotides modified by the third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0001] In some embodiments, in the antisense chain of the isolated oligonucleotide of the Disclosure, at least one of up to seven nucleotides modified by the third modification is located at position 14 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the Disclosure, two or three of up to seven nucleotides modified by the third modification are located at positions selected from positions 2, 3, 5 and 6 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the Disclosure, three of up to seven nucleotides modified by the third modification are located at positions selected from positions 2, 3, 5 and 6 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the Disclosure, two of up to seven nucleotides modified by the third modification are located at positions 2 and 5 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified by the third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0203] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified by the third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.

[0204] In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosure, one or two of up to seven nucleotides modified by the third modification are located at positions selected from the first nucleotide at the 5' end of the antisense strand, from position 14 to position 16. In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosure, two of up to seven nucleotides modified by the third modification are located at positions 14 to position 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosure, up to seven nucleotides are modified by 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosure, one of up to seven nucleotides modified by the third modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the disclosure, two of up to seven nucleotides modified by the third modification are located at positions 14 to position 16 from the first nucleotide at the 5' end of the antisense strand.

[0205] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain contains up to seven nucleotides modified by a third modification, the up to seven nucleotides being modified by a 2'-F modification. In some embodiments, in the antisense chain of the isolated oligonucleotides of this disclosure, one of the up to seven nucleotides modified by the third modification is located at position 2 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotides of this disclosure, one of the up to seven nucleotides modified by the third modification is located at position 3 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotides of this disclosure, one of the up to seven nucleotides modified by the third modification is located at position 5 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotides of this disclosure, one of the up to seven nucleotides modified by the third modification is located at position 7 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the disclosed, one of up to seven nucleotides modified by the third modification is located at position 10 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the disclosed, one of up to seven nucleotides modified by the third modification is located at position 14 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the disclosed, one of up to seven nucleotides modified by the third modification is located at position 16 from the first nucleotide at the 5' end of the antisense chain. In some embodiments, in the antisense chain of the isolated oligonucleotide of the disclosed, up to seven nucleotides modified by the third modification are located at positions 2, 3, 5, 7, 10, 14 and 16 from the first nucleotide at the 5' end of the antisense chain.

[0206] In some embodiments, the antisense strand of the isolated oligonucleotide of this disclosure is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula contains a nucleotide modified by a 2'-F modification ("F") and a nucleotide modified by a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0207] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains a nucleotide sequence of any one of sequence numbers 2 to 7, 28 or 29.

[0208] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence by SEQ ID NO: 2.

[0209] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 2, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 8.

[0210] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence by SEQ ID NO: 3.

[0211] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 3, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 9.

[0212] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence by SEQ ID NO: 4.

[0213] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 4, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 10.

[0214] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence by SEQ ID NO: 5.

[0215] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 5, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 11.

[0216] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence by SEQ ID NO: 6.

[0217] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 6, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 12.

[0218] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence of SEQ ID NO: 7.

[0219] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence of SEQ ID NO: 7, and the sense strand contains the nucleotide sequence of SEQ ID NO: 13.

[0220] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence of SEQ ID NO: 28.

[0221] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 28, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 30.

[0222] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oThe formula contains a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand contains the nucleotide sequence of SEQ ID NO: 29.

[0223] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain of the isolated oligonucleotide is given by formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The formula includes a nucleotide modified by 2'-F modification ("F") and a nucleotide modified by 2'-O-methyl modification ("M") at 5', where M is a 2'-O-methyl modified nucleotide and F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are one of 0 to 16, and the antisense strand is one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', the antisense strand contains the nucleotide sequence according to SEQ ID NO: 29, and the sense strand contains the nucleotide sequence according to SEQ ID NO: 31.

[0224] Targeted ligand

[0225] In some embodiments, the sense strand or antisense strand or both of the isolated oligonucleotides of the disclosure have terminal or internal nucleotides ligated to a targeting ligand. In some embodiments, the targeting ligand is bound to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the disclosure. In some embodiments, the targeting ligand is bound to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the disclosure. In some embodiments, the targeting ligand is bound to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the disclosure. In some embodiments, the targeting ligand is bound to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the disclosure. In some embodiments, the targeting ligand is bound to one or more nucleotides of at least two single-stranded nucleotides at the 3'-end of the antisense strand of the isolated oligonucleotide of the disclosure.

[0226] In some embodiments, the targeting ligand is selected from one or more of carbohydrates, peptides, lipids, antibodies or their fragments, aptamers, albumin, fibrinogen, and folic acid. In some embodiments, the targeting ligand binds to a surface protein on a cell expressing the target mRNA of the isolated oligonucleotide of the Disclosure. In some embodiments, the targeting ligand mediates the entry of the isolated oligonucleotide of the Disclosure into a cell expressing the target mRNA of the isolated oligonucleotide of the Disclosure.

[0227] In some embodiments, the targeted ligand is a therapeutic ligand. In some embodiments, the targeted ligand is a therapeutic antibody.

[0228] In some embodiments, a targeted ligand is bound to an isolated oligonucleotide of the Disclosure by a linker. In some embodiments, the linker is one of a protein, DNA, RNA, or compound. In some embodiments, the isolated oligonucleotide, linker, and targeted ligand of the Disclosure form a scaffold. As used herein, the term “scaffold” means a compound or complex comprising a linker of the Disclosure, wherein the linker is covalently bound to either or both of the ligand and / or isolated oligonucleotide.

[0229] In some embodiments, the isolated oligonucleotide, linker, and targeted ligand of the Disclosure form a conjugate. As used herein, the term “conjugate” refers to a compound or complex containing an isolated oligonucleotide covalently bound to a ligand via the linker of the Disclosure.

[0230] As used herein, the terms “targeting ligand” or “ligand” refer to a portion that, when covalently bound to a GalNAc oligonucleotide, can mediate its entry into a target site (e.g., a target cell or tissue) or can facilitate or enable its delivery. In some embodiments, the targeting ligand comprises a glycoligand portion (e.g., N-acetylgalactosamine (GalNAc)) that can direct the oligonucleotide to take up into the liver.

[0231] In some embodiments, the targeted ligand binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the targeted ligand binds to the liver, for example, to hepatic parenchymal cells (e.g., via ASGPR).

[0232] Appropriate targeting ligands include, but are not limited to, those disclosed in Winkler (Ther. Deliv., 2013, 4(7):791-809), PCT patent application publications International Publication 2016 / 100401, International Publication 2012 / 089352 and International Publication 2009 / 082607, and U.S. patent application publications 2009 / 0239814, 2012 / 0136042, 2013 / 0158824 and 2009 / 0247608, each incorporated by reference.

[0233] In some embodiments, the targeted ligand includes a carbohydrate moiety.

[0234] As used herein, “carbohydrate portion” refers to a portion comprising one or more monosaccharide units (which may be linear, branched, or cyclic) each having at least six carbon atoms and an oxygen, nitrogen, or sulfur atom bonded to each carbon atom. In some embodiments, the carbohydrate portion comprises monosaccharides, disaccharides, trisaccharides, or tetrasaccharides. In some embodiments, the carbohydrate portion comprises oligosaccharides containing about 4 to 9 monosaccharide units. In some embodiments, the carbohydrate portion comprises polysaccharides (e.g., starch, glycogen, cellulose, or polysaccharide gums).

[0235] In some embodiments, the carbohydrate portion comprises monosaccharides, disaccharides, trisaccharides, or tetrasaccharides. In some embodiments, the carbohydrate portion comprises oligosaccharides (for example, containing about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate portion comprises polysaccharides (for example, starch, glycogen, cellulose, or polysaccharide gum).

[0236] In some embodiments, the ligand can bind to a human asialoglycoprotein receptor (ASGPR), such as human asialoglycoprotein receptor 2 (ASGPR2).

[0237] In some embodiments, the carbohydrate portion comprises sugars (e.g., 1, 2, or 3 sugars). In some embodiments, the carbohydrate portion comprises galactose or a derivative thereof (e.g., 1, 2, or 3 galactose or a derivative thereof). In some embodiments, the carbohydrate portion comprises N-acetylgalactosamine or a derivative thereof (e.g., 1, 2, or 3 N-acetylgalactosamine or a derivative thereof). In some embodiments, the carbohydrate portion comprises N-acetyl-D-galactosylamine or a derivative thereof (e.g., 1, 2, or 3 N-acetyl-D-galactosylamine or a derivative thereof).

[0238] In some embodiments, the carbohydrate portion comprises N-acetylgalactosamine (e.g., 1, 2, or 3 N-acetylgalactosamines). In some embodiments, the carbohydrate portion comprises N-acetyl-D-galactosylamine (e.g., 1, 2, or 3 N-acetyl-D-galactosylamines).

[0239] In some embodiments, the carbohydrate portion comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate portion further comprises a linking portion that links one or more sugars (e.g., N-acetyl-D-galactosylamine) to the linker.

[0240] In some embodiments, the linker includes thioethers (e.g., thiosuccinimide or its hydrolysis analogs), disulfides, triazoles, phosphorothioates, phosphodiesters, esters, amides, or any combination thereof. In some embodiments, the linker is a tribranched linkage portion. Suitable targeting ligands include, but are not limited to, those disclosed in PCT patent application publications International Publication 2015 / 006740, International Publication 2016 / 100401, International Publication 2017 / 214112, International Publication 2018 / 039364, and International Publication 2018 / 045317, each incorporated herein by reference.

[0241] In some embodiments, the targeted ligand comprises a lipid or a lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises C8-C24 fatty acids, cholesterol, vitamins, sterols, phospholipids, or any combination thereof (e.g., one, two, or three of these).

[0242] In some embodiments, the targeted ligand comprises a peptide or peptide moiety (e.g., one, two, or three peptide moieties). In some embodiments, the peptide moiety comprises an integrin, insulin, a glucagon-like peptide, or any combination thereof (e.g., one, two, or three of these). In some embodiments, the targeted ligand comprises an antibody or antibody moiety (e.g., transferrin). In some embodiments, the targeted ligand comprises one, two, or three antibody moieties (e.g., transferrin).

[0243] In some embodiments, the targeted ligand comprises an oligonucleotide (e.g., an aptamer or CpG). In some embodiments, the targeted ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or CpG).

[0244] In some embodiments, the ligand comprises one, two, or three sugars (e.g., N-acetyl-D-galactosylamine), one, two, or three lipid moieties, one, two, or three peptide moieties, one, two, or three antibody moieties, one, two, or three oligonucleotides, or any combination thereof.

[0245] In some embodiments, the linker is bonded to the isolated oligonucleotide of the Disclosure via a phosphate group or an analogue of a phosphate group in the isolated oligonucleotide.

[0246] In some embodiments, the ligand includes a glycoligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can guide the oligonucleotide to be taken up by the liver.

[0247] In some embodiments, the ligand comprises GalNAc or a derivative thereof. In some embodiments, the ligand comprises the GalNAc G1b structure shown below. [ka]

[0248] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, the ligand comprising three GalNAc G1b moieties is contiguously located. In some embodiments, the contiguously located GalNAc G1b moieties are located at the 3' end of the sense strand. In some embodiments, the ligand comprising three contiguously located GalNAc G1b ("G1b") moieties is ligated to a first GalNAc G1b moiety, a second GalNAc G1b moiety, and a third G1b moiety. In some embodiments, the first GalNAc G1b moiety is ligated to the sense strand of an isolated oligonucleotide of the Disclosure.

[0249] In some embodiments of the isolated oligonucleotides of this disclosure, the ligand comprises three GalNAc G1b ("G1b") moieties, wherein the first GalNAc G1b moiety is ligated to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety is also ligated to a second GalNAc G1b moiety, and the second G1b moiety is ligated to a third G1b moiety. In some embodiments, the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are located consecutively at the 3' end of the sense strand.

[0250] In some embodiments of the isolated oligonucleotides of this disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b, or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal nucleotide or a terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker.

[0251] In some embodiments of the isolated oligonucleotides of this disclosure, the isolated oligonucleotide comprises a sense strand and an antisense strand, the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties are located consecutively at the 3' end of the sense strand, and the ligand is ligated to a terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is ligated to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a divalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0252] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the targeting ligand is ligated to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0253] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and antisense strand form a double-stranded region, and the targeting ligand comprises three GalNAc G1b moieties ligated to the 3' end of the sense strand, such that the sense strand comprises SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'); SEQ ID NO: 9 (5' AACUUGAAGAUAUUUAUUCA 3'); SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'); SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA Includes nucleic acid sequences such as 3'); SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'); or SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0254] The binding at the 3' end of the isolated oligonucleotides of this disclosure may be direct via the 5', 3', or 2' hydroxyl group, or indirect via a non-nucleotide linker or nucleoside, utilizing either the 2' or 3' hydroxyl position of the nucleoside. The binding may also utilize a functionalized sugar or nucleic acid base of the 3' terminal nucleotide. In some embodiments, the ligands described herein may be bound to the isolated oligonucleotides of this disclosure using a variety of ligand linkers, which may be cleavable or incleavable.

[0255] In some embodiments of the isolated oligonucleotides of this disclosure, the ligand comprises three GalNAc G1b ("G1b") moieties, wherein the first GalNAc G1b moiety is ligated to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety is also ligated to a second GalNAc G1b moiety, and the second G1b moiety is ligated to a third G1b moiety. In some embodiments, the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are located consecutively at the 3' end of the sense strand.

[0256] In some embodiments of the isolated oligonucleotides of this disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b, or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal nucleotide or a terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker.

