Method, primer composition, and kit for detecting nucleic acid amplification products

Abstract

This application provides a method for detecting nucleic acid amplification products, a primer composition, and a kit. The primer composition comprises a first primer set including an upstream primer and a downstream primer, and at least one modified primer having a labeled fluorescent group or a quencher group at its 5' end, and a probe suitable for complementary pairing with the 5' end of the modified primer and having a quencher group or a fluorescent group at its 3' end, wherein the quencher group is suitable for quenching the fluorescent group.

Description

Technical Field

[0001] The present invention relates to the fields of biomedicine and nucleic acid detection. Specifically, the present application relates to a primer composition, a kit, and a method for detecting nucleic acid amplification products.

Background Art

[0002] In the fields of biological sample analysis and molecular diagnostic techniques, in order to ensure sufficient sensitivity and specificity in detection methods, technical means for amplifying target genes or nucleotide fragments are generally adopted. The polymerase chain reaction (PCR) is one of the most commonly used methods, which can rapidly amplify target nucleic acid molecules in vitro or in a test tube and can be used for qualitative and quantitative detection. PCR utilizes temperature fluctuation cycles, and through the enzymatic promotion of polymerase, double-stranded DNA (dsDNA) is thermally denatured, primer annealed, and complementary strand extension synthesis is carried out. Repeated temperature fluctuation cycles can generate exponentially increasing PCR final products, and the amplification multiple is determined by the number of rounds of temperature fluctuation cycles. Real-time PCR, also called fluorescence quantitative PCR, is an improved PCR method that utilizes an optical detection system to monitor the accumulation concentration of PCR products in real time and realizes quantitative detection of target genes or nucleotide fragments.

[0003] However, one of the drawbacks of PCR is that it needs to rely on the heating process of a thermal cycling device to initiate DNA thermal denaturation for each temperature fluctuation cycle. In this process, double-stranded DNA is opened into free single-stranded DNA, and a synthesis reaction can be carried out under the action of primers and polymerase. Such intermittent reactions affect the synthesis efficiency and amplification rate of DNA. To overcome these limitations and drawbacks of PCR, nucleic acid isothermal amplification technology was born. Such technology can rapidly amplify target DNA or RNA fragments at a constant temperature without the support of a thermal cycling device, simplifies the complexity of nucleic acid detection means, and has important significance for immediate detection.

[0004] Common isothermal amplification techniques include loop-mediated amplification (LAMP), rolling loop amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA), recombinant polymerase amplification (RPA), transcription-mediated width amplification (TMA), single-primer isothermal amplification (SPIA), and helicase-dependent amplification (HDA). These techniques alter DNA conformation independently of temperature fluctuations, and many employ polymerase-mediated strand displacement mechanisms to achieve template strand release and primer annealing. Polymerase-mediated strand displacement is a widely applied technique in nucleic acid amplification reactions, simulating the process of nucleic acid replication in living organisms. Such displacement reactions can be performed over a wide temperature range and are easy to operate. In recent years, nucleic acid strand displacement reactions have been widely applied in various fields of molecular biology, attracting particular attention in signal amplification and biosensing detection. However, this technique still has significant shortcomings in achieving multi-target specificity co-detection.

[0005] Therefore, in this field, there is an urgent need to develop a general-purpose method suitable for detecting nucleic acid isothermal amplification products. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] This application is submitted by the inventor based on the following problems and discoveries.

[0007] Isothermal amplification is a method for rapidly amplifying nucleic acid fragments at a predetermined constant temperature, aiming to overcome the limitations and shortcomings of PCR technology. LAMP is a key representative of isothermal amplification technology, suitable for low-cost and rapid nucleic acid diagnostics. Currently, probe-based LAMP product detection methods exhibit unique characteristics due to their differing detection principles. However, the complexity of LAMP technology itself makes designing efficient probes extremely challenging. In particular, some probes, such as assay probe-LAMP, DARQ, and MERT-LAMP, have low specificity, potentially leading to high false-positive results. Furthermore, conventional probe-based labeling methods typically lack versatility, as they usually only support single-duplex labeling or single detection methods (endpoint detection or real-time detection). [Means for solving the problem]

[0008] The purpose of this application is to solve at least one of the prior technical problems.

[0009] Therefore, in a first aspect of the present application, the present application provides a primer composition. According to an embodiment of the present application, the primer composition comprises an upstream primer and a downstream primer, comprising a first primer set comprising at least one modified primer having a labeled fluorescent group or a quencher group at the 5' end of the modified primer, and a probe suitable for complementary pairing with the 5' end of the modified primer and having a quencher group or a fluorescent group at its 3' end, wherein the quencher group is suitable for quenching the fluorescent group.

[0010] According to the embodiments of this application, the specificity, sensitivity, and accuracy of detection can be improved by using the primer composition to detect nucleic acid amplification products.

[0011] In some cases, the first set of primers can be used as internal or folded primers to introduce stem-loop products during loop-mediated amplification and initiate auto-extension amplification reactions.

[0012] In some other examples, the first set of primers can be used as loop primers or accelerating primers to pair with the stem-loop product and extend during loop-mediated amplification, thereby accelerating the self-extension amplification reaction.

[0013] In some other examples, "the quencher group is suitable for quenching the fluorescent group" means that the quencher group in the primer composition is designed to interact with the fluorescent group and eliminate the fluorescent signal of the fluorescent group under certain conditions. For example, the so-called "certain conditions" include a temperature of 20-45°C, where the modified primer and probe are complementaryly paired, and the modified primer and probe constitute a fluorescent quenched double-stranded DNA (dsDNA) probe, where the fluorescent signal is quenched and no fluorescent signal is generated.

[0014] According to the embodiments of the present application, the primer composition further comprises at least one of the following technical features.

[0015] In the embodiments of the present application, the modified primer has a quencher group at its 5' end and the probe has a fluorescent group at its 3' end. In some other embodiments of the present application, the modified primer has a fluorescent group at its 5' end and the probe has a quencher group at its 3' end.

[0016] According to the embodiments of the present application, the modification is selected from at least one of the first three nucleotides at the 5' or 3' end.

[0017] In some examples of this application, the quencher group is located at the 5' end of the modified primer and may be modified to any one of the 1st to 3rd nucleotides at the 5' end. The fluorescent group is located at the 3' end of the probe and may be modified to any one of the 1st to 3rd nucleotides at the 3' end.

[0018] In some other examples of this application, the fluorescent group is located at the 5' end of the modified primer and may be modified to any one of the 1st to 3rd nucleotides at the 5' end. The quencher group is located at the 3' end of the probe and may be modified to any one of the 1st to 3rd nucleotides at the 3' end.

[0019] According to the embodiments of this application, the probe is single-stranded DNA.

[0020] According to the embodiment of the present application, the upstream primer of the first primer set has the nucleotide sequences shown in SEQ ID NO:1~3, CTGCACTTACACCGCAAACCCGAACCCATGCTTCAGTC(SEQ ID NO:1); TTGCAGCATTGTTAGCAGGATTGGGAGCCTTGAATACACC(SEQ ID NO:2); TAAGCAGTTGGTGGTGCAGGAACCATGAGAAGTATGACAACA(SEQ ID NO:3).

[0021] According to the embodiments of the present application, the downstream primer of the first primer set has the nucleotide sequences shown in SEQ ID NO: 4-6, CGGCACAGGCACTAGTACTGCAAAACCAGCTACTTTATCATTGT(SEQ ID NO:4); TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG(SEQ ID NO:5); CCTGGCCAAGGTCATCCATGTGGACTGTGGTCATGAGT(SEQ ID NO:6).

[0022] According to the embodiments of the present application, the primer composition further includes a second primer set, and the second primer set includes an upstream primer and a downstream primer. According to the embodiments of the present application, the so-called second primer set is an outer primer (or replacement primer), which replaces the internal primer at the initial stage of loop-mediated amplification to extend the strand and further promotes the formation of stem-loop products.

[0023] According to the embodiments of the present application, the upstream primer in the second primer set has a nucleotide sequence shown in SEQ ID NO: 7-9, TGTAGTTGTGATCAACTCCG (SEQ ID NO: 7); TCATATGGGTTGCAACTGA (SEQ ID NO: 8); ATGTTCGTCATGGGTGTG (SEQ ID NO: 9).

[0024] According to the embodiments of the present application, the downstream primer in the second primer set has a nucleotide sequence shown in SEQ ID NO: 10-12, TCTTGGAAGCGACAACAA (SEQ ID NO: 10); TTGCGACTACGTGATGAG (SEQ ID NO: 11); ATCCACAGTCTTCTGGGT (SEQ ID NO: 12).

[0025] According to the embodiments of the present application, the primer composition includes a third primer set, and the third primer set includes an upstream primer and a downstream primer.

