Compositions and methods for inhibiting PD-L1 expression

Abstract

The present invention provides compositions and methods that can be used to reduce the expression of the PD-L1 gene and treat PD-L1-related diseases and conditions. The present invention provides PD-L1 dsRNA agents, PD-L1 antisense polynucleotide agents, compositions comprising PD-L1 dsRNA agents, and compositions comprising PD-L1 antisense polynucleotide agents that can be used to reduce PD-L1 expression in cells and subjects.

Description

[Technical Field]

[0001] The present invention relates to compositions and methods that can be used to inhibit the expression of the programmed cell death ligand 1 (PD-L1) gene. [Background technology]

[0002] Programmed cell death ligand 1 or programmed cell death ligand 1 (PD-L1), also known as B7 homolog 1 (B7-H1), is a type 1 transmembrane protein with a length of 272 amino acids, present as a surface marker on many different cell types, and is encoded by the CD274 gene on mouse chromosome 19 and human chromosome 9. Those skilled in the art should understand that the terms PD-L1 and CD274 are nominally interchangeable when considering nucleic acids (DNA or RNA) or their corresponding translated proteins or sequences. PD-L1 is the primary ligand for PD-1 and can inhibit T cell cytotoxicity and cytokine production. CD274 / PD-L1 expression has been detected in a variety of tissues and cell types, including T cells, B cells, macrophages, dendritic cells, and non-hematopoietic cells (including endothelial cells, hepatocytes, muscle cells, and placenta). CD274 / PD-L1 expression is associated with the inhibition of antitumor immune activity. Cancer cells such as HCC cells utilize this immune checkpoint by upregulating PD-L1 expression, causing proximal T cell antitumor immune dysfunction. Studies correlating PD-L1 expression in tumors or hematological malignancies with disease outcomes have shown that PD-L1 expression is closely associated with poor prognosis in all types of lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic cell carcinoma, head cancer, kidney cancer, pancreatic cancer, and cervical cancer.

[0003] CD274 / PD-L1 expression is also associated with immune responses to avoid chronic infections such as viruses (e.g., HIV, HBV, HCV, and HTLV), bacteria (e.g., Helicobacter pylori), and parasites (e.g., Schistosomiasis mansoni).

[0004] Accordingly, the present invention provides a novel RNAi agent for reducing CD274 / PD-L1 levels and for treating CD274 / PD-L1-related diseases, symptoms and conditions such as chronic intracellular infections, viral diseases such as hepatitis, or bacterial infections such as tuberculosis, as well as cancer or hematological malignancies. [Overview of the project]

[0005] Overall, this disclosure introduces novel PD-L1 gene-specific RNAi agents, compositions comprising PD-L1 RNAi agents, and methods for inhibiting PD-L1 gene expression in vitro and / or in vivo using the PD-L1 RNAi agents and compositions comprising PD-L1 RNAi agents described herein. The PD-L1 RNAi agents described herein can selectively and effectively reduce, inhibit, or silence PD-L1 gene expression in subjects (e.g., human or animal subjects).

[0006] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent that inhibits PD-L1 expression is provided, wherein the dsRNA agent comprises one sense strand and one antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 or 3 by only 1, 2, or 3 or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 or 4 by only 1, 2, or 3 or fewer nucleotides, wherein the sense strand may be partially, basically, or completely complementary to the antisense strand.

[0007] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to the PD-L1 RNA transcript, and the complementary region comprises at least 15 consecutive nucleotides that differ by only 1, 2, or 3 or fewer nucleotides from any one antisense sequence listed in any one of Tables 1 to 3.

[0008] In some embodiments, the dsRNA agent comprises one sense strand and one antisense strand, wherein nucleotide positions 2-18 of the antisense strand comprises a region complementary to the PD-L1 RNA transcript, and the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in any one of Tables 1-3, and optionally comprises a target ligand.

[0009] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising nucleotides 64-94, 67-97, 71-101, 72-102, 73-103, 71-103, 498-528, 552-582, 553-583, 707-737, and 713-743 in the nucleotide sequence shown in SEQ ID NO: 1. The sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from any one of the sequences, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of Sequence ID No. 2, of which the sense strand may be partially, basically, or completely complementary to the antisense strand.

[0010] In several embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression is provided, wherein the sense strand comprises nucleotides 69-89, 71-89, 72-92, 74-92, 76-96, 78-96, 77-97, 79-97, 78-98, 80-98, 76-98, 72-98, 503-523, 505-523, 557-577, 559-577, 558-578, 560-5 The antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 78, 712-732, 714-732, 718-738, or 720-738, and the antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0011] In some embodiments, the PD-L1 RNA transcript is Sequence ID No. 1.

[0012] In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to any one target region of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one target region of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. In some embodiments, the dsRNA agent includes a sequence listed as a double-stranded sequence in any one of Tables 1-3.

[0013] In some embodiments, the dsRNA agent contains at least one modified nucleotide. In some embodiments, all or essentially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, reverse 2'-Ome nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotides containing a 5'-phosphorothioate group, or nucleotides containing a cholesterol derivative or a terminal nucleotide linked to a dodecanoic acid bisdecaneamide group, 2'-amino-modified nucleotide, phosphoramidite, or a non-natural base.

[0014] In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

[0015] In some embodiments, the dsRNA agent includes at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand includes at least one phosphorothioate nucleotide linkage. In some embodiments, the antisense strand includes at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages.

[0016] In some embodiments, all or essentially all nucleotides in the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, of which fewer than 6 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand contains 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which fewer than 4 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand contains 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which at least 14 modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 2, 5, 7, 11, 12, 14, 16 and / or 18, when counted from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 16, when counted from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 18 when counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides.In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16 when counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16 when counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides each at positions 2, 5, 12, 14, and 16 when counted from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides each at positions 2, 5, 12, 14, and 18 when counted from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably, of which at least 18 modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 9, 11 and / or 13 when counted from the first matching position at the 3' end of the sense strand are 2'-fluoronucleotides. In some embodiments, at least 18 modified nucleotides in the sense strand are 2'-O-methylnucleotides, and the nucleotides at positions 8, 11 and / or 13 when counted from the first matching position at the 3' end of the sense strand are 2'-fluoronucleotides. In some embodiments, the modified sense strand sequence is a modified sense strand sequence shown in one of Tables 2-3. In some embodiments, the modified antisense strand sequence is a modified antisense strand sequence shown in one of Tables 2-3.

[0017] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. In some embodiments, one or more target groups or binding groups are conjugated to a sense strand. In some embodiments, the target group or binding group comprises N-acetylgalactosamine (GalNAc).

[0018] In some embodiments, the target group includes the following structure. [ka] Each n'' is independently selected from 1 or 2.

[0019] In some embodiments, the target group has the following structure: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0020] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand.

[0021] In some embodiments, the antisense chain contains one reverse debase residue at its 3' end.

[0022] In some embodiments, the sense strand contains one or two reverse debasing residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense strand contains one reverse debasing residue. In some embodiments, each end of the sense strand contains one imann residue. In some embodiments, one or more reverse debasing residues or one or more imann residues are bonded to any one or two ends of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further bonded to any one end of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further bonded to the 5' end of the sense strand by a phosphorothioate bond. In some embodiments, the 5' end of the sense strand contains one reverse debasing residue or imann residue, of which the reverse debasing residue or imann residue is ligated via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In some embodiments, the sense chain further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense chain, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and optionally the target group is N-acetylgalactosamine (GalNAc).

[0023] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least two strands contain a 3' overhang of at least one nucleotide.

[0024] In some embodiments, the modified sense strand has a modification mode shown in any one of Tables 2-3. In some embodiments, the modified antisense strand has a modification mode shown in any one of Tables 2-3. In some embodiments, the modified sense strand is a modified sense strand sequence shown in any one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence shown in any one of Tables 2-3.

[0025] In some embodiments, the dsRNA contains a duplex selected from AV01002, AV00947, AV00948, AV00949, AV00950, AV00969, AV01004, AV00974, AV00981, AV01012, wherein the duplex optionally contains a target ligand. In some embodiments, the dsRNA contains a duplex selected from the group consisting of AD00883, AD01053, AD01053-1, AD00884, AD00884-1, AD00885, AD00885-1, AD01054, AD01055, AD01055-1, AD00887, AD00888, AD00889, AD01066, AD01066-1, AD01067, AD01067-1.

[0026] According to another aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression, wherein the dsRNA agent contains one sense strand and one antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to some PD-L1 RNA transcripts, wherein the length of each strand is about 15 to about 30 nucleotides, and wherein the sequence contained in the antisense strand may be represented by formula (I). 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′N1 N' N2 N' L N' L N' L N' L N' L (N' L ) m′ -3′ (I) Eventually, Each N' F represents a 2'-fluoromodified nucleotide, and each N' N1 and N' N2 This independently indicates modified or unmodified nucleotides, and each N' L The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m' and n' are each independently integers from 0 to 7.

[0027] In some embodiments, N' N1 and N' N2 It contains only one 2'-fluoromodified nucleotide.

[0028] In some embodiments, N' N1 This independently represents a 2'-fluoromodified nucleotide.

[0029] In some embodiments, N' N2 This independently represents a 2'-fluoromodified nucleotide.

[0030] In some embodiments, m' is 2 and n' is 4, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2.

[0031] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one reverse debase residue. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one imann residue. In some embodiments, the sense strand includes two reverse debasing residues at the 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably GLS-15*. In some embodiments, the sense strand includes two imann residues at the 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably GLS-15*. In some embodiments, the sense strand includes one reverse debasing residue or imann residue at the 5' end, of which the reverse debasing residue or imann residue is linked via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In some embodiments, the sense chain further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense chain, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and optionally the target group is N-acetylgalactosamine (GalNAc).

[0032] According to another aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression is provided, wherein the dsRNA agent comprises one sense strand and one antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to the PD-L1 RNA transcript, each strand having a length of approximately 18 to 30 nucleotides, and the sequence contained in the antisense strand may be represented by formula (II). 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′ (II) Of these, each N F represents a 2'-fluoromodified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 and N M6 Each N independently represents a modified or unmodified nucleotide. L The symbol represents modified or unmodified nucleotides independently, but does not represent 2'-fluoromodified nucleotides, and n is an integer from 0 to 7.

[0033] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2'-fluoromodified nucleotides.

[0034] In some embodiments, N M2, N M3 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0035] In some embodiments, N M2 , N M4 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0036] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide.

[0037] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0038] In some embodiments, N M2 , N M4 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0039] In some embodiments, N M1 , N M3 and N M6 Each of these independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0040] In some embodiments, N M2 , N M3 and N M6 Each of these independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0041] In some embodiments, N M2 , N M4 and N M6each independently represents a 2'-fluoro modified nucleotide, and N M5 represents an UNA modified nucleotide.

[0042] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0043] According to another aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression, wherein the dsRNA agent comprises one sense strand and one antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the PD-L1 RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides, and wherein the dsRNA duplex may be represented by formula (III). Sense strand: 5'-(N' L ) n’ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​N L N L N F N L -5' (III) Eventually, Each chain is approximately 18 to 30 nucleotides long. each N F and N' F This independently represents a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N' N1 and N' N2 Each represents a modified or unmodified nucleotide independently, and each N L and N' L The terms represent modified or unmodified nucleotides independently, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7.

[0044] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2'-fluoromodified nucleotides, and N' N1 and N' N2 It contains only one 2'-fluoromodified nucleotide.

[0045] In some embodiments, m' is 2 and n' is 4, m' is 2 and n' is 6, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0046] In some embodiments, N'N1 This independently represents a 2'-fluoromodified nucleotide.

[0047] In some embodiments, N' N2 This independently represents a 2'-fluoromodified nucleotide.

[0048] In some embodiments, N M2 , N M3 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0049] In some embodiments, N M2 , N M4 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0050] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide.

[0051] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0052] In some embodiments, N M2 , N M4 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0053] In some embodiments, N M1 , N M3 and N M6 Each of these independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0054] In some embodiments, N M2 , N M3 and NM6 Each of these independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0055] In some embodiments, N M2 , N M4 and N M6 Each of these independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0056] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one reverse debase residue. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one imann residue. In some embodiments, the sense strand contains two reverse debase residues at the 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably GLS-15*. In some embodiments, the sense strand contains two imann residues at the 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably GLS-15*. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least two strands contain a 3' overhang of at least one nucleotide. In some embodiments, one or more reverse debase residues or one or more imann residues are bound to any one or two ends of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further bound to any one end of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further attached to the 5' end of the sense chain by a phosphorothioate bond.In some embodiments, the 5' end of the sense strand includes one reverse debasing residue or imann residue, of which the reverse debasing residue or imann residue is ligated via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In some embodiments, the sense strand further includes a target group ligated to the reverse debasing residue or imann residue at the 5' end of the sense strand, of which the target group is ligated via a phosphorothioate bond to an adjacent reverse debasing residue or imann residue, and optionally the target group is N-acetylgalactosamine (GalNAc). In some embodiments of the dsRNA agent, the region partially complementary to the PD-L1 mRNA transcript includes at least 15, 16, 17, 18, or 19 consecutive nucleotides, where these nucleotides differ from the complementary sequence of any one of the target regions of the PD-L1 mRNA transcript by 0, 1, 2, or 3 or fewer nucleotides. In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to any one target region of SEQ ID NO: 1, and is provided in any one of Tables 1 to 3. In some embodiments of the above dsRNA agent, the PD-L1 mRNA transcript is SEQ ID NO: 1.

[0057] In some embodiments, any one of the sense chains in Table 1 may be further modified in the mode shown by formula (I) or (III) above.

[0058] In some embodiments, any one of the antisense chains in Table 1 may be further modified in the mode shown by formula (II) or (III) above.

[0059] In some embodiments, any one of the double strands in Table 1 may be further modified in the mode shown by formula (III) above.

[0060] According to one aspect of the present invention, a composition is provided that includes any embodiment relating to the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous (IV) administration.

[0061] According to another aspect of the present invention, cells are provided, comprising any embodiment relating to the above-mentioned embodiment of the dsRNA agent of the present invention. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0062] Another aspect of the present invention provides a method for inhibiting PD-L1 gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention. In some embodiments, the method further comprises (ii) inhibiting PD-L1 gene expression in cells by maintaining the produced cells for a time sufficient to obtain degradation of the mRNA transcript of the PD-L1 gene. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered to the subject by intravenous injection. In some embodiments, the method further comprises evaluating inhibition of the PD-L1 gene after administering a dsRNA agent to a subject, the evaluation method comprising (i) determining one or more physiological features of the subject's PD-L1-related disease or condition, and (ii) comparing the determined physiological features with baseline physiological features of the PD-L1-related disease or condition prior to treatment and / or control physiological features of the PD-L1-related disease or condition, the comparison indicating the presence or absence of one or more inhibitions of PD-L1 gene expression in the subject. In some embodiments, the physiological features are one or more PD-L1 mRNA levels (by liver biopsy), PD-L1 protein levels, decreased PD-L1 expression (which can also be indirectly evaluated by measuring a decrease in PD-L1 biological activity), or other pathologies associated with elevated PD-L1 levels (preferably in the blood or liver), or other therapeutic methods requiring inhibition of PD-L1 expression. A reduction in one or more PD-L1 mRNA levels or PD-L1 protein levels can be measured using methods commonly used by those skilled in the art (e.g., Northern blotting, qRT-PCR), and PD-L1 protein levels can be determined by methods commonly used by those skilled in the art (e.g., Western blotting, immunological techniques). A reduction in PD-L1 expression can also be indirectly assessed by measuring a decrease in PD-L1 biological activity or by measuring PD-L1 levels in a test sample (e.g., serum sample).

[0063] Another aspect of the present invention provides a method for inhibiting PD-L1 gene expression in a subject, the method comprising administering to the subject an effective amount of an embodiment of the dsRNA agent or an embodiment of the composition of the present invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject by intravenous injection. In some embodiments, the method further comprises evaluating the inhibition of the PD-L1 gene after administration of the dsRNA agent, the evaluation method comprising (i) determining one or more physiological characteristics of a PD-L1-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline physiological characteristics of a PD-L1-related disease or condition before treatment and / or control physiological characteristics of a PD-L1-related disease or condition, the comparison indicating one or more of the presence or absence of inhibition of PD-L1 gene expression in the subject. In some embodiments, PD-L1 gene expression can be assessed by measuring the level or change in level of any variable related to PD-L1 gene expression (e.g., PD-L1 mRNA level or PD-L1 protein level) using methods commonly used by those skilled in the art (e.g., Northern blotting, qRT-PCR), and PD-L1 protein levels can be determined by using methods commonly used by those skilled in the art (e.g., Western blotting, immunological techniques). Reduction in PD-L1 expression can also be indirectly assessed by measuring a decrease in PD-L1 biological activity or by measuring PD-L1 levels in a test sample (e.g., serum sample).

[0064] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of the PD-L1 protein, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention to inhibit PD-L1 gene expression. In some embodiments, the disease, condition or condition associated with PD-L1 is selected from tumors or hematological malignancies (e.g., lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic epithelial carcinoma, head cancer, kidney cancer, pancreatic cancer and cervical cancer), infections (e.g., viral, bacterial, fungal or parasitic infections). In some embodiments, the infection is a chronic infection caused by, for example, viruses (e.g., HIV, HBV, HCV and HTLV), bacteria (e.g., Helicobacter pylori), and parasites (e.g., Schistosomiasis mansoni).

[0065] In some embodiments, the effectiveness of an infectious disease treatment can be demonstrated, for example, by a reduction in the abundance of the infectious agent, which is demonstrated by the inability to culture the pathogen from the subject sample. The effectiveness of an infectious disease treatment can be demonstrated by a reduction in the abundance of the infectious agent, which can be demonstrated by a reduction in the amount of proteins, nucleic acids, or carbohydrates present in the infectious agent. The effectiveness of a treatment can be demonstrated, for example, by the presence of an immune response, which can be demonstrated by the presence of antibodies or immune cells against the infectious agent. The effectiveness of an infectious disease treatment can be demonstrated by a reduction in the presence of the infectious agent, which can be demonstrated by a reduction in one or more symptoms or signs of the infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss). The specific symptoms or signs depend on the specific pathogen. In some embodiments, the effectiveness of the method of the present invention in treating HBV infection is monitored by evaluating the combination of serological markers described below. The therapeutic effect on HBV subjects can be monitored by detecting the levels of hepatitis B antigen (HBsAg) HBeAg or HB cccDNA in the subject's serum to indicate effective treatment of the disease. The therapeutic effect can also be determined by detecting the level of anti-HBsAg antibodies in the subject.

[0066] In some embodiments, the effectiveness of the method of the present invention in cancer treatment can be monitored by evaluating the maintenance, preferably reduction, or prevention of metastasis of the primary or metastatic tumor in the subject. Methods for detecting and monitoring tumor volume are known in the art. The therapeutic effect can also be determined by detecting an increase in PD-L1 or a decrease in the severity, signs, symptoms, or markers of such disease or condition in patients with PD-L1-responsive tumors.

[0067] In some embodiments, a reduction in PD-L1 expression can also be indirectly assessed by measuring or observing a change (preferably a clinically relevant change) in at least one sign or symptom of PD-L1-related disease. The effectiveness of treatment or prevention of disease can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain reduction, quality of life, the dose of medication required to maintain the therapeutic effect, levels of disease markers, or any other measurable parameters appropriate to the specific disease being treated or prevented. Those skilled in the art can fully monitor the effectiveness of treatment or prevention by measuring any one or any combination of these parameters. For example, the therapeutic effect of a disease (e.g., an infection, a viral disease such as hepatitis, or cancer) can be enhanced by enhancing the immune response. Clinically appropriate methods may result in beneficial effects for at least a statistically significant portion of patients, such as improvement of symptoms, cure, disease reduction, extended lifespan, improved quality of life, or other effects generally considered positive by physicians familiar with the treatment of PD-L1-related disease, such as those provided in the HBV diagnostic criteria provided herein.