[0257] In some embodiments of the isolated oligonucleotides of this disclosure, the ligand comprises three GalNAc G1b ("G1b") moieties, wherein the first GalNAc G1b moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety is also linked to a second GalNAc G1b moiety, and the first GalNAc G1b moiety is linked to the second GalNAc G1b moiety via a linker comprising a phosphorothioate nucleotide bond. In some embodiments, the second G1b moiety is linked to a third G1b moiety. In some embodiments, the second G1b moiety is linked to the third G1b moiety via a linker comprising a phosphorothioate nucleotide bond.

[0258] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises a sense strand and an antisense strand, and the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties located consecutively at the 3' end of the sense strand, the first GalNAc G1b moiety being linked to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety also being linked to a second GalNAc G1b moiety via a linker comprising a phosphorothioate nucleotide linkage, the second G1b moiety being linked to a third G1b moiety via a linker comprising a phosphorothioate nucleotide linkage.

[0259] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the targeting ligand is ligated to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties located consecutively on the 3' end of the sense strand, the first GalNAc G1b moiety being ligated to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety also being ligated to a second GalNAc G1b moiety via a linker comprising a phosphorothioate internucleotide bond, and the second G1b moiety being ligated to a third G1b moiety via a linker comprising a phosphorothioate internucleotide bond.

[0260] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, the targeting ligand comprises three GalNAc G1b parenchyma attached to the 3' end of the sense strand, the first GalNAc G1b parenchyma being linked to the sense strand of the isolated oligonucleotide, the first GalNAc G1b parenchyma being also linked to a second GalNAc G1b parenchyma via a linker comprising a phosphorothioate internucleotide bond, the second G1b parenchyma being linked to a third G1b parenchyma via a linker comprising a phosphorothioate internucleotide bond, and the sense strand comprises SEQ ID NO: 8 (5' CUUUUGUAACUUGAAGAUAA 3'); SEQ ID NO: 9 (5' Includes nucleic acid sequences such as AACUUGAAGAUAUUUAUUCA 3'); SEQ ID NO: 10 (5' UGGGUUUUGUAGCAUUUUUA 3'); SEQ ID NO: 11 (5' GUUUUGUAGCAUUUUUAUUA 3'); SEQ ID NO: 12 (5' UUUGUAGCAUUUUUAUUAAA 3'); SEQ ID NO: 13 (5' UGUAGCAUUUUUAUUAAUAA 3'); SEQ ID NO: 30 (5' AUUCUGGGUUUUGUAGCAUA 3'); or SEQ ID NO: 31 (5' UUUUGUAGCAUUUUUAUUAA 3').

[0261] Modification of phosphate groups

[0262] Modified terminal phosphate groups

[0263] This disclosure further provides oligonucleotides and conjugates containing modified phosphate groups (also called phosphate mimes or phosphate derivatives) for nucleic acid delivery. This disclosure also relates to the use of oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or in the treatment or prevention of disease.

[0264] In some embodiments, the disclosure provides phosphate mimetic forms of 5' terminal nucleotides. While we do not wish to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5' end of an antisense strand), the phosphate mimetic can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, and thus enhance the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0265] In some embodiments of the isolated oligonucleotides of this disclosure, the oligonucleotides include a nucleotide modification at the 5' end. In some embodiments, the 5' end modification provides a functional effect of the phosphate group but is more stable under the environmental conditions to which the oligonucleotide is exposed when administered to a subject. In some embodiments, the isolated oligonucleotides include a phosphate mimetic that is more resistant to phosphatases and other enzymes but minimizes adverse effects on the function of the oligonucleotide (e.g., minimizing the reduction of gene target knockdown when used as an RNAi inhibitor molecule).

[0266] In some embodiments, the 5' end modification is a chemical modification. In some embodiments, the chemical modification enhances the stability of the isolated oligonucleotide against nucleases or other enzymes that degrade or interfere with its structure or activity.

[0267] In some embodiments, the sense or antisense strand of the isolated oligonucleotide of the Disclosure comprises a 5'-terminal phosphate group. In some embodiments, the 5'-terminal phosphate group comprises an unmodified phosphate having the formula -OP(=O)(OH)OH. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate. In some embodiments, the 5'-terminal phosphate group comprises a phosphate having the formula -CH2-P(=X)(OR 1 )OR 2 The formula includes a modified phosphate having, where X is O or S, and R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl. In some embodiments, the modified phosphate is called a "phosphate mimetic".

[0268] As used herein, the terms "halo" or "halogen" refer to fluoro, chloro, bromo, and iodine.

[0269] As used herein, the term "aryl" includes aromatic groups, including "conjugated" groups, or polycyclic systems having one or more aromatic rings, and which do not contain any heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, and naphthyl. Phenyl is a convenient example of an aryl group.

[0270] As used herein, the terms “alkyl” or “C1-C6 alkyl” are intended to include C1, C2, C3, C4, C5, or C6 linear saturated aliphatic hydrocarbon groups and C3, C4, C5, or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Examples of alkyls include, but are not limited to, moieties having 1 to 6 carbon atoms, such as methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, linear or branched alkyls have 6 or fewer carbon atoms (e.g., C1-C6 for linear groups, C3-C6 for branched groups), and in other embodiments, linear or branched alkyls have 4 or fewer carbon atoms. In some embodiments, linear alkyls have 1 carbon atom. In some embodiments, the linear alkyl group has two carbon atoms.

[0271] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. V is either O or CH2. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is either O or S, Y 2 is either O or S, Z stands for H, halogen, or -OR Z And, R Z This is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C 10It is an aryl, and is C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 Aaryl is one or more R Za It may also be replaced with Each R Za These are independently a halogen, a C1-C6 alkyl, or -O-(C1-C6 alkyl), where the C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens. [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0272] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is either O or S, Y 2 is either O or S, Z stands for H, halogen, or -OR Z And, R Z is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C10 aryl), and C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C10 aryl) is one or more R Za It may also be replaced with Each R ZaThese are independently a halogen, a C1-C6 alkyl, or -O-(C1-C6 alkyl), where the C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens. [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0273] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is either O or S, Y 2 is either O or S, Z stands for H, halogen, or -OR Z And, R Z This is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C 10 It is an aryl, and is C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 Aaryl is one or more R Za It may also be replaced with Each R Za These are independently a halogen, a C1-C6 alkyl, or -O-(C1-C6 alkyl), where the C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens. [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0274] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is either O or S, Y 2 is either O or S, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0275] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is either O or S, Y 2 is either O or S, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0276] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0277] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula. [ka] During the ceremony, B is H or a nucleic acid base portion. X is either O or S, R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0278] In some embodiments, V is O.

[0279] In some embodiments, V is CH2.

[0280] In some embodiments, X is O.

[0281] In some embodiments, X is S.

[0282] In some embodiments, R 1 H is H.

[0283] In some embodiments, R 1 These are C1-C6 alkyl groups (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0284] In some embodiments, R 1 It is methyl.

[0285] In some embodiments, R 2 H is H.

[0286] In some embodiments, R 2 These are C1-C6 alkyl groups (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0287] In some embodiments, R 2 It is methyl.

[0288] In some embodiments, Y 1 It is O.

[0289] In some embodiments, Y 1 S is.

[0290] In some embodiments, Y 2 It is O.

[0291] In some embodiments, Y 2 S is.

[0292] In some embodiments, Z is H.

[0293] In some embodiments, Z is not H.

[0294] In some embodiments, Z is a halogen (e.g., F, Cl, Br, or I).

[0295] In some embodiments, Z is F or Cl.

[0296] In some embodiments, Z is F.

[0297] In some embodiments, Z is -OR Z That is the case.

[0298] In some embodiments, Z is -OH.

[0299] In some embodiments, Z is not -OH.

[0300] In some embodiments, Z is an O-(C1-C6 alkyl) (for example, where the C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0301] In some embodiments, Z is -OCH3.

[0302] In some embodiments, Z is (for example, C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl)-O-(C1-C6 alkyl)-O-(C1-C6 alkyl).

[0303] In some embodiments, Z is -OCH2CH2OCH3.

[0304] In some embodiments, Z is one or more R Za It may be substituted with -O-(C1-C6 alkyl)-(C6-C 10 It is Ariel.

[0305] In some embodiments, Z is -O-(C1-C6 alkyl)-(C6-C 10 It is Ariel.

[0306] In some embodiments, Z is [ka] That is the case.

[0307] In some embodiments, Z is one or more R Za It may be replaced with [ka] That is the case.

[0308] In some embodiments, Z may be substituted with one or more halogens. [ka] That is the case.

[0309] In some embodiments, Z may be substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl) groups. [ka] The C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens.

[0310] In some embodiments, R Z H is H.

[0311] In some embodiments, R Z It is not H.

[0312] In some embodiments, R Z is one or more R Za A C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) which may be substituted with .

[0313] In some embodiments, R Z is a C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) which may be substituted with one or more halogens (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0314] In some embodiments, R Z The C1-C6 alkyl group is (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0315] In some embodiments, R Z These are methyl, ethyl, or propyl.

[0316] In some embodiments, R Z It is methyl.

[0317] In some embodiments, R Z This is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0318] In some embodiments, R Z is a C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more -O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), where -O-(C1-C6 alkyl) may be substituted with one or more halogens.

[0319] In some embodiments, R Z is one or more R Za It may be substituted with -(C1-C6 alkyl)-(C6-C 10 It is Ariel.

[0320] In some embodiments, R Z -(C1-C6alkyl)-(C6-C) may be substituted with one or more halogens (e.g., F, Cl, Br, or I), C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), or -O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl). 10 The aryl group is C1-C6 alkyl or -O-(C1-C6 alkyl), and the C1-C6 alkyl group may be substituted with one or more halogens.

[0321] In some embodiments, R Z is -(C1-C6 alkyl)-(C6-C 10 It is Ariel.

[0322] In some embodiments, at least one R Za is a halogen (e.g., F, Cl, Br, or I).

[0323] In some embodiments, at least one R Za It is either F or Cl.

[0324] In some embodiments, at least one R Za is a C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) which may be substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0325] In some embodiments, at least one R Za The C1-C6 alkyl group is (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0326] In some embodiments, at least one R Za This is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0327] In some embodiments, at least one R Za is a -O-(C1-C6 alkyl) which may be substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0328] In some embodiments, at least one R Za It is -O-(C1-C6 alkyl).

[0329] In some embodiments, at least one R Za It is a -O-(C1-C6 alkyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0330] In some embodiments, B is H.

[0331] In some embodiments, B is the nucleic acid base portion.

[0332] As used herein, the term “nucleic acid base portion” refers to a nucleic acid base that is bound to the remainder of the isolated oligonucleotide (e.g., dsRNA or siRNA) of this disclosure, for example, via an atom of the nucleic acid base or its functional group.

[0333] In some embodiments, the nucleic acid base moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0334] In some embodiments, the nucleic acid base portion is uracil (U).

[0335] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide, as shown in the following formula. [ka] During the ceremony, B is the nucleic acid base portion, and the nucleic acid base portion is uracil (U), which is located at position 1 from the 5' end of the sense strand or at position 1 from the 5' end of the antisense strand. X is O, R 1 It is a C1 alkyl group, R 2 H is H, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0336] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide, as shown in the following formula. [ka] During the ceremony, B is the nucleic acid base portion, and the nucleic acid base portion is uracil (U), which is located at position 1 from the 5' end of the sense strand or at position 1 from the 5' end of the antisense strand. X is O, R 1 H is H, R 2 H is H, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0337] In some embodiments, the phosphate mimetic is ligated to the 5' end of an isolated oligonucleotide, as shown in the following formula. [ka] During the ceremony, B is the nucleic acid base portion, and the nucleic acid base portion is uracil (U), which is located at position 1 from the 5' end of the sense strand or at position 1 from the 5' end of the antisense strand. X is O, R 1 H is H, R 2 H is H, [ka] This shows the binding of isolated oligonucleotides (e.g., siRNA) to nucleotides.

[0338] In some embodiments of the isolated oligonucleotides of this disclosure, the phosphate mimetic is bound to the 5' end of the antisense chain of the isolated oligonucleotide.

[0339] In some embodiments, the phosphate mimetic is bound to the 5'-terminal uridine of the antisense chain of an isolated oligonucleotide and has the following structure (5'-MeEPmU). [ka] In the formula, "mU" is a 2'-O-methyl-modified uridine nucleotide, and "MeEP" is a monomethyl-protected phosphate mimetic.

[0340] In some embodiments, the phosphate mimetic is bound to the 5'-terminal uridine of the antisense chain of an isolated oligonucleotide and has the following structure (5'-MeEPmUs). [ka] In the formula, "mU" is a 2'-O-methyl-modified uridine nucleotide, "MeEP" is a monomethyl-protected phosphate mimetic, and "s" is a phosphorothioate nucleotide bond.

[0341] The terms "5'-MeEP," "5'-MeEP," and "5'MeEP" are used interchangeably in this specification.

[0342] In some embodiments, the phosphate mimetic is bound to the 5'-terminal uridine of the antisense chain of an isolated oligonucleotide and has the following structure (5'-EPmU). [ka] In the formula, "mU" is a 2'-O-methyl-modified uridine nucleotide, and "EP" is a phosphate mimetic.

[0343] In some embodiments, the phosphate mimetic is bound to the 5'-terminal uridine of the antisense chain of an isolated oligonucleotide and has the following structure (5'-C-EPmU). [ka] In the formula, "mU" is a 2'-O-methyl-modified uridine nucleotide, and "C-EP" is a phosphate mimetic.

[0344] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the antisense strand comprises a monomethyl-protected phosphate mimetic (MeEP). In some embodiments, the MeEP is ligated to the 5' end of the antisense strand (5'-MeEP).

