Use of glycerides for LNP formulations
Lipid nanoparticle compositions with ionized, glyceride, structural, helper, and stealth lipids enhance nucleic acid delivery by improving stability and permeability, leading to increased protein expression.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- サノフィ ワクチンズ ユーエス インコーポレイテッド
- Filing Date
- 2024-06-28
- Publication Date
- 2026-07-21
AI Technical Summary
The efficient targeted delivery of biologically active substances, such as nucleic acid molecules, is hindered by low in vivo stability and poor cell permeability, necessitating improved lipid nanoparticle formulations.
Lipid nanoparticle compositions comprising ionized lipids, glycerides or acyl glycols, structural lipids, helper lipids, and stealth lipids are developed to enhance delivery efficacy.
The addition of glycerides or acyl glycols to LNP formulations significantly improves mRNA delivery efficiency, increasing protein expression compared to formulations without them.
Smart Images

Figure 2026524174000001 
Figure 2026524174000002 
Figure 2026524174000003
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to European Patent Application No. 23306047.4, filed on 28 June 2023, the disclosure of which is incorporated herein by reference in its entirety. [Background technology]
[0002] The efficient targeted delivery of biologically active substances, such as nucleic acid molecules (e.g., mRNA), remains an ongoing medical challenge. In particular, the delivery of nucleic acids to cells is difficult due to their low in vivo stability, rapid degradation tendency, and poor cell permeability. Therefore, there is a need to develop methods and compositions that facilitate the delivery of therapeutic and / or prophylactic agents, such as nucleic acids, to cells. [Overview of the initiative] [Problems that the invention aims to solve]
[0003] Lipid-containing nanoparticle compositions have proven effective as transport vehicles for biologically active substances such as low-molecular-weight drugs, proteins, and nucleic acids into cells and / or intracellular compartments. Such compositions generally include phospholipids containing one or more ionized (e.g., cationic) lipids, polyunsaturated lipids, cholesterol-based lipids, and / or lipids containing polyethylene glycol (PEGylated lipids). While various such lipid-containing nanoparticle compositions have been demonstrated, there is still a need for lipid nanoparticle formulations with improved efficacy. [Means for solving the problem]
[0004] This disclosure provides, in particular, compositions comprising lipid nanoparticles (LNPs), the LNPs comprising (I) an ionized lipid, (II) a glyceride or acyl glycol, and (III) one or more lipids selected from the group consisting of (a) structural lipids, (b) helper lipids, and (c) stealth lipids.
[0005] In some embodiments, the LNP comprises (I) an ionized lipid, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0006] In some embodiments, the LNP comprises (I) an ionized lipid, (II) a glyceride or acyl glycol having a structure according to formula I or formula II as defined herein, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0007] This disclosure further provides compositions comprising lipid nanoparticles (LNPs), the LNPs comprising (I) an ionized lipid having a structure according to formula CAT-I or CAT-II as defined herein, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a stealth lipid, and (V) a helper lipid.
[0008] In some embodiments, the LNP comprises (I) an ionized lipid having a structure according to formula CAT-I or CAT-II as defined herein, (II) a glyceride or acyl glycol having a structure according to formula I or II as defined herein, (III) a structural lipid, (IV) a stealth lipid, and (V) a helper lipid.
[0009] This disclosure further provides LNPs described herein, further comprising a nucleic acid molecule, the nucleic acid molecule being encapsulated within the LNP. In some embodiments, the nucleic acid molecule is an mRNA molecule.
[0010] This disclosure further discloses a method for preventing infection or reducing one or more symptoms of infection, comprising administering to a subject, optionally, an effective dose of one of the compositions described herein, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally.
[0011] This disclosure further provides the use of the compositions described herein for the manufacture of pharmaceuticals for treating subjects in need of treatment.
[0012] This disclosure further provides a kit comprising a container containing a single-use or multi-use dose of the composition described herein, the container optionally being a vial or a pre-filled syringe or injector. [Modes for carrying out the invention]
[0013] This disclosure provides lipid nanoparticle (LNP) formulations for delivering cargo, such as nucleic acid molecules (e.g., mRNA), to target cells. In particular, the LNPs of this disclosure comprise an ionized lipid, a glyceride or acyl glycol, and at least one of a structural lipid, a helper lipid, and a stealth lipid (e.g., PEGylated). In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, a structural lipid, a helper lipid, and a stealth lipid.
[0014] It has been found that the addition of glycerides or acyl glycols to LNP formulations can improve mRNA delivery efficiency, thereby increasing the expression of proteins encoded by nucleic acid molecules compared to LNP formulations that do not contain glycerides or acyl glycols. For example, LNP formulations of this disclosure containing hEPO mRNA were found to significantly improve protein expression compared to control formulations.
[0015] definition In this specification, unless otherwise defined, scientific and technical terms used in this application shall have the meanings generally understood by those skilled in the art.
[0016] As used herein and in the claims, the term “contains” may include embodiments of “consisting of” and “essentially consisting of.” As used herein, “contains,” “includes,” “has,” “has,” “can,” “contains,” and their variations are intended to be open-ended transitional phrases, terms, or words that require the presence of a named component / step and allow the presence of other components / steps. However, such descriptions should also be interpreted as describing a composition or process as “consisting of” and “essentially consisting of” the enumerated components / steps, thereby implying that only the named component / step exists and other components / steps are excluded.
[0017] As used herein, the terms “approximately” or “about” refer to values that are similar to the stated reference values when applied to the values of one or more subjects. In certain embodiments, unless otherwise specified or evident from the context, the terms “approximately” or “about” refer to values that fall within a range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction of the stated reference value (unless such numbers exceed 100% of the possible values).
[0018] As used herein, the term “delivery” encompasses both local and systemic delivery. For example, mRNA delivery includes situations where mRNA is delivered to a target tissue, the encoded protein is expressed, and retained within the target tissue (also referred to as “local distribution” or “local delivery”) and situations where mRNA is delivered to a target tissue, the encoded protein is expressed, secreted into the patient’s circulatory system (e.g., serum), systematically distributed, and absorbed by other tissues (also referred to as “systemic distribution” or “systemic delivery”).
[0019] As used herein, “expression” of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides (e.g., the heavy or light chains of an antibody) into an intact protein (e.g., an antibody), and / or post-translational modification of polypeptides or fully constructed proteins (e.g., antibodies). Herein, the terms “expression” and “production,” as well as their grammatical synonyms, are used interchangeably.
[0020] As used herein, a “functional” biomolecule is a biomolecule in which it exhibits the properties and / or activity that characterize it.
[0021] As used herein, the term “half-life” refers to the time required for a quantity, such as the concentration or activity of a nucleic acid or protein, to decrease to half of its value as initially measured over a period of time.
[0022] As used herein, the terms “improve,” “increase,” or “decrease,” or their grammatical synonyms, refer to relative values to baseline measurements, such as measurements in the same individual before the initiation of the treatment described herein, or measurements in a control subject (or multiple control subjects) that did not receive the treatment described herein. A “control subject” is a subject suffering from the same form of disease as the subject receiving treatment and being of approximately the same age as the subject receiving treatment.
[0023] As used herein, the term "in vitro" refers to events occurring in an artificial environment, such as a test tube or reaction vessel, or in a cell culture, rather than within a multicellular organism.
[0024] As used herein, the term "in vivo" refers to events occurring within multicellular organisms such as humans and non-human animals. In relation to cell-based systems, the term may be used to refer to events occurring within living cells (as opposed to, for example, in vitro systems).
[0025] As used herein, the terms “local distribution,” “local delivery,” or grammatical synonyms refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires a protein (e.g., an enzyme) that is encoded by mRNA that is translated and expressed within a cell, or has limited secretion that avoids entry into the patient’s circulatory system.
[0026] As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide encoding at least one polypeptide. As used herein, mRNA encompasses modified and unmodified RNA therapies. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, optionally purified, and chemically synthesized. Where appropriate, for example, in chemically synthesized molecules, mRNA may contain nucleoside analogs, such as analogs with chemically modified bases or sugars, or skeletal modifications. mRNA sequences are presented in a 5' to 3' manner unless otherwise specified. In some embodiments, mRNA is a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine), a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-amino Adenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose) and / or modified phosphate groups (e.g., phosphorothioate bonds and 5'-N-phosphoamidite bonds), or comprising the same.
[0027] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. These non-standard nucleotide residues may include, for example, 5-methylcytidine ("5mC"), pseudouridine ("ψU"), and / or 2-thiouridine ("2sU"). For a discussion of such residues and their incorporation into mRNA, see, for example, U.S. Patent No. 8,278,036 and International Publication No. 2011012316. The mRNA may be defined as RNA in which 25% of the U residues are 2-thiouridine and 25% of the C residues are 5-methylcytidine. Teachings relating to the use of RNA are disclosed in U.S. Patent Application Publication No. 20120195936 and International Publication No. 2011012316, both of which are incorporated herein by reference in their entirety. The presence of non-standard nucleotide residues can make mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, mRNA may contain one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurinecytosine, as well as combinations of these modifications and other nucleic acid base modifications. Certain embodiments may further include additional modifications to the furanose ring or nucleic acid bases. Additional modifications may include, for example, sugar modifications or substitutions (e.g., 2'-O-alkyl modifications, one or more locked nucleic acids (LNAs)). In some embodiments, RNA may form complexes or hybridize with additional polynucleotides and / or peptide polynucleotides (PNAs). In embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications may include, but are not limited to, 2'-deoxy-2'-fluoro modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, and 2'-deoxy modification.In certain embodiments, any of these modifications may be present in 0 to 100% of the nucleotide, for example individually or in combination, in amounts exceeding 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or 100% of the component nucleotide.
[0028] As used herein, the term “nucleic acid” in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain by phosphate diester bonds. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” includes RNA and single-stranded and / or double-stranded DNA and / or cDNA.
[0029] Where used herein, the term "pharmaceutically acceptable" means a substance that, within the bounds of reliable medical judgment, is suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, commensurate with a reasonable risk-benefit ratio.
[0030] As used herein, the terms “whole-body distribution” and “whole-body delivery” or their grammatical synonyms refer to a mechanism or method of delivery or distribution that affects the entire body or organs. Typically, whole-body distribution or delivery is achieved through the body’s circulatory system, such as blood flow. This is in comparison to the definition of “local distribution or delivery.”
[0031] As used herein, the term “subject” means a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human being. The subject may be a patient, referring to a person who visits a healthcare provider for the diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” The subject may be a person suffering from or susceptible to a disease or disorder, the symptoms of which may or may not be present.
[0032] As used herein, the term “substantially” refers to a qualitative state indicating the overall or nearly overall degree or extent of the feature or characteristic of the subject. Those skilled in the biological art will understand that it is extremely rare, if at all, for biological and chemical phenomena to proceed to completion and / or completeness, or to achieve or avoid absolute results. Therefore, the term “substantially” is used herein to capture the possibility of a lack of completeness inherent in many biological and chemical phenomena.
[0033] As used herein, the term “target tissue” refers to any tissue affected by the disease to be treated. In some embodiments, the target tissue includes tissue exhibiting a pathological condition, symptom, or feature associated with the disease.
[0034] As used herein, the term “therapeutic dose” of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition when administered to a subject who is suffering from or susceptible to such disease, disorder, and / or condition. It will be understood by those skilled in the art that a therapeutic dose is typically administered in a dose-setting regimen containing at least one unit dose.
[0035] As used herein, the terms “treatment” or “to treat” are defined as the application or administration of a therapeutic agent to a patient having or potentially developing any of the disorders or diseases described herein, or to tissues or cell lines isolated from such patients (e.g., for diagnostic or ex vivo uses), the purpose of which the application or administration is to treat, cure, alleviate, mitigate, modify, improve, enhance, or influence the disease or disorder or its symptoms. Such treatments may be specifically adapted or modified based on knowledge derived from the field of pharmacogenomics.
[0036] As used herein, the terms “prevent” or “prevention” mean that, if a disability or disease has not occurred, it will not develop, or, if a disability or disease has already developed, it will not progress further. The ability to prevent some or all of the symptoms associated with the disability or disease will also be considered.
[0037] The definitions of specific functional groups and chemical terms are explained in more detail below.
[0038] The compounds described herein may contain one or more asymmetric centers and thus may exist in various isomeric forms, such as enantiomers and / or diastereomers. For example, the compounds described herein may be in the form of individual enantiomers, diastereomers or geometric isomers, or in the form of mixtures of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomers. Isomers can be isolated from the mixture by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or the preferred isomers can be prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers. Racemates and Resolutions (Wiley Interscience, New York, 1981), Wilen et al., Tetrahedron 33:2725 (1977), Eliel, E.L. Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962) and Wilen, S.H. Tables of Resolving Agents and Optical Resolutions p.268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, Ind. 1972). The present invention further contemplates the compounds as individual isomers substantially free of other isomers, or alternatively as mixtures of various isomers.
[0039] When ranges of values are recited, it is intended to include each value and subrange within the range. For example, "C1-6 alkyl" includes C1, C2, C3, C4, C5, C6, C 1~6 , C 1~5 , C 1~4 , C 1~3 , C 1~2 , C 2~6 , C 2~5 , C 2~4 , C 2~3 , C 3~6 , C 3~5 , C 3~4 , C 4~6 , C 4~5 and C 5~6It is intended to include alkyl groups.
[0040] As used herein, “alkyl” refers to a linear or branched saturated hydrocarbon group having 1 to 50 carbon atoms (“C1-50 alkyl”). In some embodiments, the alkyl group has 1 to 40 carbon atoms (“C1-40 alkyl”). In some embodiments, the alkyl group has 1 to 30 carbon atoms (“C1-30 alkyl”). In some embodiments, the alkyl group has 1 to 20 carbon atoms (“C1-20 alkyl”). In some embodiments, the alkyl group has 1 to 10 carbon atoms (“C1-10 alkyl”). In some embodiments, the alkyl group has 1 to 9 carbon atoms (“C1-9 alkyl”). In some embodiments, the alkyl group has 1 to 8 carbon atoms (“C1-8 alkyl”). In some embodiments, the alkyl group has 1 to 7 carbon atoms (“C1-7 alkyl”). In some embodiments, the alkyl group has 1 to 6 carbon atoms (“C1-6 alkyl”). In some embodiments, the alkyl group has 1 to 5 carbon atoms (“C1-5 alkyl”). In some embodiments, the alkyl group has 1 to 4 carbon atoms ("C1-4 alkyl"). In some embodiments, the alkyl group has 1 to 3 carbon atoms ("C1-3 alkyl"). In some embodiments, the alkyl group has 1 to 2 carbon atoms ("C1-2 alkyl"). In some embodiments, the alkyl group has 1 carbon atom ("C1 alkyl"). In some embodiments, the alkyl group has 2 to 6 carbon atoms ("C2-6 alkyl"). Examples of C1-6 alkyl groups include, but are not limited to, methyl (C1), ethyl (C2), n-propyl (C3), isopropyl (C3), n-butyl (C4), tert-butyl (C4), sec-butyl (C4), iso-butyl (C4), n-pentyl (C5), 3-pentanyl (C5), amyl (C5), neopentyl (C5), 3-methyl-2-butanyl (C5), tert-amyl (C5), and n-hexyl (C6). Further examples of alkyl groups include n-heptyl (C7) and n-octyl (C8).Unless otherwise specified, each example of an alkyl group is either unsubstituted ("unsubstituted alkyl") or substituted with one or more substituents ("substituted alkyl"). In certain embodiments, the alkyl group is an unsubstituted C1-50 alkyl group. In certain embodiments, the alkyl group is a substituted C1-50 alkyl group.
[0041] As used herein, “heteroalkyl” means an alkyl group as defined herein, further comprising one or more heteroatoms selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) located within the parent chain (i.e., inserted between adjacent carbon atoms of the parent chain) and / or positioned at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkyl group means a saturated group having 1 to 50 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-50alkyl"). In certain embodiments, a heteroalkyl group means a saturated group having 1 to 40 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-40alkyl"). In certain embodiments, a heteroalkyl group means a saturated group having 1 to 30 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-30alkyl"). In certain embodiments, a heteroalkyl group means a saturated group having 1 to 20 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-20alkyl"). In certain embodiments, a heteroalkyl group refers to a saturated group having 1 to 10 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-10alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 1 to 9 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-9alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 1 to 8 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-8alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 1 to 7 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-7alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 1 to 6 carbon atoms and one or more heteroatoms in the parent chain ("heteroC1-6alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 1 to 5 carbon atoms and one or two heteroatoms in the parent chain ("heteroC1-5alkyl"). In some embodiments, the heteroalkyl group is a saturated group ("heteroC1-4alkyl") having 1 to 4 carbon atoms and 1 or 2 heteroatoms in the parent chain.In some embodiments, the heteroalkyl group is a saturated group having 1 to 3 carbon atoms and 1 heteroatom in the parent chain ("heteroC1-3 alkyl"). In some embodiments, the heteroalkyl group is a saturated group having 1 to 2 carbon atoms and 1 heteroatom in the parent chain ("heteroC1-2 alkyl"). In some embodiments, the heteroalkyl group is a saturated group having 1 carbon atom and 1 heteroatom ("heteroC1 alkyl"). In some embodiments, the heteroalkyl group is a saturated group having 2 to 6 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC2-6 alkyl"). Unless otherwise specified, each example of a heteroalkyl group is independently either unsubstituted ("unsubstituted heteroalkyl") or substituted with one or more substituents ("substituted heteroalkyl"). In certain embodiments, the heteroalkyl group is an unsubstituted heteroC1-50 alkyl. In certain embodiments, the heteroalkyl group is a substituted heteroC1-50 alkyl.
[0042] As used herein, “alkenyl” refers to a radical of a linear or branched hydrocarbon group having 2 to 50 carbon atoms and one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double bonds) ("C2-50 alkenyl"). In some embodiments, the alkenyl group has 2 to 40 carbon atoms ("C2-40 alkenyl"). In some embodiments, the alkenyl group has 2 to 30 carbon atoms ("C2-30 alkenyl"). In some embodiments, the alkenyl group has 2 to 20 carbon atoms ("C2-20 alkenyl"). In some embodiments, the alkenyl group has 2 to 10 carbon atoms ("C2-10 alkenyl"). In some embodiments, the alkenyl group has 2 to 9 carbon atoms ("C2-9 alkenyl"). In some embodiments, the alkenyl group has 2 to 8 carbon atoms ("C2-8 alkenyl"). In some embodiments, the alkenyl group has 2 to 7 carbon atoms ("C2-7 alkenyl"). In some embodiments, the alkenyl group has 2 to 6 carbon atoms ("C2-6 alkenyl"). In some embodiments, the alkenyl group has 2 to 5 carbon atoms ("C2-5 alkenyl"). In some embodiments, the alkenyl group has 2 to 4 carbon atoms ("C2-4 alkenyl"). In some embodiments, the alkenyl group has 2 to 3 carbon atoms ("C2-3 alkenyl"). In some embodiments, the alkenyl group has 2 carbon atoms ("C2 alkenyl"). One or more carbon-carbon double bonds may be internal (e.g., in 2-butenyl) or terminal (e.g., in 1-butenyl). Examples of C2-4 alkenyl groups include, but are not limited to, ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), and butadienyl (C4). Examples of C2-6 alkenyl groups include the aforementioned C2-4 alkenyl groups, as well as pentenyl (C5), pentadienyl (C5), and hexenyl (C6). Further examples of alkenyls include heptenyl (C7), octenyl (C8), and octatrienyl (C8).Unless otherwise specified, each example of an alkenyl group is either unsubstituted ("unsubstituted alkenyl") or substituted with one or more substituents ("substituted alkenyl"). In certain embodiments, the alkenyl group is an unsubstituted C2-50 alkenyl. In certain embodiments, the alkenyl group is a substituted C2-50 alkenyl.
[0043] As used herein, “heteroalkenyl” means an alkenyl group as defined herein, further comprising at least one heteroatom selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) located within the parent chain (i.e., inserted between adjacent carbon atoms of the parent chain) and / or at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkenyl group means a group having 2 to 50 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-50 alkenyl"). In certain embodiments, a heteroalkenyl group means a group having 2 to 40 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-40 alkenyl"). In certain embodiments, a heteroalkenyl group means a group having 2 to 30 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-30 alkenyl"). In certain embodiments, a heteroalkenyl group refers to a group having 2 to 20 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-20 alkenyl"). In certain embodiments, a heteroalkenyl group refers to a group having 2 to 10 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-10 alkenyl"). In some embodiments, a heteroalkenyl group has 2 to 9 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-9 alkenyl"). In some embodiments, a heteroalkenyl group has 2 to 8 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-8 alkenyl"). In some embodiments, a heteroalkenyl group has 2 to 7 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C2-7 alkenyl"). In some embodiments, the heteroalkenyl group has 2 to 6 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("heteroC2-6 alkenyl").In some embodiments, the heteroalkenyl group has 2 to 5 carbon atoms, at least one double bond, and one or two heteroatoms in the parent chain ("hetero C2-5 alkenyl"). In some embodiments, the heteroalkenyl group has 2 to 4 carbon atoms, at least one double bond, and two heteroatoms in the parent chain ("hetero C2-4 alkenyl"). In some embodiments, the heteroalkenyl group has 2 to 3 carbon atoms, at least one double bond, and one heteroatom in the parent chain ("hetero C2-3 alkenyl"). In some embodiments, the heteroalkenyl group has 2 to 6 carbon atoms, at least one double bond, and one or two heteroatoms in the parent chain ("hetero C2-6 alkenyl"). Unless otherwise specified, each example of a heteroalkenyl group is independently either unsubstituted ("unsubstituted heteroalkenyl") or substituted with one or more substituents ("substituted heteroalkenyl"). In certain embodiments, the heteroalkenyl group is an unsubstituted hetero C2-50 alkenyl. In certain embodiments, the heteroalkenyl group is a substituted hetero C2-50 alkenyl.
[0044] As used herein, “alkynyl” refers to a radical of a linear or branched hydrocarbon group having 2 to 50 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds) and optionally one or more double bonds (e.g., 1, 2, 3, or 4 double bonds) ("C2-50 alkynyl"). An alkynyl group having one or more triple bonds and one or more double bonds is also referred to as “en-yne”. In some embodiments, the alkynyl group has 2 to 40 carbon atoms ("C2-40 alkynyl"). In some embodiments, the alkynyl group has 2 to 30 carbon atoms ("C2-30 alkynyl"). In some embodiments, the alkynyl group has 2 to 20 carbon atoms ("C2-20 alkynyl"). In some embodiments, the alkynyl group has 2 to 10 carbon atoms ("C2-10 alkynyl"). In some embodiments, the alkynyl group has 2 to 9 carbon atoms ("C2-9 alkynyl"). In some embodiments, the alkynyl group has 2 to 8 carbon atoms ("C2-8 alkynyl"). In some embodiments, the alkynyl group has 2 to 7 carbon atoms ("C2-7 alkynyl"). In some embodiments, the alkynyl group has 2 to 6 carbon atoms ("C2-6 alkynyl"). In some embodiments, the alkynyl group has 2 to 5 carbon atoms ("C2-5 alkynyl"). In some embodiments, the alkynyl group has 2 to 4 carbon atoms ("C2-4 alkynyl"). In some embodiments, the alkynyl group has 2 to 3 carbon atoms ("C2-3 alkynyl"). In some embodiments, the alkynyl group has 2 carbon atoms ("C2 alkynyl"). One or more carbon-carbon triple bonds may be internal (e.g., in 2-butynyl) or terminal (e.g., in 1-butynyl). Examples of C2-4 alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), and 2-butynyl (C4). Examples of C2-6 alkenyl groups include the aforementioned C2-4 alkynyl groups, as well as pentynyl (C5) and hexynyl (C6).Further examples of alkynyls include heptynyl (C7) and octinyl (C8). Unless otherwise specified, each example of an alkynyl group is independently either unsubstituted ("unsubstituted alkynyl") or substituted with one or more substituents ("substituted alkynyl"). In certain embodiments, the alkynyl group is an unsubstituted C2-50 alkynyl. In certain embodiments, the alkynyl group is a substituted C2-50 alkynyl.