[0026] According to the embodiments of the present application, at least one modified primer is included in the third primer set, and a quencher group is provided at the 5'-end of the modified primer.

[0027] In some examples of this application, the third primer set can be used as a loop primer or accelerating primer to pair with the stem-loop product and extend during loop-mediated amplification, thereby accelerating the self-extension amplification reaction.

[0028] In some other examples of this application, a third set of primers can be used as internal or folded primers to introduce stem-loop products during loop-mediated amplification and to initiate a self-extension amplification reaction.

[0029] According to the embodiment of the present application, the upstream primer in the third primer set has the nucleotide sequences shown in SEQ ID NO: 13-15, CGTTTAAAAAACGATTGTGCATCAGC(SEQ ID NO:13); CGGGTGCCAATGTGATCTTT(SEQ ID NO:14); AGGCATTGCTGATGATCTTGAG (SEQ ID NO:15).

[0030] According to the embodiment of the present application, the downstream primer in the third primer set has the nucleotide sequences shown in SEQ ID NO: 16-18, ATGTCGTATACAGGGCTTTTGACA(SEQ ID NO:16); ATTGCCAAAAGGCTTCTACGC(SEQ ID NO:17); ACAACTTTGGTATCGTGGAAGG(SEQ ID NO:18).

[0031] According to the embodiments of the present application, the quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA, and Eclipse, and the fluorescent group is selected from at least one of FAM, HEX, ROX, Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar 570, Quasar 670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye 650, and IR Dye 750.

[0032] According to embodiments of the present application, the length of the probe is selected from 5 to 20 bp. In some examples, the length of the probe is selected from 8 to 12 bp. Specifically, the length of the probe may be 8, 9, 10, 11, or 12 bp.

[0033] According to the embodiment of the present application, the probe has the nucleotide sequence shown in SEQ ID NO: 19~21, GTGTAAGTGCAG(SEQ ID NO:19); GAAGTTGTAGCA(SEQ ID NO:20); ACCAACTGCTTA(SEQ ID NO:21).

[0034] According to the embodiments of the present application, at least one sequence in the modified primer contains at least one special nucleotide or modifying group. According to the embodiments of the present application, the purpose of adding the special nucleotide or modifying group is to change the half-melt temperature (Tm value) of the sequence or to improve the stability and specificity of complementary strand pairing.

[0035] According to embodiments of the present application, at least one of the probes comprises at least one of the special nucleotides or modifying groups.

[0036] According to the embodiments of this application, the special nucleotide comprises at least one selected from loc nucleic acids, peptide nucleic acids, ribonucleotides, and deoxyinosine. In some examples, the so-called special nucleotide includes, but is not limited to, the above types, and generally, any nucleotide that can improve the stability and specificity of complementary strand pairing is applicable.

[0037] According to the embodiments of the present application, the modifying group comprises at least one selected from a phosphate group, a methyl group, and a glycosyl group. In some examples, the so-called modifying group includes, but is not limited to, the above types, and generally, any nucleotide that can improve the stability and specificity of complementary chain pairing is applicable, such as a zinc finger structure.

[0038] In a second aspect of the present application, the present application provides a kit. According to the embodiments of the present application, the kit comprises a primer composition described in the first aspect of the present application or in any embodiment of the present application. The kit has advantages such as portability and low cost.

[0039] According to embodiments of the present application, the kit further comprises at least one of the following technical features.

[0040] According to embodiments of the present application, the kit further comprises at least one selected from strand-displacement DNA polymerase, reverse transcriptase, ribonuclease inhibitor, uracil-DNA glycosylase, dNTP, dUTP, pyrophosphatase, proofreading enzyme, protective agent, reducing agent, and packing agent. In some examples, uracil-DNA glycosylase and dUTP are used to reduce contamination of the amplification product.

[0041] In some other examples, the kit may include an enhancer, quantitative water, or instructions. The enhancer is used to detect GC sequence-rich nucleic acid products and is more effective.

[0042] According to the embodiments of this application, the strand-substituted DNA polymerase does not have 3'→5' exonuclease activity.

[0043] According to the embodiments of this application, the strand-displacement DNA polymerase comprises at least one selected from Bst 3.0 DNA polymerase, Bst 2.0 WarmStart® DNA polymerase, Bst 2.0 HotStart DNA polymerase, Bst II Pro DNA polymerase, and HotStart Bst 4.2 DNA polymerase. In some examples, the so-called kit comprises a buffer that matches the strand-displacement DNA polymerase.

[0044] According to the embodiments of this application, the reverse transcriptase comprises at least one selected from WarmStart® RTx reverse transcriptase, Hifair® III reverse transcriptase, and ThermoStable V reverse transcriptase. In some examples, the kit comprises a buffer solution matched to the reverse transcriptase.

[0045] According to the embodiments of the present application, the uracil-DNA glycosylase comprises at least one selected from Antarctic-derived heat-sensitive uracil-DNA glycosylase and temperature-sensitive uracil-DNA glycosylase.

[0046] According to the embodiments of the present application, the proofreading enzyme has 3'→5' exonuclease activity.

[0047] According to the embodiments of the present application, the proofreading enzyme comprises at least one selected from Pfu DNA polymerase, Q5U DNA polymerase, Q6U DNA polymerase, and KOD DNA polymerase. The proofreading enzyme can overcome the problem of reduced amplification efficiency due to base mismatches.

[0048] In some cases, the so-called kit includes a buffer solution tailored to the proofreading enzyme.

[0049] According to the embodiments of this application, the protective agent comprises at least one selected from bovine serum albumin, casein, trehalose, pullulan, sucrose, maltose, glycine, proline, sodium azide, and thimerosal. In some examples, the addition of a protective agent can protect enzyme activity and make the performance of the kit more stable.

[0050] According to the embodiments of this application, the protective agent is bovine serum albumin. In some examples, selecting bovine serum albumin as the protective agent can make the reaction system more stable.

[0051] According to the embodiments of this application, the reducing agent comprises at least one selected from dithiothreitol, β-mercaptoethanol, and glutathione.

[0052] According to the embodiments of the present application, the filler comprises at least one selected from polyethylene glycol, polysucrose, and dextran.

[0053] According to the embodiments of the present application, the kit comprises at least one selected from an enzyme buffer and a surfactant.

[0054] In a third aspect of the present application, the present application provides a method for detecting nucleic acid amplification products. According to an example of the present application, the method includes the steps of: performing an amplification reaction using a nucleic acid sample to be detected as a template and a primer composition described in the first aspect of the present application or a kit described in the second aspect of the present application; and signal detection of the amplification product.

[0055] According to the embodiments of this application, by using this method to detect nucleic acid amplification products, the progress of the amplification reaction (real-time detection) and the final detection result (endpoint detection) can be accurately displayed. The signal noise is relatively high, and the difference between negative and positive amplification results is significant. Furthermore, multiple detections are possible with the same reaction.

[0056] According to embodiments of the present application, the above method further includes at least one of the following technical features.

[0057] According to the embodiments of the present application, the nucleic acid sample to be detected includes at least one selected from nasopharyngeal swabs, bronchoalveolar lavage fluid, genital swabs, whole blood, plasma, serum, saliva, sputum, urine, lymph, tears, sweat, tissue, hair, feces, bacterial suspension, viral culture medium, aqueous solution, soil, aerosol, condensed water, oil storage, biological samples, and environmental samples.

[0058] According to the embodiments of the present application, the amplification reaction includes at least one selected from loop-mediated amplification, recombinant enzyme polymerase amplification, cross-primer amplification, helicase-dependent amplification, and Rolling loop amplification.

[0059] According to the embodiment of the present application, the amplification reaction is loop-mediated amplification.

[0060] According to the embodiment of the present application, the amplification reaction is carried out in the amplification reaction system.

[0061] According to the embodiments of this application, the concentration of the strand-displaced DNA polymerase in the amplification reaction system is 0.1 to 0.8 U / μL. In some examples, the strand-displaced DNA polymerase concentration is preferably 0.1 U / μL, 0.2 U / μL, 0.3 U / μL, 0.4 U / μL, 0.5 U / μL, 0.6 U / μL, 0.7 U / μL, or 0.8 U / μL.

[0062] According to the embodiments of this application, the concentration of the strand-substituted DNA polymerase in the amplification reaction system is 0.2 to 0.6 U / μL.

[0063] According to the embodiments of the present application, the concentration of the strand-substituted DNA polymerase in the amplification reaction system is 0.3 to 0.5 U / μL.

[0064] According to the embodiments of the present application, the concentration of the reverse transcriptase in the amplification reaction system is 0.2 to 2 U / μL. In some examples, the reverse transcriptase concentration is preferably 0.2 U / μL, 0.3 U / μL, 0.4 U / μL, 0.5 U / μL, 0.6 U / μL, 0.7 U / μL, 0.8 U / μL, 0.9 U / μL, 1 U / μL, 1.1 U / μL, 1.2 U / μL, 1.3 U / μL, 1.4 U / μL, 1.5 U / μL, 1.6 U / μL, 1.7 U / μL, 1.8 U / μL, 1.9 U / μL, or 2 U / μL.