[0068] In some embodiments, the method further includes administering a different treatment regimen to the subject. In some embodiments, the different treatment regimen includes the treatment of PD-L1-related diseases or conditions. In some embodiments, the different treatment regimen includes administering one or more PD-L1 antisense polynucleotides of the present invention to the subject, administering a non-PD-L1 dsRNA therapeutic agent to the subject, and inducing behavioral changes in the subject. In some embodiments, the different cancer therapeutic agent is selected from the group consisting of surgery, radiotherapy, chemotherapy, targeted therapy, immunotherapy, or hormone therapy. In some embodiments, the chemotherapy compound is alemtuzumab, altretamine, azacitidine, bendamustine, bleomycin, bortezomib, busulfan, cabazitaxel, capecitabine, carboplatin, carmofur, carmustine, chlorambucil, chlormethine, cisplatin, cladribine, clofarabine, cyclophorexate. Cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, decitabine, denosumab, docetaxel, doxorubicin, epirubicin, estramustine, etoposide, everolimus, floxuridine, fludarabine, fluorouracil, formostatin, gemcitabine,Gemtuzumab, hydroxycarbamide, ibritumomab, idarubicin, ifosfamide, irinotecan, ixabepilone, lomustine, melphalan, mecaptopurine, methotrexate, mitomycin, mitoxantrone, nedaplatin, nelarabine, ofatumumab, oxaliplatin, paclitaxel, pemetrexed, pe This includes, but is not limited to, pentostatin, pertuzumab, procarbazine, raltitrexed, streptozotocin, tegafur, temozolomide, temsirolimus, teniposide, tioguanine, topotecan, tositumomab, valrubicin, vinblastine, vincristine, vindesine, vinflunine, or vinorelbine, or any combination thereof. In some embodiments, the targeted therapy includes, but is not limited to, protein kinase inhibitors, checkpoint inhibitors, or VEGF inhibitors. Protein kinase inhibitors are small molecules, compounds, polysaccharides, lipids, peptides, polypeptides, proteins, antibodies, nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, nucleic acids, or oligonucleotides. In some embodiments, the protein kinase inhibitor is:acalabrutinib, adavosertib, afatinib, alectinib, axitinib, binimetinib, bosutinib, brigatinib, cediranib, ceritinib, cetuximab, cobimetinib, crizotinib, caboza Cabozantinib, dacomitinib, dasatinib, entrectinib, erdafitinib, erlotinib, fostamatinib, gefitinib, ibrutinib, imatinib, lapatinib, lenvatinib, restaurtinib ib), lortatinib, masitinib, momerotinib, mubritinib, neratinib, nilotinib, nintedanib, olmutinib, osimertinib, pacritinib, panitumumab, pazopanib, pegaptanib, pona Ponatinib, radotinib, regorafenib, rociletinib, ruxolitinib, selumetinib, semaxanib, sorafenib, sunitinib, SU6656, tivozanib, toceranib, trametinib, trastuzumab,This includes, but is not limited to, vandetanib or vemurafenib, or any combination thereof. In some embodiments, the checkpoint inhibitor is a small molecule, compound, polysaccharide, lipid, peptide, polypeptide, protein, antibody, nucleoside, nucleoside analog, nucleotide, nucleotide analog, nucleic acid, or oligonucleotide. In some embodiments, the immune checkpoint is a PD-1 / PD-L1 checkpoint. In some embodiments, the PD-1 checkpoint includes, but is not limited to, nivolumab, pembrolizumab, spartalizumab, cemiplimab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224 or AMP-514, or any combination thereof. In some embodiments, the PD-L1 checkpoint inhibitor includes, but is not limited to, atezolizumab, avelumab, durvalumab, KN035, AUNP12, CA-170 or BMS-986189, or any combination thereof. In some embodiments, the immune checkpoint is the CTLA-4 checkpoint. In some embodiments, the CTLA-4 checkpoint inhibitor includes, but is not limited to, ipilimumab or tremilimumab, or any combination thereof. In some embodiments, VEGF is a small molecule, compound, polysaccharide, lipid, peptide, polypeptide, protein, antibody, nucleoside, nucleoside analog, nucleotide, nucleotide analog, nucleic acid, or oligonucleotide. In some embodiments, the VEGF inhibitor is aflibercept, axitinib, bevacizumab, brivanib,This includes, but is not limited to, cabozantinib, cediranib, lenvatinib, linifumib, nintedanib, pazopanib, ponatinib, ramucirumab, regorafenib, semaxanib, sorafenib, sunitinib, tivozanib, toceranib, or vandetanib, or any combination thereof. In some embodiments, additional therapeutic agents selected from the group consisting of antiviral agents refer to pharmaceutical compositions administered to treat a viral infection. In some embodiments, viral infections include adenovirus, Ebola virus, coronavirus, Epstein-Barr virus (EBV), Friend virus, hantavirus, hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus, human immunodeficiency virus (HIV), human metapneumovirus, human papillomavirus (HPV), influenza virus, Japanese encephalitis virus, Kaposi's sarcoma-associated herpesvirus, lymphocytic choriomeningitis virus, parainfluenza virus, rabies virus, and respiratory syncytial virus (RSV). It is caused by viruses such as rhinovirus and varicella zoster virus. In some embodiments,Antiviral agents are small molecules, compounds, polysaccharides, lipids, peptides, polypeptides, proteins, antibodies, nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, nucleic acids, or oligonucleotides. In some embodiments, the antiviral agent is an interferon, a capsid assembly modifier, a sequence-specific oligonucleotide, an entry inhibitor, or a small molecule immunomodulator. In some embodiments, In this context, antiviral drugs include AB-423, AB-506, ABI-H2158, ABI-H0731, acyclovir, adapromine, adefovir, alafenamide, amantadine, asunaprevir, and baloxavir marboxil. Marboxil, beclabuvir, boceprevir, brivudine, cidofovir, ciluprevir, clevudine, cytarabine, daclatasvir, danoprevir, dasabuvir, deleobuvir, adefovir pivoxil, edoxudine, elbasvir, entecavir (entecavir), faldaprevir, famciclovir, favipiravir, filibuvir, fomivirsen, foscamet, galidesivir, ganciclovir, glecaprevir, GLS4, grazoprevir, idoxuridine, imiquimod, IFN-a, interferon alpha2b, JNJ-440, JNJ-6379, lamivudine, laninamivir, ledipasvir, mericitabine, methisazone, MK-608, moroxydine, narlaprevir, NITD008, NZ-4, odalasvir, ombitasvir, oseltamivir, paritaprevir, pegylated interferon α-2a, penciclovir, peramivir, pibrentasvir, baloxavir, pleconaril, podophyllotoxin ), presatovir, radalbuvir, ravidasvir, remdesivir, REP2139, REP2165, resiquimod, RG7907, ribavirin, rifampicin, rimantadine, ruzasvir, samatasvir (samatasvir), setrobuvir, simeprevir, sofosbuvir, sorivudine, sovaprevir, taribavirin, telaprevir, telbivudine, tenofovir, tenofovir disoproxil, triazavirin, trifluridineThis includes, but is not limited to, uridine, tromantadine, umifenovir, uprifosbuvir, valacyclovir, valgancicovir, vaniprevir, vedroprevir, velpatasvir, vidarabine, voxilaprevir, or zanamivir, or any combination thereof.

[0069] In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered intravenously to the subject. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0070] In some embodiments, a method for determining the therapeutic effect on a subject includes (i) determining one or more physiological characteristics of a PD-L1-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the PD-L1-related disease or condition, the comparison of which indicates one or more of the presence, absence, and level of effectiveness of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0071] In some embodiments, PD-L1 gene expression can be assessed based on the level or change in level of any variable in the subject related to PD-L1 gene expression (e.g., PD-L1 mRNA level, PD-L1 protein level). A decrease in PD-L1 expression can be indirectly assessed by measuring a decrease in PD-L1 bioactivity or PD-L1 level in a subject sample (e.g., serum sample), by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection, by assessing the immune response by antibodies or immune cells against the source of infection, by assessing the reduction of signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring the levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, or by detecting the subject's anti-HBsAg antibody level.

[0072] Another aspect of the present invention provides a method for reducing the level of PD-L1 protein in a subject compared to a pre-treatment baseline level of PD-L1 protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent or any embodiment of the composition of the present invention to reduce the level of PD-L1 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection.

[0073] Another aspect of the present invention provides a method for altering the physiological characteristics of a PD-L1-related disease or disorder in a subject compared to baseline physiological characteristics of the subject before treatment, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent or any embodiment of the composition of the present invention to alter the physiological characteristics of the PD-L1-related disease or disorder in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection. In some embodiments, physiological characteristics and symptoms are one or more of a decrease in the subject's PD-L1 mRNA level, PD-L1 protein level, or PD-L1 expression, and are assessed indirectly by measuring a decrease in PD-L1 bioactivity or PD-L1 level in a subject sample (e.g., serum sample), by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection, by assessing the immune response by antibodies or immune cells against the source of infection, by assessing the reduction of signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring the levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, or by detecting the subject's anti-HBsAg antibody level.

[0074] Another aspect of the present invention provides a method of using the above-mentioned dsRNA agent to treat a disease or condition associated with the presence of the PD-L1 protein. In some embodiments, the disease or condition is one or more of the following: tumors or hematological malignancies (e.g., lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic epithelial carcinoma, head cancer, kidney cancer, pancreatic cancer, and cervical cancer), infections (e.g., viral, bacterial, fungal, or parasitic infections). In some embodiments, the infection is a chronic infection caused by, for example, viruses (e.g., HIV, HBV, HCV, and HTLV), bacteria (e.g., Helicobacter pylori), and parasites (e.g., Schistosomiasis mansoni).

[0075] According to another aspect of the present invention, an antisense polynucleotide agent for inhibiting PD-L1 protein expression is provided, the agent comprising 10 to 30 consecutive nucleotides, of which at least one consecutive nucleotide is a modified nucleotide, and the nucleotide sequence of the agent is approximately 80% complementary in its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one of the target regions of SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1 to 3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1 to 3.

[0076] According to another aspect of the present invention, a composition comprising any embodiment of the above-described antisense polynucleotide agent is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating PD-L1-related diseases or conditions. In some embodiments, the composition is packaged in reagent kits, containers, packaging, dispensers, pre-filled syringes or vials. In some embodiments, the composition is prepared for use in subcutaneous or intravenous administration.

[0077] According to another aspect of the present invention, cells comprising any of the above-described embodiments of antisense polynucleotide agents are provided. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0078] Another aspect of the present invention provides a method for inhibiting PD-L1 gene expression in cells, the method comprising (i) producing cells containing an effective amount of any of the above antisense polynucleotides. In some embodiments, the method further comprises (ii) inhibiting PD-L1 gene expression in cells by maintaining the cells produced in (i) for a time sufficient to obtain degradation of the mRNA transcript of the PD-L1 gene.

[0079] Another aspect of the present invention provides a method for inhibiting PD-L1 gene expression in a subject, the method comprising administering an effective amount of any embodiment of the antisense polynucleotide agent to the subject.

[0080] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of the PD-L1 protein, the method comprising administering to a subject an effective amount of any of the above embodiments of the antisense polynucleotide agent or any of the above embodiments of the composition of the present invention in order to inhibit PD-L1 gene expression. In some embodiments, the disease or condition is one or more of the following: tumors or hematological malignancies (e.g., lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic epithelial carcinoma, head cancer, kidney cancer, pancreatic cancer and cervical cancer), infections (e.g., viral, bacterial, fungal or parasitic infections). In some embodiments, the infection is a chronic infection caused by, for example, viruses (e.g., HIV, HBV, HCV and HTLV), bacteria (e.g., Helicobacter pylori and others) and parasites (e.g., Schistosomiasis mansoni).

[0081] Another aspect of the present invention provides a method for reducing the level of PD-L1 protein in a subject compared to a baseline level of PD-L1 protein in the subject's body before treatment, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide agent or any embodiment of the composition of the present invention to reduce the level of PD-L1 gene expression. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or intravenously.

[0082] According to another aspect of the present invention, an antisense polynucleotide agent for inhibiting PD-L1 gene expression is provided, wherein the agent comprises 10 to 30 consecutive nucleotides, of which at least one consecutive nucleotide is a modified nucleotide, and the nucleotide sequence of the agent is approximately 80% or approximately 85% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 in its entire length.

[0083] Another aspect of the present invention provides a method for altering the physiological characteristics of a PD-L1-related disease or disorder in a subject compared to baseline physiological characteristics of the subject before treatment, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide agent or any embodiment of the composition of the present invention to alter the physiological characteristics of the PD-L1 disease or disorder in the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject by subcutaneous or intravenous injection. In some embodiments, physiological characteristics and symptoms are one or more of a decrease in the subject's PD-L1 mRNA level, PD-L1 protein level, or PD-L1 expression, and are assessed indirectly by measuring a decrease in PD-L1 bioactivity or PD-L1 level in a subject sample (e.g., serum sample), by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection, by assessing the immune response by antibodies or immune cells against the source of infection, by assessing the reduction of signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring the levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, or by detecting the subject's anti-HBsAg antibody level.

[0084] A brief explanation of arrays Sequence IDs 1 and 2 (reverse complementary) are from modern human CD274 / PD-L1 transcription variant 1, mRNA [NCBI reference sequence: NM_014143.4].

[0085] Sequence IDs 3 and 4 (reverse complementary) are Mus musculus (house mouse) PD-L1 mRNA [NCBI reference sequence: NM_021893.3].

[0086] Sequence IDs 5-168 are shown in Table 1, and all are sense strand sequences.

[0087] Sequence IDs 169-332 are shown in Table 1 and are antisense strand sequences.

[0088] Sequence IDs 333-496 are shown in Table 2 and are chemically modified sequences.

[0089] Sequence IDs 497-602 are shown in Table 3, and the delivery molecule is indicated as "GLX-__" at the 3' or 5' end of each sense chain. [Modes for carrying out the invention]

[0090] The present invention comprises RNAi agents capable of inhibiting PD-L1 gene expression, such as double-stranded (ds) RNAi agents, but is not limited thereto. The present invention further comprises compositions comprising PD-L1 RNAi agents and methods of using the above compositions. The PD-L1 RNAi agents disclosed herein can be attached to a delivery compound so as to be delivered to cells, including hepatocytes. The pharmaceutical compositions of the present invention may comprise at least one dsRNA PD-L1 agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a delivery compound containing GalNAc. The PD-L1 RNAi agent delivered to cells can reduce the activity of the PD-L1 protein product of the gene in the cells by inhibiting PD-L1 gene expression. The dsRNAi agents of the present invention can be used to treat PD-L1-related diseases and conditions.

[0091] In some embodiments of the present invention, PD-L1 expression in cells or subjects is reduced to treat diseases or conditions associated with PD-L1 expression in cells or subjects. Non-limiting examples of diseases and conditions that can be treated by reducing PD-L1 activity include the alleviation or improvement of one or more symptoms associated with undesirable or excessive PD-L1 expression (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), reduction of tumor burden in primary or metastatic tumors, or prevention of metastasis. "Treatment" may also mean extending survival compared to the expected survival time without treatment.

[0092] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, the terms “ribonucleotide” or “nucleotide” should be understood to refer to modified nucleotides (described in more detail below) or alternative substitutions. It will be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other parts without significantly altering the base-pairing properties of oligonucleotides containing such substitutions. For example, a nucleotide containing inosine as a base can pair with a nucleotide base containing adenine, cytosine, or uracil, but is not limited to these. Therefore, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine may be substituted with, for example, a nucleotide containing inosine. Sequences containing such substitutions are examples of the present invention.

[0093] As used herein, “CD274” and “programmed cell death ligand 1” are interchangeable terms with “B7 homolog 1 (B7-H1)” and “programmed cell death ligand 1,” respectively, or unless otherwise specified, “PD-L1” refers to the naturally occurring gene encoding the PD-L1 protein from any vertebrate or mammal, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs. The term further refers to fragments and variants of natural PD-L1 that retain at least one in vivo or in vitro activity of natural PD-L1. The amino acid and complete coding sequences of the human PD-L1 gene reference sequence can be found, for example, in GenBank Ref Seq Accession No. NM_014143.4 (SEQ ID NO. 1 and SEQ ID NO. 2) and Mus musculus (house mouse) NM_021893.3 (SEQ ID NO. 3 and SEQ ID NO. 4). More examples of PD-L1 mRNA sequences can be readily obtained using publicly available databases (e.g., GenBank, UniProt, Ensembl, and OMIM).

[0094] The following describes how compositions comprising PD-L1 single-stranded (ssRNA) and dsRNA agents can be manufactured and used to inhibit PD-L1 gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by PD-L1 gene expression. The term "RNAi" is also known in this field, and may also be called "siRNA."

[0095] As used herein, the term “RNAi” includes RNA and refers to agents that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As known in the art, an RNAi target region refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including product mRNA in the RNA processing of primary transcripts. The target portion of the sequence is at least long enough to be used as a substrate for RNAi-induced cleavage of or near that portion. The length of the target sequence may be 8–30 nucleotides (inclusive), 10–30 nucleotides (inclusive), 12–25 nucleotides (inclusive), 15–23 nucleotides (inclusive), 16–23 nucleotides (inclusive), or 18–23 nucleotides (inclusive), including all relatively short lengths within each of the above ranges. In some embodiments of the present invention, the length of the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the length of the target sequence is 9 to 26 nucleotides (including both endpoints), encompassing all subranges and integers in between. For example, but not intended to be limiting, in some embodiments of the present invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and the sequence is completely or at least fundamentally complementary to at least a portion of the RNA transcript of the PD-L1 gene. Some aspects of the present invention include a pharmaceutical composition comprising one or more PD-L1 dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the present invention, PD-L1 RNAi, as described herein, inhibits the expression of the PD-L1 protein.

[0096] As used herein, “dsRNA agent” refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can sequence-specifically degrade or inhibit the translation of a messenger RNA (mRNA) transcript of a target mRNA. Without intending to limit ourselves to any particular theory, the dsRNA agents of the present invention may function by an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Methods used for gene silencing in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188], the disclosures of which are incorporated herein by reference in their entirety. Gene silencing procedures known in the art can be used in combination with the disclosures provided herein to inhibit PD-L1 expression.

[0097] The dsRNA agents disclosed herein consist of one sense strand and one antisense strand, and include, but are not limited to, short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. In the art, dsRNA double-stranded structures of different lengths can be used to inhibit target gene expression. For example, dsRNA double-stranded structures having 19, 20, 21, 22, and 23 base pairs are known to be able to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. In some embodiments, the lengths of the sense strand and antisense strand are homologous or different. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 25 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the length of each strand is 21 nucleotides or less. In some embodiments, the length of the sense strand and antisense strand of the RNAi agent may be 15 to 49 nucleotides each. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense strand and the antisense strand length is 21 nucleotides.In some embodiments, the sense strand is complementary or essentially complementary to the antisense strand, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The PD-L1 dsRNA in some embodiments of the present invention may include at least one strand having a length of at least 21 nt, or it may have a relatively short double-stranded body based on one of the sequences listed in any one of Tables 1 to 3, which may be effective when 1, 2, 3, or 4 nucleotides are reduced at one or both ends compared to the dsRNAs listed in Tables 1 to 3. In some embodiments of the present invention, the PD-L1 dsRNA agents may have a sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and their ability to inhibit PD-L1 gene expression differs by only 5%, 10%, 15%, 20%, 25%, or 30% or less compared to the inhibition level of dsRNA containing the complete sequence. The sense sequences, antisense sequences, and double-stranded bodies disclosed in Tables 1-3 may be referred to herein as “parent” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, substituted, etc., as described herein, and the resulting sequences retain the effectiveness of all or at least part of the parent sequence in the methods and compositions of the present invention. The sense strands and antisense strands contained in the dsRNA of the present invention are independently selected. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of the other elements. For example, though not intended to be limiting, when producing the dsRNA of the present invention, two strands of "elements" may be selected so as to be contained within a double strand.One selected element, i.e., the sense sequence, may be sequence number 334 (shown in Table 2), while another selected element, i.e., the antisense sequence, may be sequence number 416, or sequence number 416 that is modified, shortened, extended, and / or contains one, two, or three substitutions compared to its parent sequence, sequence number 416. It should be understood that the double strands of the present invention do not necessarily have to contain the paired sense and antisense sequences in the double strands shown in Tables 1-3 simultaneously. The sequence numbers are appended immediately after each sense strand sequence and antisense strand sequence in the tables.

