RNAi agents that inhibit AGT gene expression and their use
A double-stranded RNAi agent targeting the AGT gene addresses the limitations of existing hypertension treatments by providing a novel mechanism to inhibit AGT expression, enhancing hypertension treatment efficacy and efficacy by inhibiting the expression of the AGT gene, thereby reducing hypertension and its cardiovascular sequelae.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- CSPC ZHONGQI PHARMACEUTICAL TECHNOLOGY (SHIJIAZHUANG) CO LTD
- Filing Date
- 2024-07-05
- Publication Date
- 2026-07-08
AI Technical Summary
Current treatments for hypertension, such as angiotensin-converting enzyme inhibitors and angiotensin type 1 receptor blockers, have limitations in preventing target organ damage and cardiovascular death, and carry a high risk of toxicity, while silencing the AGT gene offers a novel mechanism for RAAS inhibition that maintains renal homeostasis and minimizes angiotensin II signaling evasion.
A double-stranded RNAi agent is developed to inhibit the expression of the AGT gene, comprising specific nucleotide sequences and modifications, targeting the upstream of the RAAS pathway to reduce hypertension and its cardiovascular sequelae.
The RNAi agent effectively silences AGT expression, providing superior safety and efficacy in treating hypertension and preventing organ damage by maintaining renal function and minimizing angiotensin II signaling evasion.
Smart Images

Figure 2026522675000033 
Figure 2026522675000034 
Figure 2026522675000035
Abstract
Description
Technical Field
[0001] [Cross - reference to Related Applications] This application claims priority to a Chinese patent application with application number 202310826984.8, titled "RNAi Agent Inhibiting the Expression of AGT Gene and Its Use", filed with the China National Intellectual Property Administration on July 6, 2023, and a Chinese patent application with application number 202410478014.8, titled "RNAi Agent Inhibiting the Expression of AGT Gene and Its Use", filed with the China National Intellectual Property Administration on April 19, 2024, and all of their contents are incorporated herein by reference.
[0002] [Technical Field] This application belongs to the field of molecular biology and relates to a modified double - stranded RNAi agent and its use, specifically, a double - stranded RNAi agent that inhibits the expression of the AGT gene and its pharmaceutical composition, and the use of the double - stranded RNAi agent or its pharmaceutical composition in the treatment of diseases mediated by AGT expression.
Background Art
[0003] RNA interference (RNAi) widely exists in natural biological species. Since Andrew Fire and Craig Mello et al. first discovered the RNAi phenomenon in Caenorhabditis elegans (C. elegans) in 1998, and Tuschl and Phil Sharp et al. confirmed the existence of RNAi in mammals in 2001, research on the mechanism of RNAi, gene function, and clinical applications has made great progress. RNAi plays an important role in various defense mechanisms of organisms, such as virus infection defense and preventing the jumping of transposons (Hutvagner et al., 2001; Elbashir et al., 2001; Zamore 2001). Products developed based on the RNAi mechanism are very promising pharmaceutical candidates. Small interfering RNA (siRNA) can exert the RNA interference effect and is a major tool for realizing RNAi.
[0004] Hypertension is a serious cardiovascular disease that significantly increases the risk of heart, brain, kidney, and other diseases, and is a leading cause of premature death worldwide. Diagnosis of hypertension is based on two separate days of measurements, where the systolic blood pressure (SBP) is ≥140 mmHg and / or the diastolic blood pressure (DBP) is ≥90 mmHg.
[0005] It is estimated that 1.28 billion adults aged 30 to 79 worldwide suffer from hypertension. Of these, 46% of adults with hypertension are unaware they have the disease, only 42% are diagnosed and treated, and only about one-fifth (21%) have their blood pressure under control. In China, according to the latest disease survey data, more than a quarter of the population aged 18 and over suffer from hypertension, yet the blood pressure control rate is only 16.9%. The situation regarding the prevention and treatment of hypertension is extremely serious. Hypertension damages vital organs such as the heart, brain, and kidneys and is known as a "silent killer disease."
[0006] Chronic hyperactivation of the renin-angiotensin-aldosterone (RAAS) pathway is considered a major factor in the pathogenesis of cardiovascular diseases, including hypertension and heart failure. Angiotensin-converting enzyme inhibitors (ACE inhibitors) and angiotensin type 1 receptor blockers (ARBs) (e.g., commonly used sartan and prill antihypertensive drugs) block the RAAS pathway and are among the most effective treatments for hypertension and heart failure accompanied by reduced ejection fraction. However, this method has limitations in preventing target organ damage and cardiovascular death, and carries a high risk of targeted toxicity, mainly manifesting as hyperkalemia and renal failure. Therefore, clinical doses are kept low, limiting more effective inhibition and clinical benefit of these pathways. Furthermore, downstream blocking of the RAAS pathway can lead to increased compensation in the upstream pathway, potentially further limiting its therapeutic effect.
[0007] In rodents and humans, angiotensin(1-12) has been identified as a non-renin-dependent substrate for angiotensin II production. Therefore, a research team in the United States designed a monoclonal antibody against the C-terminus of the human angiotensin(1-12) sequence. Using a hypertension model in which the human angiotensinogen (AGT) gene was expressed in the rat genome, the researchers investigated whether immune neutralization of endogenous human angiotensin(1-12) was effective in suppressing blood pressure elevation and reversing hypertension-induced target organ damage. The results showed that angiotensin(1-12) is a substrate for endogenous angiotensin II production, is involved in arterial pressure control in humanized hypertension models, and that selective immune neutralization by this alternative substrate is a promising novel therapeutic approach for treating hypertension and preventing its harmful cardiovascular sequelae.
[0008] Silencing liver-derived AGT and targeting the upstream of the RAAS pathway represents a novel mechanism of RAAS inhibition. Compared to existing RAAS inhibitors, this approach has two potential advantages. First, by inhibiting AGT production in the liver and minimizing RAAS inhibition in the kidney, it can maintain renal homeostasis and the integrity of glomerular feedback, thereby retaining potassium (K+) ions, mitigating renal failure, and demonstrating superior safety. Second, it minimizes evasion mechanisms related to the recovery of angiotensin II levels or the maintenance of angiotensin II signaling. More complete inhibition of locally produced angiotensin II in vascular or cardiac tissue may be beneficial for patients with refractory hypertension or heart failure. Therefore, the development of inhibitors that efficiently silence AGT would provide an effective means with superior efficacy, specificity, stability, targeting, or tolerability for subjects with angiotensinogen-related disorders. [Overview of the project]
[0009] The object of this application is to provide a double-stranded RNAi agent and a pharmaceutical composition thereof that inhibits the expression of the AGT gene, as well as a method and use for inhibiting or reducing the expression of the AGT gene by the above double-stranded RNAi agent and the pharmaceutical composition thereof, or for treating diseases or symptoms mediated by the AGT gene.
[0010] One embodiment of the present invention provides a double-stranded RNAi agent capable of inhibiting AGT expression in cells. The double-stranded RNAi agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand being complementary, the antisense strand containing a sequence complementary to a portion of the sequence of mRNA encoding AGT, and each strand having a length of 14 to 30 nucleotides.