[0345] In some embodiments where MeEP is ligated to the 5' end of the antisense chain, the phosphate mimetic is ligated to the uridine at the 5' end of the antisense chain.

[0346] In some embodiments, the 5'-terminal uridine is a 2'-O-methyl-modified nucleotide.

[0347] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that together the sense strand and the antisense strand form a double-stranded region, the antisense strand comprises a 5'-MeEP ligated to the 5' end of the antisense strand, and the antisense strand comprises SEQ ID NO: 2 (5'UUAUCUUCAAGUUACAAAAGCAA 3'), SEQ ID NO: 3 (5'UGAAUAAAUAUCUUCAAGUUAC 3'), SEQ ID NO: 4 (5'UAAAAAUGCUACAAAACCCAGA 3'), SEQ ID NO: 5 (5'UAAUAAAAAUGCUACAAAACCC 3'), SEQ ID NO: 6 (5'UUUAAUAAAAAUGCUACAAAAC Includes nucleic acid sequences as defined by 3'), SEQ ID NO: 7 (5'UUAUUAAUAAAAAUGCUACAAA 3'), SEQ ID NO: 28 (5'UAUGCUACAAAACCCAGAAUAA 3'), or SEQ ID NO: 29 (5'UUAAUAAAAAUGCUACAAAACC 3').

[0348] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543–3596 from the 5' end of the proprotein convertase subtilisin kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, the antisense strand comprises a 5'-MeEP ligated to the 5' end of the antisense strand, and the sense strand comprises a targeted ligand comprising three GalNAc G1b moieties ligated to the 3' end of the sense strand.

[0349] Modified skeleton phosphate / phosphodiester bond

[0350] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand, the antisense strand, or both comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of this disclosure comprises a modified phosphate backbone, and the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond is given by formula: [ka] Includes a bond having, [ka] This represents the bonding to the 3' carbon of the first nucleotide in the isolated oligonucleotide of this disclosure. [ka] This shows the bond to the 5' carbon of the second nucleotide in the isolated oligonucleotide of this disclosure. In some embodiments, the phosphodiester bond is unmodified, and Z 1 is O, Z 2 is OH or O - In some embodiments, the phosphodiester bond is modified, Z 1 is O, S, NH or N (C1-C6 alkyl), Z 2 OH, SH, NH2, NH(C1-C6 alkyl), O - S - , HN - or (C1-C6 alkyl)N - And Z 1 If Z is O, 2 is OH or O - isn't it.

[0351] In some embodiments, Z1 is O.

[0352] In some embodiments, Z1 is S.

[0353] In some embodiments, Z1 is NH.

[0354] In some embodiments, Z1 is N(C1-C6 alkyl).

[0355] In some embodiments, Z2 is OH.

[0356] In some embodiments, Z2 is SH.

[0357] In some embodiments, Z2 is NH2.

[0358] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0359] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0360] In some embodiments, Z2 is O - That is the case.

[0361] In some embodiments, Z2 is S - That is the case.

[0362] In some embodiments, Z2 is HN - That is the case.

[0363] In some embodiments, Z2 is (C1-C6 alkyl)N - That is the case.

[0364] In some embodiments, Z2 is S - , HN - , or (C1-C6 alkyl)N - That is the case.

[0365] In some embodiments, Z1 is O and Z2 is SH.

[0366] In some embodiments, Z1 is O and Z2 is NH2.

[0367] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0368] In some embodiments, Z1 is S and Z2 is OH.

[0369] In some embodiments, Z1 is S and Z2 is SH.

[0370] In some embodiments, Z1 is S and Z2 is NH2.

[0371] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0372] In some embodiments, Z1 is NH and Z2 is OH.

[0373] In some embodiments, Z1 is NH and Z2 is SH.

[0374] In some embodiments, Z1 is NH and Z2 is NH2.

[0375] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0376] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0377] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0378] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0379] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0380] In some embodiments, Z1 is O and Z2 is S - That is the case.

[0381] In some embodiments, Z1 is O and Z2 is HN - That is the case.

[0382] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N - That is the case.

[0383] In some embodiments, Z1 is S and Z2 is O - That is the case.

[0384] In some embodiments, Z1 is S and Z2 is S - That is the case.

[0385] In some embodiments, Z1 is S and Z2 is HN - That is the case.

[0386] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N - That is the case.

[0387] In some embodiments, Z1 is NH and Z2 is O - That is the case.

[0388] In some embodiments, Z1 is NH and Z2 is S - That is the case.

[0389] In some embodiments, Z1 is NH and Z2 is HN - That is the case.

[0390] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N - That is the case.

[0391] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O - That is the case.

[0392] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S - That is the case.

[0393] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN - That is the case.

[0394] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N - That is the case.

[0395] In some embodiments, the modified phosphodiester bond includes a phosphorothioate nucleotide bond.

[0396] In some embodiments, the modified phosphodiester bond is [ka] or [ka] Includes, [ka] This represents the bonding to the 3' carbon of the first nucleotide in the isolated oligonucleotide of this disclosure. [ka] This represents the bonding of the second nucleotide to the 5' carbon in the isolated oligonucleotide of the present disclosure.

[0397] In some embodiments, the modified phosphodiester bond is [ka] Includes, [ka] This represents the bonding to the 3' carbon of the first nucleotide in the isolated oligonucleotide of this disclosure. [ka] This represents the bonding of the second nucleotide to the 5' carbon in the isolated oligonucleotide of the present disclosure.

[0398] In some embodiments, the modified phosphodiester bond is [ka] Includes, [ka] This represents the bonding to the 3' carbon of the first nucleotide in the isolated oligonucleotide of this disclosure. [ka] This represents the bonding of the second nucleotide to the 5' carbon in the isolated oligonucleotide of the present disclosure.

[0399] In some embodiments, the isolated oligonucleotides of the Disclosure comprise at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotides of the Disclosure, the sense strand, the antisense strand, or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0400] In some embodiments, the isolated oligonucleotide contains at least two modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least three modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least four modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least five modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least six modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least seven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least eight modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least nine modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least ten modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least eleven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least twelve modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least thirteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least fourteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least 15 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least 16 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least 17 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least 18 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains at least 19 modified phosphodiester bonds.In some embodiments, the isolated oligonucleotide contains at least 20 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains more than 20 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains 20 to 30 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains 30 to 40 modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide contains 40 to 50 modified phosphodiester bonds.

[0401] In some embodiments, the isolated oligonucleotide contains at least two phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least three phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least four phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least five phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least six phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least seven phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least eight phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least nine phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least ten phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least eleven phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least twelve phosphorothioate nucleotide interbondings. In some embodiments, the isolated oligonucleotide contains at least 13 phosphorothioate nucleotide interlinks. In some embodiments, the isolated oligonucleotide contains at least 14 phosphorothioate nucleotide interlinks. In some embodiments, the isolated oligonucleotide contains at least 15 phosphorothioate nucleotide interlinks. In some embodiments, the isolated oligonucleotide contains at least 16 phosphorothioate nucleotide interlinks. In some embodiments, the isolated oligonucleotide contains at least 17 phosphorothioate nucleotide interlinks.In some embodiments, the isolated oligonucleotide contains at least 18 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains at least 19 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains at least 20 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains more than 20 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains 20 to 30 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains 30 to 40 phosphorothioate nucleotide bonds. In some embodiments, the isolated oligonucleotide contains 40 to 50 phosphorothioate nucleotide bonds.

[0402] In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least one modified phosphodiester bond. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least two modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least three modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least four modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least five modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least six modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least seven modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least eight modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least nine modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least ten modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least eleven modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least twelve modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least thirteen modified phosphodiester bonds.In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 14 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 15 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 16 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 17 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 18 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 19 modified phosphodiester bonds. In some embodiments, the sense and / or antisense chains of the isolated oligonucleotide each contain at least 20 modified phosphodiester bonds.

[0403] In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least one phosphorothioate nucleotide linkage. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least two phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least three phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least four phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least five phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least six phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least seven phosphorothioate nucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 8 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 9 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 10 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 11 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 12 phosphorothioate nucleotide interlinks.In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 13 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 14 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 15 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 16 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 17 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 18 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 19 phosphorothioate nucleotide interlinks. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each contain at least 20 phosphorothioate nucleotide interlinks.

[0404] In some embodiments, the modified phosphodiester bond is located consecutively on the sense chain, the antisense chain, or both. In some embodiments, some but not all of the modified phosphodiester bonds are located consecutively on the sense chain, the antisense chain, or both. In some embodiments, the modified phosphodiester bonds on the sense chain, the antisense chain, or both are not located consecutively.

[0405] The present disclosure envisions isolated oligonucleotides in which any phosphodiester bond on the sense or antisense chain may be modified. In some embodiments, any phosphodiester bond on the antisense chain may be modified.

[0406] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain contains 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester bonds. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester bonds include phosphorothioate internucleotide bonds. In some embodiments, the antisense chain contains fewer than 5 modified phosphodiester bonds. In some embodiments, the antisense chain contains 1, 2, 3, or 4 modified phosphodiester bonds. In some embodiments, the antisense chain contains 1, 2, 3, or 4 modified phosphodiester bonds, including phosphorothioate internucleotide bonds. In some embodiments, the antisense chain contains 4 modified phosphodiester bonds. In some embodiments, the antisense chain contains 4 modified phosphodiester bonds. The modified phosphodiester bonds include phosphorothioates.

[0407] In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interbonds, where the phosphorothioate nucleotide interbonds connect the nucleotides at positions 1 and 2 from the first nucleotide at the 5'-terminus of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interbonds, where the phosphorothioate nucleotide interbonds connect the nucleotides at positions 2 and 3 from the first nucleotide at the 5'-terminus of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interbonds, where the phosphorothioate nucleotide interbonds connect the nucleotides at positions 20 and 21 from the first nucleotide at the 5'-terminus of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds connect the nucleotides at positions 21 and 22 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, the modified phosphodiester bonds comprising phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds located between the nucleotides at positions 1 and 2, 2 and 3, 20 and 21, and 21 and 22 from the first nucleotide at the 5' end of the antisense strand.

[0408] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense chain comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds are located between the nucleotides at positions 1-3 and 20-22, starting from the first nucleotide at the 5'-terminus of the antisense chain.

[0409] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense chain comprises at least four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds located between the nucleotides at positions 1-3 and 20-22 from the first nucleotide at the 5'-terminus of the antisense chain.

[0410] In some embodiments of the isolated oligonucleotides of this disclosure, the antisense chain comprises four phosphorothioate internucleotide bonds. In some embodiments in which the antisense chain comprises four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds are located between the nucleotides at positions 1-3 and 20-22, starting from the first nucleotide at the 5'-terminus of the antisense chain.

[0411] In some embodiments of the isolated oligonucleotides of this disclosure, the sense chain contains 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester bonds. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester bonds include phosphorothioate nucleotide bonds. In some embodiments, the sense chain contains fewer than 5 modified phosphodiester bonds. In some embodiments in which the sense chain contains fewer than 5 modified phosphodiester bonds, the sense chain contains 1, 2, 3, or 4 modified phosphodiester bonds. In some embodiments in which the sense chain contains 1, 2, 3, or 4 modified phosphodiester bonds, the 1, 2, 3, or 4 modified phosphodiester bonds include phosphorothioate nucleotide bonds. In some embodiments, the sense chain contains 4 modified phosphodiester bonds. In some embodiments in which the sense chain contains 4 modified phosphodiester bonds, the modified phosphodiester bonds include phosphorothioate nucleotide bonds.

[0412] In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, the phosphodiester bonds comprises phosphorothioate nucleotide interlinks. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interlinks, the phosphorothioate nucleotide interlinks the nucleotides at positions 1 and 2 from the first nucleotide at the 5'-terminus of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interlinks, the phosphorothioate nucleotide interlinks the nucleotides at positions 2 and 3 from the first nucleotide at the 5'-terminus of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interlinks, the phosphorothioate nucleotide interlinks the nucleotides at positions 18 and 19 from the first nucleotide at the 5'-terminus of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate nucleotide interlinks, the phosphorothioate nucleotide interlinks connect the nucleotides at positions 19 and 20 from the first nucleotide at the 5' end of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, the modified phosphodiester bonds comprising phosphorothioate nucleotide interlinks, the phosphorothioate nucleotide interlinks located between the nucleotides at positions 1 and 2, 2 and 3, 18 and 19, and 19 and 20 from the first nucleotide at the 5' end of the sense strand.

[0413] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds are located between the first nucleotide at the 5'-terminus of the sense strand and the nucleotides at positions 1-3 and positions 18-20.

[0414] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises at least four phosphorothioate internucleotide bonds, the at least four phosphorothioate internucleotide bonds are located between the nucleotides at positions 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0415] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises four phosphorothioate internucleotide bonds. In some embodiments in which the sense strand comprises four phosphorothioate internucleotide bonds, the phosphorothioate internucleotide bonds are located between the first nucleotide at the 5'-terminus of the sense strand and the nucleotides at positions 1-3 and positions 18-20.

[0416] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand and the sense strand comprise four phosphorothioate internucleotide bonds, wherein the antisense strand comprises phosphorothioate internucleotide bonds located between the nucleotides at positions 1-3 and 20-22, starting from the first nucleotide at the 5'-terminus of the antisense strand, and the sense strand comprises phosphorothioate internucleotide bonds located between the nucleotides at positions 1-3 and 18-20, starting from the first nucleotide at the 5'-terminus of the sense strand.