[0098] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or single-stranded RNA administered to a subject. For example, the antisense strands listed in any one of Tables 1 to 3 may be a composition, or a composition administered to a subject to reduce PD-L1 polypeptide activity and / or PD-L1 gene expression in the subject's body. Table 1 shows the core extension nucleotide sequences of the antisense and sense strands of a certain PD-L1 dsRNA agent. A single-stranded antisense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded antisense agent” or “antisense polynucleotide agent.” A single-stranded sense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded sense agent” or “sense polynucleotide agent.” The term “nucleotide sequence” is used herein to refer to a polynucleotide sequence that is not chemically modified or delivered by a delivery compound. For example, the sense strand CCAUUCCAGAAAGAUGAGGAA (SEQ ID NO: 6) shown in Table 1 is the nucleotide sequence of SEQ ID NO: 334 in Table 2 and the nucleotide sequence of SEQ ID NO: 497 in Table 3, and among them, SEQ ID NO: 334 and SEQ ID NO: 497, as well as their chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be labeled with "sense strand SS#", a single-stranded antisense sequence may be labeled with "antisense strand AS#", and a double-stranded molecule containing the sense strand and antisense strand may be labeled with "double-stranded molecule AD# / AV#".

[0099] Table 1 includes a sense strand and an antisense strand, and provides the label numbers for the double-stranded sequences formed by the sense strand and antisense strand in the same row of Table 1. In some embodiments of the present invention, the antisense sequence includes a nucleic acid base u or a at position 1 of the antisense sequence. In some embodiments of the present invention, the antisense sequence includes a nucleic acid base u located at position 1 of the antisense sequence. As used herein, the term “matching position” in the sense strand and antisense strand is a position that “pairs” in each strand when the two strands are double-stranded. For example, in a sense strand of 21 nucleic acid bases and an antisense strand of 21 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 21 of the antisense strand are in a “matching position”. In yet another non-limiting example, in a sense strand of 23 nucleic acid bases and an antisense strand of 23 nucleic acid bases, the nucleic acid base 2 of the sense strand and position 22 of the antisense strand are in a matching position. In yet another non-limiting example, in an 18-base sense strand and an 18-base antisense strand, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 18 of the antisense strand are in matching positions, and nucleic acid base 4 in the sense strand and nucleic acid base 15 in the antisense strand are in matching positions. A person skilled in the art will understand how to identify, or become, matching positions in the sense strands and antisense strands of a double-stranded and paired strand.

[0100] The first column in Table 1 indicates the double-stranded AV / AD# containing the sense and antisense sequences in the row of the same table. For example, Table 1 discloses a double-stranded AV00938.um containing the sense strand's SEQ ID NO: 6 and the antisense strand's SEQ ID NO: 170. Thus, each row in Table 1 labels a double-stranded of the present invention, each double-stranded containing the sense and antisense sequences shown in the same row, and the assignment identifier for each double-stranded is shown in the first column of the row.

[0101] In some embodiments of the method of the present invention, an RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body, which contains at least one nucleotide sequence listed in Table 1 and includes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, the RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is attached to a delivery molecule, a non-limiting example of which is a delivery molecule containing a GalNAc compound or a GLS-15* compound.

[0102] Table 1: Antisense and sense strand sequences of unmodified PD-L1 RNAi agents. All sequences are shown in the 5'-3' direction. Double-stranded AV / AD# is the number assigned to the double strand of two strands in the same row in the table. Table 1 [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16

[0103] Table 2 shows the antisense and sense strand sequences of a certain chemically modified PD-L1 RNAi agent of the present invention. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body labeled in a row of Table 2 and includes sequence modifications in the sense strand sequence and antisense strand sequence shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as "bound to") a compound that can deliver the RNAi agent to cells and / or tissues in the subject. Non-limiting examples of deliverable compounds that can be used in some embodiments of the present invention are GalNAc-containing compounds or GLS-15*-containing compounds. In Table 2, the first column shows the double-stranded AV# of the nucleotide sequence as shown in Table 1. Table 2 discloses double-stranded AV# and further shows the chemical modifications contained in the double-stranded sense and antisense sequences. For example, Table 1 shows SEQ ID NO: 6 (sense sequence) and SEQ ID NO: 170 (antisense sequence), which together constitute the double-stranded structure of a double-stranded product and are labeled as double-stranded AV#AV00938.um. Table 2 lists double-stranded AV#AV00938, indicating that the double-stranded sequences of SEQ ID NO: 334 and SEQ ID NO: 416 contain the nucleotide sequences of SEQ ID NO: 6 and SEQ ID NO: 170, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in the third and sixth columns, respectively. In the second column of Table 2, "Sense Strand SS#" is the assigned identifier for the sense sequence (including modifications) shown in the third column of the same row. In the fifth column of Table 2, "Antisense Strand AS#" is the assigned identifier for the antisense sequence (including modifications) shown in the sixth column.

[0104] Table 2 provides the antisense and sense strand sequences of chemically modified PD-L1 RNAi agents. All sequences are shown from 5' to 3'. These sequences are used in several in vitro study studies described herein. Table 2 [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

[0105] Table 3 shows the antisense and sense strand sequences of several chemically modified PD-L1 RNAi agents of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, RNAi agents having the polynucleotide sequences shown in Table 3 are administered to subjects. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a double-stranded body labeled in the first column of the first row of Table 3, and includes sequence modifications and / or a delivery compound in the sense strand sequence and antisense strand sequence shown in the third and sixth columns of the same row of Table 3, respectively. These sequences are used in certain in vivo study described elsewhere in this specification. In some embodiments of the methods of the present invention, the sequences shown in Table 3 may be attached to (also referred to herein as "bound to") a delivery compound, a non-limiting example of which is a GalNAc-containing compound, of which the delivery compound is labeled as "GLX-n" in the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to indicate a "GLS-n*" or "GLO-n" delivery compound (where "X" may be "S" or "O"), and GLX-0 may be any "GLS-n*" or "GLO-n" delivery compound that can be attached to the 3' end of an oligonucleotide during the synthesis process. As used herein and as shown in Table 3, "GLX-n" is used to indicate that the GalNAc-containing compound attached thereto is one of the following compounds: GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each compound is provided elsewhere in this specification.Those skilled in the art can manufacture and use the dsRNA compounds of the present invention, the delivery compound attached thereto being any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-stranded AD# assigned to the double-stranded sense and antisense sequences in that row. For example, double-stranded AD#AD00880 is the double-stranded sense strand with sequence number 497 and antisense strand with sequence number 550. Each row in Table 3 provides one sense strand and one antisense strand and discloses the double-stranded sense and antisense strands shown. The "sense strand SS#" in the second column of Table 3 is the assigned identifier for the sense sequence (including modifications) shown in the third column of the same row. The "antisense strand AS#" in the fifth column of Table 3 is the assigned identifier for the antisense sequence (including modifications) shown in the sixth column. The identifiers for the specific linked GalNAc-containing "GLO-n" or "GLS-n*" compounds are shown as GLS-5*, GLS-15*, or GLX-0, and another "GLO-n" or "GLS-n*" compound may replace the compound shown as GLO-0, and the resulting compounds should be understood to be included in the examples of the methods and / or compositions of the present invention.

[0106] Table 3 provides antisense and sense strand sequences of chemically modified PD-L1 RNAi agents. All sequences are shown from 5' to 3'. These sequences are used in certain in vivo study described elsewhere in this specification. The delivery molecule used in the in vivo study is indicated as "GLO-n" or "GLS-n*" at the 3' or 5' end of each sense strand. Table 3 [Table 4-1] Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7

[0107] Table 4 Table 5-1 Table 5-2

[0108] In some embodiments of the present invention, the dsRNA (also referred to herein as the “double-stranded DNA”) is a dsRNA disclosed in one of Tables 1 to 3. Each row in Tables 1 to 3 discloses a double-stranded DNA comprising the sense strand sequence and antisense strand sequence in that row of the table. In addition to the double-stranded DNA disclosed in Tables 1 to 3, in some embodiments, the double-stranded DNA of the present invention should be understood to include a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotides from the sense and antisense sequences shown in Tables 1 to 3. Accordingly, as a non-limiting example, in some embodiments, the antisense strand in the double-stranded DNA of the present invention may be a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Sequence ID No. 169, 180, 196, 218, or 248, respectively.

[0109] It should be understood that the sense strand sequence and antisense strand sequence in the double-stranded DNA of the present invention can be selected independently. Accordingly, the dsRNA of the present invention may include a double-stranded sense strand and antisense strand disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense strand and antisense strand in the dsRNA may include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense strand may contain one, two, three or more nucleic acid base substitutions derived from the parent sequence. In some embodiments, the above sequences may be longer or shorter than their parent sequence. Therefore, the dsRNA agents included in the present invention may, but may not necessarily, include the exact sequences of the sense strand and antisense strand pair disclosed as double-stranded DNA in Tables 1-3.

[0110] In some embodiments, the dsRNA agent comprises one sense strand and one antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the PD-L1 RNA transcript, the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprises a target ligand. In some cases, the region complementary to the PD-L1 RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides, the above consecutive nucleotides differ by 3 or fewer nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least fundamentally complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is fully complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence listed in any one of Tables 1 to 3. Some embodiments of the dsRNA agent of the present invention comprise a double helix of sense and antisense sequences disclosed in any one of Tables 1 to 3. As described herein, the sense and antisense strands in the double helix of the present invention can be selected independently.

[0111] • Mismatch It is known to those skilled in the art that mispairs, particularly in the terminal region of dsRNA, are acceptable for therapeutic effects. Certain mispairs are more resistant; for example, mispairs with fluctuating base pairs G:U and A:C are more resistant to therapeutic effects (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the PD-L1 dsRNA agent may contain one or more mispairs with the PD-L1 target sequence. In some embodiments, the PD-L1 dsRNA agent of the present invention does not contain mispairs. In some embodiments, the PD-L1 dsRNA agent of the present invention contains one or fewer mispairs. In some embodiments, the PD-L1 dsRNA agent of the present invention contains two or fewer mispairs. In some embodiments, the PD-L1 dsRNA agent of the present invention contains three or fewer mispairs. In some embodiments of the present invention, the antisense strand of the PD-L1 dsRNA agent contains a mispair with a PD-L1 target sequence that is not centrally located in the complementary region. In some embodiments, the antisense strand of the PD-L1 dsRNA agent contains one, two, three, four or more mispairs located in the last 5, 4, 3, 2, or 1 nucleotide of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether a PD-L1 dsRNA agent that mispairs with a PD-L1 target sequence effectively inhibits the expression of the PD-L1 gene.

[0112] Complementarity As used herein, unless otherwise specified, the term “complementary” means, when used to describe a first nucleotide sequence (e.g., the sense strand of a PD-L1 dsRNA agent or a target PD-L1 mRNA) to a second nucleotide sequence (e.g., the antisense strand of a PD-L1 dsRNA agent or a single-stranded antisense polynucleotide), the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence [forming interbase-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)] and to form a double-stranded or double-helical structure under specific conditions. Other conditions, such as physiologically relevant conditions that may occur in vivo, may also be applicable. Those skilled in the art can determine the optimal set of conditions for testing the complementarity of the two sequences from the final application of the hybridized nucleotides. The complementary sequence includes Watson-Crick base pairs or non-Watson-Crick base pairs, and includes natural or modified nucleotides or nucleotide mimeographs, provided that they satisfy the above conditions regarding their hybridization ability. Sequence identity or complementarity is not related to modification.

[0113] A complementary sequence, for example in the PD-L1 dsRNA described herein, includes a base pairing between an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence, wherein the base pairing extends over the full length of one of the nucleotide sequences or over the full length of both nucleotide sequences. Such sequences may be referred to herein as “fully complementary.” In embodiments, if two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should be understood not to be mispairs for the purposes of complementarity as described herein. For example, in a PD-L1 dsRNA agent containing one oligonucleotide having a length of 19 nucleotides and another oligonucleotide having a length of 20 nucleotides, the relatively longer oligonucleotide includes a 19-nucleotide sequence that is fully complementary to the relatively shorter oligonucleotide and may still be referred to as “fully complementary” for the purposes described herein. Therefore, as used herein, “fully complementary” means that all (100%) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The sequence may include all or part of the first or second nucleotide sequence.

[0114] As used herein, the term “basically complementary” means that in a pair of nucleic acid base sequences to be hybridized, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in the sequence of the first polynucleotide hybridizes with the same number of bases in the sequence of the second polynucleotide. The term "basically complementary" can be used to refer to the first sequence in relation to the second sequence, and when these two sequences hybridize, the resulting double helix of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) contains one or more (e.g., at least 1, 2, 3, 4, or 5) mispaired base pairs, while simultaneously retaining the ability to hybridize under conditions most relevant to their final application (e.g., inhibition of PD-L1 gene expression via the RISC pathway).

[0115] The term “partially complementary” can be used herein to refer to a pair of nucleic acid base sequences to be hybridized such that at least 75% (but not all) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. In some embodiments, “partially complementary” means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequence of the second polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide.

[0116] As used herein, the terms “complementary,” “fully complementary,” “basically complementary,” and “partially complementary” refer to base pairings between the sense and antisense strands of a PD-L1 dsRNA drug, between the antisense strand of a PD-L1 dsRNA drug and the sequence of the target PD-L1 mRNA, or between a single-stranded antisense oligonucleotide and the sequence of the target PD-L1 mRNA. The term “antisense strand of a PD-L1 dsRNA agent” should be understood to refer to the same sequence as “PD-L1 antisense polynucleotide agent.”

[0117] As used herein, the terms “basically the same” or “basically identical,” when used to refer to a nucleic acid sequence, refer to a nucleic acid sequence having at least about 85% or more sequence identity compared to a reference sequence, preferably containing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of matching positions by determining the number of positions in which the same nucleic acid bases appear in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein cover nucleotide sequences that are basically identical to the nucleotide sequences disclosed herein, for example, those listed in Tables 1-3. In some embodiments, the sequences disclosed herein are identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).

[0118] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing a nucleotide chain, which is described by a sequence indicated using standard nucleotide nomenclature. As used herein, the term “double-stranded RNA” or “dsRNA” refers to an RNAi containing an RNA molecule or molecular complex having a hybridization double-stranded region, which comprises two antiparallel and basically or completely complementary nucleic acid strands having “sense” and “antisense” directions with respect to the target PD-L1 RNA. The double-stranded region may be of any length that allows for the specific degradation of the desired target PD-L1 RNA by the RISC pathway, but is generally in the length range of 9 to 30 base pairs, for example, 15 to 30 base pairs. Considering a double-stranded body between 9 and 30 base pairs, the length of the double-stranded body may be any length within that range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range therein, such as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 1 This includes, but is not limited to, base pairs of 8-23, 18-22, 18-21, 18-20, 19-30, 19-26, 19-23, 19-22, 19-21, 19-20, 20-30, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-26, 21-25, 21-24, 21-23, or 21-22. The length of PD-L1 dsRNA agents produced in cells by processing with Dicer and similar enzymes is typically within the range of 19 to 22 base pairs.One strand of the double-stranded region of the PD-L1 dsRNA agent contains a sequence that is essentially complementary to the region of the target PD-L1 RNA. The two strands forming the double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be formed from two or more individual RNA molecules. If the double-stranded region is formed from two strands of a single molecule, the molecule may have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a “hairpin ring”) between the 3' end of one strand and the 5' end of the other strand forming the double-stranded structure. In some embodiments of the present invention, the hairpin ring structure contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two strands of a PD-L1 dsRNA agent are essentially complementary and consist of single RNA molecules, these molecules do not need to be covalently bonded, but they can be. When the two strands are covalently bonded in a manner other than a hairpin ring, the linking structure is called a “linker.” The term “siRNA” is also used herein to refer to the dsRNA agents described herein.

[0119] In some embodiments of the present invention, the PD-L1 dsRNA agent may include a sense sequence and an antisense sequence that do not have unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA agent. The ends of a sequence that do not have unpaired nucleotides are called "blunt ends" and do not have nucleotide overhangs. If both ends of the dsRNA agent are blunt ends, the dsRNA is called a "blunt-ended" dsRNA. In some embodiments of the present invention, the first end of the dsRNA agent is a blunt end, in some embodiments, the second end of the dsRNA agent is a blunt end, and in some embodiments of the present invention, both ends of the PD-L1 dsRNA agent are blunt ends.

[0120] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the dsRNA agent has at least one unpaired nucleotide at the end of the strand. For example, a nucleotide overhang exists when the 3' end of one strand of the dsRNA extends from the 5' end of the other strand, or vice versa. The dsRNA may contain at least one, two, three, four, five, six or more nucleotide overhangs. The nucleotide overhang may contain or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). In some embodiments, the nucleotide overhang may be located on the sense strand of the dsRNA agent, the antisense strand of the dsRNA agent, or both ends of the dsRNA agent, and the nucleotides of the overhang may be located at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides at the overhang are substituted with phosphorothioate nucleosides.

[0121] As used herein, the terms “antisense strand” or “guide strand” refer to the strand of a PD-L1 dsRNA agent that contains a region that is essentially complementary to the PD-L1 target sequence. As used herein, the terms “sense strand” or “passenger strand” refer to the strand of a PD-L1 dsRNA agent that contains a region that is essentially complementary to the antisense strand region of the PD-L1 dsRNA agent.

[0122] ·Qualification In some embodiments of the present invention, the RNA of the PD-L1 RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the present invention can be synthesized and / or modified by methods well established in the art, for example, in "Current protocols in Nucleic Acid Chemistry," Beaucage, Slet al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in some embodiments of the PD-L1 dsRNA agent of the present invention include, for example, terminal modifications such as (a) 5'-end modifications (phosphorylation, conjugate, reverse ligation, etc.) and 3'-end modifications (conjugate, DNA nucleotide, reverse ligation, etc.), (b) base modifications such as stable bases, unstable bases, or base substitutions that base-pair with an extended partner library, bases (debased nucleotides), or binding bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and (d) main chain modifications including modifications or substitutions of phosphodiester bonds. Specific examples of RNA compounds useful in some embodiments of the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide, and PD-L1 sense polynucleotide of the present invention include, but are not limited to, RNA with a modified main chain or RNA without natural internucleoside bonds. As a non-limiting example, RNA with a modified main chain may not have a phosphorus atom in the main chain. RNA without a phosphorus atom in the internucleoside main chain may be called an oligonucleoside. In some embodiments of the present invention, the modified RNA has a phosphorus atom in its internucleoside backbone.

[0123] The terms “RNA molecule” or “RNA” or “ribonucleic acid molecule” should be understood to encompass not only RNA molecules expressed or discovered in nature, but also RNA analogs and derivatives, including one or more ribonucleotide / ribonucleoside analogs or derivatives, as described herein or known in the art. The terms “ribonucleoside” and “ribonucleotide” are interchangeable herein. RNA molecules can be modified in their nucleic acid base structure or ribose-phosphate backbone structure, for example, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double helixes. As a non-limiting example, an RNA molecule may further include at least one modified ribonucleoside, including, but not limited to, 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino nucleosides, phosphoramidates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the present invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or ribonucleosides up to the full length of the PD-L1 dsRNA drug molecule, and these ribonucleosides are modified ribonucleosides. The modifications of each of these multiple modified ribonucleosides in the RNA molecule do not necessarily have to be identical.

[0124] In some embodiments of the present invention, the dsRNA agent, PD-L1 antisense polynucleotide, and / or PD-L1 sense polynucleotide may include one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester bonds. The term “independently selected” as used herein to refer to selected elements (e.g., modified nucleotides, non-phosphodiester bonds, etc.) means that two or more selected elements may be identical to each other, but do not necessarily have to be identical.