[0011] For example, each strand (sense strand or antisense strand) may be in the range of 14-30 nucleotides, 17-30 nucleotides, 25-30 nucleotides, 27-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 19-25 nucleotides, 19-23 nucleotides, 19-21 nucleotides, 21-25 nucleotides, or 21-23 nucleotides.
[0012] The double-stranded region of the double-stranded RNAi agent may be, for example, in the range of 14-30 nucleotide pairs, 17-30 nucleotide pairs, 27-30 nucleotide pairs, 17-23 nucleotide pairs, 17-21 nucleotide pairs, 17-19 nucleotide pairs, 19-25 nucleotide pairs, 19-23 nucleotide pairs, 19-21 nucleotide pairs, 21-25 nucleotide pairs, or 21-23 nucleotide pairs.
[0013] In another embodiment, the double-stranded region is selected from lengths of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotide pairs.
[0014] In one embodiment of the present invention, the double-stranded RNAi agent can inhibit the expression of the AGT gene in humans, monkeys, rats, or mice.
[0015] The RNAi agent of this application includes an RNAi agent having a nucleotide overhang at one end (i.e., a reagent having an overhang at one end and a blunt end at the other), or an RNAi agent having nucleotide overhangs at both ends.
[0016] In one embodiment, the double-stranded RNAi agent may include one or more overhanging end regions and / or capping groups at the 3' end, 5' end, or both ends of one or both strands. The overhanging end may be 1 to 6 nucleotides long, for example, 2 to 6 nucleotides, 1 to 5 nucleotides, 2 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides, and the overhanging end may be arbitrarily selected from U, A, G, C, and T. In one embodiment, the sense strand of the double-stranded RNAi agent has 21 nucleotides, and the antisense strand has 23 nucleotides.
[0017] In this application, the nucleotide sequence of the double-stranded RNAi agent is as shown in one of the dsRNA sequences in Table 2.
[0018] In one embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1) (5'→3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 2) (5'→3' direction). In another embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACC (SEQ ID NO: 3) (5'→3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence GGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 4) (5'→3' direction).
[0019] In one embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (5'→3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (5'→3' direction).
[0020] In another embodiment, one or more nucleotides of the sense strand and antisense strand of the double-stranded RNAi agent have one or more modifications selected from the group consisting of 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, locking nucleic acid modification, ring-opening or unlocking nucleic acid modification, DNA modification, and fluorescent probe modification.
[0021] In one embodiment of the present application, both the sense strand and the antisense strand of the double-stranded RNAi agent include 2'-O-methyl and / or 2'-fluoro modifications. In another embodiment of the present application, the double-stranded RNAi agent further includes, preferably, at least one phosphorothioate or methylphosphonate internucleotide bond.
[0022] In another embodiment of the present application, in the double-stranded RNAi agent, the internucleotide binding of the phosphorothioate or methylphosphonate is located at the 5' and 3' ends of one of the strands. Preferably, the internucleotide binding is located at the 5' and 3' ends of the sense strand and the antisense strand. More preferably, the internucleotide binding is located between three nucleotides at the 5' and 3' ends of the sense strand and the antisense strand.
[0023] In another embodiment of the present application, the double-stranded RNAi agent includes the following: (1) The antisense strand has a protruding end with a 5’(s)mN(s)mN3’ structure at the 3’ end; (2) The antisense strand is fluorinated at at least the 2nd, 14th, and 16th positions from the 5’ end, and methoxy-modified at other positions as much as possible; (3) The antisense strand is thiophosphorylated at least at two positions from the 3’ end and the 5’ end. Preferably, the antisense strand contains a phosphorothioate backbone modification at least at the first and second internucleotide linkages from the 3’ end and the 5’ end; (4) The sense strand is fluorinated at the 7th position from the 5’ end and at the 9th to 11th positions, and methoxy-modified at other positions as much as possible; (5) The sense strand is thiophosphorylated at least at two positions from the 5’ end. Preferably, the sense strand contains a phosphorothioate backbone modification at least at the first and second internucleotide linkages from the 5’ end. Preferably, the 3’ end is covalently bonded to GalNAc.
[0024] In another embodiment of the present application, the double-stranded RNAi agent includes: (1) A sense strand containing 21 nucleotides, which is configured such that 2’-fluoro modification regions and 2’-O-methyl modification regions alternate, the length of each modification region is 1 to 3 nucleotides, and the modification forms of the first modification regions from the 5’ end and the 3’ end are the same; and (2) An antisense strand containing 23 nucleotides, which is configured such that 2’-O-methyl modification regions and 2’-fluoro modification regions alternate, the length of each modification region is 1 to 3 nucleotides, and the 1st to 3rd consecutive nucleotide regions from the 5’ end and the 3’ end are all linked by a phosphorothioate backbone.
[0025] In one embodiment of the present application, the double-stranded RNAi agent is bound to at least one ligand, and the ligand is selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine (GalNAc) derivatives or analogs.
[0026] In some embodiments, the ligand is linked to the 3'-end, 5'-end and / or within the strand of the double-stranded RNAi agent.
[0027] In some embodiments, the 3'-end, 5'-end and / or within the strand of the double-stranded RNAi agent is modified with 1 to 5, 2 to 4 or 3 N-acetylgalactosamine derivatives or analogs. Specifically, the structure of a single said N-acetylgalactosamine derivative is as shown in Formula I.
Chemical formula
[0028] Preferably, the ligand is linked to the 3'-end of the sense strand of the double-stranded RNAi agent.
[0029] In one embodiment of the present application, in the double-stranded RNAi agent, the ligand is one or more GalNAc derivatives linked to a monovalent or trivalent branched linker.
[0030] In one embodiment of the present application, the double-stranded RNAi agent is (1) an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity with the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO:7), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO:8); (2) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO:9), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO:10); (3) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12); (4) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO:13), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO:14); (5) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16); (6) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO:17), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO:18); (7) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence AmsGfsAmAmGmAmAmAmGmGmUmGmGmUmGmUmGmUmCCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmCmC (8) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO:21); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmGm (SEQ ID NO:22); (9) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO:23); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO:24); (10) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity with the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity with the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO:26); or (11) comprising an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO:27), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm (SEQ ID NO:28); Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, while Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone. Furthermore, this application states,
[0031] (1) A sense strand containing UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and an antisense strand containing GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8); (2) A sense strand containing GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO:9) and an antisense strand containing GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO:10); (3) A sense chain containing GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO:11) and an antisense chain containing GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO:12); (4) A sense strand containing UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO:13) and an antisense strand containing CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO:14); (5) A sense strand containing UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm(SEQ ID NO:15) and an antisense strand containing CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm(SEQ ID NO:16); (6) A sense strand containing UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO:17) and an antisense strand containing GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO:18); (7) A sense strand containing AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO:19) and an antisense strand containing CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO:20); (8) A sense chain containing CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO:21) and an antisense chain containing CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO:22); (9) A sense chain containing UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO:23) and an antisense chain containing CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO:24); (10) A sense chain containing AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25) and an antisense chain containing GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO:26); or (11) A sense strand containing UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO:27) and an antisense strand containing GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm (SEQ ID NO:28); The present invention provides a double-stranded RNAi agent in which Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, and Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone.