[0417] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is i) Antisense strand of nucleic acid sequence by Sequence ID No. 36 (5' [mUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][m A][mGs][mCs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG] [mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Antisense strand of nucleic acid sequence by Sequence ID No. 37 (5' [mUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) i) Antisense strand of nucleic acid sequence by Sequence ID No. 38 (5' [mUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][m C][mAs][mGs][mA] 3'), and Sense strand of nucleic acid sequence by sequence number 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Antisense strand of nucleic acid sequence by Sequence ID No. 39 (5' [mUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mA][mCs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Antisense strand of nucleic acid sequence by Sequence ID No. 40 (5' [mUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by sequence number 24 (5' [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); vi) Antisense strand of nucleic acid sequence by Sequence ID No. 41 (5' [mUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID No. 42 (5' [mUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][m A][mUs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) Antisense strand of nucleic acid sequence by Sequence ID No. 43 (5' [mUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); or ix) Antisense strand of nucleic acid sequence by Sequence ID No. 37 (5' [mUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU] [mC][mA][G1b][G1b][G1b] 3'), "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, and "G1b" is the GalNAc G1b portion.

[0418] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is i) Antisense strand of nucleic acid sequence by Sequence ID No. 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) i) Antisense strand of nucleic acid sequence by Sequence ID No. 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'), and Sense strand of nucleic acid sequence by sequence number 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Antisense strand of nucleic acid sequence by Sequence ID No. 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Antisense strand of nucleic acid sequence by Sequence ID No. 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by sequence number 24 (5' [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); vi) Antisense strand of nucleic acid sequence by Sequence ID No. 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID No. 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) Antisense strand of nucleic acid sequence by Sequence ID No. 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by sequence number 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); ix) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by sequence number 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU] [mC][mA][G1b][G1b][G1b] 3'); x) Antisense strand of nucleic acid sequence by Sequence ID No. 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence according to Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'), or xi) Antisense strand of nucleic acid sequence by Sequence ID No. 54 (5' [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG] [mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3') is included. "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, "MeEP" is a monomethyl protected phosphate mimetic, "EP" is a phosphate mimetic, "C-EP" is a phosphate mimetic, and "G1b" is the GalNAc G1b portion.

[0419] In some embodiments of the isolated oligonucleotides of this disclosure, the double-stranded region is i) Antisense strand of nucleic acid sequence by Sequence ID No. 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 44 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1bs][G1bs][G1b] 3'); ii) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 45 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1bs][G1bs][G1b] 3'); iii) i) Antisense strand of nucleic acid sequence by Sequence ID No. 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 46 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1bs][G1bs][G1b] 3'); iv) Antisense strand of nucleic acid sequence by Sequence ID No. 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 47 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1bs][G1bs][G1b] 3'); v) Antisense strand of nucleic acid sequence by Sequence ID No. 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 48 (5' [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1bs][G1bs][G1b] 3'); vi) Antisense strand of nucleic acid sequence by Sequence ID No. 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 49 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mU][mA][mA][mUs][mAs][mA][G1bs][G1bs][G1b] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID No. 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'), and The sense strand of a nucleic acid sequence by array index: 50 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1bs][G1bs][G1b] 3'); or viii) Antisense strand of nucleic acid sequence by Sequence ID No. 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 51 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1bs][G1bs][G1b] 3'); ix) Antisense strand of nucleic acid sequence by Sequence ID No. 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and Sense strand of nucleic acid sequence by sequence number 55 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU] [mC][mA][G1bs][G1bs][G1b] 3'); x) Antisense strand of nucleic acid sequence by Sequence ID No. 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 45 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1bs][G1bs][G1b] 3'); or xi) Antisense strand of nucleic acid sequence by Sequence ID No. 54 (5' [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG] [mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by sequence number 45 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1bs][G1bs][G1b] 3'); "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, "MeEP" is a monomethyl protected phosphate mimetic, "EP" is a phosphate mimetic, "C-EP" is a phosphate mimetic, and "G1b" is the GalNAc G1b portion.

[0420] nucleic acids and vectors

[0421] This disclosure also provides vectors encoding isolated oligonucleotides disclosed herein. In some embodiments, the vector is one of a plasmid, cosmid, or viral vector. In some embodiments, the vector is an adenovirus vector. In some embodiments, the vector is a lentiviral vector. In some embodiments, the plasmid is an expression plasmid.

[0422] This disclosure provides nucleic acids comprising sequences encoding isolated oligonucleotides (e.g., dsRNA or siRNA) of this disclosure that target PCSK9 as described herein.

[0423] In some embodiments, the nucleic acid is ribonucleic acid (RNA). In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA). The DNA may be a vector or plasmid, such as an expression vector.

[0424] A “vector” is any nucleic acid molecule for cloning and / or transferring nucleic acids into cells. A vector may also be a replicon to which another nucleotide sequence can be added to enable replication of the bound nucleotide sequence. A “replicon” can be any genetic element (e.g., plasmid, phage, cosmid, chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., can replicate under its own control. The term “vector” includes both viral and non-viral nucleic acid molecules (e.g., plasmids) for introducing nucleic acids into cells in vitro, ex vivo, and / or in vivo. Nucleic acids may be manipulated using numerous vectors known in the art, such as incorporating response elements and promoters into genes. For example, insertion of nucleic acid fragments corresponding to response elements and promoters into a suitable vector can be achieved by ligating the suitable nucleic acid fragments into a selected vector having complementary attachment ends. Alternatively, the ends of a nucleic acid molecule may be enzymatically modified, or any site may be generated by ligating a nucleotide sequence (linker) to the nucleic acid end, and such vectors may be engineered to contain sequences encoding selection markers that provide selection of cells containing the vector and / or cells that have incorporated the nucleic acid of the vector into their cellular genome. Such markers enable the identification and / or selection of host cells that incorporate and express the protein encoded by the marker. A “recombinant” vector refers to a viral or non-viral vector containing one or more heterogeneous nucleotide sequences (i.e., transgenes), e.g., two, three, four, five, or more heterogeneous nucleotide sequences.

[0425] The terms “express” or “express” for a polynucleotide coding sequence mean that the sequence may be transcribed and translated. Typically, according to this disclosure, expression of the coding sequence of this disclosure results in the production of the polypeptide of this disclosure. The whole or fragment of the expressed polypeptide can also function in intact cells without purification.

[0426] In some embodiments, the vector is an expression vector for producing the siRNA of the Disclosure. Exemplary expression vectors may contain sequences encoding the sense and / or antisense strands of the isolated oligonucleotide of the Disclosure under the control of a promoter suitable for transcription. The interfering RNA can be expressed from a variety of eukaryotic promoters known to those skilled in the art, including pol III promoters such as the U6 or H1 promoter, or pol II promoters such as the cytomegalovirus promoter. Those skilled in the art will recognize that these promoters can also be adapted to allow inducible expression of the interfering RNA.

[0427] The isolated oligonucleotides (e.g., dsRNA and siRNA) of this disclosure may be expressed endogenously from plasmids or viral expression vectors, or from minimal expression cassettes, such as PCR-generated fragments containing one or more promoters and suitable templates for transcribing siRNA. Examples of commercially available plasmid-based expression vectors for shRNA include members of the pSilencer series (Ambion, Austin, Texas) and pCpG-siRNA (InvivoGen, San Diego, California). Examples of kits for producing PCR-generated shRNA expression cassettes include Silencer Express (Ambion, Austin, Texas) and siXpress (Mirus, Madison, Wisconsin).

[0428] Viral vectors for the in vivo expression of isolated oligonucleotides (e.g., siRNA and dsRNA) in eukaryotic cells are also considered to be within the scope of this disclosure. Viral vectors may be derived from a variety of viruses, including adenoviruses, adeno-associated viruses, lentiviruses (e.g., HIV, FIV, and EIAV), and herpesviruses. Examples of commercially available viral vectors for shRNA expression include pSilencer adeno (Ambion, Austin, Texas) and pLenti6 / BLOCK-iT(trademark)-DEST (Invitrogen, Carlsbad, California). The selection of viral vectors, methods for expressing siRNA from the vectors, and methods for delivering viral vectors incorporated, for example, in nanoparticles are within the ordinary skill of those skilled in the art.

[0429] Those skilled in the art will see that isolated oligonucleotides (e.g., dsRNA or siRNA) of the disclosed herein, as described herein, can be delivered to cells or subjects using any suitable vector, which may be incorporated within nanoparticles. The vector may be delivered to cells in vivo. In other embodiments, the vector may be delivered to cells ex vivo, and the cells containing the vector are then delivered to the subject. The selection of a delivery vector can be based on many factors known in the art, including the age and species of the target host, in vitro versus in vivo delivery, desired level and persistence of expression, intended purpose (e.g., therapy or screening), target cells or organs, delivery route, size of the isolated polynucleotide, and safety concerns.

[0430] delivery system

[0431] This disclosure also provides a delivery system comprising an isolated oligonucleotide disclosed herein or a vector of this disclosure encoding an isolated oligonucleotide disclosed herein. In some embodiments, the delivery system is one of liposomes, nanoparticles, polymer-based delivery systems, or ligand-conjugate delivery systems. In some embodiments, the ligand-conjugate delivery system comprises one or more of antibodies, peptides, sugar moieties, or combinations thereof.

[0432] In some embodiments, the delivery system of the Disclosure comprises nanoparticles containing an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure that targets PCSK9 mRNA for degradation.

[0433] In some embodiments, the nanoparticles include polymer-based nanoparticles, lipid polymer-based nanoparticles, metal-based nanoparticles, carbon nanotube-based nanoparticles, nanocrystals, or polymer micelles. In some embodiments, the polymer-based nanoparticles include multiblock copolymers, nonblock copolymers, polymer micelles, or hyperbranched polymers. In some embodiments, the polymer-based nanoparticles include multiblock copolymers and diblock copolymers. In some embodiments, the polymer-based nanoparticles are pH-responsive. In some embodiments, the polymer-based nanoparticles further include buffering components.

[0434] In some embodiments, the delivery system includes liposomes. Liposomes are spherical vesicles having at least one lipid bilayer and, in some embodiments, an aqueous core. In some embodiments, the lipid bilayer of the liposome may contain phospholipids. Exemplary but non-limiting examples of phospholipids include phosphatidylcholine, but the lipid bilayer may also contain additional lipids such as phosphatidylethanolamine. Liposomes may be multilayered, i.e., consisting of several lamellar-phase lipid bilayers, or monolayered liposomes having a single lipid bilayer. Liposomes can be fabricated in specific size ranges to be viable targets for phagocytosis. Liposomes may be in the size range of 20 nm to 100 nm, 100 nm to 400 nm, 1 μM or larger, or 200 nm to 3 μM. Examples of lipidoid and lipid-based formulations are provided in U.S. Patent Publication Application No. 20090023673. In other embodiments, one or more lipids are one or more cationic lipids. Those skilled in the art will recognize which liposomes are suitable for siRNA encapsulation.

[0435] In some embodiments, the liposomes or nanoparticles of the present disclosure include micelles. A micelle is an aggregate of surfactant molecules. An exemplary micelle includes an aggregate of an amphiphilic polymer, polymer, or copolymer in an aqueous solution, where the hydrophilic head is in contact with the surrounding solvent and the hydrophobic tail region is isolated at the center of the micelle.

[0436] In some embodiments, the nanoparticles include nanocrystals. Exemplary nanocrystals are crystalline particles having at least one dimension less than 1000 nanometers, preferably less than 100 nanometers.

[0437] In some embodiments, the nanoparticles include polymer-based nanoparticles. In some embodiments, the polymer includes a multiblock copolymer, a diblock copolymer, a polymer micelle, or a hyperbranched polymer. In some embodiments, the particles include one or more cationic polymers. In some embodiments, the cationic polymer is chitosan, protamine, polylysine, polyhistidine, polyarginine, or poly(ethylene)imine. In other embodiments, one or more polymers include buffering components, degradable components, hydrophilic components, cleavable binding components, or some combination thereof.

[0438] In some embodiments, the nanoparticles or a portion thereof are degradable. In other embodiments, the lipids and / or polymers of the nanoparticles are degradable.

[0439] In some embodiments, any of these delivery systems of the Disclosure may include a buffering component. In other embodiments, any of the Disclosures may include a buffering component and a degradable component. In yet another embodiment, any of the Disclosures may include a buffering component and a hydrophilic component. In yet another embodiment, any of the Disclosures may include a buffering component and a cleavable binding component. In yet another embodiment, any of the Disclosures may include a buffering component, a degradable component, and a hydrophilic component. In yet another embodiment, any of the Disclosures may include a buffering component, a degradable component, and a cleavable binding component. In yet another embodiment, any of the Disclosures may include a buffering component, a degradable component, a hydrophilic component, and a cleavable binding component. In some embodiments, the particles are composed of one or more polymers containing any of the aforementioned combinations of components.

[0440] In some embodiments of the isolated oligonucleotides of this disclosure, the delivery system comprises a ligand-conjugate delivery system. In some embodiments, the ligand-conjugate delivery system comprises one or more antibodies, peptides, sugar moieties, lipids, or combinations thereof.

[0441] In further embodiments, an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure targeting PCSK9 mRNA is conjugated, complexed, or thereby encapsulated to one or more lipids or polymers of a delivery system. In further embodiments, an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure targeting PCSK9 mRNA may be encapsulated within a hollow core of a nanoparticle. Alternatively, or in addition, an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure targeting PCSK9 mRNA may be incorporated into a lipid or polymer-based shell of a delivery system, for example, via intercalation. Alternatively, or in addition, an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure targeting PCSK9 mRNA may be bound to the surface of a delivery system. In some embodiments, an isolated oligonucleotide (e.g., siRNA or dsRNA) of the Disclosure targeting PCSK9 mRNA is conjugated to one or more lipids or polymers of a delivery system, for example, via covalent bonding.