[0045] As used herein, “heteroalkynyl” means an alkynyl group as defined herein, further comprising at least one heteroatom selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) located in the parent chain (i.e., inserted between adjacent carbon atoms of the parent chain) and / or at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkynyl group means a group having 2 to 50 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-50alkynyl"). In certain embodiments, a heteroalkynyl group means a group having 2 to 40 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-40alkynyl"). In certain embodiments, a heteroalkynyl group means a group having 2 to 30 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-30alkynyl"). In certain embodiments, a heteroalkynyl group refers to a group having 2 to 20 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-20alkynyl"). In certain embodiments, a heteroalkynyl group refers to a group having 2 to 10 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-10alkynyl"). In some embodiments, a heteroalkynyl group has 2 to 9 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-9alkynyl"). In some embodiments, a heteroalkynyl group has 2 to 8 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-8alkynyl"). In some embodiments, a heteroalkynyl group has 2 to 7 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-7alkynyl"). In some embodiments, the heteroalkynyl group has 2 to 6 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC2-6alkynyl").In some embodiments, the heteroalkynyl group has 2 to 5 carbon atoms, at least one triple bond, and one or two heteroatoms in the parent chain ("heteroC2-5 alkynyl"). In some embodiments, the heteroalkynyl group has 2 to 4 carbon atoms, at least one triple bond, and two heteroatoms in the parent chain ("heteroC2-4 alkynyl"). In some embodiments, the heteroalkynyl group has 2 to 3 carbon atoms, at least one triple bond, and one heteroatom in the parent chain ("heteroC2-3 alkynyl"). In some embodiments, the heteroalkynyl group has 2 to 6 carbon atoms, at least one triple bond, and one or two heteroatoms in the parent chain ("heteroC2-6 alkynyl"). Unless otherwise specified, each example of a heteroalkynyl group is independently either unsubstituted ("unsubstituted heteroalkynyl") or substituted with one or more substituents ("substituted heteroalkynyl"). In certain embodiments, the heteroalkynyl group is an unsubstituted heteroC2-50 alkynyl group. In certain embodiments, the heteroalkynyl group is a substituted heteroC2-50 alkynyl group.
[0046] As used herein, “carbocyclyl” or “carbocyclic” refers to a radical of a non-aromatic cyclic hydrocarbon group having 3 to 10 ring carbon atoms ("C3-10 carbocyclyl") and 0 heteroatoms in a non-aromatic ring system. In some embodiments, the carbocyclyl group has 3 to 8 ring carbon atoms ("C3-8 carbocyclyl"). In some embodiments, the carbocyclyl group has 3 to 7 ring carbon atoms ("C3-7 carbocyclyl"). In some embodiments, the carbocyclyl group has 3 to 6 ring carbon atoms ("C3-6 carbocyclyl"). In some embodiments, the carbocyclyl group has 4 to 6 ring carbon atoms ("C4-6 carbocyclyl"). In some embodiments, the carbocyclyl group has 5 to 6 ring carbon atoms ("C5-6 carbocyclyl"). In some embodiments, the carbocyclyl group has 5 to 10 ring carbon atoms ("C5-10 carbocyclyl"). Examples of C3-6 carbocyclyl groups include, but are not limited to, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), and cyclohexadienyl (C6). Examples of C3-8 carbocyclyl groups include, but are not limited to, the aforementioned C3-6 carbocyclyl groups, as well as cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrielinyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), and bicyclo[2.2.2]octanyl (C8). Examples of C3-10 carbocyclyl groups include, but are not limited to, the aforementioned C3-8 carbocyclyl groups, as well as cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C10), cyclodecenyl (C10), octahydro-1H-indenyl (C9), decahydronaphthalenyl (C10), and spiro[4.5]decanyl (C10).As the above examples show, in certain embodiments, the carbocyclyl group may be monocyclic ("monocyclic carbocyclyl") or polycyclic (e.g., bicyclic systems ("bicyclic carbocyclyl") or tricyclic systems (including condensed, cross-linked, or spirocyclic systems such as "tricyclic carbocyclyl")) and may be saturated or contain one or more carbon-carbon double or triple bonds. A "carbocyclyl" is formed when the carbocyclyl ring as defined above is condensed with one or more aryl or heteroaryl groups, and is radical Alternatively, the bond site is on a carbocyryl ring, and in such cases, the number of carbon atoms continues to specify the number of carbon atoms in the carbocyryl ring system, including ring systems. Unless otherwise specified, each example of a carbocyryl group is independently either unsubstituted ("unsubstituted carbocyryl") or substituted with one or more substituents ("substituted carbocyryl"). In certain embodiments, the carbocyryl group is an unsubstituted C3-10 carbocyryl. In certain embodiments, the carbocyryl group is a substituted C3-10 carbocyryl.
[0047] In some embodiments, "carbocyclyl" or "carbocyclic" is referred to as "cycloalkyl," i.e., a monocyclic saturated carbocyclyl group having 3 to 10 ring carbon atoms ("C3-10 cycloalkyl"). In some embodiments, the cycloalkyl group has 3 to 8 ring carbon atoms ("C3-8 cycloalkyl"). In some embodiments, the cycloalkyl group has 3 to 6 ring carbon atoms ("C3-6 cycloalkyl"). In some embodiments, the cycloalkyl group has 4 to 6 ring carbon atoms ("C4-6 cycloalkyl"). In some embodiments, the cycloalkyl group has 5 to 6 ring carbon atoms ("C5-6 cycloalkyl"). In some embodiments, the cycloalkyl group has 5 to 10 ring carbon atoms ("C5-10 cycloalkyl"). Examples of C5-6 cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C5). Examples of C3-6 cycloalkyl groups include the aforementioned C5-6 cycloalkyl groups, as well as cyclopropyl (C3) and cyclobutyl (C4). Examples of C3-8 cycloalkyl groups include the aforementioned C3-6 cycloalkyl groups, as well as cycloheptyl (C7) and cyclooctyl (C8). Unless otherwise specified, each example of a cycloalkyl group is independently either unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In certain embodiments, the cycloalkyl group is an unsubstituted C3-10 cycloalkyl group. In certain embodiments, the cycloalkyl group is a substituted C3-10 cycloalkyl group.
[0048] As used herein, “heterocyclyl” or “heterocyclic” refers to a radical of a 3- to 14-membered non-aromatic ring system having a ring carbon atom and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus (“3- to 14-membered heterocyclyl”). In heterocyclyl groups containing one or more nitrogen atoms, the bond sites may be carbon atoms or nitrogen atoms, as long as the valence allows. Heterocyclyl groups may be monocyclic (“monocyclic heterocyclyl”) or polycyclic (e.g., condensed, bridged, or spirocyclic systems such as bicyclic systems (“bicyclic heterocyclyl”) or tricyclic systems (“tricyclic heterocyclyl”)) and may be saturated or may contain one or more carbon-carbon double or triple bonds. Heterocyclyl polycyclic ring systems may contain one or more heteroatoms in one or both rings. "Heterocyclyl" includes ring systems in which the heterocyclyl ring defined above is fused with one or more carbocyrill groups and the bond site is on the carbocyrill or heterocyclyl ring, or ring systems in which the heterocyclyl ring defined above is fused with one or more aryl or heteroaryl groups and the bond site is on the heterocyclyl ring, in which case the number of ring members continues to specify the number of ring members in the heterocyclyl ring system. Unless otherwise specified, each example of a heterocyclyl group is independently either unsubstituted ("unsubstituted heterocyclyl") or substituted with one or more substituents ("substituted heterocyclyl"). In certain embodiments, the heterocyclyl group is an unsubstituted 3- to 14-membered heterocyclyl. In certain embodiments, the heterocyclyl group is a substituted 3- to 14-membered heterocyclyl.
[0049] In some embodiments, the heterocyclyl group is a 5-10 membered non-aromatic ring system having a ring carbon atom and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-10 membered heterocyclyl"). In some embodiments, the heterocyclyl group is a 5-8 membered non-aromatic ring system having a ring carbon atom and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-8 membered heterocyclyl"). In some embodiments, the heterocyclyl group is a 5-6 membered non-aromatic ring system having a ring carbon atom and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-6 membered heterocyclyl"). In some embodiments, the 5-6 membered heterocyclil has one or more (e.g., 1, 2, or 3) ring heteroatoms selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus. In some embodiments, the 5-6 membered heterocyclil has one or two ring heteroatoms selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus. In some embodiments, the 5-6 membered heterocyclil has one ring heteroatom selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus.
[0050] Examples of three-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azilidinyl, oxylanil, and thiorenyl. Examples of four-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azetidinyl, oxetanil, and thietanil. Examples of five-membered heterocyclyl groups containing one heteroatom include, but are not limited to, tetrahydrofuranil, dihydrofuranil, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Examples of five-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, dioxolanil, oxathiolanil, and dithiolanil. Examples of five-membered heterocyclyl groups containing three heteroatoms include, but are not limited to, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Examples of six-membered heterocyclyl groups containing one heteroatom include, but are not limited to, piperidinyl, tetrahydropyranil, dihydropyridinyl, and thianil. Examples of six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, piperazinyl, morpholinil, dithianil, and dioxanil. Examples of six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, triazinyl. Examples of seven-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azepanil, oxepanil, and thiepanil. Examples of eight-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azokanil, oxecanil, and thiokanil.Examples of bicyclic heterocyclyl groups include indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, tetrahydrobenzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydroclomenyl, octahydroisoclomenyl, decahydronaphthyldinyl, decahydro-1,8-naphthyldinyl, octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthalimidyl, naphthalimidyl, chromanyl, clomenyl, 1H-benzo[e][1,4]diazepinyl, 1,4,5,7-teto Examples include, but are not limited to, lahydropyrano[3,4-b]pyrrolyl, 5,6-dihydro-4H-fl[3,2-b]pyrrolyl, 6,7-dihydro-5H-fl[3,2-b]pyranyl, 5,7-dihydro-4H-thieno[2,3-c]pyranyl, 2,3-dihydro-1H-pyrrolo[2,3-b]pyridinyl, 2,3-dihydrophyuro[2,3-b]pyridinyl, 4,5,6,7-tetrahydro-1H-pyrrolo-[2,3-b]pyridinyl, 4,5,6,7-tetrahydrofl[3,2-c]pyridinyl, 4,5,6,7-tetrahydrothieno[3,2-b]pyridinyl, and 1,2,3,4-tetrahydro-1,6-naphthilidinyl.
[0051] As used herein, “aryl” refers to a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic arrangement) having 6 to 14 ring carbon atoms and 0 heteroatoms in the aromatic ring system (“C6-14 aryl”). In some embodiments, the aryl group has 6 ring carbon atoms (“C6 aryl”, e.g., phenyl). In some embodiments, the aryl group has 10 ring carbon atoms (“C10 aryl”, e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, the aryl group has 14 ring carbon atoms (“C14 aryl”, e.g., anthracyl). “Aryl” also includes ring systems in which the aryl ring as defined above is condensed with one or more carbocyrillic or heterocyclyl groups, and the radical or bond site is on the aryl ring, in which case the number of carbon atoms continues to specify the number of carbon atoms in the aryl ring system. Unless otherwise specified, each example of an aryl group is either unsubstituted ("unsubstituted aryl") or substituted with one or more substituents ("substituted aryl"). In certain embodiments, the aryl group is an unsubstituted C6-14 aryl. In certain embodiments, the aryl group is a substituted C6-14 aryl.
[0052] As used herein, “heteroaryl” refers to a 5- to 14-membered monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10 or 14 π electrons shared in a cyclic arrangement) radical having a ring carbon atom and one or more ring heteroatoms (e.g., 1, 2, 3, or 4 ring heteroatoms) in the aromatic ring system, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5- to 14-membered heteroaryl"). In heteroaryl groups containing one or more nitrogen atoms, the bond site can be a carbon atom or a nitrogen atom, as long as the valence allows. Heteroaryl polycyclic ring systems may contain one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems in which the heteroaryl ring as defined above is condensed with one or more carbocyryl or heterocyclyl groups, and the bond site is on the heteroaryl ring, in which case the number of ring members continues to specify the number of ring members in the heteroaryl ring system. "Hyperaryl" includes ring systems in which a heteroaryl ring as defined above is fused with one or more aryl groups, and the bond site is on an aryl or heteroaryl ring, in which case the number of ring members specifies the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. For polycyclic heteroaryl groups in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl), the bond site can be on either ring, i.e., a ring with a heteroatom (e.g., 2-indolyl) or a ring without a heteroatom (e.g., 5-indolyl).
[0053] In some embodiments, the heteroaryl group is a 5-10 member aromatic ring system having a ring carbon atom provided to the aromatic ring system and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-10 member heteroaryl"). In some embodiments, the heteroaryl group is a 5-8 member aromatic ring system having a ring carbon atom provided to the aromatic ring system and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-8 member heteroaryl"). In some embodiments, the heteroaryl group is a 5-6 member aromatic ring system having a ring carbon atom provided to the aromatic ring system and one or more (e.g., 1, 2, 3, or 4) ring heteroatoms, where each heteroatom is independently selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus ("5-6 member heteroaryl"). In some embodiments, a 5- to 6-membered heteroaryl group has one or more (e.g., 1, 2, or 3) ring heteroatoms selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus. In some embodiments, a 5- to 6-membered heteroaryl group has one or two ring heteroatoms selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus. In some embodiments, a 5- to 6-membered heteroaryl group has one ring heteroatom selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus. Unless otherwise specified, each example of a heteroaryl group is independently either unsubstituted ("unsubstituted heteroaryl") or substituted with one or more substituents ("substituted heteroaryl"). In certain embodiments, the heteroaryl group is an unsubstituted 5- to 14-membered heteroaryl. In certain embodiments, the heteroaryl group is a substituted 5- to 14-membered heteroaryl.
[0054] Exemplary five-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl. Exemplary five-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary five-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary five-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Exemplary six-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl. Exemplary six-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary six-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetradinyl, respectively. Examples of seven-membered heteroaryl groups containing one heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Examples of 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranil, benzoisofuranil, benzimidazolyl, benzoxazolyl, benzoisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolidinyl, and purinyl. Examples of 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthylidinyl, pteridinyl, quinolinyl, isoquinolinyl, sinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, phenanthridine, dibenzofuranil, carbazolyl, acridinil, phenothiazinil, phenoxadinil, and phenadinil.
[0055] As used herein, the term “partially unsaturated” refers to a ring moiety containing at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple unsaturated moies, but not to include aromatic groups as defined herein (e.g., aryl or heteroaryl moies).
[0056] As used herein, the term “saturated” refers to a ring portion that does not contain double or triple bonds; that is, the ring contains only single bonds.
[0057] Adding the suffix "-en" to a base name indicates that the group is a divalent part. For example, alkylene is the divalent part of alkyl, alkenylene is the divalent part of alkenyl, alkynylene is the divalent part of alkynyl, heteroalkylene is the divalent part of heteroalkyl, heteroalkenylene is the divalent part of heteroalkenyl, heteroalkynylene is the divalent part of heteroalkynyl, carbocyclylene is the divalent part of carbocyclyl, heterocyclylene is the divalent part of heterocyclyl, arylene is the divalent part of aryl, and heteroarylene is the divalent part of heteroaryl.
[0058] As can be understood from the foregoing, the alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykryl, heterocyclyl, aryl, and heteroaryl groups as defined herein are optionally substituted in certain embodiments as defined in the variable definitions for the compounds provided herein. Generally, the term “substituted” means that at least one hydrogen present on the group is substituted with an acceptable substituent, for example, a substituent that, when substituted, results in a stable compound, such as a compound that does not spontaneously undergo transformation by recombination, cyclization, removal, or other reactions. Unless otherwise indicated, a “substituted” group has substituents at one or more substitutable positions of the group, and if two or more positions in any given structure are substituted, the substituents are either the same or different at each position. The term “substituted” is intended to include substitution with any of the acceptable substituents of an organic compound that are described herein and result in the formation of a stable compound. The present invention intends any and all such combinations to arrive at a stable compound. For the purposes of this disclosure, heteroatoms such as nitrogen may have hydrogen substituents and / or any preferred substituents that result in the formation of a stable moiety that satisfies the valence of the heteroatom, as described herein.
[0059] As used herein, the terms "halo" or "halogen" refer to fluorine (fluoro, -F), chlorine (chloro, -Cl), bromine (bromo, -Br), or iodine (iod, -I).
[0060] As used herein, “counterion” is a negatively charged group that binds to a positively charged quaternary amine in order to maintain electronic neutrality. Exemplary counterions include halide ions (e.g., F-, Cl-, Br-, I-), NO3-, ClO4-, OH-, H2PO4-, HSO4-, sulfonate ions (e.g., methanesulfonic acid, trifluoromethanesulfonic acid, p-toluenesulfonic acid, benzenesulfonic acid, 10-camphorsulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1-sulfonic acid-5-sulfonate, ethane-1-sulfonic acid-2-sulfonate, etc.) and carboxylate ions (e.g., acetic acid, ethaneic acid, propanoic acid, benzoic acid, glyceric acid, lactic acid, tartaric acid, glycolic acid, etc.).
[0061] Nitrogen atoms may be substituted or unsubstituted to the extent permitted by their valence, and include primary, secondary, tertiary, and quaternary nitrogen atoms.
[0062] In certain embodiments, substituents present on the nitrogen atom are nitrogen protecting groups (also called amino protecting groups). Nitrogen protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGMWuts, 3rd edition, John Wiley & Sons, 1999, which are incorporated herein by reference.
[0063] In certain embodiments, substituents present on the oxygen atom are oxygen protecting groups (also called hydroxyl protecting groups). Oxygen protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGMWuts, 3rd edition, John Wiley & Sons, 1999, which are incorporated herein by reference.
[0064] In certain embodiments, substituents present on the sulfur atom are sulfur protecting groups (also known as thiol protecting groups). Sulfur protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGMWuts, 3rd edition, John Wiley & Sons, 1999, which are incorporated herein by reference.
[0065] As used herein, the phrase “at least one example” refers to one example, but also includes two or more examples, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 examples and up to 100 examples.
[0066] As used herein, “polymer” refers to a compound consisting of at least three repeating covalent structural units (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, etc.).
[0067] "Bonded" refers to the covalent bond between the two elements.
[0068] As used herein, "lipophilic" refers to the ability of a group to dissolve in fats, oils, lipids, and lipophilic nonpolar solvents such as hexane or toluene. Generally, a lipophilic group refers to an unsubstituted n-alkyl or unsubstituted n-alkenyl group having 6 to 50 carbon atoms, for example, 6 to 40, 6 to 30, 6 to 20, 8 to 20, 8 to 19, 8 to 18, 8 to 17, 8 to 16, or 8 to 15 carbon atoms.
[0069] As used herein, the terms “salt” or “pharmaceutically acceptable salt” refer to a salt that, within the bounds of medical judgment, is free from excessive toxicity, irritation, or allergic reactions, is suitable for contact with human and lower animal tissues, and is commensurate with a reasonable benefit / risk ratio. Pharmacochemically acceptable salts are well known in the art. For example, SMBerge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19.
[0070] Composition of these lipid nanoparticles This disclosure provides compositions comprising lipid nanoparticles (LNPs). Each LNP comprises at least an ionized lipid, a glyceride or acyl glycol, and at least one of structural lipids, helper lipids, and stealth lipids. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, and a structural lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, and a helper lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, and a stealth lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, a structural lipid, and a helper lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, a helper lipid, and a stealth lipid. In some embodiments, the LNP comprises an ionized lipid, a glyceride or acyl glycol, a structural lipid, a helper lipid, and a stealth lipid.
[0071] Ionized lipids / cationic lipids Ionized lipids facilitate mRNA encapsulation and may be cationic lipids. Cationic lipids provide a positively charged environment at low pH, making it easier to efficiently encapsulate negatively charged mRNA drug substances.
[0072] In some embodiments, the ionized lipid is a cationic lipid.
[0073] In some embodiments, cationic lipids are expressed using formula CAT-I: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, p is an integer between 1 and 9 (including the two endpoints). R 2Each presence independently involves hydrogen or C substituted by choice. 1~6 It is alkyl, Each instance of L is independently an arbitrarily substituted alkylene, an arbitrarily substituted alkenylene, an arbitrarily substituted alkynylene, an arbitrarily substituted heteroalkylene, an arbitrarily substituted heteroalkenylene, an arbitrarily substituted heteroalkynylene, an arbitrarily substituted carbocyclylene, an arbitrarily substituted heterocyclylene, an arbitrarily substituted arylene, or an arbitrarily substituted heteroarylene, or a combination thereof. R 6 and R 7 Each existence is independently a base of equation (i), (ii), or (iii), Equations (i), (ii), and (iii) are, [ka] And, Each R' is independently an alkyl group substituted with hydrogen or of any choice. X is O, S, or NR X And R X This is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. Y is O, S, or NR Y And R Y This is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. R PThis includes hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen protecting group when bonded to an oxygen atom, a sulfur protecting group when bonded to a sulfur atom, or a nitrogen protecting group when bonded to a nitrogen atom, and R L C is replaced by arbitrary selection. 1~50 Alkyl, optionally substituted C 2~50 Alkenyl, C substituted by choice 2~50 Alkynyl, optionally substituted hetero-C 1~50 Alkyl, optionally substituted hetero-C 2~50 Alkenyl, optionally substituted hetero-C 2~50 It is an alkynyl or polymer.
[0074] In certain embodiments of lipids of formula CAT-I, the group of formula (i) is the group of formula (ia) or the group of formula (ib): [ka] This represents the respective variables, each independently defined above and as described herein. In some embodiments of the lipids of formula CAT-I, the group of formula (i) is the group of formula (ia). In some embodiments of the lipids of formula CAT-I, the group of formula (i) is the group of formula (ib).
[0075] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 Each of these is independently a base of formula (i). In some embodiments of the lipids of formula CAT-I, R 6 and R 7 Each of these is independently a base of formula (ii). In some embodiments of the lipids of formula CAT-I, R 6 and R 7 Each of these is independently a base of formula (iii). In some embodiments of the lipids of formula CAT-I, R6 and R 7 Each of these is independently a base of formula (ia). In some embodiments of lipids of formula CAT-I, R 6 and R 7 Each of them is independently a base of equation (ib).
[0076] In some embodiments of the lipid of formula CAT-I, each R' is a hydrogen atom.
[0077] In some embodiments of the lipids of formula CAT-I, L is an optionally substituted alkylene.
[0078] As generally defined above for lipids of formula CAT-I, p is an integer between 1 and 9 (including the two extreme values). In a particular embodiment of the lipid of formula CAT-I, p is 1. In a particular embodiment of the lipid of formula CAT-I, p is 2. In a particular embodiment of the lipid of formula CAT-I, p is 3. In a particular embodiment of the lipid of formula CAT-I, p is 4. In a particular embodiment of the lipid of formula CAT-I, p is 5. In a particular embodiment of the lipid of formula CAT-I, p is 6. In a particular embodiment of the lipid of formula CAT-I, p is 7. In a particular embodiment of the lipid of formula CAT-I, p is 8. In a particular embodiment of the lipid of formula CAT-I, p is 9.