[0125] As used herein, “nucleotide base,” “nucleotide,” or “nucleic acid base” are heterocyclic pyrimidines or purine compounds that are standard components of all nucleic acids, and include the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleic acid bases can be further modified to include (but not limited to) universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” can be used herein to refer to unmodified nucleotides, modified nucleotides, or alternative substitutional moieties. It will be recognized by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other moieties without significantly altering the base-pairing properties of oligonucleotides containing such substitutional moieties.

[0126] In one embodiment, the modified RNA considered to be used in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and enables or mediates the specific degradation of the target RNA by the RISC pathway. In some embodiments of the present invention, the PD-L1 RNA interferant comprises a single-stranded RNA that interacts with a target PD-L1 RNA sequence to direct the cleavage of the target PD-L1 RNA.

[0127] Modified RNA backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkyl phosphotryesters, methyl and other alkylphosphonates (including 3'-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (3'-aminophosphoramidates and aminoalkylphosphoramidates), thiophosphoramidates, thioalkyl phosphonates, thioalkyl phosphotryesters and borate phosphates having normal 3'-5' links, their 2'-5' linked analogs, and those with opposite polarity (where adjacent nucleoside unit pairs are linked at 3'-5'~5'-3' or 2'-5'~5'-2'). This further includes various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing conjugates are common in the art, and such methods can be used to produce some modified PD-L1 dsRNA agents, some modified PD-L1 antisense polynucleotides, and / or some modified PD-L1 sense polynucleotides of the present invention.

[0128] Modified RNA backbones that do not contain phosphorus atoms have backbones formed by short-chain alkyl or cycloalkyl nucleotide interlinks, mixed heteroatoms and alkyl or cycloalkyl nucleotide interlinks, or one or more short-chain heteroatoms or heterocyclyl nucleotide interlinks. These include backbones with morpholine links (partially formed from the sugar portion of a nucleoside), siloxane backbones, sulfides, sulfoxides and sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonates and sulfonamide backbones, amide backbones, and other backbones having components of a mixture of N, O, S and CH2. Methods for producing modified RNA backbones that do not contain phosphorus atoms are common in the art, and such methods can be used to produce some modified PD-L1 dsRNA agents, some modified PD-L1 antisense polynucleotides, and / or some modified PD-L1 sense polynucleotides of the present invention.

[0129] In some embodiments of the present invention, RNA mimetics include, but are not limited to, PD-L1 dsRNA, PD-L1 antisense polynucleotides, and / or PD-L1 sense polynucleotides, in which, for example, the sugar-nucleoside bonds (i.e., the backbone) of nucleotide units are replaced with new groups. In such embodiments, the base units are retained to hybridize with appropriate PD-L1 nucleic acid target compounds. Oligomer compounds that are RNA mimetics and have been shown to have excellent hybridization properties are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. Nucleic acid bases are retained and directly or indirectly bonded to the aza nitrogen atom of the backbone amide portion. Methods for producing RNA mimetics are commonly practiced in the art, and such methods can be used to produce some of the modified PD-L1 dsRNA agents of the present invention.

[0130] Some embodiments of the present invention include RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as a methylene group (methylimino group) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2- [of which the natural phosphodiester backbone is represented as -OPO-CH2-]. Methods for producing RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are commonly practiced in the art, and such methods can be used to produce some modified PD-L1 dsRNA agents, some PD-L1 antisense polynucleotides and / or some PD-L1 sense polynucleotides of the present invention.

[0131] The modified RNA may further contain one or more substituted sugar moieties. The PD-L1 dsRNA, PD-L1 antisense polynucleotide and / or PD-L1 sense polynucleotide of the present invention may contain at the 2' position one of OH, F, O-, S- or N-alkyl group, O-, S- or N-alkenyl group, O-, S- or N-alkynyl group, or O-alkyl-O-alkyl group, of which alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C1-C 10 Alkyl alkyl group or C2-C 10 The group may be an alkenyl group or an alkynyl group. An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n It contains CH3)2, of which n and m are 1 to 10. In other embodiments, dsRNA has C1 to C at the 2' position. 10The group comprises a lower alkyl group, a substituted lower alkyl group, an alkylaryl group, an arylalkyl group, an O-alkylaryl group or an O-aralkyl group, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, a heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleavage group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a PD-L1 dsRNA drug, or a group for improving the pharmacodynamic properties of a PD-L1 dsRNA drug, a PD-L1 antisense polynucleotide and / or a PD-L1 sense polynucleotide, and one of other substituents having similar properties. In some embodiments, the modifications include a 2'-methoxyethoxy group (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Other exemplary modifications include a 2'-dimethylaminoethoxyethoxy group, also known as 2'-DMAOE, i.e., an O(CH2)2ON(CH3)2 group, and a 2'-dimethylaminoethoxyethoxy group (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2, as described in the examples below. Methods for producing the above modified RNAs are commonly practiced in the art, and such methods can be used to produce some of the modified PD-L1 dsRNA agents of the present invention.

[0132] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications may occur at other positions on the RNA of the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide, and / or PD-L1 sense polynucleotide of the present invention, particularly on the 3' terminal nucleotide, or at the 3' position of the sugar in the PD-L1 dsRNA, PD-L1 antisense polynucleotide, or PD-L1 sense polynucleotide linked from 2' to 5', and at the 5' position of the 5' terminal nucleotide. The PD-L1 dsRNA agent, PD-L1 antisense polynucleotide, and / or PD-L1 sense polynucleotide may further have a cyclobutyl group moiety that replaces a sugar mimetic, such as pentofuranose. The above method for producing the modified RNA is a common method in the art, and such a method can be used to produce some of the modified PD-L1 dsRNA agents, PD-L1 antisense polynucleotides, and / or PD-L1 sense polynucleotides of the present invention.

[0133] In some embodiments, the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide, and / or PD-L1 sense polynucleotide may include modifications or substitutions of nucleic acid bases (usually abbreviated as “bases” in the art). “Unmodified” or “natural” nucleic acid bases as used herein include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine, and uracil. Modified nucleic acid bases include other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, the 6-methyl group and other alkyl derivatives of adenine and guanine, the 2-propyl group and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine. This includes 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino groups, 8-thiols, 8-thioalkyl groups, 8-hydroxyl groups, and other 8-substituted adenines and guanines, 5-halogens (especially 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-azaadenine, and 3-deazaguanine and 3-deazaadenine.Other nucleic acid bases included in some embodiments of the PD-L1 dsRNA drug of the present invention are known in the art; see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302; Crooke, STand Lebleu, B., Ed., CRC Press, 1993. Methods for producing dsRNA, PD-L1 antisense strand polynucleotides, and / or PD-L1 sense strand polynucleotides containing nucleic acid base modifications and / or substitutions (e.g., those described herein) are commonly practiced in the art, and such methods can be used to produce some of the modified PD-L1 dsRNA agents, PD-L1 sense polynucleotides, and / or PD-L1 antisense polynucleotides of the present invention.

[0134] Some embodiments of the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide, and / or PD-L1 sense polynucleotide of the present invention include RNA modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety that includes additional crosslinks linking the 2' and 4' carbon atoms. This structure effectively "locks" the ribose in the 3'-internal structural conformation. By adding locked nucleic acids to the PD-L1 dsRNA agents, PD-L1 antisense polynucleotides, and / or PD-L1 sense polynucleotides of the present invention, serum stability can be increased and off-target effects can be reduced (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O. R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for producing dsRNA agents, PD-L1 antisense polynucleotides, and / or PD-L1 sense polynucleotides containing locked nucleic acids are commonly practiced in the art, and such methods can be used to produce some of the modified PD-L1 dsRNA agents of the present invention.

[0135] Some embodiments of the PD-L1 dsRNA compound, sense polynucleotide and / or antisense polynucleotide of the present invention include at least one modified nucleotide, of which the at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotides containing a 5'-phosphorothioate group, or nucleotides containing cholesterol derivatives or terminal nucleotides linked to a dodecanoic acid bisdecanamide group, 2'-amino-modified nucleotides, phosphoramidates, or non-natural bases. In some embodiments, the PD-L1 dsRNA compound includes an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0136] In some embodiments of the PD-L1 dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide include at least one modified nucleotide, of which the at least one modified nucleotide includes a debased nucleotide, a ribitol, a reverse nucleotide, a reverse debased nucleotide, a reverse 2'-OMe nucleotide, and a reverse 2'-deoxynucleotide. It is known to those skilled in the art that stability can be enhanced by including a debased or reverse debased nucleotide at the oligonucleotide end (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716.doi:10.1093 / nar / gkg393). In some embodiments, the PD-L1 dsRNA compound includes one or more reverse debased residues (invab) at the 3' end or the 5' end, or at both the 3' and 5' ends. Exemplary invab residues include, but are not limited to, the following: [ka]

[0137] Some embodiments of the PD-L1 dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide, include at least one modified nucleotide, of which the at least one modified nucleotide includes isomannitol nucleotide or a stereoisomer of the isomannitol nucleotide. Specific examples of isomannitol nucleotide or a stereoisomer of the isomannitol nucleotide are: [ka] This includes, but is not limited to, the term "Olig" independently refers to each polynucleotide portion. An example is the isomannitol residue (imann), [ka] This includes, but is not limited to, the following:

[0138] In some embodiments, the isomannitol nucleotide may be conjugated to one or more target groups or delivery molecules, such as the GalNAc moiety.

[0139] Some embodiments of the PD-L1 dsRNA compound, antisense polynucleotide of the present invention include at least one modified nucleotide, of which at least one modified nucleotide includes unlocked nucleic acid nucleotide (UNA) and / or ethylene glycol nucleic acid nucleotide (GNA). UNA and GNA are thermally unstable chemical modifications and are known to those skilled in the art to significantly improve the off-target properties of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723.doi:10.1038 / s41467-018-02989-4; Laurens et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862-70).

[0140] Another modification that may be included in the RNA of some embodiments of the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide and / or PD-L1 sense polynucleotide of the present invention comprises one or more ligands, moieties, or conjugates chemically linked to the RNA, each of which enhances one or more properties of the PD-L1 dsRNA agent, PD-L1 antisense polynucleotide and / or PD-L1 sense polynucleotide. Non-limiting examples of properties that can be enhanced include the activity, cell distribution, delivery of the PD-L1 dsRNA agent, pharmacokinetic properties of the PD-L1 dsRNA agent and / or PD-L1 sense polynucleotide. In some embodiments of the present invention, the PD-L1 dsRNA agent comprises one or more target groups or binding groups, and in some embodiments of the PD-L1 dsRNA agent of the present invention, the target groups or binding groups are conjugated to the sense strand. Non-limiting examples of target groups are compounds containing N-acetylgalactosamine (GalNAc). The terms “target group,” “targeting agent,” “binding agent,” “target compound,” “delivery molecule,” “delivery compound,” and “target ligand” are interchangeable herein. In some embodiments of the present invention, the PD-L1 dsRNA agent comprises a target compound conjugated to the 5' end of the sense strand. In some embodiments of the present invention, the PD-L1 dsRNA agent comprises a target compound conjugated to the 3' end of the sense strand. In some embodiments of the present invention, the PD-L1 dsRNA agent comprises a target group containing GalNAc. In some embodiments of the present invention, the PD-L1 dsRNA agent does not contain a target compound conjugated to one or both of the 3' and 5' ends of the sense strand. In some embodiments of the present invention, the PD-L1 dsRNA agent does not contain a target compound containing GalNAc that is bound to one or both of the 5' and 3' ends of the sense strand.

[0141] Other targeting agents and binders are well known in the art, and for example, targeting agents and binders usable in some embodiments of the present invention include, for example, cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), lipid moieties such as cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-trityl mercaptan (Manoharan et al., Ann. NYAcad. Sci., 1992, 660:306-309, Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Fatty acids such as Res., 1992, 20:533-538, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118, Kabanov et al., FEBS Lett., 1990, 259:327-330, Svinarchuk et al., Biochimie, 1993, 75:49-54), dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654, Shea et al., Nucl. Acids Phospholipids such as Res., 1990, 18:3777-3783, polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol.This includes, but is not limited to, the works described in Exp.Ther., 1996, 277:923-937.

[0142] Some embodiments of compositions comprising a PD-L1 dsRNA agent, a PD-L1 antisense polynucleotide, and / or a PD-L1 sense polynucleotide may include ligands that alter the distribution, targeting, etc., of the PD-L1 dsRNA agent. In some embodiments of compositions comprising a PD-L1 dsRNA agent of the present invention, the ligands increase affinity to selected targets (e.g., molecules, cells or cell types, compartments, e.g., cell or organ compartments, tissues, organs or body regions) compared to species in which such ligands are absent. Ligands usable in the compositions and / or methods of the present invention may be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands may be synthetic polymers, such as recombinant or synthetic components of synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-coglycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, peptide-mimicking polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.

[0143] Ligands included in the compositions and / or methods of the present invention may include target groups, non-limiting examples of which are cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, or antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). Target groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetylgalactosamine, N-acetylglucosamine polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamates, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0144] Other examples of ligands include dyes, intercalators (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texafrin, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-( The compound contains oleoyl cholic acid, dimethoxytrityl chloride group or phenoxazine, and peptide conjugates (e.g., Antenna peptide, Tat peptide), alkylating agents, phosphates, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl groups, HRP, or AP.

[0145] The ligands included in the compositions and / or methods of the present invention may be proteins such as glycoproteins, peptides such as molecules having specific affinity for coligands, or antibodies such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, cardiac cells, or osteocytes). Ligands useful in the embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Ligands useful in the embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, or polyvalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention may be substances that can increase the entry of PD-L1 dsRNA agents into cells, for example, by disrupting the cytoskeleton of cells, for example, by disrupting microtubules, microfilaments, and / or intermediate filaments of cells. Non-specific examples of such drugs include Taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlaquinolide, latranculine A, phalloidin, swinford A, indanosine, and myoserbine.

[0146] In some embodiments, ligands linked to the PD-L1 dsRNA agent of the present invention are used as pharmacokinetic (PK) modifiers. Examples of PK modifiers usable in the compositions and methods of the present invention include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, bile acids, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and aptamers that bind to serum proteins. Furthermore, since oligonucleotides containing a large number of phosphorothioate bonds are known to bind to serum proteins, short oligonucleotides containing multiple phosphorothioate bonds in their backbone (e.g., oligonucleotides with about 5, 10, 15, or 20 bases) can also be used as ligands in the compositions and / or methods of the present invention.

[0147] • PD-L1 dsRNA pharmaceutical composition In some embodiments of the present invention, the PD-L1 dsRNA agent is present in the composition. The composition of the present invention may include one or more PD-L1 dsRNA agents and one or more optionally pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. According to some embodiments of the methods of the present invention, a non-limiting example of a potentially useful targeting agent is an agent that induces the PD-L1 dsRNA agent of the present invention into cells to be treated and / or enters those cells. The selection of the targeting agent depends on the nature of the PD-L1-related disease or disorder and the target cell type. In non-limiting examples, in some embodiments of the present invention, it may be desirable to induce the PD-L1 dsRNA agent into hepatocytes and / or enter hepatocytes. In some embodiments of the methods of the present invention, the therapeutic agent should be understood to include a PD-L1 dsRNA agent having only a delivery agent, without any additional elements, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, the PD-L1 dsRNA agent can be attached to a delivery compound containing GalNAc and included in a composition comprising a pharmaceutically acceptable carrier, and can be administered to cells or subjects without the attachment of any detectable labels or targeting agents.

[0148] When the PD-L1 dsRNA agent of the present invention is administered together with one or more delivery agents, targeting agents, labeling agents, etc., and / or adheres to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will be able to recognize, select, and use agents suitable for the methods of the present invention. Labeling agents can be used in some methods of the present invention to determine the location of the PD-L1 dsRNA agent in cells and tissues, and can be used to determine the location of a therapeutic composition containing the PD-L1 dsRNA agent administered in the methods of the present invention in cells, tissues, or organs. Means for linking and utilizing labeling reagents such as enzyme labeling, dyes, and radiolabeling are well known in the art. In some embodiments of the compositions and methods of the present invention, it should be understood that the labeling agent adheres to one or both of the sense polynucleotides and antisense polynucleotides contained in the PD-L1 dsRNA agent.

[0149] • Delivery of PD-L1 dsRNA drugs and PD-L1 antisense polynucleotide drugs Some embodiments of the methods of the present invention involve delivering a PD-L1 dsRNA agent to cells. As used herein, the term “delivery” means promoting or influencing cellular uptake or absorption. Absorption or uptake of the PD-L1 dsRNA agent can occur by independent diffusion or activation of cellular processes, or by the use of a delivery agent, targeting agent, etc., that can be associated with the PD-L1 dsRNA agent of the present invention. Delivery methods applicable to the methods of the present invention include, but are not limited to, in vivo delivery, in which the PD-L1 dsRNA agent is administered by injection to a tissue site or systemically. In some embodiments of the present invention, the PD-L1 dsRNA agent adheres to the delivery agent.

[0150] Non-exclusive examples of methods usable for delivering PD-L1 dsRNA agents to cells, tissues, and / or subjects include PD-L1 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have successfully delivered therapeutic RNAi agents to treat a variety of diseases and conditions in this field, including, but not limited to, liver diseases, acute intermittent porphyria (AIP), hemophilia, and pulmonary fibrosis. Details of various delivery methods can be found in the publications, namely Nikam, RR & KRGore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018, Springer AD & SFDowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118, Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874, and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, all of which are incorporated herein by reference.

[0151] Some embodiments of the present invention involve delivering the PD-L1 dsRNA agent of the present invention to cells, tissues, and / or subjects using lipid nanoparticles (LNPs). LNPs are typically used for in vivo delivery of PD-L1 dsRNA reagents, including therapeutic PD-L1 dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the PD-L1 RNA drug is greater when delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs comprise cationic LNPs on which one or more PD-L1 RNAi molecules of the present invention are supported. LNPs containing PD-L1 RNAi molecules are administered to a subject, and the LNPs and the attached PD-L1 RNAi molecules are taken up by cells via endocytosis, and their presence leads to the release of RNAi-inducing molecules, thereby mediating RNAi.

[0152] In embodiments of the present invention, another non-limiting example of a delivery agent that can be used to deliver the PD-L1 dsRNA agent of the present invention to cells, tissues and / or subjects is a GalNAc-containing agent that is ligated to the PD-L1 dsRNA agent of the present invention and delivers the PD-L1 dsRNA agent to cells, tissues and / or subjects. Several other examples of GalNAc-containing delivery agents that can be used in several embodiments of the methods and compositions of the present invention are disclosed in PCT application:WO2020191183A1 (the entirety of which is incorporated herein). One non-limiting example of a GalNAc target ligand that can be used in the compositions and methods of the present invention to deliver the PD-L1 dsRNA agent to cells is a target ligand cluster. Examples of target ligand clusters as presented herein are referred to as phosphodiester-linked GalNAc ligands (GLO) and phosphorothioate-linked GalNAc ligands (GLS). The term "GLX-n" here refers to the attached GalNAc-containing compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4 This can be used to indicate that it is one of the compounds GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of which are as follows, and the linkage position between the GalNAc target ligand and the RNAi agent of the present invention is on the far right of each. [ka] , the phosphoramidites of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16 are disclosed in WO2023 / 045995A1 (the entire disclosure of which is incorporated herein by reference). It should be understood that any RNAi and dsRNA molecules of the present invention can be linked to any of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, and the structures of GLO-1 to GLO-16 and GLS-1* to GLS-16* are as follows.

[0153]

Table 6-1

Table 6-2

Table 6-3

Table 6-4

[0154] In some embodiments, the isomannitol nucleotide may be further conjugated to one or more GalNAc target ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc target ligands are: [ka] This includes, but is not limited to, the terms "olig" each independently represent a polynucleotide portion.

