Nucleic acid conjugates, their manufacturing methods and uses

Abstract

The present invention provides compounds having the structure shown in formula (I) for forming conjugates with oligonucleotides. The disclosure also provides the use of the corresponding conjugates, as well as the use of the conjugates for producing agents for the prevention and / or treatment of related diseases. The conjugates of the disclosure have advantages such as inexpensive raw materials, simple synthesis, and an easy-to-develop process, while also having good oligonucleotide synthesis efficiency and bioactivity in small animal bodies. [Formula 1] JPEG2026524101000140.jpg42170

Description

[Technical Field]

[0001] This disclosure relates to the field of nucleic acid delivery, and more specifically to nucleic acid conjugates, methods for producing the same, and applications. [Background technology]

[0002] siRNA is a negatively charged polymer consisting of two oligonucleotide chains. On its own, it cannot effectively target target tissues in the body, nor can it autonomously enter cells. For siRNA to exert its therapeutic effect, it needs to be delivered via a special delivery carrier to accumulate in the target organ and enter the cell.

[0003] Lipid nanoparticles (LNPs) can effectively encapsulate siRNA and achieve targeted delivery to the liver, and the drug Onpattro, which utilizes LNP technology, is already commercially available. However, many drawbacks remain in the clinical application of LNP technology. For example, LNP formulations have a short shelf life, and they often trigger immune responses during application, requiring the concomitant use of immunosuppressants such as dexamethasone, which complicates the clinical application of LNPs.

[0004] Targeted delivery of drugs into cells via endocytosis mediated by cell surface receptors is an effective strategy. The asialoglycoprotein receptor (ASGPR) is a receptor highly specifically expressed on the surface of hepatocytes, possessing characteristics such as high abundance and high receptor recycling efficiency. By covalently binding monosaccharide and polysaccharide molecules such as galactose, galactosamine, and N-acetylgalactosamine (GalNAc), which can specifically recognize ASGPR, to siRNA, siRNA can be targeted and delivered into hepatocytes, allowing siRNA to exert a gene silencing effect on target genes. Therefore, research and development of target ligands suitable for siRNA delivery is of significant importance for the clinical application of siRNA.

[0005] Currently, some progress is being made worldwide in research on the effective targeted delivery of siRNA to the liver by targeting ASGPR. A representative delivery molecule is Alnylam Pharmaceuticals' L96 (its structural formula is shown below), which is already used in four commercially available siRNA drugs and has shown good delivery activity and selectivity in in vitro and in vivo experiments. However, there is still room to further improve the biological activity and efficacy of siRNA in the body, and problems remain such as the complexity and high manufacturing costs of the CMC (chemical manufacturing and control) processes and technologies for delivery molecules.

[0006] [ka] [Overview of the project]

[0007] The delivery compounds and corresponding nucleic acid conjugates of this disclosure utilize natural amino acids such as serine and threonine as core linkage skeletons to obtain a completely novel group of GalNAc conjugates with unique chemical structures. Compared to existing delivery technologies, these have advantages such as simpler molecular structures, inexpensive and readily available raw materials, and easier development of CMC processes, while also exhibiting good oligonucleotide synthesis efficiency and in vivo biological activity.

[0008] In a first embodiment, the present disclosure provides a compound having the structure represented by formula (I):

[0009] [ka]

[0010] During the ceremony, A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or a group formed by the substitution of all or part of the hydroxyl group in the ligand with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group; The ligands are preferably, independently, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glu Cofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, N-isobutyric acid Thirylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranoose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose methyl 2,3 One selected from the group consisting of 4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranoside, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose; b is an integer in the range of 1 to 4, preferably 1, 2, or 3, more preferably 1 or 3; L1 and L2 are one or more selected independently from the bases of formulas A1 to A11. Represents linked combinations:

[0011] [ka]

[0012] Here, j1 is an integer between 1 and 20; j2 is an integer between 1 and 20; and R' is C1-C 10 It is an alkyl group; M represents the structural formula shown in equation (A12):

[0013] [ka]

[0014] Here, m represents an integer from 0 to 6, preferably 0, 1, or 2; * indicates a combination that joins to G1. Q represents the structural formula shown in equation (A13):

[0015] [ka]

[0016] Here, it binds to O

[0017] [ka] The ∫ indicates a bond to G1; R2 and R3 are identical or different and independent of each other, H, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably H, C1-C6 alkyl groups, C1-C6 alkoxy groups, C2-C6 alkenyl groups, and C2-C6 alkynyl groups; Z does not exist, or C1-C 10 It represents an alkylene group, preferably a C1-C3 alkylene group; X represents the structural formula shown in formula (A14-1) or (A14-2): [ka]

[0018] Here, R4 and R5 are the same or different and independently of each other are H, fluoro, hydroxy group, C1-C 20 alkyl group, C1-C 20 alkoxy group, C2-C 20 alkenyl group, C2-C 20 alkynyl group, preferably H, fluoro, hydroxy group, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group; p is an integer from 1 to 6, preferably 1, 2 or 3; optionally, R4 and R5 are directly bonded to form a 3- to 6-membered saturated carbocyclic group; E represents a structural formula represented by formula (A15):

[0019]

Chemical formula

[0020] Here,

[0021]

Chemical formula

[0022] Here, B1 is selected from substituted or unsubstituted C1-C5 hydrocarbon groups, optionally being a methyl group, an ethyl group, or an isopropyl group; B2 is selected from the group consisting of C1-C5 alkyl groups, cyanoethyl groups, cyanopropyl groups, and cyanobutyl groups, optionally being a cyanoethyl group; In the text,

[0023] [ka] This indicates the site where the group forms a covalent bond.

[0024] In a second embodiment, the present invention provides nucleic acid conjugates having one or more structures represented by formula (II) bound at any position on an oligonucleotide sequence, preferably having two, three or four consecutively bound structures represented by formula (II):

[0025] [ka]

[0026] Here, R p and R q Each has a structure represented by H or formula A16, and R p and R qAssuming that at least one of them has the structure shown in formula A16;

[0027] [ka]

[0028] Here, E1 is OH, SH, or BH2. A0, b, L1, L2, M, Z, X, and E are the same as in equation (I), and their explanation is omitted here.

[0029] In a third embodiment, the present invention provides a method for producing nucleic acid conjugates according to a second embodiment.

[0030] In a fourth aspect, the present invention provides the use of the nucleic acid conjugate of the present invention for producing agents for treating and / or preventing liver-derived diseases.

[0031] In a fifth embodiment, the present invention provides a method for treating a pathological condition or disease caused by gene expression in hepatocytes, the method comprising administering a nucleic acid conjugate of the second embodiment to a patient suffering from the disease.

[0032] In a sixth aspect, the present invention provides a kit comprising the nucleic acid conjugate of the present invention. [Brief explanation of the drawing]

[0033] [Figure 1] Figure 1 shows the results of the siRNA conjugate activity test in mice in Example 10. In Figure 1, ** indicates that P is less than 0.01, and *** indicates that P is less than 0.001. [Modes for carrying out the invention]

[0034] The following describes specific embodiments of this disclosure in detail. It should be understood that the specific embodiments described herein are for illustrative and interpretive purposes only and do not limit this disclosure.

[0035] definition

[0036] It should be noted that, unless otherwise specified, technical or scientific terms used in this application should be interpreted as having the ordinary meaning understood by a person skilled in the art.

[0037] In this disclosure, the compound represented by general formula (I) includes forms such as its tautomers, racemates, enantiomers, diastereomers, and mixtures thereof.

[0038] As used herein, a hyphen ("-") not between two letters or two symbols is used to indicate a substituent bond point.

[0039] As used herein, “optional” or “optionally” means that the event or situation described thereafter may or may not occur, and that description includes both the event or situation that may or may not occur. For example, “optionally replace The term "substituted alkyl group" includes "alkyl group" and "substituted alkyl group" as defined below. Those skilled in the art will understand that no group containing one or more substituents is intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically unfeasible, and / or inherently unstable.

[0040] As used herein, “alkyl group” refers to linear and branched groups having a specified number of carbon atoms. When referring to an alkyl residue having a particular number of carbon atoms, it is intended to include all branched and linear forms having that number of carbon atoms. For example, “butyl group” means including n-butyl, sec-butyl, isobutyl, and tert-butyl groups. Alkylene groups are a subset of alkyl groups and refer to residues that are the same as alkyl groups but have two bonding sites.

[0041] As used herein, “alkenyl group” means an unsaturated branched or linear alkyl group having at least one carbon-carbon double bond, the carbon-carbon double bond being obtained by losing one hydrogen atom from each adjacent carbon atom of the parent alkyl group. The group may have a cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to, vinyl groups; propenyl groups, e.g., prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl(allyl), prop-2-en-2-yl; butenyl groups, e.g., buto-1-en-1-yl, buto-1-en-2-yl, 2-methylprop-1-en-1-yl, buto-2-en-1-yl, buto-2-en-2-yl, buta-1,3-dien-1-yl, buta-1,3-dien-2-yl, etc. An alkenylene group is a subset of the alkenyl group, referring to a residue that is the same as an alkenyl group but has two binding sites.

[0042] As used herein, “alkynyl group” means an unsaturated branched or linear alkyl group having at least one carbon-carbon triple bond, which is obtained by losing two hydrogen atoms from each adjacent carbon atom of the parent alkyl group. Typical alkynyl groups include, but are not limited to, ethynyl groups; propynyl groups, e.g., prop-1-in-1-yl, prop-2-in-1-yl; and butynyl groups, e.g., buto-1-in-1-yl, buto-1-in-3-yl, buto-3-in-1-yl.

[0043] As used herein, “alkoxy group” refers to an alkyl group having a specified number of carbon atoms linked via oxygen bridges, such as methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, and 3-methylpentyloxy. Alkoxy groups typically have 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms linked via oxygen bridges.

[0044] As used herein, “cycloalkyl group” refers to a non-aromatic carbocyclic group, typically having 3 to 7 cyclic carbon atoms. The ring may be saturated or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, and cyclohexenyl groups, as well as bridged and caged ring groups such as norbornane.

[0045] As used herein, “halogen substituent” or “halo” refers to fluoro, chloro, bromo, and iodine, and the term “halogen” includes fluorine, chlorine, bromine, and iodine.

[0046] As used herein, “haloalkyl group” refers to an alkyl group having a specified number of carbon atoms that is substituted with one or more halogen atoms up to the maximum permitted number. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl groups.

[0047] A "heterocyclic group" refers to a stable 3- to 18-membered non-aromatic ring group containing 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise specified in the specification, heterocyclic groups can be monocyclic, dicyclic, tricyclic, or tetracyclic systems, and may include fused or bridging ring systems. Heteroatoms in heterocyclic groups can optionally be oxidized. One or more nitrogen atoms (if present) can optionally be quaternarily ammoniumlated. Heterocyclic groups can be partially or fully saturated. Heterocyclic groups can be bonded to the rest of the molecule via any ring atoms. Examples of such heterocyclic groups include, but are not limited to, dioxanyl group, thienyl[1,3]dithianyl group, decahydroisoquinolinyl group, imidazolinyl group, imidazolidinyl group, isothiazolidinyl group, isoxazolidinyl group, morpholinyl group, octahydroindolyl group, octahydroisoindolyl group, 2-oxapiperazinyl group, 2-oxapiperidinyl group, 2-oxapyrrolidinyl group, oxazolidinyl group, piperidinyl group, piperazinyl group, 4-piperidonyl group, pyrrolidinyl group, pyrazolidinyl group, quinuclidinyl group, thiazolidinyl group, tetrahydrofuranyl group, trithianyl group, tetrahydropyranyl group, thiomorpholinyl group, thiamorpholinyl group, 1-oxothiomorpholinyl group, and 1,1-dioxothiomorpholinyl group.

[0048] Various hydroxy protecting groups can be used in this disclosure. Generally, protecting groups can inactivate a chemical functional group under specific reaction conditions and can be added to and removed from that functional group in a molecule without substantially damaging the rest of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entirety. In some embodiments, protecting groups are stable under alkaline conditions but can be removed under acidic conditions. In some embodiments, non-limiting examples of hydroxy protecting groups available herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthene-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthene-9-yl (Mox). In some embodiments, non-limiting examples of hydroxy protecting groups available herein include Tr (trityl group), MMTr (4-methoxytrityl group), DMTr (4,4'-dimethoxytrityl group), TMTr (4,4',4''-trimethoxytrityl group), and tert-butyldimethylsilyl group (TBS or TBDMS). Non-limiting examples of hydroxy protecting groups available herein include hydrocarbon acyls.

[0049] The term “Subject” means any animal, such as a mammal or marsupial, as used herein. Subjects in this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any type of poultry.

[0050] As used herein, “treatment,” “alleviation,” or “improvement” can be used interchangeably. These terms refer to a method of obtaining a beneficial or desirable outcome, including but not limited to therapeutic benefits. “Therapeutic benefits” means the elimination or improvement of the potential disorder being treated. Furthermore, therapeutic benefits are the elimination or improvement of one or more of the potential disorder, even though the subject may still be suffering from the potential disorder. This is achieved by eliminating or improving multiple physiological symptoms, thereby observing improvement in the subject.

