Regulation of ALAS1 (5'-aminolevulinate synthase 1) gene expression

Abstract

This disclosure relates to methods, compositions, and kits for treating conditions related to the regulation of 5'-aminolevulinate synthase 1 (ALAS1) expression by gene editing.

Description

[Technical Field]

[0001] Related applications This application claims priority under U.S. Provisional Patent Application No. 63 / 515,045 filed July 21, 2023; U.S. Provisional Patent Application No. 63 / 598,408 filed November 13, 2023; and U.S. Provisional Patent Application No. 63 / 624,610 filed January 24, 2024. The entire contents of these applications are expressly incorporated herein by reference.

[0002] Sequence listing reference This application is filed together with an electronic sequence listing. The sequence listing is submitted as a file titled 80EM-341775-WO_SequenceListing, created on June 29, 2024, with a size of 399 kilobytes. The electronic information of the sequence listing is incorporated herein by reference in its entirety.

[0003] This disclosure relates to the fields of molecular biology and biotechnology, including gene editing, in general. [Background technology]

[0004] 5'-aminolevulinic acid synthase 1 (ALAS1) is the enzyme that catalyzes the first and rate-limiting step in heme synthesis in the liver. ALAS1 catalyzes the synthesis of 5-aminolevulinic acid (ALA) from glycine and succinyl-CoA. ALAS1 (e.g., ALAS1 overexpression) is associated with various conditions, including porphyria.

[0005] DNA targeting using RNA guides, the DNA targeting principle of CRISPR (clustered, regularly arranged short palindromic sequence repeats)-Cas (CRISPR-related) systems, is widely used. CRISPR-Cas systems can be classified into two classes: Class 1 systems (such as CRISPR-Cas systems I, III, and IV) that utilize complexes of multiple Cas proteins, and Class 2 systems (such as CRISPR-Cas systems II, V, and VI) that utilize a single Cas protein. Class II CRISPR-Cas-based systems are used for genome editing and require a Cas polypeptide or its variants guided by a customizable guide RNA (gRNA) for programmable DNA targets. [Overview of the project] [Problems that the invention aims to solve]

[0006] There is a need to develop safe and effective treatments to manage and prevent ALAS1-related diseases and disorders. [Means for solving the problem]

[0007] Disclosed herein are guide RNAs (gRNAs) for targeting the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA includes a spacer sequence comprising one of the sequences 25–48 and 83–112.

[0008] In some embodiments, the spacer sequence includes a sequence selected from the group consisting of SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes a spacer sequence including one of the sequences SEQ ID NOs. 25-37 and 101-112. In some embodiments, the gRNA includes a spacer sequence including the sequence SEQ ID NOs. 45, 83, 86, or 87. In some embodiments, the gRNA includes a spacer sequence including the sequence SEQ ID NOs. 25, 26, 27, 29, or 30. In some embodiments, the gRNA includes a spacer sequence including the sequence SEQ ID NOs. 29 or 30. In some embodiments, the gRNA induces or can induce a cleavage efficiency of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% for the target ALAS1 genomic locus. In some embodiments, the gRNA can induce a cleavage efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% for the target ALAS1 genomic locus. In some embodiments, the gRNA can reduce or induce a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% for the target ALAS1 genomic locus. In some embodiments, the gRNA is a single guide RNA (sgRNA).

[0009] gRNA can be chemically modified gRNA. In some embodiments, chemically modified gRNA contains one or more phosphorothioate bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some embodiments, less than 50% of the gRNA nucleotides contain 2'-O-methyl modifications. In some embodiments, about 48% of the gRNA nucleotides contain 2'-O-methyl modifications. In some embodiments, the 5' end of the gRNA contains three phosphorothioate bonds, and the 3' end of the gRNA contains three phosphorothioate bonds.

[0010] The disclosures herein include compositions. In some embodiments, the composition comprises (a) any of the gRNAs disclosed herein or a polynucleotide encoding a gRNA, and (b) an endonuclease or a nucleic acid encoding an endonuclease. In some embodiments, the composition comprises (a) any of the gRNAs disclosed herein or a polynucleotide encoding a gRNA, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0011] In some embodiments, the composition comprises (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence containing one of the sequences 25-48 and 83-112; and (b) a Cas9 endonuclease or nucleic acid encoding a Cas9 endonuclease.