[0155] In some embodiments of the present invention, in vivo delivery may be carried out by a β-dextran delivery system, for example, as described in U.S. Patents 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. Furthermore, PD-L1 RNAi agents can be introduced into cells in vitro using methods known in the art (e.g., electroporation and lipofection). In some embodiments of the methods of the present invention, PD-L1 dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. As a non-limiting example, the PD-L1 dsRNA of the present invention can be administered to a subject in the form of a pharmaceutical composition containing an RNAi agent but without a targeting agent (e.g., a GalNAc target compound) to treat a PD-L1-related disease or condition (e.g., cardiovascular disease) in the subject.

[0156] In addition to some of the delivery methods described herein, RNAi delivery methods (e.g., the methods described herein and the methods used in the art, but not limited to these) should be understood to be usable in combination with the embodiments of PD-L1 RNAi agents and therapeutic methods described herein.

[0157] The PD-L1 dsRNA agents of the present invention can be administered to a subject in an amount and manner that effectively reduces the levels and activity of the PD-L1 polypeptide in cells and / or subjects. In some embodiments of the methods of the present invention, one or more PD-L1 dsRNA agents are administered to cells and / or subjects to treat diseases or conditions related to PD-L1 expression and activity. In some embodiments, the methods of the present invention include administering one or more PD-L1 dsRNA agents to subjects requiring such treatment in order to reduce diseases or conditions related to PD-L1 expression in subjects. The PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents of the present invention can be administered to reduce PD-L1 expression and / or activity in one or more in vitro, ex vivo, and in vivo cells.

[0158] In some embodiments of the present invention, the level of PD-L1 polypeptide in cells is reduced by delivering (e.g., introducing) a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent to cells, thereby reducing its activity. Targeting agents and methods can be used to help deliver the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent to specific cell types, cell subtypes, organs, spatial regions and / or intracellular subcellular regions in a subject. In some methods of the present invention, the PD-L1 dsRNA agent can be administered alone or in combination with one or more additional PD-L1 dsRNA agents. In some embodiments, the subject is administered two, three, four or more independently selected PD-L1 dsRNA agents.

[0159] In some embodiments of the present invention, the PD-L1 dsRNA agent is administered to a subject in combination with one or more additional therapeutic regimens for treating a PD-L1-related disease or condition. Non-limiting examples of additional therapeutic regimens include administration of one or more PD-L1 antisense polynucleotides of the present invention, administration of non-PD-L1 dsRNA therapeutic agents, and behavioral changes. The additional therapeutic regimens may be administered before, concurrently with, and at one or more time points after administration of the PD-L1 dsRNA agent of the present invention. As used herein, “concurrent” means within 5 minutes, 10 minutes, 30 minutes, 45 minutes, and 60 minutes from zero time, and “zero time” should be understood to mean the time at which the subject is administered the PD-L1 dsRNA agent of the present invention. Non-PD-L1 dsRNA therapies include, but are not limited to, other cancer therapies selected from the group consisting of surgery, radiotherapy, chemotherapy, targeted therapy, immunotherapy, or hormone therapy. Examples include alemtuzumab, altretamine, azacitidine, bendamustine, bleomycin, bortezomib, busulfan, cabazitaxel, capecitabine, carboplatin, carmofur, carmustine, chlorambucil, and chlormethine. rmethine), cisplatin, cladribine, clofarabine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, decitabine, denosumab, docetaxel, doxorubicin, epirubicin,Estramustine, etoposide, everolimus, floxuridine, fludarabine, fluorouracil, fotemustine, gemcitabine, gemtuzumab, hydroxycarbamide, ibritumomab, idarubicin (in), ifosfamide, irinotecan, ixabepilone, lomustine, melphalan, mercaptopurine, methotrexate, mitomycin, mitoxantrone, nedaplatin, nelarabine, ofatumumab, oxali Platin (oxaliplatin), paclitaxel, pemetrexed, pentostatin, pertuzumab, procarbazine, raltitrexed, streptozotocin, tegafur, temozolomide, temsirolimus, teniposide, thioguani tioguanine, topotecan, tositumomab, valrubicin, vinblastine, vincristine, vindesine, vinflunine, or vinorelbine, acalabrutinib, adavosertib, afatinib, alectinib,Axitinib, binimetinib, bosutinib, brigatinib, cediranib, ceritinib, cetuximab, cobimetinib, crizotinib, cabozantinib, dacomitinib, dasatinib, entrectinib, erda erdafitinib, erlotinib, fostamatinib, gefitinib, ibrutinib, imatinib, lapatinib, lenvatinib, restaurtinib, lortatinib, masitinib, momerotinib, mubritinib, nerati Nib (neratinib), nilotinib, nintedanib, olmutinib, osimertinib, pacritinib, panitumumab, pazopanib, pegaptanib, ponatinib, radotinib, regorafenib, rociletinib, ruxolitinib xolitinib), selumetinib, semaxanib, sorafenib, sunitinib, SU6656, tivozanib, toceranib, trametinib, trastuzumab, vandetanib or vemurafenib, nivolumab, pembrolizumab,Spartalizumab, cemiplimab, camrelizumab, sintilimab, tislelizumab, toripalimab, AMP-224 or AMP-514, atezolizumab, avelumab, durvalumab b) KN035, AUNP12, CA-170 or BMS-986189, ipilimumab or tremilimumab, aflibercept, axitinib, bevacizumab, brivanib, cabozantinib, cediranib, lenvatinib lenvatinib, linifumib, nintedanib, pazopanib, ponatinib, ramucirumab, regorafenib, semaxanib, sorafenib, sunitinib, tivozanib, toceranib (toc) eranib) or vandetanib, AB-423, AB-506, ABI-H2158, ABI-H0731, acyclovir, adapromine, adefovir, alafenamide, amantadine, asunaprevir, baloxavir marboxil, beclabuvir, boceprevir, brivudine, cidofovir, ciluprevir, clevudine, cytarabine, daclatasvir, danoprevir, dasabuvir,Deleobuvir, dipivoxil, edoxudine, elbasvir, entecavir, faldaprevir, famciclovir, favipiravir, filibuvir, fomivirsen, foscamet, galidesivir, ganciclovir, glecaprevir, GLS4, grazoprevir, idoxuridine, imiquimod, IFN-a, interferon alpha 2b, JNJ-440, JNJ-6379, lamivudine, laninamivir, ledipasvir, mericitabine, methisazone, MK-608, moroxydine, narlaprevir, NITD008, NZ-4, odalasvir, ombitasvir, oseltamivir, paritaprevir, pegylated interferon α-2a, penciclovir, peramivir, pibrentasvir (pi brentasvir, baloxavir (pimodivir), pleconaril, podophyllotoxin, presatovir, radalbuvir, ravidasvir, remdesivir, REP2139, REP2165, resiquimod, RG7907, ribavirin, rifampicin, rimantadine, ruzasvir, samatasvir, setrobuvir, simeprevir,Sofosbuvir, sorivudine, sovaprevir, taribavirin, telaprevir, telbivudine, tenofovir, tenofo This includes, but is not limited to, tenofovir disoproxil, triazavirin, trifluridine, tromantadine, umifenovir, uprifosbuvir, valacyclovir, valgancicovir, vaniprevir, vedroprevir, velpatasvir, vidarabine, voxilaprevir, or zanamivir, or any combination thereof. These and other therapeutic agents and behavioral alterations are known in the art and have been used to treat PD-L1-related disorders or conditions in subjects, and can be administered to subjects in combination with one or more PD-L1 dsRNA agents of the present invention to treat PD-L1-related disorders or conditions. The PD-L1 dsRNA agent of the present invention, administered to cells or subjects to treat PD-L1-related diseases or conditions, can act synergistically with one or more other therapeutic agents or activators, enhance the efficacy of one or more therapeutic agents or activators, and / or enhance the effectiveness of treating PD-L1-related diseases or conditions with the PD-L1 dsRNA agent.

[0160] The therapeutic method of the present invention comprises the administration of a PD-L1 dsRNA agent and can be used before the onset of a PD-L1-related disease or disorder and / or during the presence of a PD-L1-related disease or disorder, including the early, middle, and late stages of the disease or disorder, as well as all time before and after these stages. The method of the present invention can be further used to treat subjects who have previously been treated for a PD-L1-related disease or disorder with one or more other therapeutic agents and / or therapeutic activities, which have failed, had a very low success rate, and / or failed to treat the PD-L1-related disease or disorder in the subjects.

[0161] • dsRNA encoded by a vector In some embodiments of the present invention, a vector can be used to deliver a PD-L1 dsRNA agent to cells. The PD-L1 dsRNA agent transcription unit may be contained in a DNA or RNA vector. The manufacture and use of such vectors encoding genetic recombination for delivering sequences to cells and / or targets is known in the art. In the methods of the present invention, a vector that results in transient expression of PD-L1 dsRNA can be used, the transient expression being, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The length of transient expression can be determined using a general method based on factors such as, for example, a selected specific vector construct and target cells and / or tissues, but not limited thereto. Such genetic recombination can be introduced as a linear construct, circular plasmid or viral vector, which may be an integrated or non-integrated vector. Genetic recombination can also be constructed to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0162] The single-stranded or multi-stranded PD-L1 dsRNA agent can be transcribed from a promoter in an expression vector. When expressing two individual strands to produce dsRNA, two individual expression vectors can be co-introduced into cells using methods such as transfection or infection. In some embodiments of the present invention, each individual strand of the PD-L1 dsRNA agent can be transcribed by a promoter contained in the same expression vector. In some embodiments of the present invention, the PD-L1 dsRNA agent is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence such that the PD-L1 dsRNA agent has a stem-loop structure.

[0163] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. Expression vectors useful in the embodiments of the present invention may be compatible with eukaryotic cells. Eukaryotic cell expression vectors are commonly used in the art and are available from many commercial sources. Delivery of the PD-L1 dsRNA expression vector may be systemic, for example, by intravenous or intramuscular administration to target cells isolated from the subject and then reintroduced into the subject's body, or by any other method that enables introduction into desired target cells.

[0164] Viral vector systems that may be included in embodiments of the method include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors including, but not limited to, lentivirus vectors and Moloney's mouse leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors such as orthopoxvirus vectors, or avipoxvirus vectors such as canarypoxvirus vectors or foulpoxvirus vectors, and (j) helper-dependent or enteric-free adenovirus vectors. Constructs used for recombinant expression of PD-L1 dsRNA agents may include selectable regulators such as promoters and enhancers to provide constitutive or regulatory / inducible expression. The use of viral vector systems, promoters and enhancers is a common technique in the art and can be used in combination with the methods and compositions described herein.

[0165] Some embodiments of the present invention involve delivering a PD-L1 dsRNA reagent into cells using a viral vector. In the art, various adenovirus-based delivery systems are commonly used for delivery to the lungs, liver, central nervous system, endothelial cells, and muscles, among others. Non-limiting examples of viral vectors usable in the methods of the present invention include AAV vectors, poxviruses (e.g., vaccinia virus), modified Ankara virus (MVA), NYVAC, Foulpox, or Avipox such as canarypoxvirus.

[0166] Some embodiments of the present invention include a method for delivering a PD-L1 dsRNA agent to cells using a vector, wherein such a vector may be located in a pharmaceutically acceptable carrier, which may, but does not have to, include a sustained-release matrix into which the gene delivery vector is embedded. In some embodiments, the vector for delivering PD-L1 dsRNA can be produced by recombinant cells, and the pharmaceutical composition of the present invention may include one or more cells that generate a PD-L1 dsRNA delivery system.

[0167] • Pharmaceutical composition containing PD-L1 dsRNA or ssRNA agent Some embodiments of the present invention involve the use of a pharmaceutical composition containing a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent and a pharmaceutically acceptable carrier. A pharmaceutical composition containing a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent can be used in the methods of the present invention to reduce PD-L1 gene expression and PD-L1 activity in cells, and can be used to treat PD-L1-related diseases or conditions. Such pharmaceutical compositions can be prepared by delivery methods. Non-limiting examples of formulations for delivery methods include compositions prepared for subcutaneous delivery, compositions prepared for systemic administration by parenteral delivery, compositions prepared for intravenous (IV) delivery, compositions prepared for intrathecal delivery, and compositions prepared for direct delivery into the brain. The pharmaceutical compositions of the present invention can be administered to deliver PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents to cells by one or more methods, including, for example, topical (e.g., by transdermal patch), by inhalation or blowing of powder or aerosol agents including by spray, to the lungs, airways, nasal cavity, epidermis and transderm, orally or parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, subcutaneous administration including by implantation devices, or intracranial, intrathecal or intraventricular administration including intracerebral parenchymal administration. PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can also be delivered directly to target tissues, such as by direct delivery to the liver or direct delivery to the kidneys. The "delivery of PD-L1 dsRNA agents" or "delivery of PD-L1 antisense polynucleotide agents" to cells should be understood to include, respectively, the direct delivery of PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents, the direct expression of PD-L1 dsRNA agents in cells, the expression of PD-L1 dsRNA agents from a coding vector delivered into cells, or any appropriate method for making PD-L1 dsRNA or PD-L1 antisense polynucleotide agents appear in cells. The preparation and use of formulations and means for delivering suppressor RNA are known and commonly used in the art.

[0168] As used herein, the "pharmaceutical composition" includes a pharmacologically effective amount of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture media. In the case of drugs administered orally, pharmaceutically acceptable carriers include pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives, but are not limited thereto. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are usually magnesium stearate, stearic acid, or talc. If necessary, tablets can be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The agents included in the pharmaceutical preparation are further described below.

[0169] Terms such as "pharmacologically effective amount", "therapeutically effective amount", and "effective amount" as used herein refer to the amount by which the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention can produce the expected pharmacological, therapeutic, or prophylactic results. For example, when a measurable parameter related to a disease or disorder is reduced by at least 10%, if a given clinical treatment is considered effective, the therapeutically effective amount of a drug for treating the disease or disorder is the amount necessary to reduce the parameter by at least 10%. For example, the therapeutically effective amount of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent can reduce the PD-L1 polypeptide level by at least 10%.

[0170] · Effective amount In some embodiments, the method of the present invention involves contacting cells with an effective amount of PD-L1 dsRNA or PD-L1 antisense polynucleotide to reduce PD-L1 gene expression in the contacting cells. Some embodiments of the method of the present invention involve administering an effective amount of PD-L1 dsRNA or PD-L1 antisense polynucleotide to a subject in order to reduce PD-L1 gene expression in the subject and to treat a PD-L1-related disease or condition in the subject. The “effective amount” for reducing PD-L1 expression and / or treating a PD-L1-related disease or condition is the amount necessary or sufficient to achieve the desired biological effect. For example, the effective amount of PD-L1 dsRNA or PD-L1 antisense polynucleotide for treating a PD-L1-related disease or condition may be (i) the amount necessary to slow or halt the progression of the disease or condition, or (ii) the amount necessary to reverse, alleviate or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, the effective dose is the amount of PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent that, when administered to a subject requiring treatment for a PD-L1-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. According to some aspects of the present invention, the effective dose is the amount of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention that, when combined with or co-administered with another treatment method for a PD-L1-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. In some embodiments of the present invention, the biological effect of treating a subject with the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention may be improvement and / or complete elimination of symptoms caused by a PD-L1-related disease or condition. In some embodiments of the present invention, the biological effect is the complete elimination of a PD-L1-related disease or condition, as demonstrated, for example, by a diagnostic test showing that the subject does not have a PD-L1-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in PD-L1 levels in the liver of a subject after administration of the agent of the present invention.Other methods known in the art for evaluating the status of PD-L1-related diseases or conditions can be used to determine the effects of the agents and / or methods of the present invention on PD-L1-related diseases or conditions.

[0171] Typically, in clinical trials, an effective dose of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent is determined to reduce PD-L1 polypeptide activity to a level that treats PD-L1-related diseases or conditions. Such clinical trials are blinded studies that establish effective doses for the test population and the control population. In some embodiments, the effective dose is the amount that produces the desired response, for example, the amount that alleviates the PD-L1-related disease or condition in the cells, tissues, and / or subjects suffering from the disease or condition. Therefore, the effective dose of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent for treating PD-L1-related diseases or conditions that can be treated by reducing PD-L1 polypeptide activity may be an amount that, when administered, reduces the activity level of PD-L1 polypeptide in the subject to a level lower than the activity level of PD-L1 polypeptide present in the cells, tissues, and / or body of the subject when the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent is not administered. In some embodiments of the present invention, the level of PD-L1 polypeptide activity and / or PD-L1 gene expression present in cells, tissues, and / or the body of a subject that have not been exposed to or administered with the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention is referred to as the “control” level. In some embodiments of the method of the present invention, the subject’s control level is the subject’s pre-treatment level, in other words, the level in the subject before administration of the PD-L1 agent may be the subject’s control level and is used to compare with the level of PD-L1 polypeptide activity and / or PD-L1 gene expression after administration of siRNA to the subject. When treating PD-L1-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. Methods such as determining PD-L1 polypeptide activity, PD-L1 gene expression, symptom assessment, and clinical trials should be understood as being usable to monitor the state of PD-L1-related diseases or conditions.In some embodiments of the present invention, the desired response to the treatment of PD-L1-related diseases or conditions is the delay of the onset of the disease or condition, or even the prevention of the onset of the disease or condition.

[0172] The effective amount of a compound that reduces PD-L1 polypeptide activity can also be determined by evaluating the physiological effects on cells or subjects (e.g., reduction in PD-L1-related disease or symptoms after administration) of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent. Subjective measurements and / or symptom monitoring can be used to determine the effectiveness of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention (which can be administered in the form of the drug compound of the present invention) and to determine whether or not there is a response to treatment. One non-limiting example is that one or more PD-L1 bioactivity tests known in the art may be evaluated by the presence of an immune response, which manifests as the presence of antibodies or immune cells against an infectious agent; by the reduction of one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); by detecting the level of anti-HBsAg antibodies in the subject's body; or by measuring hepatitis B surface antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum. Another non-limiting example is that one or more liver function tests known in the art may be used to determine the state of PD-L1-related lipid imbalance in the subject's body before and after treatment with the PD-L1 dsRNA agent of the present invention.

[0173] Some embodiments of the present invention include a method for determining the efficacy of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention administered to a subject for the treatment of a PD-L1-related disease or condition, the method comprising evaluating and / or monitoring one or more "physiological characteristics" of a PD-L1-related disease or condition in the subject. Non-limiting examples of physiological features of PD-L1-related diseases or conditions include decreased PD-L1 mRNA levels, PD-L1 protein levels, or PD-L1 expression, which can be assessed indirectly by measuring decreased PD-L1 bioactivity or PD-L1 levels in a subject sample (e.g., serum sample), by measuring decreased levels of proteins, nucleic acids, or carbohydrates present in the source of infection, by assessing the immune response by antibodies or immune cells against the source of infection, by reducing signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, or by detecting the subject's anti-HBsAg antibody level. Standard methods for determining such physiological features are known in this field and include, but are not limited to, blood tests, imaging studies, and physical examinations.

[0174] It should be understood that the amount of PD-L1 dsRNA or PD-L1 antisense polynucleotide administered to a subject can be adjusted, at least partially, based on a judgment of the subject's disease and / or pathological state and / or physiological characteristics. The therapeutic dose can be altered, for example, by increasing or decreasing the amount of PD-L1 dsRNA or PD-L1 antisense polynucleotide, by changing the composition in which the PD-L1 dsRNA or PD-L1 antisense polynucleotide is administered, by changing the route of administration, or by changing the time of administration. The effective dose of PD-L1 dsRNA or PD-L1 antisense polynucleotide varies depending on the specific disease being treated, the age and physical condition of the subject being treated, the severity of the disease, the duration of treatment, the nature of any concurrent treatments, the specific route of administration, and other factors within the scope of the healthcare professional's knowledge and expertise. For example, the effective dose may depend on the level of PD-L1 polypeptide activity and / or PD-L1 gene expression required to effectively treat PD-L1-related diseases or conditions. Those skilled in the art can empirically determine the effective amount of a particular PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent used in the method of the present invention without performing excessive experiments. By referring to the teachings provided herein, it is possible to select from the various PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents of the present invention and plan an effective prophylactic or therapeutic scheme to effectively treat a particular subject by making trade-offs of factors such as efficacy, relative bioavailability, patient weight, severity of adverse side effects, and preferred method of administration. As used in embodiments of the present invention, the effective amount of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention may be the amount that produces the desired biological effect in the cell when in contact with the cell.