[0065] According to the embodiments of the present application, the concentration of the reverse transcriptase in the amplification reaction system is 0.4 to 1.6 U / μL.

[0066] According to the embodiments of the present application, the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.2 to 1.2 U / μL.

[0067] According to the embodiments of the present application, the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.5 to 0.9 U / μL.

[0068] According to the embodiments of the present application, the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.01 to 0.1 U / μL.

[0069] According to the embodiments of the present application, the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.02 to 0.05 U / μL.

[0070] According to the embodiments of the present application, in the amplification reaction system, the molar ratio of dUTP to dTTP is 0:10 to 10:0. In some examples, the molar ratio of dUTP to dTTP is preferably 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9:1.

[0071] According to the embodiment of the present application, in the amplification reaction system, the molar ratio of dUTP to dTTP is 2:8 to 8:2.

[0072] According to the embodiments of the present application, the concentration of the proofreading enzyme in the amplification reaction system is 0.001 to 0.1 U / μL. In some examples, the concentration of the proofreading enzyme is selectively 0.001 U / μL, 0.01 U / μL, 0.02 U / μL, 0.03 U / μL, 0.04 U / μL, 0.05 U / μL, 0.06 U / μL, 0.07 U / μL, 0.08 U / μL, 0.09 U / μL, or 0.1 U / μL.

[0073] According to the embodiments of the present application, the concentration of the proofreading enzyme in the amplification reaction system is 0.005 to 0.05 U / μL.

[0074] According to the embodiments of the present application, the concentration of bovine serum albumin in the amplification reaction system is 0.1 to 25 μg / μL. In some examples, selectively, the concentration of bovine serum albumin is 0.1 μg / μL, 1 μg / μL, 2 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, 6 μg / μL, 7 μg / μL, 8 μg / μL, 9 μg / μL, 10 μg / μL, 11 μg / μL, 12 μg / μL, 13 μg / μL, 14 μg / μL, 15 μg / μL, 16 μg / μL, 17 μg / μL, 18 μg / μL, 19 μg / μL, 20 μg / μL, 21 μg / μL, 22 μg / μL, 23 μg / μL, 24 μg / μL or 25 μg / μL.

[0075] According to the embodiments of the present application, the concentration of bovine serum albumin in the amplification reaction system is 0.5 to 15 μg / μL.

[0076] According to the embodiments of the present application, the method further includes a step of annealing the primer composition before the amplification reaction, the annealing reaction being carried out at 20 to 45°C. At this reaction temperature, the modified primers pair complementaryally with the probe to form a fluorescent quenched double-stranded DNA (dsDNA) probe, which is the reaction initiation point and does not contain a fluorescent signal.

[0077] According to the embodiment of the present application, the annealing reaction is carried out at 40°C. The inventors ultimately determined that 40°C is the most suitable annealing temperature after comprehensively considering the signal-to-noise ratio of the fluorescence signal and the time required for amplification.

[0078] According to the embodiments of this application, the amplification reaction is carried out under conditions of 60-68°C. At this reaction temperature, the modified primer and the probe complementary strand are opened, forming two single-stranded DNA (ssDNA) molecules. The modified primer binds to the amplification primer and generates a fluorescent signal.

[0079] According to the embodiment of the present application, the amplification reaction is carried out under conditions of 65°C. The inventors ultimately determined that 65°C is the optimal amplification temperature after comprehensively considering the signal-to-noise ratio of the fluorescence signal and the time required for amplification.

[0080] In the embodiments of the present application, the molar ratio of the modified primer to the probe in the amplification reaction system is 1:1.2 to 1:1.5. Generally, the amount of probe added does not exceed the maximum amount of dsDNA probe that can be fully paired with the modified primer to constitute a fluorescent quench within the temperature range, and is usually smaller than the amount of modified primer added. In some examples, the molar ratio of the modified primer to the probe is 1:1.2, 1:1.3, 1:1.4, or 1:1.5.

[0081] According to embodiments of the present application, the amplification reaction includes a step of pre-treating the test nucleic acid sample, the pre-treatment including mixing the sample release agent with the test nucleic acid sample. In some embodiments of the present application, the sample release agent may be a commercial kit purchased from a manufacturer such as Shenzhen Huadazhi Manufacturing Co., Ltd. (Hua Da Zhi Zao, catalog number: 1000027692).

[0082] In some other examples of the present application, the pretreatment of the test nucleic acid sample includes, but is not limited to, extracting DNA or RNA from the nucleic acid sample, and the extraction method includes, but is not limited to, direct extraction using a sample release agent, RNA or DNA magnetic bead extraction, RNA or DNA silica gel centrifugal column extraction, and the like.

[0083] Additional aspects and advantages of the present invention are partially shown in the following description, partially become apparent in the following description, or can be understood through the practice of the present invention. [Brief explanation of the drawing]

[0084] The above and / or additional aspects and advantages of the present invention will be apparent and readily understood from the description of the embodiments with reference to the following drawings. [Figure 1] This is a schematic diagram of the loop-mediated isothermal amplification (LAMP) reaction principle according to one embodiment of the present invention. [Figure 2] This is a schematic diagram of a LAMP non-sequence-specific labeling method according to one embodiment of the present invention. [Figure 3] A schematic diagram of a LAMP sequence-specific multi-target labeling method according to one embodiment of the present invention. [Figure 4] This is a schematic diagram of a primer composition and probe according to one embodiment of the present invention. [Figure 5] This is a schematic diagram of the double-stranded probe labeling principle and detection means according to one embodiment of the present invention. [Figure 6] This is a schematic diagram of the annealing and dissolution temperature test results for Group 1 and Group 2 according to one embodiment of the present invention. [Figure 7] This is a schematic diagram of the annealing and dissolution temperature test results for groups 3 and 4 according to one embodiment of the present invention. [Figure 8] This is a schematic diagram of the real-time detection results of ORF and N gene single-weight according to one embodiment of the present invention. [Figure 9] This is a schematic diagram of the results of dual real-time detection of ORF and N genes and the triple real-time detection results of ORF, N, and GAPDH genes according to one embodiment of the present invention. [Figure 10] This is a schematic diagram of the results of detecting single-strength ORF, N, and GAPDH gene endpoints under excitation by a portable ultraviolet light source according to one embodiment of the present invention. [Figure 11] This is a schematic diagram of a dual-channel LAMP real-time signal curve (raw data from HBJ FQD-96A) according to one embodiment of the present invention. [Figure 12] This is a schematic diagram of the endpoint fluorescence signal image of a 96-well PCR plate according to one embodiment of the present invention. A: Dark-field fluorescence image; B: Light-field fluorescence image [Figure 13] This is a schematic diagram of real-time detection results at 60°C, 62°C, and 65°C according to one embodiment of the present invention. [Modes for carrying out the invention]

[0085] The above drawings are illustrative and not limiting. In the drawings, the sizes of some components may be exaggerated and not depicted proportionally for illustrative purposes. Such dimensions and relative dimensions may not correspond to true reductions in the actual implementation of the invention.

[0086] definition

[0087] In this specification, unless otherwise specified, singular forms such as "one type" and "one" refer to multiple items (one or more), and "one set" or "plural" refers to two or more items.

[0088] In this specification, unless otherwise specified, the terms “inclusion” or “comprehensible” are open expressions, meaning they include the content shown in this invention but do not exclude the content of other embodiments.

[0089] In this specification, unless otherwise specified, terms such as “first,” “second,” “third,” and “fourth” are for descriptive purposes only and should not be considered to indicate or imply relative importance or an implied number of technical features, and features limited to “first,” “second,” etc., may be explicitly or implicitly indicated to include one or more such features in the examples.

[0090] In this specification, so-called primers, probes, or nucleic acid fragments are all represented by being written from left to right in the 5' to 3' direction.

[0091] In this specification, so-called dNTPs include four types of natural nucleotides, such as dATP, dTTP, dGTP, and dCTP, and also include variants of natural nucleotides.

[0092] In this specification, the term "loop-mediated amplification (LAMP)" refers to a high-speed and efficient self-circular chain substitution amplification technology (DOI:10.1093 / nar / 28.12.e63) developed by Nippon Eiken Chemical Co., Ltd. in 2000 as an effective alternative to PCR. This technology constructs intermediate products with specific structures through bidirectional multi-strand substitution by designing a special primer combination. These intermediate products form multiple primer annealing sites, thereby initiating super-exponential amplification and DNA self-extension (Figure 1). LAMP uses a polymerase with strong substitution activity to achieve rapid extension and replication of DNA double strands under mild isothermal conditions (usually a constant temperature within the range of 60-68°C). Due to its stable amplification performance and ease of operation, LAMP technology is widely applied in fields such as infectious disease diagnosis, genetic screening, prenatal diagnosis, cancer testing, and environmental monitoring. Furthermore, LAMP technology can be bound to reverse transcriptase and is used to detect RNA targets such as influenza virus, Ebola virus, and dengue virus.