[0012] In some embodiments, the spacer sequence includes a sequence selected from the group consisting of SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA contains one or more phosphorothioate bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some embodiments, less than 50% of the gRNA nucleotides contain 2'-O-methyl modifications. In some embodiments, approximately 48% of the gRNA nucleotides contain 2'-O-methyl modifications. In some embodiments, the 5' end of the gRNA contains three phosphorothioate bonds, and the 3' end of the gRNA contains three phosphorothioate bonds.

[0013] In some embodiments, the Cas9 endonuclease is selected from Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitides Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, and T. denticola Cas9. In some embodiments, the composition comprises (a) ALAS1 gRNA and (b) Cas9 endonuclease, where ALAS1 gRNA and Cas9 nuclease are formulated as ribonucleoprotein particles (RNPs). In some embodiments, the composition comprises (a) nucleic acid encoding ALAS1 gRNA and (b) nucleic acid encoding Cas9 endonuclease. In some embodiments, (a) and / or (b) are present in a viral vector. In some embodiments, the viral vector is an adeno-associated virus vector. In some embodiments, (a) gRNA or a nucleic acid encoding gRNA, (b) Cas9 endonuclease or a nucleic acid encoding Cas9 endonuclease, or both, are complexed with liposomes or lipid nanoparticles (LNPs). In some embodiments, the lipid nanoparticles include one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids. In some embodiments, the lipid nanoparticles include cholesterol, polyethylene glycol (PEG) lipids, or both.

[0014] The disclosures herein include methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the methods include administering one of the compositions disclosed herein to a subject to treat a disease or disorder caused by ALAS1 overexpression in that subject.

[0015] The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the methods include administering one of the compositions disclosed herein to a subject to thereby treat porphyria.

[0016] The disclosure herein includes methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the method includes administering a composition to a subject comprising (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating diseases or disorders caused by ALAS1 overexpression in the subject. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence comprising any one of sequences 25-48 and 83-112; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating diseases or disorders caused by ALAS1 overexpression in the subject.

[0017] The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating porphyria. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence comprising any one of sequences 25-48 and 83-112; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating porphyria.

[0018] Cas9 endonucleases may be, for example, Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, or T. denticola Cas9. In some embodiments, the nanoparticles are lipid nanoparticles. Lipid nanoparticles may include, for example, one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids. In some embodiments, the lipid nanoparticles include cholesterol, polyethylene glycol (PEG) lipids, or both. The method may involve administering the composition to a subject in a single dose of about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg, or 2.0 mg / kg as the sum of the nucleic acids of (a) and (b). In some embodiments, the method involves a single dose of the composition to the subject. In some embodiments, the subject is administered the composition two or more times. In some embodiments, each of the two or more doses is spaced about two weeks to about four weeks apart. In some embodiments, each of the two or more doses is spaced at least three months apart.

[0019] In some embodiments, ALAS1 expression in a subject is reduced. In some embodiments, ALAS1 expression is reduced in the liver of the subject. In some embodiments, the reduction is a reduction compared to (a) the ALAS1 expression of the subject before administration of the composition; (b) the ALAS1 expression in one or more untreated subjects; and / or (c) a reference level of ALAS1 expression in a healthy subject. In some embodiments, ALAS1 expression in a subject is reduced by at least 20% after administration. In some embodiments, ALAS1 expression in a subject is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% after administration. In some embodiments, the level of ALAS1 mRNA is reduced by at least 90% following administration. In some embodiments, the level of ALAS1 protein is reduced by at least 75% following administration. In some embodiments, the reduction lasts for at least two weeks, at least three weeks, at least four weeks, or at least one month. The method may include administering a therapeutically effective dose of at least one additional therapeutic agent to the subject. In some embodiments, additional therapeutic agents include hematin, heme arginite, ALAS1 siRNA, or a combination thereof.

[0020] In some embodiments, subjects have or are suspected of having cutaneous porphyria. Cutaneous porphyria may be, for example, congenital erythropoiesis (CEP), myelohepatic porphyria (HEP), patent cutaneous porphyria (PCT), or myeloid protoporphyria and X-linked porphyria (EP / XLP). In some embodiments, subjects have, are suspected of having, or have had acute porphyria. Acute porphyria may be, for example, acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), atypical porphyria (VP), or delta-aminolevulinic acid dehydratase deficiency porphyria (ADP). In some embodiments, the frequency of acute porphyria attacks is reduced in subjects compared to subjects before administration.