[0079] In some embodiments of lipids of formula CAT-I, the lipid is of formula CAT-Ia: [ka] The formula has the structure or a pharmaceutically acceptable salt thereof, where each variable is independently defined above and as described herein.
[0080] In certain embodiments of the lipid of formula CAT-I, L is an optionally substituted alkylene, for example, an optionally substituted C 1~50 Alkylene, optionally substituted C 1~40 Alkylene, optionally substituted C 1~30Alkylene, optionally substituted C 1~20 Alkylene, optionally substituted C 4~20 Alkylene, optionally substituted C 6~20 Alkylene, optionally substituted C 8~20 Alkylene, optionally substituted C 10~20 Alkylene, optionally substituted C 1~6 Alkylene, optionally substituted C 2~6 Alkylene, optionally substituted C 3~6 Alkylene, optionally substituted C 4~6 Alkylene, optionally substituted C 4~5 alkylene or optionally substituted C 3~4It is an alkylene. In some embodiments of the lipid of formula CAT-I, L is a C1 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C2 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C3 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C4 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C5 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C6 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C7 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is a C8 alkylene that is optionally substituted. In some embodiments of the lipid of formula CAT-I, L is -CH2-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)2-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)3-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)4-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)5-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)6-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)7-. In some embodiments of the lipid of formula CAT-I, L is -(CH2)8-.
[0081] In certain embodiments of the lipid of formula CAT-I, L is an optionally substituted alkenylene, for example, an optionally substituted C 2~50 Alkenylene, optionally substituted C 2~40 Alkenylene, optionally substituted C 2~30 Alkenylene, optionally substituted C 2~20 Alkenylene, optionally substituted C 4~20 Alkenylene, optionally substituted C 6~20 Alkenylene, optionally substituted C 8~20Alkenylene, optionally substituted C 10~20 Alkenylene, optionally substituted C 2~6 Alkenylene, optionally substituted C 3~6 Alkenylene, optionally substituted C 4~6 Alkenylene, optionally substituted C 4~5 Alkenylene or optionally substituted C 3~4 It is alkenylene.
[0082] In certain embodiments of the lipid of formula CAT-I, L is an optionally substituted alkynylene, for example, an optionally substituted C 2~50 Alkynylene, optionally substituted C 2~40 Alkynylene, optionally substituted C 2~30 Alkynylene, optionally substituted C 2~20 Alkynylene, optionally substituted C 4~20 Alkynylene, optionally substituted C 6~20 Alkynylene, optionally substituted C 8~20 Alkynylene, optionally substituted C 10~20 Alkynylene, optionally substituted C 2~6 Alkynylene, optionally substituted C 3~6 Alkynylene, optionally substituted C 4~6 Alkynylene, optionally substituted C 4~5 Alkynylene or optionally substituted C 3~4 It is alkynylene.
[0083] In certain embodiments of the lipid of formula CAT-I, L is an optionally substituted heteroalkylene, for example, an optionally substituted heteroC 1~50 Alkylene, optionally substituted hetero-C 1~40 Alkylene, optionally substituted hetero-C 1~30 Alkylene, optionally substituted hetero-C 1~20 Alkylene, optionally substituted hetero-C 4~20Alkylene, optionally substituted hetero C 6~20 Alkylene, optionally substituted hetero C 8~20 Alkylene, optionally substituted hetero C 1~20 Alkylene, optionally substituted hetero C 1~6 Alkylene, optionally substituted hetero C 2~6 Alkylene, optionally substituted hetero C 3~6 Alkylene, optionally substituted hetero C 4~6 Alkynylene, optionally substituted hetero C 4~5 Alkylene or optionally substituted hetero C 3~4 is alkylene.
[0084] In certain embodiments of the lipid of formula CAT-I, L is optionally substituted heteroalkenylene, such as optionally substituted hetero C 2~50 Alkenylene, optionally substituted hetero C 2~40 Alkenylene, optionally substituted hetero C 2~30 Alkenylene, optionally substituted hetero C 2~20 Alkenylene, optionally substituted hetero C 4~20 Alkenylene, optionally substituted hetero C 6~20 Alkenylene, optionally substituted hetero C 8~20 Alkenylene, optionally substituted hetero C 10~20 Alkenylene, optionally substituted hetero C 2~6 Alkenylene, optionally substituted hetero C 3~6 Alkenylene, optionally substituted hetero C 4~6 Alkenylene, optionally substituted hetero C 4~5 Alkenylene or optionally substituted hetero C 3~4 is alkenylene.
[0085] In certain embodiments of the lipid of formula CAT-I, L is optionally substituted heteroalkynylene, such as optionally substituted hetero C 2~50Alkynylene, optionally substituted hetero-C 2~40 Alkynylene, optionally substituted hetero-C 2~30 Alkynylene, optionally substituted hetero-C 2~20 Alkynylene, optionally substituted hetero-C 4~20 Alkynylene, optionally substituted hetero-C 6~20 Alkynylene, optionally substituted hetero-C 8~20 Alkynylene, optionally substituted hetero-C 10~20 Alkynylene, optionally substituted hetero-C 2~6 Alkynylene, optionally substituted hetero-C 3~6 Alkynylene, optionally substituted hetero-C 4~6 Alkynylene, optionally substituted hetero-C 4~5 Alkynylene or optionally substituted hetero-C 3~4 It is alkynylene.
[0086] In certain embodiments of the lipid of formula CAT-I, L is optionally substituted with carbocyclylene, for example, optionally substituted with C 3~10 Carbocyclylene, optionally substituted with C 5~8 Carbocyclylene, optionally substituted with C 5~6 The material is carbocyclylene, C5-carbocyclylene substituted by optional means, or C6-carbocyclylene substituted by optional means.
[0087] In some embodiments of the lipid of formula CAT-I, L is an optionally substituted heterocyclene, such as an optionally substituted 3-14 member heterocyclene, an optionally substituted 3-10 member heterocyclene, an optionally substituted 5-8 member heterocyclene, an optionally substituted 5-6 member heterocyclene, an optionally substituted 5 member heterocyclene, or an optionally substituted 6 member heterocyclene.
[0088] In some embodiments of the lipid of formula CAT-I, L is optionally substituted arylene, for example, optionally substituted phenylene. In some embodiments, L is optionally substituted phenylene. In some embodiments, L is substituted phenylene. In some embodiments, L is unsubstituted phenylene.
[0089] In certain embodiments of the lipid of formula CAT-I, L is an optionally substituted heteroarylene, such as an optionally substituted 5-14 member heteroarylene, an optionally substituted 5-10 member heteroarylene, an optionally substituted 5-6 member heteroarylene, an optionally substituted 5 member heteroarylene, or an optionally substituted 6 member heteroarylene.
[0090] In some embodiments of lipids of formula CAT-I, the lipid is of formula CAT-Ib: [ka] The formula has the structure or a pharmaceutically acceptable salt thereof, where each variable is independently defined above and as described herein, and 1 is an integer from 1 to 10.
[0091] In a particular embodiment of the lipid of formula CAT-Ib, q is an integer between 2 and 10 (including both ends). In a particular embodiment of the lipid of formula CAT-Ib, q is an integer between 2 and 8 (including both ends). In a particular embodiment of the lipid of formula CAT-Ib, q is an integer between 2 and 6 (including both ends). In a particular embodiment of the lipid of formula CAT-Ib, q is 3 or 4. In a particular embodiment of the lipid of formula CAT-Ib, q is 1. In a particular embodiment of the lipid of formula CAT-Ib, q is 2. In a particular embodiment of the lipid of formula CAT-Ib, q is 3. In a particular embodiment of the lipid of formula CAT-Ib, q is 4. In a particular embodiment of the lipid of formula CAT-Ib, q is 5. In a particular embodiment of the lipid of formula CAT-Ib, q is 6. In a particular embodiment of the lipid of formula CAT-Ib, q is 7. In a particular embodiment of the lipid of formula CAT-Ib, q is 8.
[0092] In some embodiments of the lipids of formula CAT-I, R 6 is the base of formula (i). In some embodiments of the lipids of formula CAT-I, R 6 is the base of formula (ia). In some embodiments of lipids of formula CAT-I, R6 is of formula (i-a1): [ka] It is the basis of.
[0093] In some embodiments of the lipids of formula CAT-I, R 6 is the base of formula (ib). In some embodiments of lipids of formula CAT-I, R 6 is the base of formula (ii). In some embodiments of the lipids of formula CAT-I, R 6 is the basis of equation (iii).
[0094] In some embodiments of the lipids of formula CAT-I, R 7 is the base of formula (i). In some embodiments of the lipids of formula CAT-I, R 7 is the base of formula (ia). In some embodiments of lipids of formula CAT-I, R 7is the base of formula (i-a1). In some embodiments of the lipids of formula CAT-I, R 7 is the base of formula (ib). In some embodiments of lipids of formula CAT-I, R 7 is the base of formula (ii). In some embodiments of the lipids of formula CAT-I, R 7 is the basis of equation (iii).
[0095] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 R is independently a base of formula (i). In some embodiments of lipids of formula CAT-I, R 6 and R 7 R is independently a base of formula (ia). In some embodiments of lipids of formula CAT-I, R 6 and R 7 R is independently a base of formula (ib). In some embodiments of lipids of formula CAT-I, R 6 and R 7 R is independently a base of formula (ii). In some embodiments of lipids of formula CAT-I, R 6 and R 7 It is independently a base of equation (iii).
[0096] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 These are the same. In some embodiments of the lipids of formula CAT-I, R 6 and R 7 They are different.
[0097] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 Equation (i-a1): [ka] It is the same group as R L This is defined above and as described herein.
[0098] In some embodiments of the lipids of formula CAT-I, R6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 1~50 Alkyl, optionally substituted C 2~50 Alkenyl, C substituted by choice 2~50 Alkynyl, optionally substituted hetero-C 1~50 Alkyl, optionally substituted hetero-C 2~50 Alkenyl or optionally substituted hetero-C 2~50 It is alkinyl.
[0099] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same base, and R is C which is substituted by choice. 5~25 Alkyl, optionally substituted C 5~25 Alkenyl, C substituted by choice 5~25 Alkynyl, optionally substituted hetero-C 5~25 Alkyl, optionally substituted hetero-C 5~25 Alkenyl or optionally substituted hetero-C 5~25 It is alkinyl.
[0100] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 5~15 Alkyl, optionally substituted C 5~15 Alkenyl, C substituted by choice 5~15 Alkynyl, optionally substituted hetero-C5~15 Alkyl, optionally substituted hetero-C 5~15 Alkenyl or optionally substituted hetero-C 5~15 It is alkinyl.
[0101] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 1~50 It is alkyl.
[0102] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 5~25 It is alkyl.
[0103] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 5~20 It is alkyl.
[0104] In some embodiments of the lipids of formula CAT-I, R 6 and R 7 The formula is: [ka] It is the same group as R L C is replaced by arbitrary selection. 5~15 It is alkyl.
[0105] In some embodiments of the lipids of formula CAT-I, R 2 R is hydrogen. In some embodiments of lipids of formula CAT-I, 2 At least one of them is hydrogen. In some embodiments of lipids of formula CAT-I, R 2 Each of these entities is hydrogen.
[0106] In a specific embodiment of the lipid of formula CAT-I, R 2 C is replaced by arbitrary selection. 1~6 Alkyl, optionally substituted C 2~6 Alkyl, optionally substituted C 3~6 Alkyl, optionally substituted C 4~6 Alkyl, optionally substituted C 4~5 C is alkyl or optionally substituted. 3~4 It is alkyl. In certain embodiments of lipids of formula CAT-I, R 2 The existence of at least one of C is substituted by arbitrary choice. 1~6 It is alkyl.
[0107] As generally defined above with respect to lipids of formula CAT-I, each R' is independently hydrogen or an optionally substituted alkyl. In some embodiments of lipids of formula CAT-I, R' is hydrogen. In some embodiments of lipids of formula CAT-I, R' is a substituted alkyl. In certain embodiments of lipids of formula CAT-I, at least one R' is hydrogen. In certain embodiments of lipids of formula CAT-I, at least two R' are hydrogen. In certain embodiments of lipids of formula CAT-I, each R' is hydrogen. In certain embodiments of lipids of formula CAT-I, at least one R' is an optionally substituted alkyl, e.g., methyl. In certain embodiments of lipids of formula CAT-I, at least two R' are optionally substituted alkyls, e.g., methyl. In some embodiments of lipids of formula CAT-I, at least one R' is hydrogen, and at least one R' is an optionally substituted alkyl. In certain embodiments of the lipid of formula CAT-I, the presence of one R' is an optionally substituted alkyl, and the remainder are hydrogen.
[0108] As generally defined above with respect to lipids in formula CAT-I, X is O, S, or NR. X In some embodiments of the lipids of formula CAT-I, X is O. In some embodiments of the lipids of formula CAT-I, X is S. In some embodiments of the lipids of formula CAT-I, X is NR X And R X This is defined above and as described herein.
[0109] Regarding the lipids in formula CAT-I, as generally defined above, R XR is a hydrogen atom, an optionally substituted alkyl group, an optionally substituted alkenyl group, an optionally substituted alkynyl group, an optionally substituted carbocyryl group, an optionally substituted heterocyclyl group, an optionally substituted aryl group, an optionally substituted heteroaryl group, or a nitrogen protecting group. In some embodiments of lipids of formula CAT-I, R X is hydrogen. In some embodiments of lipids of formula CAT-I, R X R is an alkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, X is an alkenyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R X R is an alkynyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, X R is a carbocyclyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, X is a heterocycline that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R X R is an aryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, X R is a heteroaryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, X This is a nitrogen protecting group.
[0110] As generally defined above with respect to lipids in formula CAT-I, Y is O, S, or NR. Y In some embodiments of the lipids of formula CAT-I, Y is O. In some embodiments of the lipids of formula CAT-I, Y is S. In some embodiments of the lipids of formula CAT-I, Y is NR Y And RY is as defined above and as described herein.
[0111] Regarding the lipids in formula CAT-I, as generally defined above, R YR is a hydrogen atom, an optionally substituted alkyl group, an optionally substituted alkenyl group, an optionally substituted alkynyl group, an optionally substituted carbocyryl group, an optionally substituted heterocyclyl group, an optionally substituted aryl group, an optionally substituted heteroaryl group, or a nitrogen protecting group. In some embodiments of lipids of formula CAT-I, R Y is hydrogen. In some embodiments of lipids of formula CAT-I, R Y R is an alkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, Y is an alkenyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R Y R is an alkynyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, Y R is a carbocyclyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, Y is a heterocycline that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R Y R is an aryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, Y R is a heteroaryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, Y This is a nitrogen protecting group.
[0112] Regarding the lipids in formula CAT-I, as generally defined above, R P R is a hydrogen atom, an optionally substituted alkyl group, an optionally substituted alkenyl group, an optionally substituted alkynyl group, an optionally substituted carbocyryl group, an optionally substituted heterocyclyl group, an optionally substituted aryl group, an optionally substituted heteroaryl group, an oxygen protecting group when bonded to an oxygen atom, a sulfur protecting group when bonded to a sulfur atom, or a nitrogen protecting group when bonded to a nitrogen atom. In some embodiments of lipids of formula CAT-I, R P is hydrogen. In some embodiments of lipids of formula CAT-I, RP R is an alkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, P is an alkenyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R P R is an alkynyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, P R is a carbocyclyl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, P is a heterocycline that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, R P R is an aryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, P R is a heteroaryl that has been optionally substituted. In some embodiments of the lipid of formula CAT-I, P R is an oxygen protecting group when bonded to an oxygen atom. In some embodiments of lipids of formula CAT-I, P R is a sulfur protecting group when bonded to a sulfur atom. In some embodiments of lipids of formula CAT-I, R P When bonded to a nitrogen atom, it acts as a nitrogen protecting group.
[0113] Regarding the lipids in formula CAT-I, as generally defined above, R L C is replaced by arbitrary selection. 1~50 Alkyl, optionally substituted C 2~50 Alkenyl, C substituted by choice 2~50 Alkynyl, optionally substituted hetero-C 1~50 Alkyl, optionally substituted hetero-C 2~50 Alkenyl, optionally substituted hetero-C 2~50 It is an alkynyl or polymer.
[0114] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 1~50It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~30 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~20 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~15 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~10 It is alkyl.
[0115] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~50 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~30 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~20 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~15 It is alkyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~10 It is alkyl.
[0116] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted alkyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted alkyl group. In some embodiments of lipids of formula CAT-I, L R is a linear alkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, L R is a substituted linear alkyl group. In some embodiments of lipids of formula CAT-I, R LR is an unsubstituted linear alkyl group. In some embodiments of lipids of formula CAT-I, R L R is a branched alkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, L R is a substituted branched alkyl group. In some embodiments of lipids of formula CAT-I, L It is an unsubstituted branched alkyl group.
[0117] In a specific embodiment of the lipid of formula CAT-I, R L The presence of at least one of them is an unsubstituted alkyl group. Exemplary unsubstituted alkyl groups include -CH3, -C2H5, -C3H7, -C4H9, and -C5H 11 , -C6H 13 -C7H 15 -C8H 17 -C9H 19 , -C 10 H 21 , -C 11 H 23 , -C 12 H 25 , -C 13 H 27 , -C 14 H 29 , -C 15 H 31 , -C 16 H 33 , -C 17 H 35 , -C 18 H 37 , -C 19 H 39 , -C 20 H 41 -C 21 H 43 , -C 22 H 45 , -C 23 H 47 , -C 24 H 49 and -C 25 H 51 These include, but are not limited to, the following:
[0118] In a specific embodiment of the lipid of formula CAT-I, R LThe presence of at least one of the is a substituted alkyl. For example, in certain embodiments of lipids of formula CAT-I, R L The presence of at least one of these is an alkyl group substituted with one or more fluorine substituents. Exemplary fluorinated alkyl groups include: [ka] These include, but are not limited to, the following:
[0119] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~50 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~30 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~20 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~18 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~15 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~10 It is Alkenil.
[0120] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~50 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~30 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~20 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~18It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~15 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~10 It is Alkenil.
[0121] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted alkyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted alkyl group. In some embodiments of lipids of formula CAT-I, L R is a linear alkenyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, L R is a substituted linear alkenyl group. In some embodiments of lipids of formula CAT-I, R L R is an unsubstituted linear alkenyl group. In some embodiments of lipids of formula CAT-I, R L R is a branched alkenyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted branched alkenyl group. In some embodiments of lipids of formula CAT-I, L This is an unsubstituted branched alkenyl group.
[0122] Examples of unsubstituted alkenyl groups include: [ka] These include, but are not limited to, the following: Myristoleic acid -(CH2)7CH=CH(CH2)CH3, Palmitoleic acid -(CH2)7CH=CH(CH2)5CH3, Sapenoic acid -(CH2)4CH=CH(CH2)8CH3, Oleic acid - (C2)7CH=CH(CH2)7CH3, Linoleic acid - (CH2)7CH=CHCH2CH=CH(CH2)4CH3, α-Linoleic acid - (CH2)7CH=CHCH2CH=CHCH2CH=CHCH2CH3, Arachidonic acid - (CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CH(CH2)4CH3, eicosapentaenoic acid - (CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH3, • Erucic acid-(CH2) 11 CH=H(C(CH2)7CH3, and Docosahexaenoic acid - (CH2)2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CH-CH2CH3.
[0123] In some embodiments of the lipids of formula CAT-I, R L C 6~50 Alkyl or C 6~50 Defined as an alkenyl group, such a group implies the inclusion of a lipophilic group (also called a "lipid tail"). Lipophilic groups constitute the base of molecules including fats, waxes, oils, and fatty acids. The lipid tails present on these lipid groups can be saturated or unsaturated, depending on whether the lipid tail contains a double bond. Lipid tails can also be of varying lengths, often intermediate (i.e., having a tail of 7 to 12 carbon atoms, for example, C 7~12 Alkyl or C 7~12 Alkenyls), long (i.e., having a tail of more than 12 carbon atoms and up to 22 carbon atoms, for example C 13~22 Alkyl or C 13~22 Alkenyl) or very long (i.e., having a tail with more than 22 carbon atoms, for example C) 23~30 Alkyl or C 23~30 It is classified as an alkenyl.
[0124] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~50It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~30 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~20 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~15 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 2~10 It is alkinyl.
[0125] In some embodiments of the lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~50 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~30 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~20 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~15 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L C is replaced by arbitrary selection. 6~10 It is alkinyl.
[0126] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted alkynyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted alkynyl group. In some embodiments of lipids of formula CAT-I, L R is a linear alkynyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R LR is a linear alkynyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted linear alkynyl group. In some embodiments of lipids of formula CAT-I, R L R is an unsubstituted linear alkynyl group. In some embodiments of lipids of formula CAT-I, R L R is a branched alkynyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, L R is a substituted branched alkynyl group. In some embodiments of lipids of formula CAT-I, L This is an unsubstituted branched alkynyl group.
[0127] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 1~50 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~30 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~20 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~15 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~10 It is alkyl.
[0128] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~50 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~30 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~20 It is alkyl. In some embodiments of lipids of formula CAT-I, RL This is a hetero C that has been substituted by arbitrary selection. 6~15 It is alkyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~10 It is alkyl.
[0129] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted heteroalkyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted heteroalkyl group. In some embodiments of lipids of formula CAT-I, L R is a linear heteroalkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted linear heteroalkyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted linear heteroalkyl group. In some embodiments of lipids of formula CAT-I, R L R is a branched heteroalkyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, L R is a substituted branched heteroalkyl group. In some embodiments of lipids of formula CAT-I, L It is an unsubstituted branched heteroalkyl group.
[0130] Examples of unsubstituted heteroalkyl groups include: [ka] These include, but are not limited to, the following:
[0131] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~50 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~30 It is an alkenyl. In some embodiments of lipids of formula CAT-I, RL This is a hetero C that has been substituted by arbitrary selection. 2~20 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~15 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~10 It is Alkenil.
[0132] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~50 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~30 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~20 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~15 It is an alkenyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~10 It is Alkenil.
[0133] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted heteroalkenyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted heteroalkenyl group. In some embodiments of lipids of formula CAT-I, L R is a linear heteroalkenyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted linear heteroalkenyl group. In some embodiments of lipids of formula CAT-I, R L R is an unsubstituted linear heteroalkenyl group. In some embodiments of lipids of formula CAT-I, R LR is a branched heteroalkenyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted branched heteroalkenyl group. In some embodiments of lipids of formula CAT-I, R L This is an unsubstituted branched heteroalkenyl group.
[0134] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~50 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~30 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~20 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~15 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 2~10 It is alkinyl.
[0135] In some embodiments of the lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~50 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~30 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~20 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~15 It is an alkynyl. In some embodiments of lipids of formula CAT-I, R L This is a hetero C that has been substituted by arbitrary selection. 6~10 It is alkinyl.
[0136] In some embodiments of the lipids of formula CAT-I, for example, in any of the embodiments described above, R L R is a substituted heteroalkynyl group. In some embodiments of lipids of formula CAT-I, L R is an unsubstituted heteroalkynyl group. In some embodiments of lipids of formula CAT-I, L R is a linear heteroalkynyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted linear heteroalkynyl group. In some embodiments of lipids of formula CAT-I, R L R is an unsubstituted linear heteroalkynyl group. In some embodiments of lipids of formula CAT-I, R L R is a branched heteroalkynyl group that is optionally substituted. In some embodiments of lipids of formula CAT-I, R L R is a substituted branched heteroalkynyl group. In some embodiments of lipids of formula CAT-I, L This is an unsubstituted branched heteroalkynyl group.