[0175] It should be recognized that PD-L1 gene silencing can be performed constitutively or by genomic engineering and can be determined in any cell expressing PD-L1 by any appropriate measurement. In some embodiments of the present invention, administration of the PD-L1 dsRNA agent of the present invention reduces PD-L1 gene expression by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the present invention, administration of the PD-L1 dsRNA agent of the present invention reduces PD-L1 gene expression by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0176] • Dosage PD-L1 dsRNA agents and PD-L1 antisense polynucleotide agents are delivered in a pharmaceutical composition at a dose sufficient to inhibit PD-L1 gene expression. In some embodiments of the present invention, the dose of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kilogram of body weight per day of the recipient, and is generally 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight (including both extreme values). For example, PD-L1 A single dose of dsRNA or PD-L1 antisense polynucleotide is approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1. 9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, It can be administered in doses of 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg to 50 mg / kg of body weight.

[0177] When determining the dose and administration time of the PD-L1 dsRNA agent of the present invention, various factors can be considered. The absolute amount of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent administered depends on various factors, including concurrent treatment, dose quantity, and parameters of the individual subject, including age, physical condition, body size, and weight. These factors are well known to those skilled in the art and can be resolved by conventional experiments alone. In some embodiments, the maximum dose, i.e., the safest dose based on reasonable medical judgment, can be used.

[0178] In some embodiments, the method of the present invention may involve administering to a subject a dose of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent. In some cases, the drug compound (e.g., comprising a PD-L1 dsRNA agent or comprising a PD-L1 antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, bi-weekly, monthly, etc. The dose may be administered once daily or multiple times daily, for example, two, three, four, five or more times within a single 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent may be administered in two, three or more subdoses at appropriate intervals per day, or even delivered by continuous infusion or through a sustained-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention is administered to a subject once or more times a day, once or more times a week, once or more times a month, or once or more times a year.

[0179] The methods of the present invention, in some embodiments, include administering a drug compound alone, in combination with one or more other PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents, and / or in combination with other drug therapies or therapeutic activities or schemes administered to subjects suffering from PD-L1-related diseases or conditions. The drug compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may contain a sterile, fixed amount of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent that reduces the activity of the PD-L1 polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to a subject. The dose of the pharmaceutical composition containing the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent administered to a subject to reduce PD-L1 protein activity may be selected based on different parameters, in particular, the method of administration used and the condition of the subject. Other factors include the desired treatment time. If the subject's response to the initial dose is insufficient, a higher dose may be used within the patient's tolerance range (or the dose may be effectively increased by a different, more localized delivery route).

[0180] ·Treatment As used herein, “PD-L1-related disorders,” “PD-L1-related disorders and conditions,” and “disorders or conditions caused and / or regulated by PD-L1” are intended to include any disorder related to the PD-L1 gene or protein. Such disorders may be caused, for example, by overproduction of the PD-L1 protein, mutations in the PD-L1 gene, abnormal cleavage of the PD-L1 protein, or abnormal interactions between PD-L1 and other proteins or other endogenous or exogenous substances. Exemplary PD-L1-related disorders include, but are not limited to, tumors or hematological malignancies (e.g., lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic cell carcinoma, head cancer, kidney cancer, pancreatic cancer, and cervical cancer), and infections (e.g., viral, bacterial, fungal, or parasitic diseases). In some embodiments, the infection is a chronic infection caused by, for example, viruses (e.g., HIV, HBV, HCV, and HTLV), bacteria (e.g., Helicobacter pylori), and parasites (e.g., Schistosoma mansoni).

[0181] In some embodiments of the present invention, a subject may be administered the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention at one or more time points before or after the diagnosis of a PD-L1-related disease or condition. In some embodiments of the present invention, the subject has or is at risk of developing a PD-L1-related disease or condition. A subject at risk of developing a PD-L1-related disease or condition is a subject whose likelihood of developing a PD-L1-related disease or condition is increased compared to a control risk of developing a PD-L1-related disease or condition. In some embodiments of the present invention, the risk level is statistically significant compared to the control level of risk. Subjects at risk may include, for example, subjects with pre-existing diseases and / or genetic abnormalities that make them more susceptible to PD-L1-related disorders or conditions compared to control subjects without pre-existing diseases or genetic abnormalities; subjects with a family history and / or personal history of PD-L1-related disorders or conditions; and subjects who have previously received or will receive treatment for PD-L1-related disorders or conditions. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to PD-L1-related disorders or conditions may be diseases or genetic abnormalities that, if present, have been previously determined to be associated with a higher likelihood of developing PD-L1-related disorders or conditions.

[0182] It should be understood that a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent may be administered to an individual subject based on the subject's medical condition. For example, the healthcare provider to a subject may evaluate the PD-L1 level measured in a sample obtained from the subject and determine that it is desirable to reduce the subject's PD-L1 level by administering the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention. In this example, even if the subject has not been diagnosed with a PD-L1-related disease as disclosed herein, the PD-L1 level may be considered a physiological characteristic of a PD-L1-related disease. The healthcare provider may monitor changes in the subject's PD-L1 level as a criterion for measuring the therapeutic effect of the administered PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention. In non-limiting examples, a biological sample such as a blood or serum sample may be obtained from the subject, and the subject's PD-L1 level may be determined from the sample. A PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent is administered to the subject, and a blood sample is obtained from the subject after administration. The PD-L1 level is determined using this sample, and the result is compared with the result determined using a sample taken before administration to the subject. A reduction in the subject's PD-L1 level in the later sample compared to the pre-administration level indicates that the administered PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent is effective in reducing lipid levels in the subject.

[0183] Some embodiments of the methods of the present invention include a modified treatment, which involves administering the subject a dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention, at least in part on an assessment of changes in one or more physiological characteristics of a PD-L1-related disease or condition caused by treating the subject. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention on the subject can be determined and used to assist in adjusting the amount of the dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention administered to the subject later. In one non-limiting example, the subject is administered a dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention, the subject's PD-L1 level is measured after administration, and it is determined, at least in part on the measured level, that a higher amount of the dsRNA agent or PD-L1 antisense polynucleotide agent is needed to increase the physiological effect of the administered agent, for example, to reduce or further reduce the subject's PD-L1 level. In yet another non-limiting example, it is necessary to administer the dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention to a subject, measure the subject's PD-L1 level after administration, and administer a relatively low amount of the dsRNA agent or PD-L1 antisense polynucleotide agent to the subject, at least in part, based on the measured level.

[0184] Accordingly, some embodiments of the present invention include evaluating changes in one or more physiological characteristics caused by the subject's prior treatment in order to adjust the amount of the dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention administered to the subject later. Some embodiments of the methods of the present invention include measuring the physiological characteristics of a PD-L1-related disease or condition one, two, three, four, five, six or more times to evaluate and / or monitor the effectiveness of the administered PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention, and optionally using these measurements to adjust one or more of the dose, administration scheme and / or frequency of the dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention to treat a PD-L1-related disease or condition in a subject. In some embodiments of the method of the present invention, the desired outcome of administering an effective amount of the dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention to a subject is a reduction in PD-L1 mRNA levels, a reduction in PD-L1 protein levels, or a decrease in PD-L1 expression in the subject, which is indirectly evaluated by measuring a decrease in PD-L1 biological activity or PD-L1 levels in a subject sample (e.g., serum sample), by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection, by evaluating the immune response by antibodies or immune cells against the source of infection, by reducing signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, or by detecting the subject's anti-HBsAg antibody level.

[0185] As used herein, when used in relation to PD-L1-related disorders or conditions, the terms “to treat,” “treated,” or “being treated” may refer to prophylactic treatment that reduces the likelihood that a subject has a PD-L1-related disorder or condition, or to treatment performed after a subject has been diagnosed with a PD-L1-related disorder or condition to eliminate or reduce the level of the disorder or condition, prevent further progression (e.g., becoming more severe), and / or delay the progression of the disorder or condition in the subject compared to an untreated subject, thereby reducing the activity of the PD-L1 polypeptide in the subject.

[0186] Some embodiments of the agents, compositions, and methods of the present invention can be used to inhibit PD-L1 gene expression. As used herein with respect to PD-L1 gene expression, the terms “suppression,” “silencing,” “reduction,” “downregulation,” and “knockdown” refer to a reduction in PD-L1 gene expression, measured by one or more levels of RNA transcribed from the PD-L1 gene, the activity level of expressed PD-L1, and PD-L1 polypeptide, protein, or protein subunit translated from mRNA, when cells, cell populations, tissues, organs, or subjects come into contact with (e.g., are treated with) the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention, compared to a control level of RNA transcribed from the PD-L1 gene, the activity level of expressed PD-L1, or the level of PD-L1 translated from mRNA, respectively, in cells, cell populations, tissues, organs, or subjects transcribing the PD-L1 gene, the activity level of expressed PD-L1, or the level of PD-L1 translated from mRNA. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been in contact with (e.g., treated with) a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent.

[0187] • Method of administration Multiple routes of administration of PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be used in the methods of the present invention. The specific method of administration selected depends at least in part on the specific disease being treated and the dose required for the therapeutic effect. Generally, the methods of the present invention can be carried out by any medically acceptable method of administration, i.e., any method that produces an effective therapeutic level for PD-L1-related diseases or conditions without causing clinically unacceptable side effects. In some embodiments of the present invention, PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be administered orally, intraintestinally, mucosally, subcutaneously and / or parenterally. The term "parenterally" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a nasogastric tube), cutaneous, vaginal, rectal, sublingual and inhalation. The delivery routes of the present invention may include intrathecal, ventricular or intracranial. In some embodiments of the present invention, a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent can be administered by placing it in a sustained-release matrix and placing the matrix in the body of a subject. In some embodiments of the present invention, a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent can be delivered to the cells of a subject using nanoparticles coated with a delivery agent that targets specific cells or organelles. Various delivery means, methods, and agents are known in the art. Other parts of this specification further provide non-limiting examples of delivery methods and delivery agents. In some aspects of the present invention, the term “delivery” with respect to PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents may refer to administering one or more “naked” PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent sequences to cells or subjects, and in certain aspects of the present invention, “delivery” may refer to delivering cells or subjects by transfection means, delivering cells containing PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents to subjects, delivering vectors encoding PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents to cells and / or subjects, etc.The delivery of a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent using transfection means may include administering the vector to cells and / or subjects.

[0188] In some methods of the present invention, one or more PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be administered in the form of a formulation, which can be administered in the form of a pharmaceutically acceptable solution, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, a suitable carrier, an adjuvant, and optionally other therapeutic components. In some embodiments of the present invention, the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent can be prepared together with another therapeutic agent for co-administration. According to the methods of the present invention, the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent can be administered in the form of a pharmaceutical composition. Typically, the pharmaceutical composition comprises the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the efficacy of the biological activity of the active ingredient (e.g., the ability of a PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent to inhibit PD-L1 gene expression in cells or subjects). Various methods for administering and delivering dsRNA agents or PD-L1 antisense polynucleotide agents used for therapeutic purposes are known in the art and can be used in the methods of the present invention.

[0189] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and other optional therapeutic agents. While salts are pharmaceutically acceptable when used in drugs, pharmaceutically unacceptable salts can be suitably used in the production of their pharmaceutically acceptable salts and are not excluded from the scope of the present invention. Such pharmacokinetic and pharmaceutically acceptable salts include, but are not limited to, salts produced from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Furthermore, pharmaceutically acceptable salts can be produced as alkali metal salts or alkaline earth salts, such as sodium salts, potassium salts, or calcium salts.

[0190] Some embodiments of the methods of the present invention involve directly administering one or more PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which PD-L1-related disease or pathology is present or likely to develop, a non-limiting example being the liver. Direct administration to tissue can be achieved by direct injection or by other means. Many orally delivered compounds spontaneously reach and pass through the liver and kidneys, and some embodiments of the therapeutic methods of the present invention involve orally administering one or more PD-L1 dsRNA agents to a subject. The PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be administered in a single dose or in multiple doses, whether administered alone or in combination with other therapeutic agents. When administered in multiple doses, the PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be administered via different routes. For example, though not intended to be limiting, the initial (or first few) doses may be administered subcutaneously, and one or more additional doses may be administered orally and / or systemically.

[0191] In embodiments of the present invention where systemic administration of a PD-L1 dsRNA agent or a PD-L1 antisense polynucleotide agent is desired, the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent can be prepared for parenteral administration by injection, for example, bolus injection or continuous infusion. The injectable formulation can exist in unit dosage form, with or without preservatives, for example, in ampoules or multi-dose containers. The PD-L1 dsRNA agent formulation (also called a pharmaceutical composition) can take the form of a suspension, solution or emulsion on an oily or aqueous carrier, and may contain preparing agents such as suspending agents, stabilizers and / or dispersants.

[0192] Parenteral formulations include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions containing saline and a buffer medium. Parenteral carriers include sodium chloride solution, ringer's dextrose, glucose and sodium chloride solution, lactated ringer's solution, or non-volatile oils. Intravenous carriers include liquids and nutritional supplements, electrolyte supplements (e.g., supplements based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may be present. Doses for other forms of administration (e.g., intravenous administration) are relatively low. If the subject's response to the initial dose is insufficient, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased by a different, more localized delivery route). If necessary, multiple doses can be used daily to achieve appropriate systemic or local levels of one or more PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents, and to achieve appropriate reduction of PD-L1 protein activity.

[0193] In other embodiments, the method of the present invention includes using a delivery carrier, for example, biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a test subject). An example of a bioerosive implant that may be useful by the method is described in PCT publication number WO95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for housing biomacromolecules.

[0194] In the method of the present invention, one or more PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be delivered to a subject using non-biodegradable and biodegradable polymer matrices. In some embodiments, the matrix may be biodegradable. The matrix polymer may be natural or synthetic. The polymer can be selected depending on the period for which release is required, typically from several hours to one year or longer. Releases over periods of several hours to 3 to 12 months are typically available. The polymer may optionally be in the form of a hydrogel capable of absorbing up to about 90% of its weight in water, and may further optionally be crosslinked with polyvalent ions or other polymers.

[0195] In general, in some embodiments of the present invention, PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be delivered by diffusion using bioerosive implants or by degradation of a polymer matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents by methods known in the art. Bioadhesive polymers such as bioerosive hydrogels (see HSSawhney, CPPathak and JAHubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used to deliver PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents to treat PD-L1-related diseases or conditions. Other suitable delivery systems may include sustained-release, delayed-release, or slow-release delivery systems. Such systems can avoid repeated administration of PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available for use and understanding by those skilled in the art. (See, for example, U.S. Patents 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974 and 5,407,686 (the teachings of each patent are incorporated herein by reference)). Furthermore, pump-based hardware delivery systems, some of which are applicable to implantation, can be used.

[0196] The use of long-term sustained-release implants is suitable for prophylactic treatment of subjects and may also be suitable for subjects at risk of developing recurrent PD-L1-related disease or condition. As used herein, long-term release refers to constructing and positioning an implant to enable sustained delivery of therapeutic levels of PD-L1 dsRNA or PD-L1 antisense polynucleotide agents over periods of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or longer. Long-term sustained-release implants are well known to those skilled in the art and include some of the release systems described above.

[0197] Therapeutic formulations of PD-L1 dsRNA agents or PD-L1 antisense polynucleotide agents can be prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers [Remington's Pharmaceutical Sciences, 21st edition, (2006)]. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dose and concentration used and include buffers such as phosphates, citrates, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (e.g., benzyldimethylstearylammonium chloride hydrate, hexamethonium, benzalkonium chloride, benzethonium chloride, phenol, butanol, or benzyl alcohol, alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate, catechol, resorcinol, cyclohexanol, 3-pentanopropyl (Like sulfone and m-cresol), low molecular weight (less than about 10 residues) polypeptides, proteins such as serum albumin, gelatin or immunoglobulin, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose or dextrin, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose or sorbitol, salt-forming counterions such as sodium, metal complexes (e.g., Zn-protein complexes), and / or TWEEN (登録商標)PLURONICS (登録商標) Alternatively, it may contain a nonionic surfactant such as polyethylene glycol (PEG).

[0198] • Cells, subjects, and controls The methods of the present invention can be used with cells, tissues, organs and / or subjects. In some embodiments of the present invention, the subjects are humans or vertebrate mammals, including but not limited to dogs, cats, horses, cattle, goats, mice, rats and monkeys. Accordingly, the present invention can be used for the treatment of PD-L1-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subjects may be farm animals, zoo animals, domesticated animals or non-domesticated animals, and the methods of the present invention can be used in veterinary preventive and therapeutic schemes. In some embodiments of the present invention, the subjects are humans, and the methods of the present invention can be used in human preventive and therapeutic schemes.

[0199] Non-limiting examples of subjects to whom the present invention can be applied are subjects diagnosed with, suspected of having, or at risk of having, a disease or condition related to the following diseases or conditions, also known as “elevated PD-L1 expression levels,” which are higher than desired PD-L1 expression and / or activity. Non-limiting examples of diseases and conditions related to higher-than-expected PD-L1 expression and / or activity are described elsewhere in this specification. The method of the present invention can be applied to subjects diagnosed with a disease or condition related to higher-than-desired PD-L1 expression and / or activity at the time of treatment, or subjects who are considered to have or be at risk of developing a disease or condition related to higher-than-desired PD-L1 expression and / or activity. In some embodiments of the present invention, the disease or condition related to higher-than-desired PD-L1 expression levels and / or activity is an acute disease or condition, and in some embodiments of the present invention, the disease or condition related to higher-than-desired PD-L1 expression levels and / or activity is a chronic disease or condition.

[0200] Cells to which the methods of the present invention can be applied include in vitro, in vivo, and ex vivo cells. The cells may be present in the body of a subject, in a culture, and / or in a suspension, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may also be liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments of the present invention, the cells to which the methods of the present invention can be applied are healthy, normal cells not known as disease cells. In some examples of the present invention, the cells to which the methods and compositions of the present invention can be applied are liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In some embodiments of the present invention, while control cells are normal cells, it should be understood that in certain cases, cells suffering from disease or illness may be used as control cells, for example, in the results of comparing treated cells suffering from disease or illness with untreated cells suffering from the same disease or illness.

[0201] According to the method of the present invention, the PD-L1 polypeptide activity level can be measured and compared to a control level of PD-L1 polypeptide activity. The control may be a predetermined value employing various forms. It may be a single cutoff value such as the median or mean. It can be established based on comparison groups such as a group having normal levels of PD-L1 polypeptide and / or PD-L1 polypeptide activity, and a group having increased levels of PD-L1 polypeptide and / or PD-L1 polypeptide activity. Another non-limiting example of a comparison group may be a group having one or more symptoms or diagnoses of a PD-L1-related disease or condition, a group not having one or more symptoms or diagnoses of such disease or condition, a group of subjects treated with the siRNA of the present invention, and a group of subjects not treated with the siRNA of the present invention. Typically, the control may be based on normal individuals or cells that appear healthy in an appropriate age group. In addition to predetermined values, it should be understood that the control according to the present invention may be a material sample tested in parallel with the experimental material. Examples include a sample from a control population, or a control sample produced by manufacturing for parallel testing with the experimental sample. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted with or treated with the PD-L1 dsRNA agent of the present invention, in which case the control level of PD-L1 polypeptide and / or PD-L1 polypeptide activity can be compared with the level of PD-L1 polypeptide and / or PD-L1 polypeptide activity in cells or subjects that have been contacted with the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention.