[0093] LAMP technology is generally considered to have high specificity and sensitivity comparable to PCR. However, the main challenge in low-cost or immediate diagnostic applications is to achieve nucleic acid amplification detection while minimizing reliance on cumbersome operations and complex equipment. Furthermore, the detection mechanisms commonly used in LAMP technology do not easily enable multiple operations, making it difficult to achieve the objective of distinguishing multiple targets in a single (tube) reaction. Examples include genotyping of gene mutations or identification of different mutant strains of pathogens. On the other hand, real-time PCR, using multicolor fluorescent labeling-based multiplexing techniques, can detect 2-4 targets per reaction (e.g., labeling methods such as TaqMan hydrolyzable probes, molecular beacons, and scorpion-type probes). Moreover, most conventional LAMP technologies employ non-sequence-specific labeling methods, which lack high specificity for target DNA and are prone to false positives. These detection methods include magnesium pyrophosphate precipitation turbidity measurement, gel electrophoresis, calcium / magnesium ion metal indicators, pH colorimetric chromogenesis, dissolution and annealing curve analysis, embedding fluorescent dye labeling (e.g., EvaGreen, PicoGreen, SYBR Green series, SYTO series, etc.), and iophosphate-converted bioluminescence or electrochemiluminescence. Because LAMP technology uses numerous primer combinations of different lengths and Tm (melting temperature) values, there is a significant risk of primer dimerization or primer self-elongation, and employing the non-sequence-specific labeling methods listed above is likely to result in false positive results (Figure 2). In contrast, sequence-specific labeling methods exhibit superior performance by using target-specific probes or modified primers as identification elements. Sequence-specific labeling methods can accurately identify amplicons without being affected by non-specific products. Furthermore, since sequence-specific labeling methods can simultaneously label and identify multiple target genes or nucleotide fragments in a single detection, single-tube multiplex detection can be easily achieved.

[0094] In this specification, primer-Q represents a primer / probe containing a quencher group, and primer-P represents a primer / probe containing a fluorescent group.

[0095] Conventional technology

[0096] Currently, the sequence-specific labeling methods employed in LAMP technology (Figure 3) mainly include self-quenching loop primers (Fluorescence of loop primer upon self-dequenching), HyBeacon probes, guanine quenching probes (Guanine quenching), graphene oxide-based fluorescence resonance energy transfer (GO-FRET), detection of amplification by release of quenching (DARQ), quench detection of unincorporated amplification signal reporters (QUASR), one-step strand displacement (OSD), molecular beacon (MB), dual hybridization probe (LightCycler probe), assay probe (Assimilating probe), and mediator displacement probe. Different labeling methods can be divided into two types of technical means: endpoint detection and real-time detection.

[0097] Self-quenching loop primers employ self-quenching fluorescent group-modified loop primers and do not require additional fluorescent molecules; therefore, this is a quenching mechanism based on a non-FRET (Fluorescence Resonance Energy Transfer) effect. The quenching mechanism of the labeling group within the primer is unknown and may involve interactions with nucleoside bases surrounding the group. During the amplification process, the modified primer is incorporated into the double-stranded amplicon, resulting in a de-quenching effect, which causes fluorescence enhancement. The main challenge of this technique is the need to match fluorescent groups that exhibit high self-quenching with primer sequences suitable for modification with those fluorescent groups. Currently, this method has only been reported for single-target labeling, and multiple detection will not be possible for some time.

[0098] Unlike self-quench loop primers, HyBeacon probes are non-extendable reporter molecules located between the internal primer FIP and BIP sequences. They are typically detected using a dissolution / annealing curve after LAMP completion and usually only allow for single-target labeling.

[0099] Guanine quench probes typically employ a fluorescent modification at the 5' end of a cytosine (C) residue. When the probe anneals to the target sequence, fluorescence is quenched by electron transfer between the fluorescent group and a complementary guanine (G) residue. A major drawback of this method is that signal generation is highly dependent on the target sequence; that is, the fluorescent group must be linked to cytosine (C) for efficient quenching at the target-probe complex. Furthermore, the signal from a free probe may be affected by any nearby guanine bases.

[0100] GO-FRET is achieved by a FRET quenching effect between the fluorescent group on the probe and GO. The single-stranded probe adsorbs to the GO surface via π-π interactions, and the fluorescence is quenched due to the close contact between the fluorescent group and GO. After LAMP is complete, the fluorescent probe hybridizes with the amplicon, and the GO cannot approach the nucleotide base, thus restoring the quenched fluorescence signal. When the LAMP product is added to the probe-GO mixture and the LAMP reaction is positive, the probe preferentially binds to the amplicon, and the fluorescence signal is restored within 10 minutes. A drawback of this method is that the cap must be opened and the product transferred after LAMP, which is highly prone to amplicon contamination. However, the effective FRET between GO and the group results in high fluorescence signal quenching efficiency, which is an advantage of this detection method.

[0101] The DARQ probe is a double-stranded quench reporter probe for real-time detection, consisting of a modified FIP primer and an additional oligonucleotide (Fd probe) complementary to the 5' protruding end of the FIP primer. The FIP primer is modified with a fluorescent or quencher group at its 5' end and anneals with the Fd probe, while the Fd probe is also modified with a quencher or fluorescent group at its 3' end. The newly synthesized product chain and Fd probe hybridize together and are used as a template for subsequent primer extension. Primer extension at the 3' end of the new product chain causes substitution of the Fd probe and release of a fluorescent quench, leading to signal enhancement. The double-stranded quench reporter probe is typically doped with an unmodified normal primer in a certain ratio (generally 1:10) to participate in the amplification reaction. Tanner et al. first reported the DARQ probe and its real-time detection method, which has been used for single and quadruple real-time detection in model systems including Escherichia coli, Caenorhabditis elegans, HeLa cells, lambda, and hBRCA1 DNA. However, the shape of the amplification curves does not show consistency and has a clear deviation from the S curve. In addition, the large number of primers and probes in the system leads to non-template amplification in multiple detection, reducing the specificity of the method to some extent (DOI:10.2144 / 0000113902).

[0102] The QUASR method was designed as a means for detecting the LAMP endpoint. Similar to DARQ, the QUASR method uses a primer modified with a fluorescent group at its 5' end and a short quench probe of approximately 7-13 nucleotides in length modified at its 3' end. The 3' end of the short quench probe is complementary to the 5' end of the modified primer, and the semimelting temperature Tm of the double-stranded quench reporter probe configured before amplification initiation must be significantly lower than the LAMP temperature (e.g., below 50°C) to ensure that the short quench probe is free ssDNA after LAMP initiation, thus avoiding any impact on amplification rate and efficiency. After LAMP completion, the reaction is cooled to room temperature, and the still free 5' end fluorescently modified primer (if still present) and the short quench probe hybridize again, at which point the quench effect does not emit a fluorescent signal. Once the target DNA is amplified, the fluorescently modified primer at the 5' end is incorporated into the amplicon, preventing the short quench probe from approaching again. As a result, the fluorescence signal remains bright and can be observed visually under ultraviolet light. Ball et al. applied the QUASR method to dual endpoint detection of West Nile virus and Chikungunya virus, and completed the reading of results using a smartphone as the detection terminal (DOI:10.1021 / acs.analchem.5b04054). Currently, because a color-based visual judgment method is employed, the QUASR endpoint detection method only supports dual detection, and accurate quantitative analysis is still not possible.

[0103] The OSD probe method involves two complementary probes: a target-binding probe containing a fluorescent group at its 5' or 3' end, and a second oligonucleotide modified with a quencher group at its 3' or 5' end. The target-binding probe is 10-11 bases longer than the second oligonucleotide, resulting in a higher binding enthalpy between the target-binding probe and the amplicon. According to Le Chatelier's principle, a standing-mediated strand displacement reaction is induced in the target-binding probe during the amplification of the target DNA, leading to the separation of the fluorescent group and the quencher group, which in turn increases fluorescence intensity. Due to its thermodynamic properties, the probe is sensitive to a single mismatch in the target amplicon, allowing the OSD probe to distinguish SNPs in LAMP amplicons with a high signal-to-noise ratio. In the presence of the wild-type gene, LAMP-OSD was applied to SNP detection in the mutant BRAF allele (V600E). The detection sensitivity for the mutant allele (V600E) was 20 copies per reaction. The main drawback of this method is that LAMP-OSD requires careful design of the analytical probe sequence, and the binding enthalpies between different sequences must be calculated and balanced to ensure that the standing-mediated chain substitution reaction proceeds smoothly.