[0021] The subject may have an increase in urinary porphobilinogen (PBG), an increase in urinary aminolevulinic acid (ALA), an increase in urinary porphyrin, an increase in fecal porphyrin, an increase in plasma porphyrin, or any combination thereof. In some embodiments, it is compared to a reference value. In some embodiments, the levels of plasma and / or urinary porphobilinogen (PBG), plasma and / or urinary aminolevulinic acid (ALA), urinary porphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof are reduced in the subject following administration of the composition. In some embodiments, the level of ALAS1 mRNA in the urine of the subject is reduced following administration of the composition; wherein the reduction is a reduction compared to (a) the subject's ALAS1 mRNA level prior to administration of the composition; (b) the ALAS1 mRNA level in one or more untreated subjects; and / or (c) the reference level of ALAS1 mRNA in healthy subjects. In some embodiments, the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of ALAS2, ALAD, HMBS, UROD, UROS, CPOX, PPOX, and FECH. In some embodiments, the mutation results in a reduction in the expression, stability, and / or activity of the RNA and / or protein product of at least one gene.

Brief Description of the Drawings

[0022] [Figure 1] Figure 1 shows non-limiting and exemplary data showing the editing efficiency of gRNAs containing the indicated spacer sequences in Huh7-Cas9 human hepatoma cells.

[0023] [Figure 2] Figure 2 shows non-limiting and exemplary data showing the editing efficiency of gRNAs containing the indicated spacer sequences in LLC-MK2 rhesus kidney cells.

[0024] [Figure 3]Figure 3 shows non-limiting, illustrative data illustrating the editing efficiency of gRNAs containing the indicated spacer sequence in AML12-Cas9 mouse hepatocytes.

[0025] [Figure 4] Figure 4 shows non-limiting, illustrative data illustrating the editing efficiency of gRNAs containing the indicated spacer sequence in human hepatocytes derived from two donors.

[0026] [Figure 5] Figure 5 shows non-limiting, illustrative data illustrating the editing efficiency of gRNAs containing the indicated spacer sequences in mouse liver. As used herein, "mpk" represents LNPs per kilogram (mg / kg) of mouse body weight.

[0027] [Figure 6] Figure 6 shows non-restrictive, illustrative data illustrating the editing efficiency of gRNA containing the xhALAS1_E5_G5 (SEQ ID NO: 30) spacer sequence in primary human hepatocytes.

[0028] [Figure 7] Figure 7 shows a non-limiting diagram illustrating the rationale for the treatment of acute intermittent porphyria.

[0029] [Figure 8] Figure 8 shows non-limiting, illustrative data regarding the activity of the gRNAs of this disclosure. The percentage of ALAS1 editing in the livers of individual NHPs administered with the gRNAs shown is indicated.

[0030] [Figure 9A]Figures 9A and 9B show non-limiting, exemplary data on ALAS1 editing and protein dose curves in human and NHP hepatocytes treated with LNPs formulated with Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30). Figure 9A shows data from human hepatocytes. Figure 9B shows data from NHP hepatocytes. Protein levels are expressed as relative expression of treated samples compared to untreated samples. [Figure 9B] Same as above. [Modes for carrying out the invention]

[0031] The following detailed description refers to the accompanying drawings, which form part thereof. In the drawings, similar symbols typically indicate similar components unless otherwise indicated by the context. The exemplary embodiments described in the detailed description, drawings and claims are not limiting. Other embodiments are available, and other variations may be made without departing from the spirit and scope of the subject matter shown herein. The aspects of this disclosure generally described herein and illustrated in the drawings may be arranged, substituted, combined, separated and designed in a wide variety of different arrangements, all of which are clearly intended herein and form part of the disclosure herein.

[0032] All patents, published patent applications, other publications, and sequences derived from GenBank and other databases referenced herein are incorporated herein by reference in their entirety with respect to the relevant technology.

[0033] The disclosure herein includes guide RNA (gRNA) for targeting the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA includes a spacer sequence containing one of the sequences 25-48 and 83-112.

[0034] The disclosures herein include compositions. In some embodiments, the compositions include (a) any of the gRNAs disclosed herein or a polynucleotide encoding a gRNA, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0035] In some embodiments, the composition comprises (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence containing one of the sequences 25-48 and 83-112; and (b) a Cas9 endonuclease or nucleic acid encoding a Cas9 endonuclease.

[0036] The disclosures herein include methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the methods include administering one of the compositions disclosed herein to a subject to treat a disease or disorder caused by ALAS1 overexpression in that subject.

[0037] The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the methods include administering one of the compositions disclosed herein to a subject to thereby treat porphyria.

[0038] The disclosure herein includes methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating diseases or disorders caused by ALAS1 overexpression in the subject. The disclosure herein includes methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence comprising one of the sequences 25-48 and 83-112; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating diseases or disorders caused by ALAS1 overexpression in the subject.