[0202] In some embodiments of the present invention, the control level may be a PD-L1 polypeptide level determined for a subject, where PD-L1 polypeptide levels determined for the same subject at different time points are compared to the control level. In non-limiting examples, PD-L1 levels are measured in biological samples obtained from subjects who have not received PD-L1 treatment according to the present invention. In some embodiments, the biological sample is a serum sample. PD-L1 polypeptide levels measured in samples obtained from subjects can be used as a baseline or control value for the subject. In the therapeutic method of the present invention, after administering a PD-L1 dsRNA agent to a subject once or more times, one or more additional serum samples can be obtained from the subject, and PD-L1 polypeptide levels in these subsequent samples can be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of PD-L1-related disease or condition in the subject. For example, if the PD-L1 polypeptide level in a baseline sample obtained from a subject is higher than the level obtained from the same subject after administration of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention to the same subject, this indicates regression of PD-L1-related disease or condition, and demonstrates the efficacy of the administered PD-L1 dsRNA agent of the present invention in treating PD-L1-related disease or condition.

[0203] In some embodiments of the present invention, the values ​​of PD-L1 polypeptide levels and / or PD-L1 polypeptide activity can be used as a control value for subsequent comparison of PD-L1 polypeptide levels and / or PD-L1 activity in the same subject, thereby enabling the evaluation of changes in PD-L1 polypeptide activity in the subject relative to the "baseline". Thus, if an initial PD-L1 polypeptide level and / or initial PD-L1 polypeptide activity level exists and / or may be determined in the subject, and the methods and compounds of the present invention can be used to reduce the level of PD-L1 polypeptide and / or PD-L1 polypeptide activity in the subject, of which the initial level is used as a control level for the subject.

[0204] By using the method of the present invention, the PD-L1 dsRNA agent and / or PD-L1 antisense polynucleotide agent of the present invention can be administered to a subject. The effectiveness of the administration and treatment of the present invention can be evaluated if the level of PD-L1 polypeptide in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, compared to the pre-administration level of PD-L1 polypeptide in a serum sample obtained from the subject at a previous point in time, or compared to an uncontacted control level (e.g., the level of PD-L1 polypeptide in a control serum sample). It should be understood that both the level of PD-L1 polypeptide and the level of PD-L1 polypeptide activity correlate with the level of PD-L1 gene expression. Some embodiments of the method of the present invention include inhibiting PD-L1 gene expression by administering an effective amount of the PD-L1 dsRNA and / or PD-L1 antisense agent of the present invention to a subject, thereby reducing the level of PD-L1 polypeptide and the level of PD-L1 polypeptide activity in the subject.

[0205] Some embodiments of the present invention involve determining the presence, absence, and / or amount (also referred to herein as level) of PD-L1 polypeptide in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the effectiveness of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of PD-L1 polypeptide in a biological sample obtained from a subject that has been previously treated with the PD-L1 dsRNA agent and / or PD-L1 antisense agent of the present invention. If the level of PD-L1 polypeptide measured in a serum sample obtained from a treated subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-treatment level of PD-L1 polypeptide determined for the subject, or compared to the level of an uncontacted control biological sample, the level of effectiveness of the treatment given to the subject is indicated.

[0206] In some embodiments of the present invention, the physiological characteristics of a PD-L1-related disease or condition determined for a subject can be used as a control result, and the results of the determination of physiological characteristics of the same subject at different time points can be compared with the control result. In non-limiting examples, a decrease in physiological characteristics of a subject, such as PD-L1 mRNA levels, PD-L1 protein levels, and PD-L1 expression, may be indirectly assessed by measuring a decrease in PD-L1 biological activity or PD-L1 levels in a subject sample (e.g., serum sample), by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection, by assessing the immune response by antibodies or immune cells against the source of infection, by assessing the reduction of signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), by measuring levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, by detecting the subject's anti-HBsAg antibody level, or by detecting the anti-HBsAg antibody level in the subject or plasma or tissue sample, which is a criterion determined in biological samples (e.g., serum samples) obtained from subjects not treated with PD-L1 according to the present invention. The PD-L1 mRNA levels (and / or other physiological characteristics of PD-L1 disease or condition) determined in samples obtained from a subject can be used as a baseline or control value for the subject. In the therapeutic method of the present invention, after administering a PD-L1 dsRNA agent to a subject once or more times, one or more additional serum samples can be obtained from the subject, and the PD-L1 mRNA levels and / or PD-L1 protein levels in the subsequent samples can be compared to the subject's control / baseline levels and / or ratios, respectively. Such comparisons can be used to assess the onset, progression, or regression of PD-L1-related disease or condition in the subject.For example, if the PD-L1 mRNA level in a baseline sample obtained from a subject is higher than the PD-L1 mRNA level measured in a sample obtained from the same subject after administration of the PD-L1 dsRNA agent or PD-L1 antisense polynucleotide agent of the present invention to the same subject, this indicates regression of PD-L1-related disease or condition, and demonstrates the efficacy of the administered PD-L1 dsRNA agent of the present invention in treating PD-L1-related disease or condition.

[0207] In some embodiments of the present invention, the values ​​of one or more physiological characteristics of a PD-L1-related disease or disorder determined in a subject can then be used as control values ​​to compare the physiological characteristics of the same subject, thereby enabling the evaluation of changes in the "baseline" physiological characteristics from the subject. Thus, if an initial physiological characteristic is present and / or can be determined in a subject, and the methods and compounds of the present invention can be used to reduce the levels of PD-L1 polypeptide and / or PD-L1 polypeptide activity in the subject, the measured values ​​of the initial physiological characteristic can be used as a control for the subject.

[0208] By using the method of the present invention, the PD-L1 dsRNA agent and / or PD-L1 antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat PD-L1 disease or disorder. The efficacy of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of PD-L1 disease or disorder. In non-limiting examples, the PD-L1 mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous point in time, or compared to uncontacted control levels (e.g., PD-L1 mRNA levels in a control serum sample). It should be understood that PD-L1 mRNA levels, PD-L1 protein levels, or lipid levels, triglycerides, cholesterol levels, and free fatty acid levels in a subject, or in a plasma or tissue sample, are related to PD-L1 gene expression levels, respectively. Some embodiments of the methods of the present invention involve administering an effective amount of the PD-L1 dsRNA and / or PD-L1 antisense agent of the present invention to a subject to inhibit PD-L1 gene expression, thereby reducing PD-L1 mRNA levels, PD-L1 protein levels, or otherwise positively influencing the physiological characteristics of PD-L1-related diseases or conditions in the subject.

[0209] Some embodiments of the present invention include, for example, determining the presence, absence, and / or alteration of the physiological characteristics of a PD-L1-related disease or disorder using methods such as (1) evaluating the physiological characteristics of one or more biological samples obtained from one or more subjects, (2) imaging the subjects (e.g., obtaining liver images), and (3) performing a physical examination of the subjects, but not limited to these methods. The determination can be used to evaluate the effectiveness of the therapeutic method of the present invention.

[0210] ·kit The scope of the present invention also includes reagent kits comprising one or more PD-L1 dsRNA agents and / or PD-L1 antisense polynucleotide agents, as well as instructions for their use in the methods of the present invention. The reagent kits of the present invention may comprise one or more PD-L1 dsRNA agents, PD-L1 sense polynucleotides, and PD-L1 antisense polynucleotide agents that can be used to treat PD-L1-related diseases or conditions. Reagent kits comprising one or more PD-L1 dsRNA agents, PD-L1 sense polynucleotides, and PD-L1 antisense polynucleotide agents can be prepared and used in the therapeutic methods of the present invention. The components of the reagent kits of the present invention can be packaged in aqueous media or lyophilized form. The reagent kits of the present invention may comprise one or more container devices or a series of container devices (e.g., test tubes, vials, flasks, bottles, syringes, etc.) enclosed therein by a separate carrier. The first container device or series of container devices may comprise one or more compounds, e.g., PD-L1 dsRNA agents and / or PD-L1 sense or antisense polynucleotide agents. The second container device or series of container devices may include a targeting agent, a labeling agent, a delivery agent, etc., which may be included as part of the PD-L1 dsRNA agent and / or PD-L1 antisense polynucleotide administered in embodiments of the therapeutic method of the present invention.

[0211] The reagent kit of the present invention may further include instructions. The instructions are typically in written form and are used to instruct how to perform the treatment included in the reagent kit and to make decisions based on said treatment.

[0212] The following examples are used to illustrate specific examples of the embodiment of the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention is applicable to a variety of compositions and methods.

[0213] ●Examples Example 1. Phosphoramidite compound 2 [ka] DMTrCl (232 g, 684 mmol, 1.0 equivalent) in pyridine (400 mL) was added to a pyridine (600 mL) solution of compound A, isomannitol (100 g, 684 mmol, 1.0 equivalent), and the mixture was stirred at 25°C for 12 hours. LC-MS showed that compound A was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with dichloromethane (500 mL x 2), washed with saline solution (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1~50 / 1, 0.1% Et3N) to obtain a yellow solid compound B (150 g, yield 48.9%).

[0214] 1 H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).

[0215] At 25°C under an N2 atmosphere, 2H-tetrazole (0.45 M, 436 mL, 1.1 equivalents) was added dropwise to a solution of compound B (80.0 g, 178 mmol, 1.0 equivalent) in DCM (800 mL), and then a solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 equivalent) in DCM (200 mL) was added dropwise to the mixture. The reaction mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and a single main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500 mL), extracted with DCM (500 mL × 3), washed with NaHCO3 / saline solution = 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain compound 2 (77g, 119 mmol, yield 66.5%), which was a white solid.

[0216] 1 H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

[0217] Phosphoramidite compound 1: [ka] Under an N2 atmosphere at 0-5°C, compound D (607 mg, 3.34 mmol, 3.0 equivalents) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equivalents) were added to a DCM (5.0 mL) solution of compound B (500 mg, 1.11 mmol, 1.0 equivalent), and the mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and several new peaks appeared on LC-MS, with approximately 70.9% of the desired compound detected. The resulting reaction mixture was cooled to -20°C and poured into an ice-cold (0-5°C) saturated NaHCO3 (5.0 mL) solution. Extraction was performed with DCM (5.0 mL × 2), and the combined organic layer was washed with ice-cold (0-5°C) saturated NaHCO3 / saline solution = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and vacuum concentrated to obtain the residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to obtain compound 1 (280 mg, 471 μmol, yield 42.3%), which was a white solid.

[0218] 1 H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (br d, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).

[0219] Other phosphoramidites can be produced by the methods described herein and / or by the prior art (e.g., US426,220 and WO02 / 36743).

[0220] Example 2. Production of a solid support containing the phosphoramidite monomer of the present invention [ka] [ka] This represents the carrier portion of the highly porous aminomethyl polyethylene resin. Under the protection of nitrogen gas, 19.50 kg of dichloromethane was added to a 50 L glass reaction vessel, and stirring was started. The temperature was controlled to 20-30°C. 1.47 kg of DMTrimann, 1.50 kg of triethylamine, 0.164 kg of 4-dimethylaminopyridine, and 1.34 kg of succinic anhydride were added to the glass reaction vessel. The mixture was kept warm at 20-30°C for 18 hours, sampled, and the reaction was stopped. 22.50 kg of saturated sodium bicarbonate solution was added to the reaction system and stirred for 10-20 minutes until the layers separated. The organic phase was separated, the aqueous phase was extracted twice with dichloromethane, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and vacuum concentrated to obtain 1.83 kg of a gray to grayish-white solid residue.

[0221] N,N-dimethylformamide (23.50 kg) was added to a 100 L glass vessel and stirring was started. The temperature was controlled to 20-30°C and, under the protection of nitrogen gas, the products from the previous step, O-benzotriazoletetramethyluronium hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass vessel via a solid addition funnel, stirred for 10-30 minutes, and then discharged into a 50 L zinc drum for use. Large-porous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., lot number HA2X1209, load amount 0.48 mmol / g) was added to the above 100 L solid-phase synthesis reactor via a solid-feed funnel, the temperature was controlled to 20-30°C, N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc drum in the previous step were added to the solid-phase synthesis reactor, the reaction system was kept warm and allowed to proceed, and the solid load was monitored until it reached ≥250 umol / g, with ultraviolet light used for load detection. The mixture was filtered under nitrogen gas pressure, the filtered cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), and the filtered cake was left in the vessel. CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were added to an 80 L glass vessel and stirred for 3 to 8 minutes before use. This procedure was repeated three times, the vessel was covered, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis reaction vessel. After bubbling with nitrogen gas for 10 to 30 minutes, the mixture was pressure filtered. This procedure was repeated four times, the filtered cake in the solid-phase synthesis reaction vessel was purged with nitrogen gas for 2 to 4 hours, and then transferred to a 50 L pressure filter tank. Drying was continued while controlling the temperature to 15-30°C, and after drying, a product weighing 3.516 kg and being a yellow to white solid was obtained.

[0222] The isomannitol residue is added to the 5' or 3' end of the oligonucleotide chain by a method well known to those skilled in the art (e.g., invab), and then added to the target group.

[0223] Example 3. Synthesis of PD-L1 RNAi agent. The double-stranded PD-L1 RNAi agents listed in Tables 2-3 above were synthesized according to the following general procedure.

[0224] siRNA sense and antisense chain sequences were synthesized in an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain elongation was achieved by a four-step cycle consisting of deprotection, condensation, capping, and oxidation or sulfidation steps for the addition of each nucleotide. Synthesis was carried out on a solid support made from pore-controlled glass (CPG, 1000 angstroms). Monomer phosphoramidites may be purchased from commercial sources or may be the phosphoramidite compounds in Example 1. The phosphoramidite compounds described herein can be attached to the 3' end as monomer phosphoramidites and further attached to the CPG solid support. When attached to the 5' end, the phosphoramidite compounds can be used for the final coupling reaction and, if necessary, further bound to a target ligand.

[0225] Phosphoramidites containing GalNAc ligand clusters (GLS-5* and GLS-15* phosphoramidites are non-limiting examples) are disclosed in WO2023 / 045995A1 (the entirety of which is incorporated herein by reference). siRNAs used for in vitro screening (Table 2) were synthesized on a scale of 2 μmol, while siRNAs used for in vivo testing (Table 3) were synthesized on a scale of 5 μmol or more. When the GalNAc ligand (GLO-n phosphoramidites are disclosed as non-limiting examples in WO2023 / 045995A1 (the entirety of which is incorporated herein by reference)) was attached to the 3' end of the sense strand, a CPG solid support attached to the GalNAc ligand was used. When a GalNAc ligand (as a non-limiting example, GLS-5* or GLS-15* is attached to the 5' end of the sense chain, and GLS-5* and GLS-15* phosphoramidites having a GalNAc ligand cluster are disclosed in WO2023 / 045995A1 (which is incorporated herein in whole)) is attached to the 5' end of the sense chain, the final coupling reaction was carried out using a GalNAc phosphoramidite. Trichloroacetic acid (TCA) in 3% dichloromethane was used to deprotect the 4,4'-dimethoxytrityl protecting group (DMT). 5-Ethylthio-1H-tetrazolyl was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN were used for oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomers bound to the solid support were cleaved, and the protecting groups were removed by treatment with a 1:1 volume of 40 wt% aqueous methylamine solution and a 28% ammonium hydroxide solution. The crude mixture was concentrated to synthesize siRNA for use in vitro screening. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the single-stranded product as a sodium salt, which could be used for annealing without further purification. To synthesize siRNA for use in vivo testing, the single-stranded product was further purified by ion-pair reverse-phase HPLC (IP-RP-HPLC).The single-stranded oligonucleotide product purified from IP-RP-HPLC was converted to a sodium salt by dissolving it in 1.0 M NaOAc, and precipitated by adding ice-cold EtOH. Equimolar amounts of complementary sense and antisense oligonucleotides were annealed in water to form a double-stranded siRNA product, which was freeze-dried to obtain a fluffy white solid.

[0226] In several studies, methods for attaching a GalNAc-containing target group (also referred to herein as a GalNAc delivery compound) to the 5' end of a sense strand involved using a GalNAc phosphoramidite (GLS-5* or GLS-15* phosphoramidite) in the final coupling step of solid-phase synthesis, for example, using the same synthetic process used for extending oligonucleotide chains to add nucleotides to the 5' end of a sense strand.

[0227] In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves using a GLO-n-containing solid support (CPG). In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves attaching the GalNAc target group to a CPG solid support via ester bonding, and obtaining the GalNAc target group attached to the 3' end of the sense chain by using the CPG solid support to which the GalNAc target group obtained above is attached during the synthesis of the sense chain.

[0228] imann residues can be added to the 5' or 3' end of an oligonucleotide chain and / or further added to a GalNAc target group by methods well known to those skilled in the art, such as invab.

[0229] Example 4. In vitro screening of PD-L1 siRNA double-stranded bodies SNU-387 cells were grown in RPMI medium containing 10% FBS, streptomycin, and glutamine at 37°C under 5% CO2 conditions until near confluence, and then released from the culture dish by trypsin digestion. For transfection, 14.8 μL of Opti-MEM and 0.2 μL of Lipofectamine® RNAiMax per well were added to 5 μL of siRNA double-stranded cells per well and placed in a 96-well plate, incubated at room temperature for 15 minutes. Approximately 2 x 10⁶ cells were then transfected. 4 80 μL of full growth medium containing 1 SNU-387 cells was added to the siRNA mixture. The cells were incubated for 24 hours before RNA purification. Single-dose experiments were performed at final siRNA concentrations of 0.5 nM and 0.05 nM. mRNA was isolated, and mRNA (target gene) expression was determined by qPCR and standardized using the housekeeping gene GAPDH. The knockdown rate was calculated by comparing mRNA (target gene) expression in siRNA-treated samples and negative control-treated samples. The double-stranded sequences used correspond to those shown in Table 2, and the results are summarized in Table 5.

[0230] Table 5 presents experimental results from in vitro studies using various PD-L1 RNAi agents to inhibit PD-L1 expression. The double-stranded sequences used correspond to those shown in Table 2. Table 5 [Table 7-1] [Table 7-2] [Table 7-3]

[0231] Example 5. In vivo study of PD-L1 siRNA double strands On day 1, female C57BL / 6J mice (4 mice per group, 4-6 weeks old) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding human PD-L1 and luciferase genes. On day 8, the mice received a single subcutaneous injection of 3 mg / kg of PD-L1 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 15, 22, and 29. Plasma samples were isolated, and luciferase activity was measured according to the manufacturer's recommended procedure. Since human PD-L1 expression levels are related to luciferase expression levels, the percentage of remaining PD-L1 was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and this was standardized by the change in luciferase activity in control-treated samples over the same period. The results are summarized in Tables 6-8.

[0232] Table 6. Screening of a single subcutaneous dose of 3 mpk of PD-L1 siRNA in mice transducing AAV-PD-L1. The percentage reduction in human PD-L1 in mouse serum was standardized based on PD-L1 expression before siRNA administration and the PBS control group. Table 6 [Table 8-1] [Table 8-2]

[0233] Table 7. Screening of a single subcutaneous dose of 3 mpk of PD-L1 siRNA in mice transduced with AAV-PD-L1. The percentage reduction in human PD-L1 in mouse serum was standardized based on PD-L1 expression before siRNA administration and the PBS control group. Table 7 [Table 9-1] [Table 9-2]

[0234] Table 8. Screening of a single subcutaneous dose of 3 mpk of PD-L1 siRNA in mice transduced with AAV-PD-L1. The percentage reduction in human PD-L1 in mouse serum was standardized based on PD-L1 expression before siRNA administration and the PBS control group. Table 8 [Table 10-1] [Table 10-2]

[0235] Example 6. In vivo study of PD-L1 siRNA double strands On day 1, female C57BL / 6J mice (4 mice per group, 4-6 weeks old) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding human PD-L1 and luciferase genes. On day 8, the mice received a single subcutaneous injection of 3 mg / kg of PD-L1 siRNA drug or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 15 and 22. Plasma samples were separated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human PD-L1 expression levels are related to luciferase expression levels, the percentage of remaining PD-L1 was calculated by comparing luciferase activity in siRNA treatment group samples before and after treatment, and this was standardized by the change in luciferase activity in control treatment group samples over the same period. The results are summarized in Table 9.