[0032] In some embodiments, the double-stranded RNAi agent is (1) A sense strand having the nucleic acid sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8) and 0, 1, 2, 3, or 4 nucleotides; (2) A sense strand having the nucleic acid sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10) and 0, 1, 2, 3, or 4 nucleotides; (3) A sense strand having the nucleic acid sequence GmsAfsAmCmCmUmGmUmCmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12) and 0, 1, 2, 3, or 4 nucleotides; (4) A sense strand having the nucleic acid sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14) and 0, 1, 2, 3, or 4 nucleotides; (5) A sense strand having the nucleic acid sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16) and 0, 1, 2, 3, or 4 nucleotides; (6) A sense strand having the nucleic acid sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18) and 0, 1, 2, 3, or 4 nucleotides; (7) A sense strand having the nucleic acid sequence AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20) and 0, 1, 2, 3, or 4 nucleotides; (8) A sense strand having the nucleic acid sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22) and 0, 1, 2, 3, or 4 nucleotides; (9) A sense strand having the nucleic acid sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and 0, 1, 2, 3, or 4 nucleotides, and an antisense strand having the nucleic acid sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24) and 0, 1, 2, 3, or 4 nucleotides; (10) A sense strand having the nucleic acid sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25) and 0, 1, 2, 3 or 4 nucleotides, and an antisense strand having the nucleic acid sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO:26) and 0, 1, 2, 3 or 4 nucleotides; or (11) A sense strand comprising the nucleic acid sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and 0, 1, 2, 3 or 4 nucleotides, and an antisense strand comprising the nucleic acid sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm (SEQ ID NO: 28) and 0, 1, 2, 3 or 4 nucleotides; Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, while Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone.
[0033] Furthermore, in some embodiments, the 3' end of the sense strand of the double-stranded RNAi agent is ligated with 1 to 5, 2 to 4, or 3 N-acetylgalactosamine derivatives or analogs. Specifically, the structure of a single N-acetylgalactosamine derivative is as shown in Formula I. [ka] In equation I, n is an integer between 1 and 15.
[0034] In some embodiments of the present application, the double-stranded RNAi agent has 1 to 5, 2 to 4, or 3 GalNAc derivatives linked to a monovalent or trivalent branched linker at the 3' end of the sense strand of the double-stranded RNAi agent. In some embodiments of the present application, the structure of GalNAc in the double-stranded RNAi agent is as shown in formula II. [ka]
[0035] In some embodiments of the present application, the nucleotide at the 3' end of the sense strand of the double-stranded RNAi agent is ligated to L96, whose structural formula is shown in Formula III. [ka]
[0036] In one embodiment of the present application, the double-stranded RNAi agent is (1) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29); (2) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGfsUmAmCmUmCmUmCmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm-L96 (SEQ ID NO: 30); (3) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31); (4) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32); (5) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO: 33); (6) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34); (7) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence AmsGfsAmAmGmAmAmAmGmGmUmGmGmUmGmGmUmGmCGmGmUmGmGmCmUmGmGmGmCmGmGmCmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmGmCmGmGmG (8) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO:21); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmGm-L96 (SEQ ID NO:36); (9) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO:23); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm-L96 (SEQ ID NO:37); (10) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25); and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm-L96 (SEQ ID NO:38); (11) comprising an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO:27), and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm-L96 (SEQ ID NO:39); Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, while Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively. (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone, and L96, whose structural formula is shown in Formula III, is linked to the 3' end of the sense strand of the double-stranded RNAi agent. [ka]
[0037] In one embodiment of the present invention, the double-stranded RNAi agent has the structure of formula IV. [ka]
[0038] This application provides examples of double-stranded RNAi agents, namely AGT203-EG, AGT202-EG, AGT814-EG, AGT815-EG, AGT1452-EG, AGT1613-EG, AGT1638-EG, AGT1642-EG, AGT1654-EG, AGT1689-EG, and AGT1854-EG. The present invention further includes a DNA molecule capable of producing the double-stranded RNAi agent, a vector capable of expressing the double-stranded RNAi agent, and a reagent or kit containing the double-stranded RNAi agent, the DNA molecule, or the vector.
[0039] The present invention further provides cells containing the above-mentioned double-stranded RNAi agent.
[0040] The present application also provides a pharmaceutical composition comprising the above-mentioned double-stranded RNAi agent. The pharmaceutical composition comprises a pharmacologically effective amount of the double-stranded RNAi agent of this application and other pharmacologically acceptable components. "Effective amount" means the amount of double-stranded RNAi that effectively produces the intended pharmacological therapeutic effect. "Other components" include water, saline, glucose, buffer (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.
[0041] The present invention further provides a method for inhibiting the expression of AGT in cells, the method comprising (a) contacting the cells with the aforementioned double-stranded RNAi agent or a pharmaceutical composition thereof, and (b) maintaining the cells obtained in step (a) for a certain period of time sufficient to achieve degradation of the mRNA transcript of the AGT gene, thereby inhibiting the expression of the AGT gene in the cells.
[0042] This application provides the use of the aforementioned double-stranded RNAi agents or their pharmaceutical compositions in the inhibition of AGT gene expression or in the preparation of products for inhibiting AGT gene expression, wherein the inhibition of AGT gene expression involves inhibiting or reducing the expression level of the AGT gene in human, monkey, rat, or mouse cells in vivo or in vitro. The cells are mammalian cells expressing AGT, such as primate cells or human cells. Preferably, the AGT gene is expressed at a high level in the target cells. More preferably, the cells are derived from the brain, salivary glands, heart, spleen, lungs, liver, kidneys, intestines, or tumors. Even more preferably, the cells are liver cancer cells or cervical cancer cells. Even more preferably, the cells are selected from HepG2, Hep3B, Huh7, COS7, 293T, MHCC97H, HeLa, mouse primary hepatocytes, or human primary hepatocytes. In some embodiments of the present application, the final cellular concentration of the double-stranded RNAi agent is 0.1 to 1000 nM, for example, 10 to 500 nM, 25 to 300 nM, or 50 to 100 nM.
[0043] In some embodiments of the present application, the double-stranded RNAi agent and the pharmaceutical composition thereof may be administered by any suitable means, such as parenteral administration. Such parenteral administration includes intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous injection. The method of administration includes, but is not limited to, single or multiple doses.
[0044] The present invention further provides the use of the aforementioned double-stranded RNAi agents or pharmaceutical compositions thereof in the preparation of pharmaceuticals for the prevention and / or treatment of diseases mediated by AGT expression, or for the alleviation of symptoms of diseases mediated by the AGT gene.
