Heterobifunctional compounds and methods of use thereof

Abstract

This specification discloses a heterobifunctional compound comprising a BCL6 binding moiety and a moiety that binds to the bromodomain of histone acetyltransferase (HAT), the two moieties being linked via a linker. Similarly, this specification discloses pharmaceutical compositions comprising the compound, and methods of using the compound to treat proliferative disorders, such as cancer.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority and interest in U.S. Provisional Patent Application No. 63 / 511,374, filed on 30 June 2023, which is incorporated herein by reference in its entirety.

[0002] Description of federally funded research This invention was made with government support under contracts CA163915, CA276167, and MH126720 granted by the National Institutes of Health. The government has certain rights in this invention.

[0003] Description of sequence listings The contents of the electronic sequence listing file titled STDU2_42137_601_SequenceListing.xml (size: 2854 bytes, creation date: June 28, 2024) are incorporated herein by reference in their entirety.

[0004] This specification discloses a heterobifunctional compound comprising a BCL6 binding moiety and a moiety that binds to the bromodomain of histone acetyltransferase (HAT), the two moieties being linked via a linker. Similarly, this specification discloses pharmaceutical compositions comprising the compound, and methods of using the compound to treat proliferative disorders, such as cancer. [Background technology]

[0005] One of the major achievements in cancer biology within the last 40 years is the identification of cancer drivers that, when mutated or otherwise misregulated, drive the growth, metastasis, or survival of cancer cells (Weinberg, Science 230(4727), 770-776(1985); Davoli et al. Cell 155, 948-962(2013); Sanchez-Vega et al. Cell 173, 321-337 e310(2018); Denny et al. Cell 166, 328-342(2016)). Cancer drivers are widely recognized from human genetic studies of specific tumors and can be grouped into tumor suppressors that prevent the development of cancer, or oncogenes that directly contribute to cancer growth or metastasis at the expense of the organism.

[0006] Over the past 40 years, parallel studies, primarily conducted in the laboratories of developmental biologists, have identified programmed cell death pathways that kill specific populations of cells with developmental programming errors or errors in DNA replication or repair (Hengartner et al. Cell 76,665-676 (1994), Strasser et al. Annu. Rev. Biochem. 69,217-245 (2000)). These cell death pathways have been evolutionarily perfected over more than 100 million years and are remarkably effective. In fact, approximately 60 billion of our cells are killed by these mechanisms every day (Alberts et al. in Molecular Biology of the Cell (2002)). The genes, proteins, and biochemical pathways that induce programmed cell death (pro-apoptosis) and prevention (anti-apoptosis) are well known and fairly well understood. [Overview of the Initiative]

[0007] Disclosed herein are compounds of formula (I). ALB (I) or a pharmaceutically acceptable salt thereof (in the formula: A is the BCL6 bond portion; L is the linker; B is the portion that binds to the bromodomain of histone acetyltransferase.

[0008] In some embodiments, A is part of the following equation: [ka]

[0009] In some embodiments, A is part of the following equation: [ka]

[0010] In some embodiments, B is the portion that binds to the bromodomain or CBP of p300. In some embodiments, B is the portion of the following formula: [ka]

[0011] In some embodiments, B is part of the following equation: [ka]

[0012] In some embodiments, the compound is the compound of formula (Ia): [ka]

[0013] In some embodiments, L is either directly bonded or a moiety consisting of -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, where the arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties are independently unsubstituted or substituted with one, two, or three substituents. In some embodiments, L is either directly bonded or includes any combination of -CH2-, -O-, -C(O)-, -NH-, -N(CH3)-, cycloalkylene, and heterocyclylene moieties. In some embodiments, L includes any combination of the following moieties: [ka] -(CH2) q -, -C(O)-, -NH-, [ka]

[0014] (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16). In some embodiments, L has a formula selected from the following: [ka]

[0015] (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16).

[0016] In some embodiments, L has an expression selected from the following: [ka]

[0017] In some embodiments, the compound is selected from the following: [ka] [ka] [ka] [ka] [ka] [ka] and its pharmaceutically acceptable salts.

[0018] This specification also discloses pharmaceutical compositions comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0019] This specification also discloses a method for treating a proliferative disorder in a subject requiring treatment of the proliferative disorder, comprising administering a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof to the subject. In some embodiments, the proliferative disorder is a cancer selected from carcinomas, sarcomas, and malignant hematological disorders. In certain embodiments, the cancer is a lymphoma. In some embodiments, it is diffuse large B-cell lymphoma.

[0020] This specification also discloses compounds of formula (I) or pharmaceutically acceptable salts thereof for use as pharmaceuticals.

[0021] This specification also discloses compounds of formula (I) or pharmaceutically acceptable salts thereof for use in the treatment of proliferative disorders. In some embodiments, the proliferative disorder is cancer selected from carcinomas, sarcomas, and malignant hematological disorders. In certain embodiments, the cancer is lymphoma. In some embodiments, the cancer is diffuse large B-cell lymphoma.

[0022] This specification also discloses kits comprising the compound of formula (I) or a pharmaceutically acceptable salt thereof. [Brief explanation of the drawing]

[0023] [Figure 1] This document outlines general strategies for activating cell death pathways in cancer drivers. The left side shows the major cancer driver pathways. The right side shows the pro-apoptotic or cell death pathways. TCIP binds the cancer driver pathway to one chemical, and TCIP binds the cell death pathway to a second chemical. In this application, histone acetyltransferases contribute to the driving mechanisms of certain cancers, such as diffuse large B-cell lymphoma (DLBCL), and BCL6 is a potent regulator of programmed cell death or apoptosis. [Figure 2] This is an illustration of a transcription / epigenetic chemical inducer (TCIP) in which one end binds to histone acetyltransferase and the other end binds to BCL6. The combination of these two proteins and TCIP is called a ternary complex. [Figure 3] This diagram illustrates how TCIP utilizes only a small fraction of its total target, rewiring it to generate new connections. This gain-of-function strategy underlies their remarkable potency and lack of toxicity. [Figure 4] In the diffuse large B-cell lymphoma (DLBCL) cell line KARPAS422, activation of the green fluorescent protein (GFP), a reporter gene whose transcription is regulated by endogenous BCL6, was observed. Cells were treated with the drug using HAT-BCL6 TCIP for 24 hours. Mean ± se, n=1-3 independent repeats. [Figure 5] This study demonstrates the effect of HAT-BCL6 TCIP on the viability of DLBCL strains SUDHL5 (A) and KARPAS422 (B). Cells were treated with the compound for 72 hours. Mean ± se, 1–3 biological replicates. [Figure 6] The results of assays of cell viability in SUDHL5(A) or KARPAS422(B) cell lines after competitive titration of monovalent inhibitors against BCL6 or p300 / CBP against 1 nM of the most potent HAT-BCL6 TCIP, MNN-03-038. Cells were treated with the compound for 72 hours. [Figure 7A] The results of testing the suppression of the tumor protein c-MYC by Western blotting, measuring the protein levels of c-MYC, BCL6, CBP, and p300 after treating SUDHL5 cells with MNN-03-038 (TCIP3) for 4 hours, are shown. These are representative of three biological replicates. [Figure 7B] The results of testing for the suppression of the tumor protein c-MYC are shown. Quantification of Western blots in Figure 7A, mean ± standard deviation, and biological replicates of n=3. [Figure 7C] The results of testing the suppression of the tumor protein c-MYC are shown. Western blot of time-dependent changes in c-MYC protein after 1 nM MNN-03-038 (TCIP3) in SUDHL5 cells. Representative of three biological replicates. [Figure 7D] The results of testing the suppression of the tumor protein c-MYC are shown. Quantification of Western blots in Figure 7C, overlaid with RT-qPCR measurements of time-dependent changes in c-MYC mRNA after 1 nM MNN-03-038 (TCIP3) in SUDHL5 cells, and the suppression half-life calculated to fit a one-phase exponential decay. Mean ± standard deviation, n=3 biological replicates. [Figure 7E]The results of testing the suppression of the tumor protein c-MYC are shown. All differential transcripts quantified by RNA-seq after 1 nM TCIP3 treatment in SUDHL5 cells. Three biological replicates. P-values ​​were calculated by two-sided Wald tests and adjusted for multiple comparisons by Benjamini-Hochberg. [Figure 7F] The results of testing the suppression of the tumor protein c-MYC are presented. RT-qPCR quantification of c-MYC mRNA was performed in SUDHL5 cells, comparing treatment with 1nM MNN-03-038 (TCIP3) versus 1nM GNE-781 and 1nM BI-3812. Biological replicates were performed with mean ± sd, n=3. [Figure 7G] This report presents the results of testing the suppression of the tumor protein c-MYC. RT-qPCR quantification of c-MYC mRNA was performed, comparing treatment with 1 nM MNN-03-038 (TCIP3) in lymphoma cell lines with an increase in BCL6 levels. Biological replicates were performed with mean ± standard deviation, n=3. [Figure 8A] The 72-hour survival curves of MNN-03-038 (TCIP3) and its inhibitor in SUDHL5 cells demonstrate cytotoxicity and ternary complex formation activity. This is a biological repeat with mean ± sd, n=3. [Figure 8B] It exhibits cytotoxicity and ternary complex formation activity. IC50 values ​​for 72-hour survival assays in SUDHL5 cells for all synthesized TCIPs. [Figure 8C] It exhibits cytotoxicity and ternary complex formation activity. Activation of the BCL6 reporter upon treatment with MNN-03-038 (TCIP3) and its inhibitor. Biological replicates of mean ± sd, n=3. [Figure 8D] It exhibits cytotoxicity and ternary complex formation activity. The TR-FRET assay shows ternary complex formation between recombinant p300-bromodomain-His and BCL6-BTB-domain protein after 1 hour of co-incubation with TCIP molecules. [Figure 8E]It exhibits cytotoxicity and ternary complex formation activity. Competitive titration of p300 / CBP inhibitors (GNE-781 or SGC-CBP-30) or BCL6 inhibitors (BI-3812, GSK137, or CCT373566) against MNN-03-038 (TCIP3) (1nM) in SUDHL5 cells over 72 hours. Mean ± sd, n=2-3 biological replicates. [Figure 8F] It exhibits cytotoxicity and ternary complex formation activity. 72-hour survival curves of four DLBCL cell lines treated with MNN-03-038(TCIP3) or GNE-781+BI-3812, ordered by the decrease in BCL6 levels. [Modes for carrying out the invention]

[0024] The fact that the biochemical pathways used to drive cancer coexist within the same cell as programmed cell death pathways that efficiently kill cells increases the likelihood that the cell's biochemical circuits can be rewired to kill itself using the biochemical pathways initiated by the cancer driver. This specification discloses a class of small molecules (Transcriptional / Epigenetic Chemical Inducers of Proximity, i.e., TCIPs) that rewire the cell's biochemical circuits to activate pathways that are not normally under the control of the first pathway (in this case, the cancer driver). The action of these molecules is shown in Figure 1, with gray arrows linking the cancer driver and its dependent biochemical pathway to the cell death pathway initiated in this case by DNA replication damage or developmental error. The general structure of TCIP, which recruits the transcription activator, histone acetyltransferase, to the promoter of a cell death gene to which BCL6 binds, is shown in Figure 2.

[0025] TCIP utilizes only a portion of the target protein and uses it to activate transcription. For example, as shown in Figure 3, only a portion of the total HAT is used. By utilizing only a small amount of the target protein rather than inhibiting the entire target protein, TCIP can avoid toxicity based on mechanisms associated with complete inhibition or removal of the target. This whole process is illustrated in Figure 3.

[0026] This specification discloses highly potent TCIPs for the treatment of cancers such as human diffuse large B-cell lymphoma (DLBL). BCL6 represses pro-apoptotic genes by binding to histone deacetylase. Therefore, recruitment of histone acetyltransferase can activate these repressed genes. Compounds such as B-I3812 bind to the BTB domain of BCL6 and prevent histone deacetylase binding. Accordingly, the compounds disclosed herein are designed to bind to the BTB domain of BCL6 and are chemically linked to entities that bind to histone acetyltransferase (HAT) Ep300 and CBP.

[0027] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. In case of any conflict, including definitions, this document shall prevail.

[0028] Definitions of specific functional groups and chemical terms are described in more detail below. For the purposes of this disclosure, chemical elements are as defined in Handbook of Chemistry and Physics, 75. th The periodic table of elements is identified according to the CAS version on the endpaper of the ed., and specific functional groups are generally defined as described therein. Furthermore, general principles of organic chemistry, as well as specific functional groups and reactivity, are described in Sorrell, Organic Chemistry, 2 ndedition, University Science Books, Sausalito, 2006; Smith, March’s Advanced Organic Chemistry: Reactions, Mechanism, and Structure, 7 th Edition, John Wiley & Sons, Inc., New York, 2013; Larock, Comprehensive Organic Transformations, 3 rd Edition, John Wiley & Sons, Inc., New York, 2018; and Carruthers, Some Modern Methods of Organic Synthesis, 3 rd Edition, Cambridge University Press, Cambridge, 1987.

[0029] As used herein, the modifier “about” when used in relation to an amount includes the recited value and has the meaning indicated by the context (e.g., it includes at least the degree of error associated with the measurement of a particular amount). The modifier “about” should also be considered to disclose a range defined by the absolute values of the two endpoints. For example, the expression “about 2 to about 4” also discloses the range “2 to 4”. The term “about” may refer to ±10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean 0.9 to 1.1. Other meanings of “about” may become apparent from the context, such as rounding, for example, “about 1” may also mean 0.5 to 1.4.

[0030] As used herein, the term “alkyl” refers to a radical of a straight-chain or branched saturated hydrocarbon chain. The alkyl chain may have, for example, 1 to 24 carbon atoms (C1-C 24 alkyl), 1 to 16 carbon atoms (C1-C 16 alkyl), 1 to 14 carbon atoms (C1-C 14 alkyl), 1 to 12 carbon atoms (C1-C 12Alkyl), 1 to 10 carbon atoms (C1-C 10 Alkyl compounds may include 1-8 carbon atoms (C1-C8 alkyl), 1-6 carbon atoms (C1-C6 alkyl), 1-4 carbon atoms (C1-C4 alkyl), 1-3 carbon atoms (C1-C3 alkyl), or 1-2 carbon atoms (C1-C2 alkyl). Typical examples of alkyl compounds include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl.