[0051] As used herein, “prevention” and “prevention” can be used interchangeably. These terms refer to a method of obtaining a beneficial or desirable outcome, including but not limited to a preventive benefit. To obtain a “preventive benefit,” a conjugate or composition may be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even if a diagnosis of the disease has not yet been made.

[0052] According to a first aspect of the present invention, a compound having the structure represented by formula (I) is provided:

[0053] [ka]

[0054] During the ceremony, A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or a group formed by the substitution of all or part of the hydroxyl group in the ligand with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group; The ligands are preferably, independently, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannopyranose, β-D-mannopyranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine Samine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranoose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose It consists of lucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranose, 4-thio-β-D-galactopyranoside, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose. It is one of the options selected from the group; b is an integer in the range of 1 to 4, preferably 1, 2, or 3, more preferably 1 or 3; L1 and L2 independently represent one or more linked combinations selected from the bases of formulas A1 to A11:

[0055] [ka]

[0056] Here, j1 is an integer between 1 and 20; j2 is an integer between 1 and 20; and R' is C1-C 10 It is an alkyl group; M represents the structural formula shown in equation (A12):

[0057] [ka]

[0058] Here, m represents an integer from 0 to 6, preferably 0, 1, or 2; * indicates a combination that joins to G1. Q represents the structural formula shown in equation (A13):

[0059] [ka]

[0060] Here, it binds to O

[0061] [ka] The ∫ indicates a bond to G1; R2 and R3 are identical or different and independent of each other, H, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably H, C1-C6 alkyl groups, C1-C6 alkoxy groups, C2-C6 alkenyl groups, and C2-C6 alkynyl groups; Z does not exist, or C1-C 10 It represents an alkylene group, preferably a C1-C3 alkylene group; X represents the structural formula shown in formula (A14-1) or (A14-2): [ka]

[0062] Here, R4 and R5 are the same or different, and independently of each other, H, fluoro, hydroxyl group, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably H, fluoro, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, or C2-C6 alkynyl; p is an integer from 1 to 6, preferably 1, 2, or 3; optionally, R4 and R5 are directly bonded to form a 3-6 membered saturated carbon ring group; E represents the structural formula shown in equation (A15):

[0063] [ka]

[0064] Here,

[0065] [ka] C3-C 18 Cycloalkyl groups or C3-C 18 Represents a heterocyclic group, preferably a C4-C8 cycloalkyl group or a C3-C8 heterocyclic group, more preferably a C3-C6 heterocyclic group, and even more preferably a 4-6 member nitrogen-containing saturated cycloalkyl group, and R1 is H, fluoro, hydroxyl group, cyano group, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably from H, fluoro, hydroxyl, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, and C2-C6 alkynyl groups; G1 and G2 each represent a phosphoramidite functional group or hydroxy protecting group having the structure shown in formula (G-1), and it is assumed that at least one of G1 and G2 has the structure shown in formula (G-1), and the hydroxy protecting group is one selected from the group consisting of a trityl group, a 4-methoxytrityl group, a 4,4'-dimethoxytrityl group (DMTr), and a 4,4',4''-trimethoxytrityl group, preferably a 4,4'-dimethoxytrityl group; [ka]

[0066] Here,

[0067] [ka] The symbol indicates the site of the covalent bond of the group; B1 is selected from substituted or unsubstituted C1-C5 hydrocarbon groups, optionally being a methyl group, an ethyl group, or an isopropyl group; B2 is selected from the group consisting of C1-C5 alkyl groups, cyanoethyl groups, cyanopropyl groups, and cyanobutyl groups, optionally being a cyanoethyl group.

[0068] In some embodiments, L1 or L2 is one or more linkage combinations independently selected from A1, A2, A4, A6, A7, A8, A9, A10. In some embodiments, L1 or L2 is at least two linkage combinations independently selected from A1, A2, A4, A8, A9, A10. In some embodiments, L1 or L2 is at least two linkage combinations independently selected from A1, A4, A8, A10. In some embodiments, the length of L1 or L2 is 1 to 25 atoms independently, and the length of L1 or L2 refers to the number of chain-forming atoms on the longest straight chain. In some embodiments, the length of L1 or L2 is 1 to 20 atoms independently.

[0069] In some embodiments, each j1 is an integer between 1 and 10, and each j2 is an integer between 1 and 10, independently of each other. In some embodiments, each j1 is an integer between 1 and 8, and each j2 is an integer between 1 and 8, independently of each other.

[0070] In some embodiments, A0 is a group formed by the substitution of all or part of an N-acetylgalactosamine (GalNAc) group or its hydroxyl group with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group:

[0071] [ka]

[0072] .

[0073] In some embodiments, the compound has the following structure (I-1):

[0074] [ka]

[0075] In some embodiments, L is A10 and j1 is an integer between 2 and 8, or A11 and j2 is an integer between 1 and 7. In some embodiments, m is 0, 1, or 2. In some embodiments, n is 0, 1, 2, or 3. In some embodiments,

[0076] [ka] represents a 4- to 8-membered total carbon or nitrogen-containing saturated ring group. In some embodiments, [ka] It is a 4, 5, or 6-membered saturated cycloalkyl group containing one or two nitrogen atoms.

[0077] In one specific embodiment, the compound of the present disclosure has one of the following structures:

[0078] [ka] [ka]

[0079] According to a second aspect of the present invention, a nucleic acid conjugate is provided having one or more structures represented by formula (II) bound at any position on an oligonucleotide sequence, preferably having two, three or four consecutively bound structures represented by formula (II):

[0080] [ka]

[0081] Here, R p and R q Each has a structure represented by H or formula A16, and R p and R q Assuming that at least one of them has the structure shown in formula A16;

[0082] [ka]

[0083] Here, E1 is OH, SH, or BH2. A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or a group formed by the substitution of all or part of the hydroxyl group in the ligand with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group; The ligands are preferably, independently, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannopyranose, β-D-mannopyranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluor Roacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranose, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio -One selected from the group consisting of α-D-glucoheptopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose; b is an integer in the range of 1 to 4, preferably 1, 2, or 3, more preferably 1 or 3; L1 and L2 independently represent one or more linked combinations selected from the bases of formulas A1 to A11:

[0084] [ka]

[0085] Here, j1 is an integer between 1 and 20; j2 is an integer between 1 and 20; R' is C1-C 10 It is an alkyl group; M represents the structural formula shown in equation (A12):

[0086] [ka]

[0087] Here, m represents an integer from 0 to 6, preferably 0, 1, or 2; * is R p It shows a bond that connects to, Q represents the structural formula shown in equation (A13):

[0088] [ka]

[0089] Here, it binds to O

[0090] [ka] is R pThis shows the bonds that form between H, C1-C; R2 and R3 are identical or different and independent of each other. 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably H, C1-C6 alkyl groups, C1-C6 alkoxy groups, C2-C6 alkenyl groups, and C2-C6 alkynyl groups; Z does not exist, or C1-C 10 It represents an alkylene group, preferably a C1-C3 alkylene group; X represents the structural formula shown in formula (A14-1) or (A14-2): [ka]

[0091] Here, R4 and R5 are the same or different, and independently of each other, H, fluoro, hydroxyl group, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 Selected from alkynyl groups, preferably H, fluoro, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, or C2-C6 alkynyl; p is an integer from 1 to 6, preferably 1, 2, or 3; optionally, R4 and R5 are directly bonded to form a 3-6 membered saturated carbon ring group; E represents the structural formula shown in equation (A15):

[0092] [ka]

[0093] Here,

[0094] [ka] The symbol indicates the site of the covalent bond of the group; [ka] C3-C 18 Cycloalkyl groups or C3-C 18 Represents a heterocyclic group, preferably a C4-C8 cycloalkyl group or a C3-C8 heterocyclic group, more preferably a C3-C6 heterocyclic group, and even more preferably a 4-6 member nitrogen-containing saturated cycloalkyl group, and R1 is H, fluoro, hydroxyl group, cyano group, C1-C 20 Alkyl alkyl group, C1-C 20 Alkoxy group, C2-C 20 Alkenyl group, C2-C 20 The group is selected from alkynyl groups, preferably from H, fluoro, hydroxyl, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, and C2-C6 alkynyl groups.

[0095] In a third embodiment, the present invention provides a nucleic acid conjugate comprising one or more structures represented by formula (II-A) bound at any position on an oligonucleotide sequence:

[0096] [ka]

[0097] Here, a represents an integer between 0 and 7, preferably between 0 and 3, more preferably 0, 1, 2, or 3; R p and R q Each has a structure represented by H or formula A16, and at least one of them has a structure represented by formula A16;

[0098] [ka]

[0099] The structure of W is shown by the following formula:

[0100] [ka]

[0101] Here, E1 is OH, SH, or BH2.

[0102] A0, b, L1, L2, M, Z, X, and E are the same as in equation (II), and their explanation is omitted here.

[0103] In some embodiments, L1 or L2 is one or more linkage combinations independently selected from A1, A2, A4, A6, A7, A8, A9, A10. In some embodiments, L1 or L2 is at least two linkage combinations independently selected from A1, A2, A4, A8, A9, A10. In some embodiments, L1 or L2 is at least two linkage combinations independently selected from A1, A4, A8, A10. In some embodiments, the length of L1 or L2 is 1 to 25 atoms independently, and the length of L1 or L2 refers to the number of chain-forming atoms on the longest straight chain. In some embodiments, the length of L1 or L2 is 1 to 20 atoms independently.

[0104] In some embodiments, each j1 is an integer between 1 and 10, and each j2 is an integer between 1 and 10, independently of each other. In some embodiments, each j1 is an integer between 1 and 8, and each j2 is an integer between 1 and 8, independently of each other.

[0105] In some embodiments, A0 is a group formed by the substitution of all or part of an N-acetylgalactosamine (GalNAc) group or its hydroxyl group with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group:

[0106] [ka]

[0107] .

[0108] In the context of this disclosure, unless otherwise specified, “conjugate” refers to a compound formed by the covalent bonding of two or more chemical parts, each having a specific function, and therefore, a “conjugate” refers to a compound formed by the covalent bonding of these individual chemical parts. Furthermore, “nucleic acid conjugate” refers to a compound formed by the covalent bonding of one or more chemical parts having a specific function to an oligonucleotide. Hereinafter, nucleic acid conjugates in this disclosure may be simply referred to as “conjugates.”

[0109] In a specific embodiment of the present invention, the nucleic acid conjugate of the present invention has one of the following structures:

[0110] [ka] [ka] [ka] [ka] [ka] [ka]

[0111] In some embodiments of this disclosure, the oligonucleotide is one selected from the group consisting of small interfering RNA, microRNA, antimicroRNA, microRNA antagonist, microRNA mimetics, decoy oligonucleotides, immunostimulants, G quadruplexes, variable splicings, single-stranded RNA, antisense nucleic acids, nucleic acid aptamers, stem-loop RNA, mRNA fragments, and activating RNA; optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide; optionally, the oligonucleotide is a single-stranded oligonucleotide, the P atom in formula (A16) is bound to the terminal end of the single-stranded oligonucleotide, the terminal end of the single-stranded oligonucleotide refers to the first four nucleotides counted from one end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is bound to the terminal end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is bound to the 3' end of the single-stranded oligonucleotide; Optionally, the oligonucleotide is a double-stranded oligonucleotide comprising a sense strand and an antisense strand, the P atom in formula (A16) is bound to the terminal of the double-stranded oligonucleotide, the terminal of the double-stranded oligonucleotide being the first four nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is bound to the terminal of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is bound to the 5' end of the antisense strand; optionally, the P atom in formula (A16) is bound to the 2', 3', or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphate diester bond.

[0112] In some embodiments, the “target sequence” is a target mRNA. In the context of this disclosure, “target mRNA” means mRNA corresponding to a gene that is abnormally expressed in hepatocytes, which may be mRNA corresponding to an overexpressed gene or mRNA corresponding to an underexpressed gene. Since most diseases are caused by mRNA overexpression, in this disclosure, target mRNA specifically refers to mRNA corresponding to an overexpressed gene. In some embodiments of this disclosure, corresponding to the abnormally expressed gene, the target mRNA may be mRNA corresponding to genes such as ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV, HCV, etc. In some embodiments, the target mRNA may be mRNA transcribed from the corresponding HBV gene, or mRNA corresponding to the ANGPTL3 gene, Alternatively, it could be mRNA corresponding to the APOC3 gene.

[0113] Those skilled in the art know that siRNA comprises a nucleotide group as a basic structural unit, and that the nucleotide group comprises a phosphate group, a ribose group, and a base. Typically, active, i.e., functional siRNA is about 12 to 40 nucleotides long, and in some embodiments, about 15 to 30 nucleotides long, and each nucleotide in the siRNA can be independently modified or unmodified, and to increase stability, at least one nucleotide in the siRNA is modified.

[0114] The inventors of this disclosure have found that the siRNAs described in the following embodiments have higher activity and / or stability and therefore may be the object of the invention of siRNA in this disclosure.