[0045] The present invention further provides the aforementioned double-stranded RNAi agent or pharmaceutical composition thereof for the prevention and / or treatment of diseases mediated by AGT expression, or for the alleviation of symptoms of diseases mediated by the AGT gene.
[0046] The present invention also provides a method for preventing and / or treating a disease mediated by AGT expression or a method for alleviating the symptoms of a disease mediated by the AGT gene, comprising administering a double-stranded RNAi agent or a pharmaceutical composition thereof described herein to a subject in need.
[0047] In this application, diseases mediated by the AGT gene include hypertension, borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, treatment-resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, and vascular disease. This includes conditions such as diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess conditions (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid excess conditions, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina pectoris, stroke, diabetes, nephropathy, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) and fetal growth restriction.
[0048] In some embodiments, a single dose of the pharmaceutical composition can have a long-lasting effect, with the reduction in AGT expression lasting for at least 4, 7, 11, 14, 18, 21, 25, 28, 32, 35, 39, 42, 49, 56 days or longer.
[0049] The innovative aspects of this invention are as follows: 1. RNAi molecules screened by high-throughput screening have inhibitory activity equivalent to or greater than that of AD85481 (positive control compound). 2. Modified RNAi molecules have high stability and high inhibitory activity. 3. Pharmacodynamic experiments using rhesus monkeys have demonstrated that candidate sequences reduce serum AGT protein levels by more than 90% compared to the positive control AD85481-EG, exhibiting a longer duration of effect and significant efficacy.
[0050] Although various modifications can be attempted to improve the performance of double-stranded RNAi, these attempts cannot be considered modifications that mediated RNA interference while maintaining improved stability in serum (e.g., improved resistance to nucleases and / or extended duration). The modified double-stranded RNAi of the present invention maintains high inhibitory activity while possessing high stability.
[0051] [Definition] "AGT" refers to the angiotensinogen gene or protein. AGT is also known as ANHU, hFLT1, or SERPINA8. Examples of AGT mRNA sequences are readily available, for example, using GenBank.
[0052] "G," "C," "A," and "U" typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it should be understood that the terms "ribonucleotide," "nucleotide," or "deoxyribonucleotide" may also refer to modified nucleotides or alternative substitutions. Those skilled in the art will readily understand that guanine, cytosine, adenine, and uracil can be substituted for other parts without substantially altering the base-pairing properties of oligonucleotides (including nucleotides with substitutions). Sequences containing such substitutions are embodiments of the present invention.
[0053] "RNAi agents" refer to cleavage targeting RNA transcripts via the RNA-induced silencing complex (RISC) pathway. RNAi agents induce sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). RNAi agents regulate, for example, inhibit the expression of AGT in cells, such as those in the body of a subject (e.g., a mammalian subject).
[0054] In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, such as an AGT target mRNA sequence, to induce cleavage of the target RNA. In another embodiment, the RNAi agent may be a single-stranded siRNA introduced into a cell or organism to inhibit a target mRNA.
[0055] In another embodiment, the “RNAi agent” used in the compositions, uses, and methods of the present application is double-stranded RNA, and here refers to a “double-stranded RNAi agent.” The term “double-stranded RNAi agent” refers to a complex of ribonucleic acid molecules having a double-stranded structure containing two antiparallel and substantially complementary nucleic acid strands having “sense” and “antisense” directions with respect to the target RNA, i.e., the AGT gene. In some embodiments of the present application, the double-stranded RNA induces the degradation of a target RNA, such as mRNA, via a post-transcriptional gene silencing mechanism (referred to here as RNA interference or RNAi).
[0056] The term "antisense strand" refers to the strand of a double-stranded RNAi agent that contains a region substantially complementary to the target sequence (e.g., human AGT mRNA).
[0057] The "sense strand" refers to a dsRNA strand that contains a region substantially complementary to the antisense strand region.
[0058] A “complementary region” refers to a region on the antisense strand that is completely or substantially complementary to the target mRNA sequence. If the complementary region is not completely complementary to the target sequence, the mismatch may be located in the interior or terminal region of the molecule. As used here, the term “complementary” refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions, such as stringent conditions.
[0059] A "nucleotide overhang" refers to one or more unpaired nucleotides protruding from the double-stranded structure of an RNAi agent when the 3' end of one strand of the RNAi agent extends beyond the 5' end of the other strand, or vice versa. A "flat end" or "blunt end" means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e., there are no nucleotide overhangs. A "flat-ended" RNAi agent means a dsRNA that is double-stranded throughout its entire length, i.e., has no nucleotide overhangs at any end of the molecule.
[0060] "Inhibition of AGT expression in cells" includes inhibiting the expression of any AGT gene (e.g., mouse AGT gene, rat AGT gene, monkey AGT gene, or human AGT gene) and variants of the AGT gene (e.g., naturally occurring variants) or mutants. Thus, the AGT gene may be a wild-type AGT gene, a mutant AGT gene, or a transgenic AGT gene in genetically modified cells, cell populations, or organisms.
[0061] The cells are mammalian cells expressing AGT, such as primate cells or human cells. Preferably, the AGT gene is highly expressed in the target cells. More preferably, the cells are derived from the brain, salivary glands, heart, spleen, lungs, liver, kidneys, intestines, or tumors. Even more preferably, the cells are liver cancer cells or cervical cancer cells. Even more preferably, the cells are selected from HepG2, Hep3B, Huh7, COS7, 293T, MHCC97H, HeLa, mouse primary hepatocytes, or human primary hepatocytes.
[0062] "Inhibition of AGT gene expression" includes any level of suppression of the AGT gene, for example, including at least partial inhibition of AGT gene expression, such as at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% inhibition.
[0063] "Bringing cells into contact with a double-stranded RNAi agent" includes bringing cells into contact by any possible means. This includes bringing cells into contact with the RNAi agent in vitro or in vivo. This contact can be direct or indirect. Therefore, for example, the RNAi agent may involve physical contact between the individual performing the method and the cells, or alternatively, allowing the entry of the RNAi agent or subsequent contact with the cells.
[0064] "AGT expression-mediated diseases" are intended to include any disease related to the AGT gene or protein. Such diseases may be caused, for example, by overproduction of the AGT protein, mutations in the AGT gene, abnormal cleavage of the AGT protein, or abnormal interactions between AGT and other proteins or other endogenous or exogenous substances.
[0065] Various substances can be bound to the RNAi agent of this invention. Preferably, these are ligands that are covalently bound directly or indirectly via an intervening tether.
[0066] Ligands typically include therapeutic modifiers, such as those that promote uptake; diagnostic compounds or reporter groups, such as those that monitor distribution; crosslinking agents; and moieties that confer nuclease resistance. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetic compounds.
[0067] The ligand can be a naturally occurring substance such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin), a carbohydrate (e.g., dextran, amylopectin, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or a lipid. The ligand may also be a recombinant or synthetic molecule such as a synthetic polymer (e.g., synthetic polyamino acids) or an oligonucleotide (e.g., aptamer). Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudo-peptide polyamines, peptide-mimicking polyamines, dendritic polymer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.