[0031] As used herein, the term “alkenyl” refers to a radical of a straight or branched hydrocarbon chain containing at least one carbon-carbon double bond and no triple bond. The double bond(s) can be located at any position(s) in the hydrocarbon chain. An alkenyl chain, for example, contains 2 to 24 carbon atoms (C2-C2). 24 Alkenyl), 2-16 carbon atoms (C2-C 16 Alkenyl), 2-14 carbon atoms (C2-C 14 Alkenyl), 2-12 carbon atoms (C2-C 12 Alkenyl), 2 to 10 carbon atoms (C2-C 10 Alkenyls may include alkenyls with 2-8 carbon atoms (C2-C8 alkenyls), 2-6 carbon atoms (C2-C6 alkenyls), 2-4 carbon atoms (C2-C4 alkenyls), 2-3 carbon atoms (C2-C3 alkenyls), or 2 carbon atoms (C2 alkenyls). Typical examples of alkenyls, though not limited to them, include ethenyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, butadienyl, 2-methyl-2-propenyl, 3-butenyl, pentenyl, pentadinyl, hexenyl, heptenyl, octenyl, and octatrienyl.

[0032] As used herein, the term "alkynyl" means a linear or branched hydrocarbon chain radical containing at least one carbon-carbon triple bond. An alkynyl chain is, for example, a chain containing 2 to 24 carbon atoms (C2-C2). 24 Alkynyl), 2-16 carbon atoms (C2-C 16 Alkynyl), 2-14 carbon atoms (C2-C 14 Alkynyl), 2-12 carbon atoms (C2-C 12 Alkynyl), 2 to 10 carbon atoms (C2-C 10 The hydrocarbon chain may contain alkynyl groups, 2-8 carbon atoms (C2-C8 alkynyl), 2-6 carbon atoms (C2-C6 alkynyl), 2-4 carbon atoms (C2-C4 alkynyl), 2-3 carbon atoms (C2-C3 alkynyl), or 2 carbon atoms (C2 alkynyl). Triple bonds (or more) can be located at any position (or more) in the hydrocarbon chain. Representative examples of alkynyls include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, and 2-butynyl.

[0033] As used herein, the term "alkoxy" refers to an alkyl group as defined herein, which is attached to the parent molecule via an oxygen atom. Typical examples of alkoxys include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, and tert-butoxy.

[0034] As used herein, the term "amino" refers to the group -NR x R y It refers to, and in the formula, R x and R y The group is selected from hydrogen and alkyl (e.g., C1-C4 alkyl). In this specification, the -NH (alkyl) group may be called "alkylamino," and the -N (alkyl)2 group may be called "dialkylamino."

[0035] As used herein, the term “aryl” refers to a monocyclic, bicyclic, or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic arrangement) having 6 to 14 ring carbon atoms and 0 heteroatoms (“C6-C 14 In some embodiments, the aryl group has six ring carbon atoms ("C6 aryl", i.e., phenyl). In some embodiments, the aryl group has ten ring carbon atoms ("C6 aryl"). 10 "aryl" (e.g., naphthyl, e.g., 1-naphthyl and 2-naphthyl). In some embodiments, the aryl group has 14 ring carbon atoms ("C"). 14 "Aryl" (e.g., anthracenyl and phenantrenyl).

[0036] As used herein, the term "arylene" refers to a divalent aryl radical.

[0037] As used herein, the term "cycloalkyl" refers to a saturated carbocyclic radical containing 3 to 10 carbon atoms and 0 heteroatoms. Cycloalkyls may be monocyclic, bicyclic, bridging, condensed, or spirocyclic. Typical examples of cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, adamantyl, bicyclo[2.2.1]heptanyl, bicyclo[3.2.1]octanyl, and bicyclo[5.2.0]nonanyl.

[0038] As used herein, the term "cycloalkylene" refers to a divalent cycloalkyl radical.

[0039] As used herein, the term "cyano" refers to the -CN group.

[0040] As used herein, the terms "halogen" or "halo" refer to F, Cl, Br, or I.

[0041] As used herein, the term “haloalkyl” refers to an alkyl group in which at least one hydrogen atom (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 hydrogen atoms) is replaced by a halogen, as defined herein. In some embodiments, each hydrogen atom of the alkyl group is replaced by a halogen (“perhaloalkyl”). Typical examples of haloalkyls include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, and 3,3,3-trifluoropropyl.

[0042] As used herein, the term “haloalkoxy” refers to an alkyl group as defined herein, which is attached to the parent molecule via an oxygen atom. Typical examples of haloalkoxys include, but are not limited to, difluoromethoxy, trifluoromethoxy, and 2,2,2-trifluoroethoxy.

[0043] As used herein, the term "heteroalkyl" means that one or more carbon atoms (and associated hydrogen atoms) independently form a heteroatomic group (e.g., -NH-, -O-, -S-, -S(O)-, -S(O)2-, -OP(O)(O) - This refers to alkyl groups as defined herein, which are substituted with (e.g., C(O)-). For example, one, two, three, four, five, six, or more carbon atoms may be independently substituted with the same or different heteroatom groups. Heteroalkyl groups may also include one or more carbonyl moieties (i.e., carbon atoms of the alkyl group are oxidized to -C(O)- groups).

[0044] As used herein, the term “heteroaryl” refers to a 5- to 10-membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 π electrons shared in the ring arrangement) radical having a ring carbon atom and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 10-membered heteroaryl”). In heteroaryl groups containing one or more nitrogen atoms, the bond site may be a carbon atom or a nitrogen atom, as long as the valence allows. A heteroaryl bicyclic ring system may contain one or more heteroatoms in one or both rings. “Heteroaryl” also includes ring systems in which the heteroaryl ring defined above is fused with one or more aryl groups, where the bond site is in either the aryl or heteroaryl ring, and in such examples, the number of ring members indicates the number of ring members in the fused (aryl / heteroaryl) ring system. The bond site of a bicyclic heteroaryl group in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.) may be on either ring, i.e., a ring containing a heteroatom (e.g., 2-indolyl) or a ring without a heteroatom (e.g., 5-indolyl). Examples of five-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl. Examples of five-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Examples of five-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Examples of five-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Examples of six-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl. Examples of six-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl.Examples of six-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetradinyl, respectively. Examples of seven-membered heteroaryl groups containing one heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Examples of 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranil, benzoisofuranil, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolidinyl, and prinyl. Examples of 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthylidinyl, pteridinyl, quinolinyl, isoquinolinyl, synnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.

[0045] As used herein, the term "heteroarylene" refers to a divalent heteroaryl radical.

[0046] As used herein, the term “heterocyclyl” refers to a radical of a 3- to 10-membered non-aromatic ring system having a ring carbon atom and 1 to 4 ring heteroatoms, each heteroatom independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3- to 10-membered heterocyclyl”). In heterocyclyl groups containing one or more nitrogen atoms, the bond sites can be carbon atoms or nitrogen atoms, as long as the valence allows. Heterocyclyl groups can be monocyclic (“monocyclic heterocyclyl”), or condensed, bridging, or spirocyclic systems (e.g., bicyclic systems (“bicyclic heterocyclyl”)), and can be saturated or partially unsaturated. A heterocyclyl bicyclic ring system may contain one or more heteroatoms in one or both rings. "Heterocyclyl" includes ring systems in which the heterocyclyl ring defined above is fused with one or more cycloalkyl groups, with the bond site located on either the cycloalkyl ring or the heterocyclyl ring, or ring systems in which the heterocyclyl ring defined above is fused with one or more aryl or heteroaryl groups, with the bond site located on the heterocyclyl ring, in which case the ring member number continues to indicate the ring member number in the heterocyclyl ring system. A heterocyclyl group may be described, for example, as a 3- to 7-membered ring heterocyclyl, and the term "membered ring" refers to the ring atoms other than hydrogen within that part, namely carbon, nitrogen, oxygen, sulfur, boron, phosphorus, and silicon. Examples of 3-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azildinyl, oxyranyl, and thiorenyl. Examples of 4-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azetidinyl, oxetanyl, and thietanyl. Examples of five-membered heterocyclyl groups containing one heteroatom include, but are not limited to, tetrahydrofuranil, dihydrofuranil, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinil, dihydropyrrolyl, and pyrrolyl-2,5-dione. Examples of five-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, dioxolanil, oxasulfuranil, disulfuranil, and oxazolidine-2-one.Examples of five-membered heterocyclyl groups containing three heteroatoms include, but are not limited to, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Examples of six-membered heterocyclyl groups containing one heteroatom include, but are not limited to, piperidinyl (e.g., 2,2,6,6-tetramethylpiperidinyl), tetrahydropyranyl, dihydropyridinyl, pyridinonyl (e.g., 1-methylpyridine-2-onyl), and thianyl. Examples of six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, piperazinyl, morpholinyl, pyridadinonyl (2-methylpyridazine-3-onyl), pyrimidinonyl (e.g., 1-methylpyrimidine-2-onyl, 3-methylpyrimidine-4-onyl), dithianyl, and dioxanyl. Examples of six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, triazinyl. Examples of seven-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azepanyl, oxepanyl, and thiepanyl. Examples of eight-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azokanyl, oxekanyl, and thiokanyl. Examples of five-membered heterocyclyl groups condensed on a C6 aryl ring (also referred to herein as 5,6-bicyclic heterocyclyl rings) include, but are not limited to, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, and benzoxazolinonyl. Examples of five-membered heterocyclyl groups condensed on a heterocyclyl ring (also referred to herein as 5,5-bicyclic heterocyclyl rings) include, but are not limited to, octahydropyrrolopyrrolyl (e.g., octahydropyrrolo[3,4-c]pyrrolyl). Examples of six-membered heterocyclyl groups (also called 4,6-membered heterocyclyl rings) condensed on a heterocyclyl ring include, but are not limited to, diazaspirononanyl (e.g., 2,7-diazaspirononanyl).Examples of six-membered heterocyclyl groups fused to an aryl ring (also referred to herein as 6,6-bicyclic heterocyclyl rings) include, but are not limited to, tetrahydroquinolinyl and tetrahydroisoquinolinyl. Examples of six-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as 6,7-bicyclic heterocyclyl rings) include, but are not limited to, azabicyclooctanyl (e.g., (1,5)-8-azabicyclo[3.2.1]octanyl). Examples of six-membered heterocyclic groups fused to a cycloalkyl ring (also referred to herein as 6,8-bicyclic heterocycles) include, but are not limited to, azabicyclononanyl (e.g., 9-azabicyclo[3.3.1]nonanyl).

[0047] As used herein, the term "heterocyclylene" refers to a divalent heterocyclyl radical.

[0048] As used herein, the terms "hydroxy" or "hydroxyl" refer to the -OH group.

[0049] As used herein, the term "nitro" refers to the -NO2 group.

[0050] Where a group or part can be substituted, the term “substituted” means that one or more hydrogens on the group indicated in the expression using “substituted” (e.g., 1, 2, 3, 4, 5, or 6; 1, 2, or 3 in some embodiments; 1 or 2 in other embodiments) can be replaced with a certain range of enumerated groups or preferred substituents known to those skilled in the art (e.g., one or more of the groups listed below), provided that the number of substituents does not exceed the normal valence of the specified atom. Substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, acyl, amino, amide, amidino, aryl, azide, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkenyl, guanidino, halo, haloalkyl, haloalkoxy, heteroalkyl, heteroaryl, heterocyclyl, hydroxy, hydrazino, imino, oxo, nitro, phosphate, phosphonate, sulfonic acid, thiol, thion, or combinations thereof.

[0051] When used herein, the chemical structure contains [ka] The notation indicates a point where one part is bonded to another part (for example, a substituent on the rest of the compound).

[0052] For the compounds described herein, the groups and substituents can be selected according to the allowable valencies of the atoms and substituents, and as a result, stable compounds that do not spontaneously undergo transformations such as rearrangement, cyclization, or elimination can be obtained through selection and substitution.

[0053] When substituents are indicated by a standard chemical formula and written from left to right, such notation also includes substituents that would be obtained by writing the structure from right to left. For example, if a divalent group is indicated as -CH2O-, such notation also includes -OCH2-, and similarly, -OC(O)NH- includes -NHC(O)O-. When a linker portion is indicated, the linker can be bonded to other parts of the compound in either direction.

[0054] As used herein, the terms “administer,” “give,” or “give” mean to implant, absorb, ingest, inject, inhale, or otherwise introduce a compound or pharmaceutical composition.

[0055] As used herein, the terms “condition,” “disease,” and “disorder” are interchangeable.

[0056] The “effective amount” of a compound or composition refers to the amount sufficient to elicit a desired biological response (e.g., to treat a condition). As those skilled in the art will understand, the effective amount of a compound can vary depending on factors such as the desired biological outcome, the pharmacokinetics of the compound, the condition being treated, the mode of administration, and the age and health status of the subject. Effective amounts encompass both therapeutic and prophylactic measures. For example, in the treatment of cancer, an effective amount of a compound or composition may reduce tumor burden or halt tumor growth or metastasis.

[0057] The “therapeutic dose” of a compound or composition is the amount sufficient to provide a therapeutic effect in the treatment of a condition, or to delay or minimize one or more symptoms associated with the condition. In some embodiments, the “therapeutic dose” is the amount sufficient to provide a therapeutic effect in the treatment of a condition, or to minimize one or more symptoms associated with the condition. The therapeutic dose of a compound means the amount of the therapeutic agent alone or in combination with other therapies that provide a therapeutic benefit in the treatment of a condition. The term “therapeutic dose” may include an amount that improves the overall therapy, reduces or avoids the symptoms or etiology of a condition, or enhances the therapeutic effect of another therapeutic agent.

[0058] The “targets” to which the administration is intended include, but are not limited to, humans (i.e., males or females of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)) and / or other non-human animals, e.g., mammals (e.g., primates (e.g., crab-eating macaques, rhesus macaques); commercially available suitable mammals such as cattle, pigs, horses, sheep, goats, cats, and / or dogs), and birds (e.g., commercially available suitable birds such as chickens, ducks, geese, quail, and / or turkeys).