[0442] In some embodiments, the ligand-conjugate delivery system further comprises a target drug. In some embodiments, the target drug comprises a peptide ligand, a nucleotide ligand, a polysaccharide ligand, a fatty acid ligand, a lipid ligand, a small molecule ligand, an antibody, an antibody fragment, an antibody mimetic, or an antibody mimetic fragment.

[0443] In some embodiments, the isolated oligonucleotides disclosed herein may further include ligands that facilitate the delivery or uptake of the isolated oligonucleotide to specific tissues or cells, such as hepatocytes. In certain embodiments, the ligand targets the delivery of the RNAi construct to hepatocytes. In these and other embodiments, the ligand may include galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand includes a polyvalent galactose or polyvalent GalNAc moiety, such as a trivalent or tetravalent galactose or a GalNAc moiety. The ligand may optionally be covalently bonded to the 5' or 3' end of the sense strand of the RNAi construct via a linker.

[0444] In some embodiments, the target drug comprises a binding partner for a cell surface protein that encodes PCSK9 mRNA and expresses PCSK9 protein, which is upregulated, overexpressed, or normally expressed in target cells. In some embodiments, the binding partner may be a transmembrane peptidoglycan expressed on the surface of many types of such cells. Thus, targeting of cell surface proteins by the delivery system of the Disclosure provides excellent delivery and specificity of the composition of the Disclosure to target cells. In some embodiments, the target cells may be any one of intestinal cells, arterial cells, cardiovascular cells, hepatocytes, pancreatic cells, or a combination thereof.

[0445] In some embodiments, the delivery system of the present disclosure includes a polymer-based delivery system. In some embodiments, the polymer-based delivery system includes a blended polymer. In some embodiments, the blended polymer is a copolymer comprising a biodegradable component and a hydrophilic component. In some embodiments, the biodegradable component of the blended polymer is polyester, poly(orthoester), poly(ethyleneimine), poly(caprolactone), polyanhydride, poly(acrylic acid), polyglycolide, or poly(urethane). In some embodiments, the biodegradable component of the blended polymer is poly(lactic acid) (PLA) or poly(lactic acid-glycolic acid copolymer) (PLGA). In some embodiments, the hydrophilic component of the blended polymer is polyalkylene glycol or polyalkylene oxide. In some embodiments, the polyalkylene glycol is polyethylene glycol (PEG). In other embodiments, the polyalkylene oxide is polyethylene oxide (PEO).

[0446] In some embodiments, the delivery system of the present disclosure is a polymer-based nanoparticle. The polymer-based nanoparticle comprises one or more polymers. In some embodiments, one or more polymers include polyester, poly(orthoester), poly(ethyleneimine), poly(caprolactone), polyanhydride, poly(acrylic acid), polyglycolide, or poly(urethane). In yet other embodiments, one or more polymers include poly(lactic acid) (PLA) or poly(lactic acid-glycolic acid copolymer) (PLGA). In some embodiments, one or more polymers include poly(lactic acid-glycolic acid copolymer) (PLGA). In some embodiments, one or more polymers include poly(lactic acid) (PLA). In some embodiments, one or more polymers include polyalkylene glycol or polyalkylene oxide. In some embodiments, polyalkylene glycol is polyethylene glycol (PEG) or polyalkylene oxide is polyethylene oxide (PEO).

[0447] In some embodiments, the polymer-based nanoparticles include poly(lactic acid-glycolic acid copolymer)PLGA polymers. In some embodiments, the PLGA nanoparticles further include the target agents described herein.

[0448] In some embodiments, the delivery system of the present disclosure is a nanoparticle having an average characteristic dimension of approximately 500 nm, 400 nm, 300 nm, 250 nm, 200 nm, 180 nm, 150 nm, 120 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or less than 20 nm. In other embodiments, the nanoparticle has an average characteristic dimension of 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 120 nm, 150 nm, 180 nm, 200 nm, 250 nm, or 300 nm. In a further embodiment, the nanoparticles are 10-500nm, 10-400nm, 10-300nm, 10-250nm, 10-200nm, 10-150nm, 10-100nm, 10-75nm, 10-50nm, 50-500nm, 50-400nm, 50-300nm, 50-200nm, 50-150nm, 50-100nm, 50-75nm, 100-500nm, 100-400 It has average characteristic dimensions of nm, 100-300 nm, 100-250 nm, 100-200 nm, 100-150 nm, 150-500 nm, 150-400 nm, 150-300 nm, 150-250 nm, 150-200 nm, 200-500 nm, 200-400 nm, 200-300 nm, 200-250 nm, 200-500 nm, 200-400 nm, or 200-300 nm.

[0449] Therapeutic drugs

[0450] In some embodiments, the delivery system of the present disclosure is administered together with one or more additional therapeutic agents. In some embodiments, the additional therapeutic agents may be steroids, anti-inflammatory agents, antibodies, fusion proteins, small molecules, or combinations thereof.

[0451] In some embodiments, the additional therapeutic agent is incorporated into a delivery system of this disclosure comprising at least one isolated oligonucleotide targeting PCSK9 as disclosed herein. In some embodiments, the additional therapeutic agent is conjugated, complexed, or thereby encapsulated in one or more lipids or polymers of the delivery system. The additional therapeutic agent may be encapsulated within a hollow core of the delivery system. Alternatively, or in addition, the additional therapeutic agent may be incorporated into a lipid or polymer-based shell of the delivery system, for example, via intercalation. Alternatively, or in addition, the additional therapeutic agent may be bonded to the surface of the delivery system. In some embodiments, the additional therapeutic agent is conjugated to one or more lipids or polymers of the delivery system, for example, via covalent bonding.

[0452] In some embodiments, an additional therapeutic agent and a delivery system comprising at least one isolated oligonucleotide targeting PCSK9 as disclosed herein are formulated in the same composition. For example, a delivery system comprising the isolated oligonucleotide of this disclosure targeting PCSK9 and the additional therapeutic agent may be formulated in the same pharmaceutical composition.

[0453] In some embodiments, the additional therapeutic agent and the delivery system comprising at least one isolated oligonucleotide targeting PCSK9 as disclosed herein are formulated, for example, as separate compositions for separate administration to the target.

[0454] Pharmaceutical composition

[0455] The Disclosure also provides a pharmaceutical composition comprising an isolated oligonucleotide disclosed herein, a vector of the Disclosure encoding an isolated oligonucleotide disclosed herein, or a delivery system of the Disclosure, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0456] The pharmaceutical compositions of this disclosure may optionally include therapeutic agents, pharmaceutical agents, carriers, adjuvants, dispersants, diluents, and the like.

[0457] In some embodiments, the pharmaceutical composition includes a therapeutic agent, such as a chemotherapeutic agent. In some embodiments, the therapeutic agent is formulated into a delivery system comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) that target PCSK9 of the Disclosure.

[0458] In some embodiments, the additional therapeutic agent is not formulated into a delivery system containing one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 of the Disclosure, but both the delivery system and the therapeutic agent are formulated into the same pharmaceutical composition. In some embodiments, the additional therapeutic agent is not formulated into a delivery system containing one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 of the Disclosure, but the delivery system and the therapeutic agent are formulated into separate pharmaceutical compositions.

[0459] The pharmaceutical composition may contain any of the above-mentioned reagents and one or more pharmaceutically acceptable carriers, diluents, or excipients.

[0460] The pharmaceutical composition is in a form suitable for administration to a target. In one embodiment, the pharmaceutical composition is in bulk or unit dosage form. The unit dosage form is any of a variety of forms, including, for example, capsules, IV bags, tablets, single pumps of aerosol inhalers, or vials. The amount of the active ingredient (e.g., formulation of the disclosed drug) in a unit dose of the composition is an effective amount and varies according to the specific treatment involved. Those skilled in the art will recognize that it may be necessary to routinely vary the dosage depending on the patient's age and condition. The dosage also depends on the route of administration. Various routes are expected, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, inhalation, oral cavity, sublingual, intrapleural, intrathecal, and intranasal. Dosage forms for topical or transdermal administration of the present disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. In one embodiment, the activator is mixed under sterile conditions with a pharmaceutically acceptable carrier and also with any necessary preservatives, buffers, or propellants.

[0461] As used herein, the term “pharmaceutically acceptable” means a compound, anion, cation, substance, composition, carrier and / or dosage form that is suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reaction or other problems or complications, within the bounds of sound medical judgment, and that is commensurate with a reasonable benefit / risk ratio.

[0462] "Pharmacologically acceptable excipients" means excipients that are generally safe, non-toxic, and not biologically or otherwise harmful, and are useful in the preparation of pharmaceutical compositions, and include excipients that are acceptable not only for human pharmaceutical use but also for veterinary use. "Pharmacologically acceptable excipients" as used herein and in the claims includes both one and more such excipients.

[0463] The pharmaceutical compositions of this disclosure are formulated to suit their intended route of administration. Examples of routes of administration include parenteral administration, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraperitoneal (into body cavities), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, intraperitoneal, or subcutaneous applications may contain the following components: sterile diluents, e.g., water for injection, saline, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents, e.g., benzyl alcohol or methylparaben; antioxidants, e.g., ascorbic acid or sodium bisulfite; chelating agents, e.g., ethylenediaminetetraacetic acid; buffers, e.g., acetates, citrates, or phosphates, and agents for adjusting tonicity, such as sodium chloride or dextrose. pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be sealed in ampoules made of glass or plastic, disposable syringes, or multi-dose vials. These preparations may contain antioxidants, buffers, bacteriostatic agents, and solutes to make the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions may contain suspending agents and thickeners. The formulations can be placed in unit / dose or multi-dose containers, such as sealed ampoules and vials, and can be stored in a freeze-dried state requiring only the addition of a sterile liquid carrier, such as physiological saline or distilled water for injection, immediately before use.

[0464] Pharmaceutical compositions containing nanoparticles as described herein can be manufactured by commonly known methods, such as conventional mixing, dissolution, granulation, sugar-coated tablet preparation, grinding, emulsification, encapsulation, mixing, or lyophilization processes. The pharmaceutical compositions can be formulated conventionally using one or more pharmaceutically acceptable carriers, including excipients and / or adjuvants that facilitate the processing of the active ingredient into a pharmaceutically usable preparation. Of course, the appropriate formulation depends on the chosen route of administration.

[0465] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water for injection, Cremophor EL® (BASF, Parsippany, New Jersey), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid enough to pass easily through an injection needle. The composition must be stable under manufacturing and storage conditions and protected from microbial contamination, such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required nanoparticle size in the case of dispersions, and by using a surfactant. The action of microorganisms can be inhibited by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. Often, the composition preferably contains isotonic agents, such as sugars, polyhydric alcohols like mannitol and sorbitol, and sodium chloride. Sustained absorption of the injectable composition can be achieved by including absorption-delaying agents, such as aluminum monostearate or gelatin, in the composition.

[0466] Oral compositions generally contain an inert diluent or a pharmaceutically acceptable food-grade carrier. They may be encapsulated in gelatin capsules or compressed into tablets. For therapeutic oral administration purposes, the activator may be incorporated into an excipient and used in the form of tablets, lozenges, or capsules. Oral compositions may also be prepared using a fluid carrier for use as a mouthwash, in which case the drug in the fluid carrier is applied orally, rinsed and spat out, or swallowed. Pharmaceutically compatible binders and / or auxiliary substances may be included as part of the composition. Tablets, pills, capsules, lozenges, etc., may contain any of the following ingredients or drugs of similar properties: binders, such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients, such as starch or lactose; disintegrants, such as alginic acid, Primogel, or corn starch; lubricants, such as magnesium stearate or Sterotes; fluidizers, such as colloidal silicon dioxide; sweeteners, such as sucrose or saccharin; or flavorings, such as peppermint, methyl salicylate, or orange flavoring.

[0467] When administered by inhalation, the drug is delivered in the form of an aerosol spray from a pressurized container or dispenser containing an appropriate propellant, such as a gas like carbon dioxide, or from a nebulizer.

[0468] The pharmaceutical compositions of this disclosure can be prepared on a pharmaceutically acceptable carrier that protects one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure from rapid removal from the body, such as in controlled-release formulations including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art, and the materials are commercially available. Liposome suspensions (containing liposomes targeting infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0469] Formulating oral or parenteral compositions in the form of unit dosage forms is particularly beneficial for ease of administration and uniformity of dosage. As used herein, a unit dosage form refers to a physically distinct unit adapted as a single dose for the target being treated, each unit containing a predetermined amount of activating agent calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications of the unit dosage forms in this disclosure are determined by and directly depend on the inherent characteristics of the activating agent and the specific therapeutic effect to be achieved.

[0470] The pharmaceutical composition may be included in a container, pack, or dispenser along with instructions for administration.

[0471] As used herein, “pharmaceutically acceptable salt” refers to a derivative of the compound of the disclosure, in which the parent compound is modified by producing an acidic or basic salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic salts of basic residues such as amines, and alkali or organic salts of acidic residues such as carboxylic acids. Examples of pharmaceutically acceptable salts include conventional non-toxic salts or quaternary ammonium salts of the parent compound formed from non-toxic inorganic or organic acids.

[0472] Techniques for formulating and administering the compositions disclosed in this disclosure can be found in Remington: The Science and Practice of Pharmacy, 19th edition, Mack Publishing Co., Easton, PA (1995).