[0068] Ligands may include target groups such as cell or tissue targeting agents that bind to specific cell types (e.g., kidney cells), as well as proteins such as lectins, glycoproteins, lipids, or antibodies. Target groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetylgalactosamine, N-acetylglucosamine, polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folates, vitamin B12, biotin, RGD peptides, RGD peptide mimes, or aptamers. Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules (e.g., cholesterol, bile acids, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyloxyhexyl, cetylglycerol, borneol, menthol, 1,3-propanediol, heptadecanil, palmitic acid) (e.g., phenolic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl), or phenoxazine peptide complexes (e.g., Antennapedia peptide, Tat peptide, etc.), alkylating agents, phosphate esters, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyl groups, substituted alkyl groups, radiolabeling markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole cluster, acridine-imidazole complex, tetraaza macrocyclic Eu) 3+ Examples include complexes, dinitrophenyl, HRP, or AP.
[0069] The ligand may be a protein such as a glycoprotein, a peptide such as a molecule that has a specific affinity for one type of coligand, or an antibody that binds to a specific cell type (e.g., cancer cells, endothelial cells, or osteocytes). The ligand may also include hormones and hormone receptors. It may also include lipids, lectins, carbohydrates, vitamins, cofactors, and non-peptides such as polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, or aptamers. This ligand may be, for example, a lipopolysaccharide, a p38MAP kinase activator, or an NF-κB activator.
[0070] Ligands can be substances such as drugs that can increase the uptake of iRNA agents into cells by, for example, disrupting the cytoskeleton of a cell (e.g., disrupting the cell's microtubules, microfilaments, and / or intermediate filaments). Drugs may include, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latruncrine A, phalloidin, swinholide A, indanosine, or myoservin. A ligand can be any ligand capable of targeting a specific receptor. Examples include folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters (e.g., GalNAc clusters, mannose clusters, galactose clusters), or aptamers. A cluster is a combination of two or more sugar units. These target ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands. These ligands may also be nucleic acid-based, such as aptamers. These aptamers may be unmodified or in any combination of the modifications disclosed herein. [Brief explanation of the drawing]
[0071] [Figure 1] This figure shows the effect of candidate sequences on AGT gene expression based on DLR high-throughput screening. [Figure 2] This figure shows the effect of the top 10 candidate sequences on AGT gene expression in Hep3B cells. [Figure 3] This figure shows the effect of the top 10 candidate modification sequences on AGT gene expression in Hep3B cells. [Figure 4] This figure shows the effect of candidate sequences on serum AGT protein in humanized mice. [Figure 5] This figure shows the effect of candidate sequences on AGT gene mRNA at PHH levels. [Figure 6] This figure shows the effect of candidate sequences on serum AGT protein in humanized mice. [Figure 7] This figure shows the effect of candidate sequences on serum AGT protein in rhesus monkeys. [Figure 8] This figure shows the effect of candidate sequences on serum AGT protein in hypertensive cynomolgus monkeys. [Modes for carrying out the invention]
[0072] Example 1: AGT-siRNA activity screening 1.siRNA design Based on human AGT mRNA sequences, multiple AGT siRNAs were designed by selecting different sites. All designed single siRNAs were able to target all transcripts of the target gene (see Table 1). The above sequences (see Table 2) showed the lowest homology to all other non-target gene sequences when compared using sequence similarity software. The sequence design methods referred to those of Elbashir et al. 2002; Paddison et al. 2002; Reynoldset et al. 2004; and Ui-Tei et al. 2004.
[0073] [Table 1]
[0074] [Table 2(1)] [Table 2(2)] [Table 2(3)] [Table 2(4)] [Table 2(5)] [Table 2(6)]
[0075] 2. siRNA synthesis (natural RNA / 2'-methoxy or 2'-fluoro-modified RNA / GalNAc-RNA) In this application, oligonucleotides containing only ribonucleotides, or 2'-methoxy or 2'-fluoro-modified oligonucleotides, were synthesized according to a theoretical yield of 1 μmol. All oligonucleotides were synthesized using 1 μmol of general-purpose Frit vector. [ka] The preparations were made using an LK-192X synthesizer with Biocomma (or GalNAc CPG, WuXi AppTec / Glen Research, loading amount 30 umol / g). All phosphoramide monomers (Shanghai Zhaowei / Chengdu Pioneer) were diluted 1:20 (g / mL) with anhydrous acetonitrile as the solvent, with a coupling time of 3 minutes and two coupling cycles. Deprotection was performed with 3% TCA, activation with 0.3 M benzylthiotetrazole acetonitrile solution, and capping and oxidation were performed with CAPA / CAPB and 50 mM I2 solution, respectively. After trityl-off synthesis, the solid-phase carrier was transferred to a 2 mL centrifuge tube, 1.2 mL of aqueous ammonia was added, and the protecting group was removed by heating in a 65°C oven for 3 hours. Subsequently, the solution was cooled to room temperature, concentrated under vacuum for 30 minutes, filtered into a sample vial through a 0.22 μm filter, and single-chain purification was performed using a semi-preparative reverse-phase purification system, with an elution gradient of 7% to 30% (ACN: 100 mM TEAA) for 10 minutes at a flow rate of 5 mL / min. After purification, the solution was concentrated under vacuum and spin-dried at room temperature. Finally, the sample was dissolved in water, and each solution was desalted using a GE Hi-Trap desalting column to elute the final oligonucleotide product. All properties and purities were confirmed using ESI-MS and IEX HPLC, respectively. Concentrations were measured using a microplate reader under UV irradiation. Equimolar amounts of sense and antisense chains were mixed, transferred to a new delivery tube, heated at 95°C for 5 minutes, slowly annealed to room temperature, and finally spin-dried at room temperature using a vacuum concentrator to obtain the final product.
[0076] 3. Detection of AGT-siRNA inhibitory activity in the in vitro Psicheck-2 system (1) Construction of the detection plasmid A recombinant plasmid (Shanghai Generay Biotech Co., Ltd.) was constructed using the psicheck-2 plasmid containing all the target sequences of the AGT siRNA under test, and the cloning sites were the 5'XhoI and 3'NotI regions of the psicheck-2 plasmid.
[0077] (2) Co-transfection of AGT siRNA and recombinant plasmid into different cells All cells were obtained from the collections of the Chinese Academy of Sciences or from other publicly available sources. Other reagents were commercially available.
[0078] [Table 3]
[0079] Cells were cultured in DMEM medium containing 10% fetal bovine serum in a constant temperature incubator at 37°C with 5% CO2. When the cells reached a good state (70% confluence) during the logarithmic growth phase, they were seeded and transfected. Cell density was adjusted to 1.5 × 10⁶ cells per well in a 24-well plate. 5 Cells were seeded. For the preparation of the transfection complex, 250 μL of Opti-MEM, 40 ng of recombinant plasmid, and 5 μL of 10 nM siRNA were mixed. Then, 250 μL of Opti-MEM and 2.5 μL of Lipofectamine 2000 transfection reagent were mixed and allowed to stand for 5 minutes. After that, the two mixtures were mixed and allowed to stand for 20 minutes. The transfection complex was added to a 24-well plate and incubated in a constant temperature incubator at 5% CO2 and 37°C for 6 hours. The supernatant was aspirated and removed, 1 mL of complete medium was added to each well, and incubation was continued for a further 24 hours.