[0059] As used herein, the terms “treatment,” “to treat,” and “to treat” refer to the reversal, alleviation, delay of onset, or inhibition of progression of a disease or condition, or one or more signs or symptoms thereof. In some embodiments, “treatment,” “to treat,” and “to treat” require that signs or symptoms of the disorder or condition of the disease have developed or been observed. In other embodiments, treatment may be administered even without signs or symptoms of the disease or condition. For example, treatment may be administered to an individual who is susceptible before the onset of symptoms (e.g., in light of the history of the symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after the symptoms have subsided, for example, to delay or prevent relapse.

[0060] compound Disclosed herein are compounds of formula (I): ALB (I) or a pharmaceutically acceptable salt thereof (in the formula: A is the BCL6 bond portion; L is the linker; B is the portion that binds to the bromodomain of histone acetyltransferase.

[0061] Part A is the BCL6 bond portion. In some embodiments, A is the portion of the following formula: [ka]

[0062] In some embodiments, A is part of the following equation: [ka]

[0063] Part B is the portion that binds to the bromodomain of histone acetyltransferase. In some embodiments, B is the portion that binds to the bromodomain or CBP of p300. In some embodiments, B is the portion of the following formula: [ka]

[0064] In some embodiments, B is part of the following equation: [ka]

[0065] In some embodiments, the compound of formula (I) is the compound of formula (Ia): [ka] or a pharmaceutically acceptable salt thereof.

[0066] L is a linker that provides a covalent bond between the A and B portions. The exact structure of the linker may not be important in some embodiments, as long as it does not substantially interfere with the activity of the BCL6 binding portion or the portion that binds to the bromodomain of HAT. In some embodiments, L is a direct bond. In other embodiments, L includes any combination of -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, where R' is selected from hydrogen and C1-C6 alkyl, and the arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties are independently unsubstituted or substituted with one, two, or three substituents.

[0067] In some embodiments, the linker contains an alkylene chain (e.g., having 2 to 20 -CH2- units). In other embodiments, the linker contains -O-, -S-, -N(R')-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -OC(O)N(R')-, -C(NR') -, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2- , -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, -N(R')S(O)N(R')-, C3-C 12The alkylene chain comprises a cycloalkylene, a 3-12 member heterocyclylene, a 5-10 member arylene, a 5-12 member heteroarylene, or any combination thereof, interrupted and / or terminated (at one or both ends) by at least one group selected from the following: each R' is independently selected from hydrogen and C1-C6 alkyl groups, and the interrupting and terminating groups may be the same or different.

[0068] In some embodiments, L is an alkylene chain: [ka] The formula includes, where q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some embodiments, q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. For example, in some embodiments, q is 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-16, 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-16, 3-15, 3-14, 3-13, 3-12, 3-11, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-16, 4-15, 4-14 , 4~13, 4~12, 4~11, 4~10, 4~9, 4~8, 4~7, 4~6, 4~5, 5~16, 5~15, 5~14, 5~13, 5~12, 5~11, 5~10, 5~9, 5~8, 5~7, 5~6, 6~16, 6~15, 6~14, 6~13 ,6~12,6~11,6~10,6~9,6~8,6~7,7~16,7~15,7~14,7~13,7~12,7~11,7~10,7~9,7~8,8~16,8~15,8~14,8~13,8~12,8~11,8~10,8~9,or These are 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, 9-10, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-16, 11-15, 11-14, 11-13, 11-12, 12-16, 12-15, 12-14, 12-13, 13-16, 13-15, 13-14, 14-16, 14-15, and 15-16. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6. In some embodiments, q is 7. In some embodiments, q is 8. In some embodiments, q is 9. In some embodiments, q is 10. In some embodiments, q is 11. In some embodiments, q is 12. In some embodiments, q is 13. In some embodiments, q is 14.In some embodiments, q is 15. In some embodiments, q is 16. Specific examples of alkylene chains include: [ka] These are some examples.

[0069] In some embodiments, L is -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R') It contains alkylene groups interrupted by functional groups such as -, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, or -N(R')S(O)N(R')-.

[0070] In some embodiments, L comprises one or more alkylene glycol repeating units, for example, ethylene glycol or propylene glycol repeating units. For example, in some embodiments, L comprises a poly- or oligo-ethylene glycol chain: [ka] The formula includes, where p is 1, 2, 3, 4, 5, or 6. In some embodiments, L is in the formula: [ka] The formula includes the base, where p is 1, 2, 3, 4, 5, or 6. In some embodiments, p is 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-6, or 5-6. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5. In some embodiments, p is 6.

[0071] In some embodiments, L comprises one or more cycloalkylene groups or heterocyclylene groups, and non-limiting examples of these include: [ka] These are some examples.

[0072] In some embodiments, L includes a cycloalkylene group or a heterocyclylene group, such as any of the cycloalkylene groups and heterocyclylene groups exemplified above, having one or more additional groups at one or both ends, where the additional groups are independently CH2-, -O-, -S-, -N(R')-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)N(R')-, -N(R') Selected from C(O)O-, -OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, and -N(R')S(O)N(R')-, or any combination thereof, where each R' is independently selected from hydrogen and C1-C6 alkyl. In some embodiments, L includes a cycloalkylene group or a heterocyclylene group, such as one of the cycloalkylene groups and heterocyclylene groups exemplified above, having one or more additional groups at one or both ends, where the additional groups are independently selected from -CH2-, -C(O)-, -NH-, and -O-.

[0073] In some embodiments, L comprises two or more cycloalkylene groups or heterocyclylene groups, such as two or three cycloalkylene groups or heterocyclylene groups, independently selected from the above, which are linked to each other by covalent bonds or one or more linking groups, and optionally having one or more additional linking groups at one or both ends, where the linking groups are independently -O-, -S-, -N(R')-, -CH2-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O )-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR' )N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2 -, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, and -N(R')S(O)N(R')-, or any combination thereof, where each R' is independently selected from hydrogen and C1-C6 alkyl. In some embodiments, L comprises two or more cycloalkylene groups or heterocyclylene groups, such as two or three cycloalkylene groups or heterocyclylene groups, independently selected from the above, which are linked to each other by covalent bonds or one or more linking groups, and optionally having one or more additional linking groups at one or both ends, where the linking groups are independently selected from -O- and -CH2-.

[0074] In some embodiments, L comprises one or more cycloalkylene or heterocyclylene groups substituted with one, two, or three substituents independently selected from C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, halo, hydroxy, etc. In some embodiments, L comprises one or more cycloalkylene or heterocyclylene groups substituted with one, two, or three substituents independently selected from C1-C4 alkyl and halo. In some embodiments, L comprises one or more cycloalkylene or heterocyclylene groups substituted with one, two, or three substituents independently selected from methyl and fluoro.

[0075] In some embodiments, L is either directly bonded or comprises -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, where the arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties are independently unsubstituted or substituted with one, two, or three substituents. In some embodiments, L is either directly bonded or comprises any combination of -CH2-, -O-, -C(O)-, -NH-, -N(CH3)-, cycloalkylene, and heterocyclylene moieties.

[0076] In some embodiments, L includes any combination of the following parts: [ka] -(CH2) q -, -C(O)-, -NH-, [ka] (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16).

[0077] In some embodiments, L has an expression selected from the following: [ka] (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16).

[0078] In some embodiments, L has an expression selected from the following: [ka]

[0079] In some embodiments, the compound of formula (I) is [ka] [ka] [ka] [ka] [ka] [ka]

[0080] and their pharmaceutically acceptable salts are selected.

[0081] When discussing the compounds of formula (I) as described herein, or the specific features or properties of compositions, methods, or kits containing the compounds of formula (I), such references should be understood to include the compounds of formula (Ia) and the specific exemplary compounds disclosed herein.

[0082] Compounds may exist as stereoisomers containing a chiral or asymmetric center. Stereoiomers are "R" or "S" depending on the arrangement of substituents around the chiral carbon atom. As used herein, "R" and "S" refer to the arrangements defined below: IUPAC 1974 Recommendations for Section E, Fundamental Stereochemistry, in Pure Appl. Chem., 1976, 45:13-30. Various stereoisomers and mixtures thereof are specifically included within the scope of this disclosure. Stereoiomers include enantiomers and diastereomers, as well as mixtures of enantiomers or diastereomers. Individual stereoisomers of a compound may be prepared synthetically from commercially available starting materials containing a chiral or asymmetric center, or they may be prepared by preparing a racemic mixture and then following resolution methods known to those skilled in the art. These separation methods are exemplified below: (1) binding the enantiomer mixture to a chiral auxiliary, separating the resulting diastereomer mixture by recrystallization or chromatography, and optionally liberating the optically pure product from the auxiliary as described below: Furniss, Hannaford, Smith, and Tatchell, “Vogel's Textbook of Practical Organic Chemistry,” 5th edition (1989), Longman Scientific & Technical, Essex CM20 2JE, England; or (2) directly separating the optical enantiomer mixture by chiral chromatography column; or (3) fractional recrystallization.

[0083] The compound may also exist in different tautomers, and all such forms are included within the scope of this disclosure.

[0084] This disclosure also includes isotope-labeled compounds that are identical to those described in formula (I), except that one or more atoms are substituted with atoms having atomic masses or mass numbers different from those commonly found in nature. Examples of isotopes suitable for incorporation into the compounds of the present invention are, but are not limited to, 2 H, 3 H, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 35 S, 18 F, and 36 These include hydrogen such as Cl, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine. Deuterium ( 2 Substitution with heavier isotopes such as H) can yield certain therapeutic benefits, such as improved metabolic stability, e.g., extended in vivo half-life, or reduced dosage requirements, and is therefore preferable depending on the circumstances. Positron-emitting isotopes can be incorporated into compounds for medical imaging and positron emission tomography (PET) studies to determine receptor distribution. Suitable positron-emitting isotopes that can be incorporated into the compound of formula (I) are: 11 C, 13 N, 15 O, and 18 F is the isotope-labeled compound of formula (I). The isotope-labeled compound of formula (I) can generally be prepared by conventional methods known to those skilled in the art, or by a process similar to that described in the attached examples, using a suitable isotope-labeled reagent instead of a non-isotope-labeled reagent.

[0085] The compounds disclosed herein can exist in solvated forms with pharmaceutically acceptable solvents such as water, methanol, and ethanol, and this disclosure is intended to include both solvated and unsolvated forms of these compounds. In one embodiment, the compound is amorphous. In one embodiment, the compound is a single polymorph. In another embodiment, the compound is a mixture of polymorphs. In yet another embodiment, the compound is in crystalline form.

[0086] a. Pharmaceutically acceptable salts The disclosed compounds may exist as pharmaceutically acceptable salts. The term “pharmaceutically acceptable salt” refers to a salt or amphoteric ion of a compound that is water-soluble or oil-soluble or dispersible, suitable for treating disorders without excessive toxicity, irritation, and allergic responses, commensurate with a reasonable benefit / risk ratio, and effective for the intended use. The salt may be prepared during the final isolation and purification of the compound, or separately by reacting the amino group of the compound with a suitable acid. For example, the compound may be dissolved in a suitable solvent (e.g., methanol and water, but not limited to) and treated with an acid such as at least one equivalent of hydrochloric acid. The resulting salt may be precipitated, isolated by filtration, and dried under reduced pressure. Alternatively, the solvent and excess acid may be removed under reduced pressure to provide the salt. Typical salts include acetate, adipine, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, isethionate, fumarate, lactate, maleate, methanesulfonate, naphthylenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, oxalate, maleate, pivaphosphate, propionate, succinate, tartrate, trichloroacetate, trifluoroacetate, glutamate, para-toluenesulfonate, undecanoate, hydrochloride, hydrobromide, sulfate, and phosphate. The amino group of the compound can also be quaternized with alkyl chlorides, alkyl bromides, and alkyl iodides such as methyl, ethyl, propyl, isopropyl, butyl, lauryl, myristyl, and stearyl.

[0087] Base addition salts can be prepared during the final isolation and purification of the disclosed compounds by the reaction of a carboxyl group of a metal cation (e.g., lithium, sodium, potassium, calcium, magnesium, or aluminum) with a suitable base (e.g., hydroxide, carbonate, or bicarbonate) or an organic primary, secondary, or tertiary amine. Quaternary amine salts can be prepared from methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N-dibenzylphenethylamine, 1-efenamine, and N,N'-dibenzylethylenediamine, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, etc.

[0088] b. Synthesis method In another embodiment, a method for producing a compound of formula (I) or a pharmaceutically acceptable salt thereof is disclosed herein. Generally, compounds of formula (I) and pharmaceutically acceptable salts thereof can be prepared by any process known to be applicable to the preparation of chemically related compounds. Exemplary preferred synthesis schemes are provided in the Examples section.

[0089] Compounds and intermediates may be isolated and purified by methods well known to those skilled in the field of organic synthesis. Examples of conventional methods for isolating and purifying compounds include, but are not limited to, chromatography on solid supports such as silica gel, alumina, or silica derivatized with alkylsilane groups, recrystallization at high or low temperatures with optional pretreatment with activated carbon, thin-layer chromatography, distillation at various pressures, sublimation under vacuum, and grinding, as described, for example, in “Vogel's Textbook of Practical Organic Chemistry”, 5th edition (1989), pub. Longman Scientific & Technical, Essex CM20 2JE, England, by Furniss, Hannaford, Smith, and Tatchell.

[0090] The reaction conditions and reaction times for each individual step may vary depending on the specific reactants used and the substituents present in them. The reactants may be work-up in a conventional manner (e.g., by removing the solvent from the residue) and may be further purified by, but not limited to, crystallization, distillation, extraction, tritulation, and chromatography, according to methodologies commonly known in the art. Unless otherwise stated, starting materials and reagents are commercially available or can be prepared by those skilled in the art from commercially available materials using methods described in the chemical literature.

[0091] Routine experiments, including the proper manipulation of reaction conditions, reagents and sequence of synthetic routes, protection of any chemical functions that cannot be adapted to the reaction conditions, and deprotection at appropriate time points in the reaction sequence of the method, are included in the scope of this disclosure. Suitable protecting groups and methods for protecting and deprotecting various substituents using such suitable protecting groups are well known to those skilled in the art, for example, Protective Groups in Organic Synthesis (4 thThis can be found in the book by Greene titled "PGM Wuts and TW Greene" (ed.), John Wiley & Sons, NY (2006).