[0137] In some embodiments of the lipids of formula CAT-I, R L A polymer is a polymer. As used herein, “polymer” refers in some embodiments to a compound composed of at least three repeating covalent structural units (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, etc.). In certain embodiments, polymers are biocompatible (i.e., non-toxic). Exemplary polymers include, but are not limited to, cellulose polymers (e.g., hydroxyethylcellulose, ethylcellulose, carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose (HPMC)), dextran polymers, polymaleic acid polymers, poly(acrylic acid) polymers, poly(vinyl alcohol) polymers, polyvinylpyrrolidone (PVP) polymers, and polyethylene glycol (PEG) polymers, and combinations thereof.
[0138] In some embodiments of the lipids of formula CAT-I, R L R is a lipophilic, hydrophobic and / or nonpolar group. In some embodiments of lipids of formula CAT-I, L R is a lipophilic group. In some embodiments of lipids of formula CAT-I, L R is a hydrophobic group. In some embodiments of lipids of formula CAT-I, L It is a nonpolar group.
[0139] In some embodiments of the lipids of formula CAT-I, R L When the group is described, for example, as to bisect the carbon-carbon bond in formula (i), R L It is understood that it can be bonded to any of the carbon atoms.
[0140] Various combinations of the above embodiments of formula CAT-I are intended herein.
[0141] In some embodiments, the lipid of formula CAT-I is formula CAT-Ic: [ka] It has a structure such that, in the formula, R 2 and R L Each of these is independently defined above and as described herein.
[0142] In some embodiments, the lipid of formula CAT-I is formula CAT-Id: [ka] It has a structure such that, in the formula, R 2 and R L Each of these is independently defined above and as described herein.
[0143] In some embodiments of lipids of formula CAT-I, CAT-Ia, CAT-Ib, CAT-Ic, or CAT-Id, R L C 1~20 Alkyl or C 2~20It is an alkenyl. In some embodiments of lipids of formula CAT-I, CAT-Ia, CAT-Ib, CAT-Ic, or CAT-Id, R L C 6~20 Alkyl or C 6~20 It is Alkenil.
[0144] In some embodiments, the lipid of formula CAT-I has the following structure: [ka] This is cKK-E10, which has [this feature].
[0145] In some embodiments, the lipid of formula CAT-I has the following structure: [ka] This is OF-02, which has [this feature].
[0146] Examples of additional cationic lipids suitable for the LNPs of this disclosure are described in International Publication No. 2013063468, International Publication No. 2016205691, and International Publication No. 2013063468, each of which is incorporated herein by reference in whole.
[0147] In some embodiments, cationic lipids are expressed using formula CAT-II: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, A 1 teeth, [ka] Selected from, the left side of each illustrated structure is bonded to -(CH2)a-, Z 1 teeth, [ka] Selected from, the right side of each illustrated structure is bonded to -(CH2)a-, R 1A and R 1B These are optionally substituted alkyls, optionally substituted alkenyls, optionally substituted alkynyls, optionally substituted acyls, and -W 1 -X 1 -Y 1 Each is independently selected from, Each W 1 It is independently selected from optionally substituted alkyls and optionally substituted alkenyls, each X 1 The atoms are independently selected from alkyls substituted with -*O-(C=O)-optionally, alkyls substituted with -(*C=O)-O-optionally, alkenyls substituted with -*O-(C=O)-optionally, and alkenyls substituted with -(*C=O)-O-optionally, and the atoms marked with * are W 1 It is connected to, Each Y 1 The atoms are independently selected from hydrogen, -*O-(C=O)-optionally substituted alkyl, -(*C=O)-O-optionally substituted alkyl, -*O-(C=O)-optionally substituted alkenyl, and -(*C=O)-O-optionally substituted alkenyl, and the atoms marked with * are X 1 It is connected to, b is 1, 2, 3, 4 or 5, and Each a is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
[0148] In some embodiments, the lipid of formula CAT-II is formula CAT-IIa: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0149] In some embodiments, the lipid of formula CAT-II is formula CAT-IIb: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0150] In some embodiments, the lipid of formula CAT-II is formula CAT-IIc: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0151] In some embodiments of the lipids of formula CAT-II, A 1 and Z 1 These are the same. In some embodiments of the lipids of formula CAT-II, A 1 and Z 1 They are different.
[0152] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-. In some embodiments of the lipid of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-. In some embodiments of the lipid of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-.
[0153] In some embodiments of the lipids of formula CAT-II, Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-. In some embodiments of the lipid of formula CAT-II, Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-. In some embodiments of the lipid of formula CAT-II, Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0154] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0155] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0156] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0157] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0158] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0159] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0160] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0161] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0162] In some embodiments of the lipids of formula CAT-II, A 1 teeth, [ka] The left side of the illustrated structure is bonded to -(CH2)a-, and Z 1 teeth, [ka] The right side of the illustrated structure is bonded to -(CH2)a-.
[0163] In some embodiments of the lipids of formula CAT-II, R 1A and R 1B teeth, [ka] Each is selected independently.
[0164] In some embodiments of the lipid of formula CAT-II, each a is independently selected from 2, 3, and 4. In some embodiments of the lipid of formula CAT-II, each a is the same. In some embodiments of the lipid of formula CAT-II, each a is different.
[0165] In some embodiments of the lipids of formula CAT-II, R 1A and R 1B is, -W 1 -X 1 -Y 1 That is the case.
[0166] In some embodiments of the lipids of formula CAT-II, -W 1 -X 1 -Y 1 It is defined as follows: Each W 1 C is replaced by arbitrary selection. 1~20 Alkyl and optionally substituted C 2~20 Selected independently from Alkenil, each X 1 This is C substituted by -*O-(C=O)-arbitrary selection. 1~20 Alkyl, -(*C=O)-O-C optionally substituted C 1~20 Alkyl, -*O-(C=O)-C optionally substituted C 2~20 Alkenyl and -(*C=O)-O-Curved C 2~20 Atoms selected independently of alkenyls and marked with an asterisk are W 1 It is connected to each Y 1 This is a C atom substituted with hydrogen, -*O-(C=O)- by any choice. 1~20 Alkyl, -(*C=O)-O-C optionally substituted C 1~20Alkyl, -*O-(C=O)-C optionally substituted C 2~20 Alkenyl and -(*C=O)-O-Curved C 2~20 Atoms selected independently of alkenyls and marked with an asterisk are X 1 It is connected to.
[0167] In some embodiments of the lipids of formula CAT-II, -W 1 -X 1 -Y 1 It is defined as follows: Each W 1 C is replaced by arbitrary selection. A~B Alkyl and optionally substituted C C~D Selected independently from Alkenil, each X 1 This is C substituted by -*O-(C=O)-arbitrary selection. A~B Alkyl, -(*C=O)-O-C optionally substituted C A~B Alkyl, -*O-(C=O)-C optionally substituted C C~D Alkenyl and -(*C=O)-O-Curved C C~D Atoms selected independently of alkenyls and marked with an asterisk are W 1 It is connected to each Y 1 This is a C atom substituted with hydrogen, -*O-(C=O)- by any choice. A~B Alkyl, -(*C=O)-O-C optionally substituted C A~B Alkyl, -*O-(C=O)-C optionally substituted C C~D Alkenyl and -(*C=O)-O-Curved C C~D Atoms selected independently of alkenyls and marked with an asterisk are X 1 It is connected to.
[0168] In some embodiments of the lipids of formula CAT-II, C A~B C 1~20 C C~D C 2~20 In some embodiments, C A~B C 1~15 C C~D C2~15 In some embodiments, C A~B C 1~10 C C~D C 2~10 In some embodiments, C A~B C 3~15 C C~D C 3~15 In some embodiments, C A~B C 3~10 C C~D C 3~10 In some embodiments, C A~B C 3~8 C C~D C 3~8 That is the case.
[0169] In some embodiments of the lipids of formula CAT-II, R 1A and R IB C is replaced by arbitrary selection. 5~50 Alkyl, optionally substituted C 5~50 Alkenyl, C substituted by choice 5~50 Alkinyl, optionally substituted with C 5~50 Acyl and -W 1 -X 1 -Y 1 Each is independently selected from -W 1 -X 1 -Y 1 This is defined herein.
[0170] In some embodiments of the lipids of formula CAT-II, R 1A and R IB C is replaced by arbitrary selection. 5~50 Alkyl, optionally substituted C 5~50 Alkenyl, C substituted by choice 5~50 Alkynyl and optionally substituted C 5~50 Each is selected independently from Ashiru.
[0171] In some embodiments of the lipids of formula CAT-II, R 1A and RIB C is replaced by arbitrary selection. 5~30 Alkyl, optionally substituted C 5~30 Alkenyl, C substituted by choice 5~30 Alkinyl, optionally substituted with C 5~30 Acyl and -W 1 -X 1 -Y 1 Each is independently selected from -W 1 -X 1 -Y 1 This is defined herein.
[0172] In some embodiments of the lipids of formula CAT-II, R 1A and R IB C is replaced by arbitrary selection. 5~30 Alkyl, optionally substituted C 5~30 Alkenyl, C substituted by choice 5~30 Alkynyl and optionally substituted C 5~30 Each is selected independently from Ashiru.
[0173] In some embodiments of the lipids of formula CAT-II, R 1A and R IB C is replaced by arbitrary selection. 5~20 Alkyl, optionally substituted C 5~20 Alkenyl, C substituted by choice 5~20 Alkinyl, optionally substituted with C 5~20 Acyl and -W 1 -X 1 -Y 1 Each is independently selected from -W 1 -X 1 -Y 1 That is the case.
[0174] In some embodiments of the lipids of formula CAT-II, R 1A and R IB C is replaced by arbitrary selection. 5~20 Alkyl, optionally substituted C 5~20 Alkenyl, C substituted by choice5~20 Alkynyl and optionally substituted C 5~20 Each is selected independently from Ashiru.
[0175] In some embodiments of the lipids of formula CAT-II, R 1A and R 1IB Each of these is independently replaced by C by arbitrary selection. 5~50 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~30 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~20 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~15 It is alkyl.
[0176] In some embodiments of the lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~50 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~30 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~20 It is alkyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~15 It is alkyl.
[0177] In some embodiments of the lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection.5~50 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~30 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~20 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~15 It is Alkenil.
[0178] In some embodiments of the lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~50 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~30 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~20 It is an alkenyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~15 It is Alkenil.
[0179] In some embodiments of the lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~50 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~30 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IBEach of these is independently replaced by C by arbitrary selection. 5~20 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of these is independently replaced by C by arbitrary selection. 5~15 It is alkinyl.
[0180] In some embodiments of the lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~50 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~30 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~20 It is an alkynyl. In some embodiments of lipids of formula CAT-II, R 1A and R IB Each of them is independent of C 5~15 It is alkinyl.
[0181] In some embodiments of the lipids of formula CAT-II, R 1A and R IB is not substituted by choice. In some embodiments of the lipids of formula CAT-II, each R 1A They are the same. In some embodiments of the lipids of formula CAT-II, each R 1A In some embodiments of lipids of different formulas CAT-II, each R IB They are the same. In some embodiments of the lipids of formula CAT-II, each R IB These are different. In some embodiments of the lipids of formula CAT-II, R 1A and R IB These are the same. In some embodiments of the lipids of formula CAT-II, R 1A and R 1B They are different.
[0182] In some embodiments, the lipid of formula CAT-II has the following structure: [ka] It is GL-HEPES-E3-E10-DS-3-E18-1(2-(4-(2-((3-(bis((Z)-2-hydroxyoctadeca-9-en-1-yl)amino)propyl)disulfaneyl)ethyl)piperazine-1-yl)ethyl4-(bis(2-hydroxydecyl)amino)butanoate).
[0183] In some embodiments, the lipid of formula CAT-II has the following structure: [ka] It is a 2-(4-(3-((4-(bis((Z)-2-hydroxyoctadeca-9-en-1-yl)amino)butyl)disulfaneyl)propyl)piperazine-1-yl)ethyl 4-(bis(2-hydroxydecyl)amino)butanoate.
[0184] In some embodiments, the lipid of formula CAT-II has the following structure: [ka] It is GL-HEPES-E3-E12-DS-4-E10(2-(4-(2-((3-(bis(2-hydroxydecyl)amino)butyl)disulfaneyl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate).
[0185] In some embodiments, the lipid of formula CAT-II has the following structure: [ka] It is GL-HEPES-E3-E12-DS-3-E14(2-(4-(2-((3-(bis(2-hydroxytetradecyl)amino)propyl)disulfaneyl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate).
[0186] Examples of additional cationic lipids suitable for the LNPs of this disclosure are described in International Publication No. 2022221688, which is incorporated herein by reference in its entirety.
[0187] Other cationic lipids that can be used are described, for example, in International Publication No. 2016176330, International Publication No. 2017049245, and International Publication No. 2017075531.
[0188] Therefore, in some embodiments, cationic lipids are expressed using formula CAT-III: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, L 1 or L 2 One of them is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, -NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O- and L 1 or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, -NR a C(=O)NRa -, -OC(=O)NR a -or-NR a C(=O)O- or direct bond G 1 and G 2 These are, independently, non-substituted C1~C 12 Alkylene and C1~C 12 It is alkenylene, G 3 C1~C 24 Alkylene, C1~C 24 These are alkenylenes, C3-C8 cycloalkylenes, and C3-C8 cycloalkenylenes. R a H or C1~C 12 It is alkyl, R 1 and R 2 These are, independently, C6~C 24 Alkyl or C6-C 24 It is alkenyl, R 3 H, OR 5 , CN, -C(=O)OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 And, R 4 C1~C 12 It is alkyl, R 5 is H or C1-C6 alkyl, and x is 0, 1, or 2.
[0189] Therefore, in some embodiments, cationic lipids are expressed using formula CAT-IV: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, R1 is C 5~30 Alkyl, C 5~20 Selected from the group consisting of alkenyl, -R*YR'', -YR''', and -R''M'R', R2 and R3 are H, C1~14 Alkyl, C 2~14 R2 and R3 are independently selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3, together with the atom to which they are bonded, form a heterocycle or a carbon ring. R4 is C 3~6 Carbocyclyl, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2 and unsubstituted C 1~6 Selected from the group consisting of alkyl groups, Q is a carbocyclic, heterocyclic, -OR, or -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n Selected from OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR and -C(R)N(R)2C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5. Each R5 is C 1~3 Alkyl, C 2~3 Independently selected from the group consisting of alkenyls and H, Each R6 is C 1~3 Alkyl, C 2~3 Independently selected from the group consisting of alkenyls and H, M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups and heteroaryl groups. R7 is C 1~3 Alkyl, C 2~3 Selected from the group consisting of alkenyls and H, R8 is C 3~6 Selected from the group consisting of carbocyclic and heterocyclic rings, R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenil, C 3~6 Selected from the group consisting of carbocyclic and heterocyclic rings, Each R is C 1~3 Alkyl, C 2~3 Independently selected from the group consisting of alkenyls and H, Each R' is C 1~18 Alkyl, C 2~18 Independently selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R'' is C 3~14 Alkyl and C 3~14 Independently selected from the group consisting of alkenils, Each R* is C 1~12 Alkyl and C 2~12 Independently selected from the group consisting of alkenils, Each Y is independent of C 3~6 It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I. m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.
[0190] In some embodiments, cationic lipids are expressed using the formula CAT-V: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, A 1The left side of each listed structure is selected from -C(=O)O-, -C(=O)S-, -C(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -NHC(=O)O-, -SC(=O)NH-, -OCH2CH2O-, -OCH2O-, -OCH(CH3)O-, -S-, and -SS-, and the left side of each listed structure is -(CH2) a - is coupled to Z 1 The following are selected from -OC(=O)-, -SC(=O)-, -NHC(=O)-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)S-, -OCH2CH2O-, -OCH2O-, -OCH(CH3)O-, -S-, and -SS-, and the right side of each listed structure is -(CH2) a - is coupled to Each R is, [ka] (In the formula, each R 1 (which is independently selected from optionally substituted alkyls, optionally substituted alkenyls, and optionally substituted alkynyls), [ka] (In the formula, each R 2 These are optionally substituted alkyls, optionally substituted alkenyls, optionally substituted alkynyls, and -W 1 -X 1 (Selected independently of) Selected independently from, Each W 1 These are independently selected from optionally substituted alkylenes and optionally substituted alkenylenes, and each X 1 The atoms are independently selected from alkyls substituted with -*O-(C=O)-optionally, alkyls substituted with -(*C=O)-O-optionally, alkenyls substituted with -*O-(C=O)-optionally, and alkenyls substituted with -(*C=O)-O-optionally, and the atoms marked with * are W 1 , [ka] (In the formula, each R 3 (which can be independently selected from optionally substituted alkyls, optionally substituted alkenyls, and optionally substituted alkynyls), and [ka] (In the formula, each R 4 (This is independently selected from optionally substituted cycloalkyls or optionally substituted heterocycloalkyls.) It is connected to, At least three R's are [ka] Selected independently from, Each a is independently selected from 2, 3, 4, and 5. Each b is independently selected from 2, 3, 4, 5, 6, 7, 8, 9 and 10, and Each c is independently selected from 2, 3, 4, 5, 6, 7, 8, 9, and 10.
[0191] In some embodiments, the lipid of formula CAT-V is formula CAT-Va: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0192] In some embodiments, the lipid of formula CAT-V is formula CAT-Vb: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0193] In some embodiments of lipids of formula V, formula Va, or formula Vb, R 2 This is an optionally substituted alkyl or -W 1 -X1 In some embodiments of the lipids of formula V, formula Va, or formula Vb, R 2 is an alkyl group that is optionally substituted. In some embodiments of lipids of formula V, formula Va, or formula Vb, R 2 is alkyl. In some embodiments of lipids of formula V, formula Va, or formula Vb, R 2 is, -W 1 -X 1 That is the case.
[0194] In some embodiments of lipids of formula V, formula Va, or formula Vb, each W 1 These are alkylenes that are independently and optionally substituted. In some embodiments of lipids of formula V, formula Va, or formula Vb, each W 1 It is an alkylene, independently.
[0195] In some embodiments of the lipids of formula V, formula Va, or formula Vb, each X 1 The atoms are independently selected from alkyl groups substituted with -*O-(C=O)-optionally and alkyl groups substituted with -(*C=O)-O-optionally, and the atoms marked with * are W 1 It is linked to. In some embodiments of the lipids of formula V, formula Va, or formula Vb, each X 1 The atoms are independently selected from -*O-(C=O)-alkyl and -(*C=O)-O-alkyl, and the atoms marked with * are W 1 It is connected to.
[0196] In some embodiments, the lipid of formula CAT-V has the following structure: [ka] IM-001((3R,3aR,6R,6aR)-hexahydroflou[3,2-b]furan-3,6-diyrbis(4-(bis(2-hydroxydodecyl)amino)butanoate)) or a pharmaceutically acceptable salt thereof.
[0197] In some embodiments, the lipid of formula CAT-V has the following structure: [ka] IS-001((3R,3aR,6S,6aR)-hexahydrofl[3,2-b]furan-3,6-diyrbis(4-(bis(2-hydroxydodecyl)amino)butanoate)) or a pharmaceutically acceptable salt thereof.
[0198] In some embodiments, cationic lipids are expressed using formula CAT-VI: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, m is an integer selected from 1 to 6, for example, 2 to 4. n is an integer selected from 1 to 6, for example, 2 to 4. p is an integer selected from 1 to 6, for example, 2 to 4. R 1 and R 2 This is linear or branched (C1~C 30 ) Alkyl and linear or branched (C2~C 30 ) independently selected from the group consisting of alkenils, Each alkyl and alkenyl is optionally interrupted by one or more groups selected from -C=O-, -C=OO-, and -O-, and / or Each alkyl and alkenyl is optionally substituted with one or more substituents selected from -OR, -CN-, -(C1~C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 3 This is selected from the group consisting of (C1-C6) alkyls that are optionally substituted with one or more substituents selected from H, -OR, -CN-, -(C1-C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 4 and R 5The alkyl or alkenyl is independently selected from the group consisting of linear or branched (C1-C6) alkyls and linear or branched (C2-C6) alkenyls, and each alkyl or alkenyl is optionally substituted with one or more substituents selected from the group consisting of -OR, -CN-, -(C1-C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms and -NRR', or R 4 and R 5 Together with the N atoms to which they are bonded, A 5-6 membered cycloalkyl or heterocycle containing 1-4 heteroatoms selected from O, N, and S, or 5-6 membered aryl or heteroaryl containing 1-4 heteroatoms selected from O, N, and S Forming, The cycloalkyl, heterocyclic, aryl, or heteroaryl is optionally substituted with one or more substituents selected from -OR, -CN-, -(C1~C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 6 and R 7 This is linear or branched (C1~C 30 ) Alkyl and linear or branched (C2~C 30 ) independently selected from the group consisting of alkenils, Each alkyl and alkenyl is optionally interrupted by one or more groups selected from -C=O-, -C=OO-, and -O-, and / or Each alkyl and alkenyl is optionally substituted with one or more substituents selected from -OR, -CN-, -C1~C6 alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms and -NRR', and R and R' are independently selected from H and (C1-C6) alkyl groups.
[0199] In some embodiments of the lipids of formula VI, R 1 and R 2 This is linear or branched (C5~C 30 ) Alkyl and linear or branched (C2~C30 ) Independently selected from the group consisting of alkenyls, each alkyl and alkenyl is optionally substituted with one -OH group. In some embodiments of the lipid of formula VI, R 1 and R 2 These are independently linear or branched (C5~C) molecules substituted with one -OH group. 30 ) is alkyl. In some embodiments of the lipid of formula VI, R 1 and R 2 These are independently linear (C5~C) chains substituted with one -OH group. 30 It is alkyl.
[0200] In some embodiments of the lipids of formula VI, R 4 and R 5 These, together with the N atom to which they are bonded, form a 5-6 member cycloalkyl or heterocyclyl or a 5-6 member heteroaryl containing 1-4 heteroatoms selected from O, N, and S. In some embodiments of the lipid of formula VI, R 4 and R 5 These, together with the N atom to which they are bonded, form a 5-6 member heteroaryl containing 1-4 heteroatoms selected from O, N, and S. In some embodiments of the lipids of formula VI, R 4 and R 5 These, together with the N atom to which they are bonded, form an imidazolyl group.
[0201] In some embodiments of the lipids of formula VI, R 6 and R 7 This is linear or branched (C1~C 30 ) Alkyl and linear or branched (C2~C 30 ) Independently selected from the group consisting of alkenyls. In some embodiments of the lipid of formula VI, R 6 and R 7 These can be linear or branched (C1~C 30 ) is alkyl. In some embodiments of the lipid of formula VI, R 6 and R 7 These are, independently, linear (C1~C30 It is alkyl.
[0202] In some embodiments, the lipid of formula CAT-VI has the following structure: [ka] A2H7iiT6(N-(1-((3-(1H-imidazole-1-yl)propyl)amino)-4-((4-(bis(2-hydroxytetradecyl)amino)butyl)disulfaneil)-1-oxobutan-2-yl)-5-(bis(2-hydroxydecyl)amino)pentanamide) or a pharmaceutically acceptable salt thereof.
[0203] In some embodiments, cationic lipids have the following structure: [ka] This is an MC3 that has the following characteristics.
[0204] In some embodiments, cationic lipids have the following structure: [ka] It is SM-102 (9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate).
[0205] In some embodiments, cationic lipids have the following structure: [ka] This is ALC-0315[(4-hydroxybutyl)azandiyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate).
[0206] In some embodiments, cationic lipids have the following structure: [ka] This is cOrn-EE1, which has [the following characteristics].