[0104] A molecular beacon is a target-specific, dual-labeled probe modified with a fluorescent group and a quenching group at each end of the chain. Its 3' end is complementary to its 5' end, causing the probe to spontaneously form a hairpin structure. In the absence of an amplicon, intramolecular hybridization occurs between the 5' and 3' ends, and the molecular beacon exists in a closed-loop configuration. This results in the fluorescent and quenching groups being very close together, leading to a fluorescent quench. In the presence of an amplicon, the probe hybridizes with the amplicon, opening the loop, separating the phosphor and quenching agent, and releasing fluorescence (Figure 3). The hairpin structure is unstable under LAMP conditions, and background fluorescence affects the signal-to-noise ratio and detection performance. Generally, locking nucleic acids (LNAs) are used to improve the thermal stability of molecular beacons and reduce background fluorescence, but this is expensive to synthesize.

[0105] Similar to DARQ, the assay probe consists of two partially complementary oligonucleotides: a fluorescent probe and a quench probe. The fluorescent probe is designed with a universal oligonucleotide (F chain) modified with a fluorescent group at the 5' end of a loop primer (LF or LB), while the quench probe (Q chain) is complementary to the F chain and labeled with a quencher group at its 3' end. If target DNA is not present, the fluorescence is quenched after the groups approach each other due to hybridization of the fluorescent and quench probes. If target DNA is present, after LAMP initiation, newly synthesized DNA replaces the quench probe, thereby releasing a fluorescent signal.

[0106] The various probe-based LAMP methods described above exhibit different characteristics because they stem from different principles. Among these methods, probe design for OSD probes, molecular beacons, Q-probe-LAMP, assay-probe-LAMP, and TaqMan-LAMP is relatively difficult. While probe-based LAMP methods significantly improve detection specificity, the specificity of assay-probe-LAMP, DARQ, and MERT-LAMP is relatively lower compared to some other methods. Furthermore, each of these various labeling methods has certain technical limitations or design difficulties, such as supporting only single-duplex labeling or only a single detection method (endpoint detection or real-time detection), thus lacking versatility.

[0107] Method for detecting nucleic acid amplification products

[0108] Defects in nucleic acid amplification products are detected based on conventional technology. This application provides a method for detecting nucleic acid amplification products. The method includes the steps of: performing an amplification reaction using a nucleic acid sample to be detected as a template and a primer composition described in the first aspect or any example of this application, or a kit described in the second aspect or any example; and performing signal detection on the amplification product.

[0109] The method described herein is applicable to strand substitution amplification and can also be designed for other similar strand substitution amplification methods, such as recombinant enzyme polymerase amplification, cross-primer amplification, Rolling loop amplification, or other derivative and variant amplification methods (e.g., droplet digital loop-mediated amplification), and new amplification methods that may emerge in the future. In particular, it is applicable to LAMP or RT-LAMP (reverse transcription-loop-mediated amplification) and offers the advantages of simplicity, speed, sensitivity, and accuracy in the detection of single-step, closed-tube, and multiple nucleic acid amplification products. Moreover, the method can simultaneously satisfy two technical means: endpoint detection and real-time detection, and the minimum detection limit (LoD) of a single target can reach 10 copies or less per reaction.

[0110] In one example of this application, the primer composition referred to herein can also be used in combination with or mixed with other labeling methods to detect nucleic acid amplification products such as molecular beacons, ribonuclease cleavage primers or CRISPR cleavage probes, and endonuclease probes.

[0111] In one example of the present invention, as shown in Figures 4 and 5, a nucleic acid sample to be detected is used as a template, and loop-mediated amplification is performed with specific amplification primers. At least one of the 5' ends of an internal primer or loop primer of a single or multiple target involved in amplification is modified with a quencher group at one end. A sequence that is paired complementary to the 5' end of the modified primer and has a fluorescent group modified at the 3' end at one end becomes a fluorescent probe. Within a certain temperature range (20-45°C), a double-stranded probe of the modified primer and fluorescent quench is formed, and the amount of the modified primer consumed in loop-mediated amplification is labeled. Before amplification begins, the consumption of the modified primer is zero, and the fluorescence signal of the fluorescent probe is completely quenched by pairing to form a double-stranded probe. At this point, the fluorescence signal is at its lowest level. After amplification begins, the consumption of the modified primer gradually increases until it becomes insufficient, and all of the fluorescent probe is paired to form a double-stranded probe. As a result, the amount of free ssDNA-state fluorescent probe gradually increases, causing an enhancement of the fluorescence signal. The fluorescence signal reaches saturation when the modified primer is completely consumed and all of the fluorescent probe becomes free ssDNA.

[0112] Since modified primers are usually internal primers or loop primers, they are typically added in large quantities during amplification reactions and fully participate in the amplification reaction, resulting in relatively high consumption. The detection method employing the above labeling principle can accurately show the progress of the amplification reaction and the final detection result, and moreover, the signal-to-noise ratio is relatively superior, and the difference between negative and positive detection results is significant. Furthermore, once the target DNA is amplified, the internal primer or loop primer is specifically incorporated into the amplicon by the action of the strand-displacement polymerase, thus guaranteeing the specificity of the detection method. When detecting multiple target DNAs, differentiation can be achieved by modifying at least one internal primer or loop primer corresponding to each of the multiple targets, labeling them complementaryly with fluorescent probes, and labeling different emission wavelengths of the fluorescent groups. This enables multiple detection in the same reaction. Moreover, the detection method of this invention simultaneously satisfies two technical means: endpoint detection and real-time detection, enabling rapid nucleic acid detection applications in different scenarios.

[0113] To facilitate understanding, the endpoint detection method and real-time detection method for nucleic acid amplification products described in this application will be explained in detail below.

[0114] (1) Method for detecting the endpoint

[0115] A. Template preparation: Nucleic acid samples are collected and stored, and target template solutions are prepared according to the type of nucleic acid sample, such as RNA, cDNA, or dsDNA. Specific sample processing methods that can be employed include direct extraction with a sample release agent, RNA or DNA magnetic bead extraction, RNA or DNA silica gel centrifugal column extraction, and reverse transcription of RNA samples to cDNA. Experimental operations can be performed using either a manual or automated platform, depending on the sample processing needs at different throughput levels.

[0116] B. Preparation of amplification reaction solution: The specificity primer set and probe are synthesized by the method described above to prepare the loop-mediated amplification detection kit. The kit may contain two forms: liquid reagents and solid reagents, or contain both of the above forms. The solid reagents are produced by process methods including freeze-drying and air-drying, and their external form may include multiple types such as spherical, square, thin film, irregular, granular, powder, or amorphous. The solution is diluted or redissolved in a solution according to a predetermined volume and concentration, and mixed with the target template solution to form an amplification reaction solution, or the template solution is directly added and redissolved to form an amplification reaction solution of a predetermined volume and concentration. The above amplification reaction solution preparation process can be performed using a manual platform or an automated platform.

[0117] C. On-board amplification: The amplification reaction solution is heated in situ or transferred to a device, facility, or environment with a constant temperature incubation function, including but not limited to water baths, metal baths, ovens, hot plates, thermal cycle devices, resistance heating devices, semiconductor thermoelectric devices, magnetic heating devices, photothermal devices, biological or chemical heating devices, etc. An amplification reaction solution containing a sufficient amount of template will generate a sufficient loop-mediated amplification reaction under appropriate temperature conditions (usually a constant temperature within the range of 60-68°C), while an amplification reaction solution containing below the detection limit amount of template will not generate a loop-mediated amplification reaction with a certain probability, and the template content in the same reaction shows a positive correlation with the probability of amplification occurring. The time required to complete amplification varies depending on the type and quantity of template, and the performance of the primer set and probe, and is 5 to 60 minutes.

[0118] D. Endpoint Detection: When the temperature of the amplification reaction solution is lowered to a low temperature range, it is irradiated using an appropriate excitation light source (e.g., ultraviolet light or excitation light sources of each wavelength corresponding to the detection channel), and the light intensity and color of the fluorescence signal emitted by the optical sensor or the naked eye are judged and compared with the untemplated control (NTC) amplification reaction solution. After that, the light intensity threshold is calculated to determine the amplification result. Depending on the light intensity, it is determined whether the target on the template has been detected (if the endpoint light intensity or change in endpoint light intensity is significantly increased compared to the NTC, it is judged as a positive result indicating detection; if there is no significant increase, it is judged as a negative result indicating no detection), and the type of amplification target detected is determined according to the color (different fluorescently labeled primers correspond to different types of amplification targets).

[0119] (2) Real-time detection method

[0120] A. Template preparation: Nucleic acid samples are collected and stored, and target template solutions are prepared according to the type of nucleic acid sample, such as RNA, cDNA, or dsDNA. Specific sample processing methods that can be employed include direct extraction with a sample release agent, RNA or DNA magnetic bead extraction, RNA or DNA silica gel centrifugal column extraction, and reverse transcription of RNA samples to cDNA. Experimental operations can be performed using either a manual or automated platform, depending on the sample processing needs at different throughput levels.