[0092] If an optically active form of the disclosed compound is required, it can be obtained by performing one of the procedures described herein using an optically active starting material (e.g., prepared by asymmetric induction of an appropriate reaction step), or by separating a mixture of stereoisomers of the compound or intermediate using a standard procedure (such as chromatographic separation, recrystallization, or enzymatic degradation).

[0093] Similarly, if a pure geometric isomer of a compound is required, it can be obtained by using the pure geometric isomer as a starting material and performing one of the procedures described herein, or by separating a mixture of geometric isomers of the compound or intermediate using standard procedures such as chromatographic separation.

[0094] The synthesis schemes and specific examples described herein are illustrative and should not be construed as limiting the scope of this disclosure or the claims. Substitutions, modifications, and equivalents of the synthesis methods and specific examples are intended.

[0095] Pharmaceutical composition The disclosed compounds may be incorporated into pharmaceutical compositions suitable for administration to a subject (e.g., a patient, which may be human or non-human). The pharmaceutical compositions may contain a “therapeutic effective dose” or a “preventive effective dose” of the agent. “Therapeutic effective dose” refers to an effective amount in the dosage and duration required to achieve a desired therapeutic outcome. The therapeutic effective dose of a composition may be determined by those skilled in the art and may vary depending on factors such as the individual’s condition, age, sex, and weight, as well as the composition’s ability to induce a desired response in the individual. The therapeutic effective dose is also the amount in which the therapeutically beneficial effect outweighs any toxic or adverse effects of any of the compounds of the present invention. “Preventive effective dose” refers to an effective amount in the dosage and duration required to achieve a desired preventive outcome. Since preventive doses are typically administered to a subject before or during the initial stages of a disease or condition, the preventive effective dose will be less than the therapeutic effective dose.

[0096] Pharmaceutical compositions may contain pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically acceptable carrier” means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation aid. Some examples of substances that can function as pharmaceutically acceptable carriers are: sugars (e.g., lactose, glucose, and sucrose); starches (e.g., corn starch and potato starch); cellulose and its derivatives (e.g., sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate); tragacanth powder; malt; gelatin; talc; excipients (e.g., cocoa butter and suppository wax); oils (e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil); Recall (e.g., propylene glycol, but not limited); esters (e.g., ethyl oleate and ethyl laurate, but not limited); agar; buffers (e.g., magnesium hydroxide and aluminum hydroxide, but not limited); alginic acid; pyrogenic substances without water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer. Other non-toxic compatible lubricants (e.g., sodium lauryl sulfate and magnesium stearate, but not limited), as well as colorants, release agents, coating agents, sweeteners, flavorings and fragrances, preservatives, and antioxidants may also be present in the composition at the discretion of the formulation.

[0097] Therefore, compounds and their pharmaceutically acceptable salts can be formulated for administration, for example, in solid doses, eye drops, topical oily preparations, injection, inhalation (either orally or nasally), implantation, or by oral, buccal, parenteral, or rectal administration. Techniques and formulations can generally be found in "Remington's Pharmaceutical Sciences" (Meade Publishing Co., Easton, Pa.). Therapeutic compositions typically must be sterile and stable under manufacturing and storage conditions.

[0098] The type of carrier to be used will be determined by the route through which the disclosed compound is administered and the form of the composition. The composition may be in various forms suitable for systemic administration (e.g., oral, rectal, nasal, sublingual, oral, implantable, or parenteral) or topical administration (e.g., percutaneous, transpulmonary, transnasal, ocular, intraocular, liposome delivery system, or iontophoresis).

[0099] Carriers for systemic administration typically contain at least one of the following: diluents, lubricants, binders, disintegrants, colorants, flavorings, sweeteners, antioxidants, preservatives, flow enhancers, solvents, suspending agents, wetting agents, surfactants, or combinations thereof. All carriers are optional in the composition.

[0100] Suitable diluents include sugars (e.g., glucose, lactose, dextrose, and sucrose); diols (e.g., propylene glycol), calcium carbonate, sodium carbonate, and sugar alcohols (e.g., glycerin, mannitol, and sorbitol). The amount of diluent(s) in a systemic or topical composition is usually about 50 to about 90% by weight of the composition.

[0101] Suitable lubricants include silica, talc, stearic acid and its magnesium and calcium salts, calcium sulfate, and liquid lubricants (e.g., polyethylene glycol, and vegetable oils (e.g., peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and theobroma oil)). The amount of lubricant(s) in a systemic or topical composition is usually about 5 to about 10% by weight of the composition.

[0102] Suitable binders include polyvinylpyrrolidone, aluminum magnesium silicate, starch (e.g., corn starch and potato starch), gelatin, tragacanth, and cellulose and its derivatives (e.g., sodium carboxymethylcellulose, ethylcellulose, methylcellulose, microcrystalline cellulose, and sodium carboxymethylcellulose). The amount of binder(s) in the whole composition is usually about 5 to about 50% by weight of the composition.

[0103] Suitable disintegrants include agar, alginic acid and its sodium salts, effervescent mixtures, croscarmellose, crospovidone, sodium carboxymethyl starch, sodium starch glycolate, clay, and ion exchange resins. The amount of disintegrant(s) in a systemic or topical composition is usually about 0.1 to about 10% by weight of the composition.

[0104] Suitable colorants include FD&C dyes. When used, the amount of colorant in a whole-body or topical composition is usually about 0.005 to about 0.1% by weight of the composition.

[0105] Suitable flavorings include menthol, peppermint, and fruit flavors. The amount of flavoring(s) used in a systemic or topical composition is typically about 0.1% to 1.0%.

[0106] Suitable sweeteners include aspartame and saccharin. The amount of sweetener(s) in a systemic or topical composition is usually about 0.001% to about 1% by weight of the composition.

[0107] Suitable antioxidants include butylated hydroxyanisole ("BHA"), butylated hydroxytoluene ("BHT"), and vitamin E. The amount of antioxidant(s) in a systemic or topical composition is typically about 0.1 to about 5% by weight of the composition.

[0108] Suitable preservatives include benzalkonium chloride, methylparaben, and sodium benzoate. The amount of preservative(s) in a systemic or topical composition is usually about 0.01 to about 5% by weight of the composition.

[0109] A suitable fluidity enhancer is silicon dioxide. The amount of fluidity enhancer(s) in a whole-body or topical composition is usually about 1 to about 5% by weight of the composition.

[0110] Suitable solvents include water, isotonic saline, ethyl oleate, glycerin, hydroxylated castor oil, alcohol (e.g., ethanol), and phosphate buffer solution. The amount of solvent(s) in a whole-body or topical composition is usually about 0 to about 100% by weight of the composition.

[0111] Suitable suspensions include AVICEL RC-591 (manufactured by FMC Corporation in Philadelphia, Pennsylvania) and sodium alginate. The amount of suspension(s) in a systemic or topical composition is typically about 1 to about 8% by weight of the composition.

[0112] Suitable surfactants include lecithin, polysorbate 80, sodium lauryl sulfate, and TWEENS (manufactured by Atlas Powder Company, Wilmington, Delaware). Suitable surfactants are disclosed below: CTFA Cosmetic Ingredient Handbook, 1992, pp. 587-592; Remington's Pharmaceutical Sciences, 15th Ed. 1975, pp. 335-337; and McCutcheon's Volume 1, Emulsifiers & Detergents, 1994, North American Edition, pp. 236-239. The amount of surfactant(s) in a systemic or topical composition is typically about 0.1% to about 5% by weight of the composition.

[0113] The amounts of components in a whole-body composition may vary depending on the type of whole-body composition being prepared, but generally, a whole-body composition contains 0.01% to 50% by weight of an active compound and 50% to 99.99% by weight of one or more carriers. Compositions for parenteral administration typically contain 0.1% to 10% by weight of an active ingredient and 90% to 99.9% by weight of a carrier (e.g., a diluent and a solvent).

[0114] Compositions for oral administration may have various dosage forms. For example, solids include tablets, capsules, granules, and bulk powders. These oral dosage forms contain a safe and effective amount of the active ingredient, usually at least about 5% by weight, more specifically about 25% to about 50% by weight. Oral drug compositions contain about 50% to about 95% by weight, more specifically about 50% to about 75% by weight of a carrier.

[0115] Tablets may be compressed tablets, powder tablets, enteric-coated tablets, sugar-coated tablets, film-coated tablets, or multi-compressed tablets. Tablets typically contain the active ingredient and a carrier (e.g., a component selected from diluents, lubricants, binders, disintegrants, colorants, flavorings, sweeteners, flow enhancers, and combinations thereof). Specific diluents include calcium carbonate, sodium carbonate, mannitol, lactose, and cellulose. Specific binders include starch, gelatin, and sucrose. Specific disintegrants include alginic acid and croscarmellose. Specific lubricants include magnesium stearate, stearic acid, and talc. Specific colorants are FD&C dyes that can be added for appearance. Chewable tablets preferably contain sweeteners (e.g., aspartame and saccharin) or flavorings (e.g., menthol, peppermint, fruit flavors), or combinations thereof.

[0116] Capsules (e.g., implants, sustained-release formulations, and sustained-release formulations) typically contain an active compound (e.g., a compound of formula (I)) and a carrier containing one or more of the diluents disclosed above, within a gelatin-containing capsule. Granules typically contain the disclosed compounds, preferably a flow enhancer (e.g., silicon dioxide) to improve flow properties. Implants may be of a biodegradable or non-biodegradable type.

[0117] The selection of components for carriers of oral compositions is determined by secondary considerations such as taste, cost, and storability, but these are not important to the purposes of this disclosure.

[0118] The solid composition can typically be coated in a conventional manner using a pH or time-dependent coating, and the disclosed compound is released in the gastrointestinal tract near the desired application, or at various points in time to extend the desired effect. The coating typically comprises one or more components selected from the group consisting of cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropyl methylcellulose phthalate, ethylcellulose, EUDRAGIT® coating (available from Evonik Industries (Essen, Germany)), wax, and shellac.

[0119] Oral administration compositions may take the form of a liquid. For example, preferred liquid forms include aqueous solutions, emulsions, suspensions, solutions reconstituted from non-foaming granules, suspensions reconstituted from non-foaming granules, effervescent preparations reconstituted from effervescent granules, elixirs, tinctures, and syrups. Liquid oral administration compositions typically contain the disclosed compounds and a carrier (i.e., a carrier selected from diluents, colorants, flavorings, sweeteners, preservatives, solvents, suspending agents, and surfactants). Oral liquid compositions preferably contain one or more components selected from colorants, flavorings, and sweeteners.

[0120] Other compositions useful for achieving systemic delivery of the target compound include sublingual, buccal, and nasal dosage forms. Such compositions typically contain one or more soluble fillers (e.g., diluents including sucrose, sorbitol, and mannitol) and binders (e.g., acacia, microcrystalline cellulose, carboxymethylcellulose, and hydroxypropyl methylcellulose). Such compositions may further contain lubricants, colorants, flavorings, sweeteners, antioxidants, and flow enhancers.

[0121] The disclosed compounds can be administered topically. Topical compositions that can be applied topically to the skin may take any form, including solids, solutions, oils, creams, ointments, gels, lotions, shampoos, rinse-off hair conditioners, milks, cleansers, moisturizers, sprays, skin patches, and the like. A topical composition comprises the disclosed compound (e.g., the compound of formula (I)) or a pharmaceutically acceptable salt thereof, and a carrier. The carrier of the topical composition preferably helps the compound to penetrate the skin. The carrier may further comprise one or more optional components.

[0122] The amount of carrier used in combination with the disclosed compound is sufficient to provide a practical amount of composition for administration per unit dose of the compound. Methods and compositions for producing dosage forms useful for the methods disclosed herein are described in the following references: Modern Pharmaceutics, Chapters 9 and 10, Banker & Rhodes, eds. (1979), Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1981), and Ansel, Introduction to Pharmaceutical Dosage Forms, 2nd Ed., (1976).

[0123] The carrier may consist of a single component or a combination of two or more components. In topical compositions, the carrier includes a topical carrier. Suitable topical carriers include one or more components selected from phosphate-buffered saline, isotonic water, deionized water, monofunctional alcohol, symmetrical alcohol, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, propylene glycol, PPG-2 myristylpropionate, dimethyl isosorbide, castor oil, and combinations thereof. More specifically, carriers for skin application include propylene glycol, dimethyl isosorbide, and water, and even more specifically, phosphate-buffered saline, isotonic water, deionized water, monofunctional alcohol, and symmetrical alcohol.

[0124] The carrier of the topical composition may further contain one or more components selected from emollients, propellants, solvents, humectants, thickeners, powders, fragrances, pigments, and preservatives, all of which are optional.

[0125] Suitable emollients include: stearyl alcohol, glyceryl monostearate, glyceryl monostearate, propane-1,2-diol, butane-1,3-diol, mink oil, cetyl alcohol, isopropyl isostearate, stearic acid, isobutyl palmitate, isocetyl stearate, oleyl alcohol, isopropyl laurate, hexyl laurate, decyl oleate, octadecane-2-ol, isocetyl alcohol, cetyl palmitate. Di-n-butyl sebacate, isopropyl myristart, isopropyl palmitate, isopropyl stearate, butyl stearate, polyethylene glycol, triethylene glycol, lanolin, sesame oil, coconut oil, peanut oil, castor oil, acetylated lanolin alcohol, petroleum, mineral oil, butyl myristart, isostearic acid, palmitic acid, isopropyl linolate, lauryl lactate, myristyl lactate, decyl oleate, myristyl myristart, and combinations thereof. Specific emollients for skin include stearyl alcohol and polydimethylsiloxane. The amount of emollient(s) in a skin-based topical composition is typically about 5% to about 95% by weight of the composition.

[0126] Suitable propellants include propane, butane, isobutane, dimethyl ether, carbon dioxide, nitrous oxide, and combinations thereof. The amount of propellant(s) in a topical composition is typically about 0% to 95% by weight of the composition.