[0115] In some embodiments, each nucleotide in the siRNA in the siRNA conjugate of the Disclosure (hereinafter also referred to as the siRNA of the Disclosure) is independently a modified or unmodified nucleotide, the siRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises nucleotide sequence 1 and the antisense strand comprises nucleotide sequence 2, the lengths of nucleotide sequence 1 and nucleotide sequence 2 are both 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 nucleotides, and are at least partially inversely complementary to form a complementary double-stranded region, at least a portion of nucleotide sequence 2 is complementary to a first nucleotide sequence, the first nucleotide sequence is a portion of the nucleotide sequence in a target mRNA.

[0116] In some embodiments, nucleotide sequence 1 is equal in length to the first nucleotide sequence and has a difference of 3 nucleotides or less; nucleotide sequence 2 is equal in length to nucleotide sequence B and has a difference of 3 nucleotides or less; and nucleotide sequence B is a nucleotide sequence that is completely inversely complementary to the first nucleotide sequence. While we do not wish to be limited, these specific nucleotide differences do not significantly reduce the target gene repression ability of the siRNA conjugate, and siRNA conjugates containing these specific nucleotide differences are also protected within the scope of this disclosure.

[0117] In some embodiments, nucleotide sequence 1 and nucleotide sequence 2 are substantially inversely complementary, substantially completely inversely complementary, or completely inversely complementary.

[0118] In some embodiments, the nucleotide sequence 1 and the first nucleotide sequence have a difference of one nucleotide or less, and / or the nucleotide sequence 2 and the nucleotide sequence B have a difference of one nucleotide or less. In some embodiments, the nucleotide difference between the nucleotide sequence 2 and the nucleotide sequence B includes a difference in the position of the first nucleotide Z' on the nucleotide sequence 2 in the direction from the 5' end to the 3' end. In some embodiments, the last nucleotide Z on the nucleotide sequence 1 in the direction from the 5' end to the 3' end is a nucleotide complementary to Z'.

[0119] In some embodiments, the sense strand further comprises nucleotide sequence 3, and the antisense strand further comprises nucleotide sequence 4, wherein nucleotide sequence 3 and nucleotide sequence 4 are of equal length and both consist of 1 to 4 nucleotides, nucleotide sequence 3 is bound to the 5' end of nucleotide sequence 1, and nucleotide sequence 4 is bound to the 3' end of nucleotide sequence 2, and nucleotide sequence 4 is complementary to a second nucleotide sequence, which is present in the target mRNA. This refers to a nucleotide sequence adjacent to the first nucleotide sequence and having the same length as nucleotide sequence 4. In some embodiments, nucleotide sequence 3 and nucleotide sequence 4 are substantially completely inversely complementary or completely inversely complementary. Therefore, the lengths of the sense and antisense strands can be 19 to 23 nucleotides.

[0120] In some embodiments, the siRNA of the Disclosure further comprises a nucleotide sequence 5, the length of which is 1 to 3 nucleotides, and is bonded to the 3' end of the antisense strand to constitute the 3' overhang of the antisense strand; in some embodiments, the length of the nucleotide sequence 5 is 1 or 2 nucleotides. Thus, in some embodiments, the ratio of sense strand to antisense strand lengths of the siRNA of the Disclosure may be 19 / 20, 19 / 21, 20 / 21, 20 / 22, 21 / 22, 21 / 23, 22 / 23, 22 / 24, 23 / 24, or 23 / 25.

[0121] In one embodiment, the length of nucleotide sequence 5 is 2 nucleotides, and in the direction from the 5' end to the 3' end, nucleotide sequence 5 is complementary to two consecutive deoxythymidine nucleotides, two consecutive uracil nucleotides, or a third nucleotide sequence, wherein the third sequence refers to a nucleotide sequence in the target mRNA that is adjacent to the first nucleotide sequence or adjacent to the second nucleotide sequence and has a length equal to that of nucleotide sequence 5. In one embodiment, the sense strand-to-antisense strand length ratio of the siRNA of the Disclosure is 19 / 21 or 21 / 23, in which case the siRNA of the Disclosure has better hepatocyte mRNA silencing activity.

[0122] In some embodiments, the nucleotides in the siRNA of the Disclosure are independently modified or unmodified nucleotides. In some embodiments, the siRNA of the Disclosure does not contain modified nucleotide groups; in some embodiments, the siRNA of the Disclosure contains modified nucleotide groups.

[0123] Currently, there are various methods available in the field for modifying siRNA, including skeletal modifications (also known as internucleotide bond modifications, such as phosphate group modifications), ribose group modifications, and base modifications (see, for example, Watts, JK, GFDeleavey and MJDamha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): pp.842-55, the entire content of which is incorporated herein by reference).

[0124] In the context of this disclosure, the term "modified nucleotide" as used refers to a nucleotide in which the ribose group of the nucleotide has been modified, for example, a nucleotide or nucleotide analog formed by the substitution of the hydroxyl group at the 2' position with another group, or a nucleotide in which the base on the nucleotide has been modified.

[0125] In some embodiments of the present disclosure, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide and / or at least one phosphate group is a phosphate group having a modifying group, in other words, at least a portion of the phosphate groups and / or ribose groups in the phosphate-sugar backbone of at least one of the single strands of the sense strand and the antisense strand are phosphate groups having a modifying group and / or ribose groups having a modifying group (or modified phosphate groups and / or modified ribose groups). In some embodiments of the present disclosure, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides.

[0126] In some embodiments, each nucleotide in the sense strand and the antisense strand is independently either a fluorinated or unfluorinated nucleotide. Fluorinated nucleotides are nucleotides formed by substituting fluorine for the hydroxyl group at the 2' position of the ribose group of a nucleotide, and have the structure shown in formula (17) below.

[0127] Non-fluorinated modified nucleotides refer to nucleotides or nucleotide analogs formed by substituting a non-fluorinated group for the hydroxyl group at the 2' position of the ribose group of a nucleotide. In some embodiments, each non-fluorinated modified nucleotide is independently selected from nucleotides or nucleotide analogs formed by substituting a non-fluorinated group for the hydroxyl group at the 2' position of the ribose group of a nucleotide.

[0128] Nucleotides formed by substituting the hydroxyl group at the 2' position of a ribose group with a nonfluorine group are known to those skilled in the art, and these nucleotides may be one selected from the group consisting of 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0129] In some embodiments, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), represented by formula (18). The 2'-substituted alkoxy-modified nucleotide may be, for example, a 2'-O-methoxyethyl-modified nucleotide (2'-MOE), represented by formula (19). In some embodiments, the 2'-amino-modified nucleotide (2'-NH2) is represented by formula (20). In some embodiments, the 2'-deoxynucleotide (DNA) is represented by formula (21).

[0130] [ka]

[0131] A nucleotide analog refers to a group that can substitute for a nucleotide in a nucleic acid but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine. In some embodiments, the nucleotide analog may be an isonucleotide, a bridged nucleic acid (BNA) nucleotide, or an acyclic nucleotide.

[0132] BNA nucleotides refer to nucleotides that are constrained or inaccessible. BNAs may contain a cross-linking structure with a "fixed" C3'-endosugar packer of a 5-membered, 6-membered, or 7-membered ring. Typically, this cross-linking is incorporated at the 2'-,4'-position of the ribose ring, providing 2',4'-BNA nucleotides such as LNA, ENA, and cET BNA, where LNA is represented by formula (22), ENA by formula (23), and cET BNA by formula (24).

[0133] [ka]

[0134] Acyclic nucleotides are a type of nucleotide formed by the ring-opening of the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) nucleotides or glycerol nucleic acid (GNA) nucleotides, where UNA is represented by formula (25) and GNA is represented by formula (26).

[0135] [ka]

[0136] Here, R is selected from H, OH, or an alkoxy group (O-alkyl group). Isonucleotides are compounds formed when a base in a nucleotide changes position on the ribose ring. For example, they are compounds formed when a base moves from the 1'-position to the 2'-position or 3'-position of the ribose ring, and are represented by formulas (27) or (28).

[0137] [ka]

[0138] Here, Base represents a base, such as A, U, G, C, or T; R is selected from H, OH, F, or the non-fluorinated group mentioned above.

[0139] In some embodiments, the nucleotide analog is selected from the group consisting of isonucleotides, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluorinated modified nucleotide is a methoxy-modified nucleotide, which refers to a nucleotide formed by substituting the 2'-hydroxyl group of a ribose group with a methoxy group.

[0140] In the above and below sentences, "fluorinated nucleotide," "2'-fluorinated nucleotide," "nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with fluorine," and "2'-fluororibose group" all have the same meaning and refer to compounds having the structure shown in formula (17) formed by the substitution of the 2'-hydroxyl group of a nucleotide with fluorine; "methoxy group modified nucleotide," "2'-methoxy group modified nucleotide," "nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with a methoxy group," and "2'-methoxy group modified nucleotide" The term "toxicibose group" has the same meaning, and in both cases, it refers to a structure in which the 2'-hydroxyl group of the ribose group of a nucleotide is replaced with a methoxy group, forming the structure shown in formula (18).

[0141] In some embodiments, the siRNA of the present disclosure is an siRNA having the following modifications: both the sense strand and the antisense strand contain fluorinated and unfluorinated nucleotides, wherein the fluorinated nucleotides are located in the aforementioned nucleotide sequence 1 and nucleotide sequence 2, the number of fluorinated nucleotides in nucleotide sequence 1 is 5 or less, and the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 are fluorinated nucleotides in the direction from the 5' end to the 3' end; the number of fluorinated nucleotides in nucleotide sequence 2 is 7 or less, and the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 are fluorinated nucleotides in the direction from the 5' end to the 3' end.In some embodiments, the siRNA of the Disclosure is an siRNA having the following modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 in the sense strand of the siRNA are fluorinated nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; in the antisense strand, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 are fluorinated nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; in some embodiments, the siRNA of the Disclosure is an siRNA having the following modifications: or in the direction from the 5' end to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence 1 in the sense strand of the siRNA are fluorinated nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides The siRNA is a nucleotide modified with a nucleotide group; in the antisense strand, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence 2 are fluorinated nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; in some embodiments, the siRNA of the present disclosure is an siRNA having the following modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 in the sense strand of the siRNA are fluorinated nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; and in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 in the antisense strand of the siRNA are fluorinated nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides.

[0142] In some specific embodiments of the siRNA described herein, the nucleotide includes a phosphate modification. In the context of this disclosure, the phosphate modification is, in one embodiment, a phosphorothioate modification represented by formula (11) below, i.e., replacing a non-crosslinked oxygen atom in the phosphate diester bond with a sulfur atom, thereby replacing the phosphate diester bond with a phosphorothioate diester bond. In some embodiments, this modification can stabilize the structure of the siRNA and maintain high specificity and affinity for base pairing.

[0143] [ka]

[0144] According to some embodiments of the present disclosure, the phosphorothioate group binding in the siRNA is located at at least one of the following positions: sense strand or antisense strand. Between the first and second nucleotides at either end of the chain; between the second and third nucleotides at either end of the sense or antisense chain; or any combination of the above. In some embodiments, the phosphorothioate bond is present at all of the aforementioned positions except the 5' end of the sense chain. In some embodiments, the phosphorothioate bond is present at all of the aforementioned positions except the 3' end of the sense chain. In some embodiments, the phosphorothioate bond is present at at least one of the following positions: The bond between the first and second nucleotides at the 5' end of the sense strand; The bond between the second and third nucleotides at the 5' end of the sense strand; The bond between the first and second nucleotides at the 3' end of the sense strand; The bond between the second and third nucleotides at the 3' end of the sense strand; The bond between the first and second nucleotides at the 5' end of the antisense strand; The bond between the second nucleotide and the third nucleotide at the 5'-end of the antisense strand; The bond between the first nucleotide and the second nucleotide at the 3'-end of the antisense strand; and The bond between the second nucleotide and the third nucleotide at the 3'-end of the antisense strand.

[0145] According to some embodiments of the present disclosure, the 5'-terminal nucleotide of the antisense strand sequence of the siRNA molecule is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide. In some embodiments, the 5'-phosphate nucleotide may have a structure represented by formula (12):

[0146]

Chemical formula

[0147] At the same time, the types of the commonly used 5'-phosphate analog-modified nucleotides are known to those skilled in the art. For example, they are the four nucleotides represented by the following formulas (13)-(16) disclosed in Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48:

[0148] [[ID=二十七]]

Chemical formula

[0149] Here, R represents a group selected from the group consisting of H, OH, F, and a methoxy group; Base represents a base selected from A, U, C, G, or T.

[0150] In some embodiments, the 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is a nucleotide containing a vinyl phosphonate (E-vinylphosphonate, E-VP) represented by formula (13), a nucleotide containing a 5'-phosphate modification represented by formula (12), or a nucleotide containing a 5'-thiophosphate modification represented by formula (15).

[0151] In some embodiments of this disclosure, the double-stranded oligonucleotide is an siRNA.