[0121] B. Preparation of amplification reaction solution: The specificity primer set and probe are synthesized by the method described above to prepare the loop-mediated amplification detection kit. The kit may contain either liquid reagents or solid reagents, or both. The solid reagents are produced by process methods including freeze-drying and air-drying, and their form includes multiple types such as spherical, square, thin film, irregular, granular, powder, or amorphous. The solution is diluted or redissolved in a solution according to a predetermined volume and concentration, and mixed with the target template solution to form an amplification reaction solution, or the template solution is added directly and redissolved to form an amplification reaction solution of a predetermined volume and concentration. The above amplification reaction solution preparation process can be performed using a manual platform or an automated platform.

[0122] C. Real-time detection program settings: Different real-time detection programs are set depending on the type of sample to be detected. RNA samples may have separate reverse transcription programs set, or the reaction temperature may be increased to combine loop-mediated amplification programs and single-step programs. Typically, the reverse transcription program temperature is constant within the range of 40-65°C and lasts for 2-20 minutes, and the loop-mediated amplification program temperature is constant within the range of 60-68°C and lasts for 10-40 minutes. During this time, multiple fluorescence signal reading points may be set (the number can be adjusted according to the demands of time and kit performance, and usually 5-40 times considering the limitations of the real-time signal processing algorithm), the reading temperature is constant within the range of 20-68°C (this temperature ensures pairing of the nucleotide-length fluorescence probe with the modified primer to form a double-stranded probe for fluorescence quenching and labels the consumption of the modified primer in loop-mediated amplification), and the reading time is greater than or equal to the minimum time inherent to the equipment. The setting of the fluorescence signal detection channels is the same as in conventional multi-channel real-time fluorescence PCR programs, supported by the software and hardware of the real-time detection equipment. A detection channel corresponding to the fluorescence probe wavelength for each sample to be detected in the amplified reaction solution is selected, and 1 to 4 channels are selected from, for example, FAM, HEX(VIC), ROX, and CY5 to perform real-time signal acquisition.

[0123] D. On-board amplification: The amplification reaction solution is heated in-situ and detected in real time, or transferred to equipment or apparatus with constant temperature incubation and real-time detection capabilities to execute a real-time detection program. This includes, but is not limited to, real-time fluorescence PCR instruments, various miniaturized nucleic acid detection devices, and self-developed fluorescence detection platforms, such as ThermoFisher ABI 7500, Shanghai Hongshi SLAN-96S, Hangzhou Bori QuantGene 9600, and MGI GenCase. An amplification reaction solution containing a sufficient amount of template will generate sufficient loop-mediated amplification under appropriate temperature conditions (usually a constant temperature within the range of 60-68°C), while an amplification reaction solution containing less than the detection limit of template will not generate loop-mediated amplification with a certain probability. For the same reaction, the template content shows a positive correlation with the probability of amplification occurring. The time required to complete amplification varies depending on the type and quantity of template, the performance of the primer set and probe, and the performance of the software and hardware of the equipment running the real-time detection program, ranging from 5 to 90 minutes. Simultaneously with signal collection, real-time detection signal data is recorded or stored.

[0124] E. Real-time signal processing: This involves processing real-time detection signal data recorded based on equipment or device-attached software, which may be a real-time signal algorithm created by the inventor. Processing this data allows for the calculation and completion of the amplification result determination, and parameters of interest regarding the amplification reaction are obtained. This step may be performed after step D is completed, or it may be performed synchronously with step D.

[0125] In some cases, since the modified primers are typically internal or loop primers with large input volumes, the changes in their consumption are relatively large, resulting in relatively significant differences in the generated fluorescence signals and a relatively high signal-to-noise ratio. Furthermore, since the 5' end of the modified primers is entirely modified with a quencher group, the input volume of the paired fluorescent probe modified at the 3' end can be relatively reduced, and the working concentration can be adjusted together with the modified primers according to the input volume ratio of different target primer sets, resulting in less interference with the amplification system. In addition, during the amplification process, the fluorescent probe can separate from the modified primer and form a free ssDNA probe depending on the difference between the actual reaction temperature and the probe's semi-melting temperature, thus not interfering with amplification efficiency and detection performance without causing competition or inhibition to normal primer amplification. Moreover, once the target DNA is amplified, the internal or loop primers are specifically incorporated into the amplicon by the polymerase action of strand displacement activity, thus ensuring the specificity of the detection method. When it is necessary to detect multiple target DNAs, differentiation can be achieved by modifying at least one internal primer or loop primer for each of the corresponding targets, labeling them complementaryly with fluorescent probes, and labeling the different emission wavelengths of the fluorescent groups. This enables multiple detection in the same reaction. Furthermore, the detection method of this invention simultaneously satisfies two technical means: endpoint detection and real-time detection, enabling rapid nucleic acid detection applications in different scenarios.

[0126] The means of this disclosure will be interpreted in combination with the following examples. Those skilled in the art will understand that the following examples are used solely to illustrate this disclosure and should not be considered to limit the scope of this disclosure. Where no specific technique or conditions are shown in the examples, they should be carried out in accordance with the techniques or conditions described in the art literature or in accordance with the product specifications. Where the manufacturer of the reagents or equipment used is not indicated, they are conventional products available on the market.

[0127] Example 1: Testing the optimal reading temperature of a real-time detection means. In this embodiment, in order to obtain an optimal representation of real-time detection means performance, it is necessary to make trade-offs in both the signal-to-noise ratio of the fluorescence signal and the time required for amplification. Depending on the degree of the difference between the amplification reaction temperature and the reading temperature, it is necessary to prefer a reading temperature that has an optimal signal-to-noise ratio, and in order to minimize the heating and cooling time due to the temperature difference, it is necessary to optimize the real-time detection program to reduce the number of signal readings or to reduce the difference between the amplification reaction temperature and the reading temperature as much as possible. The kit performs optimization tests for the semi-melting temperature of the double-stranded probe and simultaneously tests the signal-to-noise ratio under different reading temperature conditions, thereby obtaining the most rational primer set and probe sequence design means.

[0128] After completing the primer set and probe sequence design and synthesis, the optimal reading temperature and corresponding signal-to-noise ratio of the double-stranded probe can be tested. The test platform is the Shanghai Hongshi SLAN-96S real-time fluorescence PCR instrument. Depending on the working concentration of 25 μL of amplification reaction solution, the synthesized Vibrio flius toxR gene-modified primers and FAM-modified fluorescent probes, and the SARS-CoV-19 N gene-modified primers and HEX-modified fluorescent probes are tested individually. Test array: toxR-BIP-Q:BHQ1-TCACCCGGATCTCACGTCGTCGGTGTGCATTCCACCATA toxR-BIPc-P:ATCCGGGTGA-FAM N-BIP-Q:BHQ1-TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG N-BIPc-P:GAAGTTGTAGCA-HEX The amounts of modified primer and modified fluorescent probe added were 1.6 μM and 1 μM, respectively.

[0129] The test temperature program is divided into four groups: Group 1 involves annealing at 20°C and dissolving at 75°C; Group 2 involves annealing at 35°C and dissolving at 65°C; Group 3 involves annealing at 40°C and dissolving at 65°C; and Group 4 involves annealing at 45°C and dissolving at 65°C. Each group is repeated three times, and the fluorescence signal intensity during annealing and dissolution of each tube is recorded. ToxR and N in each group are tested three times each.

[0130] As can be seen from the test results (Figure 7), the difference in annealing signal intensity is not large at 20°C, 35°C, and 40°C, indicating that the reading temperature does not significantly affect the signal-to-noise ratio within this temperature range. At the same time, the difference in dissolution signal intensity is not large at 65°C and 75°C, and there is a difference of more than 10 times compared to the annealing signal, indicating that the amplification reaction can be carried out within this temperature range, without being affected by interference from the double-stranded probe, and that positive results are significantly amplified compared to negative result signals. Furthermore, at 45°C, the annealing signal changes significantly, increasing from approximately 750 to approximately 1150, and the signal-to-noise ratio decreases, so the reading temperature should not be set in this range. Therefore, considering the signal-to-noise ratio of the fluorescence signal and the time required for amplification, the optimal reading temperature and amplification temperature can be set to 40°C and 65°C.

[0131] Example 2: Single and multiple detection of the novel coronavirus

[0132] In this embodiment, in order to verify the feasibility of the above-described double-stranded probe loop-mediated amplification single and multiple detection techniques, this embodiment employs a real-time detection method, independently designs primer sets and fluorescent probe sequences, labels the internal primers of the SARS-CoV-2 ORF gene, N gene, and human-derived GAPDH gene using fluorescent probes with different fluorescence wavelengths, and prepares an MGI self-study loop-mediated amplification system to perform single-channel and multi-channel real-time detection on a test sample. The total volume of the detection system is 30 μL, including 12 μL of test sample template. The primer sets and probe sequences included in the kit developed for SARS-CoV-2 detection are as follows.