[0127] Suitable solvents include water, ethyl alcohol, methylene chloride, isopropanol, castor oil, ethylene glycol monoethyl ether, diethylene glycol monobutyl ether, diethylene glycol monoethyl ether, dimethyl sulfoxide, dimethylformamide, tetrahydrofuran, and combinations thereof. Specific examples of solvents include ethyl alcohol and homotopic alcohol. The amount of solvent(s) in a topical composition is typically about 0% to 95% by weight of the composition.

[0128] Suitable humectants include glycerin, sorbitol, sodium 2-pyrrolidone-5-carboxylate, soluble collagen, dibutylphthalate, gelatin, and combinations thereof. A specific example of a humectant is glycerin. The amount of humectant(s) in a topical composition is usually 0% to 95% by weight of the composition.

[0129] The amount of thickener(s) in a topical composition is typically about 0% to 95% by weight of the composition.

[0130] Suitable powders include beta-cyclodextrin, hydroxypropyl cyclodextrin, chalk, talc, fuller's earth, kaolin, starch, gum, colloidal silicon dioxide, sodium polyacrylate, tetraalkylammonium smectite, trialkylarylammonium smectite, chemically modified magnesium aluminum silicate, organically modified montmorillonite clay, hydrated aluminum silicate, fumed silica, carboxyvinyl polymer, sodium carboxymethylcellulose, ethylene glycol monostearate, and combinations thereof. The amount of powder(s) in a topical composition is usually 0% to 95% by weight of the composition.

[0131] The amount of fragrance in a topical composition is usually about 0% to 0.5% by weight of the composition, and in particular, about 0.001% to 0.1% by weight.

[0132] Suitable pH-adjusting additives include HCl or NaOH in amounts sufficient to adjust the pH of the topical pharmaceutical composition.

[0133] How to use The disclosed compounds and pharmaceutical compositions may be used in methods for the treatment of disorders, including proliferative disorders such as cancer. In some embodiments, the cancer is characterized by or mediated by the activity of BCL6. In some embodiments, the cancer is a cancer expressing both BCL6 and p300 / CBP.

[0134] Accordingly, in some embodiments, methods for treating a disorder in a subject are disclosed herein, the disorder being a cancer characterized by or mediated by the activity of BCL6, or expressing BCL6 and p300 / CBP, and the method comprises administering to the subject a therapeutically effective amount of a compound disclosed herein (e.g., the compound of formula (I), or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound disclosed herein (e.g., the compound of formula (I), or a pharmaceutically acceptable salt thereof). In some embodiments, the disorder is a proliferative disorder, i.e., a disease resulting from abnormal proliferation or elongation by cell proliferation. In some embodiments, the disease is cancer. The term "cancer" refers to a type of disease characterized by the development of abnormal cells that have the ability to proliferate uncontrollably and invade and destroy normal body tissues. See, for example, Stedman's Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990.

[0135] In some embodiments, the compounds and pharmaceutical compositions disclosed herein are used to treat cancer in subjects requiring treatment for cancer. In some embodiments, the cancer is a cancer in which BCL6 is mutated. In some embodiments, the cancer is a cancer in which BCL6 is highly expressed or overexpressed compared to non-cancerous cells.

[0136] In some embodiments, cancer is a solid tumor, such as a sarcoma or carcinoma. In some embodiments, cancer is a blood cancer.

[0137] Examples of sarcomas include alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell sarcoma of soft tissue, dedifferentiated liposarcoma, desmoid, fibroplastic round cell tumor, fetal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, sensory neuroblastoma, Ewing's sarcoma, extrarenal rhabdoid tumor, extraskeletal myxoid chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, giant cell tumor, periangiocarcinoma, infantile fibrosarcoma, inflammatory myofibroblastic tumor, Kaposi's sarcoma, leiomyosarcoma of bone, liposarcoma, osteoliposarcoma, and malignant fibrous tissue Examples of tumors that fall under this category include, but are not limited to, follicular cytomas (MFH), malignant fibrous histiocytoma (MFH) of bone, malignant mesenchymal tumors, malignant peripheral nerve sheath tumors, mesenchymal chondrosarcomas, myxofibrosarcomas, myxoid liposarcomas, myxoinflammatory fibroblastic sarcomas, tumors exhibiting perivascular epithelioid differentiation, osteosarcomas, paraosteal osteosarcomas, tumors exhibiting perivascular epithelioid differentiation, periosteal osteosarcomas, pleomorphic liposarcomas, pleomorphic rhabdomyosarcomas, PNET / extraosseous Ewing tumors, rhabdomyosarcomas, round cell liposarcomas, small cell osteosarcomas, solitary fibrous tumors, synovial sarcomas, and telangiectatic osteosarcomas.

[0138] Similar cancers include, but are not limited to, adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, anal carcinoma, appendiceal carcinoma, bile duct carcinoma (i.e., cholangiocarcinoma), bladder carcinoma, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of unknown primary origin (CUP), esophageal carcinoma (e.g., esophageal squamous cell carcinoma), eye tumor, fallopian tube cancer, digestive system cancer, kidney cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, gastric cancer, testicular cancer, pharyngeal cancer, thyroid cancer, uterine cancer, vaginal cancer, and vulvar cancer.

[0139] Exemplary malignant hematological disorders include, but are not limited to, leukemia, lymphoma, myeloma, non-Hodgkin lymphoma, Hodgkin lymphoma, T-cell malignancies, and B-cell malignancies. Exemplary T-cell malignancies include anaplastic large cell lymphoma, angioimmunoblastic lymphoma, adult T-cell leukemia / lymphoma (ATLL), blastic NK-cell lymphoma, cutaneous T-cell lymphoma, intestinal disease-type T-cell lymphoma, hemosplenic gamma delta T-cell lymphoma, lymphoblastic lymphoma, nasal NK / T-cell lymphoma, peripheral T-cell lymphoma not otherwise specified (PTCL-NOS), and treatment-associated T-cell lymphoma. Exemplary B-cell malignancies include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, and non-CLL / SLL lymphoma. In some embodiments, the cancer is selected from B-cell hyperlymphocytic leukemia, Burkitt lymphoma, diffuse large B-cell lymphoma (DLBCL), perinodal B-cell lymphoma, follicular lymphoma (FL), immunoblastic large B-cell lymphoma, intravascular large B-cell lymphoma, lymphomatoid granulomatosis, lymphoplasmic lymphoma, mantle cell lymphoma (MCL), septal (thymic) large B-cell lymphoma, multiple myeloma, perinodal B-cell lymphoma, non-Burkitt high malignancy B-cell lymphoma, plasmacytosis myeloma, plasmacytoma, precursor B-lymphoblastic lymphoma, primary exudative lymphoma, primary mediastinal B-cell lymphoma (PMBL), splenic marginal zone lymphoma, or Waldenström macroglobulinemia. In some embodiments, the cancer is diffuse large B-cell lymphoma (DLBCL).

[0140] In some embodiments, cancer is a recurrent or refractory cancer, such as the cancers described herein. In some embodiments, cancer is a metastatic cancer, such as the cancers described herein.

[0141] In the therapeutic methods described herein, the compound or pharmaceutical composition may be administered to a subject systemically / peripherally or at the desired site of action by any convenient route of administration, including but not limited to oral (e.g., by ingestion), topical (e.g., including percutaneous, intranasal, intraocular, buccal, and sublingual), pulmonary (e.g., by mouth or nose, e.g., by inhalation or inhalation therapy using aerosols), rectal, vaginal, parenteral (e.g., by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subepidermal, intra-articular, subarachnoid, and intrasternal injection), or implantation of a subcutaneous or intramuscular depot. In some embodiments, administration includes oral administration. In some embodiments, administration includes parenteral administration. Additional modes of administration may include supplying the compound as part of the animal's diet by adding the compound and / or a composition containing the compound to a food or beverage containing water for the animal.

[0142] It will be understood that the appropriate dosage of a compound and a composition containing the compound may vary from patient to patient. Determining the optimal dosage generally involves balancing the level of therapeutic effect against any risks or adverse side effects of the treatment disclosed herein. The selected dosage level depends on a variety of factors, including but not limited to the activity of the particular agent, the route of administration, the time of administration, the rate of secretion of the compound, the duration of treatment, other drugs, compounds, and / or materials used concomitantly, the patient's age, sex, weight, condition, general health, and prior medical history. The amount and route of administration of the compound are ultimately at the discretion of the physician, but generally the dosage is designed to achieve a local concentration at the site of action that achieves the desired effect without substantially causing harm or adverse side effects.

[0143] In vivo administration can be achieved in a single dose throughout the course of treatment, continuously or intermittently (e.g., in divided doses at appropriate intervals). Methods for determining the most effective means of administration and dosage are well known to those skilled in the art and vary depending on the formulation used for treatment, the purpose of treatment, the target cells being treated, and the subject being treated. Single or multiple doses may be administered at dose levels and patterns selected by the treating physician. Generally, a suitable dose of the compound is in the range of about 100 μg to about 250 mg per kilogram of body weight of the subject per day.

[0144] The compound or composition may be administered once, on a continuous basis (e.g., intravenous infusion), or on a periodic / intermittent basis, including once every hour, once every two hours, once every four hours, once every eight hours, once every twelve hours, once every day, once every two days, once every three days, twice every week, once every week, and once every month. The composition may be administered until the desired relief of symptoms is achieved.

[0145] The compounds described herein may be used in combination with other known treatments. “Combined” means, as used herein, that two (or more) different treatments are delivered to a subject in the course of the subject's illness, for example, that two or more treatments are administered after the subject has been diagnosed, before the illness is cured or disappears, or before treatment is discontinued for any other reason. In some embodiments, the delivery of one treatment is still occurring at the commencement of the second delivery, so as to be an overlap in administration. This may be referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment is completed before the commencement of the delivery of the other treatment. In some embodiments of any of these cases, the treatments are more effective for combined administration. For example, the second treatment is more effective, and, for example, a similar effect is seen with less of the second treatment, or the second treatment reduces symptoms more, or a similar situation is seen with the first treatment, compared to the effect when the second treatment is given without the first treatment. In some embodiments, delivery is made such that the reduction in symptoms or other parameters associated with the disorder is greater than that observed with one treatment delivered in the absence of the other. The effects of the two treatments may be partially additive, fully additive, or more additive. Delivery may be made such that the effect of the first treatment delivered is still detectable when the second treatment is delivered.

[0146] The compounds or compositions described herein and at least one additional therapeutic agent may be administered simultaneously, in the same or separate compositions, or sequentially. For sequential administration, the compounds described herein may be administered first, followed by the additional agents, or the order of administration may be reversed.

[0147] In some embodiments, the compounds described herein are administered in combination with other treatments, including surgery, radiation, transplantation (e.g., stem cell transplantation or bone marrow transplantation), cryotherapy, and hyperthermia. Such combination therapies make it possible to reduce the dosage of the administered drug and / or other chemotherapeutic agents, and thus avoid the potential toxicity and complications associated with various therapies.

[0148] In some embodiments, the compounds described herein are administered together with at least one additional therapeutic agent, such as a chemotherapeutic agent. In certain embodiments, the compounds described herein are administered in combination with one or more additional chemotherapeutic agents. The chemotherapeutic agents may be those identified in the "A to Z List of Cancer Drugs" published by the National Cancer Institute.

[0149] A method for reducing the proliferation of cancer cells in a sample is also disclosed herein, comprising contacting the sample with a compound described herein (for example, a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition described herein.

[0150] kit The compounds and / or compositions disclosed herein may be assembled into kits or pharmaceutical systems. Accordingly, a kit or pharmaceutical system may include a carrier or package, such as a box, carton, or tube, which may contain one or more sealed containers, such as vials, tubes, ampoules, or bottles, containing a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof. The kit or pharmaceutical system may also include printed instructions for use of the compounds and / or compositions.

[0151] The following embodiments further illustrate aspects of the present disclosure, but should not be construed as limiting its scope in any way. [Examples]

[0152] The following abbreviations are used in the examples: DIPEA is N,N-diisopropylethylamine, DMF is N,N-dimethylformamide, DMSO is dimethyl sulfoxide, HATU is 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate, HPLC is high-performance liquid chromatography, TFA is trifluoroacetic acid, and UP-LC is ultra-high-performance liquid chromatography.

[0153] Example 1: Compound Synthesis [ka]

[0154] Procedure A (MNN-02-155): To a solution of 5-((tert-butoxycarbonyl)amino)pentanoic acid (4.35 mg, 0.0200 mmol, 1.50 equivalents) in anhydrous DMF (300 uL, 0.05 M) and DIPEA (6.97 uL, 0.0400 mmol, 3.00 equivalents), HATU (7.61 mg, mmol, 1.50 equivalents) was added under nitrogen at 0°C. The reaction mixture was stirred at 0°C for 15 minutes, after which 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(piperidine-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide (7.00 mg, 0.0133 mmol, 1.00 equivalent) dissolved in DMSO (1 mg / 10 μL) was added dropwise. The reaction mixture was stirred for 3 hours, and at that point the mass of the product was observed by UP-LC to an acceptable purity (MS m / z 724.62 [M+H]). +The reaction mixture was diluted with water, the product was extracted three times in ethyl acetate, dried over Na2SO4, and concentrated under vacuum. The crude product was then dissolved in 500 μL of dichloromethane and 100 μL of TFA, stirred at room temperature for 1 hour, the solution was then concentrated under vacuum, azeotropically mixed three times with dichloromethane, and left under vacuum for 12 hours. [ka]

[0155] Procedure B (MNN-02-155): To a solution of 1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxylic acid (7.66 mg, 0.0144 mmol, 1.50 equivalents) in DMF (200 μL, 0.05 M), DIPEA (11.7 μL, 0.0673 mmol, 7.00 equivalents) and HATU (5.49 mg, 0.0144 mmol, 1.50 equivalents) were added, and the mixture was stirred under nitrogen at 0°C for 15 minutes. The product of Procedure A was then dissolved in 200 μL of DMF. (6.00 mg, 0.00962 mmol, 1.00 equivalent) was added dropwise, and the mixture was stirred for 12 hours. The reaction mixture was directly purified by preparative HPLC (85%-20% water (0.05% TFA) / methanol). The product was 1-(1-(5-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,-dihydroquinoline-6-yl)amino (Pyrimidine-2-yl)piperidine-4-carboxamide)pentanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide was obtained as a white solid (4.28 mg, 40%, MS m / z 1136.52 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.03 (s, 1H), 8.10 (d, J = 6.0 Hz, 1H), 7.95 (q, J = 4.5 Hz, 1H), 7.79 (t, J = 5.6 Hz, 1H), 7.73 (s, 1H), 7.51 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.78 (s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.49 - 4.43 (m, 3H), 4.31 (td, J = 10.6, 5.4 Hz, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.7 Hz, 1H), 3.87 (d, J = 3.4 Hz, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 6.1 Hz, 2H), 3.56 (t, J = 5.6 Hz, 2H), 3.21 - 3.09 (m, 1H), 3.03 (q, J = 7.0 Hz, 2H), 2.95 - 2.87 (m, 2H), 2.82 (t, J = 6.3 Hz, 2H), 2.76 - 2.71 (m, 2H), 2.68 (d, J = 12.5 Hz, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 2.42 - 2.35 (m, 1H), 2.33 (t, J = 7.3 Hz, 2H), 1.96 (q, J = 5.9 Hz, 2H), 1.91 - 1.82 (m, 3H), 1.70 (d, J = 13.1 Hz, 3H), 1.58-1.43 (m, 4H), 1.40 (t, J = 7.4 Hz, 2H).