[0152] A third aspect of the present invention provides a method for producing a nucleic acid conjugate disclosed herein, the method comprising oxidizing a phosphoramidite functional group in a compound of formula (I) described in the present invention to a structure represented by formula (W), then binding it with an oligonucleotide, and further cleaving and deprotecting it to obtain the conjugate.

[0153] [ka]

[0154] Here,

[0155] [ka] The symbol indicates the site of the covalent bond of the group; E1 is OH, SH, or BH2.

[0156] Any reasonable synthetic route can be employed to produce the nucleic acid conjugates of this disclosure. For example, the method for producing nucleic acid conjugates of the present disclosure comprises sequentially attaching nucleotide monomers in the 3' to 5' direction according to the type and order of nucleotides of the functional oligonucleotide, under phosphoramidite solid-phase synthesis conditions, wherein the attachment of each nucleotide monomer comprises four reaction steps: deprotection, coupling, capping, oxidation, or sulfidation.

[0157] In some embodiments of the present disclosure, the coupling reaction is carried out in the presence of an activator, and the activator is one or more selected from, for example, 1H-tetrazole, 5-ethylthio-1H-tetrazole, 5-benzylthio-1H-tetrazole, and in some embodiments, it is 5-ethylthio-1H-tetrazole.

[0158] In some embodiments of the present disclosure, the oxidation reaction conditions include a temperature of 0 to 50 °C, in some embodiments 15 to 35 °C, a reaction time of 1 to 100 seconds, and in some embodiments it includes 5 to 50 seconds, and the oxidation reagent is iodine in some embodiments (in further embodiments, it is provided in the form of aqueous iodine).

[0159] According to a fourth aspect of the present invention, there is provided the use of the nucleic acid conjugate disclosed in the present invention for producing a medicament for treating and / or preventing liver-derived diseases.

[0160] According to a fifth aspect of the present invention, there is provided a method for treating a condition or disease caused by gene expression in hepatocytes, the method comprising administering to a patient suffering from the disease the nucleic acid conjugate disclosed in the present invention.

[0161] According to a sixth aspect of the present invention, there is provided a kit comprising the nucleic acid conjugate disclosed in the present invention. Mode for carrying out the invention

[0162] The following examples illustrate the present invention and are not limiting. The raw materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0163] Example 1 Production of Compound I-1-1

[0164] 1.1 Production of Intermediate 1-1

[0165] [ka]

[0166] Compound 1-Cbz-4-hydroxymethylpiperidine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (40.1 mmol, 10.0 g) was placed in a clean, dry reaction flask, 100 mL of pyridine was added, and 4,4'-dimethoxytrityl chloride (1.2 equiv, 48.1 mmol, 16.3 g) was added at room temperature. The mixture was then stirred for 1 hour at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction mixture. The organic phase was washed with mL of saturated sodium bicarbonate solution and 150 mL of saturated saline solution, dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 - 4 / 1) to obtain compound 1-1, a pale yellow oily substance (21.7 g, 39.3 mmol, 98% yield). Molecular formula of compound 1-1: C 35 H 37 O5N, molecular weight: 551.3, LC-MS measured value: 552.4 (M+H). 1 H NMR (400 MHz, DMSO-d6): δ 7.31 - 7.22 (m, 9H), 7.17 (d, J = 8.6 Hz, 5H), 6.82 (d, J = 8.7 Hz, 4H), 4.99 (s, 2H), 3.93 (d, J = 12.6 Hz, 2H), 3.66 (s, 6H), 2.78 - 2.61 (m, 4H), 2.44 (s, 1H), 1.62 (d, J = 12.6 Hz, 2H), 0.97 (qd, J = 12.7, 3.6 Hz, 2H).

[0167] 1.2 Production of Intermediate 1-2

[0168] [ka]

[0169] Compound 1-1 (39.3 mmol, 21.7 g) was placed in a clean, dry reaction flask, 150 mL of methanol was added, and palladium-carbon (wet base, 10% Pd / C) (10% wt, 2.2 g) was added at room temperature under a hydrogen atmosphere. The mixture was then stirred at room temperature for 12 hours. After the reaction, the palladium-carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 1-2, a white solid (16.1 g, 38.5 mmol, 98% yield). This was added directly to the next reaction without purification. Molecular formula of compound 1-2: C 27 H 31 O3N, molecular weight: 417.2, LC-MS measured value: 418.4 (M+H).

[0170] 1.3 Production of Intermediate 1-3

[0171] [ka]

[0172] Compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (35.0 mmol, 8.4 g) was placed in a clean, dry reaction flask, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 52.5 mmol, 19.9 g), compound 1-2 (1.1 equiv, 38.5 mmol, 16.1 g), and N,N-diisopropylethylamine (3.0 equiv, 105.0 mmol, 13.5 g) were added at room temperature. The mixture was then stirred for 1 hour at room temperature. After the reaction, 150 mL of dichloromethane was added to the reaction mixture, washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine, the organic phase was dried, filtered, and concentrated. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1 - 2 / 3) to obtain compounds 1-3 as white solids (14.9 g, 23.5 mmol, yield 67%). Molecular formula of compounds 1-3: C 38 H 42O7N2, molecular weight: 638.3, LC-MS observed value: 639.4 (M+H). 1 H NMR (400 MHz, DMSO-d6): δ 7.42 - 7.26 (m, 9H), 7.23 (d, J = 8.7 Hz, 5H), 6.89 (d, J = 8.8 Hz, 4H), 5.03 - 4.96 (m, 2H), 4.79 (dt, J = 25.7, 5.4 Hz, 1H), 4.55 - 4.48 (m, 1H), 4.36 (d, J = 10.7 Hz, 1H), 4.01 (dt, J = 24.8, 8.8 Hz, 1H), 3.73 (s, 6H), 3.56 (ddd, J = 18.7, 12.7, 5.8 Hz, 1H), 3.43 - 3.38 (m, 1H), 3.00 (t, J = 12.3 Hz, 1H), 2.85 - 2.79 (m, 2H), 2.69 (s, 1H), 2.56 (d, J = 10.2 Hz, 1H ), 1.88 (d, J = 21.0 Hz, 1H), 1.69 (dd, J = 36.5, 11.3 Hz, 2H), 1.19 - 0.98 (m, 2H).

[0173] 1.4 Production of Intermediate 1-4

[0174] [ka]

[0175] Compound 1-3 (23.5 mmol, 14.9 g) was placed in a clean, dry reaction flask, 100 mL of methanol was added, and palladium-carbon (wet base, 10% Pd / C) (10% wt, 1.5 g) was added at room temperature under a hydrogen atmosphere. The mixture was then stirred at room temperature for 12 hours. After the reaction, the palladium-carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 1-4, a white solid (11.6 g, 23.0 mmol, 98% yield). This was added directly to the next reaction without purification. Molecular formula of compound 1-4: C 30 H 36O5N2, molecular weight: 504.2, LC-MS measured value: 527.6 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 7.36 (d, J = 7.5 Hz, 2H), 7.31 (t, J = 7.6 Hz, 2H), 7.23 (d, J = 8.8 Hz, 5H), 6.89 (d, J = 8.8 Hz, 4H), 4.39 (t, J = 12.2 Hz, 1H), 3.97 (d, J = 13.0 Hz, 1H), 3.73 (s, 6H), 3.69 (t, J = 6.3 Hz, 1H), 3.43 - 3.36 (m, 5H), 3.01 - 2.92 (m, 2H), 2.83 (d, J = 6.1 Hz, 2H), 1.84 (dd, J = 11.6, 8.1 Hz, 1H), 1.72 (d, J = 12.0 Hz, 2H), 1.17 - 0.91 (m, 2H).

[0176] 1.5 Production of Intermediate 1-5

[0177] [ka]

[0178] Compound 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Nuokanglin Biomedical Technology (Suzhou) Co., Ltd.) (9.3 g, 20.9 mmol) was placed in a clean, dry reaction flask, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 31.3 mmol, 11.9 mmol) was added at room temperature. Add (g) and stir for 10 minutes. Then, add compound 1-4 (1.1 equiv, 23.0 mmol, 11.6 g) and N,N-diisopropylethylamine (3.0 equiv, 62.7 mmol, 8.1 g) to the reaction system and continue stirring at room temperature for 1 hour. After the reaction, add 150 mL of dichloromethane to the reaction mixture, wash with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine, dry the organic phase, filter, and concentrate. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1 - 20 / 1) to obtain compound 1-5 as a white solid (15.4 g, 16.5 mmol, yield 79%). Molecular formula of compound 1-5: C 49 H 63 O 13 N5, molecular weight: 933.4, LC-MS measured value: 932.5 (MH). 1 H NMR (400 MHz, DMSO-d6): δ 7.93 (dd, J = 24.8, 8.3 Hz, 1H), 7.80 (dd, J = 8.8, 5.3 Hz, 1H), 7.36 (d, J = 7.8 Hz, 2H), 7.31 (t, J = 7.6 Hz, 2H), 7.23 (d, J = 8.7 Hz, 5H), 6.89 (d, J = 8.8 Hz, 4H), 5.21 (d, J = 3.3 Hz, 1H), 4.97 (dd, J = 11.2, 3.4 Hz, 1H), 4.79 (d, J = 4.7 Hz, 1H), 4.47 (dd, J = 8.0, 3.6 Hz, 1H), 4.37 (d, J = 12.7 Hz, 1H), 4.05 - 4.00 (m, 5H), 3.87 (dd, J = 20.2, 10.3 Hz, 1H), 3.73 (s, 6H), 3.57 - 3.50 (m, 1H), 3.14 (qd, J = 7.3, 4.3 Hz, 1H), 2.99 (t, J = 14.2 Hz, 1H), 2.82 (d, J = 3.8 Hz, 2H), 2.10 (s, 5H), 1.99 - 1.98 (m, 6H), 1.89 (s, 3H), 1.76 (d, J = 9.2 Hz, 4H), 1.25 (dd, J = 12.6, 6.5 Hz, 5H), 1.17 (t, J = 7.1 Hz, 3H).

[0179] 1.6 Preparation of Compound I-1-1

[0180] [ka]

[0181] Compounds 1-5 (16.5 mmol, 15.4 g) were placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. At room temperature under argon protection, compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphodiamidite (2.0 (equv, 33.0 mmol, 9.9 g) and 4,5-dicyanoimidazole (1.5 equiv, 24.7 mmol, 2.9 g) were added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 50 mL of dichloromethane was added to the reaction mixture, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The resulting crude product was fractionated using a C18 reversed-phase column (specifications: 30 μm; 100 Å, commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O = 75%:25%) to obtain the white solid I-1-1 (11.6 g, 10.2 mmol, yield 62%). Compound I -1-1 Molecular formula: C 58 H 80 O 15 N6P, Molecular weight: 1133.5, LC-MS measured value: 1132.4 (MH). 1H NMR (400 MHz, DMSO-d6): δ 8.22 - 8.04 (m, 1H), 7.79 (t, J = 8.2 Hz, 1H), 7.35 (d, J = 2.3 Hz, 2H), 7.30 (t, J = 7.6 Hz, 2H), 7.22 (d, J = 8.5 Hz, 5H), 6.88 (d, J = 8.7 Hz, 4H), 5.21 (d, J = 3.3 Hz, 1H), 4.93 (ddd, J = 18.3, 11.7, 4.3 Hz, 2H), 4.49 - 4.45 (m, 1H), 4.40 - 4.30 (m, 1H), 3.99 (p, J = 8.9 Hz, 4H), 3.85 (dt, J = 13.0, 6.6 Hz, 2H), 3.73 (s, 6H), 3.71 (s, 2H), 3.68 - 3.62 (m, 2H), 3.49 (ddd, J = 15.7, 13.6, 6.6 Hz, 2H), 3.42 - 3.36 (m, 1H), 3.00 (t, J = 14.4 Hz, 1H), 2.82 - 2.79 (m, 2H), 2.77 - 2.72 (m, 1H), 2.69 - 2.64 (m, 1H), 2.60 - 2.54 (m, 1H), 2.10 (s, 5H), 1.98 (dd, J = 8.7, 3.5 Hz, 3H), 1.89 (s, 4H), 1.77 - 1.63 (m, 5H), 1.50 - 1.37 (m, 4H), 1.19 - 1.10 (m, 12H). 31 P NMR (162 MHz, DMSO-d6): δ 147.90, 147.30.

[0182] Example 2 Production of Compound I-1-7

[0183] 2.1 Manufacturing of intermediate 2-1

[0184]

change

[0185] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean, dry reaction flask. 50 mL of acetonitrile was added, and tert-butyldimethylchlorosilane (1.3 equiv, 21.9 mmol, 3.31 g) was slowly added at room temperature. The mixture was then stirred at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction mixture, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 - 5 / 1) to obtain compound 2-1, a colorless oily substance (4.9 g, 16.8 mmol, 99% yield). Molecular formula of compound 2-1: C 17 H 29 ONSi, molecular weight: 291.2, LC-MS actual value: 292.4 (M+H).