[0473] All percentages and ratios used herein are by weight unless otherwise indicated. Other features and advantages of this disclosure are evident from various examples. The provided examples illustrate various components and techniques useful for carrying out this disclosure. The examples do not limit the claimed disclosure. Based on this disclosure, those skilled in the art can identify and adopt other components and methods useful for carrying out this disclosure.

[0474] Method for preparing isolated oligonucleotides

[0475] Methods for producing one or more oligonucleotides (e.g., dsRNA or siRNA) that target PCSK9 of the present disclosure, and delivery systems comprising the same, are provided herein.

[0476] One or more oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 as disclosed herein may be generated externally by chemical synthesis, in vitro transcription, or by cleavage of longer double-stranded RNA with Dicer or another suitable nuclease having similar activity. Chemically synthesized siRNA, prepared from protected ribonucleoside phosphoramidites using conventional DNA / RNA synthesizers, is available from commercial suppliers. siRNA can be purified, for example, by extraction, precipitation, electrophoresis, chromatography, or a combination thereof using solvents or resins. Alternatively, siRNA may be used with minimal purification to avoid loss during sample processing.

[0477] In some embodiments, one or more oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 of the present disclosure can be prepared, for example, using an expression vector from which a nucleic acid encoding double-stranded RNA has been cloned, under the control of an appropriate promoter.

[0478] In some embodiments, one or more oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 of the present disclosure can be incorporated into a delivery system (e.g., nanoparticles) of the present disclosure.

[0479] The delivery systems comprising dsRNA or siRNA according to this disclosure can be prepared by any suitable means known in the art. For example, polymer nanoparticles can be prepared using a variety of methods, including, but not limited to, solvent evaporation, spontaneous emulsification, solvent diffusion, desolvation, dialysis, ion gelation, nanoprecipitation, salting out, spray drying, and supercritical fluid methods. Dispersion of pre-formed polymers and polymerization of monomers are two further strategies for the preparation of polymer nanoparticles. However, the selection of a suitable method depends on a variety of factors known to those skilled in the art.

[0480] A sterile injection solution containing the delivery system of this disclosure may be prepared by incorporating one or more isolated oligonucleotides (e.g., dsRNA and siRNA) targeting PCSK9 as disclosed herein, along with one or a combination of the components listed herein as needed, into the delivery system (e.g., nanoparticles) in a suitable solvent in the required amount, and then sterilizing by filtration. Alternatively, or in addition, sterilization may be achieved by other means such as radiation or gas. Generally, dispersions are prepared by incorporating delivery particles into a sterile vehicle, which contains a basic dispersion medium and other components as needed from those listed above. In the case of sterile powders for the preparation of sterile injection solutions, the preparation methods are vacuum drying and freeze-drying, thereby obtaining powders of the delivery system containing one or more isolated oligonucleotides (e.g., dsRNA and siRNA) targeting PCSK9 as disclosed herein, and powders of any additional desired components, from their pre-sterilized filtered solutions.

[0481] How to use

[0482] The Disclosure also provides methods for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, the methods comprising administering an effective amount of an isolated oligonucleotide disclosed herein, a vector of the Disclosure encoding an isolated oligonucleotide disclosed herein, a delivery system of the Disclosure, or a pharmaceutical composition of the Disclosure to a subject.

[0483] The Disclosure also provides methods for treating or preventing diseases or disorders related to abnormal or increased expression or activity of PCSK9, or diseases or disorders involving PCSK9, in subjects requiring such treatment, the methods comprising administering to a subject an effective amount of an isolated oligonucleotide disclosed herein, a vector of the Disclosure encoding an isolated oligonucleotide disclosed herein, a delivery system of the Disclosure, or a pharmaceutical composition of the Disclosure.

[0484] The Disclosure also provides isolated oligonucleotides disclosed herein, vectors of the Disclosure encoding isolated oligonucleotides disclosed herein, delivery systems of the Disclosure, or pharmaceutical compositions of the Disclosure for use in the treatment or prevention of diseases or disorders related to abnormal or increased expression or activity of PCSK9, or diseases or disorders involving PCSK9, in subjects requiring such treatment or prevention.

[0485] This disclosure also provides the use of the isolated oligonucleotides disclosed herein, the vectors disclosed herein that encode the isolated oligonucleotides disclosed herein, the delivery systems disclosed herein, or the pharmaceutical compositions disclosed herein in the manufacture of pharmaceuticals for the treatment or prevention of diseases or disorders related to abnormal or increased expression or activity of PCSK9, or diseases or disorders involving PCSK9, in subjects where such use is required.

[0486] This specification provides a method for inhibiting or downregulating the expression or activity of PCSK9 in cells, comprising contacting the cells with one or more PCSK9-targeting oligonucleotides (e.g., dsRNA or siRNA) described herein. One or more PCSK9-targeting oligonucleotides (e.g., dsRNA or siRNA) described herein can reduce or inhibit PCSK9 activity via the RNAi pathway. The cells may be in vitro, in vivo, or ex vivo. For example, the cells may be derived from a cell line or may be in vivo in a subject where they are needed.

[0487] In some embodiments, one or more PCSK9-targeting oligonucleotides (e.g., dsRNA or siRNA) described herein can induce RNAi-mediated degradation of PCSK9 mRNA in target cells.

[0488] As used herein, the terms “contact,” “introduce,” and “administer” are interchangeable and refer to a process by which the dsRNA or siRNA of the Disclosure or a nucleic acid molecule encoding the dsRNA or siRNA of the Disclosure is delivered to a cell in order to inhibit, alter, or modify the expression of a target gene. dsRNA can be administered by many methods, for example, but not limited to, direct introduction into cells (i.e., intracellular) and / or extracellular introduction into body cavities, interstitial spaces, or the circulation of an organism.

[0489] In relation to cells or organisms, “introducing” means presenting nucleic acid molecules to an organism and / or cells in a manner that allows the nucleic acid molecules to gain access to the inside of the cell. When two or more nucleic acid molecules are introduced, these nucleic acid molecules may associate as part of a single polynucleotide or nucleic acid construct, or as separate polynucleotides or nucleic acid constructs, and may be located on the same or different nucleic acid constructs. Thus, these polynucleotides may be introduced into cells in a single transformation event or separate transformation events. Therefore, as used herein, the term “transformation” refers to the introduction of heterologous nucleic acids into cells. Cellular transformation may be stable or transient.

[0490] As used herein, the terms “inhibit” or “reduce” or their grammatical variations refer to a reduction or decrease of at least about 5%, about 10%, about 15%, about 25%, about 35%, about 40%, about 50%, about 60%, about 75%, about 80%, about 90%, about 95%, or more of a particular level or activity. In some embodiments, the inhibition or reduction results in little to no detectable activity (at most a small amount, e.g., less than about 10% or even less than 5%).

[0491] In contrast, as used herein, the term “increase” or its grammatical variations refers to an increase or rise of at least about 5%, about 10%, about 15%, about 25%, about 35%, about 40%, about 50%, about 60%, about 75%, about 80%, about 90%, about 95%, or more, of a particular level or activity. An increase in activity can be described in terms of a multiplier change. For example, activity can be increased by 1.2X, 1.5X, 2X, 3X, 5X, 6X, 7X, 8X, 9X, 10X, or more compared to a baseline level of activity.

[0492] When used herein, "IC50" or "IC 50 The term "IC value" refers to the concentration of a drug at which cell viability is reduced by half. Therefore, IC 50 The IC50 is a measure of the effectiveness of a drug in inhibiting a biological process. In an exemplary model, cell lines are cultured using standard techniques and treated with one or more PCSK9-targeting oligonucleotides (e.g., dsRNA or siRNA) described herein, and the IC50 values ​​of the PCSK9-targeting oligonucleotides (e.g., dsRNA or siRNA) are calculated at 24, 48, and / or 72 hours to determine their effectiveness in downregulating or inhibiting PCSK9 mRNA or protein levels by up to 50% compared to the levels in untreated cells or in the same cells before treatment with the isolated oligonucleotide.

[0493] Methods for monitoring PCSK9 mRNA and / or protein expression can be used to characterize gene silencing and determine the effectiveness of the compositions described herein. PCSK9 expression can be evaluated by any known technique. Examples include immunoprecipitation, flow cytometry, or assays utilizing a PCSK9 antibody, such as ELISA, Western blotting, or immunohistochemistry, to visualize PCSK9 protein expression in cells. Additional methods include various hybridization techniques, Northern blotting, Southern blotting, and various PCR-based methods such as RT-PCR, qPCR, or droplet digital PCR, utilizing nucleic acids that specifically hybridize with the nucleic acid encoding PCSK9 or its specific fragments, or with the transcript (e.g., mRNA) or splicing product of said nucleic acid. PCSK9 mRNA expression can be further evaluated using high-throughput sequencing techniques.

[0494] A method for assaying the effects of individual isolated oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 comprises transfecting a representative cell line with the isolated oligonucleotide and measuring viability. For example, cells from a representative cell line may be transfected using methods known in the art, such as lipofectamine RNAiMAX (Invitrogen-13778-150, Carlsbad, California) and cultured using any suitable techniques known in the art. Optionally, additional therapeutic agents described herein may be added to the cell culture medium at variable concentrations after transfection. After a suitable incubation period, such as 24–96 hours, cell viability can be determined by measuring cell viability using methods such as Cell Titer Glo 2.0 (Promega, CA), and / or PCSK9 mRNA and protein levels can be evaluated using methods described herein.

[0495] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to the present disclosure, isolated oligonucleotides, vectors, delivery systems, or pharmaceutical compositions are administered parenterally.

[0496] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to the present disclosure, parenteral administration is intravenous, subcutaneous, intraperitoneal, or intramuscular.

[0497] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells of the present disclosure, the subjects are human. In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells of the present disclosure, the subjects have related liver diseases such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells of the present disclosure, the method comprises administering an isolated oligonucleotide, vector, delivery system or pharmaceutical composition in combination with at least a second therapeutic agent.

[0498] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to the present disclosure, the second therapeutic agent is an antibody, a small molecule drug, a peptide, a nucleotide molecule, or a combination thereof.

[0499] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells of the present disclosure, the second therapeutic agent is an isolated oligonucleotide of the present disclosure.

[0500] This disclosure also provides a method for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, the method comprising administering an effective amount of a first and at least second oligonucleotide disclosed herein to the subject, the first and at least second oligonucleotides comprising different sequences.

[0501] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to the present disclosure, a first and at least a second oligonucleotide are administered simultaneously.

[0502] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to the present disclosure, a first and at least a second oligonucleotide are administered sequentially.

[0503] In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to this disclosure, the subjects are human. In some embodiments of the methods for inhibiting or downregulating PCSK9 expression or activity in cells according to this disclosure, the subjects have related liver diseases such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In some embodiments of the methods for treating or preventing diseases or disorders associated with abnormal or increased PCSK9 expression or activity, or diseases or disorders involving PCSK9, the subjects are human. In some embodiments of the methods for treating or preventing diseases or disorders associated with abnormal or increased PCSK9 expression or activity, or diseases or disorders involving PCSK9, the disease or disorder is related liver diseases such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0504] In some embodiments of the use of PCSK9 in this disclosure for the treatment or prevention of diseases or disorders associated with abnormal or increased expression or activity of PCSK9, or diseases or disorders in which PCSK9 is involved, the subject is human. In some embodiments of the use of PCSK9 in this disclosure for the treatment or prevention of diseases or disorders associated with abnormal or increased expression or activity of PCSK9, or diseases or disorders in which PCSK9 is involved, the disease or disorder is an associated liver disease such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In some embodiments of the use of PCSK9 in this disclosure in the manufacture of a medicament for the treatment or prevention of diseases or disorders associated with abnormal or increased expression or activity of PCSK9, the subject is human. In some embodiments of the use of PCSK9 in this disclosure in the manufacture of a medicament for the treatment or prevention of diseases or disorders associated with abnormal or increased expression or activity of PCSK9, the disease or disorder is an associated liver disease such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). The treatment or prevention of the disease or disorder is associated with abnormal or increased expression or activity of PCSK9. Route of administration

[0505] Nanoparticles comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure can be administered to a subject by many of the well-known methods currently used for therapeutic treatment. For example, for the treatment of mammalian diseases related to PCSK9 expression or activity, compositions comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure may be injected directly into cells, into the bloodstream or body cavities, or ingested orally, or applied through the skin in the form of a patch. The selected dose should be sufficient to constitute an effective treatment but not so high as to cause unacceptable side effects. The patient's medical condition and health status should preferably be closely monitored during and for a reasonable period after treatment.

[0506] A composition comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure can be administered orally, nasally, percutaneously, pulmonaryly, by inhalation, buccally, sublingually, intraperitoneally, subcutaneously, intramuscularly, intravenously, rectally, intrapleurally, intrathecally, and parenterally. In some embodiments, parenteral administration includes intramuscular, intraperitoneal, subcutaneous, or intravenous administration. Those skilled in the art will recognize the advantages of specific routes of administration.

[0507] The compositions of this disclosure may be administered parenterally. Systemic administration of compositions comprising the nanoparticles of this disclosure may also be by intravenous, transmucosal, subcutaneous, intraperitoneal, intramuscular, or transdermal means. For intravenous parenteral administration, the compositions comprising the nanoparticles may be administered by injection or infusion. For transmucosal or transdermal administration, a penetrating agent suitable for the barrier to be penetrated is used in the formulation. Such penetrating agents are commonly known in the art, and examples of transmucosal administration include surfactants, bile salts, and fusidic acid derivatives. Transmucosal administration may be carried out using a nasal spray or suppository. Dosage

[0508] In therapeutic applications, the dosage of a pharmaceutical composition used in accordance with this disclosure will vary depending on factors influencing the selected dosage, particularly the drug, the age, weight, and clinical condition of the recipient patient, as well as the experience and judgment of the clinician or practitioner administering the treatment. Generally, the dose should be sufficient to result in a reduction, preferably regression, or treatment of a condition or symptom associated with PCSK9 expression or activity. The dosage may vary depending on the age and size of the subject, as well as the type and severity of the disease or disorder associated with PCSK9 expression.