[0080] In each cell transfection, in addition to the test group, the following control groups were established: NC (irrelevant siRNA) was used as the negative control group, and Lipo was used as the transfection reagent control group. Both the test group and the control group were repeated three times. The nucleotide sequence of the NC control group is as follows: Sense chain: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 186) Antisense chain: ACGUGACACGUUCGGAGAATT (SEQ ID NO: 187)
[0081] 3. DLR detection and analysis Detection was performed using the Dual-Luciferase Reporter Assay System kit (Promega), and treated cells were lysed and collected according to the kit's instructions. The fluorescence intensity of firefly (Photinus pyralis) luciferase and sea pansy (Renilla reniformis) luciferase was measured sequentially using the Infinite Eplex plate reader (TECAN). The fluorescence intensity ratio between sea pansy (Renilla reniformis) luciferase and firefly (Photinus pyralis) luciferase was calculated and normalized using the NC group as a control. The nucleotide sequence of the positive control AD85481 is as follows. Sense chain: GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 188) Antisense chain: UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 189).
[0082] [Table 4]
[0083] As shown in Figure 1, DLR screening of AGT siRNAs in 293T cells identified the top 30 siRNA molecules with high cellular activity based on relative luciferase activity. Table 1 shows the DLR detection results, representing the mean dual luciferase reporter gene expression levels of the AGT siRNA experimental group compared to the NC group.
[0084] 4. AGT siRNA qPCR screening (1) AGT siRNA transfection into Hep3B cells Hep3B cells were cultured in DMEM medium containing 10% fetal bovine serum in a constant temperature incubator at 37°C with 5% CO2. When the cells reached a good state (70% confluence) during the logarithmic growth phase, they were seeded and transfected. Cell density was adjusted, and the cells were cultured in 24-well plates at a density of 1.5 × 10⁶ per well. 5 Cells were seeded. For the preparation of the transfection complex, Mix 250 μL of Opti-MEM with 5 μL of 10 nM siRNA, then mix 250 μL of Opti-MEM with 2.5 μL of Lipofectamine 2000 transfection reagent, let stand for 5 minutes, then mix the two mixtures and let stand for 20 minutes. Add the transfection complex to a 24-well plate and incubate in a constant temperature incubator at 5% CO2 and 37°C for 6 hours. Remove the supernatant by aspirate, add 1 mL of complete medium to each well, and continue culturing for another 24 hours. For each cell transfection, in addition to the test group, the following control groups were established: the NC group as the negative control group (irrelevant siRNA), and the Lipo group as the transfection reagent control group (no siRNA added).
[0085] (2) Real-time fluorescence quantitative PCR analysis Twenty-four hours after transfection, the cells were lysed, and total cellular RNA was extracted using a column extraction kit (Vazyme). Real-time fluorescence quantitative PCR was performed using the TaqMan probe method with a CFX96 fluorescence quantitative PCR instrument (Bio-Rad) using the β-actin gene as an internal standard. The primers used were as follows:
[0086] [Table 5]
[0087] (3) Data analysis After the PCR reaction was completed, relative quantitative analysis was performed using the 2-ΔΔCt (Livak) method with the reference gene as the baseline. As is clear from the results in Table 6 and Figure 2, the top 10 siRNA sequences showing superior AGT mRNA inhibitory activity compared to the positive control AD85481 were selected by qPCR from the top 30 siRNAs obtained from DLR screening.
[0088] [Table 6]
[0089] Example 2: Optimization of AGT-siRNA 1. Detection of inhibitory activity of modified siRNA against the ANGPTL3 gene The candidate sequences obtained from the above screening were modified (Table 7), and combinations of fluorination and methoxy modifications were performed at different positions on the sense and antisense strands. The antisense strand was replaced with methoxy modifications whenever possible. The procedures for synthesis, transfection into Hep3B cells, detection by quantitative PCR, and analysis were the same as in Example 1, and the final transfection concentration was 0.1 nM.
[0090] [Table 7(1)] [Table 7(2)] Note: Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone; and (Tgn) represents (s)-GNA-T. The specific chemical formulas are as follows. [ka]
[0091] As shown in Figure 3, the modification scheme is important, and some modifications may reduce inhibitory activity. The following preferred modification schemes have high inhibitory activity: (1) The antisense strand having a 5'(s)mN(s)mN3' structure overhang at the 3' end is advantageous for loading the antisense strand into RISC and increasing RNAi interference activity without compromising stability. (2) The antisense strand being fluorinated at at least the 2nd, 14th, and 16th positions from the 5' end, and methoxy modified at as many other positions as possible, is advantageous for RISC binding. (3) The antisense strand being modified at least two thiophosphate positions from the 3' and 5' ends is advantageous for maintaining nucleic acid stability. (4) The sense strand being modified sequentially at the 7th and 9th-11th positions from the 5' end, and methoxy modified at as many other positions as possible, is advantageous for RISC binding. (5) The sense strand being modified at least two thiophosphate positions from the 5' end and covalently bonded to GalNAc at the 3' end. In the 5'(s)mN(s)mN3' structure, N represents any nucleotide, m indicates that the nucleotide represented by the N on the right is modified with 2'-O-methyl, and (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone. Table 8 shows that when AGT202-EG, AGT814-EG, AGT1613-EG, AGT1638-EG, AGT1642-EG, AGT1654-EG, AGT1689-EG, and AGT203-EG, out of 11 candidate siRNA sequences, were transfected to a final concentration of 0.1 nM, they showed inhibitory activity in Hep3B cells equivalent to that of the positive control AD85481, and all were able to knock down the mRNA level of AGT to less than 10%.
[0092] [Table 8]
[0093] Example 3: Detection of in vivo efficacy in mice The experiment used 72 humanized AGT male and female mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) aged 6-8 weeks, which were randomly divided into groups based on body weight. Each group consisted of 8 mice (4 males and 4 females), and they were administered a single dose of 3 mg / kg of AGT1654-EG, AGT202-EG, AGT1638-EG, AGT814-EG, AGT1613-EG, AGT1642-EG, AGT1689-EG, and AGT203-EG via subcutaneous injection. Blood was collected on days 3, 7, 14, 21, and 28 (the mice were fasted for 4-5 hours before collection, and the day of administration was considered day 0). Serum was separated from the collected blood, and the expression levels of AGT proteins in the serum were measured using the Human Total Angiotensinogen Assay Kit (IBL, #27412), and intergroup comparisons were also performed.
[0094] [Table 9]
[0095] The efficacy results in mice (Figure 4, Table 9) show that AGT1654-EG, AGT202-EG, AGT1638-EG, and AGT203-EG all reduced serum AGT levels by approximately 70% or more, and in some cases by more than 80%, with efficacy lasting for at least 28 days.