[0186] 2.2 Preparation of Intermediate 2-2

[0187] [ka]

[0188] Compound 2-1 (16.8 mmol, 4.9 g) was placed in a clean, dry reaction flask, 100 mL of methanol was added, and palladium-carbon (wet base, 10% Pd / C) (10% wt, 490.0 mg) was added at room temperature under a hydrogen atmosphere. The mixture was then stirred at room temperature for 12 hours. After the reaction, the palladium-carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 2-2, a white solid (3.31 g, 16.5 mmol, 98% yield). This was added directly to the next reaction without purification. Molecular formula of compound 2-2: C 10 H 23 ONSi, molecular weight: 201.1, LC-MS actual value: 202.3 (M+H).

[0189] 2.3 Production of Intermediate 2-3

[0190] [ka]

[0191] Compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (15.0 mmol, 3.58 g) was placed in a clean, dry reaction flask, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 22.5 mmol, 8.53 g), compound 2-2 (1.1 equiv, 16.5 mmol, 3.31 g), and N,N-diisopropylethylamine (3.0 equiv, 45.0 mmol, 5.78 g) were added at room temperature, and the mixture was stirred for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction mixture, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1 - 1 / 3) to obtain compound 2-3 as a white solid (4.5 g, 10.65 mmol, 2-step yield 63%). Molecular formula of compound 2-3: C 21 H 34 O5N2Si, Molecular weight: 422.2, LC-MS measured value: 423.3 (M+H). 1 H NMR (400 MHz, CDCl3): δ 7.35 - 7.29 (m, 5H), 5.96 (dd, J = 14.3, 8.3 Hz, 1H), 5.10 (s, 2H), 4.61 - 4.40 (m, 2H), 3.85 - 3.68 (m, 2H), 3.65 - 3.49 (m, 2H), 3.41 (d, J = 12.7 Hz, 1H), 3.31 (s, 1H), 1.95 (qdd, J = 15.0, 11.8, 5.3 Hz, 2H), 1.77 (s, 1H), 0.86 (s, 9H), 0.06 (d, J = 3.1 Hz, 6H).

[0192] 2. Production of Intermediate 2-4

[0193]

Chemical Structure

[0194] Compound 2-3 (10.65 mmol, 4.5 g) was placed in a clean and dry reaction flask, 100 mL of pyridine was added, 4,4'-dimethoxytrityl chloride (1.2 equiv, 12.78 mmol, 4.32 g) was added at room temperature, and then stirring was continued at room temperature for 12 hours. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and it was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 - 1 / 1) to obtain Compound 2-4 as a pale yellow oil (7.56 g, 10.43 mmol, yield 98%). The molecular formula of Compound 2-4 is C 42 H 52 O7N2Si, molecular weight: 724.3, LC-MS measured value: 747.4 (M+Na). 1 1H NMR (400 MHz, CDCl3): δ 7.35 - 7.31 (m, 1H), 7.28 (d, J = 4.7 Hz, 4H), 7.27 - 7.23 (m, 2H), 7.23 - 7.14 (m, 5H), 7.13 - 7.11 (m, 2H), 6.80 - 6.78 (m, 1H), 6.76 (dd, J = 7.7, 5.4 Hz, 4H), 5.72 (dd, J = 22.7, 8.3 Hz, 1H), 5.08 - 4.9 (m, 2H), 4.6 (m, 1H), 4.35 - 4.30 (m, 1H), 3.73 (dd, J = 4.5, 3.7 Hz, 6H), 3.65 - 3.44 (m, 2H), 3.36 - 3.20 (m, 3H), 1.86 - 1.81 (m, 1H), 1.70 (s, 1H), 0.80 (d, J = 13.1 Hz, 9H), -0.02 (dd, J = 14.9, 4.2 Hz, 6H).

[0195] 2.5 Production of intermediates 2-5

[0196] [ka]

[0197] Compound 2-4 (10.43 mmol, 7.56 g) was placed in a clean, dry reaction flask, 100 mL of methanol was added, and palladium-carbon (wet base, 10% Pd / C) (10% wt, 750.0 mg) was added at room temperature under a hydrogen atmosphere, and then the reaction proceeded in a chamber. The mixture was stirred at warm temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 2-5, a white solid (6.0 g, 10.22 mmol). Yield 98%. This was added directly to the next reaction without purification. Molecular formula of compound 2-5: C 34 H 46 O5N2Si, molecular weight: 590.3, LC-MS measured value: 591.6 (M+H).

[0198] 2.6 Production of intermediates 2-6

[0199] [ka]

[0200] Compound 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercial product, purchased from Nuokanglin Biomedical Technology (Suzhou) Co., Ltd.) (2.06 g, 4.62 mmol) was placed in a clean, dry reaction flask, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 6.93 mmol, 2.63 g) was added at room temperature and the mixture was stirred for 10 minutes. Then, compound 2-5 (1.1 equiv, 5.08 mmol, 3.0 g) and N,N-diisopropylethylamine (3.0 equiv, 13.86 mmol, 17.91 g) were added to the reaction system and the mixture was stirred at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction mixture, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product obtained was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1 - 10 / 1) to obtain compound 2-6 as a white solid (3.58 g, 3.51 mmol, yield 76%). Molecular formula of compound 2-6: C 53 H 73 O 15 N3Si, molecular weight: 1019.3, LC-MS measured value: 1018.3 (MH).

[0201] 2.7 Production of intermediates 2-7

[0202] [ka]

[0203] Compound 2-6 (3.51 mmol, 3.58 g) was placed in a clean, dry reaction flask, 50 mL of pyridine was added, and triethylamine hydrogen fluoride (5.0 equiv, 17.55 mmol, 2.97 g) was added at room temperature. The mixture was then stirred at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction mixture, and 100 mL of saturated carbon dioxide was added. It was washed with a sodium hydrogen carbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered, and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1 - 10 / 1) to obtain compound 2-7 as a pale yellow oily substance (2.4 g, 2.65 mmol, yield 76%). The molecular formula of compound 2-7: C 47 H 59 O 15 N3, molecular weight: 905.3, LC-MS measured value: 904.4 (M-H). 1 H NMR (400 MHz, CDCl3): δ 7.30 (dd, J = 4.2, 1.9 Hz, 1H), 7.29 - 7.25 (m, 5H), 7.19 - 7.15 (m, 4H), 6.85 - 6.81 (m, 4H), 5.40 - 5.34 (m, 1H), 5.30 (s, 1H), 5.26 - 5.19 (m, 1H), 5.13 (ddd, J = 14.5, 10.9, 3.3 Hz, 1H), 4.85 - 4.78 (m, 1H), 4.75 - 4.71 (m, 1H), 4.68 - 4.61 (m, 1H), 4.50 (d, J = 11.5 Hz, 1H), 4.18 - 4.11 (m, 2H), 4.06 - 3.97 (m, 1H), 3.90 (dt, J = 10.6, 6.8 Hz, 2H), 3.80 (s, 6H), 3.67 - 3.46 (m, 4H), 3.25 - 3.19 (m, 2H), 2.34 - 2.23 (m, 1H), 2.17 - 2.15 (m, 3H), 2.10 - 2.03 (m, 5H), 1.98 (dt, J = 12.9, 2.4 Hz, 4H), 1.76 - 1.61 (m, 4H), 1.37 (t, J = 7.3 Hz, 3H).<​​​​​​​​​

[0206] Compound 2-7 (2.65 mmol, 2.4 g) was placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) was added. At room temperature under argon protection, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphodiamidite (2.0 equiv, 5.3 mmol, 1.6 g) and 4,5-dicyanoimidazole (1.5 equiv, 3.97 mmol, 470.0 mg) were added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 50 mL of dichloromethane was added to the reaction mixture, washed with 100 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered, and concentrated. The obtained crude product was separated using a C18 reversed-phase column (specifications: 30 μm; 100 Å, commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O = 75%:25%) to obtain the white solid I-1-7 (2.03 g, 1.84 mmol, yield 70%). Molecular formula of compound I-1-7: C 56 H 76 O 15 N6P, molecular weight: 1105.5, LC-MS measured value: 1128.4 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 8.12 - 8.06 (m, 1H), 7.78 (dd, J = 9.1, 2.0 Hz, 1H), 7.35 - 7.28 (m, 4H), 7.23 - 7.17 (m, 5H), 6.88 (d, J = 7.5 Hz, 4H), 5.21 (d, J = 3.3 Hz, 1H), 4.97 (dd, J = 11.2, 3.0 Hz, 1H), 4.86 - 4.75 (m, 1H), 4.52 (s, 1H), 4.47 (d, J = 8.5 Hz, 1H), 4.04 - 3.98 (m, 3H), 3.91 - 3.83 (m, 1H), 3.74 (s, 6H), 3.70 - 3.60 (m, 3H), 3.58 - 3.47 (m, 3H), 3.39 (t, J = 11.7 Hz, 2H), 3.31 (d, J = 4.1 Hz, 1H), 3.19 (qd, J = 8.7, 3.8 Hz, 1H), 3.02 (dt, J = 19.9, 6.8 Hz, 1H), 2.78 - 2.70 (m, 1H), 2.60 (td, J = 5.8, 1.8 Hz, 1H), 2.09 (s, 5H), 1.98 (s, 4H), 1.89 (s, 3H), 1.73 (s, 3H), 1.44 (s, 4H), 1.20 - 0.88 (m, 14H). 31 P NMR (162 MHz, DMSO-d6): δ 148.22 (s), 146.82 (t, J = 35.8 Hz).

[0207] Example 3 Production of Compound I-1-5

[0208]

change

[0209] The synthesis method of Example 2 was based on the raw material N-Hydrocondensate-4-Hydrocondensate (commercially available product). , Shanghai Titan Technology Co., Ltd. purchased) and manufactured white solid I-1-5 (3.0 g, 2.68 mmol, yield 72%). Molecular formula of compound I-1-5: C 57 H 78 O 15 N6P, molecular weight: 1119.5, LC-MS measured value: 1142.4 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 8.14 - 8.08 (m, 1H), 7.80 (d, J = 9.2 Hz, 1H), 7.35 (d, J = 7.6 Hz, 2H), 7.29 (t, J = 7.6 Hz, 2H), 7.22 (d, J = 7.5 Hz, 5H), 6.87 (d, J = 7.8 Hz, 4H), 5.22 (d, J = 3.3 Hz, 1H), 5.02 - 4.96 (m, 2H), 4.49 (d, J = 8.4 Hz, 1H), 4.02 (tt, J = 7.9, 3.8 Hz, 4H), 3.88 (dd, J = 19.8, 8.9 Hz, 1H), 3.74 (s, 6H), 3.72 - 3.66 (m, 3H), 3.63 - 3.54 (m, 3H), 3.38 (dd, J = 11.9, 7.7 Hz, 3H), 3.32 - 3.31 (m, 1H), 3.19 (t, J = 7.2 Hz, 1H), 3.06 (s, 1H), 2.77 - 2.74 (m, 2H), 2.14 - 2.07 (m, 5H), 1.98 (s, 3H), 1.90 (s, 3H), 1.75 (s, 4H), 1.46 (s, 6H), 1.27 - 1.05 (m, 13H). 31 P NMR (162 MHz, DMSO-d6): δ 148.24 (s), 145.47 (dd, J = 15.7, 11.5 Hz).

[0210] Example 4 Production of Compound I-1-2

[0211]

change

[0212] The synthesis method of Example 1 was based on the base material and the raw material L-スレオニン (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) and the white solid I-1-2 was produced by the manufacturer (1.2 g, 1.05 mmol, yield 56%). Molecular formula of compound I-1-2: C 59 H 82 O 15 N6P, molecular weight: 1147.5, LC-MS measured value: 1170.3 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 7.79 (dt, J = 12.8, 4.5 Hz, 1H), 7.37 - 7.29 (m, 4H), 7.22 (d, J = 7.6 Hz, 5H), 6.88 (d, J = 7.7 Hz, 4H), 5.21 (d, J = 3.3 Hz, 1H), 4.97 (dd, J = 11.0, 3.3 Hz, 1H), 4.88 (dt, J = 11.6, 4.7 Hz, 1H), 4.47 (dd, J = 10.6, 5.5 Hz, 1H), 4.41 - 4.32 (m, 1H), 4.16 - 4.08 (m, 1H), 4.04 - 3.99 (m, 3H), 3.92 - 3.82 (m, 1H), 3.73 (s, 6H), 3.70 - 3.63 (m, 2H), 3.30 - 3.24 (m, 5H), 2.90 (dd, J = 10.7, 5.2 Hz, 1H), 2.82 (dt, J = 9.3, 5.6 Hz, 2H), 2.76 - 2.66 (m, 1H), 2.34 - 2.32 (m, 1H), 2.20 - 2.14 (m, 2H), 2.10 (s, 3H), 2.01 - 1.96 (m, 4H), 1.89 - 1.81 (m, 4H), 1.77 - 1.65 (m, 5H), 1.53 - 1.38 (m, 5H), 1.23 - 0.94 (m, 17H). 31 P NMR (162 MHz, DMSO-d6): δ 148.02.