[0207] In some embodiments, cationic lipids have the following structure: [ka] This is BAL-005 (bis(3-(bis(2-hydroxydodecyl)amino)propyl)2,2'-(methylazandiyl)diacetate) which has the following properties.
[0208] In some embodiments, cationic lipids have the following structure: [ka] This is BAL-020 (bis(3-(bis(2-hydroxydodecyl)amino)propyl)3-hydroxy-3-methylpentanediote).
[0209] In some embodiments, cationic lipids have the following structure: [ka] It is HEP-E4-E12[(2,5-dimethylpiperazine-1,4-diyl)bis(ethane-2,1-diyl)bis(5-(bis(2-hydroxydodecyl)amino)pentanoate)] which has [the specified property].
[0210] In some embodiments, cationic lipids have the following structure: [ka] It is TL1-12D-DMA (tris(5-(octanoyloxy)pentyl)2-((3-(dimethylamino)propanoyl)oxy)propane-1,2,3-tricarboxylate).
[0211] In some embodiments, the cationic lipids are cKK-E10, OF-02, [(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl]4-(dimethylamino)butanoate (D-Lin-MC3-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLin-DMA), di((Z)-non-2-en-1-yl)9-((4-(dimethylamino )Butanoyl)oxy)heptadecanedioate (L319), 9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102), [(4-hydroxybutyl)azandiyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), [3-(dimethylamino)-2-[(Z)-octadeca-9-enoyl]oxypropyl](Z)-octadeca-9-enoate (DODAP), 2,5-bis(3-aminopropylamino )-N-[2-[di(heptadecyl)amino]-2-oxoethyl]pentanamide (DOGS), [(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3-yl]N-[2-(dimethylamino)ethyl]carbamate (DC-Chol), tetrakis(8-methylnonyl)3,3',3'',3'''-(((methylazandyl (Iyl)bis(propane-3,1-diyl))bis(azantriyl))tetrapropionate (306Oi10), decyl(2-(dioctylammonio)ethyl)phosphate (9A1P9), ethyl 5,5-di((Z)-heptadeca-8-en-1-yl)-1-(3-(pyrrolidine-1-yl)propyl)-2,5-dihydro-1H-imidazole-2-carboxylate (A2-Iso5-2DC18), bis(2-(dodecyldisulfanyl)ethyl)3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6-Diazahexacosyl)azandiyl)dipropionate (BAME-O16B), 1,1'-((2-(4-(2-((2-((bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azandiyl)bis(dodecane-2-ol)(C12-200), 3,6-bis(4-(bis(2-hydroxydodecyl )amino)butyl)piperazine-2,5-dione (cKK-E12), hexa(octan-3-yl)9,9',9'',9''',9'''',9''''-((((benzene-1,3,5-tricarbonyl)iris(azandiyl))tris(propane-3,1-diyl))tris(azantriyl))hexanonaate (FTT5), (((3,6-dioxopiperazine-2 ,5-diyl)bis(butane-4,1-diyl))bis(azantriyl))tetrakis(ethane-2,1-diyl)(9Z,9'Z,9''Z,9'''Z,12Z,12'Z,12''Z,12'''Z)-tetrakis(octadeca-9,12-dienoate)(OF-Deg-Lin),TT3,N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1, The following can be selected from the group including 3,5-tricarboxamide, N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamide)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), heptadecan-9-yl8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (Lipid 5), GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14 and combinations thereof.
[0212] In some embodiments, cationic lipids are biodegradable.
[0213] In some embodiments, cationic lipids are not biodegradable.
[0214] In some embodiments, cationic lipids are cleavable.
[0215] In some embodiments, cationic lipids are not cleavable.
[0216] Cationic lipids are described in Dong et al. (PNAS.111;11:3955-60.2014), Fenton et al. (Adv Mater.28:2939.2016), U.S. Patent No. 9,512,073, U.S. Patent No. 10,201,618, European Patent No. 22307007.9, and International Publication No. 22307007.9 (each of which is incorporated herein by reference).
[0217] Glycerides and acyl glycols Glycerides or acyl glycols are hydrophobic ester compounds formed from glycerin and fatty acids, and they facilitate the delivery of LNPs. Therefore, LNPs of the present disclosure containing glycerides or acyl glycols may exhibit improved delivery efficiency compared to LNPs that do not contain glycerides or acyl glycols.
[0218] In some embodiments, the glyceride or acyl glycol is a monoglyceride, diglyceride, triglyceride, or diacyl glycol. In some embodiments, the glyceride is a monoglyceride. In some embodiments, the glyceride is a diglyceride. In some embodiments, the glyceride is a triglyceride. In some embodiments, the acyl glycol is a diacyl glycol.
[0219] In some embodiments, the glyceride or acyl glycol is of formula I or formula II: [ka] It has a structure such that, in the formula, R G1 、R G2 and R G3 are each independently H, -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl, and these -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl are each independently selected from 1 to 3 groups independently selected from -OC(O)C (1~25) alkyl, -OC(O)C (1~25) alkenyl, -C(O)OC (1~25) alkyl, -C(O)OC (1~25) alkenyl, -OC (1~25) alkyl, -OC (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl and are optionally substituted, provided that no more than two of R G1 、R G2 and R G3 are H, R G4 is -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl, and each of these is independently selected from 1 to 3 groups independently selected from -OC(O)C (1~25) alkyl, -OC(O)C (1~25) alkenyl, -C(O)OC (1~25) alkyl, -C(O)OC (1~25) alkenyl, -OC (1~25) alkyl, -OC (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl and are optionally substituted, R G5 is H, -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C(1~25) alkyl or -C(O)C (1~25) is alkenyl, and these -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl is -OC(O)C (1~25) alkyl, -OC(O)C (1~25) alkenyl, -C(O)OC (1~25) alkyl, -C(O)OC (1~25) alkenyl, -OC (1~25) alkyl, -OC (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl is optionally substituted with one to three groups independently selected from
[0220] In some embodiments, the glyceride or acyl glycol has a structure according to Formula I or Formula II, wherein R G1 , R G2 and R G3 are each independently H, -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl, provided that no more than two of R G1 , R G2 and R G3 are H, R G4 is -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl, R G5 is H, -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl.
[0221] In some embodiments, the glyceride or acyl glycol is of formula I: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are H and -C, respectively, independently. (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl. However, R G1 , R G2 and R G3 If there are two or fewer of these, then it is H.
[0222] In some embodiments, the glyceride or acyl glycol is of formula I: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are H and -C, respectively, independently. (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C(1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Is optionally substituted with one to three groups independently selected from alkenyl, Provided that R G1 , R G2 And R G3 At most two of them are H.
[0223] In some embodiments, the glyceride or acyl glycol of formula I is of formula Ia or Ib: < [ka] It has a structure such that, in the formula, R G1 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0225] In some embodiments of the glycerides or acyl glycols of formula Ia, R G1 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0226] In some embodiments of the glycerides or acyl glycols of formula Ia, R G1 is -C (11~25) Alkyl, -C (11~25) Alkenyl, -C(O)C (11~25) Alkyl or -C(O)C (11~25) It is Alkenil.
[0227] In some embodiments, the glyceride or acyl glycol of formula I is formula Ib: [ka] It has a structure such that, in the formula, R G2 is -C (1~25) Alkyl, -C (1~25)Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0228] In some embodiments of the glycerides or acyl glycols of formula Ib, R G2 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0229] In some embodiments of the glycerides or acyl glycols of formula Ib, R G2 is -C (11~25) Alkyl, -C (11~25) Alkenyl, -C(O)C (11~25) Alkyl or -C(O)C (11~25) It is Alkenil.
[0230] In some embodiments of glycerides or acyl glycols of formula I, Ia, or Ib, R G1 and R G2 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0231] In some embodiments of glycerides or acyl glycols of formula I, Ia, or Ib, R G1 and R G2 These are, independently, -C (11~25)Alkyl, -C (11~25) Alkenyl, -C(O)C (11~25) Alkyl or -C(O)C (11~25) It is Alkenil.
[0232] In some embodiments, the glyceride or acyl glycol of formula I is formula Ic or Id: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0233] In some embodiments, the glyceride or acyl glycol of formula I is formula Ic: [ka] It has a structure such that, in the formula, R G1 and R G2 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25)Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0234] In some embodiments of glycerides or acyl glycols of formula Ic, R G1 and R G2 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0235] In some embodiments of glycerides or acyl glycols of formula Ic, R G1 and R G2 These are, independently, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0236] In some embodiments of glycerides or acyl glycols of formula Ic, R G1 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is Alkenil.
[0237] In some embodiments of glycerides or acyl glycols of formula Ic, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0238] In some embodiments, the glyceride or acyl glycol of formula I is formula Id: [ka] It has a structure such that, in the formula, R G1 and R G3These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0239] In some embodiments of glycerides or acyl glycols of formula Id, R G1 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0240] In some embodiments of glycerides or acyl glycols of formula I, Ic, or Id, R G1 , R G2 and R G3 These are, independently, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0241] In some embodiments of glycerides or acyl glycols of formula I, Ic, or Id, R G1 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is Alkenil.
[0242] In some embodiments of glycerides or acyl glycols of formula I, Ic, or Id, R G2 is -C(O)C (1~25)Alkyl or -C(O)C (1~25) It is Alkenil.
[0243] In some embodiments of glycerides or acyl glycols of formula I, Ic, or Id, R G3 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is Alkenil.
[0244] In some embodiments of glycerides or acyl glycols of formula I, Ic, or Id, R G1 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is alkenyl, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is an alkenyl, and R G3 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is Alkenil.
[0245] In some embodiments, the glyceride or acyl glycol of formula I is formula Ie: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C(1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0246] In some embodiments, the glyceride or acyl glycol of formula I has a structure according to formula Ie, where R G1 , R G2 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0247] In some embodiments of glycerides or acyl glycols of formula I or Ie, R G1 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0248] In some embodiments of glycerides or acyl glycols of formula I or Ie, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0249] In some embodiments of glycerides or acyl glycols of formula I or Ie, R G3 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0250] In some embodiments of glycerides or acyl glycols of formula I or Ie, R G1 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is alkenyl, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl, and R G3 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0251] In some embodiments of glycerides or acyl glycols of formula I or Ie, R G1 , R G2 and R G3 These are, independently, -C(O)C (7~21) Alkyl or -C(O)C (7~21) It is Alkenil.
[0252] In some embodiments, the glyceride or acyl glycol is of formula II: [ka] It has a structure such that, in the formula, R G4 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C(1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl. R G5 H, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0253] In some embodiments, the glyceride or acyl glycol of formula II is formula IIa or IIb: [ka] It has a structure such that, in the formula, R G4 and R G5 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25)Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0254] In some embodiments, the glyceride or acyl glycol of formula II is formula IIa: [ka] It has a structure such that, in the formula, R G4 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0255] In some embodiments, the glyceride or acyl glycol of formula II has the structure according to formula IIa, where R G4 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0256] In some embodiments, the glyceride or acyl glycol of formula II is formula IIb: [ka] It has a structure such that, in the formula, R G4 and R G5 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0257] In some embodiments, the glyceride or acyl glycol of formula II has the structure according to formula IIb, where R G4 and R G5 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0258] In one or more embodiments of the glyceride or acyl glycol of formula II, IIa, or IIb, R G4 and R G5 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0259] In one or more embodiments of the glyceride or acyl glycol of formula II, IIa, or IIb, R G4 and R G5 These are, independently, -C(O)C(1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0260] In one or more embodiments, the glyceride or acyl glycol is selected from the group consisting of the following or combinations thereof.
[0261] [Table 1]
[0262] [Table 2]
[0263] [Table 3]
[0264] In some embodiments, the glyceride or acyl glycol is C18(plasm)MG. In some embodiments, the glyceride or acyl glycol is 08:0 DG. In some embodiments, the glyceride or acyl glycol is 10:0 DG. In some embodiments, the glyceride or acyl glycol is 12:0 DG. In some embodiments, the glyceride or acyl glycol is 14:0 DG. In some embodiments, the glyceride or acyl glycol is 15:0-18:1 DG. In some embodiments, the glyceride or acyl glycol is 16:0 ethylene glycol. In some embodiments, the glyceride or acyl glycol is 16:0 DG. In some embodiments, the glyceride or acyl glycol is 16:0-18:1 DG. In some embodiments, the glyceride or acyl glycol is 18:0 DG.
[0265] In some embodiments, the glyceride or acyl glycol is 18:0-16:0 DG. In some embodiments, the glyceride or acyl glycol is 18:0-18:2 DG. In some embodiments, the glyceride or acyl glycol is 18:0-20:4 DG. In some embodiments, the glyceride or acyl glycol is 18:0-22:6 DG. In some embodiments, the glyceride or acyl glycol is 18:1 ethylene glycol. In some embodiments, the glyceride or acyl glycol is 18:1 DG. In some embodiments, the glyceride or acyl glycol is tributylin. In some embodiments, the glyceride or acyl glycol is tricaproine. In some embodiments, the glyceride or acyl glycol is trioctanoin. In some embodiments, the glyceride or acyl glycol is 15:0-18:1-15:0 TG. In some embodiments, the glyceride or acyl glycol is 16:0-(12-PAHSA)-18:1 TG.
[0266] In some embodiments, the glyceride or acyl glycol is selected from the group consisting of the following or combinations thereof.
[0267] [Table 4]
[0268] [Table 5]
[0269] In some embodiments, the glyceride or acyl glycol is 1-C16 ether MG. In some embodiments, the glyceride or acyl glycol is 18:1-2:0 DG. In some embodiments, the glyceride or acyl glycol is trilaurin. In some embodiments, the glyceride or acyl glycol is trilinolein. In some embodiments, the glyceride or acyl glycol is glyceryltrinonadecanoate. In some embodiments, the glyceride or acyl glycol is tripalmitin.
[0270] In some embodiments, the glyceride or acyl glycol is selected from the group consisting of the following or combinations thereof.
[0271] [Table 6]
[0272] In some embodiments, the glyceride or acyl glycol is monoolein. In some embodiments, the glyceride or acyl glycol is monolinolein. In some embodiments, the glyceride or acyl glycol is trimyristine. In some embodiments, the glyceride or acyl glycol is tristearin. In some embodiments, the glyceride or acyl glycol is trialakidine.
[0273] In some embodiments, glycerides or acyl glycols are selected from the following:
[0274] [Table 7]
[0275] In some embodiments, the glyceride or acyl glycol is diolein. In some embodiments, the glyceride or acyl glycol is tricaprine. In some embodiments, the glyceride or acyl glycol is triolein.
[0276] In one or more embodiments, the glyceride or acyl glycol is hydrolyzable by lipase.
[0277] structural lipids Structural lipid components provide stability to the lipid bilayer structure within the nanoparticles. In some embodiments, LNPs include one or more structural lipids. Suitable cholesterol-based lipids include, for example, DC-Choi(N,N-dimethyl-N-ethylcarboxamide cholesterol) and 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991) 179:280, Wolf et al.). al., BioTechniques (1997) 23:139, US Patent No. 5,744,335), Imidazole cholesterol ester ("ICE", International Publication No. 2011 / 068810 pamphlet), sitosterol (22,23-dihydrostigmasterol), β-sitosterol, sitostanol, fucosterol, stigmasterol (stigma-5,22-dien-3-ol), ergosterol, desmosterol (3β-hydroxy-5,24-cholesterol), lanosterol (8,24-lanostadien-3b-ol), 7-dehydrocholesterol (Δ5,7-cholesterol), dihydrolanosterol (24, Other modified forms of cholesterol include 25-dihydrolanosterol, thymosterol (5α-cholesta-8,24-diene-3β-ol), lasosterol (5α-cholesta-7-ene-3β-ol), diosgenin ((3β,25R)-spirosto-5-ene-3-ol), campesterol (campesto-5-ene-3β-ol), campestanol (5α-campestan-3β-ol), 24-methylenecholesterol (5,24(28)-cholestadiene-24-methylene-3β-ol), cholesteryl margalate (cholesta-5-ene-3β-ylheptadecanoate), cholesteryl oleate, cholesteryl stearate, and others.
[0278] In some embodiments, the structural lipid is cholesterol.
[0279] Stealth lipids Stealth lipid components provide control over the particle size and stability of nanoparticles. Adding such components can prevent complex aggregation, extend circulating lifespan, and provide a means to increase the delivery of lipid-nucleic acid drug compositions to target tissues.
[0280] In some embodiments, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid. These components may be selected to be rapidly replaced from the pharmaceutical composition in vivo (see, for example, U.S. Patent No. 5,885,613).
[0281] The intended PEGylated lipids include derivatized ceramides (e.g., N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)](C8 PEG ceramide)), such as C6-C6 PEGylated lipids. 20 (For example, C8, C 10 , C 12 , C 14 , C 16 or C 18 Examples include, but are not limited to, polyethylene glycol (PEG) up to 5 kDa in length, covalently bonded to a lipid having an alkyl chain of ) length. In some embodiments, the PEGylated lipid is 1,2-dimiristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DLPE-PEG), or 1,2-distearoyl-rac-glycero-polyethylene glycol (DSG-PEG).
[0282] In some embodiments, PEG has a high molecular weight, for example, 2000 to 2400 g / mol. In some embodiments, PEG is PEG2000 (or PEG-2K). In some embodiments, the PEGylated lipids as used herein are DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, or C8 PEG2000. In some embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000).
[0283] Helper lipids Helper lipids enhance the structural stability of LNPs and assist in LNP extrusion into endosomes. This improves the uptake and release of mRNA drug payloads. In some embodiments, the helper lipids are zwitterionic lipids. While we do not wish to be constrained by theory, helper lipids may possess fusion properties to facilitate the uptake and release of drug payloads. Examples of helper lipids include 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), 1,2-dieridoyl-sn-glycero-3-phosphoethanolamine (DEPE), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-distearoylphosphatidylethanolamine (DSPE), and 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).
[0284] Other exemplary helper lipids include dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidiethanolamine (SOPE), or combinations thereof.
[0285] In certain embodiments, the helper lipid is DOPE.
[0286] Combinations and molar ratios of lipid components In some embodiments, LNP is (I) a cationic lipid and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristin, 15:0-18:1-15:0 The (III) structural lipid comprises TG, 16:0-(12-PAHSA)-18:1 TG, a glyceride or acyl glycol selected from the group consisting of tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitin, and combinations thereof.
[0287] In some embodiments, LNP is (I) a cationic lipid and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristin, 15:0-18:1-15:0 The (III) comprises TG, 16:0-(12-PAHSA)-18:1 TG, a glyceride or acyl glycol selected from the group consisting of tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitin, and combinations thereof, and a helper lipid.
[0288] In some embodiments, LNP is (I) a cationic lipid and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristin, 15:0-18:1-15:0 The (III) stealth lipid comprises TG, 16:0-(12-PAHSA)-18:1 TG, a glyceride or acyl glycol selected from the group consisting of tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitin, and combinations thereof, and (III) stealth lipids.
[0289] In some embodiments, LNP is (I) a cationic lipid and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristin, 15:0-18:1-15:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0290] In some embodiments, the LNP comprises (I) a cationic lipid, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitine, and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0291] In some embodiments, the LNP comprises (I) a cationic lipid, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitin, and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0292] In some embodiments, the LNP comprises (I) a cationic lipid, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0293] In some embodiments, the LNP comprises (I) a cationic lipid, (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0294] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol, and (III) a structural lipid.
[0295] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol, and (III) a helper lipid.
[0296] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol, and (III) a stealth lipid.
[0297] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0298] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0299] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0300] In some embodiments, the LNP comprises (I) a cationic lipid which is cKK-E10, OF-02, or GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0301] In some embodiments, the LNP comprises (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020, or BAL-005; (II) a glyceride or acyl glycol; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0302] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, and (III) a structural lipid.
[0303] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, and (III) a helper lipid.
[0304] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, and (III) a stealth lipid.
[0305] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0306] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0307] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I or formula II, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0308] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0309] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula Ia or formula Ib, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0310] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula Ic or formula Id, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0311] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula Ie, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0312] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, or formula Ie, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0313] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, or formula Ie, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0314] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, or formula Ie, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0315] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula II, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0316] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula IIa or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0317] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol having a structure according to formula IIa or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0318] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula IIa or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0319] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0320] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0321] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0322] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0323] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0324] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0325] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0326] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0327] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0328] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitin, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0329] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitin, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0330] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitin, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0331] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0332] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0333] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0334] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I or formula CAT-II, (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0335] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-I, (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0336] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-II, (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0337] In some embodiments, the LNP is (I) a cationic lipid which is cKK-E10, OF-02 or GL-HEPES-E3-E12-DS-4-E10, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0338] In some embodiments, the LNP comprises (I) a cationic lipid which is cKK-E10, OF-02, or GL-HEPES-E3-E12-DS-4-E10; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0339] In some embodiments, the LNP comprises (I) a cationic lipid which is cKK-E10, OF-02, or GL-HEPES-E3-E12-DS-4-E10; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitin, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0340] In some embodiments, the LNP comprises (I) a cationic lipid which is cKK-E10, OF-02, or GL-HEPES-E3-E12-DS-4-E10; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0341] In some embodiments, the LNP comprises (I) a cationic lipid which is cKK-E10, OF-02, or GL-HEPES-E3-E12-DS-4-E10; (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0342] In some embodiments, the LNP is (I) GL-HEPES-E3-E12-DS-4-E10 and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0343] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0344] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprine, trilaurine, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0345] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of diolein, dilinolein, trimiristin, tristearin, trialakidine and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0346] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of trimiristin, tristearin and combinations thereof, and (III) one or more lipids selected from the group consisting of structural lipids, helper lipids and stealth lipids.
[0347] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of trimyristin, tristearin and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0348] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) trimyristin, and (III) one or more lipids selected from the group consisting of structural lipids, helper lipids, and stealth lipids.
[0349] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) trimyristin, (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0350] In some embodiments, the LNP is (I) GL-HEPES-E3-E12-DS-4-E10 and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0351] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, triptyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof, (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0352] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprine, trilaurine, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof, (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0353] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) a glyceride or acyl glycol selected from the group consisting of diolein, dilinolein, trimyristine, tristearin, trialakidine and combinations thereof, (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0354] In some embodiments, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) trimyristine, (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0355] In some embodiments, the LNP is (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020 or BAL-005, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0356] In some embodiments, the LNP comprises (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020, or BAL-005; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0357] In some embodiments, the LNP comprises (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020, or BAL-005; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tricaprin, trilaurin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitin, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0358] In some embodiments, the LNP comprises (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020, or BAL-005; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, tricaprin, trimiristin, tristearin, triolein, trialakidine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0359] In some embodiments, the LNP comprises (I) a cationic lipid which is TL1-12D-DMA, HEP-E4-E12, BAL-020, or BAL-005; (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, triolein, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0360] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol, and (III) one or more lipids selected from the group consisting of (a) structural lipids, (b) helper lipids, and (c) stealth lipids.
[0361] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0362] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0363] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0364] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0365] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, dilinolein, tricaprin, trimiristin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0366] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V; (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0367] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol selected from the group consisting of tricaprin, trimyristin, triolein, glyceryltrinonadecanoate, trialakidine and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0368] In some embodiments, the LNP comprises (I) a cationic lipid that is IM-001 or IS-001, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid. In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0369] In some embodiments, the LNP is (I) a cationic lipid which is IM-001 or IS-001, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0370] In some embodiments, the LNP comprises (I) a cationic lipid which is IM-001 or IS-001; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0371] In some embodiments, the LNP comprises (I) a cationic lipid which is IM-001 or IS-001; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, dilinolein, tricaprin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialacidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0372] In some embodiments, the LNP comprises (I) a cationic lipid which is IM-001 or IS-001; (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialacidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0373] In some embodiments, the LNP comprises (I) a cationic lipid which is IM-001 or IS-001; (II) a glyceride or acyl glycol selected from the group consisting of tricaprin, trimiristin, triolein, glyceryltrinonadecanoate, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0374] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI, (II) a glyceride or acyl glycol, and (III) one or more lipids selected from the group consisting of (a) structural lipids, (b) helper lipids, and (c) stealth lipids.