[0096] Example 4: Detection of the efficacy of siRNA in human primary hepatocytes (PHH) 4.1 The compound was taken up by human primary hepatocytes via free uptake. The process was as follows:
[0097] 1) The compound was diluted to 10 times its final concentration with nuclease-free water. 2) Two cell samples were removed from the liquid nitrogen tank and gently shaken in a water bath until the cryopreservation solution thawed. The cells were then transferred to a cell medium containing 10% fetal bovine serum. The cell density was set to 6.7 × 10⁶. 5 The concentration was adjusted to cells / mL. 3) 25 μL of the compound was added to the cell plate, followed by 225 μL of the cell suspension prepared in step 2). The final compound concentrations were two different types (100 nM and 500 nM), with 3 wells, and the blank was used as a cell control group with nuclease-free water. The above test was repeated three times.
[0098] 4.2 Fluorescence Quantitative PCR 1) Total RNA in cells was detected by RT-PCR. The method followed the instructions for the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. Commercial qPCR primers and probes were purchased from Thermo Fisher (catalog number 4331182). The prepared qPCR reaction system is shown in the table below.
[0099] [Table 10]
[0100] 2) Using GAPDH as an internal standard gene, the expression level of target gene RNA in each sample was calculated using the ΔΔCt relative quantification method. The relative expression level of the target gene is expressed as 2-ΔΔCT.
[0101] 3) qPCR reaction program: 10 minutes at 95°C, followed by 15 seconds at 95°C and 1 minute at 60°C, repeated for 40 cycles.
[0102] 4) Data Analysis ΔCT = Average Ct value of target gene - Average Ct value of internal standard gene ΔΔCT = ΔCT(sample group) - ΔCT(nuclease-free water control group) Target gene mRNA relative expression level = 2 -ΔΔCT Inhibition rate (%) = (1 - relative expression level of sample / mean relative expression level of control group) × 100
[0103] 4.3 Data Analysis: [Table 11]
[0104] The PHH uptake test is a more representative test that demonstrates that siRNA is taken up by the liver and exerts its knockdown effect. According to the experimental results (Table 11, Figure 5), in the uptake test, when the final concentrations were 100 nM and 500 nM, AGT203-EG and AD85481-EG showed similar inhibition rates against AGT gene mRNA, both reaching over 90%.
[0105] Example 5: Detection of in vivo efficacy in mice For the experiment, 40 humanized AGT male and female mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.), aged 6-8 weeks, were used and randomly divided into groups based on body weight. Each group consisted of 10 mice, and a single dose of 3 mg / kg of physiological saline, AGT202-EG, AD85481-EG, and AGT203-EG was administered by subcutaneous injection. Blood samples were collected on days 3, 7, 14, 21, and 28 (the mice were fasted for 4-5 hours before collection, with the day of administration being considered day 0). Serum was separated from the collected blood, and the expression levels of AGT proteins in the serum were measured using the Human Total Angiotensinogen Assay Kit (IBL, #27412), and intergroup comparisons were also performed.
[0106] [Table 12]
[0107] Results from efficacy experiments using mice (Figure 6, Table 12) show that both AD85481-EG and AGT203-EG were able to reduce serum AGT levels to their lowest values on day 14 after administration, with a reduction rate of over 90% and sustained at low levels. It is clear that the efficacy of AGT202-EG lasted longer compared to the AD85481-EG group.
[0108] Example 6: Detection of efficacy in vivo in rhesus monkeys Eight rhesus macaques (Beijing Zhaoyan Biotechnology Co., Ltd.) were used in the experiment and randomly assigned to either a positive control group or test groups (four test compounds: AD85481-EG, AGT202-EG, AGT1638-EG, AGT1654-EG) based on body weight, resulting in a total of four groups. Each group consisted of two macaques (one male and one female). Each group received a single subcutaneous injection of 3 mg / kg. Blood was collected from the cutaneous vein of the forelimb radially on days -1, 4, 7, 11, 14, 18, 21, 28, 32, 35, 39, 42, 49, and 56 (fasting overnight before blood collection, with the first dose considered day 0), and serum was isolated. The expression levels of AGT protein in the serum were measured using the Human Total Angiotensinogen Assay Kit (IBL, #27412), and intergroup comparisons were performed.
[0109] [Table 13]
[0110] The results (Figure 7, Table 13) show that, compared to baseline, the AGT202-EG group reduced serum AGT protein levels by approximately 80% on day 11 after administration, and this effect was sustained, resulting in a reduction of over 90% on day 28. Furthermore, the effect of reducing serum AGT protein levels by 90% was maintained until at least day 63. The AGT1638-EG group showed a strong and sustained effect on reducing serum AGT protein, achieving an approximately 80% reduction on day 11, and then maintaining a 73% reduction in serum AGT protein levels until day 63. In the positive control AD85481-EG group, serum AGT protein levels reached a minimum value of approximately 80% by day 32 after administration, and the 80% reduction effect lasted for about 10 days before rebounding. Thus, the AGT202-EG and AGT1638-EG groups were significantly superior to the positive control AD85481-EG group in both efficacy and duration of effect.
[0111] Example 7: Detection of in vivo efficacy in hypertensive cynomolgus monkeys Six spontaneously hypertensive cynomolgus monkeys (Kunming Keling Biotechnology Co., Ltd.) were used in the experiment. A systolic blood pressure (SBP) range of ≥140 mmHg and a diastolic blood pressure (DBP) range of ≥70 mmHg were required. Based on body weight, the monkeys were randomly assigned to either a low-dose AGT203 EG group (1.5 mg / kg) or a high-dose AGT203 EG group (3 mg / kg), with 3 monkeys in each group. Subcutaneous injection was administered. Blood was collected from peripheral veins on days -9, -2, 4, 7, 14, 21, 28, 42, and 56 (fasting overnight before blood collection; the first dose was considered day 0), and serum was separated and used for analysis of AGT protein content. Additionally, on days -7, 23, and 54, systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured at the left forelimb wrist or tail base using a high-resolution oscilloscope (HDO), and mean arterial pressure (MAP) was calculated.
[0112] [Table 14]
[0113] [Table 15]
[0114] The results (Figure 8, Tables 14-15) show that, compared to baseline, both the high-dose and low-dose AGT203 EG groups reduced serum AGT protein levels by more than 90% on day 14 after administration, and maintained this effect, keeping levels low even on day 56. In the low-dose AGT203 EG group, SBP and DBP decreased by 16.6% and 19.1%, respectively, on day 54 after administration. In the high-dose AGT203 EG group, SBP and DBP decreased by 16.1% and 30.2%, respectively, on day 54 after administration. These results indicate that the effects of AGT203 EG administration are significant, demonstrating a substantial reduction in target gene proteins and alleviating hypertension. As is clear from Figures 7 and 8, AGT203-EG can reduce AGT to lower levels more rapidly and maintain low levels of AGT for a longer period of time compared to AGT202-EG and AGT1638-EG, thus demonstrating superior AGT mRNA inhibition efficiency compared to AGT202-EG and AGT1638-EG.