[0213] Example 5 Production of Compound I-1-9

[0214]

change

[0215] The synthesis method of Example 2 is based on the raw material: 1-ベンジルオキシカルボニル-3-ヒドロキシアゼチジン (commercial product, purchased from Shanghai Titan Technology Co., Ltd.) から white solid のI- 1-9をManufacture した (3.02 g, 2.77 mmol, yield 83%). Molecular formula of compound I-1-9: C 55 H 74 O 15 N6P, molecular weight: 1091.4, LC-MS measured value: 1114.3 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 8.09 - 8.02 (m, 1H), 7.78 (d, J = 9.1 Hz, 1H), 7.37 - 7.29 (m, 4H), 7.24 - 7.19 (m, 5H), 6.89 (d, J = 8.9 Hz, 4H), 5.21 (d, J = 3.4 Hz, 1H), 4.97 (dd, J = 11.2, 3.1 Hz, 1H), 4.77 - 4.61 (m, 1H), 4.57 - 4.50 (m, 1H), 4.47 (dd, J = 8.5, 2.6 Hz, 1H), 4.24 - 4.06 (m, 2H), 4.04 - 3.98 (m, 3H), 3.92 - 3.81 (m, 1H), 3.78 (dd, J = 6.7, 3.8 Hz, 1H), 3.69 (ddd, J = 9.9, 5.5, 2.7 Hz, 2H), 3.61 - 3.51 (m, 2H), 3.40 - 3.35 (m, 1H), 3.16 (q, J = 7.7 Hz, 1H), 3.04 - 2.98 (m, 1H), 2.80 - 2.74 (m, 2H), 2.21 - 2.06 (m, 5H), 1.98 (s, 3H), 1.89 (s, 3H), 1.74 (d, J = 2.5 Hz, 3H), 1.51 - 1.37 (m, 4H), 1.18 - 1.10 (m, 12H), 1.06 (d, J = 6.7 Hz, 2H). 31 P NMR (162 MHz, DMSO-d6): δ 146.95 (dd, J = 65.4, 20.5 Hz).

[0216] Example 6 Production of Compound I-1-8

[0217] 6.1 Production of Intermediate 6-1

[0218] [ka]

[0219] The compound selinol (commercially available, purchased from Adamas, Shanghai Taitan Technology Co., Ltd.) (54.9 mmol, 5.0 g) was placed in a clean reaction flask and dissolved in 90 mL of water. Sodium carbonate (3.4 equiv, 183.8 mmol, 19.5 g) was added at room temperature. Under an ice bath, triphosgene (0.33 equiv, 18.3 mmol, 5.4 g) was slowly added in fractions, and stirring was continued at room temperature for 24 hours. The solvent was removed by reducing the pressure, ethanol was added, and the mixture was stirred for 2 hours. The mixture was then concentrated by suction filtration. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1 - 9 / 1) to obtain compound 6-1 as a white solid (4.6 g, 39.3 mmol, 72% yield). The molecular formula of compound 6-1 is C4H7NO3, its molecular weight is 117.1, and its LC-MS measured value is 118.4 (M+H). 1 1H NMR (400 MHz, DMSO-d6): δ 7.58 (s, 1H), 4.31 (t, J = 8.6 Hz, 1H), 4.05 (dd, J = 8.5, 5.0 Hz, 1H), 3.78 - 3.72 (m, 1H), 3.36 (d, J = 5.0 Hz, 2H).

[0220] 6.2 Preparation of Intermediate 6-2

[0221] [ka]

[0222] Compound 6-1 (47.0 mmol, 5.5 g) was placed in a clean, dry reaction flask, and 300 mL of dichloromethane was added, followed by DMAP (2.0 equiv, 93.9 mmol, 11.5 g). Under an ice bath, TsCl (1.1 equiv, 51.7 mmol, 9.8 g) was slowly added in portions, and the mixture was stirred at room temperature for 2 hours. After the reaction, the reaction solution was washed sequentially with 100 mL of 1 M HCl, 100 mL of water, and 100 mL of saturated brine, dried, and then dried in a rotary evaporator to obtain a white powder, 6-2 (12.3 g, 45.3 mmol, 97% yield). The crude product was added directly to the next reaction without purification. Molecular formula of compound 6-2: C 11 H 13 NO5S, molecular weight: 271.1, LC-MS measured value: 272.4 (M+H).

[0223] 6.3 Production of Intermediate 6-3

[0224] [ka]

[0225] Compound 6-2 (45.5 mmol, 12.3 g) was placed in a clean, dry reaction flask and dissolved in 50 mL of tetrahydrofuran. 4-piperidinemethanol (3.0 equiv, 136.6 mmol, 15.7 g) was added, and the mixture was reacted under reflux for 16 hours. The reaction mixture was concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1 - 9 / 1) to obtain a colorless, syrup-like compound 6-3 (7.9 g, 36.8 mmol, 81% yield). Molecular formula of compound 6-3: C 10 H 18 N2O3, molecular weight: 214.1, LC-MS measured value: 215.3 (M+H). 1H NMR (400 MHz, DMSO-d6): δ 7.61 (s, 1H), 4.38 (d, J = 5.3 Hz, 1H), 4.33 (t, J = 8.2 Hz, 1H), 3.97 (dd, J = 8.3, 5.5 Hz, 1H), 3.94 - 3.87 (m, 1H), 3.22 (t, J = 5.7 Hz, 2H), 2.82 (t, J = 10.5 Hz, 2H), 2.37 - 2.28 (m, 2H), 1.97 - 1.86 (m, 2H), 1.59 (d, J = 12.4 Hz, 2H), 1.34 - 1.23 (m, 1H), 1.10 (pd, J = 12.3, 3.9 Hz, 2H).

[0226] 6.4 Production of Intermediate 6-4

[0227] [ka]

[0228] Compound 6-3 (23.3 mmol, 5.0 g) was placed in a clean, dry reaction flask, 50 mL of pyridine was added, and 4,4'-dimethoxytrityl chloride (1.2 equiv, 28.0 mmol, 9.5 g) was added at room temperature. The mixture was then stirred for 1 hour at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction mixture, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine, respectively. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 0 - 100 / 3) to obtain compound 6-4 as a nearly white, foamy solid (8.2 g, 15.9 mmol, yield 68%). Molecular formula of compound 6-4: C 31 H 36 N2O5, molecular weight: 516.2, LC-MS measured value: 515.3 (MH). 1H NMR (400 MHz, DMSO-d6): δ 7.61 (s, 1H), 7.38 - 7.35 (m, 2H), 7.30 (t, J = 7.7 Hz, 2H), 7.24 - 7.21 (m, 5H), 6.88 (d, J = 8.9 Hz, 4H), 4.32 (t, J = 8.2 Hz, 1H), 3.96 (dd, J = 8.2, 5.4 Hz, 1H), 3.89 (dt, J = 13.2, 6.8 Hz, 1H), 3.73 (s, 6H), 2.80 (t, J = 9.2 Hz, 4H), 2.37 - 2.27 (m, 2H), 1.94 (dd, J = 26.3, 11.7 Hz, 2H), 1.63 (d, J = 12.3 Hz, 2H), 1.56 - 1.50 (m, 1H), 1.23 - 1.08 (m, 2H).

[0229] 6.5 Production of Intermediate 6-5

[0230] [ka]

[0231] Compound 6-4 (15.9 mmol, 8.2 g) was placed in a clean, dry reaction flask and dissolved in 82 mL of ethanol. 41 mL of aqueous potassium hydroxide solution (3.0 equiv, 47.6 mmol, 2.7 g) was added at room temperature, and the mixture was heated to 85°C and reacted overnight. The mixture was concentrated to remove the solvent, and 100 mL of ethyl acetate was added to the reaction solution. The mixture was washed with 60 mL of saturated sodium bicarbonate solution. 50 mL of ethyl acetate was added to the aqueous phase for back-extraction. The organic phases were combined, dried, filtered, and concentrated to obtain a white, foamy solid, 6-5 (7.6 g, 15.5 mmol, 98% yield). The crude product was added directly to the next reaction without purification. Molecular formula of compound 6-5: C 30 H 38 N2O4, Molecular weight: 490 .2, LC-MS measured value: 491.3 (M+H).

[0232] 6.6 Production of Intermediate 6-6

[0233] [ka]

[0234] Compound 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Nuokanglin Biomedical Technology (Suzhou) Co., Ltd.) (6.9 g, 15.5 mmol) was placed in a clean, dry reaction flask, 80 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.0 equiv, 15.5 mmol, 5.9 g) was added at room temperature and the mixture was stirred for 10 minutes. Then, compound 6-5 (1.0 equiv, 15.5 mmol, 7.6 g) and N,N-diisopropylethylamine (2.0 equiv, 31.0 mmol, 4.0 g) were added to the reaction system, and the mixture was stirred at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction mixture, washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine, dried the organic phase, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1 - 10 / 1) to obtain compound 6-6 as a white foamy solid (7.7 g, 8.4 mmol, yield 54%). Molecular formula of compound 6-6: C 49 H 65 N3O 14 Molecular weight: 919.4, LC-MS measured value: 918.3 (MH). 1 H NMR (400 MHz, DMSO-d6): δ 7.81 (dd, J = 9.2, 3.1 Hz, 1H), 7.45 (d, J = 6.0 Hz, 1H), 7.36 (d, J = 7.3 Hz, 2H), 7.30 (t, J = 7.7 Hz, 2H), 7.24 - 7.21 (m, 5H), 6.88 (d, J = 8.9 Hz, 4H), 5.21 (d, J = 3.4 Hz, 1H), 4.97 (dd, J = 11.2, 3.0 Hz, 1H), 4.48 (dd, J = 8.4, 1.4 Hz, 1H), 4.04 - 3.98 (m, 3H), 3.87 (dd, J = 19.9, 9.3 Hz, 2H), 3.73 (s, 6H), 3.71 - 3.67 (m, 1H), 3.43 - 3.35 (m, 2H), 2.84 (dd, J = 17.8, 8.8 Hz, 4H), 2.10 (s, 3H), 2.05 (t, J = 6.7 Hz, 2H), 1.98 (d, J = 1.4 Hz, 4H), 1.89 (s, 3H), 1.77 (s, 3H), 1.65 (d, J = 9.9 Hz, 2H), 1.53 - 1.41 (m, 5H), 1.26 - 1.23 (m, 1H), 1.14 (dt, J = 22.4, 9.2 Hz, 2H).

[0235] 6.7 Production of Compound I-1-8

[0236]

change

[0237] Compound 6-6 (2.2 mmol, 2.0 g) was placed in a clean, dry reaction flask, and 20 mL of anhydrous dichloromethane was added. Compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphodiamidite (2.0 equiv, 4.4 mmol, 1.3 g) and 4,5-dicyanoimidazole (1.5 equiv, 3.3 mmol, 0.38 g) were added at room temperature under argon protection, and the mixture was stirred for 1 hour at room temperature. After the reaction, 20 mL of dichloromethane was added to the reaction mixture, washed with 50 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered, and concentrated. The crude product obtained was fractionated using a C18 reversed-phase column (specifications: 30 μm; 100 Å, commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O = 75%:25%) to obtain the white solid I-1-8 (1.1 g, 1.0 mmol, yield 45%). Molecular formula of compound I-1-8: C 58 H 82 O 15 N5P, molecular weight: 1119.5, LC-MS measured value: 1118.4 (MH). 1 H NMR (400 MHz, DMSO-d6): δ 7.83 (d, J = 9.2 Hz, 1H), 7.36 (d, J = 7.3 Hz, 2H), 7.31 (dd, J = 9.2, 6.0 Hz, 2H), 7.22 (d, J = 8.6 Hz, 5H), 6.88 (dd, J = 8.8, 1.5 Hz, 4H), 5.21 (d, J = 3.2 Hz, 1H), 4.97 (dd, J = 11.3, 3.3 Hz, 1H), 4.48 (d, J = 8.4 Hz, 1H), 4.06 - 3.96 (m, 4H), 3.87 (dd, J = 20.0, 9.0 Hz, 1H), 3.73 (s, 6H), 3.72 - 3.69 (m, 2H), 3.59 - 3.52 (m, 1H), 2.81 (d, J = 6.0 Hz, 3H), 2.73 (dt, J = 9.7, 6.0 Hz, 2H), 2.09 (s, 3H), 2.07 - 2.03 (m, 2H), 1.99 - 1.98 (m, 4H), 1.88 (d, J = 5.1 Hz, 4H), 1.77 (s, 3H), 1.69 - 1.59 (m, 2H), 1.48 - 1.40 (m, 5H), 1.23 - 1.11 (m, 12H). 31 P NMR (162 MHz, DMSO-d6): δ 146.45.