[0375] In some embodiments, LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid. In some embodiments, LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0376] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0377] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0378] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, dilinolein, tricaprin, trimiristin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0379] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, tricaprin, trimiristin, tristearin, triolein, glyceryltrinonadecanoate and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0380] In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-VI, (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, tricaprin, triolein and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0381] In some embodiments, the LNP comprises (I) a cationic lipid that is A2H7iiT6, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid. In some embodiments, the LNP comprises (I) a cationic lipid having a structure according to formula CAT-V, (II) a glyceride or acyl glycol having a structure according to formula I, formula Ia, formula Ib, formula Ic, formula Id, formula Ie, formula II, formula IIa, or formula IIb, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0382] In some embodiments, the LNP is (I) a cationic lipid that is A2H7iiT6, and (II) 1-C16 ether MG, monoolein, C18 (plasm) MG, monolinolein, 08:0 DG, 10:0 DG, 12:0 DG, 14:0 DG, 15:0-18:1 DG, 16:0 ethylene glycol, 16:0 DG, 16:0-18:1 DG, 18:0 DG, diolein, 18:0-16:0 DG, 18:0-18:2 DG, 18:0-20:4 DG, 18:0-22:6 DG, 18:1 ethylene glycol, 18:1 DG, 18:1-2:0 The material comprises (III) structural lipids, (IV) helper lipids, and (V) stealth lipids.
[0383] In some embodiments, the LNP comprises (I) a cationic lipid that is A2H7iiT6; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, monolinolein, diolein, 18:1-2:0 DG, dilinolein, tributyline, tricaproin, trioctanoin, tricaprin, trilaurin, trimiristine, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialaxidine, tripalmitine, and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0384] In some embodiments, the LNP comprises (I) a cationic lipid that is A2H7iiT6; (II) a glyceride or acyl glycol selected from the group consisting of monoolein, diolein, dilinolein, tricaprin, trimiristin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine and combinations thereof; (III) a structural lipid; (IV) a helper lipid; and (V) a stealth lipid.
[0385] In some embodiments, the LNP comprises (I) a cationic lipid that is A2H7iiT6, (II) a glyceride or acyl glycol selected from the group consisting of diolein, tricaprin, trimiristin, tristearin, triolein, trilinolein, glyceryltrinonadecanoate, trialakidine and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0386] In some embodiments, the LNP comprises (I) a cationic lipid that is A2H7iiT6, (II) a glyceride or acyl glycol selected from the group consisting of tricaprin, trimiristin, triolein, glyceryltrinonadecanoate, trialakidine and combinations thereof, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0387] In some embodiments, cationic lipids may constitute a molar ratio of about 1% to about 90%, about 2% to about 70%, about 5% to about 50%, about 10% to about 40%, or about 20% to about 70% of the total lipids present in the lipid nanoparticles. In some embodiments, cationic lipids may constitute a molar ratio of 35% to about 55% of the total lipids present in the lipid nanoparticles. In some embodiments, cationic lipids may constitute a molar ratio of about 40% of the total lipids present in the lipid nanoparticles. In some embodiments, cationic lipids may constitute a molar ratio of about 45% of the total lipids present in the lipid nanoparticles. In some embodiments, cationic lipids may constitute a molar ratio of about 50% of the total lipids present in the lipid nanoparticles.
[0388] In some embodiments, structural lipids may constitute a molar ratio of about 5% to about 90% or about 10% to about 70% of the total lipids present in the lipid nanoparticles. In some embodiments, structural lipids may constitute a molar ratio of 20% to 35% of the total lipids present in the lipid nanoparticles. In some embodiments, structural lipids may constitute a molar ratio of about 25% of the total lipids present in the lipid nanoparticles. In some embodiments, structural lipids may constitute a molar ratio of about 28.5% of the total lipids present in the lipid nanoparticles.
[0389] In some embodiments, the helper lipids and glycerides or acyl glycols may constitute a combined molar ratio of about 2% to about 90% or about 5% to about 70% of the total lipids present in the lipid nanoparticles. In some embodiments, the helper lipids and glycerides or acyl glycols may constitute a combined molar ratio of 10% to 35% of the total lipids present in the lipid nanoparticles. In some embodiments, the helper lipids and glycerides or acyl glycols may constitute a combined molar ratio of 15% to 35% of the total lipids present in the lipid nanoparticles. In some embodiments, the helper lipids and glycerides or acyl glycols may constitute a combined molar ratio of about 30% of the total lipids present in the lipid nanoparticles.
[0390] In some embodiments, helper lipids may constitute a molar ratio of about 2% to about 90% or about 5% to about 70% of the total lipids present in the lipid nanoparticles. In some embodiments, helper lipids may constitute a molar ratio of 10% to 35% of the total lipids present in the lipid nanoparticles. In some embodiments, helper lipids may constitute a molar ratio of 15% to 35% of the total lipids present in the lipid nanoparticles. In some embodiments, helper lipids may constitute a molar ratio of about 25% of the total lipids present in the lipid nanoparticles.
[0391] In some embodiments, glycerides or acyl glycols may constitute a molar ratio of about 1% to about 20%, about 1% to about 20%, about 1% to about 15%, or about 1% to about 10% of the total lipids present in the lipid nanoparticles. In some embodiments, glycerides or acyl glycols may constitute a molar ratio of 1% to about 15% of the total lipids present in the lipid nanoparticles. In some embodiments, glycerides or acyl glycols may constitute a molar ratio of 1% to about 10% of the total lipids present in the lipid nanoparticles. In some embodiments, glycerides or acyl glycols may constitute a molar ratio of about 5% of the total lipids present in the lipid nanoparticles.
[0392] In some embodiments, stealth (e.g., PEGylated) lipids may constitute a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, or about 1% to about 10% of the total lipids present in the lipid nanoparticles. In some embodiments, stealth (e.g., PEGylated) lipids may constitute a molar ratio of 0.25% to 2.75% of the total lipids present in the lipid nanoparticles. In some embodiments, stealth (e.g., PEGylated) lipids may constitute a molar ratio of 0.25% to 8.75% of the total lipids present in the lipid nanoparticles. In some embodiments, stealth (e.g., PEGylated) lipids may constitute a molar ratio of about 1.5% of the total lipids present in the lipid nanoparticles. In some embodiments, stealth (e.g., PEGylated) lipids may constitute a molar ratio of about 3% of the total lipids present in the lipid nanoparticles.
[0393] In some embodiments, the LNP comprises a cationic lipid in a molar ratio of 35% to 45%, a structural lipid in a molar ratio of 20% to 35%, a stealth lipid in a molar ratio of 0.25% to 8.75%, and a combined molar ratio of helper lipids and glycerides or acyl glycols in a molar ratio of 10% to 35%. In some embodiments, the LNP comprises a cationic lipid in a molar ratio of about 40%, a structural lipid in a molar ratio of about 28.5%, a stealth lipid in a molar ratio of about 1.5%, and a combined molar ratio of helper lipids and glycerides or acyl glycols in a molar ratio of about 30%.
[0394] In some embodiments, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 35% to 45%, cholesterol in a molar ratio of 20% to 35%, DMG-PEG2000 in a molar ratio of 0.25% to 8.75%, and DOPE and trimiristin in a combined molar ratio of 10% to 35%.
[0395] In some embodiments, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 35% to 45%, cholesterol in a molar ratio of 20% to 35%, DMG-PEG2000 in a molar ratio of 0.25% to 8.75%, DOPE in a molar ratio of 15% to 35%, and trimiristin in a molar ratio of 1% to 10%.
[0396] In some embodiments, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of about 40%, cholesterol in a molar ratio of about 28.5%, DMG-PEG2000 in a molar ratio of about 1.5%, and DOPE and trimiristin in a combined molar ratio of about 30%.
[0397] In some embodiments, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of about 40%, cholesterol in a molar ratio of about 28.5%, DMG-PEG2000 in a molar ratio of about 1.5%, DOPE in a molar ratio of about 25%, and trimiristin in a molar ratio of about 5%.
[0398] To calculate the actual amount of each lipid (including glycerides or acyl glycols) contained in an LNP formulation, first determine the molar amount of the cationic lipid based on the desired N / P ratio (where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA transported by the LNP). Next, calculate the molar amount of each of the other lipids based on the molar amount of the cationic lipid and the selected molar ratio. Then, convert these molar amounts to weight using the molecular weight of each lipid.
[0399] LNP active ingredients The active component of this LNP composition may be mRNA encoding the target polypeptide. In certain embodiments, the polypeptide is an antigen. In certain embodiments, the polypeptide is a therapeutic polypeptide. The therapeutic polypeptide may be an antibody (e.g., antibody heavy chain or antibody light chain). The therapeutic polypeptide may be an enzyme.
[0400] An mRNA molecule encapsulated by an LNP of this disclosure may comprise at least one ribonucleic acid (RNA) containing an ORF encoding the polypeptide of interest. In certain embodiments, the mRNA further comprises at least one 5'UTR, 3'UTR, poly(A) tail and / or 5' cap.
[0401] A.5' Cap The 5' cap of mRNA can provide resistance to nucleases found in most eukaryotic cells and can enhance translational efficiency. Several types of 5' caps are known. The 7-methylguanosine cap (also called "m7G" or "cap 0") contains guanosine linked to the first transcribed nucleotide via a 5'-5'-triphosphate bond.
[0402] The 5' cap is typically added as follows: first, one of the terminal phosphate groups is removed from the 5' nucleotide by a phosphatase at the end of the RNA, leaving two terminal phosphates; then guanosine triphosphate (GTP) is added to the terminal phosphate by guanylyltransferase to form a 5'5'5 triphosphate bond; and then the 7-nitrogen of guanine is methylated by methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp, (5'(A,G(5')ppp(5')A and G(5')ppp(5')G. Further cap structures are described in U.S. Patent Application Publication 2016 / 0032356 and U.S. Patent Application Publication 2018 / 0125989, which are incorporated herein by reference.
[0403] To generate 5'-guanosine cap structures according to the manufacturer's protocol, the following chemical RNA cap analogues can be used to simultaneously complete the 5'-cap addition of polynucleotides during in vitro transcription reactions: 3'-O-Me-m7G(5')ppp(5')G(ARCA cap), G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA, TriLink Biotechnologies). Using vaccinia virus capaddase, the 5'-cap addition of modified RNA can be completed post-transcriptionally to produce the cap 0 structure: m7G(5')ppp(5')G. Using both vaccinia virus capaddase and 2'-O methyltransferase, the cap 1 structure can be produced to produce m7G(5')ppp(5')G-2'-O-methyl. The cap 2 structure can be generated from the cap 1 structure, followed by 2'-O methylation of the 5'-nucleotide using 2'-O methyltransferase. The cap 3 structure can be generated from the cap 2 structure, followed by 2'-O methylation of the 5'-nucleotide using 2'-O methyltransferase.
[0404] In certain embodiments, the mRNA of the Disclosure includes a 5' cap selected from the group consisting of 3'-O-Me-m7G(5')ppp(5')G(ARCA cap), G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG.
[0405] In certain embodiments, the mRNA of this disclosure includes the following 5' cap. [ka]
[0406] B. Untranslated Region (UTR) In some embodiments, the mRNA of this disclosure includes a 5' and / or 3' untranslated region (UTR). In mRNA, the 5' UTR begins at the transcription start site and continues to the start codon, but does not contain the start codon. The 3' UTR begins immediately after the stop codon and continues to the transcription termination signal.
[0407] In some embodiments, the mRNA disclosed herein may include a 5'UTR containing one or more elements that affect mRNA stability or translation. In some embodiments, the 5'UTR may be about 10 to 5,000 nucleotides long. In some embodiments, the 5'UTR may be about 50 to 500 nucleotides long. In some embodiments, the 5'UTR may be at least about 10 nucleotides long, about 20 nucleotides long, about 30 nucleotides long, about 40 nucleotides long, about 50 nucleotides long, about 100 nucleotides long, about 150 nucleotides long, about 200 nucleotides long, about 250 nucleotides long, about 300 nucleotides long, about 350 nucleotides long, about 400 nucleotides long, about 450 nucleotides long, about 500 nucleotides long, about 550 nucleotides long, about 600 nucleotides long, about The lengths are approximately 650 nucleotides, 700 nucleotides, 750 nucleotides, 800 nucleotides, 850 nucleotides, 900 nucleotides, 950 nucleotides, 1,000 nucleotides, 1,500 nucleotides, 2,000 nucleotides, 2,500 nucleotides, 3,000 nucleotides, 3,500 nucleotides, 4,000 nucleotides, 4,500 nucleotides, or 5,000 nucleotides.
[0408] In some embodiments, the mRNA disclosed herein may include a 3'UTR comprising one or more polyadenylation signals, protein binding sites affecting the stability of mRNA site in a cell, or one or more binding sites to miRNA. In some embodiments, the 3'UTR may be 50 to 5,000 nucleotides or longer. In some embodiments, the 3'UTR may be 50 to 1,000 nucleotides or longer. In some embodiments, the 3'UTR is at least about 50 nucleotides long, about 100 nucleotides long, about 150 nucleotides long, about 200 nucleotides long, about 250 nucleotides long, about 300 nucleotides long, about 350 nucleotides long, about 400 nucleotides long, about 450 nucleotides long, about 500 nucleotides long, about 550 nucleotides long, about 600 nucleotides long, about 650 nucleotides long, about 700 nucleotides long, about 750 nucleotides long, about 800 nucleotides long, about 850 nucleotides long, about 900 nucleotides long, about 950 nucleotides long, about 1,000 nucleotides long, about 1,500 nucleotides long, about 2,000 nucleotides long, about 2,500 nucleotides long, about 3,000 nucleotides long, about 3,500 nucleotides long, about 4,000 nucleotides long, about 4,500 nucleotides long, or about 5,000 nucleotides long.
[0409] In some embodiments, the mRNA disclosed herein may include a 5' or 3' UTR derived from a gene different from the gene encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).
[0410] In certain embodiments, the 5' and / or 3'UTR sequences may be derived from stable mRNA (e.g., globin, actin, GAPDH, tubulin, histone, or citrate cycle enzymes) to enhance mRNA stability. For example, the 5'UTR sequence may contain a sub-sequence or fragment thereof of the pre-initial 1 (IE1) gene to improve nuclease resistance and / or improve mRNA half-life. It is also conceivable to include a sequence or fragment thereof encoding human growth hormone (hGH) at the 3' end or untranslated region of the mRNA. Generally, these modifications improve mRNA stability and / or pharmacokinetic properties (e.g., half-life) compared to the unmodified counterpart, including modifications made, for example, to improve resistance of such mRNA to in vivonuclease digestion.
[0411] Exemplary 5'UTRs include sequences derived from the CMV pre-early 1 (IE1) gene (U.S. Patent Application Publication No. 2014 / 0206753 and No. 2015 / 0157565, each of which is incorporated herein by reference) or the sequence GGGAUCCUACC (U.S. Patent Application Publication No. 2016 / 0151409, which is incorporated herein by reference).
[0412] In various embodiments, the 5'UTR may be derived from the 5'UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5'-terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-related translational regulation. However, TOP genes with tissue-specific translational regulation are also known. In certain embodiments, the 5'UTR derived from the 5'UTR of a TOP gene lacks the 5'TOP motif (oligopyrimidine tract) (e.g., U.S. Patent Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each incorporated herein by reference).
[0413] In certain embodiments, the 5'UTR is derived from the ribosomal protein large 32 (L32) gene (see U.S. Patent Application Publication No. 2017 / 0029847 above).
[0414] In certain embodiments, the 5'UTR is derived from the 5'UTR of the hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (see U.S. Patent Application Publication No. 2016 / 0166710 above).
[0415] In certain embodiments, the 5'UTR is derived from the 5'UTR of the ATP5A1 gene (see U.S. Patent Application Publication No. 2016 / 0166710 above).
[0416] In some embodiments, the internal ribosome entry site (IRES) is used instead of the 5'UTR.
[0417] In some embodiments, the 5'UTR includes the nucleic acid sequence reproduced below. [ka]
[0418] In some embodiments, the 3'UTR includes the nucleic acid sequence reproduced below. CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC
[0419] The 5'UTR and 3'UTR are described in further detail in International Publication No. 2012 / 075040, which is incorporated herein by reference.
[0420] C. Polyadenylated tail As used herein, the terms “poly(A) sequence,” “poly(A) tail,” and “poly(A) region” refer to the sequence of adenosine nucleotides at the 3' end of an mRNA molecule. Poly(A) tails can confer stability to mRNA and protect it from exonuclease degradation. Poly(A) tails can enhance translation. In some embodiments, poly(A) tails are essentially homopolymers. For example, a poly(A) tail of 100 adenosine nucleotides may essentially have a length of 100 nucleotides. In certain embodiments, a poly(A) tail may be interrupted by at least one nucleotide different from adenosine nucleotides (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly(A) tail of 100 adenosine nucleotides may have a length greater than 100 nucleotides (including 100 adenosine nucleotides and at least one nucleotide different from adenosine nucleotides or a stretch of nucleotides). In certain embodiments, a poly(A) tail is a sequence [ka] Includes.
[0421] As used herein, “poly(A)tail” typically refers to RNA. However, in connection with this disclosure, the term also refers to the corresponding sequence in a DNA molecule (e.g., “poly(T) sequence”).
[0422] The poly(A) tail may contain approximately 10 to 500 adenosine nucleotides, approximately 10 to 200 adenosine nucleotides, approximately 40 to 200 adenosine nucleotides, or approximately 40 to 150 adenosine nucleotides. The length of the poly(A) tail may be at least approximately 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.
[0423] In some embodiments where the nucleic acid is RNA, the poly(A) tail of the nucleic acid is obtained from the DNA template during RNA in vitro transcription. In certain embodiments, the poly(A) tail is obtained in vitro by common chemical synthesis methods without transcription from the DNA template. In various embodiments, the poly(A) tail is produced by enzymatic polyadenylation of RNA (after RNA in vitro transcription) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A) polymerase using methods and means described, for example, in International Publication No. 2016 / 174271.
[0424] Nucleic acids may contain poly(A) tails obtained by enzymatic polyadenylation, and most nucleic acid molecules contain approximately 100 (+ / -20) to approximately 500 (+ / -50) or approximately 250 (+ / -20) adenosine nucleotides.
[0425] In some embodiments, the nucleic acid may include a poly(A) tail derived from template DNA, as described, for example, in International Publication No. 2016 / 091391, and may additionally include at least one further poly(A) tail produced by enzymatic polyadenylation.
[0426] In certain embodiments, the nucleic acid includes at least one polyadenylation signal.
[0427] In various embodiments, the nucleic acid may contain at least one poly(C) sequence.
[0428] As used herein, the term “poly(C) sequence” is intended to mean a sequence of cytosine nucleotides of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence contains about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence contains about 30 cytosine nucleotides.
[0429] D. Chemical modification The mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may include at least one chemical modification. In some embodiments, the mRNA disclosed herein may typically include one or more modifications that enhance RNA stability. Exemplary modifications include skeletal modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including but not limited to purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C) and uracil (U)). In certain embodiments, the disclosed mRNA is a modified nucleotide analog or derivative of purines and pyrimidines, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thiouracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-(carboxymethylaminomethyl-2-thiouracil) It can be synthesized from roxymethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyluracil, 5-methyl-2-thiouracil, 5-methyluracil, N-uracil-5-oxyacetate methyl ester, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, uracil-5-oxyacetate methyl ester, uracil-5-oxyacetate(v), 1-methyl-pseuduracil, quosin, β-D-mannosylquosin, phosphoramidate, phosphorothioate, peptide nucleotide, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, and inosine.
[0430] In some embodiments, the disclosed mRNA may include, but is not limited to, at least one chemical modification, including pseudouridine, N1-methylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudridine, 2-thio-dihydropseudridine, 2-thio-pseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-1-methylpseudridine, 4-thiopseudridine, 5-aza-uridine, dihydropseudridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.
[0431] In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.
[0432] In some embodiments, the chemical modification includes N1-methylpseuduridine.
[0433] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the mRNA are chemically modified.
[0434] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the ORF are chemically modified.
[0435] Preparations of such analogues are described, for example, in U.S. Patent Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642.
[0436] E.mRNA synthesis The mRNA disclosed herein may be synthesized according to any of the following methods. For example, the mRNA according to this disclosure may be synthesized via in vitro transcription (IVT). Several methods for in vitro transcription are described, for example, in Geall et al. (2013) Semin.Immunol.25(2):152-159 and Brunelle et al. (2013) Methods Enzymol.530:101-14. Briefly, IVT is typically carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system which may include DTT and magnesium ions, a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or an RNase inhibitor. The exact conditions may vary depending on the specific application. The presence of these reagents is generally undesirable in the final mRNA product, and these reagents may be considered impurities or contaminants that can be purified or removed to provide clean and / or homogeneous mRNA suitable for therapeutic use. In some embodiments, mRNA provided from an in vitro transcription reaction may be preferred, but other mRNA sources, including wild-type mRNA produced from bacteria, fungi, plants and / or animals, can be used in accordance with this disclosure.
[0437] If necessary, LNPs or LNP formulations may be polyvalent. In some embodiments, LNPs may hold mRNA encoding two or more polypeptides (e.g., antigens), for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides. For example, an LNP may hold multiple mRNA molecules, each encoding a different polypeptide, or it may hold polycistronic mRNA that can be translated into two or more polypeptides (e.g., each polypeptide coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as 2A peptide). LNPs holding different mRNA molecules typically contain (encapsulate) multiple copies of each mRNA molecule. For example, an LNP holding or encapsulating two different mRNA molecules typically holds multiple copies of each of the two different mRNA molecules.
[0438] In some embodiments, a single LNP formulation may contain multiple types (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) of LNPs, each type holding a different mRNA.
[0439] Buffer and other components To stabilize nucleic acids and / or LNPs (e.g., to extend the shelf life of a vaccine product), to facilitate the administration of LNP pharmaceutical compositions, and / or to improve the in vivo expression of nucleic acids, nucleic acids and / or LNPs may be formulated in combination with one or more carriers, targeted ligands, stabilizing reagents (e.g., preservatives and antioxidants) and / or other pharmaceutically acceptable excipients. Examples of such excipients include parabens, thimerosal, thiomersal, chlorobutanol, benzalkonium chloride, and chelating agents (e.g., EDTA).
[0440] The LNP compositions of this disclosure may be provided in cryogenic liquid form or lyophilized form. Various cryoprotective agents may be used, but are not limited to sucrose, trehalose, glucose, mannitol, mannose, and dextrose. The cryoprotective agent may constitute 5 to 30% (w / v) of the LNP composition. In some embodiments, the LNP composition contains trehalose, for example, 5 to 30% (e.g., 10%) (w / v). Once formulated with the cryoprotective agent, the LNP composition may be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.
[0441] The LNP composition may be provided to the patient in a buffer solution (which can be thawed if pre-frozen, or reconstituted with the buffer solution at the bedside if pre-lyophilized). The buffer solution may be isotonic and suitable for, for example, intramuscular or intradermal injection. In some embodiments, the buffer solution is phosphate-buffered saline (PBS).