[0509] The terms “effective dose” or “therapeutic effective dose,” as used interchangeably herein, refer to the amount of a pharmaceutical agent used to treat, improve, inhibit, downcontrol or control symptoms associated with PCSK9 expression or abnormal or ectopic PCSK9 expression in a subject, or to exhibit a detectable therapeutic or inhibitory effect in the subject. The effect can be detected by any assay method known in the art. The exact effective dose for a subject depends on the subject’s weight, size and health status, the nature and degree of the condition, and the therapeutic agent or combination of therapeutic agents selected for administration. The therapeutic effective dose for a given situation can be determined by routine experiments, which are within the scope of the clinician’s skill and judgment.

[0510] For any one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 mRNA in this disclosure, the therapeutically effective dose can be initially estimated using a cell culture assay, e.g., a neoplastic cell assay, or an animal model, typically a rat, mouse, rabbit, dog, or pig. Animal models may also be used to determine appropriate concentration ranges and routes of administration. In some embodiments, the efficacy of one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting PCSK9 mRNA in this disclosure can be determined using standard xenograft or patient-derived xenograft mouse models. Such information can then be used to determine useful doses and routes of administration in humans. Therapeutic / prophylactic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., doses of maximum tolerated dose and doses of unobservable adverse effects. Pharmaceutical compositions exhibiting a large therapeutic concentration range are preferred. Dosages may vary within this range depending on the dosage form employed, patient sensitivity, and route of administration.

[0511] Dosage and administration are adjusted to provide a sufficient level of activator or to maintain the desired effect. Factors to consider include the severity of the disease state, the subject's overall health status, age, weight and sex, diet, timing and frequency of administration, drug combinations, sensitivity to response, and tolerance / response to treatment. Long-acting pharmaceutical compositions may be administered every 3-4 days, weekly, or every 2 weeks, depending on the half-life and clearance rate of the particular formulation.

[0512] The required dose of nanoparticles containing one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure depends on the choice of administration route, the nature of the formulation, the nature of the patient's disease, the size, weight, surface area, age, and sex of the subject, other drugs being administered, and the judgment of the attending physician. A wide range of dose variations are expected, considering the different efficiencies of various administration routes. For example, oral administration is expected to require a higher dose (e.g., 2, 3, 4, 6, 8, 10, 20, 50, 100, 150 or more) than intravenous administration. These dose level variations can be adjusted using standard empirical routines for optimization, as is well understood in the art. Administration may be a single dose or multiple doses. Encapsulation of the inhibitor in a suitable delivery vehicle (e.g., capsule or implantable device) may enhance the efficiency of delivery, particularly for oral delivery.

[0513] A therapeutically effective amount of one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure may be combined with an approved amount of the therapeutic agent as described herein.

[0514] Kits and manufactured products

[0515] The Disclosure also provides a kit comprising an isolated oligonucleotide disclosed herein, a vector encoding an isolated oligonucleotide disclosed herein, a delivery system of the Disclosure, or a pharmaceutical composition of the Disclosure.

[0516] The kit is intended for use in treating diseases associated with abnormal or abnormal expression of PCSK9 in mammals. The kit is intended for use in partially or completely downregulating or inhibiting PCSK9 expression in mammals. In some embodiments, the mammal is human, mouse, rat, rabbit, pig, cattle, dog, cat, ungulate, ape, monkey, or horse. In some embodiments, the mammal is human.

[0517] Nanoparticles comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting the PCSK9 mRNA of this disclosure may be lyophilized before being packaged in a kit, or may be provided in a solution containing a pharmaceutically acceptable carrier, excipient diluent.

[0518] In some embodiments of the kits of this disclosure, the kit comprises a composition comprising a delivery system of this disclosure containing one or more isolated oligonucleotides (dsRNA or siRNA) of this disclosure that target PCSK9 in a therapeutically effective amount, and instructions for use thereof. In some embodiments, the kit further comprises at least one additional therapeutic agent as described herein.

[0519] The manufactured product includes, but is not limited to, instructions for use of the kit in the treatment of diseases associated with abnormal or ectopic expression of PCSK9 or diseases associated with PCSK9 expression.

[0520] In some embodiments, the kit further includes instructions for administering the isolated oligonucleotides, vectors, delivery systems, and pharmaceutical compositions of this disclosure.

[0521] All percentages and ratios used herein are by weight unless otherwise indicated. Other features and advantages of this disclosure are evident from the various examples. The provided examples illustrate various components and techniques useful for carrying out this disclosure. The examples do not limit the claimed invention. Based on this disclosure, those skilled in the art can identify and adopt other components and methods useful for carrying out this disclosure. [Examples]

[0522] Example 1: Design and testing of siRNA compounds against PCSK9 mRNA.

[0523] The examples described herein, including those listed in Tables 1-3, demonstrated the efficacy of siRNA compounds against PCSK9 mRNA.

[0524] material and method

[0525] A set of siRNA compounds against the human PCSK9 transcript (accession number: NM_174936.4) was designed (Table 1). Due to the low expression level of PCSK9 in the in vitro cell line, a Dual-Glo Luciferase assay was performed to evaluate the efficacy of the compounds in silencing human PCSK9 mRNA. First, on day 0, Huh-7 cells were transfected with the psiCHECK2-PCSK9 plasmid using Fugene-HD reagent. On day 1, the siRNA compounds were diluted to the desired concentration in PBS and transfected into Huh-7 cells transfected with the psiCHECK2-PCSK9 plasmid at two concentrations, 0.05 nM and 0.5 nM, using the lipofectamine RNAiMAX reagent. 24 hours after siRNA transfection (day 2), the luciferase activity of fireflies (transfection control) and sea urchins (fused with the PCSK9 transcription sequence) was measured using the Dual-Glo Luciferase reagent kit. The data is represented as mean + / - SEM.

[0526] Compound synthesis

[0527] Oligonucleotides were prepared by solid-phase synthesis according to a standard protocol. Briefly, oligonucleotide synthesis was performed on a solid support, and each nucleoside phosphoramidite was incorporated from the 3'-terminus to the 5'-terminus to prepare single-chain oligonucleotides. ETT or BTT was used as an activator for the coupling reaction. Iodine in water / pyridine / THF was used to oxidize the phosphate tryster (P(III)) to obtain the phosphate backbone, and DDTT was used to prepare the phosphorothioate bond. The oligonucleotides were cleaved from the solid support using an aqueous ammonium solution, and the protecting groups were removed overall. The crude oligonucleotides were then concentrated using Genevac and purified by AEX-HPLC. The pure fractions were combined and concentrated, and their purity was analyzed by LC-MS. The oligonucleotides were then dialyzed against water using a MidiTrap G-25 column, concentrated, and their OD values ​​were measured.

[0528] To prepare siRNA double helix, the sense and antisense strands were annealed at 95°C for 10 minutes based on equimolar amounts and then cooled to room temperature. Double helix purity was determined by AEX-HPLC, and the solution was lyophilized to obtain the desired siRNA double helix powder.

[0529] RT-qPCR

[0530] mRNA from cells was prepared using the RNeasy 96 kit. Liver mRNA samples were prepared using the RNeasy Plus mini kit. mRNA was reverse transcribed into cDNA using high-capacity cDNA reverse transcription kits with RNase inhibitors. TaqMan multiplex qPCR assays were performed to determine the relative levels of PCSK9 mRNA over time.

[0531] In vitro compound screening in Huh-7 cells

[0532] The compounds (Table 1) were diluted to the desired concentration in PBS. The compounds were transfected into cultured Huh-7 cells using lipofectamine RNAiMAX reagent. mRNA was extracted 24 hours after transfection for RT-qPCR analysis.

[0533] Western blotting

[0534] A 10 mg liver sample was homogenized in RIPA lysis buffer. Total protein concentration was determined by BCA assay. 10 μg of total protein sample was added for electrophoresis. Cynomolgus monkey PCSK9 protein was blotted with rabbit anti-PCSK9 (N-terminal) polyclonal antibody (Absin, Abs110383, 1:1000 dilution). GAPDH protein was blotted with rabbit anti-GAPDH polyclonal antibody (Absin, Abs132004, 1:5000 dilution). Proteins were detected using goat anti-rabbit IgG-HRP secondary antibody (Absin, Abs20002, 1:20000).

[0535] Evaluation of ex vivo efficacy in primary human hepatocytes (PHH)

[0536] Compounds containing a GalNAc conjugate at the 3' end of the sense (passenger) strand were tested via free-uptake in PHH. The compounds were directly added to cultured primary hepatocytes in single or multiple doses. After 48 hours, cells were harvested for mRNA analysis by RT-qPCR. Data are shown as mean + / - SD. (Figures 4A-4B)

[0537] In vivo compound screening in HDI mouse liver

[0538] A compound containing a GalNAc conjugate was formulated in 1×PBS and administered subcutaneously to BALB / c female animals (6-8 weeks old) on day 1. Subsequently, the animals received 10 μg of pcDNA3.1-PCSK9 plasmid on day 4. Liver autopsy was performed on day 5 for RT-qPCR analysis.

[0539] For dose-response studies, 6-8 week old female BALB / c mice were subcutaneously administered 0.25 mg / kg, 0.5 mg / kg, or 1 mg / kg. Control animals were administered PBS. The animals were sacrificed 4 days after administration, and liver samples were collected for RNA extraction and PCSK9 mRNA level analysis by RT-qPCR. The results of this experiment are shown in Figures 1A and 1B.

[0540] Evaluation of in vivo efficacy and duration in cynomolgus monkeys

[0541] To evaluate the potency of the compounds (Table 3), non-terminal studies were performed in cynomolgus monkeys. Liver biopsies were taken from the cynomolgus monkeys in this study two weeks prior to administration (-14 days) to determine baseline mRNA expression levels. Serum LDL-c and PCSK9 protein levels were assessed as baseline measurements on -14 days, -7 days, and day 1. On day 1, a single dose of 3 mg / kg of the compounds listed in Table 3 was administered to the animals. Blood samples were taken on post-administration days 8, 16, 22, 30, 36, 43, 50, 58, 64, 71, 78, 86, 93, 99, 106, and 113. Liver biopsies were collected on post-administration days 15, 29, and 85. The results of this experiment are shown in Figures 3A and 3B.

[0542] Furthermore, monkeys with LDL-C levels exceeding 1.5 mmol / L were used as a model for idiopathic hypercholesterolemia. On day 0, these monkeys were subcutaneously administered 3 mg / kg of the compound (Table 3). Serum samples were collected for PCSK9 and LDL-C analysis (Figures 7A-7B).

[0543] Evaluation of in vivo efficacy and duration in humanized PCSK9 gene-transformed mice.

[0544] The potency and efficacy of the compounds listed in Table 3 were tested by administering them to humanized PCSK9 gene-transfer mice. The humanized PCSK9 gene-transfer mice were mice in which the endogenous mouse PCSK9 locus was replaced with human PCSK9 (hsPCSK9 Tg strain, GemPharmatech Company, B6 / JGpt-Pcsk9em1Cin(hPCSK9-UTR) / Gpt, T053388). These mice were subcutaneously administered 0.5 or 3 mg / kg of the reference compound or candidate compound. In the potency evaluation test (Figures 5A-5C), hsPCSK9 Tg mice were fed solid feed throughout the study. In the efficacy test (Figures 6A-6C), hsPCSK9 Tg mice were fed a 60% high-fat diet (test diet, D12492) for 11 weeks. In the high-fat diet, hypercholesterolemia was successfully established with an average 3.5-fold increase in LDL-C levels, and this remained stable from week 6 to week 11. The animals were maintained on the same diet until the end of the study (day 80 after administration).

[0545] The reference compound was an oligonucleotide containing the sense and antisense strands shown below. Sense chain: 5'-Cms-Ums-Am-Gm-Am-Cm-Cf-Um-Gf-Um-dT-Um-Um-Gm-Cm-Um-Um-Um-Um-Gm-Um-L96-3'(Sequence ID 56) Antisense chain: 3'-Ams-Ams-Gm-Am-Um-Cf-Um-Gf-Gm-Af-Cm-Af-Am-Af-Am-Cf-Gm-Af-Af-Af-Ams-Cfs-Am-5' (Sequence ID 57) Here, "Af" is adenine 2'-F ribonucleotide, "Cf" is cytosine 2'-F ribonucleotide, "Gf" is guanine 2'-F ribonucleotide, "Am" is adenine 2'-OMe ribonucleotide, "Cm" is cytosine 2'-OMe ribonucleotide, "Gm" is guanine 2'-OMe ribonucleotide, "Um" is uracil 2'-OMe ribonucleotide, "dT" is thymidine, "s" is a phosphorothioate, and "L96" is a tribranched GalNAc (N-acetyl-galactosamine) with the following structure. [ka]

[0546] Measurement of serum PCSK9 protein and LDL cholesterol

[0547] Cynomolgus monkey serum PCSK9 protein was measured using a human PCSK9 ELISA kit or a human proprotein convertase 9 / PCSK9 immunoassay. LDL-c levels were measured using a chemical analyzer.