[0238] Example 7: Preparation of Compound I-1-13

[0239] [ka]

[0240] Based on the synthesis method of Example 2, I-1-13 was prepared as a white solid from the starting material N-benzyloxycarbonyl-DL-serine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (2.32 g, 2.1 mmol, yield 81%). Molecular formula of compound I-1-13: C 56 H 76 O 15 N6P, molecular weight: 1105.5, LC-MS measured value: 1128.6 (M+Na). 1 H NMR (400 MHz, DMSO-d6): δ 8.09 - 8.03 (m, 1H), 7.75 (dd, J = 9.1, 2.0 Hz, 1H), 7.32 - 7.25 (m, 4H), 7.17 (ddd, J = 13.7, 8.2, 2.3 Hz, 5H), 6.85 (d, J = 7.5 Hz, 4H), 5.18 (d, J = 3.3 Hz, 1H), 4.94 (dd, J = 11.2, 3.0 Hz, 1H), 4.83 - 4.72 (m, 1H), 4.49 - 4.43 (m, 2H), 4.01 - 3.95 (m, 3H), 3.88 - 3.80 (m, 1H), 3.71 (s, 6H), 3.67 - 3.44 (m, 6H), 3.36 (t, J = 11.7 Hz, 2H), 3.28 (d, J = 4.1 Hz, 1H), 3.16 (qd, J = 8.7, 3.8 Hz, 1H), 2.99 (dt, J = 19.9, 6.8 Hz, 1H), 2.75 - 2.67 (m, 1H), 2.57 (td, J = 5.8, 1.8 Hz, 1H), 2.06 (s, 5H), 1.95 (s, 4H), 1.86 (s, 3H), 1.70 (s, 3H), 1.41 (s, 3H), 1.16 - 0.96 (m, 16H). 31 P NMR (162 MHz, DMSO-d6): δ 147.08, 146.82, 146.78, 146.64.

[0241] Example 8: Preparation of Compound I-1-15

[0242] [ka]

[0243] Based on the synthesis method of Example 2, I-1-15 was prepared as a white solid from the starting materials N-benzyl-4-hydroxypiperidine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) and N-benzyloxycarbonyl-DL-serine (commercially available, purchased from Shanghai Taitan Technology Co., Ltd.) (2.1 g, 1.88 mmol, yield 78%). Molecular formula of compound I-1-15: C 57 H 78 O 15 N6P, molecular weight: 1119.5, LC-MS measured value: 1142.6 (M+Na). 1H NMR (400 MHz, DMSO-d6): δ 8.10 - 8.05 (m, 1H), 7.76 (d, J = 9.2 Hz, 1H), 7.32 (d, J = 7.6 Hz, 2H), 7.25 (t, J = 7.6 Hz, 2H), 7.18 (d, J = 7.5 Hz, 5H), 6.84 (d, J = 7.8 Hz, 4H), 5.18 (d, J = 3.3 Hz, 1H), 4.98 - 4.92 (m, 2H), 4.45 (d, J = 8.4 Hz, 1H), 4.01 - 3.95 (m, 4H), 3.84 (dd, J = 19.8, 8.9 Hz, 1H), 3.70 (s, 6H), 3.69 - 3.63 (m, 3H), 3.59 - 3.50 (m, 2H), 3.34 (dd, J = 11.9, 7.7 Hz, 2H), 3.28 (d, J = 1.6 Hz, 1H), 3.16 (t, J = 7.2 Hz, 2H), 2.73 - 2.70 (m, 2H), 2.11 - 2.03 (m, 5H), 1.95 (s, 3H), 1.86 (s, 3H), 1.72 (s, 4H), 1.43 (s, 6H), 1.12 - 1.09 (m, 15H). 31 P NMR (162 MHz, DMSO-d6): δ 145.56, 145.49, 145.46, 145.39.

[0244] Example 9 Production of siRNA コンジュゲートの

[0245] Using the solid-phase phosphoramidite method, the specially modified compounds produced in the above process and commercially purchased conventionally modified monomers (phosphoamidite monomers for synthetically modified nucleosides dT, Am, Cm, Gm, Um, Af, Cf, Gf, and Uf were all purchased from Shanghai Zhaowei Technology Development Co., Ltd.) were used to sequentially bond the nucleoside monomers in the 3'→5' direction according to the nucleotide sequence order. Here, the specially modified off-target prevention compound was placed in the seed region of the antisense chain (any position between 4 and 8 from the 5' end), and the delivery monomer compound was freely positioned at the 3' or 5' end as a conventional monomer. The bonding of each nucleoside monomer involved four reaction steps: deprotection, coupling, capping, and oxidation or sulfidation. Synthetic conditions for both the sense and antisense chains were employed. Instrument model: MerMade 12 Oligonucleotide synthesizer solid-phase synthesis system, Beijing Haijing 6 mL synthesis column, Cytiva Source™ 15Q 4.6 / 100PE purification column. The reagents used for synthesizing the siRNA conjugates were purchased from Suzhou Kerema Biotechnology Co., Ltd.

[0246] The synthesis outline is as follows: The single-chain synthesis reaction process extends in the 3'→5' direction and is completed in a solid-phase synthesizer. It includes four main reaction steps: a. DMTr removal reaction: The protecting group DMTr on the nucleoside is removed using dichloroacetic acid to obtain the 5'-hydroxy terminus. b. Coupling reaction: The protected nucleoside phosphoramidite monomer is mixed with the activator ethylthiotetrazole to activate the phosphoramidite group. The 5'-hydroxyl group, still protected with DMTr, condenses with the 5'-hydroxyl group bound to the solid support to produce phosphite triester. c. Oxidation reaction: Under the action of iodine, an oxidizing agent, the triester phosphite obtained in the previous condensation reaction is converted into a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus). d. Sulfidation reaction: Under the action of the sulfidation reagent PADS (phenylacetyl disulfide), the phosphite triester obtained in the previous condensation reaction is converted to a phosphorothioate ester (oxidation or sulfidation is selected depending on the sequence design). e. Capping reaction: In the condensation reaction, a very small amount of unreacted 5'-hydroxy (less than 2%) may be present. Therefore, the reaction is carried out using acetic anhydride and 1-methylimidazole, and then capped with an acetate ester that cannot participate in the subsequent reaction to prevent further reaction. Such short fragments can be separated during purification. The above four steps are repeated until the desired sequence is synthesized. The main chemical equations are as follows:

[0247] After the final nucleoside monomer is attached, the nucleic acid sequence on the solid support is sequentially cleaved, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands.

[0248] Here: The conditions for cleavage and deprotection are as follows: First, an ammonia decomposition solution (a mixture of ammonia water and ethanol in a 3:1 ratio, to a volume of 2 mL) is prepared. The solid support is added to the reaction flask and shaken thoroughly to homogenize. Ammonia is decomposed in a constant temperature water bath at 50°C for 16 hours. After 16 hours of ammonia decomposition, the mixture is cooled to room temperature (25°C ± 2°C) in a water bath, filtered through a sintered glass filter, and the filtrate is collected in a round-bottom flask. The filtrate residue is washed with a 50% ethanol aqueous solution, and the filtrate is collected. It is concentrated using a rotary evaporator, transferred to a glass bottle, and a sample of the crude product is sent to the analytical department for LC-MS measurement of the crude product. The measurement method is as follows: The purity of the sense and antisense chains is measured using Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18), and the molecular weight is analyzed. The measured values ​​are in agreement with the theoretical values ​​and are shown in Table 1. The purification and desalting conditions are as follows: Purification is performed using an ion-exchange chromatography column, desalting is performed using a Cytiva HiPrep™ 26 / 10 Desalting gel column, and then the single strands are freeze-dried. After freeze-drying the single strands, it is necessary to collect samples and measure them using LC-MS. Finally, the resulting sense strand and antisense strand need to be annealed to create a double strand. The annealing procedure is as follows: The purified sense and antisense chains are dissolved in sterile water for injection, and solutions of 0.1 mg / mL to 40 mg / mL are prepared. These are mixed in equimolar ratios using Thermo Scientific Nanodrop Eight, heated at 90°C for 5 minutes, and then allowed to cool slowly to form a double-stranded structure via hydrogen bonding. Samples are taken and the SEC purity of the product is measured, as shown in Table 2. The double-stranded samples are freeze-dried.

[0249] [Table 1] [Table 2] Example 10 Activity test of siRNA conjugates in mice

[0250] We selected SPF-grade female C57BL / 6J mice aged 6-8 weeks, with a body weight of 20±2. The weight was g. Before administration, the weight of the mice was measured, their condition was observed, and animals with uniform weight and no abnormalities were randomly divided into groups of 4. The mice in the experimental group were given the conjugate subcutaneously, and the mice in the solvent group were given phosphate-buffered saline (PBS), with each mouse receiving a dose of 1 mg / kg of the conjugate subcutaneously. 2 On day 0, the animals were euthanized, liver tissue was collected, and the liver was finely chopped according to standard procedures and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was homogenized in lysis solution (Changchun Zhiang Biotechnology Co., Ltd., MNTR / FX96) (Shanghai Jingxin Industrial Development Co., Ltd., JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B), and the expression level of the target gene, complement C5 mRNA, was measured by fluorescence qPCR (Vazyme, Q711). Primers for the target gene: Forward primer: CCAGCCCAATCAAGTTCCTAGAG; Reverse primer: CGGCGTGTAAACAGGTTTGTC; Primers for the internal standard gene GAPDH: Forward primer: TGCACCACCAACTGCTTAG; Reverse primer: GATGCAGGGATGATGTTC;

[0251] The results are shown as residual expression levels in the siRNA-administered group compared to the solvent group (solvent group set to 100%), and the siRNA sequences of the conjugates used for injection are shown in Table 1. As shown in Figure 1 and Table 3, conjugate SD003974 showed comparable target gene complement C5 mRNA silencing activity to the positive conjugate SD003317. Conjugates SD004119, SD004122, and SD004125 showed significantly superior activity to the target gene complement C5 mRNA silencing activity of conjugate SD003317.

[0252] [Table 3] In the sequences mentioned above and in Table 1, each symbol is used to represent the following modified nucleosides.

[0253] A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate; dT = thymidine deoxynucleoside; Am = 2'-O-methyladenosine-3'-phosphate; Ams = 2'-O-methyladenosine-3'-phosphorothioate; Cm = 2'-O-methylcytidine-3'-phosphate; Cms = 2'-O-methylcytidine-3'-phosphorothioate; Gm = 2'-O-methylguanosine- 3'-phosphate; Gms = 2'-O-methylguanosine-3'-phosphorothioate; Um = 2'-O-methyluridine-3'-phosphate; Ums = 2'-O-methyluridine-3'-phosphorothioate; Af = 2'-fluoroadenosine-3'-phosphate; Afs = 2'-fluoroadenosine-3'-phosphorothioate; Cf = 2'-fluorocytidine-3'-phosphate; Cfs = 2'-fluorocytidine-3'-phosphorothioate; Gf = 2'-fluoroguanosine-3'-phosphate; Gfs = 2'-fluoroguanosine-3'-phosphorothioate; Uf = 2'-fluorouridine-3'-phosphate; Ufs = 2'-fluorouridine-3'-phosphorothioate

[0254] This specification discloses exemplary embodiments and uses specific terms, but these are used and described only in a general and descriptive sense and are not intended to be limiting. In some cases, as will be apparent to those skilled in the art from the time of filing this application, characteristics, features, and / or elements described in connection with a particular embodiment can be used alone or in combination with characteristics, features, and / or elements described in connection with other embodiments, unless otherwise explicitly stated. Accordingly, those skilled in the art should understand that various modifications of form and detail are possible without departing from the spirit and scope of the invention as described in the claims.

Claims

1. A compound having the structure shown in formula (I). 【Chemistry 1】 During the ceremony, A ０ k represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or a group formed by the substitution of all or part of the hydroxyl group in the ligand with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group; b is an integer in the range of 1 to 4; L １ and L ２ Each represents one or more linked combinations selected independently from the bases of formulas A1 to A11: 【Chemistry 2】 Here, j1 is an integer between 1 and 20; j2 is an integer between 1 and 20; and R' is C １ -C １０ It is an alkyl group; M represents the structural formula shown in formula (A12): 【Transformation 3】 Here, m represents an integer from 0 to 6; * represents G １ It shows a bond that connects to, Q represents the structural formula shown in equation (A13): 【Chemistry 4】 Here, it binds to O. 【Transformation 5】 is coupled to G １ shows the bond coupled to; R ２ , R ３ are the same or different and are independent of each other, and are selected from H, C １ -C ２０ alkyl group, C １ -C ２０ alkoxy group, C ２ -C ２０ alkenyl group, C ２ -C ２０ alkynyl group; Z does not exist, or C １ -C １０ Represents an alkylene group; X represents the structural formula shown in formula (A14-1) or (A14-2): 【Transformation 6】 Here, R ４ , R ５ These are identical or different, and independently of each other, H, fluoro, hydroxyl, and C. １ -C ２０ alkyl group, C １ -C ２０ Alkoxy group, C ２ -C ２０ Alkenyl group, C ２ -C ２０ Selected from alkynyl groups; p is an integer from 1 to 6; optionally, R ４ and R ５ They directly bond to form a 3-6 member saturated carbon ring group; E represents the structural formula shown in equation (A15): 【Transformation 7】 Here, 【Transformation 8】 C ３ -C １８ Cycloalkyl groups or C ３ -C １８ Represents a heterocyclic group, and R １ H, fluoro, hydroxyl group, cyano group, C １ -C ２０ alkyl group, C １ -C ２０ Alkoxy group, C ２ -C ２０ Alkenyl group, C ２ -C ２０ Selected from the alkynyl group; G １ and G ２ Each of these represents a phosphoramidite functional group or hydroxy protecting group having the structure shown in formula (G-1), and G １ and G ２ Assuming that at least one of them has the structure represented by formula (G-1), the hydroxy protecting group is one selected from the group consisting of a trityl group, a 4-methoxytrityl group, a 4,4'-dimethoxytrityl group (DMTr), and a 4,4',4''-trimethoxytrityl group; 【Chemistry 9】 Here, B １ C is either substituted or non-substituted. １ -C ５ Selected from the hydrocarbon groups; 【Chemistry 10】 This indicates the site where the group forms a covalent bond.