[0442] Process for producing this LNP formulation These LNPs can be prepared by various techniques currently known in the art. For example, multilayer vesicles (MLVs) can be prepared according to the prior art by, for example, dissolving lipids in a suitable solvent to deposit selected lipids on the inner wall of a suitable container or vessel, then evaporating the solvent to leave a thin film on the inside of the vessel, or by spray drying. Then, an aqueous phase can be added to the container by vortex motion resulting in the formation of the MLV. The multilayer vesicles can then be homogenized and single-layer vesicles (ULVs) can be formed by sonication or extrusion. In addition, single-layer vesicles can be formed by detergent removal techniques.
[0443] Various methods are described in U.S. Patent Publication No. 2011 / 0244026, U.S. Patent Publication No. 2016 / 0038432, U.S. Patent Publication No. 2018 / 0153822, U.S. Patent Publication No. 2018 / 0125989 and PCT / US2020 / 043223 (filed July 23, 2020) that can be used to carry out the present invention. One exemplary process, as described in U.S. Patent Publication No. 2016 / 0038432, involves encapsulating mRNA by mixing mRNA with a lipid mixture without first pre-forming the lipids into lipid nanoparticles. Another exemplary process, as described in U.S. Patent Publication No. 2018 / 0153822, involves encapsulating mRNA by mixing pre-formed LNPs with mRNA.
[0444] In some embodiments, the process for preparing mRNA-loaded LNPs includes heating one or more solutions to a temperature higher than ambient temperature, wherein the one or more solutions are a solution containing pre-formed lipid nanoparticles, a solution containing mRNA, and a mixed solution containing mRNA encapsulated in LNPs. In some embodiments, the process includes heating one or both of the mRNA solution and the pre-formed LNP solution before the mixing step. In some embodiments, the process includes heating one or more of the solutions containing the pre-formed LNPs, the mRNA solution, and the mRNA encapsulated in LNPs during the mixing step. In some embodiments, the process includes heating the mRNA encapsulated in LNPs after the mixing step. In some embodiments, the temperature at which one or more solutions are heated is approximately 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, the temperature at which one or more solutions are heated is in the range of about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In some embodiments, the temperature is about 65°C.
[0445] Various methods can be used to prepare mRNA solutions suitable for the present invention. In some embodiments, mRNA may be dissolved directly in the buffer solution described herein. In some embodiments, the mRNA solution may be produced by mixing the mRNA stock solution with the buffer solution before mixing it with the lipid solution for mounting. In some embodiments, the mRNA solution may be produced by mixing the mRNA stock solution with the buffer solution immediately before mixing it with the lipid solution for mounting. In some embodiments, a suitable mRNA stock solution may contain mRNA in water or buffer solution at concentrations of about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml or 5.0 mg / ml or higher.
[0446] In some embodiments, the mRNA stock solution is mixed with a buffer solution using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. Typically, the buffer solution is mixed at a faster rate than the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times faster than the mRNA stock solution. In some embodiments, the buffer solution is mixed at a flow rate in the range of approximately 100–6000 ml / min (e.g., approximately 100–300 ml / min, 300–600 ml / min, 600–1200 ml / min, 1200–2400 ml / min, 2400–3600 ml / min, 3600–4800 ml / min, 4800–6000 ml / min, or 60–420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of approximately 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or more.
[0447] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of approximately 10 to 600 ml / min (e.g., approximately 5 to 50 ml / min, approximately 10 to 30 ml / min, approximately 30 to 60 ml / min, approximately 60 to 120 ml / min, approximately 120 to 240 ml / min, approximately 240 to 360 ml / min, approximately 360 to 480 ml / min, or approximately 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of approximately 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or more.
[0448] The process of incorporating desired mRNA into lipid nanoparticles is referred to as “loading.” Exemplary methods are described in Lasic et al., FEBS Lett. (1992) 312:255-8. Nucleic acids incorporated into LNPs may be located entirely or partially within the internal space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the outer surface of the lipid nanoparticle membrane. The incorporation of mRNA into lipid nanoparticles is also referred to herein as “encapsulation,” in which the nucleic acid is contained entirely or substantially within the internal space of the lipid nanoparticle.
[0449] Suitable LNPs can be produced in a variety of sizes. In some embodiments, reducing the size of the lipid nanoparticles is associated with more efficient mRNA delivery. The selection of an appropriate LNP size may take into account to some extent the site of the target cell or tissue and the intended use for which the lipid nanoparticles are produced.
[0450] Various methods known in the art can be used to size a population of lipid nanoparticles. In the preferred method described herein, LNP particle size is measured using a Zetasizer Nano ZS (Malvern Panalytical). In one protocol, 10 μl of LNP sample is mixed with 990 μl of 10% trehalose. This solution is placed in a cuvette and then in a Zetasizer machine. The z-mean diameter (nm) or cumulant mean is considered the average size of the LNPs in the sample. The Zetasizer machine can also be used to measure the polydispersity index (PDI) using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. The mean LNP diameter can be reduced by sonication of the formed LNPs. Intermittent sonication cycles can be alternating with quasi-elastic light scattering (QELS) evaluation to lead to efficient lipid nanoparticle synthesis.
[0451] In some embodiments, the majority of the purified LNPs, i.e., more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs, have a size of about 70–150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all (e.g., more than 80 or 90%) of the purified lipid nanoparticles have a size of about 70 to 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).
[0452] In some embodiments, the LNPs in the composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.
[0453] In some embodiments, more than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the LNPs in the composition have sizes in the range of about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, or about 60-70 nm), about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, or about 60-70 nm), or about 50-70 nm (e.g., 55-65 nm), which are particularly suitable for lung delivery via nebulization.
[0454] In some embodiments, the dispersion degree or molecular size heterogeneity measure (PDI) of LNPs in the pharmaceutical compositions provided by this disclosure is less than about 0.5. In some embodiments, the LNPs have a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI can be measured by a Zetasizer machine as described above.
[0455] In some embodiments, about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% of the purified LNPs in the pharmaceutical compositions provided herein encapsulate mRNA within each individual particle. In some embodiments, substantially all (e.g., 80% or more than 90%) of the purified lipid nanoparticles in the pharmaceutical compositions encapsulate mRNA within each individual particle. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of 50% to 99% or about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 98%, or more than 99%. Typically, the lipid nanoparticles for use herein have an encapsulation efficiency of at least 90% (e.g., at least 91%, 92%, 93%, 94%, or 95%).
[0456] In some embodiments, the LNPs have an N / P ratio of 1 to 10. In some embodiments, the lipid nanoparticles have an N / P ratio greater than 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In further embodiments, the typical LNPs of this specification have an N / P ratio of 4.
[0457] In some embodiments, the pharmaceutical composition according to the present invention contains at least about 0.5 μg, 1 μg, 5 μg, 10 μg, 100 μg, 500 μg, or 1000 μg of encapsulated mRNA. In some embodiments, the pharmaceutical composition contains about 0.1 μg to 1000 μg, at least about 0.5 μg, at least about 0.8 μg, at least about 1 μg, at least about 5 μg, at least about 8 μg, at least about 10 μg, at least about 50 μg, at least about 100 μg, at least about 500 μg, at least about 100 μg, or at least about 1000 μg of encapsulated mRNA.
[0458] Packaging and Use of mRNA-LNPs mRNA-LNPs may be packaged for parenteral (e.g., intramuscular, intradermal, subcutaneous, or intravenous) or nasopharyngeal (e.g., intranasal) administration. The composition may be in the form of an immediate formulation in which the LNP composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) immediately before use. The composition may also be shipped and supplied in the form of an aqueous solution or frozen aqueous solution, which can be administered directly to the subject without reconstitution (after thawing if previously frozen).
[0459] Accordingly, this disclosure provides a product, e.g., a kit, that provides mRNA-LNP in a single container, or provides mRNA-LNP in one container and physiological buffer for reconstitution in another container. The container may contain a single-use dose or a multi-use dose. The container may be a pre-treated glass vial or ampoule. The product may also include instructions for use.
[0460] In some embodiments, the present invention provides a method for preventing or treating a disease or disorder by administering a composition of the present invention to a subject in need thereof. In some embodiments, the subject is suffering from or susceptible to an infection.
[0461] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have meanings generally understood by those skilled in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials may also be used in the practice or testing of the present invention. In case of any inconsistency, this specification shall prevail, including definitions. Generally, the nomenclature and techniques used herein in connection with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, pharmaceutical and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization are well-known and commonly used in the art. Enzyme reactions and purification techniques are carried out as generally achieved in the art or as described herein, in accordance with the manufacturer's specifications. Furthermore, unless otherwise required by context, singular terms shall include plural terms, and plural terms shall include singular terms. Throughout this specification and its embodiments, the terms “have” and “comprise,” or variations such as “has,” “has,” “comprises,” or “includes,” are understood to mean that they include the integer or set of integers described, but not to mean that they exclude any other integer or set of integers. All publications and other references referenced herein are incorporated by reference in their entirety. While several documents are cited herein, their citations do not constitute an endorsement that any of those documents form part of the common technical knowledge of the art. Where used herein, the terms “approximately” or “about,” when applied to one or more values of interest, refer to values similar to the reference value described. In certain embodiments, unless otherwise stated or evident from the context, the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the reference value described.
[0462] Specific Embodiments In the first embodiment, a composition is provided comprising lipid nanoparticles (LNPs), the LNPs comprising (I) an ionized lipid, (II) a glyceride or acyl glycol, and (III) one or more lipids selected from the group consisting of (a) structural lipids, (b) helper lipids, and (c) stealth lipids.
[0463] In the second embodiment, the LNP comprises (I) an ionized lipid, (II) a glyceride or acyl glycol, (III) a structural lipid, (IV) a helper lipid, and (V) a stealth lipid.
[0464] In the third embodiment, the glyceride or acyl glycol is a monoglyceride, diglyceride, triglyceride, or diacyl glycol.
[0465] In the fourth embodiment, the glyceride or acyl glycol is a compound of formula I or formula II: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are H and -C, respectively, independently. (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25)It is optionally replaced by 1 to 3 groups independently selected from the alkenyl. However, R G1 , R G2 and R G3 If there are two or fewer of these, then H, R G4 is -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl. R G5 H, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0466] In the fifth embodiment, the glyceride or acyl glycol is a compound of formula I: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are H and -C, respectively, independently. (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls and -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl. However, R G1 , R G2 and R G3 If there are two or fewer of these, then it is H.
[0467] In the sixth embodiment, the glyceride or acyl glycol is of formula Ia or Ib: [ka] It has a structure such that, in the formula, R G1 and R G2 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25)Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0468] In the seventh embodiment, the glyceride or acyl glycol has a structure according to formula Ia or Ib, where R G1 and R G2 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0469] In the eighth embodiment, the glyceride or acyl glycol has a structure according to formula Ia or Ib, where R G1 and R G2 These are, independently, -C (11~25) Alkyl, -C (11~25) Alkenyl, -C(O)C (11~25) Alkyl or -C(O)C (11~25) It is Alkenil.
[0470] In the ninth embodiment, the glyceride or acyl glycol is of formula Ic or Id: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC(1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0471] In the tenth embodiment, the glyceride or acyl glycol has a structure according to formula Ic or Id, where R G1 , R G2 and R G3 These are, independently, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0472] In the 11th embodiment, the glyceride or acyl glycol has a structure according to formula Ic or Id, where R G1 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is an alkenyl, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is an alkenyl and R G3 is -C(O)C (3~25) Alkyl or -C(O)C (3~25) It is Alkenil.
[0473] In the twelfth embodiment, the glyceride or acyl glycol is of formula Ie: [ka] It has a structure such that, in the formula, R G1 , R G2 and R G3 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC(1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0474] In the 13th embodiment, the glyceride or acyl glycol has a structure according to formula Ie, where R G1 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is an alkenyl, R G2 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally substituted with 1 to 3 groups independently selected from the alkenyl, and R G3 is -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0475] In the 14th embodiment, the glyceride or acyl glycol has a structure according to formula Ie, where R G1 , R G2 and R G3 These are, independently, -C(O)C (7~21) Alkyl or -C(O)C (7~21) It is Alkenil.
[0476] In the 15th embodiment, the glyceride or acyl glycol is of formula IIa or IIb: [ka] It has a structure such that, in the formula, R G4 and R G5 These are, independently, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally replaced by 1 to 3 groups independently selected from the alkenyl.
[0477] In the sixteenth embodiment, the glyceride or acyl glycol has a structure according to formula IIa or IIb, where R G4 and R G5 These are, independently, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is Alkenil.
[0478] In the 17th embodiment, the glyceride or acyl glycol is hydrolyzable by lipase.
[0479] In the 18th embodiment, the glyceride or acyl glycol is selected from the group consisting of the following:
[0480] [Table 8]
[0481] [Table 9]
[0482] [Table 10]
[0483] [Table 11]
[0484] In the 19th embodiment, the glyceride or acyl glycol is selected from the group consisting of the following:
[0485] [Table 12]
[0486] [Table 13]
[0487] In the 20th embodiment, the glyceride or acyl glycol is selected from the group consisting of the following:
[0488] [Table 14]
[0489] In the 21st embodiment, the glyceride or acyl glycol is as follows:
[0490] [Table 15]
[0491] In the 22nd embodiment, the glyceride or acyl glycol is as follows:
[0492] [Table 16]
[0493] In the 23rd embodiment, the glyceride or acyl glycol is as follows:
[0494] [Table 17]
[0495] In the 24th embodiment, the ionized lipid is of formula CAT-I: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, p is an integer between 1 and 9 (including the two endpoints). R 2 Each presence independently involves hydrogen or C substituted by choice. 1~6 It is alkyl, Each instance of L is independently an arbitrarily substituted alkylene, an arbitrarily substituted alkenylene, an arbitrarily substituted alkynylene, an arbitrarily substituted heteroalkylene, an arbitrarily substituted heteroalkenylene, an arbitrarily substituted heteroalkynylene, an arbitrarily substituted carbocyclylene, an arbitrarily substituted heterocyclylene, an arbitrarily substituted arylene, or an arbitrarily substituted heteroarylene, or a combination thereof. R 6 and R 7 Each existence is independently a base of equation (i), (ii), or (iii), Equations (i), (ii), and (iii) are, [ka] And, Each R' is independently an alkyl group substituted with hydrogen or of any choice. X is O, S, or NR X And R XThis is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. Y is O, S, or NR Y And R Y This is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. R P This includes hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen protecting group when bonded to an oxygen atom, a sulfur protecting group when bonded to a sulfur atom, or a nitrogen protecting group when bonded to a nitrogen atom, and R L C is replaced by arbitrary selection. 1~50 Alkyl, optionally substituted C 2~50 Alkenyl, C substituted by choice 2~50 Alkynyl, optionally substituted hetero-C 1~50 Alkyl, optionally substituted hetero-C 2~50 Alkenyl, optionally substituted hetero-C 2~50 It is an alkynyl or polymer.
[0496] In the 25th embodiment, the ionized lipid is given by formula CAT-Ia: [ka] The structure or a pharmaceutically acceptable salt thereof, where q is an integer between 1 and 10 (including the two extreme values).
[0497] In the 26th embodiment, the ionized lipid has the following structure: [ka] It has.
[0498] In the 27th embodiment, the ionized lipid has the following structure: [ka] It has.
[0499] In the 28th embodiment, the ionized lipid is of formula CAT-II: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, A 1 teeth, [ka] Selected from, the left side of each illustrated structure is bonded to -(CH2)a-, Z 1 teeth, [ka] Selected from, the right side of each illustrated structure is bonded to -(CH2)a-, R 1A and R 1B These are optionally substituted alkyls, optionally substituted alkenyls, optionally substituted alkynyls, optionally substituted acyls, and -W 1 -X 1 -Y 1 Each is independently selected from, Each W 1 It is independently selected from optionally substituted alkyls and optionally substituted alkenyls, each X 1The atoms are independently selected from alkyls substituted with -*O-(C=O)-optionally, alkyls substituted with -(*C=O)-O-optionally, alkenyls substituted with -*O-(C=O)-optionally, and alkenyls substituted with -(*C=O)-O-optionally, and the atoms marked with * are W 1 It is connected to, Each Y 1 The atoms are independently selected from hydrogen, -*O-(C=O)-optionally substituted alkyl, -(*C=O)-O-optionally substituted alkyl, -*O-(C=O)-optionally substituted alkenyl, and -(*C=O)-O-optionally substituted alkenyl, and the atoms marked with * are X 1 It is connected to, b is 1, 2, 3, 4 or 5, and Each a is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
[0500] In the 29th embodiment, the ionized lipid is of formula CAT-IIa: [ka] It has a structure or a pharmaceutically acceptable salt thereof.
[0501] In the 30th embodiment, the ionized lipid has the following structure: [ka] It has.
[0502] In the 31st embodiment, the cationic lipid is of formula CAT-V: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, A 1The left side of each listed structure is selected from -C(=O)O-, -C(=O)S-, -C(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -NHC(=O)O-, -SC(=O)NH-, -OCH2CH2O-, -OCH2O-, -OCH(CH3)O-, -S-, and -SS-, and the left side of each listed structure is -(CH2) a - is coupled to Z 1 The following are selected from -OC(=O)-, -SC(=O)-, -NHC(=O)-, -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)S-, -OCH2CH2O-, -OCH2O-, -OCH(CH3)O-, -S-, and -SS-, and the right side of each listed structure is -(CH2) a - is coupled to Each R is, [ka] (In the formula, each R 1 (which is independently selected from optionally substituted alkyls, optionally substituted alkenyls, and optionally substituted alkynyls), [ka] (In the formula, each R 2 These are optionally substituted alkyls, optionally substituted alkenyls, optionally substituted alkynyls, and -W 1 -X 1 (Selected independently of) Selected independently from, Each W 1 These are independently selected from optionally substituted alkylenes and optionally substituted alkenylenes, and each X 1 The atoms are independently selected from alkyls substituted with -*O-(C=O)-optionally, alkyls substituted with -(*C=O)-O-optionally, alkenyls substituted with -*O-(C=O)-optionally, and alkenyls substituted with -(*C=O)-O-optionally, and the atoms marked with * are W 1 , [ka] (In the formula, each R 3 (which can be independently selected from optionally substituted alkyls, optionally substituted alkenyls, and optionally substituted alkynyls), and [ka] (In the formula, each R 4 (This is independently selected from optionally substituted cycloalkyls or optionally substituted heterocycloalkyls.) It is connected to, At least three R's are [ka] Selected independently from, Each a is independently selected from 2, 3, 4, and 5. Each b is independently selected from 2, 3, 4, 5, 6, 7, 8, 9 and 10, and Each c is independently selected from 2, 3, 4, 5, 6, 7, 8, 9, and 10.
[0503] In the 32nd embodiment, the ionized lipid is given by formula CAT-Vb: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, R 2 It is an alkyl group.
[0504] In the 33rd embodiment, the ionized lipid has the following structure: [ka] or a pharmaceutically acceptable salt thereof.
[0505] In the 34th embodiment, the ionized lipid has the following structure: [ka] or a pharmaceutically acceptable salt thereof.
[0506] In the 35th embodiment, the ionized lipid is of formula CAT-VI: [ka] Having a structure or a pharmaceutically acceptable salt thereof, in the formula, m is an integer selected from 1 to 6, for example, 2 to 4. n is an integer selected from 1 to 6, for example, 2 to 4. p is an integer selected from 1 to 6, for example, 2 to 4. R 1 and R 2 This is linear or branched (C1~C 30 ) Alkyl and linear or branched (C2~C 30 ) independently selected from the group consisting of alkenils, Each alkyl and alkenyl is optionally interrupted by one or more groups selected from -C=O-, -C=OO-, and -O-, and / or Each alkyl and alkenyl is optionally substituted with one or more substituents selected from -OR, -CN-, -(C1~C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 3 This is selected from the group consisting of (C1-C6) alkyls that are optionally substituted with one or more substituents selected from H, -OR, -CN-, -(C1-C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 4 and R 5 The alkyl or alkenyl is independently selected from the group consisting of linear or branched (C1-C6) alkyls and linear or branched (C2-C6) alkenyls, and each alkyl or alkenyl is optionally substituted with one or more substituents selected from the group consisting of -OR, -CN-, -(C1-C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms and -NRR', or R 4 and R 5 Together with the N atoms to which they are bonded, A 5-6 membered cycloalkyl or heterocycle containing 1-4 heteroatoms selected from O, N, and S, or 5-6 membered aryl or heteroaryl containing 1-4 heteroatoms selected from O, N, and S Forming, The cycloalkyl, heterocyclic, aryl, or heteroaryl is optionally substituted with one or more substituents selected from -OR, -CN-, -(C1~C6)alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms, and -NRR'. R 6 and R 7 This is linear or branched (C1~C 30 ) Alkyl and linear or branched (C2~C 30 ) independently selected from the group consisting of alkenils, Each alkyl and alkenyl is optionally interrupted by one or more groups selected from -C=O-, -C=OO-, and -O-, and / or Each alkyl and alkenyl is optionally substituted with one or more substituents selected from -OR, -CN-, -C1~C6 alkyl-OH, -CF3, -NO2, -COOR, -SR, halogen atoms and -NRR', and R and R' are independently selected from H and (C1-C6) alkyl groups.
[0507] In the 36th embodiment, the ionized lipid has the following structure: [ka] or a pharmaceutically acceptable salt thereof.
[0508] In the 37th embodiment, the ionized lipid is selected from the group consisting of the following:
[0509] [Table 18]
[0510] [Table 19]
[0511] In the 38th embodiment, the ionized lipid is selected from the group consisting of the following:
[0512] [Table 20]
[0513] [Table 21]
[0514] In the 39th embodiment, the structural lipid is a sterol.
[0515] In the 40th embodiment, the structural lipid is a sterol, and the sterol is cholesterol.
[0516] In the 41st embodiment, the helper lipid is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), 1,2-dieridoyl-sn-glycero-3-phosphoethanolamine (DEPE), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-distearoylphosphatidylethanolamine (DSPE), or 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).
[0517] In the 42nd embodiment, the helper lipid is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE).
[0518] In the 43rd embodiment, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid.
[0519] In the 44th embodiment, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid, and the PEGylated lipid is 1,2-dimiristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DLPE-PEG), or 1,2-distearoyl-rac-glycero-polyethylene glycol (DSG-PEG).
[0520] In the 45th embodiment, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid, and the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG).
[0521] In the 46th embodiment, the LNP comprises ionized lipids in a molar ratio of 35% to 55%, structural lipids in a molar ratio of 20% to 35%, stealth lipids in a molar ratio of 0.25% to 2.75%, and helper lipids and glycerides or acyl glycols in a combined molar ratio of 10% to 35%.
[0522] In the 47th embodiment, the LNP comprises 40% molar ratio of ionized lipids, 28.5% molar ratio of structural lipids, 1.5% molar ratio of stealth lipids, and 30% molar ratio of combined helper lipids and glycerides or acyl glycols.
[0523] In the 48th embodiment, the LNP comprises (I) GL-HEPES-E3-E12-DS-4-E10, (II) trimyristine, (III) cholesterol, (IV) DOPE, and (V) DMG-PEG2000.
[0524] In the 49th embodiment, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 35% to 45%, cholesterol in a molar ratio of 20% to 35%, DMG-PEG2000 in a molar ratio of 0.25% to 8.75%, DOPE in a molar ratio of 15% to 35%, and trimiristin in a molar ratio of 1% to 10%.