[0156] MNN-03-037:(1-(1-(4-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)butanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide). Compound MNN-03-037 was synthesized using the linker 4-((tert-butoxycarbonyl)amino)butanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (1.95 mg, 18%, MS m / z 1122.51 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.03 (s, 1H), 8.09 (s, 1H), 7.97 - 7.91 (m, 1H), 7.81 (t, J = 5.7 Hz, 1H), 7.74 (d, J = 2.6 Hz, 1H), 7.51 (d, J = 2.7 Hz, 2H), 7.49 (s, 1H), 7.08 (s, 1H), 7.00 (s, 1H), 6.78 (s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.46 (d, J = 12.9 Hz, 3H), 4.35 - 4.26 (m, 1H), 4.01 (s, 2H), 3.93 (d, J = 13.4 Hz, 1H), 3.86 (s, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.66-3.58 (m, 2H), 3.56 (t, J = 5.7 Hz, 2H), 3.14 (d, J = 12.3 Hz, 1H), 3.05 (q, J = 6.6 Hz, 2H), 2.96 - 2.87 (m, 2H), 2.81 (d, J = 6.5 Hz, 2H), 2.73 (d, J = 5.5 Hz, 2H), 2.69 (d, J = 12.7 Hz, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 2.42 - 2.36 (m, 1H), 2.33 (t, J = 7.5 Hz, 2H), 1.95 (p, J = 6.3 Hz, 2H), 1.87 (d, J = 17.1 Hz, 3H), 1.75 - 1.68 (m, 3H), 1.62 (p, J = 7.2 Hz, 2H), 1.50 (td, J = 12.2, 8.6 Hz, 2H).

[0157] MNN-02-195: 1-(1-(6-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)hexanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-195 was synthesized using the linker 6-((tert-butoxycarbonyl)amino)hexanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (3.52 mg, 20%, MS m / z 1150.53 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.12 (s, 1H), 8.12 (d, J = 5.5 Hz, 1H), 7.95 (q, J = 4.5 Hz, 1H), 7.77 (t, J = 5.6 Hz, 1H), 7.73 (s, 1H), 7.51 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.78 (s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.44 (d, J = 13.2 Hz, 3H), 4.36 - 4.26 (m, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.2 Hz, 1H), 3.86 (s, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 5.8 Hz, 2H), 3.56 (t, J = 5.6 Hz, 2H), 3.15 (t, J = 12.0 Hz, 1H), 3.01 (q, J = 6.8 Hz, 2H), 2.93 (t, J = 12.5 Hz, 2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 5.9 Hz, 2H), 2.71 - 2.66 (m, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54 (s, 3H), 2.41 - 2.34 (m, 1H), 2.31 (t, J = 7.5 Hz, 2H), 1.95 (t, J = 5.8 Hz, 2H), 1.91 - 1.83 (m, 3H), 1.71 (dd, J = 13.2, 3.7 Hz, 3H), 1.49 (dt, J = 14.5, 5.6 Hz, 4H), 1.39 (p, J = 7.1 Hz, 2H), 1.25 (qd, J = 8.5, 5.8 Hz, 2H).

[0158] RCS-SBM-IJD-001:1-(1-(7-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)heptanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound RCS-SBM-IJD-001 was synthesized using the linker 8-((tert-butoxycarbonyl)amino)octanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (3.92 mg, 18%, MS m / z 1165.48 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.16 (s, 1H), 8.12 (s, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.76 (t, J = 5.6 Hz, 1H), 7.73 (s, 1H), 7.50 (s, 2H), 7.48 (d, J = 0.8 Hz, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.79 (s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.53 (s, 1H), 4.55 (s, 2H, assigned by HSQC), 4.46 - 4.40 (3H, assigned by HSQC), 4.35 - 4.27 (m, 1H, assigned by HSQC), 4.01 (s, 2H), 3.95 (d, J = 13.6 Hz, 1H), 3.86 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 5.8 Hz, 2H), 3.56 (t, J = 5.7 Hz, 2H), 3.15 (t, J = 12.5 Hz, 1H), 3.00 (q, J = 6.6 Hz, 2H), 2.97 - 2.89 (m, 2H), 2.82 (t, J = 6.3 Hz, 2H), 2.73 (t, J = 6.0 Hz, 2H), 2.68 (d, J = 12.1 Hz, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54 (s, 3H), 2.42 - 2.34 (m, 1H), 2.31 (t, J = 7.5 Hz, 2H), 1.96 (p, J = 6.3 Hz, 2H), 1.88 (dd, J = 18.7, 8.7 Hz, 3H), 1.74 - 1.68 (m, 3H), 1.56 - 1.42 (m, 4H), 1.36 (q, J = 7.0 Hz, 2H), 1.25 (d, J = 5.4 Hz, 4H).

[0159] MNN-02-196:1-(1-(8-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)octanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-196 was synthesized using the linker 8-((tert-butoxycarbonyl)amino)octanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (1.43 mg, 8%, MS m / z 1180.09 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.86 (d, J = 8.5 Hz, 1H), 8.06 (d, J = 8.2 Hz, 1H), 8.02 - 7.97 (m, 1H), 7.74 (q, J = 7.3 Hz, 2H), 7.52 (d, J = 8.9 Hz, 2H), 7.47 (d, J = 8.9 Hz, 1H), 7.08 (d, J = 8.8 Hz, 1H), 7.00 (d, J = 8.6 Hz, 1H), 6.79 (s, 1H), 6.76 (t, 1H), 6.53 (s, 1H), 4.54 (s, 2H), 4.50 (d, J = 21.7 Hz, 3H), 4.35 - 4.26 (m, 1H), 4.00 (d, J = 8.7 Hz, 2H), 3.94 (d, J = 13.2 Hz, 1H), 3.87 (d, J = 2.2 Hz, 3H), 3.86 - 3.82 (m, 6H), 3.68-3.34 (4H, assigned by HSQC), 3.14 (q, J = 10.1 Hz, 1H), 3.00 (q, J = 6.7 Hz, 2H), 2.88 (t, J = 12.1 Hz, 2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 6.1 Hz, 2H), 2.68 (d, J = 12.1 Hz, 1H), 2.64 (dd, J = 9.2, 4.6 Hz, 3H), 2.54 (s, 3H), 2.36 (q, J = 5.2 Hz, 1H), 2.30 (t, J = 7.5 Hz, 2H), 1.95 (q, J = 6.2 Hz, 2H), 1.86 (d, J = 10.5 Hz, 3H), 1.69 (d, J = 12.3 Hz, 3H), 1.47 (t, J = 11.0 Hz, 4H), 1.35 (d, J = 8.0 Hz, 2H), 1.29 - 1.14 (m, 6H).

[0160] MNN-02-187:1-(1-(9-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)octanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-187 was synthesized using the linker 9-((tert-butoxycarbonyl)amino)nonanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (1.41 mg, 8%, MS m / z 1193.80 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.10 (d, J = 3.5 Hz, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.79 - 7.72 (m, 2H), 7.51 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.01 (d, J = 2.6 Hz, 1H), 6.79 (s, 1H), 6.76 (t, J = 55.2 Hz, 1H), 6.54 (s, 1H), 4.54 (s, 2H), 4.46 (d, J = 13.1 Hz, 3H), 4.31 (s, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.7 Hz, 1H), 3.88 - 3.83 (m, 9H), 3.58 (dt, J = 22.9, 5.6 Hz, 4H), 3.19 - 3.11 (m, 1H), 3.09 - 2.97 (m, 2H), 2.97 - 2.87 (m, 2H), 2.82 (t, J = 6.4 Hz, 2H), 2.79 - 2.71 (m, 2H), 2.69 (s, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.53 (s, 3H), 2.38 (d, J = 11.7 Hz, 2H), 2.30 (t, J = 7.4 Hz, 2H), 1.95 (p, J = 6.0 Hz, 3H), 1.89 (s, 3H), 1.70 (d, J = 13.2 Hz, 3H), 1.56 - 1.42 (m, 4H), 1.38 - 1.28 (m, 2H), 1.28 - 1.20 (m, 6H).

[0161] MNN-02-197:1-(1-(10-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)decanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-197 was synthesized using the linker 10-((tert-butoxycarbonyl)amino)decanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (1.41 mg, 8%, MS m / z 1207.76 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.10 (s, 1H), 8.11 (s, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.75 (t, J = 5.6 Hz, 1H), 7.74 (s, 1H), 7.51 (s, 2H), 7.48 (d, J = 0.9 Hz, 1H), 7.08 (s, 1H), 7.01 (d, J = 1.8 Hz, 1H), 6.79 (s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.45 (d, J = 12.9 Hz, 3H), 4.30 (m, J = 10.4, 5.3 Hz, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.6 Hz, 1H), 3.87 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.65 - 3.53 (m, 4H), 3.18 - 3.09 (m, 1H), 2.99 (q, J = 6.6 Hz, 2H), 2.97 - 2.89 (m, 2H), 2.82 (t, J = 6.4 Hz, 2H), 2.73 (t, J = 5.9 Hz, 2H), 2.68 (d, J = 12.0 Hz, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (d, J = 1.2 Hz, 3H), 2.43 - 2.35 (m, 2H), 2.33 - 2.27 (m, 2H), 1.96 (p, J = 6.3 Hz, 3H), 1.91 - 1.80 (m, 3H), 1.71 (d, J = 13.3 Hz, 3H), 1.56 - 1.43 (m, 4H), 1.35 (t, J = 6.8 Hz, 2H), 1.29 - 1.20 (m, 8H).

[0162] MNN-02-160: 1-(1-(11-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)undecanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-160 was synthesized using the linker 11-((tert-butoxycarbonyl)amino)undecanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (0.89 mg, 7%, MS m / z 1221.82 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.07 (s, 1H), 8.10 (s, 1H), 7.96 (q, J = 4.8 Hz, 1H), 7.77 (t, J = 5.6 Hz, 1H), 7.74 (d, J = 0.9 Hz, 1H), 7.52 (s, 2H), 7.48 (d, J = 0.8 Hz, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.79 (s, 1H), 6.76 (t, J = 55.3 Hz, 1H), 6.55 (s, 1H), 4.55 (s, 2H), 4.47 (m, J = 13.0 Hz, 3H), 4.31 (tt, J = 10.6, 4.5 Hz, 1H), 4.01 (s, 2H), 3.98 - 3.91 (m, 1H), 3.87 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.58 (m, J = 17.8, 5.3 Hz, 4H), 3.15 (t, J = 12.4 Hz, 1H), 2.99 (q, J = 6.6 Hz, 2H), 2.97 - 2.88 (m, 2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 6.0 Hz, 2H), 2.68 (d, J = 11.7 Hz, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54 (d, J = 1.7 Hz, 3H), 2.42 - 2.34 (m, 1H), 2.33 - 2.27 (m, 2H), 1.96 (dt, J = 10.0, 6.3 Hz, 2H), 1.91 - 1.83 (m, 3H), 1.71 (d, J = 13.2 Hz, 3H), 1.49 (dq, J = 22.0, 8.1 Hz, 4H), 1.38 - 1.32 (m, 2H), 1.27 - 1.15 (m, 12H).

[0163] MNN-02-161: 1-(1-(3-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)ethoxy)propanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-161 was synthesized using the linker 3-(2-tert-butoxycarbonyl)amino)ethoxy)propanoic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (2.52 mg, 20%, MS m / z 1152.48 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.83 (s, 1H), 8.05 (s, 1H), 7.96 (q, J = 4.6 Hz, 1H), 7.84 (t, J = 5.6 Hz, 1H), 7.73 (s, 1H), 7.53 (q, J = 2.3 Hz, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 6.99 (s, 1H), 6.76 (t, 2H), 6.54 (d, J = 4.7 Hz, 1H), 4.54 (s, 2H), 4.47 (t, J = 18.1 Hz, 3H), 4.31 (d, J = 10.2 Hz, 1H), 3.98 (d, J = 18.1 Hz, 2H), 3.96 (s, 1H), 3.91 - 3.81 (m, 9H), 3.64 - 3.52 (m, 4H), 3.38 (t, J = 5.9 Hz, 2H), 3.17 (dt, J = 5.9, 2.8 Hz, 1H), 2.87 (s, 1H), 2.81 (d, 2H), 2.73 (t, J = 5.8 Hz, 2H), 2.72 - 2.68 (m, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.59 (dt, J = 12.3, 6.6 Hz, 1H), 2.54 (s, 3H), 2.44 - 2.36 (m, 2H), 1.95 (p, J = 6.3 Hz, 2H), 1.87 (d, J = 22.9 Hz, 3H), 1.69 (d, J = 9.7 Hz, 4H), 1.53 - 1.43 (m, 2H), 1.29 - 1.21 (m, 2H).