[0236] Table 9. Screening of a single subcutaneous dose of 3 mpk of PD-L1 siRNA in mice transducing AAV-PD-L1. The percentage reduction in human PD-L1 in mouse serum was standardized based on PD-L1 expression before siRNA administration and the PBS control group. Table 9 [Table 11-1] [Table 11-2]

[0237] ●Equivalent While several embodiments of the present invention have been described and explained herein, those skilled in the art will readily conceive of various other means and / or structures to perform the function and / or obtain the results and / or one or more advantages described herein, and each of these variations and / or modifications will be considered to be within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and arrangements described herein are illustrative and that actual parameters, dimensions, materials and / or arrangements will depend on the specific application taught by the present invention. Those skilled in the art will recognize many equivalents of the specific embodiments of the present invention described herein, or can identify them simply by using conventional experiments. Accordingly, it should be understood that the above embodiments are shown merely illustratively and that within the scope of the appended claims and their equivalents, the present invention can be carried out in ways different from those specifically described and claimed. The present invention relates to each of the individual features, systems, articles, materials and / or methods described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods is included within the scope of the present invention, provided that such features, systems, articles, materials, and / or methods are not contradictory to each other.

[0238] All definitions defined and used herein should be understood as definitions in comparative dictionaries, definitions in documents incorporated by citation, and / or the general meaning of the terms defined.

[0239] As used herein and in the claims, the indefinite articles "a" and "an" should be understood as "at least one" unless expressly stated otherwise.

[0240] The phrase "and / or" as used in the specification and claims should be understood as "either one or both" of the elements thus combined, that is, the elements may exist in combination in some cases and separately in other cases. In addition to the elements explicitly marked in the "and / or" section, other elements may exist, whether related to the explicitly marked elements or not, unless otherwise explicitly stated.

[0241] All references, patents and patent applications, and publications cited or referenced herein are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting PD-L1 expression, wherein the dsRNA agent comprises one sense strand and one antisense strand, the sense strand comprising at least 15 consecutive nucleotides that differ by three or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprising at least 15 consecutive nucleotides that differ by three or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand may be partially, basically, or completely complementary to the antisense strand. Double-stranded ribonucleic acid (dsRNA) agent.

2. The dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 64-94, 67-97, 71-101, 72-102, 73-103, 71-103, 498-528, 552-582, 553-583, 707-737, and 713-743 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2, wherein the sense strand may be partially, basically, or completely complementary to the antisense strand. The sRNA agent according to claim 1.

3. The sense strand consists of nucleotides 69-89, 71-89, 72-92, 74-92, 76-96, 78-96, 77-97, 79-97, 78-98, 80-98, 76-98, 72-98, 503-523, 505-523, 557-577, 559-577, 558-578, 560-578, 712-732, 714-732, 718-738, and 720-738 of Sequence ID No.

1. The sequence of nucleotides comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from Sequence ID No.

2. The dsRNA agent according to claim 2.

4. The antisense strand includes a region complementary to the PD-L1 RNA transcript, and the region includes at least 15 consecutive nucleotides that differ by 1, 2, or 3 or fewer nucleotides from any one antisense sequence listed in any one of Tables 1 to 3. The dsRNA agent according to claim 1.

5. The antisense strand includes a region complementary to the PD-L1 RNA transcript, and the region includes at least 15 consecutive nucleotides from any one of the antisense sequences listed in any one of Tables 1 to 3. The dsRNA agent according to claim 1.

6. A double-stranded ribonucleic acid (dsRNA) agent that inhibits PD-L1 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, the nucleotides at positions 2 to 18 of the antisense strand comprise a region complementary to the PD-L1 RNA transcript, and the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1 to 3, and optionally comprises a target ligand. Double-stranded ribonucleic acid (dsRNA) agent.

7. The region complementary to the PD-L1 RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides, and these nucleotides differ from one of the antisense sequences listed in one of Tables 1 to 3 by no more than three nucleotides. The dsRNA agent according to claim 6.

8. The antisense strand of the dsRNA is basically or completely complementary to any one of the target regions of Sequence ID No. 1, and preferably the dsRNA agent contains an antisense strand sequence described in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 7.

9. The sense strand sequence is at least fundamentally complementary or completely complementary to the antisense strand sequence in the dsRNA agent, and preferably the dsRNA agent contains a sense strand sequence listed in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 8.

10. The dsRNA agent contains a sequence listed as a double-stranded sequence in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 9.

11. The dsRNA agent comprises at least one modified nucleotide. A dsRNA agent according to any one of claims 1 to 10.

12. All or essentially all nucleotides in the sense strand and / or antisense strand are modified nucleotides. A dsRNA agent according to any one of claims 1 to 11.

13. The dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, and the antisense strand includes a region partially complementary to the PD-L1 RNA transcript, and each strand has a length of approximately 15 to 30 nucleotides, and the sense strand includes a sequence that may be represented by formula (I). 5’-(N’ Ｌ ) ｎ’ N’ Ｌ N’ Ｌ N’ Ｌ N’ Ｌ N’ Ｆ N’ Ｌ N’ Ｆ N’ Ｌ N’ Ｎ１ N’ Ｎ２ N’ Ｌ N’ Ｌ N’ Ｌ N’ Ｌ N’ Ｌ (N’ Ｌ ) ｍ’ -3’(I) Among them, each N' Ｆ represents a 2'-fluoromodified nucleotide, and each N' Ｎ１ and N' Ｎ２ Each N' independently represents a modified or unmodified nucleotide. Ｌ The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m' and n' are each independently integers from 0 to 7. A dsRNA agent according to any one of claims 1 to 11.

14. The dsRNA agent comprises one sense strand and one antisense strand, wherein the sense strand is complementary to the antisense strand, and the antisense strand includes a region complementary to a portion of the PD-L1 RNA transcript, and each strand has a length of approximately 18 to 30 nucleotides, and the sequence contained in the sense strand may be represented by formula (II). 3’-(N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｍ４ N Ｌ N Ｌ N Ｌ N Ｍ５ N Ｌ N Ｍ６ N Ｌ N Ｌ N Ｆ N Ｌ -5’ (II) Of these, each N Ｆ This represents a 2'-fluoromodified nucleotide, and each N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ and N Ｍ６ Each N independently represents a modified or unmodified nucleotide. Ｌ This represents a modified or unmodified nucleotide independently, but it is not a 2'-fluoromodified nucleotide, and n is an integer from 0 to 7. A dsRNA agent according to any one of claims 1 to 11.

15. The dsRNA agent comprises one sense strand and one antisense strand, the sense strand and the antisense strand form a dsRNA double-stranded body, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the PD-L1 RNA transcript, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA comprises a double-stranded body represented by formula (III). Sense strand: 5'-(N' Ｌ ) ｎ’ N' Ｌ N' Ｌ N' Ｌ N' Ｌ N' Ｆ N' Ｌ N' Ｆ N' Ｌ N' Ｎ１ N' Ｎ２ N' Ｌ N' Ｌ N' Ｌ N' Ｌ N' Ｌ (N' Ｌ ) ｍ’ -3' Antisense strand: 3'-(N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｍ４ N Ｌ N Ｌ N Ｌ N Ｍ５ N Ｌ N Ｍ６ N Ｌ N Ｌ N Ｆ N Ｌ -5' (III) Eventually, Each chain has a length of approximately 18 to 30 nucleotides. Each N Ｆ and N' Ｆ each represent a 2'-fluoro modified nucleotide, and N Ｍ１ N, Ｍ２ N, Ｍ３ N, Ｍ４ N, Ｍ５ N', Ｎ１ and N' Ｎ２ each independently represent a modified or unmodified nucleotide, and N' Ｎ１ and N' Ｎ２ each contain only one 2'-fluoro modified nucleotide, and N Ｍ１ N, Ｍ２ N, Ｍ３ N, Ｍ４ N, Ｍ５ and N Ｍ６ each have only three 2'-fluoro modified nucleotides, and each N Ｌ and N' Ｌ each independently represent a modified or unmodified nucleotide, do not represent a 2'-fluoro modified nucleotide, and m', n' and n are each independently an integer from 0 to 7, A dsRNA agent according to any one of claims 1 to 11.

16. The one or more modified nucleotides are independently selected from the group consisting of 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reversed nucleotide, reversed debasalized nucleotide, isomannoside nucleotide, reversed 2'-Ome nucleotide, reversed 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, cholesterol derivatives or terminal nucleotides linked to a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphate amide ester, or nucleotides containing a non-natural base. A dsRNA agent according to any one of claims 11 to 15.

17. The guide strand contains an E-vinylphosphonate nucleotide located at its 5' end. A dsRNA agent according to any one of claims 1 to 16.

18. The dsRNA agent comprises at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 17.

19. The sense strand includes at least one phosphorothioate nucleotide interlink, A dsRNA agent according to any one of claims 1 to 17.

20. The antisense chain includes at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 17.

21. The sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 17.

22. The antisense chain contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 17.

23. The modified sense strand is one of the modified sense strand sequences shown in Tables 2 to 3. A dsRNA agent according to any one of claims 1 to 22.

24. The modified antisense chain is one of the modified antisense chain sequences shown in Tables 2-3. A dsRNA agent according to any one of claims 1 to 22.

25. The sense strand is complementary to the antisense strand, or is essentially complementary, and the length of the complementary region is between 16 and 23 nucleotides. A dsRNA agent according to any one of claims 1 to 24.

26. The length of the complementary region is 19 to 21 nucleotides. A dsRNA agent according to any one of claims 1 to 25.

27. Each chain has a length of 30 nucleotides or less. A dsRNA agent according to any one of claims 1 to 26.

28. Each chain has a length of 25 nucleotides or less. A dsRNA agent according to any one of claims 1 to 26.

29. Each chain has a length of 23 or fewer nucleotides. A dsRNA agent according to any one of claims 1 to 26.

30. The dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. A dsRNA agent according to any one of claims 1 to 29.

31. One or more target groups or binding groups are conjugated to the sense chain. The dsRNA agent according to claim 30.

32. The target group or binding group comprises N-acetylgalactosamine (GalNAc), The dsRNA agent according to claim 30 or 31.

33. The aforementioned target group includes the following structure: 【Chemistry 1】 n'' is independently selected from 1 or 2. A dsRNA agent according to any one of claims 30 to 32.

34. The target group has the following structure: A dsRNA agent according to any one of claims 30 to 33. Table 1-1 Table 1-2 Table 1-3 Table 1-4

35. The dsRNA agent comprises a target group conjugated to the 5'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 34.

36. The dsRNA agent comprises a target group conjugated to the 3' end of the sense strand. A dsRNA agent according to any one of claims 1 to 34.

37. The antisense chain contains one reverse debase residue at its 3' end. A dsRNA agent according to any one of claims 1 to 34.

38. The sense strand includes one or two reverse debase residues or imann residues at its 3' or / and 5' end. A dsRNA agent according to any one of claims 1 to 34.

39. The dsRNA agent has two blunt ends, A dsRNA agent according to any one of claims 1 to 38.

40. At least one strand contains the 3' overhang of at least one nucleotide. A dsRNA agent according to any one of claims 1 to 38.

41. At least one strand contains the 3' overhanging ends of at least two nucleotides. A dsRNA agent according to any one of claims 1 to 38.

42. The PD-L1 RNA transcript is sequence number 1. A dsRNA agent according to any one of claims 1 to 41.

43. A dsRNA agent comprising any one of claims 1 to 42, composition.

44. Further comprising a pharmaceutically acceptable carrier, The composition according to claim 43.

45. Further comprising one or more other therapeutic agents, The composition according to claim 44.

46. The composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe, or vial. The composition according to claim 45.

47. The composition is prepared for use in subcutaneous or intravenous (IV) administration. The composition according to any one of claims 43 to 46.

48. A cell comprising a dsRNA agent according to any one of claims 1 to 42, wherein the cell is optionally a mammalian cell and optionally a human cell. cell.

49. A method for inhibiting PD-L1 gene expression in cells, wherein the method is (i) Providing a cell comprising an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47, method.

50. (ii) Further comprising inhibiting the expression of the PD-L1 gene in the cells by maintaining the cells produced in claim 49(i) for a time sufficient to obtain degradation of the mRNA transcript of the PD-L1 gene, The method according to claim 49.

51. The cells are located within the body of the subject, and the dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 49 to 50.

52. The cells are located within the body of the subject, and the dsRNA agent is administered intravenously to the subject. The method according to any one of claims 49 to 50.

53. The procedure further includes evaluating inhibition of the PD-L1 gene after administering a dsRNA agent to the subject, and the evaluation method is as follows: (i) To determine one or more physiological characteristics of the subject's PD-L1-related disease or condition, (ii) Comparing the determined physiological characteristics with baseline physiological characteristics of PD-L1-related disease or condition prior to treatment and / or control physiological characteristics of PD-L1-related disease or condition, Of these, the comparison above indicates one or more types of the presence or absence of inhibition of PD-L1 gene expression in the subject. The method according to claim 51 or 52.

54. The determined physiological characteristics are one or more of the subject's PD-L1 mRNA levels, PD-L1 protein levels, or decreased PD-L1 expression, and are indirectly assessed by: measuring decreased PD-L1 biological activity or PD-L1 levels in a subject sample (e.g., serum sample); measuring decreased proteins, nucleic acids, or carbohydrates present in the source of infection; assessing the immune response by antibodies or immune cells against the source of infection; assessing the reduction of signs or symptoms of one or more infections (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); assessing the levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum; or assessing the subject's anti-HBsAg antibody level. The method according to claim 53.

55. The decrease in PD-L1 gene expression can be evaluated by a reduction in one or more of the subject's PD-L1 mRNA levels, PD-L1 protein levels and / or PD-L1 activity, a reduction in one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), or the detection of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum. The method according to claim 54.

56. A method for inhibiting PD-L1 gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47. method.

57. The dsRNA agent is administered subcutaneously to the subject. The method according to claim 56.

58. The dsRNA agent is administered intravenously to the subject. The method according to claim 56.

59. The further includes evaluating inhibition of the PD-L1 gene after administration of a dsRNA agent, of which the evaluation method is: (i) To determine one or more physiological characteristics of the subject's PD-L1-related disease or condition, (ii) Comparing the determined physiological characteristics with baseline physiological characteristics of PD-L1-related disease or condition prior to treatment and / or control physiological characteristics of PD-L1-related disease or condition, Of these, the comparison above indicates one or more types of the presence or absence of inhibition of PD-L1 gene expression in the subject. The method according to any one of claims 56 to 58.

60. The determined physiological characteristics include one or more of the subject's PD-L1 mRNA levels, PD-L1 protein levels, and / or PD-L1 activity, evaluated by signs or symptoms of one or more infections (fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss), evaluated by hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum, and evaluated by detection of the subject's anti-HBsAg antibody levels. The method according to claim 59.

61. A reduction in one or more of the PD-L1 mRNA levels, PD-L1 protein levels, and / or a decrease in PD-L1 expression of the subject is indirectly assessed by: measuring a decrease in PD-L1 biological activity or PD-L1 levels in a subject sample (e.g., serum sample); measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection; assessing the immune response by antibodies or immune cells against the source of infection; assessing a reduction in one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); assessing the levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum; or detecting the subject's anti-HBsAg antibody level. The method according to claim 59.

62. A method for treating a disease or condition associated with the presence of the PD-L1 protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47 in order to inhibit PD-L1 gene expression. method.

63. The aforementioned disease or condition is one or more of the following: tumors or hematological malignancies (e.g., lymphoma / leukemia, hematological malignancies, breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, bladder cancer, liver cancer, salivary gland cancer, gastric cancer, glioma, thyroid cancer, thymic epithelial carcinoma, head cancer, kidney cancer, pancreatic cancer, and cervical cancer), and infectious diseases (e.g., viral, bacterial, fungal, or parasitic diseases). Preferably, the infectious disease is a chronic infection caused by viruses (e.g., HIV, HBV, HCV, and HTLV), bacteria (e.g., Helicobacter pylori), and parasites (e.g., Schistosomiasis mansoni). The method according to claim 62.

64. The further step is to administer another treatment plan to the subject. The method according to claim 63.

65. The aforementioned alternative treatment plan includes administering one or more types of PD-L1 antisense polynucleotides of the present invention to the subject, administering a non-PD-L1 dsRNA therapeutic agent to the subject, and including behavioral changes in the subject. The method according to claim 64.

66. The non-PD-L1 dsRNA therapeutic agent is one or more of the following, selected from additional cancer treatments for surgery, radiotherapy, chemotherapy, targeted therapy, immunotherapy, or hormone therapy, and the non-PD-L1 dsRNA therapeutic agent is selected from additional antiviral drugs, where antiviral drugs refer to pharmaceutical compositions administered to treat viral infections. The method according to claim 65.

67. The dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 62 to 66.

68. The dsRNA agent is administered intravenously to the subject. The method according to any one of claims 62 to 66.

69. This further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject, The method according to any one of claims 62 to 68.

70. The method for determining the therapeutic effect in the subject of the aforementioned treatment is: (i) To determine one or more physiological characteristics of PD-L1-related disease or disorder in the subject, (ii) Comparing the determined physiological characteristics with baseline physiological characteristics prior to treatment of PD-L1-related disease or disorder, Among these, the comparison indicates one or more of the presence, absence, and level of effectiveness of administering double-stranded ribonucleic acid (dsRNA) agents to the subject. The method according to claim 69.

71. The determined physiological characteristics are a decrease in the subject's PD-L1 mRNA level, PD-L1 protein level, or PD-L1 expression, assessed indirectly by measuring a decrease in PD-L1 biological activity or by measuring PD-L1 levels in a subject sample (e.g., serum sample); assessed by measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection; assessed by the presence of an immune response (e.g., demonstrated by the presence of antibodies or immune cells against the source of infection); assessed by the reduction of one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); assessed by hepatitis B surface antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum; and assessed by detecting the level of anti-HBsAg antibodies in the subject's body. The method according to claim 70.

72. A reduction in one or more PD-L1 mRNA levels, PD-L1 protein levels, and / or a decrease in PD-L1 expression in a subject is indirectly assessed by: measuring a decrease in PD-L1 biological activity or PD-L1 levels in a subject sample (e.g., serum sample); measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection; assessing the immune response by antibodies or immune cells against the source of infection; assessing a reduction in one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); measuring levels of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum; or detecting the subject's anti-HBsAg antibody level. The method according to claim 70.

73. A method for reducing the level of PD-L1 protein in a subject compared to a pre-treatment baseline level of PD-L1 protein in the subject, wherein the pre-treatment baseline is the level obtained by administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42, or a composition according to any one of claims 43 to 47, in order to reduce the level of PD-L1 gene expression. method.

74. The dsRNA agent is administered subcutaneously to the subject or intravenously to the subject. The method according to claim 73.

75. A method for altering the physiological characteristics of a PD-L1-related disease or condition in a subject compared to baseline physiological characteristics before treatment, wherein the pre-treatment baseline method comprises administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47 in order to alter the physiological characteristics of the PD-L1-related disease or condition in the subject. method.

76. The dsRNA agent is administered subcutaneously to the subject or intravenously to the subject. The method according to claim 75.

77. The aforementioned physiological characteristics are one or more of the subject's PD-L1 mRNA level, PD-L1 protein level, and / or PD-L1 expression decrease, and are indirectly evaluated by: measuring a decrease in PD-L1 biological activity or PD-L1 level in a subject sample (e.g., serum sample); measuring a decrease in proteins, nucleic acids, or carbohydrates present in the source of infection; evaluating the immune response by antibodies or immune cells against the source of infection; evaluating the reduction of one or more signs or symptoms of infection (e.g., fever, pain, nausea, vomiting, blood chemical abnormalities, weight loss); evaluating the level of hepatitis B antigen (HBsAg), HBeAg, or HB cccDNA in the subject's serum; and evaluating the subject's anti-HBsAg antibody level. The method according to any one of claims 75 to 76.

Images