[0039] The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the method includes administering a composition to a subject comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating the porphyria. The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the method includes administering a composition to a subject comprising (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence comprising one of the sequences of SEQ ID NOs. 25-48 and 83-112; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating the porphyria.

[0040] definition Unless otherwise defined, technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which this disclosure pertains. See, for example, Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY 1989). For the purposes of this disclosure, the following terms are defined:

[0041] As used herein, the term "about" may mean plus or minus 5% of the indicated value.

[0042] As used herein, the term “RNA-guided endonuclease” refers to a polypeptide that can bind to RNA (e.g., gRNA) to form a complex that is targeted to a specific DNA sequence (e.g., in target DNA). Non-limiting examples of RNA-guided endonucleases are Cas polypeptides (e.g., Cas endonucleases, e.g., Cas9 endonucleases). In some embodiments, the RNA-guided endonucleases described herein are targeted to a specific DNA sequence in target DNA by the RNA molecule to which they bind. The RNA molecule may contain a sequence that is complementary to and can hybridize with a specific sequence in the target DNA, thereby enabling the targeting of the binding polypeptide to a specific position in the target DNA.

[0043] As used herein, the terms “guide RNA” or “gRNA” may refer to site-specific targeted RNA that can bind to an RNA guide endonuclease to form a complex, thereby directing the activity of the bound RNA guide endonuclease (such as Cas endonuclease) to a specific sequence within a target nucleic acid (e.g., a specific gene or region within a gene). Guide RNA may comprise one or more RNA molecules.

[0044] As used herein, “secondary structure” of a nucleic acid molecule (e.g., RNA fragment or gRNA) refers to base pairing interactions within the nucleic acid molecule.

[0045] As used herein, the terms “Cas endonuclease” or “Cas nuclease” refer to RNA-guided DNA endonucleases associated with and / or derived from the CRISPR-adaptive immune system.

[0046] Unless otherwise indicated, "nuclease" and "endonuclease" are used interchangeably herein to refer to enzymes that possess catalytic activity for nucleotide chain cleavage for polynucleotide cleavage.

[0047] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Polynucleotides may be polymers containing single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids / triple helixes, or purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, unnatural or derivatized nucleotide bases.

[0048] As used herein, the term "binding" refers to non-covalent interactions between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be "associated" or "interacting" or "binding" (e.g., when it is stated that molecule X interacts with molecule Y, it means that molecule X binds to molecule Y in a non-covalent manner). Binding interactions can be characterized by a dissociation constant (Kd), e.g., 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M, 10 -14 M, 10 -15 M or a number or range between any two of these values or a Kd less than these, or may be dependent on environmental conditions such as pH and temperature. "Affinity" refers to the strength of binding, and an increase in binding affinity correlates with a decrease in Kd.

[0049] As used herein, the term “hybridizing” or “hybridize” refers to the pairing of substantially complementary or complementary nucleic acid sequences in two different molecules. Pairing can be achieved by any step of linking a substantially or completely complementary sequence through base pairing so that the nucleic acid sequence forms a hybridization complex. “Hybridizing” or “hybridize” may include denaturing a molecule to disrupt its intramolecular structure (or multiple) [e.g., secondary structure (or multiple)]. In some embodiments, denaturing a molecule includes heating a solution containing the molecule to a temperature sufficient to disrupt the molecule’s intramolecular structure. In some cases, denaturing a molecule includes adjusting the pH of a solution containing the molecule to a pH sufficient to disrupt the molecule’s intramolecular structure. For the purposes of hybridization, two nucleic acid sequences or segments of sequences are “substantially complementary” if at least 80% of their individual bases are complementary to each other. In some embodiments, a splint oligonucleotide sequence is not more than 50% identical to one of two polynucleotides (e.g., RNA fragments) designed to be complementary. The complementary portions of each sequence may be referred to herein as “segments,” and segments are substantially complementary if they have 80% or more identity.