[0164] MNN-02-162: 1-(1-(3-(2-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)ethoxy)ethoxy)propanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-162 was synthesized using the linker 2,2-dimethyl-4-oxo-3,8,11-trioxa-5-azatetradecane-14-acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (2.91 mg, 20%, MS m / z 1196.40 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.85 (s, 1H), 8.06 (s, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.84 (t, J = 5.8 Hz, 1H), 7.73 (s, 1H), 7.53 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.00 (s, 1H), 6.77 (t, 1H), 6.53 (d, J = 5.1 Hz, 1H), 4.54 (s, 2H), 4.47 (dd, J = 26.3, 12.9 Hz, 3H), 4.35 - 4.27 (m, 1H), 4.00 (d, J = 5.1 Hz, 2H), 3.96 (d, J = 5.9 Hz, 1H), 3.90 - 3.82 (m, 9H), 3.60-3.56 (4H, assigned by HSQC),3.48 (s, 2H), 3.37 (t, J = 5.9 Hz, 2H), 3.16 (q, J = 6.0 Hz, 3H), 2.88 (td, J = 13.0, 2.7 Hz, 2H), 2.82 (t, J = 6.4 Hz, 2H), 2.73 (q, J = 5.7 Hz, 2H), 2.69 (s, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.59 (q, J = 6.5 Hz, 2H), 2.54 (s, 3H), 2.40 (dh, J = 11.4, 3.7 Hz, 2H), 1.99 - 1.92 (m, 2H), 1.87 (d, J = 18.6 Hz, 3H), 1.77 - 1.66 (m, 3H), 1.48 (qd, J = 12.5, 4.1 Hz, 2H), 1.29 - 1.21 (m, 2H), 1.13 - 1.08 (m, 1H).

[0165] MNN-02-156: 1-(1-(1-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-yl)-1-oxo-5,8,11-trioxa-2-azatetradecane-14-yl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-156 was synthesized using the linker 2,2-dimethyl-4-oxo-3,8,11,14-tetraoxa-5-azaheptadecane-17-acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound. (2.00 mg, 20%, MS m / z 1241.04 [M+H]) + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.83 (s, 1H), 8.06 (d, J = 1.4 Hz, 1H), 7.96 (d, J = 4.9 Hz, 1H), 7.85 (q, J = 6.2 Hz, 1H), 7.74 (d, J = 1.7 Hz, 1H), 7.53 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.00 (s, 1H), 6.91 - 6.63 (m, 2H), 6.53 (d, J = 4.7 Hz, 1H), 4.54 (s, 2H), 4.47 (dd, J = 27.5, 12.8 Hz, 3H), 4.31 (s, 1H), 4.00 (s, 2H), 3.97 (s, 1H), 3.89 - 3.83 (m, 9H), 3.61 (dt, J = 6.6, 3.4 Hz, 4H), 3.50 - 3.36 (m, 2H), 3.17 (p, J = 5.8 Hz, 3H), 2.88 (td, J = 12.8, 2.7 Hz, 1H), 2.82 (t, J = 6.1 Hz, 2H), 2.76 - 2.72 (m, 2H), 2.70 (d, J = 12.8 Hz, 1H), 2.65 (d, J = 4.7 Hz, 3H), 2.62 - 2.56 (m, 1H), 2.53 (d, J = 3.3 Hz, 3H), 2.45 - 2.33 (m, 1H), 2.30 (dd, J = 7.8, 5.2 Hz, 1H), 1.99 - 1.92 (m, 2H), 1.91 - 1.84 (m, 3H), 1.75 - 1.66 (m, 3H), 1.54 - 1.43 (m, 2H).

[0166] MNN-03-039: 1-(1-(1'-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carbonyl)-[1,4'-bipiperidine]-4-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-039 was synthesized using the linker 1'-(tert-butoxycarbonyl)-[1,4'-bipiperidine]-4-carboxylic acid according to procedure A, followed by synthesis according to procedure B to obtain the title compound (0.88 mg, 10%, MS m / z 1232.68 [M+H]). + ).

[0167] MNN-03-049: 1-(1-(3-(1-(5-Chloro-4-((8-Methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carbonyl)-3-azaspiro[5.5]undecane-9-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-049 was synthesized using the linker 3-(tert-butoxycarbonyl)-3-azaspiro[5.5]undecane-9-carboxylic acid according to procedure A, followed by the synthesis according to procedure B to obtain the title compound. (2.65 mg, 30%, MS m / z 1216.57 [M+H]) + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.11 (s, 1H), 8.11 (s, 1H), 7.94 (q, J = 4.6 Hz, 1H), 7.74 (s, 1H), 7.52 (d, J = 2.3 Hz, 1H), 7.51 - 7.45 (m, 2H), 7.09 (s, 1H), 7.01 (s, 1H), 6.81 (s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.45 (d, J = 12.7 Hz, 3H), 4.40 - 4.28 (m, 1H), 4.02 (s, 3H), 3.89 - 3.84 (m, 9H), 3.71 - 3.58 (m, 4H), 3.56 (t, J = 5.6 Hz, 2H), 3.47 (s, 2H), 3.41 (s, 2H), 3.18 (t, J = 12.7 Hz, 1H), 3.00 (s, 2H), 2.93 (d, J = 10.5 Hz, 1H), 2.83 (t, J = 6.4 Hz, 2H), 2.74 (t, J = 5.7 Hz, 2H), 2.69 (s, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.60 (s, 1H), 2.54 (s, 3H), 1.96 (h, J = 6.8 Hz, 2H), 1.85 (d, J = 16.9 Hz, 2H), 1.73 - 1.63 (m, 4H), 1.50 (d, J = 16.4 Hz, 6H), 1.38 (s, 1H), 1.30 (s, 1H), 1.16 (dd, J = 24.9, 9.9 Hz, 3H).

[0168] MNN-03-050: 1-(1-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinolin-6-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)-2-azaspiro[3.3]heptane-6-carbonyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-050 was synthesized according to Step 1 using linker 2'-(tert-butoxycarbonyl)-2-azaspiro[3.3]heptane-6-carboxylic acid and subsequently synthesized by Step 2 to obtain the title compound (4.72 mg, 40%, MS m / z 1160.73 [M+H] + ). 1 H NMR (500 MHz, DMSO-d 6) δ = 9.17 (s, 1H), 8.12 (s, 1H), 7.94 (q, J = 4.7 Hz, 1H), 7.74 (s, 1H), 7.52 (dd, J = 7.1, 2.3 Hz, 1H), 7.48 (d, J = 2.6 Hz, 2H), 7.09 (s, 1H), 7.00 (s, 1H), 6.81 (d, J = 2.2 Hz, 1H), 6.77 (t, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.42 (d, J = 12.8 Hz, 3H), 4.32 (dq, J = 11.2, 5.3 Hz, 1H), 4.24 (s, 1H), 4.22 (s, 1H), 4.08 (s, 1H), 4.06 (s, 2H), 4.02 (s, 2H), 3.86 (dd, J = 4.5, 1.7 Hz, 9H), 3.80 (d, J = 13.9 Hz, 1H), 3.70 (s, 1H), 3.58 (dt, J = 18.3, 6.3 Hz, 4H), 3.26 (td, J = 8.4, 2.7 Hz, 1H), 3.11 (s, 1H), 2.97 (s, 2H), 2.83 (t, J = 6.4 Hz, 2H), 2.73 (h, J = 6.2 Hz, 3H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 2.34 (td, J = 8.1, 4.0 Hz, 2H), 2.25 (d, J = 8.2 Hz, 1H), 1.97 (p, J = 6.1 Hz, 2H), 1.87 (d, J = 13.2 Hz, 2H), 1.81 (s, 1H), 1.69 (d, J = 31.1 Hz, 3H), 1.44 (t, J = 12.0 Hz, 2H).

[0169] MNN-03-038: 1-(1-(3-(4-(1-(5-Chloro-4-((8-Methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carbonyl)piperazine-1-yl)propanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-038 was synthesized according to Procedure 1 using the linker 3-(4-tert-butoxycarbonyl)piperazin-1-yl)propanoic acid, followed by the synthesis in Procedure 2 to obtain the title compound (3.33 mg, yield 30%, MS m / z 1177.74 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 9.57 (s, 1H), 8.94 (s, 1H), 8.09 (s, 1H), 7.98 (d, J = 4.7 Hz, 1H), 7.74 (s, 1H), 7.58 (d, J = 2.2 Hz, 1H), 7.50 (d, J = 2.3 Hz, 1H), 7.49 (d, J = 0.8 Hz, 1H), 7.09 (s, 1H), 6.99 (s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.76 (s, 1H), 6.55 (s, 1H), 4.55 (s, 2H), 4.48 (m, J = 15.8 Hz, 4H), 4.41 - 4.32 (m, 1H), 4.23 (s, 1H), 4.02 (s, 2H), 3.95 (d, J = 13.1 Hz, 1H), 3.87 (s, 3H), 3.86 (s, 6H), 3.80-3.50 (7H, as assigned by HSQC), 3.36 (s, 2H), 3.26 - 3.17 (m, 1H), 3.10 (s, 1H), 3.04 - 2.94 (m, 5H), 2.91 (q, J = 6.8 Hz, 2H), 2.83 (q, J = 8.5 Hz, 3H), 2.76 (q, J = 8.1 Hz, 2H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 1.94 (m, J = 13.2, 4.8 Hz, 5H), 1.84 - 1.63 (m, 3H), 1.50 (s, 2H).

[0170] MNN-03-041: (1-(1-(4-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidine-2-yl)piperidine-4-carboxamide)cyclohexane-1-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide). Compound MNN-03-041 was synthesized according to Procedure 1 using the linker 4-((tert-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid, followed by the synthesis in Procedure 2 to obtain the title compound (4.73 mg, 40%, MS m / z 1162.38 [M+H]). + ). 1 1H NMR (500 MHz, DMSO-d 6) δ = 8.96 (s, 1H), 8.09 (s, 1H), 7.94 (q, J = 4.8 Hz, 1H), 7.77 - 7.71 (m, 1H), 7.55 - 7.49 (m, 2H), 7.48 (t, J = 1.4 Hz, 1H), 7.08 (s, 1H), 7.04 - 6.98 (m, 1H), 6.81 (s, 1H), 6.76 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (d, J = 2.3 Hz, 2H), 4.50 (d, J = 13.2 Hz, 3H), 4.32 (dq, J = 10.8, 5.4 Hz, 1H), 4.02 (s, 3H), 3.90 - 3.80 (m, 9H), 3.77 (s, 1H), 3.60 (t, J = 5.7 Hz, 2H), 3.56 (t, J = 5.6 Hz, 2H), 3.43 (s, 1H), 3.18 (t, J = 12.7 Hz, 1H), 3.07 (t, J = 11.4 Hz, 1H), 2.98 (t, J = 12.4 Hz, 1H), 2.92 - 2.85 (m, 2H), 2.85 - 2.79 (m, 2H), 2.74 (t, J = 6.0 Hz, 2H), 2.69 (d, J = 3.3 Hz, 1H), 2.67 - 2.59 (m, 3H), 2.54 (s, 3H), 1.96 (q, J = 5.9 Hz, 2H), 1.88 (s, 3H), 1.68 (d, J = 12.7 Hz, 6H), 1.48 (d, J = 29.4 Hz, 4H).

[0171] MNN-03-040: 1-(1-(1-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinolin-6-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)azetidine-3-carbonyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinolin-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-040 was synthesized according to Step 1 using linker 1-(tert-butoxycarbonyl)azetidine-3-carboxylic acid and subsequently synthesized by Step 2 to obtain the title compound (0.82 mg, 6%, MS m / z 1120.61 [M+H] + ). 1 H NMR (500 MHz, DMSO-d 6) δ = 8.89 (s, 1H), 8.07 (d, J = 2.2 Hz, 1H), 7.97 - 7.92 (m, 1H), 7.74 (d, J = 8.5 Hz, 1H), 7.54 (t, J = 2.8 Hz, 1H), 7.51 (d, J = 2.2 Hz, 1H), 7.48 (d, J = 4.7 Hz, 1H), 7.08 (s, 1H), 6.98 (d, J = 5.2 Hz, 1H), 6.79 (d, J = 3.1 Hz, 1H), 6.78 (td, J = 55.2, 3.1 Hz, 1H), 6.54 (s, 1H), 4.55 (d, J = 3.4 Hz, 2H), 4.48 (d, J = 13.8 Hz, 3H), 4.31 (dt, J = 14.3, 6.9 Hz, 1H), 4.01 (d, J = 5.2 Hz, 2H), 3.99 (s, 1H), 3.94 - 3.88 (m, 1H), 3.88 - 3.81 (m, 9H), 3.74 (ddd, J = 15.0, 8.5, 6.0 Hz, 1H), 3.67 (d, J = 13.5 Hz, 1H), 3.60 (s, 2H), 3.56 (t, J = 5.7 Hz, 2H), 3.21 - 3.12 (m, 2H), 3.09 (td, J = 7.3, 4.8 Hz, 2H), 2.94 (t, J = 13.0 Hz, 2H), 2.83 (t, J = 6.5 Hz, 2H), 2.79 (s, 1H), 2.74 (t, J = 5.9 Hz, 2H), 2.64 (dd, J = 4.7, 2.2 Hz, 3H), 2.58 - 2.52 (m, 3H), 1.96 (t, J = 5.8 Hz, 2H), 1.90 (s, 3H), 1.76 (d, J = 7.3 Hz, 1H), 1.66 (t, J = 14.3 Hz, 2H), 1.43 (d, J = 13.7 Hz, 2H).