2. The compound according to claim 1, L １ or L ２ These are one or more linked combinations independently selected from A1, A2, A4, A6, A7, A8, A9, A10, A11; The ligands are, independently, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannopyranose, β-D-mannopyranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, and α-D-fructofuranose. S, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose , one selected from the group consisting of 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranose, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranose, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose; b is 1, 2, or 3; m is 0, 1, or 2; R ２ , R ３ H and C are independent of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; Z does not exist, or C １ -C ３ Represents an alkylene group; R ４ , R ５ These are H, fluoro, hydroxyl, and C, independently of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from alkynyl groups; p is 1, 2, or 3; 【Chemistry 11】 C ４ -C ８ Cycloalkyl groups or C ３ -C ８ Represents a heterocyclic group; and R １ H, fluoro, hydroxyl group, cyano group, C １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; B １ is a methyl group, an ethyl group or an isopropyl group; B ２ is C １ -C ５ and is any one selected from the group consisting of an alkyl group of, a cyanoethyl group, a cyanopropyl group and a cyanobutyl group The aforementioned compound.

3. The compound according to claim 2, b is either 1 or 3; 【Chemistry 12】 C ３ -C ６ Represents a heterocyclic group; A ０ This is a group formed by the substitution of all or part of an N-acetylgalactosamine (GalNAc) group or its hydroxyl group with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group: 【Chemistry 13】 ； The hydroxy protecting group is a 4,4'-dimethoxytrityl group; L １ or L ２ The length of is, independently of each other, 1 to 25 atoms, and the said L １ or L ２ The length of refers to the number of chain-forming atoms on the longest straight chain; Each j1 is an integer between 1 and 10, and each j2 is an integer between 1 and 10, independently of each other. The aforementioned compound.

4. The compound according to claim 3, 【Chemistry 14】 This represents a 4-6 member nitrogen-containing saturated cycloalkyl group; L １ or L ２ The length of each atom is 1 to 20 atoms, independently of each other; Each j1 is an integer between 1 and 8, and each j2 is an integer between 1 and 8, independently of each other. The aforementioned compound.

5. The compound according to claim 2, L １ or L ２ The compound is a combination of at least two linked elements independently selected from A1, A2, A4, A8, A9, A10, and A11.

6. The compound according to claim 2, L １ or L ２ The compound is a combination of at least two linked elements independently selected from A1, A4, A8, A10, and A11.

7. A compound according to claim 1, wherein the compound has the structure (I-1) shown below: 【Chemistry 15】 During the ceremony, L is A10 where j1 is an integer from 2 to 8, or A11 where j2 is an integer from 1 to 7. ； m is 0, 1, or 2; n is 0, 1, 2, or 3; Q represents the structural formula shown in equation (A13): 【Chemistry 16】 Here, 【Chemistry 17】 R indicates the site of the covalent bond of the group; ２ , R ３ H and C are independent of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; X represents the structural formula shown in formula (A14-1) or (A14-2): [Chemistry 18] Here, R ４ , R ５ These are H, fluoro, hydroxyl, and C, independently of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from alkynyl groups; p is 1, 2, or 3; optionally, R ４ and R ５ They directly bond to form a 3-6 member saturated carbon ring group; 【Chemistry 19】 This represents a saturated ring containing all carbon or nitrogen with 4 to 8 members. R １ H, fluoro, hydroxyl group, cyano group, C １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; Here, 【Chemistry 20】 The hydroxyl groups in the molecule are all or partially substituted with KCOO- groups, where each K is Independently, one selected from the group consisting of methyl group, trifluoromethyl group, difluoromethyl group, monofluoromethyl group, trichloromethyl group, dichloromethyl group, monochloromethyl group, ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group, and alkylphenyl group. The aforementioned compound.

8. The compound according to claim 1, 【Chemistry 21】 The compound is a 4, 5, or 6-membered saturated cycloalkyl group containing one or two nitrogen atoms.

9. The compound according to claim 1, wherein the compound is one selected from the group consisting of the following structures: 【Chemistry 22】 【Chemistry 23】

10. A nucleic acid conjugate comprising one or more structures represented by formula (II) bound to any position on an oligonucleotide sequence: 【Chemistry 24】 During the ceremony, R ｐ and R ｑ Each has a structure represented by H or formula A16, and R ｐ and R ｑ Assuming that at least one of them has the structure shown in formula A16; 【Chemistry 25】 Here, 【Chemistry 26】 The symbol indicates the site of the covalent bond of the group; E １ is OH, SH, or BH ２ And, A ０ k represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or a group formed by the substitution of all or part of the hydroxyl group in the ligand with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group; b is an integer in the range of 1 to 4; L １ and L ２ Each represents one or more linked combinations selected independently from the bases of formulas A1 to A11: 【Chemistry 27】 Here, j1 is an integer between 1 and 20; j2 is an integer between 1 and 20; and R' is C １ -C １０ It is an alkyl group; M represents the structural formula shown in formula (A12): 【Chemistry 28】 Here, 【Chemistry 29】 indicates the covalent bond site of the base; m represents an integer from 0 to 6; and * represents R ｐ It shows a bond that connects to, Q represents the structural formula shown in equation (A13): 【Transformation 30】 Here, 【Chemistry 31】 The symbol indicates the covalent bond site of the group, and is bonded to O. 【Chemistry 32】 is R ｐ It shows a bond that connects to; R ２ , R ３ H and C are identical or different and independent of each other. １ -C ２０ alkyl group, C １ -C ２０ Alkoxy group, C ２ -C ２０ Alkenyl group, C ２ -C ２０ Selected from alkynyl groups, preferably H, C １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ It is an alkynyl group; Z does not exist, or C １ -C １０ Represents an alkylene group; X represents the structural formula shown in formula (A14-1) or (A14-2): 【Transformation 33】 Here, R ４ , R ５ These are identical or different, and independently of each other, H, fluoro, hydroxyl, and C. １ -C ２０ alkyl group, C １ -C ２０ Alkoxy group, C ２ -C ２０ Alkenyl group, C ２ -C ２０ Selected from alkynyl groups, preferably H, fluoro, hydroxyl, and C groups. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ It is an alkynyl group; p is an integer from 1 to 6; arbitrarily, R ４ and R ５ They directly bond to form a 3-6 member saturated carbon ring group; E represents the structural formula shown in equation (A15): 【Transformation 34】 Here, 【Chemistry 35】 The symbol indicates the site of the covalent bond of the group; 【Transformation 36】 C ３ -C １８ Cycloalkyl groups or C ３ -C １８ Represents a heterocyclic group, and R １ H, fluoro, hydroxyl group, cyano group, C １ -C ２０ alkyl group, C １ -C ２０ Alkoxy group, C ２ -C ２０ Alkenyl group, C ２ -C ２０ Selected from alkynyl groups, The aforementioned nucleic acid conjugate.

11. A nucleic acid conjugate according to claim 10, wherein the conjugate includes one or more structures represented by formula (II-A) bound to any position on an oligonucleotide sequence. 【Chemistry 37】 During the ceremony, a represents an integer from 0 to 7; The structure of W is shown by the following equation: 【Transformation 38】 Here, 【Chemistry 39】 indicates the site of the covalent bond of the group; E １ is OH, SH, or BH ２ That is the case.

12. The nucleic acid conjugate according to claim 11, wherein a represents an integer of 0, 1, 2, or 3.

13. A nucleic acid conjugate according to claim 10 or 11, L １ or L ２ These are one or more linked combinations independently selected from A1, A2, A4, A6, A7, A8, A9, A10, A11; The ligands are, independently, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannopyranose, β-D-mannopyranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranoose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-gluco One selected from the group consisting of pyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranoside, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose; b is 1, 2, or 3; m is 0, 1, or 2; R ２ , R ３ H and C are independent of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; Z does not exist, or C １ -C ３ Represents an alkylene group; R ４ , R ５ These are H, fluoro, hydroxyl, and C, independently of each other. １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from alkynyl groups; p is 1, 2, or 3; 【Chemistry 40】 C ４ -C ８ Cycloalkyl groups or C ３ -C ８ Represents a heterocyclic group; and R １ H, fluoro, hydroxyl group, cyano group, C １ -C ６ alkyl group, C １ -C ６ Alkoxy group, C ２ -C ６ Alkenyl group, C ２ -C ６ Selected from the alkynyl group; B １ is a methyl group, an ethyl group, or an isopropyl group; B ２ C １ -C ５ It is one selected from the group consisting of alkyl groups, cyanoethyl groups, cyanopropyl groups, and cyanobutyl groups. The aforementioned nucleic acid conjugate.

14. A nucleic acid conjugate according to claim 13, b is either 1 or 3; 【Chemistry 41】 C ３ -C ６ Represents a heterocyclic group; A ０ This is a group formed by the substitution of all or part of an N-acetylgalactosamine (GalNAc) group or its hydroxyl group with a KCOO- group, where each K is independently selected from the group consisting of a methyl group, a trifluoromethyl group, a difluoromethyl group, a monofluoromethyl group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group: 【Chemistry 42】 ； The hydroxy protecting group is a 4,4'-dimethoxytrityl group; L １ or L ２ The length of each atom is 1 to 25 atoms, and the L １ or L ２ The length refers to the number of chain-forming atoms on the longest straight chain; Each j1 is an integer between 1 and 10, and each j2 is an integer between 1 and 10, independently of each other. The aforementioned nucleic acid conjugate.

15. A nucleic acid conjugate according to claim 14, 【Chemistry 43】 This represents a 4-6 member nitrogen-containing saturated cycloalkyl group; L １ or L ２ The length of each atom is 1 to 20 atoms, independently of each other; Each j1 is an integer between 1 and 8, and each j2 is an integer between 1 and 8, independently of each other. The aforementioned nucleic acid conjugate.

16. A nucleic acid conjugate according to claim 10 or 11, wherein L １ or L ２ The nucleic acid conjugate is a combination of at least two linked elements independently selected from A1, A2, A4, A8, A9, and A10.

17. A nucleic acid conjugate according to claim 10 or 11, wherein L １ or L ２ The nucleic acid conjugate is a combination of at least two linked elements selected independently from A1, A4, A8, and A10.

18. A nucleic acid conjugate according to claim 10 or 11, wherein the nucleic acid conjugate is one selected from the group consisting of the structures shown below: 【Chemistry 44】 【Chemistry 45】 【Chemistry 46】 【Chemistry 47】 【Chemistry 48】 【Chemistry 49】

19. A nucleic acid conjugate according to claim 10 or 11, The oligonucleotide is one selected from the group consisting of small interfering RNA, microRNA, antimicroRNA, microRNA antagonist, microRNA mime, decoy oligonucleotide, immunostimulant, G quadruplex, variable splicing, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; The oligonucleotide may optionally be a single-stranded oligonucleotide or a double-stranded oligonucleotide; Optionally, the oligonucleotide is a single-stranded oligonucleotide, and the P atom in formula (A16) is bound to the terminal end of the single-stranded oligonucleotide, where the terminal end refers to the first four nucleotides counted from one end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is bound to the terminal end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is bound to the 3' end of the single-stranded oligonucleotide; Optionally, the oligonucleotide is a double-stranded oligonucleotide comprising a sense strand and an antisense strand, the P atom in formula (A16) is bonded to the terminal portion of the double-stranded oligonucleotide, the terminal portion of the double-stranded oligonucleotide being the first four nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is bonded to the terminal portion of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is bonded to the 5' end of the antisense strand; optionally, the P atom in formula (A16) is bonded to the 2', 3', or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphate diester bond. The aforementioned nucleic acid conjugate.

20. The nucleic acid conjugate according to claim 19, wherein the double-stranded oligonucleotide is siRNA.

21. A method for producing a nucleic acid conjugate according to any one of claims 10 to 20, comprising oxidizing a phosphoramidite functional group in a compound of formula (I) according to claims 1 to 9 to a structure represented by formula (W), then binding it with an oligonucleotide, and further cleaving and deprotecting it to obtain the conjugate. [Transformation 50] During the ceremony, 【Chemistry 51】 indicates the site of the covalent bond of the group; E １ is OH, SH, or BH ２ That is the case.

22. A pharmaceutical product for treating and / or preventing liver-derived diseases, comprising a nucleic acid conjugate according to any one of claims 10 to 20.

23. A therapeutic agent for treating a pathological condition or disease caused by gene expression in hepatocytes, comprising a nucleic acid conjugate according to any one of claims 10 to 20.

24. A kit comprising a nucleic acid conjugate according to any one of claims 10 to 20.

Images