Claims
1. A double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the nucleotide sequences of the sense strand and the antisense strand are represented by any of the dsRNA sequences in Table 2.
2. It includes a sense chain and an antisense chain. (1) The sense strand comprises the nucleotide sequence GUCAUCCAACAUGAGAGUACA (SEQ ID NO: 1) (5'→3' direction), and / or the antisense strand comprises the nucleotide sequence UGUACUCUCACAUUGUGGAAUGAACGA (SEQ ID NO: 2) (5'→3' direction); (2) The sense strand comprises the nucleotide sequence GUCAUCCAACAUGAGAGAGUACC (SEQ ID NO: 3) (5'→3' direction), and / or the antisense strand comprises the nucleotide sequence GGUACUCUCACAUUGUGGAAUGAACGA (SEQ ID NO: 4) (5'→3' direction); or (3) The double-stranded RNAi agent according to claim 1, wherein the sense strand comprises the nucleotide sequence CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (5'→3' direction), and / or the antisense strand comprises the nucleotide sequence UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (5'→3' direction).
3. The double-stranded RNAi agent according to claim 1 or 2, wherein one or more nucleotides of the sense strand and antisense strand of the double-stranded RNAi agent have one or more modifications selected from the group consisting of 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, lock nucleic acid modification, ring-opening or unlock nucleic acid modification, DNA modification, and fluorescent probe modification, and preferably both the sense strand and antisense strand of the double-stranded RNAi agent contain 2'-O-methyl and / or 2'-fluoro modifications.
4. The double-stranded RNAi agent further comprises at least one internucleotide bond of phosphorothioate or methylphosphonate, preferably at least one phosphorothioate bond, and more preferably the internucleotide bond is located at the 5' and 3' ends of the sense strand and antisense strand, and more preferably the internucleotide bond is located between three nucleotides at the 5' and 3' ends of the sense strand and antisense strand, as described in claim 3.
5. The double-stranded RNAi agent comprises the following: (1) the antisense strand has a protruding end of a 5'(s)mN(s)mN3' structure at its 3' end; (2) the antisense strand is fluorinated at at least the 2nd, 14th, and 16th positions from its 5' end and methoxy modified at other positions; (3) the antisense strand is fluorinated at least two positions from its 3' and 5' ends, preferably the antisense strand has thiophosphate backbone modifications at at least the first and second internucleotide bonds from its 3' and 5' ends; (4) the sense strand is fluorinated at the 7th and 9th to 11th positions from its 5' end and methoxy modified at other positions; and (5) the sense strand is fluorinated at least two positions from its 5' end, preferably the sense strand has thiophosphate backbone modifications at at least the first and second internucleotide bonds from its 5' end.
6. The double-stranded RNAi agent is bound to at least one ligand, the ligand being selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine (GalNAc) derivatives or analogs, and preferably the ligand being an N-acetylglucosamine (GalNAc) derivative or analog, as described in any one of claims 1 to 5.
7. The double-stranded RNAi agent according to claim 6, characterized in that the ligand is ligated to the 3' end, 5' end, and / or intermediate part of the sequence of the double-stranded RNAi agent, and preferably the ligand is ligated to the 3' end of the sense strand of the double-stranded RNAi agent.
8. (1) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmSGmSAm (SEQ ID NO: 7), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8); (2) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmCm (SEQ ID NO: 9), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10); (3) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmAmGm (SEQ ID NO: 11), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12); (4) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmAm (SEQ ID NO: 13), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14); (5) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmAmSAm (SEQ ID NO: 15), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16); (6) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmGmGm (SEQ ID NO: 17), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGmsAmCmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18); (7) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20); (8) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAfsUmUmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmAmAmUmGm (SEQ ID NO: 22); (9) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmSAmAm (SEQ ID NO: 23), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24); (10) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100%, identity with the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26); or a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100%, identity with the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26); or (11) an antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100%, identity with the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100%, identity with the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAm (SEQ ID NO: 28); Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, while Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and (s) indicates that the two nucleotides before and after it are linked by a thiophosphate backbone.
9. The double-stranded RNAi agent according to claim 8, characterized in that the double-stranded RNAi agent is bound to at least one ligand.
10. The ligand is an N-acetylglucosamine (GalNAc) derivative or analog, preferably the N-acetylglucosamine (GalNAc) derivative or analog is ligated to the 3' end of the sense strand of the double-stranded RNAi agent, and more preferably the GalNAc structure is shown in formula II, as described in claim 9. 【Chemistry 1】
11. (1) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmSGmSAm (SEQ ID NO: 7), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29); (2) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmCm (SEQ ID NO: 9), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm-L96 (SEQ ID NO: 30); (3) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmUmCmUfUmCfUmCmAmGmCmAmGm (SEQ ID NO: 11), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsCmSUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31); (4) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmAm (SEQ ID NO: 13), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32); (5) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmAmSAm (SEQ ID NO: 15), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO: 33); (6) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmGmGm (SEQ ID NO: 17), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence GmsGmsAmCmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34); (7) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm-L96 (SEQ ID NO: 35); (8) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsAfsUmUmAmGmAmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmAmAmUmGm-L96 (SEQ ID NO: 36); (9) An antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmSAmAm (SEQ ID NO: 23), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, and 100% identity with the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm-L96 (SEQ ID NO: 37); (10) An antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100%, identity with the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmGmUmGmUm-L96 (SEQ ID NO: 38) identity with at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100%; or (11) an antisense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100%, identity with the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27), and a sense strand comprising a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100%, identity with the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm-L96 (SEQ ID NO: 39); The double-stranded RNAi agent according to any one of claims 8 to 10, wherein Am, Um, Cm, and Gm each represent 2'-O-methyl modified ribonucleotides A, U, C, and G, Af, Uf, Cf, and Gf each represent 2'-fluoro modified ribonucleotides A, U, C, and G, (s) indicates that the two nucleotides before and after it are linked by a thiophosphate skeleton, and the L96 shown in the structural formula of formula III is linked to the 3' end of the sense strand of the double-stranded RNAi agent. 【Chemistry 2】
12. The double-stranded RNAi agent according to claim 11, characterized by having the structure of formula IV. 【Transformation 3】
13. A reagent or kit comprising a double-stranded RNAi agent according to any one of claims 1 to 12, or a DNA molecule according to claim 12.
14. A pharmaceutical composition comprising a double-stranded RNAi agent according to any one of claims 1 to 12.
15. Use of a double-stranded RNAi agent according to any one of claims 1 to 12 or a pharmaceutical composition according to claim 15 in the preparation of a pharmaceutical for the prevention and / or treatment of a disease mediated by AGT expression, or for the alleviation of symptoms of a disease mediated by the AGT gene.
16. Diseases mediated by the AGT gene include hypertension, borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, treatment-resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, and diabetes. The use according to claim 15, characterized in that it includes retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess conditions (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid excess conditions, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina pectoris, stroke, diabetes, nephropathy, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) and fetal growth restriction.