[0525] In the 50th embodiment, the LNP comprises GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of about 40%, cholesterol in a molar ratio of about 28.5%, DMG-PEG2000 in a molar ratio of about 1.5%, DOPE in a molar ratio of about 25%, and trimiristin in a molar ratio of about 5%.
[0526] In the 51st embodiment, the composition further comprises nucleic acid molecules, the nucleic acid molecules being encapsulated in LNPs.
[0527] In the 52nd embodiment, the LNP comprises 1 to 20 nucleic acid molecules, optionally 5 to 10 or 6 to 8.
[0528] In the 53rd embodiment, the nucleic acid molecule is an mRNA molecule.
[0529] In the 54th embodiment, the nucleic acid molecule is an mRNA molecule, and the mRNA molecule encodes an antigen, optionally a viral antigen or a bacterial antigen.
[0530] In the 55th embodiment, the LNP encapsulates two or more mRNA molecules, each mRNA molecule encoding a different antigen, and optionally, the different antigens are from the same pathogen or different pathogens.
[0531] In the 56th embodiment, the composition comprises two or more LNPs, each LNP encapsulating mRNA encoding a different antigen, and optionally, the different antigens are from the same pathogen or different pathogens.
[0532] In the 57th embodiment, the composition is formulated for intramuscular injection.
[0533] In the 58th embodiment, the composition comprises phosphate-buffered saline.
[0534] In the 59th embodiment, the composition optionally contains trehalose at 10% (w / v) of the composition.
[0535] A 60th embodiment provides a method for inducing an immune response in a subject requiring such induction, comprising administering to the subject a prophylactically effective amount of a composition described in any one of embodiments 51 to 59, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally.
[0536] A 61st embodiment provides a method for preventing an infection or reducing one or more symptoms of an infection, comprising optionally administering to a subject a prophylactically effective amount of a composition described in any one of embodiments 51 to 59 intramuscularly, intranasally, intravenously, subcutaneously, or intradermally.
[0537] In the 62nd embodiment, the method of the 60th or 61st embodiment comprises administering one or more doses of the composition to a subject, each dose comprising 1 to 250 μg, optionally 2.5, 5, 15, 45, or 135 μg of mRNA.
[0538] In the 63rd embodiment, the method of the 60th, 61st, or 62nd embodiment includes administering two doses of the composition to the subject at intervals of 2 to 6 weeks, or optionally 4 weeks.
[0539] In the 64th embodiment, the use of any one of the compositions described in any one of the embodiments 51 to 59 is provided for the manufacture of a pharmaceutical product for use in any one of embodiments 60 to 63, at the discretion of the user, in the treatment of a subject requiring treatment.
[0540] In the 65th embodiment, a composition according to any one of embodiments 51 to 59 is provided for use, optionally, in the method described in any one of embodiments 60 to 63 in the treatment of a subject requiring treatment.
[0541] In the 66th embodiment, a kit is provided, which comprises a container containing a single-use or multi-use dose of the composition described in any one of embodiments 51 to 59, the container optionally being a vial or a pre-filled syringe or injector.
[0542] To better understand the present invention, the following examples are provided. These examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention. [Examples]
[0543] The compounds and methods disclosed herein are further illustrated by the following examples, which should not be construed as further limitations. Unless otherwise indicated, the implementation of this disclosure utilizes the prior art of organic synthesis, cell biology, cell culture and molecular biology, which is within the scope of the skills of the art.
[0544] The following embodiments further illustrate aspects of the present disclosure. However, they do not limit in any way the teachings of the present disclosure described herein.
[0545] Example 1 - Formulation The glycerides described herein may be used in the preparation of lipid nanoparticles by methods known in the art. For example, a preferred method is described in International Publication No. 2018 / 089801 (which is incorporated herein by reference in its entirety).
[0546] The lipid nanoparticles in the example of the present invention were formulated using Process A of International Publication No. 2018 / 089801 (see, for example, Example 1 and Figure 1 of International Publication No. 2018 / 089801). Process A ("A") is a conventional method for encapsulating mRNA by mixing mRNA with a lipid mixture without first pre-forming the lipids into lipid nanoparticles. In the exemplary process, an ethanol solution of a mixture of lipids (cationic lipids, phosphatidylethanolamine, cholesterol, and polyethylene glycol-lipids) was combined with an aqueous buffer solution of target mRNA at a fixed lipid-to-mRNA ratio under controlled conditions and acidic pH to obtain a homogeneous suspension of LNPs. After ultrafiltration and dialysfiltration into a suitable dilution system, the obtained nanoparticle suspension was diluted to final concentration, filtered, and stored frozen at -80°C until use.
[0547] Lipid nanoparticle formulations were prepared by process A using the molar ratio lipids disclosed in Table 1 below. The polydispersity index (PdI) of the lipid nanoparticles can be determined by diluting the formulation with 10% trehalose at an mRNA concentration of approximately 0.1 mg / ml and then measuring the size with a Malvern zetasizer. Lipid nanoparticle sizes can be obtained using the Malvern Zetasizer Nano-ZS.
[0548] Dynamic light scattering (DLS) measurements can be performed using a Malvern Instruments Zetasizer (Worcestershire, UK) with a backscatter detector angle of 173° and a 4mW, 633-nm He-Ne laser. Samples were analyzed by diluting them with 10% trehalose and measuring their size and polydispersity index (PdI) in optical-grade polystyrene cuvettes.
[0549] With a few exceptions, size, PdI, and encapsulation efficiency were measured within the expected range.
[0550] [Table 22]
[0551] Table 23
[0552] Table 24
[0553] Table 25
[0554] Table 26
[0555] Table 27
[0556] Table 28
[0557] Table 29
[0558] Table 30
[0559] Example 2 - IM EPO データ To determine the activity of glyceride-containing LNPs, an EPO expression study was performed using 6-8 week old female BALB / cJ mice (n=4 per group). Mice were administered 0.1 μg in 30 μL of LNP by a single intramuscular (IM) injection into the gastrocnemius muscle. Blood samples were collected 6 and 24 hours after injection, and serum hEPO levels in the mice were measured using an ELISA assay according to the manufacturing protocol. All LNPs were supplied in 1.5:40:28.5:25:5 (PEG:cat:chol:help:glyceride), where PEG is DMG-PEG-2000, cat is a cationic lipid, and help is DOPE. International Publication No. 2022 / 099003A1 also describes an in vivo assay for intramuscular administration (e.g., paragraph
[0206] on page 46). Data on various cationic lipid compositions are shown in Tables 2-7, for example, normalized for each LNP formulation without added glycerides.
[0560] In general, the addition of different glycerides resulted in increased EPO expression using various ionized lipids.
[0561] [Table 31]
[0562] [Table 32]
[0563] [Table 33]
[0564] [Table 34]
[0565] [Table 35]
[0566] [Table 36]
[0567] Example 3 - Modification of glyceride percentage in the composition The proportion of glycerides in the composition was also investigated. LNPs containing cKK-E10 were produced using tricaprine or triolein at concentrations of 0-9.71%. EPO expression tests were performed on female BALB / cJ mice 6-8 weeks old (n=4 per group). Mice were administered 0.1 μg in 30 μL of LNP by a single intramuscular (IM) injection into the gastrocnemius muscle. Blood samples were collected 6 and 24 hours after injection, and serum hEPO levels in the mice were measured using an ELISA assay according to the manufacturing protocol. Data for various LNP compositions are shown in Tables 8 and 9 below, normalized to a control composition without added glycerides.
[0568] Overall, EPO expression was increased by using glycerides at the majority of the glyceride molar percentage ratios tested.
[0569] [Table 37]
[0570] [Table 38]
[0571] Example 4 - Improvement of HAI using tricaprine The ability of LNP to induce an immune response in animals was determined. Following treatment groups, BALB / c mice (Mus musculus) were immunized under isoflurane anesthesia via the IM pathway in the quadriceps femoris muscle with 0.05 mL of modified Tasmanian H3 mRNA lipid nanoparticles at a dose of 0.4 ug per mouse, on one hind leg on day 0 and on the opposite leg on day 21. Mice were evaluated for at least 3 days after administration, and any animals that lost severe clinical signs after veterinary evaluation were euthanized by subcutaneous injection of meloxicam 5 mg / kg.
[0572] Blood was collected from all sedated animals by submandibular or orbital venous sinus sampling (blood collection was performed on days -1 and 20 during life) and cardiac puncture (terminal sampling, day 35). Mice were collected in a prior study to obtain baseline preimmune serum samples and for pre-screening purposes.
[0573] HAI assays were performed using the A / Tasmania / 503 / 2020(H3N2) virus strain (BIOQUAL, Inc.). Serum was treated with receptor-destroying enzyme (RDE) by diluting one part serum with three parts enzyme, and incubated overnight in a 37°C water bath. The enzyme was inactivated by incubation at 56°C for 30 minutes, followed by the addition of six parts PBS to finally dilute to 1 / 10. HAI assays were performed in V-bottom 96-well plates using four hemagglutination units (HAU) of the virus and 0.5% turkey RBCs. Standard serum of each strain was included in each assay plate as a positive control. Each plate also included back titration to confirm the antigen dose (4 HAU / 25 pl) and the negative control sample (PBS or naive control serum). In serum, the HAI titer was most diluted, and hemagglutination was completely inhibited. The results were only valid for plates with appropriate back titration results (confirmation of 4 HAU / 25 μl addition) and plates where the standard serum titer was within twice the expected titer.
[0574] Using tricaprine, the HAI titer was increased for both cKK-E10 (Table 10) and OF-02 (Table 11) with a composition of 1.5:40:28.5:25:5 (DMG-PEG-2000: ionized lipids: cholesterol: DOPE: glycerides).
[0575] [Table 39]
[0576] [Table 40]
[0577] Example 5 - Synthesis of a typical cationic lipid of formula CAT-V The cationic lipid IM-001 can be synthesized according to the general procedure presented in Scheme 1. Scheme 1: General synthesis scheme for lipid IM-001 [ka]
[0578] Similarly, the cationic lipid IS-001 can be synthesized according to the general procedure presented in Scheme 2. Scheme 2: General synthesis scheme for lipid IS-001 [ka]
[0579] Example 6 - Synthesis of a typical cationic lipid of formula CAT-VI The cationic lipid A2H7iiT6 can be synthesized according to the procedure shown in Scheme 3. Scheme 3: Synthesis scheme for lipid A2H7iiT6 [ka]
[0580] Amide synthesis (3) [ka] In dichloromethane (DCM), amine (2) (1.00 g, 6.51 mmol) was added to a solution of acid (1) (5.14 g, 7.81 mmol), 4-dimethylaminopyridine (DMAP) (1.60 g, 13.02 mmol), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (2.50 g, 13.02 mmol). The resulting mixture was stirred overnight at room temperature. After 16 hours, MS analysis indicated completion of the reaction. The reaction mixture was diluted with DCM and washed with saturated sodium bicarbonate (NaHCO3) solution, water, and brine solution. The organic layer was dried over anhydrous sodium sulfate (Na2SO4) and concentrated. The crude residue was purified through an 80 g silica column, and the desired product was eluted with 9% ethyl acetate in hexane. The purest fraction was concentrated to obtain 3.71 g (75.3%) of the pure product. ESI-MS analysis: Calculated value C 41 H 84 N2O4SSi2, [M+H + ]=757.58, measured value=757.5.
[0581] Amide deprotection (4) [ka] To a solution of amide 3 (3.71 g, 4.90 mmol) in tetrahydrofuran (12 mL), hydrogen fluoride (70% HF.py complex, 4.41 mL, 48.99 mmol) was added at 0°C and the mixture was stirred at the same temperature for 10 minutes. The reaction mixture was then heated to room temperature and stirred for 16 hours. MS analysis indicated completion of the reaction. The reaction mixture was diluted with ethyl acetate, and solid NaHCO3 was slowly added at 0°C, followed by quenching with saturated NaHCO3 solution. The organic layer was washed with saturated NaHCO3 solution, water, and brine. The resulting solution was then dried over anhydrous Na2SO4 and concentrated. The crude residue was purified, and the desired product was eluted with 6% methanol in DCM. The fraction containing the pure product was concentrated to obtain 2.07 g (79.9%) of the pure product. ESI-MS analysis: Calculated value C 29 H 56 N2O4S, [M+H + ]=529.40, measured value=529.3.
[0582] Synthesis of R-SS-Py solution (5) [ka] To a solution of thiolactone (4) (0.59 g, 1.116 mmol) in chloroform (20 mL), dipyridyl disulfide (0.74 g, 3.35 mmol) and triethylamine (TEA) (0.640 g, 3.35 mmol) were added and the mixture was stirred for 1 hour. Then, amine (5) (0.84 g, 6.70 mmol) was added and the mixture was stirred overnight at room temperature. MS analysis indicated completion of the reaction. The reaction mixture was diluted with DCM and washed with saturated ammonium chloride solution, water, and brine solution. The organic layer was dried over anhydrous sodium sulfate (Na2SO4) and concentrated. The crude residue was purified through a 12 g silica column, and the desired product was eluted with 7% methanol in DCM. The purest fraction was concentrated to obtain 0.72 g (84.6%) of pure product. ESI-MS analysis: Calculated value C 40 H 70 N6O4S2, [M+H + ]=763.50, measured value=763.5.
[0583] Thiol synthesis (6) [ka] To a solution of 1,1'-((4-(tritylthio)butyl)azandiyl)bis(tetradecane-2-ol) (0.79 g, 1.02 mmol) in DCM (4 mL), trifluoroacetic acid (TFA) (5.40 g, 47.38 mmol) was added and the mixture was stirred at room temperature for 30 minutes. Then, triethylsilane (0.14 g, 1.18 mmol) was slowly added and the mixture was stirred at room temperature for 1 hour. MS analysis indicated completion of the reaction. The reaction mixture was concentrated using a rotary evaporator, dissolved in chloroform (12 mL), and then used immediately. ESI-MS analysis: Calculated value C 32 H 67 NO2S, [M+H + ] = 530.50, calculated value = 530.5.
[0584] Synthesis of the final thiolactone product (A2H7iiT6) [ka] A solution of R-SS-Py(5) (0.72 g, 0.943 mmol) in chloroform (10 mL) was mixed with a solution of thiol(6) (0.54 g, 1.02 mmol) in chloroform (8 mL) at room temperature. The resulting reaction mixture was stirred overnight at room temperature for 16 hours. MS analysis indicated completion of the reaction. The reaction mixture was concentrated. The crude residue was purified by passing it through a 24 g column, and the desired product was eluted with 16% MeOH in DCM. The fraction containing the product was concentrated to obtain 0.61 g (54.9%) of pure product. ESI-MS: Calculated value C 67 H 132 N6O6S2, [M+H + ]=1181.97, measured value=1181.8, [M / 2+H + ]=591.5 and [M / 3+H + ]=394.9.
[0585] Example 7 - IM EPO Data To determine the activity of LNPs containing glycerides, EPO expression tests were performed as described in Example 2. Data for various cationic lipid compositions are shown in Tables 12-14, normalized for each LNP formulation, for example, without added glycerides. Several formulations resulted in increased EPO expression compared to the control condition without glycerides.
[0586] [Table 41]
[0587] [Table 42]
[0588] [Table 43]
[0589] Example 8 - IM EPO data using POPE helper lipids To determine the activity of LNPs containing glycerides, EPO expression tests were performed as described in Example 2, but the DOPE helper lipid in the formulation was replaced with palmitoyloleoyl-phosphatidylethanolamine (POPE). Data for various cationic lipid compositions are shown in Table 15, normalized for each LNP formulation, for example, without added glycerides. All conditions tested showed increased EPO expression compared to the control without glycerides.
[0590] [Table 44]
[0591] Example 9 - Improvement of HAI using glycerides The ability of glyceride LNPs to induce an immune response in animals was determined as described in Example 4. Inclusion of trimyristine and tristearin in the GL-HEPES-E3-E12-DS-4-E10 LNP formulation resulted in an increase in HAI titer compared to a control without glycerides.
[0592] [Table 45]
Claims
1. A composition comprising lipid nanoparticles (LNPs), wherein the LNPs are (I) Ionized lipids and (II) Glycerides or acyl glycols, (III) One or more lipids, (a) structured lipid, (b) Helper lipids, and (c) Stealth lipids One or more lipids selected from the group consisting of and A composition containing the following:
2. The aforementioned LNP is, (I) Ionized lipids and (II) Glycerides or acyl glycols, (III) Structural lipids and (IV) Helper lipids, (V) Stealth lipids and The composition according to claim 1, comprising:
3. The composition according to claim 1 or 2, wherein the glyceride or acyl glycol is a monoglyceride, diglyceride, triglyceride, or diacyl glycol.
4. The glyceride or acyl glycol is of formula I or formula II: 【Chemistry 1】 (In the formula, R G1 、 R G2 and R G3 are each independently H, -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl or -C(O)C (1~25) alkenyl, and the -C (1~25) alkyl, -C (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl are each independently optionally substituted with one to three groups selected from -OC(O)C (1~25) alkyl, -OC(O)C (1~25) alkenyl, -C(O)OC (1~25) alkyl, -C(O)OC (1~25) alkenyl, -OC (1~25) alkyl, -OC (1~25) alkenyl, -C(O)C (1~25) alkyl and -C(O)C (1~25) alkenyl, However, R G1 , R G2 and R G3 Two or fewer of these are H, R G4 is, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) These are alkenyls, and each of them is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) It is optionally substituted with one to three groups independently selected from the alkenyl. R G5 H, -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl or -C(O)C (1~25) It is an alkenyl, and the -C (1~25) Alkyl, -C (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) Alkenyl is -OC(O)C (1~25) Alkyl, -OC(O)C (1~25) Alkenyl, -C(O)OC (1~25) Alkyl, -C(O)OC (1~25) Alkenyl, -OC (1~25) Alkyl, -OC (1~25) Alkenyl, -C(O)C (1~25) Alkyl and -C(O)C (1~25) (The alkenyl is replaced by one to three groups selected independently by arbitrary choice.) A composition according to claim 1 or 2, having the structure of the following.
5. The composition according to any one of claims 1 to 4, wherein the glyceride or acyl glycol is hydrolyzable by lipase.
6. The composition according to any one of claims 1 to 3, wherein the glyceride or acyl glycol is selected from the group consisting of the following or combinations thereof. Table 1 Table 2 Table 3 Table 4
7. The aforementioned ionized lipid is given by formula CAT-I: 【Chemistry 2】 (In the formula, p is an integer between 1 and 9 (including the two endpoints), R 2 Each presence independently involves hydrogen or C substituted by choice. 1~6 It is alkyl, Each L entity is independently an arbitrarily substituted alkylene, an arbitrarily substituted alkenylene, an arbitrarily substituted alkynylene, an arbitrarily substituted heteroalkylene, an arbitrarily substituted heteroalkenylene, an arbitrarily substituted heteroalkynylene, an arbitrarily substituted carbocyclylene, an arbitrarily substituted heterocyclylene, an arbitrarily substituted arylene, or an arbitrarily substituted heteroarylene, or a combination thereof. R 6 and R 7 Each existence of is independently a base of equation (i), (ii), or (iii), Equations (i), (ii), and (iii) are, 【Transformation 3】 And, Each R' element is independently an alkyl group substituted with hydrogen or of any choice. X is O, S, or NR X And R X This is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. Y is O, S, or NR Y And R Y This is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyryl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or nitrogen protecting group. R P This includes hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen protecting group when bonded to an oxygen atom, a sulfur protecting group when bonded to a sulfur atom, or a nitrogen protecting group when bonded to a nitrogen atom, and R L C is replaced by arbitrary selection. 1~50 Alkyl, optionally substituted C 2~50 Alkenyl, C substituted by choice 2~50 Alkynyl, optionally substituted hetero-C 1~50 Alkyl, optionally substituted hetero-C 2~50 Alkenyl, optionally substituted hetero-C 2~50 (It is an alkynyl or polymer.) Having a structure by, The aforementioned ionized lipid is given by formula CAT-II: 【Chemistry 4】 (In the formula, A 1 teeth, 【Transformation 5】 Selected from, the left side of each illustrated structure is -(CH 2 ) is bonded to a-, Z 1 teeth, 【Transformation 6】 Selected from, the right side of each illustrated structure is -(CH 2 ) is bonded to a-, R 1A and R 1B These are optionally substituted alkyls, optionally substituted alkenyls, optionally substituted alkynyls, optionally substituted acyls, and -W 1 -X 1 -Y 1 Each is independently selected from, Each W 1 It is independently selected from optionally substituted alkyls and optionally substituted alkenyls. Each X 1 The atoms are independently selected from -*O-(C=O)-optionally substituted alkyls, -(*C=O)-O-optionally substituted alkyls, -*O-(C=O)-optionally substituted alkenyls, and -(*C=O)-O-optionally substituted alkenyls, and the atoms marked with * are W 1 It is connected to, Each Y 1 The atoms are independently selected from hydrogen, an optionally substituted alkyl group -*O-(C=O), an optionally substituted alkyl group -(*C=O)-O, an optionally substituted alkenyl group -*O-(C=O)-O, and an optionally substituted alkenyl group -(*C=O)-O. The atoms marked with * are X 1 It is connected to, b is 1, 2, 3, 4 or 5, and Each a is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. A composition according to any one of claims 1 to 6, having the structure of the above, or a pharmaceutically acceptable salt thereof.
8. The ionized lipid is selected from the group consisting of the following, in the composition according to any one of claims 1 to 6. Table 5 Table 6
9. The aforementioned structural lipids are sterols, such as cholesterol. The helper lipids are 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), 1,2-dieridoyl-sn-glycero-3-phosphoethanolamine (DEPE), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-distearoylphosphatidylethanolamine (DSPE), or 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), and The composition according to any one of claims 1 to 8, wherein the stealth lipid is a polyethylene glycol conjugated (PEG-conjugated) lipid selected from the group consisting of 1,2-dimiristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DLPE-PEG), and 1,2-distearoyl-rac-glycero-polyethylene glycol (DSG-PEG).
10. The aforementioned LNP is, The ionized lipid in a molar ratio of 35% to 55%, The structural lipids in a molar ratio of 20% to 35%, The stealth lipid in a molar ratio of 0.25% to 2.75%, The helper lipid and the glyceride or acyl glycol in a combined molar ratio of 10% to 35% A composition according to any one of claims 1 to 9, comprising:
11. LNP is, GL-HEPES-E3-E12-DS-4-E10 with a molar ratio of approximately 40%, Cholesterol at a molar ratio of approximately 28.5%, DMG-PEG2000 at a molar ratio of approximately 1.5%, DOPE with a molar ratio of approximately 25%, Trimyristine in a molar ratio of approximately 5% The composition according to claim 1, comprising:
12. The composition according to any one of claims 1 to 11, further comprising a nucleic acid molecule, wherein the nucleic acid molecule is encapsulated in the LNP, and the nucleic acid molecule is an mRNA molecule.
13. The composition according to claim 12, wherein the mRNA molecule encodes an antigen, optionally a viral antigen, or a bacterial antigen.
14. The composition according to claim 12 or 13, comprising two or more LNPs, each LNP encapsulating mRNA encoding a different antigen, wherein the different antigens are optionally from the same pathogen or different pathogens.
15. Use of the composition according to any one of claims 12 to 14 for the manufacture of a pharmaceutical product for inducing an immune response in a subject.
16. Use of the composition according to any one of claims 12 to 14 for the manufacture of a pharmaceutical product for preventing infection or alleviating one or more symptoms of infection.
17. A method for inducing an immune response in a subject requiring such response, comprising administering to the subject a therapeutically effective amount of the composition according to any one of claims 12 to 14.
18. A method for preventing infection or alleviating one or more symptoms of infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the composition described in any one of claims 12 to 14.