[0548] For experiments using humanized PCSK9 gene-transfected mice, orbital blood was collected in EDTA-clad tubes after a 4-hour fast before administration and on days 4, 8, and 12 post-administration. Plasma was separated and collected after centrifugation at 5,000 rpm for 10 minutes. Plasma human PCSK9 protein was measured using a human PCSK9 ELISA kit.

[0549] Results and Observations

[0550] The results, as shown in Table 2, indicated that the compounds were able to reduce the level of human PCSK9 mRNA in transfected Huh-7 cells by more than 50% at concentrations of 0.02 nM, 0.1 nM, 0.5 nM, or 1.5 nM. Furthermore, some compounds were able to reduce the level of human PCSK9 mRNA in transfected cells by more than 80% or more than 85% at a concentration of 0.5 nM (Table 2). Figures 1A and 1B show the results of in vivo compound screening in the liver of HDI mice. All compounds demonstrated efficacy in reducing the RNA expression level of human PCSK9.

[0551] As shown in Figures 2A and 2C, all eight compounds without a 5'MeEP cap listed in Table 3 (SEQ ID NO: 16 / SEQ ID NO: 36, SEQ ID NO: 18 / SEQ ID NO: 37, SEQ ID NO: 20 / SEQ ID NO: 38, SEQ ID NO: 22 / SEQ ID NO: 39, SEQ ID NO: 24 / SEQ ID NO: 40, SEQ ID NO: 26 / SEQ ID NO: 41, SEQ ID NO: 32 / SEQ ID NO: 42, and SEQ ID NO: 34 / SEQ ID NO: 43) were able to reduce cynomolgus monkey PCSK9 protein in cynomolgus monkey liver samples after a single subcutaneous administration of 3 mg / kg. LDL-c levels (normalized to day 1 before administration) remained reduced until day 113 (day 113 or D113) after administration, as shown in Figure 2A. PCSK9 protein levels (normalized to day 1 before administration) remained reduced until day 99 (day 99 or D99) after administration, as shown in Figure 2B. As shown in Figure 2C, by day 15, several compounds reduced PCSK9 protein levels by at least 50% compared to pre-administration levels (-day 14). For all compounds, the maximum reduction in PCSK9 protein levels was observed on day 29 post-administration, as shown in Figure 2C.

[0552] As shown in Figures 3A to 3C, the three compounds listed in Table 3 (SEQ ID NO: 16 / SEQ ID NO: 17, SEQ ID NO: 18 / SEQ ID NO: 19, and SEQ ID NO: 45 / SEQ ID NO: 19) were able to reduce cynomolgus monkey PCSK9 protein in cynomolgus monkey liver samples after a single subcutaneous administration of 3 mg / kg. As shown in Figure 3A, LDL-c levels (normalized to day 1 before administration) remained reduced until day 112 (day 112 or D112) after administration. As shown in Figure 3B, PCSK9 protein levels (normalized to day 1...

Claims

1. Including sense strands and antisense strands, The sense strand comprises a nucleotide sequence substantially identical to the region between nucleotide positions 3543-3596 from the 5' end of the proprotein convertase subtilisin / kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1, An isolated oligonucleotide, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

2. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between nucleotide positions 3543 and 3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO:

1.

3. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 3543-3596 from the 5' end of the PCSK9 mRNA sequence according to SEQ ID NO:

1.

4. The isolated oligonucleotide according to any one of claims 1 to 3, wherein the antisense chain comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-7, 28, or 29.

5. The isolated oligonucleotide according to any one of claims 1 to 4, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 8-13, 30, or 31.

6. The aforementioned double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 2 (5'UUAUCUUCAAAGUACAAAGCA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 8 (5'CUUUUGUACUUGAAGAAUAA 3') ii) Antisense strand of nucleic acid sequence by SEQ ID NO: 3 (5'UGAAUAAAAAUCUUCAAAGUUAC 3') and sense strand of nucleic acid sequence by SEQ ID NO: 9 (5'AACUUGAAAGAUAUUUAUCA 3') iii) Antisense strand of nucleic acid sequence by Sequence ID: 6 (5'UUUAAUAAAAUGCUACAAAAC 3'), and sense strand of nucleic acid sequence by Sequence ID: 12 (5'UUUGUAGCAAUUUUUAUUAAA 3'); iv) The antisense strand of the nucleic acid sequence by SEQ ID NO: 7 (5'UUAUUAAUAAAAUGCUACAAA 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 13 (5'UGUAGCAAUUUUUAUAAUAA 3'); or v) The isolated oligonucleotide according to claim 3, comprising an antisense strand of a nucleic acid sequence by SEQ ID NO: 28 (5'UAUGCUACAAAACCCAGAAUAA 3') and a sense strand of a nucleic acid sequence by SEQ ID NO: 30 (5'AUUCUGGGGUUUUUGUAGCAAUA 3').

7. The aforementioned double-stranded region is i) Antisense strand of nucleic acid sequence by SEQ ID NO: 4 (5'UAAAAAAUGCUACAAAACCCAGA 3') and sense strand of nucleic acid sequence by SEQ ID NO: 10 (5'UGGGGUUUUGUAGCAAUUUUUA 3'), ii) The antisense strand of the nucleic acid sequence by SEQ ID NO: 5 (5'UAAUAAAAUGCUACAAAACCC 3') and the sense strand of the nucleic acid sequence by SEQ ID NO: 11 (5'GUUUUGUAGCAAUUUUUAUA 3'); or iii) The isolated oligonucleotide according to claim 3, comprising an antisense strand of a nucleic acid sequence by SEQ ID NO: 29 (5'UUAAUAAAAAUGCUACAAAACC 3') and a sense strand of a nucleic acid sequence by SEQ ID NO: 31 (5'UUUUGUAGCAAUUUUUAUUAA 3').

8. The isolated oligonucleotide according to any one of claims 1 to 7, wherein the sense strand, the antisense strand, or both comprises one or more modified nucleotide sequences.

9. The isolated oligonucleotide according to claim 8, wherein the antisense chain comprises a monomethyl-protected phosphate mimetic (5'-MeEP).

10. The isolated oligonucleotide according to claim 8, wherein the antisense chain comprises a phosphate mimetic linked to a 5'-terminated uracil, and the phosphate mimetic is selected from the following: 【Chemistry 1】

11. An isolated oligonucleotide according to any one of claims 1 to 10, wherein the sense strand, the antisense strand, or both have terminal or internal nucleotides linked to a targeted ligand.

12. The isolated oligonucleotide according to claim 11, wherein the targeted ligand is bound to the 3' end (e.g., the 3' terminal position) of the sense strand.

13. The isolated oligonucleotide according to any one of claims 11 to 12, wherein the targeted ligand comprises GalNAc.

14. The isolated oligonucleotide according to any one of claims 11 to 13, wherein the targeted ligand comprises at least one GalNAc G1b moiety.

15. The aforementioned antisense chain is given by the formula: 3' (M) ０ (F) ０ (M) ６ (F) １ (M) １ (F) １ (M) ３ (F) １ (M) ２ (F) １ (M) １ (F) １ (M) １ (F) ２ (M) １ An isolated oligonucleotide according to any one of claims 1 to 14, comprising nucleotides modified with 2'-F modification and nucleotides modified with 2'-O-methyl modification by 5'.

16. The aforementioned sense chain is given by the formula: 5' (M) ０ (F) ０ (M) ５ (F) １ (M) １ (F) ４ (M) ９ An isolated oligonucleotide according to any one of claims 1 to 15, comprising a nucleotide modified by a 2'-F modification and a nucleotide modified by a 2'-O-methyl modification by a 3'.

17. The aforementioned antisense chain, i) Antisense strand of nucleic acid sequence by Sequence ID No. 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3'); ii) Antisense strand of nucleic acid sequence by Sequence ID 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'); iii) i) Sequence ID 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'); Antisense strand of nucleic acid sequence, iv) Sequence ID 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mC][fA][mA][mA][mCs][mCs][mCs][mC] 3'); Antisense strand of nucleic acid sequence, v) Antisense strand of nucleic acid sequence by Sequence ID No. 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'); vi) Antisense strand of nucleic acid sequence by Sequence ID No. 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][mA][mC][fC][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'); viiii) Sequence ID 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mA][mAs][mCs][mC] 3'); Antisense strand of nucleic acid sequence, ix) Sequence ID 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'); antisense strand of nucleic acid sequence by, or x) Sequence ID 54 (5' [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), contains one of the antisense strands of nucleic acid sequences, "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide interbond, and "MeEPmU" is as follows: 【Chemistry 2】 And "EPmU" is as follows: 【Transformation 3】 And "C-EPmU" is as follows: 【Chemistry 4】 The isolated oligonucleotide according to any one of claims 1 to 16.

18. The aforementioned sense chain, i) Sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) Sense strand of nucleic acid sequence by Sequence ID No. 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Sense strand of nucleic acid sequence by Sequence ID No. 24 (5' [mUs][mUs][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); vi) Sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Sense strand of nucleic acid sequence by Sequence ID 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viiii) Sense strand of nucleic acid sequence by Sequence ID 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'), or ix) Sequence ID 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mU][mA][mU][mU][mC][mA][G1b][G1b][G1b] 3'), contains one of the sense strands of nucleic acid sequences, An isolated oligonucleotide according to any one of claims 1 to 17, wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide internucleotide bond, and "G1b" is a GalNac G1b moiety.

19. The aforementioned double-stranded region is i) Antisense strand of nucleic acid sequence by Sequence ID No. 17 (5' [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mA][mGs][mCs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 16 (5' [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); ii) Sequence ID 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), antisense strand of nucleic acid sequence and Sense strand of nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'); iii) i) Sequence ID 21 (5' [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3'), antisense strand of nucleic acid sequence and Sense strand of nucleic acid sequence by Sequence ID No. 20 (5' [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3'); iv) Sequence ID: 23 (5' [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mC][mCs][mCs][mCs][mC] 3'), antisense strand of nucleic acid sequence and Sense strand of nucleic acid sequence by Sequence ID No. 22 (5' [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) Sequence ID 25 (5' [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3'), antisense strand of nucleic acid sequence and Sequence ID 24 (5' [mUs][mUs][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mU][mA][mU][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3'); Sense strand of nucleic acid sequence, vi) Sequence ID 27 (5' [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][mA][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3'), antisense strand of nucleic acid sequence and Sense strand of nucleic acid sequence by Sequence ID No. 26 (5' [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); vii) Antisense strand of nucleic acid sequence by Sequence ID No. 33 (5' [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][mA][mC][fC][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3'), and Sense strand of nucleic acid sequence by Sequence ID No. 32 (5' [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3'); viiii) Antisense strand of nucleic acid sequence by Sequence ID 35 (5' [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mA][mAs][mCs][mC] 3'), and Sense strand of nucleic acid sequence by Sequence ID 34 (5' [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); ix) Sequence ID 19 (5' [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), antisense strand of nucleic acid sequence and Sense strand of nucleic acid sequence by Sequence ID No. 52 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mU][mA][mU][mU][mC][mA][G1b][G1b][G1b] 3'); x) Antisense strand of nucleic acid sequence by Sequence ID 53 (5' [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), and The sense strand of the nucleic acid sequence by Sequence ID No. 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'), or xi) Sequence ID 54 (5' [CEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3'), antisense strand of nucleic acid sequence and Sequence ID 18 (5' [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3'), contains the sense strand of the nucleic acid sequence, "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, "G1b" is the GalNac G1b portion, and "MeEPmU" is as follows: 【Transformation 5】 And "EPmU" is as follows: 【Transformation 6】 And "C-EPmU" is as follows: 【Transformation 7】 The isolated oligonucleotide according to any one of claims 1 to 18.

20. A vector encoding an isolated oligonucleotide according to any one of claims 1 to 19.

21. The vector according to claim 20, wherein the vector is a plasmid.

22. A delivery system comprising an isolated oligonucleotide according to any one of claims 1 to 19 or a vector according to any one of claims 20 to 21.

23. A pharmaceutical composition comprising an isolated oligonucleotide according to any one of claims 1 to 19, a vector according to any one of claims 20 to 21, a delivery system according to claim 22, and a pharmaceutically acceptable carrier, diluent, or excipient.

24. A kit comprising an isolated oligonucleotide according to any one of claims 1 to 19, a vector according to any one of claims 20 to 21, a delivery system according to claim 22, or a pharmaceutical composition according to claim 23.

25. A method for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring it, comprising administering to the subject an effective amount of an isolated oligonucleotide according to any one of claims 1 to 19, a vector according to any one of claims 20 to 21, a delivery system according to claim 22, or a pharmaceutical composition according to claim 23.

26. The method according to claim 25, wherein the subject has hypercholesterolemia, coronary heart disease, peripheral artery disease, stroke, type 2 diabetes, obesity, or hypertension, or a combination thereof.

27. The method according to any one of claims 25 to 26, wherein the method comprises administering the isolated oligonucleotide, the vector, the delivery system, or the pharmaceutical composition in combination with at least a second therapeutic agent.

28. A method for inhibiting or downregulating the expression or level of PCSK9 in a subject requiring such inhibition, the method comprising administering to the subject an effective amount of a first and at least second oligonucleotide described in any one of claims 1 to 19, wherein the first and at least second oligonucleotides comprise different sequences.

29. A method for treating or preventing a disease or disorder related to abnormal or increased expression or activity of PCSK9, or a disease or disorder involving PCSK9, in a subject requiring such treatment, the method comprising administering to the subject an effective amount of an isolated oligonucleotide according to any one of claims 1 to 19, a vector according to any one of claims 20 to 21, a delivery system according to claim 22, or a pharmaceutical composition according to claim 23.

Images