[0172] MNN-04-022:(S)-1-(1-(3-(4-(1-(5-Chloro-4-((2-cyclopropyl-3,3-difluoro-7-methyl)-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazepino[2,3-c]quinoline-10-yl)amino)pyrimidine-2-yl)piperidine-4-carbonyl)piperazine-1-yl)propanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-04-022 was synthesized according to Procedure 1 using the linker 3-(4-(tert-butoxycarbonyl)piperazine-1-yl)propanoic acid to obtain 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(1-(3-(piperazine-1-yl)propanoyl)piperidine-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide as a white solid (9.90 mg, 97%). [ka]

[0173] To a solution of (S)-1-(5-chloro-4-((2-cyclopropyl-3,3-difluoro-7-methyl-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazepino[2,3-c]quinoline-10-yl)amino)pyrimidine-2-yl)piperidine-4-carboxylic acid (11.1 mg, 0.0199 mmol, 1.20 equivalents) in DMF (330 μL, 0.05 M), DIPEA (20.2 μL, 0.0116 mmol, 7.00 equivalents) and HATU (8.18 mg, 0.0215 mmol, 1.30 equivalents) were added, and the mixture was stirred under nitrogen at 0°C for 15 minutes. After stirring for 15 minutes, the crude mixture of 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(1-(3-(piperazine-1-yl)propanoyl)piperidine-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide dissolved in DMF is added dropwise, and the reaction mixture is stirred for 1 hour. -methyl-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazepino[2,3-c]quinoline-10-yl)amino)pyrimidine-2-yl)piperidine-4-carbonyl)piperazine-1-yl)propanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazole-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide was obtained (1.88 mg, 9%, MS m / z 1207.86 [M+H]). + ).

[0174] Example 2: Activation of a reporter gene The above compounds were tested for their ability to activate the BCL6 reporter gene (GFP) incorporated into the KARPAS lymphoma cell line. This reporter construct contains eight highly reliable BCL6 binding sites and flanking base pairs identified by chromatin immunoprecipitation sequencing (ChIP-seq) and includes functional genomic data in an effective cell death gene upstream of minimal promoter-driven green fluorescent protein (GFP), as described in Gourisankar et al. Nature 620, 417-425 (2023). This is incorporated into the genome of otherwise genetically unmodified KARPAS422 DLBCL cells, where GFP is normally not transcribed due to its repressive function of endogenous BCL6. As shown in Figures 4 and 8C, some of the compounds activated the reporter even at the lowest concentrations.

[0175] Example 3: Cell viability assay HAT-BCL6 TCIPs were tested for their ability to kill lymphoma cells after 72 hours of treatment. 30,000 cells were seeded in 100 μL of medium per well in a 96-well plate and treated with the drug at the indicated number of times and doses. A resazurin-based cell indicator was added for 1.5 hours, after which the fluorescence ratio at 560 / 590 nm was recorded. Background fluorescence was subtracted and the signal was normalized to DMSO-treated cells. DMSO content was normalized to 0.1%. EC50 values ​​were calculated using a standard four-parameter log-logistic function. The data are shown in Figures 5A and 8A (SUDHL5 cells) and 5B (KARPAS422 cells), along with the EC50 values ​​in Figures 8A and 8B and Table 1. dCBP-1 is a p300 / CBP degrader (CAS number 2484739-25-3), A485 is a catalytic site p300 / CBP inhibitor (CAS number 1889279-16-6), and GNE-781 is a p300 / CBP bromodomain inhibitor (CAS number 1936422-33-1). Negative 1 is a negative control of MNN-02-155, in which the BCL6 binding is inactivated. This compound has the following structure: [ka]

[0176]

Table 1

[0177] Example 4: Formation of ternary complex To determine whether HAT-BCL6 TCIP functions by inducing the formation of a ternary complex between p300 / CBP and BCL6, for each compound, the ability to rescue (restore) the reduction in cell viability that occurs when MNN-03-038 (TCIP3), one of the most potent HAT-BCL6 TCIPs, is treated at a fixed amount of 1 nM against a p300 / CBP inhibitor containing an excess amount of SGC-CBP-30, GNE-781, or A-485 added at the start of the experiment, and a BCL6 inhibitor containing an excess amount of BI-3812, GSK137 (CAS 2728727-91-9), or CCT373567 (CAS 2378853-67-7) was assayed. The data are shown in Figure 6A (KARPAS422 cells) and Figures 6B and 8E (SUDHL5 cells). The formation of the ternary complex is reflected in the rescue of viability because the excess monomeric drug competes with the biologically active ternary complex.

[0178] Example 5: Half-life and intrinsic clearance Table 3 shows the in vitro half-life and intrinsic clearance of p300 / CBP TCIP in mouse liver microsome stability analysis, compared with the reference kinase inhibitor sunitinib.

[0179]

Table 2

[0180] Example 6: Cancer gene suppression test method Cell culture. Lymphoma and leukemia cells were cultured in 10% FBS containing RPMI-1640 (ATCC30-2001) + antibiotic (100×PenStrepGIBCO#15140122) and incubated at 37°C and 5% CO2. Cells were regularly tested for mycoplasma, and any suspected cases were tested immediately. No cultures were found to be positive.

[0181] Western blot. Cells were seeded at 1 million / ml (mL) and treated with drugs at the indicated time points and doses. Cells were harvested on ice in RIPA buffer (50 mM Tris-HCl (pH 8), 150 mM NaCl, 1% NP-40, 0.1% DOC, 1% SDS, protease inhibitor cocktail (approximately 20 mg / ml pepstatin, aprotinin, and leupeptin), 1 mM DTT), 1:200 benzonase (Sigma #E1014) was added, and the cells were incubated for 20 minutes. After centrifugation at 14,000 g, 4°C for 10 minutes, the supernatant was collected and protein concentration was measured using Bradford. The antibodies used for immunoblotting were BCL6 (Cell Signaling D65C10), p300 (Santa Cruz F-4), CBP (Cell Signaling D6C5), c-MYC (Cell Signaling D84C12), and GAPDH (Santa Cruz 6C5). All antibodies except GAPDH (1:2000) were used at a dilution of 1:1000 v / v. ImageStudio (Licor) was used for blot imaging and quantification.

[0182] RNA extraction, qPCR, and sequencing library preparation. Cells were seeded at 1 million / ml and collected on TRIsure (Bioline #38033). RNA was extracted using a Direct-zol RNA MicroPrep column (Zymo #R2062) treated with DNAseI. cDNA was prepared for RT-qPCR using the SensiFAST cDNA preparation kit (Bioline #65054). 1 μL of cDNA was used for each RT-qPCR reaction prepared with SYBR Lo-ROX (Bioline #94020). For sequencing library preparation, poly(A)-containing transcripts were enriched on (NEB #E7490S) to prepare paired-end libraries (NEB #E7760S), and sequenced using Illumina NovaSeq with paired-end read lengths of 150 bp using Novogene.

[0183] RNA-seq analysis. Raw read quality was checked using fastqc (www.bioinformatics.babraham.ac.uk / projects / fastqc / ), and reads were trimmed from the adapter using cutadapt (Martin, EMBnet.journal 17,10(2011)) with the parameters cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (SEQ ID NO: 1) -b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 2) --nextseq-trim=20 --minimum length 1. Transcripts were quantified against human Gencodev33 indexed transcriptome and annotation using kallisto (Bray et al. Nature Biotechnology 34,525-527(2016)). Differential gene analysis was performed using DESeq2 (Lab et al. Genome Biol 15, 550 (2014)) and apeglm (Zhu et al. Bioinformatics 35, 2084-2092 (2019)) to reduce the log2 factor change.

[0184] result The results are shown in Figures 7A–7G. The data in Figures 7A–7F show the reduction of c-MYC compared to controls such as BCL6 inhibition via BI-3812 (a nanomolar inhibitor of BCL6) (or related compounds) or p300 / CBP bromodomain inhibition via GNE-781 (a nanomolar inhibitor of p300 / CBP) (or related compounds). The data in Figure 7E shows that, in an unbiased analysis of all transcripts altered by TCIP3, c-MYC was the most significantly repressed gene after 1 hour of 1nM treatment. The data in Figure 7G shows that this reduction is dependent on the cell line's BCL6 level. The data in Figure 7A shows that the repression of MYC occurs not through degradation or loss of target (p300, CBP, BCL6) proteins, but through a novel signaling event. The data in Figure 7D shows that repressed c-MYC is the first to reach a transcriptional level of the c-MYC gene in time. This level is expected with TCIP, which acts through transcriptional regulation.

[0185] Example 7: Ternary complex-dependent, BCL6-regulated intracellular gene expression and cytotoxicity assay method Cell viability was measured. 30,000 cells were seeded in 100 μL of medium into a 96-well plate and treated with the indicated dose of drug for 72 hours. Resazurin-based cell health indicator (PrestoBlue, ThermoFisher #P50200) was added, and the plate was incubated at 37°C for 1.5 hours. The fluorescence ratio at 560 / 590 nm was then recorded. Background fluorescence was subtracted, and the signal was normalized for DMSO-treated cells. Dose-response curve fitting and statistical analysis were performed using a 4-parameter log-logistic function with the drc package in R.

[0186] Reporter assay. KARPAS422 cells were lentivirally transduced with a previously reported GFP-reporter construct (Gurisanka et al. Nature 620, 417-425 (2023)). After selection, cells were seeded and treated with the indicated amounts of each compound for 8 hours. Cells were washed with 2.5% FBS / PBS, administered 1:250 v / v 7-AAD to distinguish viable cells from dead cells, and collected for flow cytometry using BD Accuri. Given a transduced polyclonal population, the area under the curve of the histogram representing the FITC signal across all viable cells was calculated as an integral measure of the total GFP signal. GFP-positive gates were drawn from non-transduced cells, and the area exceeding the threshold for each sample was calculated and normalized for cells treated with DMSO.

[0187] TR-FRET. 10 nM p300-bromodomain (purified from Addgene construct number 39018, donated by Nicola Burgess-Brown), 200 nM biotinylated BCL6-BTB, 20 nM streptavidin-FITC (Thermo#SA1001), and 1:400 anti-6×His terbium antibody (PerkinElmer #61HI2TLF) were added to a low-volume 384-well plate in 10 μL of buffer (20 mM HEPES, 150 mM NaCl, 0.1% BSA, 0.1% NP-40, and 1 mM TCIP). Each protein mixture was incubated with a digitally dispensed drug (Tecan D300e) in the dark at room temperature for 1 hour, then excited at 337 nM. Emissions at 520 nM (FITC) and 490 nM (terbium) were measured using a PHERAstar FS plate reader (BMG Labtech). The signal ratios from 520 nm to 490 nm were calculated, normalized for DMSO-treated conditions, and plotted.

[0188] result The results are shown in Figures 8A-8F. MNN-03-038(TCIP3) showed higher cell killing than the inhibitor alone, indicating that this cell killing was dependent on the formation of a ternary complex between p300 and BCL6. Figure 8A shows the increased cell killing induced by TCIP3 compared to known p300 / CBP inhibitors (A-485), degradation agents (dCBP-1), or combinations of BCL6 and p300 / CBP inhibitors (BI-3812 and GNE-781, respectively). Figure 8B shows the IC5 of all synthesized p300 / CBP TCIP molecules in a 72-hour viability assay in SUDHL5 cells. 50 The values ​​and their structure-activity relationships are shown. Figure 8C shows that treatment with TCIP3 induces transcriptional activation at the BCL6 promoter compared to BI-3812 or GNE-781. Figure 8D shows that all TCIPs, for both linear and rigid linkers, can biochemically induce a ternary complex between p300 and BCL6 in the TR-FRET assay compared to BI-3812 and GNE-781. Figure 8E shows that titration of BI-3812 or GNE-781 in a dose-dependent manner could rescue TCIP3-mediated cell killing in a 72-hour viability assay. Figure 8F shows that TCIP3-mediated killing is more effective in DLBCL cell lines with high levels of BCL6 protein.

[0189] All references cited herein, including publications, patent applications, and patents, are incorporated herein by reference to the same extent as they are incorporated herein by reference, with each reference indicated to be incorporated individually and specifically.

Claims

1. Compound of formula (I) A-L-B (I) or a pharmaceutically acceptable salt thereof. (In the formula, A is the BCL6 bond portion; L is the linker; (B is the portion that binds to the bromodomain of histone acetyltransferase.)

2. A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein A is the part of the following formula: 【Chemistry 1】

3. A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein A is the part of the following formula: 【Chemistry 2】

4. A compound according to any one of claims 1 to 3 or a pharmaceutically acceptable salt thereof, wherein B is a portion that binds to the bromodomain or CBP of p300.

5. A compound according to any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof, wherein B is the part of the following formula: 【Transformation 3】

6. A compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof, wherein B is the part of the following formula: 【Chemistry 4】

7. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound is the compound of formula (Ia): 【Transformation 5】

8. L is either a direct bond or -CH 2 -, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O) 2 - A compound according to any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, wherein the arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties are independently unsubstituted or substituted with one, two, or three substituents.

9. L is either a direct bond or -CH 2 -, -O-, -C(O)-, -NH-, -N(CH 3 )- A compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, comprising any combination of a cycloalkylene and a heterocyclylene moiety.

10. L comprises any combination of the following parts, wherein L is a compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof: 【Transformation 6】 -(CH) 2 ) q -、-C(O)-、-NHH-、 【Transformation 7】 (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16).

11. A compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, wherein L has a formula selected from the following: 【Transformation 8】 (wherein p is 1, 2, 3, 4, 5, or 6, and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16).

12. A compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, wherein L has a formula selected from the following: 【Chemistry 9】

13. The aforementioned compound, 【Chemistry 10-1】 【Chemistry 10-2】 【Chemistry 10-3】 [Chemistry 10-4] [Transformation 10-5] 【Chemistry 10-6】 The compound according to claim 1, selected from the pharmaceutically acceptable salts thereof.

14. A pharmaceutical composition comprising a compound according to any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

15. A method for treating a proliferative disorder in a subject requiring treatment for the proliferative disorder, comprising administering to the subject a therapeutically effective amount of a compound according to any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof.

16. The method according to claim 14, wherein the proliferative disorder is a cancer selected from carcinomas, sarcomas, and malignant hematological diseases.

17. The method according to claim 15, wherein the cancer is lymphoma.

18. The method according to claim 16, wherein the cancer is diffuse large B-cell lymphoma.

19. A compound according to any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof, for use as a pharmaceutical.

20. A compound according to any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof, for use in the treatment of proliferative disorders.

21. The compound according to claim 20, wherein the proliferative disorder is a cancer selected from carcinoma, sarcoma, and malignant hematological disease.

22. The compound according to claim 21, wherein the cancer is lymphoma.

23. The compound according to claim 22, wherein the cancer is diffuse large B-cell lymphoma.

24. A kit comprising the compound according to any one of claims 1 to 13, or a pharmaceutically acceptable salt thereof.

Images