[0133] The primer composition used in this embodiment has a uniquely designed sequence and was synthesized by Bioengineering Bioengineering Co., Ltd. ORF: Two sequences of outer primers: Upstream primer F(F3): TGTAGTTGTGATCAACTCCG, Downstream primer R(B3):TCTTGGAAGCGACAACAA; Two sequences of internal primers (including one modified primer): Upstream primer F (FIP): BHQ1-CTGCACTTACACCGCAAACCCGAACCCATGCTTCAGTC, Downstream primer R(BIP):CGGCACAGGCACTAGTACTGCAAAACCAGCTACTTTATCATTGT; Two sequences of loop primers: Upstream primer F(LF):CGTTTAAAAACGATTGTGCATCAGC, Downstream primer R(LB):ATGTCGTATACAGGGCTTTTGACA; N: Two sequences of outer primers: Upstream primer F(F3):TCATATGGGTTGCAACTGA, Downstream primer R(B3):TTGCGACTACGTGATGAG; Two sequences of internal primers (including one modified primer): Upstream primer F (FIP): TTGCAGCATTGTTAGCAGGATTGGGAGCCTTGAATACACC, Downstream primer R(BIP): BHQ1-TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG; Two sequences of loop primers: Upstream primer F(LF): CGGGTGCCAATGTGATCTTTT, Downstream primer R(LB):ATTGCCAAAAGGCTTCTACGC; GAPDH: Two sequences of outer primers: Upstream primer F(F3):ATGTTCGTCATGGGTGTG, Downstream primer R(B3):ATCCACAGTCTTCTGGGT; Two sequences of internal primers (including one modified primer): Upstream primer F (FIP): BHQ2-TAAGCAGTTGGTGGTGCAGGAACCATGAGAAGTATGACAACA, Downstream primer R(BIP):CCTGGCCAAGGTCATCCATGTGGACTGTGGTCATGAGT; Two sequences of loop primers: Upstream primer F(LF): AGGCATTGCTGATGATCTTGAG, Downstream primer R(LB):ACAACTTTGGTATCGTGGAAGG.

[0134] The fluorescent probes used in this embodiment have a uniquely designed sequence and were synthesized by Bioengineering Biotechnology Co., Ltd. Different fluorescent probes correspond to different modified primers as described above, and their sequences are as follows. One sequence of ORF fluorescent probes: GTGTAGTGCAG-FAM One sequence of N fluorescent probes: GAAGTTGTAGCA-HEX One sequence of GAPDH fluorescent probes: ACCAACTGCTTA-ROX

[0135] The amplification reaction solution was prepared according to the proportions shown in the table below. Single-strength detection: [Table 1]

[0136] Multiple detection: [Table 2]

[0137] The prepared amplified reaction solution is transferred to the test platform and the real-time detection program is activated. The test platform is a Shanghai Hongshi SLAN-96S real-time fluorescence PCR instrument. The detection program involves amplification at 65°C for 60 minutes, during which 20-30 fluorescence signal reading points are set and read once every 2-3 minutes, with the reading temperature set to 40°C. The detection channels are set to the ORF gene detection FAM channel, the N gene detection HEX channel, and the GAPDH gene detection ROX channel. Multiple detection channels are set to combinations of the above channels.

[0138] The single-strength real-time detection results for ORF and N genes are shown in Figure 8, the double real-time detection results for ORF and N genes and the triple real-time detection results for ORF, N, and GAPDH genes are shown in Figure 9, and the single-strength endpoint detection results for ORF, N, and GAPDH genes are shown in Figure 10. The excitation light source is a portable ultraviolet light source, and positive and negative results can be determined according to the intensity and color of the dark-field fluorescence light.

[0139] Example 3: Comparative Verification of Loop-Mediated Amplification Real-Time Detection and Endpoint Detection Based on Dual-Channel Double-Stranded Fluorescent Probes

[0140] In this embodiment, in order to verify the consistency between the real-time detection technique and the endpoint detection technique, this embodiment prepares an MGI self-developed double-stranded probe system and performs single-channel detection on nucleic acid templates containing multiple different concentrations. The total volume of the detection system is 30 microliters, and it contains 12 microliters of template. The detection system contains two different fluorescence wavelength probes modified with FAM and ROX, respectively. The amplification vessel is a 96-well PCR plate containing 10 positive controls with a total of 5 different conditions (2 types of FAM-modified fluorescent probes O-Q2 and O-Q1, and 3 types of ROX-modified fluorescent probes YN-N3, YN, and N3, each with 2 repeats), 10 negative controls with a total of 5 different conditions (2 types of FAM-modified fluorescent probes O-Q2 and O-Q1, and 3 types of ROX-modified fluorescent probes YN-N3, YN, and N3, each with 2 repeats), and 76 test samples of low-concentration nucleic acid templates with a total of 5 different conditions (2 types of FAM-modified fluorescent probes O-Q2 and O-Q1, and 3 types of ROX-modified fluorescent probes YN-N3, YN, and N3, each with 8 repeats and each with 20 repeats). The sample concentration of the storage solution before extraction of the test samples is 500 copies / ml. The real-time signal acquisition equipment was a Hangzhou Bori FQD-96A. The equipment's client software, Gene-9660, was run, and the acquisition program was set to 25 time points, divided into three stages: pre-acquisition, reverse transcription, and isothermal amplification. Two-channel fluorescence signals, FAM and ROX, were acquired. The temperature during signal acquisition was set to 30°C, and the temperature during reverse transcription and isothermal amplification was set to 65°C. Clicking "Start Execution" initiated the acquisition program. After waiting a short time for the acquisition program to complete 25 acquisition operations and acquire all amplified real-time signal data, the client software Gene-9660 automatically and synchronously drew the amplified real-time signal curve shown in Figure 11.

[0141] According to the accompanying software, a table of TTP value data for the well position distribution of each reaction tube in each 96-well PCR plate can be calculated, which is shown in Table 3. [Table 3]

[0142] Endpoint detection technology means: The 96-well plate, after real-time detection is completed, is transferred to a self-constructed visual detection platform, where an ultraviolet excitation light source is placed, and fluorescence excitation and imaging can be performed on the entire 96-well plate. The captured dark-field and light-field fluorescence images are shown in Figure 12.

[0143] Comparing the thermal or grayscale distributions in Figure 12 and Table 3, it can be determined that there is a correspondence between the results. This indicates that the results of the real-time detection technique and the endpoint detection technique for loop-mediated amplification based on a dual-channel double-stranded fluorescent probe are consistent.

[0144] Example 4: Specific detection amplification product using a double-stranded probe doped with loc nucleic acid

[0145] This embodiment uses microviral nucleic acids for amplification. A double-stranded probe is used for product detection. The fluorescent or quenching strand of the double-stranded probe is modified to increase the Tm value of the double-stranded probe, such as with loc nucleic acid or MGB. This gives the double-stranded probe a more stable double-stranded structure when forming complementary pairs, significantly improving stability in the LAMP reaction process. Amplification and detection can be performed simultaneously at higher temperatures, resulting in higher reaction specificity. Furthermore, this method reduces the temperature difference required for amplification and detection, lowering the requirements for the overall reaction process equipment hardware, thus making it widely applicable to immediate, on-site diagnostics and other similar scenarios. 1) The DNA templates used are shown below. (SEQ ID NO:22). 2) Primers used: F3:ACTGGAACCGTGGAGTAC B3:CTCTCCTGGCTCTCTTTG FIP:CTTTGTGAGTAACGCCAAGTTGGCCAGATACGCCTATTGCA BIP:GGTCCGAAATAGAGGCAGACCCTTAATCCAAGTCGTCTCGA LF:TTGATTGTTGATTTGCAGTTTC LBQ (downstream loop primer containing a quencher group): BHQ1-TGAGAG / iXNA_C / / iXNA_C / AT / iXNA_C / TTTACTTCTGAAC LBP (complementary probe at the 5' end of a downstream loop primer containing a fluorescent group): GTAAAGATGGCTCTCA-FAM / iXNA_C / indicates that a lock nucleic acid modification is performed on base C.

[0146] 3) The reaction system consisted of 0.15 μL Bst polymerase, 3 μL 10× Isothermal Buffer (isothermal amplification buffer), 1.8 μL MgCl2, 1.3 μL dNTPs, 0.06 μL F3 / B3, 0.48 μL FIP / BIP, 0.24 μL LF / LBQ, and 0.12 μL LBP, which were added to 15 μL of nucleic acid template. After homogenization by vibration, the reaction was carried out in a real-time fluorescence quantitative PCR system at 60-65°C for 45 minutes.

[0147] 4) Reaction results After forming a double-stranded probe, LBQ and LBP exhibit good stability, and their Tm value can reach above 60°C, which is close to the optimal temperature for amplification. In negative samples, the primer and template do not bind, and there is no amplification in the reaction system, so LBQ and LBP maintain their binding, and no increase in fluorescence signal occurs. In positive samples, the primer binds to the template and is amplified by the action of Bst polymerase. At this time, LBQ and LBP are released by the chain displacement activity of Bst polymerase as their products are elongated, separating the fluorescent group and quencher group, which increases the fluorescence signal.

[0148] Although embodiments of the present invention have been shown and described above, these embodiments are illustrative and should not be understood as limiting the present invention. Those skilled in the art can modify, alter, substitute, or change the above embodiments within the scope of the present invention.

Claims

1. A primer composition, A first primer set comprising an upstream primer and a downstream primer, and at least one modified primer having a labeled fluorescent group or a quencher group at its 5' end, The probe comprises a probe suitable for complementary pairing with the 5' end of the modified primer and having a quencher group or a fluorescent group at its 3' end, A primer composition characterized in that the quencher group is suitable for quenching the fluorescent group.

2. The primer composition according to claim 1, characterized in that the modified primer has a quencher group at its 5' end and the probe has a fluorescent group at its 3' end.

3. The primer composition according to claim 1, characterized in that the modification is selected from at least one of the first three nucleotides at the 5' or 3' end.

4. The primer composition according to claim 1, characterized in that the probe is single-stranded DNA.

5. The upstream primer in the first primer set has the nucleotide sequence shown in SEQ ID NO: 1 to 3. The primer composition according to claim 1, characterized in that the downstream primer in the first primer set has the nucleotide sequence shown in SEQ ID NO: 4 to 6.

6. The primer composition according to claim 1, further comprising a second primer set including an upstream primer and a downstream primer.

7. The upstream primer in the second primer set has the nucleotide sequence shown in SEQ ID NO: 7-9, The primer composition according to claim 6, characterized in that the downstream primer in the second primer set has the nucleotide sequence shown in SEQ ID NO: 10 to 12.

8. The primer composition according to claim 1, further comprising a third primer set including an upstream primer and a downstream primer.

9. The primer composition according to claim 8, characterized in that the third primer set includes at least one modified primer, the modified primer having a quencher group at its 5' end.

10. The upstream primer in the third primer set has the nucleotide sequence shown in SEQ ID NO: 13-15, The primer composition according to claim 8, characterized in that the downstream primer in the third primer set has the nucleotide sequence shown in SEQ ID NO: 16 to 18.

11. The quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ650, Dabcyl, DBQ1, TAMRA, and Eclipse. The primer composition according to claim 1, characterized in that the fluorescent group is selected from at least one of FAM, HEX, ROX, and CY5Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar 570, Quasar 670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye 650, and IR Dye 750.

12. The primer composition according to claim 1, characterized in that the length of the probe is selected from 5 to 20 bp.

13. The primer composition according to claim 12, characterized in that the probe has a nucleotide sequence shown in SEQ ID NO: 19 to 21.

14. At least one sequence in the modified primer comprises at least one special nucleotide or modifying group. At least one of the probes may be optionally comprised of at least one of the special nucleotides or modifying groups. Preferably, the special nucleotide comprises at least one selected from loc nucleic acid, peptide nucleic acid, ribonucleotide and deoxyinosine. Preferably, the primer composition according to claim 1, 6, or 7, characterized in that the modifying group comprises at least one selected from a phosphate group, a methyl group, and a glycosyl group.

15. It's a kit, A kit characterized by comprising the primer composition described in any one of claims 1 to 14.

16. The kit according to claim 15, further comprising at least one selected from strand-displacement DNA polymerase, reverse transcriptase, ribonuclease inhibitor, uracil-DNA glycosylase, dNTP, dUTP, pyrophosphatase, proofreading enzyme, protective agent, reducing agent, and filler.

17. The aforementioned strand-substituted DNA polymerase does not possess 3'→5' exonuclease activity. Preferably, the strand substitution DNA polymerase comprises at least one selected from Bst 3.0 DNA polymerase, Bst 2.0 WarmStart® DNA polymerase, Bst 2.0 HotStart DNA polymerase, Bst II Pro DNA polymerase, and HotStart Bst 4.2 DNA polymerase. The reverse transcriptase optionally comprises at least one selected from WarmStart® RTx reverse transcriptase, Hifair® III reverse transcriptase, and ThermoStable V reverse transcriptase. The kit according to claim 16, characterized in that the uracil-DNA glycosylase optionally comprises at least one selected from Antarctic-derived heat-sensitive uracil-DNA glycosylase and temperature-sensitive uracil-DNA glycosylase.

18. The proofreading enzyme has 3'→5' exonuclease activity, Preferably, the proofreading enzyme comprises at least one selected from Pfu DNA polymerase, Q5U DNA polymerase, Q6U DNA polymerase, and KOD DNA polymerase, as described in claim 16.

19. The protective agent comprises at least one selected from bovine serum albumin, casein, trehalose, pullulan, sucrose, maltose, glycine, proline, sodium azide, and thimerosal. Preferably, the protective agent is bovine serum albumin. The reducing agent optionally comprises at least one selected from dithiothreitol, β-mercaptoethanol, and glutathione. The kit according to claim 16, characterized in that the filler optionally comprises at least one selected from polyethylene glycol, polysucrose, and dextran.

20. The kit according to claim 15, further comprising at least one selected from an enzyme buffer and a surfactant.

21. A method for detecting nucleic acid amplification products, The steps include: using a nucleic acid sample to be detected as a template, and amplifying the reaction using the primer composition described in any one of claims 1 to 14 or the kit described in any one of claims 15 to 20; A method for detecting nucleic acid amplification products, characterized by comprising the step of detecting the amplification product as a signal.

22. The amplification reaction includes at least one selected from loop-mediated amplification, recombinant enzyme polymerase amplification, cross-primer amplification, helicase-dependent amplification, and Rolling loop amplification. Preferably, the method according to 21, characterized in that the amplification reaction is loop-mediated amplification.

23. The amplification reaction is carried out in the amplification reaction system, and the concentration of the strand-substituted DNA polymerase in the amplification reaction system is 0.1 to 0.8 U / μL. Preferably, the concentration of the strand-substituted DNA polymerase in the amplification reaction system is 0.2 to 0.6 U / μL. The method according to 21, more preferably characterized in that the concentration of the strand-substituted DNA polymerase in the amplification reaction system is 0.3 to 0.5 U / μL.

24. The amplification reaction is carried out in the amplification reaction system, and the concentration of reverse transcriptase in the amplification reaction system is 0.2 to 2 U / μL. Preferably, the method according to 21, characterized in that the concentration of the reverse transcriptase in the amplification reaction system is 0.4 to 1.6 U / μL.

25. The amplification reaction is carried out in the amplification reaction system, and the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.2 to 1.2 U / μL. Preferably, the method according to 21, characterized in that the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.5 to 0.9 U / μL.

26. The amplification reaction is carried out in the amplification reaction system, and the concentration of uracil-DNA glycosylase in the amplification reaction system is 0.01 to 0.1 U / μL. Preferably, the method according to 21, characterized in that the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.02 to 0.05 U / μL.

27. The amplification reaction is carried out in an amplification reaction system, and in the amplification reaction system, the molar ratio of dUTP to dTTP is 0:10 to 10:

0. Preferably, the method according to 21, characterized in that the molar ratio of dUTP to dTTP is 2:8 to 8:

2.

28. The amplification reaction is carried out in the amplification reaction system, and the concentration of the proofreading enzyme in the amplification reaction system is 0.001 to 0.1 U / μL. Preferably, the method according to 21, characterized in that the concentration of the proofreading enzyme in the amplification reaction system is 0.005 to 0.05 U / μL.

29. The amplification reaction is carried out in the amplification reaction system, and the concentration of bovine serum albumin in the amplification reaction system is 0.1 to 25 μg / μL. Preferably, the method according to 21, characterized in that the concentration of bovine serum albumin in the amplification reaction system is 0.5 to 15 μg / μL.

30. The process further includes a step of annealing the primer composition before the amplification reaction, the annealing reaction being carried out at 20 to 45°C. The annealing reaction may be carried out at 40°C, as optional. The amplification reaction may be carried out under conditions of 60-68°C, at any discretion. Preferably, the method according to 21, characterized in that the amplification reaction is carried out under conditions of 65°C.

31. The method according to 21, characterized in that the amplification reaction is carried out in an amplification reaction system, and in the amplification reaction system, the molar ratio of the modified primer to the probe is 1:1.2 to 1:1.5.

Images