[0050] The terms “complementarity” and “complementary” mean that a nucleic acid can form hydrogen bonds with another nucleic acid based on the traditional Watson-Crick base pairing rule, i.e., adenine (A) pairs with thymine [T, or uracil (U) in RNA], and guanine (G) pairs with cytosine (C). Complementarity may be perfect (e.g., fully complementary) or imperfect (e.g., partially complementary). Perfect or fully complementary indicates that each and every nucleic acid base in one strand can form hydrogen bonds with the corresponding base in another antiparallel nucleic acid sequence according to the Watson-Crick base pairing rule. Partial complementarity indicates that only a portion of consecutive residues in a nucleic acid sequence can form Watson-Crick base pairs with the same number of consecutive residues in another antiparallel nucleic acid sequence. In some embodiments, complementarity can be a number or range between at least 70%, 80%, 90%, 100%, or any two of these values. In some embodiments, complementarity is perfect, i.e., 100%. For example, a complementarity candidate sequence segment is perfectly complementary to a candidate sequence segment, and its sequence can be inferred from the candidate sequence segment using the Watson-Crick base pairing rule.

[0051] As used herein, the terms “nucleic acid” and “polynucleotide” are interchangeable and refer to any nucleic acid composed of phosphodiester bonds, or modified bonds such as phosphotriesters, phosphoramidates, siloxanes, carbonates, carboxymethyl esters, acetamidates, carbamates, thioethers, cross-linked phosphoramidates, cross-linked methylenephosphonates, cross-linked phosphoramidates, cross-linked phosphoramidates, cross-linked methylenephosphonates, phosphorothioates, methylphosphonates, phosphorodithioates, cross-linked phosphorothioates, or sultone bonds, and combinations thereof. The terms “nucleic acid” and “polynucleotide” also explicitly include nucleic acids composed of bases other than the five biologically present bases (adenine, guanine, thymine, cytosine, and uracil).

[0052] The terms “DNA editing efficiency” or “editing efficiency” may be used interchangeably herein and may refer to the number or percentage of the target sequence edited. For example, if a CRISPR-Cas9 system edits 10% of the target sequence (e.g., within an intracellular or cell population), the system may be described as having an efficiency of 10%. In some embodiments, efficiency may be reported as a percentage of indels, e.g., the percentage of insertions and / or deletions detected in the target sequence. Indels (e.g., insertions-deletions) may result from the repair of double-strand DNA breaks caused by Cas9 cleavage, including, but not limited to, non-homologous end-joining (NHEJ) repair.

[0053] As used herein, the term “off-target editing frequency” refers to the number or percentage of DNA sequences that are edited unintentionally. On-target and off-target editing frequencies can be measured by methods and assays, including high-throughput sequencing reads, further considering the techniques well known in the art described herein. As used herein, high-throughput sequencing involves hybridization of nucleic acid primers (e.g., DNA primers) that are complementary to nucleic acid (e.g., DNA) regions immediately upstream or downstream of the target sequence or off-target sequence of interest. Since many Cas9-dependent off-target sites have high sequence identity to the target site of interest, nucleic acid primers that are sufficiently complementary to upstream or downstream regions of the Cas9-dependent off-target site can be designed using techniques and kits well known in the art. These kits utilize polymerase chain reaction (PCR) amplification, which produces augmentation byproducts as intermediate products. Target and off-target sequences may include genomic loci, further comprising protospacers and PAMs. Therefore, as used herein, the term “augmentation by-products” may refer to nucleic acid molecules that constitute genomic loci, protospacers, and PAM aggregates. High-throughput sequencing techniques used herein include Sanger sequencing and / or whole-genome sequencing (WGS).

[0054] As used herein, the terms “transfection” or “infection” refer to the introduction of nucleic acids into host cells, such as by contacting cells with liposomes or nanoparticles (e.g., lipid nanoparticles) as described herein.

[0055] As used herein, “treatment” refers to a clinical intervention performed in response to a disease, disorder, or physiological condition exhibited by or susceptible to a patient. Objectives of treatment include, but are not limited to, the reduction or prevention of symptoms, the slowing or cessation of the progression or worsening of a disease, disorder, or condition, and / or the improvement of a disease, disorder, or condition. “Treatment” refers to either or both therapeutic treatments and preventive or preventive measures. Individuals in need of treatment include those already suffering from a disease, disorder, or undesirable physiological condition, and those for whom the disease, disorder, or undesirable physiological condition can be prevented.

[0056] As used herein, the terms “effective dose,” “pharmaceutical effective dose,” and “therapeutic effective dose” refer to an amount sufficient to produce a beneficial or desirable biological and / or clinical outcome.

[0057] As used herein, the term “pharmaceutically acceptable excipient” refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive, or diluent for the administration of the compound(s) of interest to a subject. A pharmaceutically acceptable excipient may include substances referred to as a pharmaceutically acceptable diluent, a pharmaceutically acceptable additive, and a pharmaceutically acceptable carrier.

[0058] As used herein, “subject” refers to an animal for which diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. As used herein, “mammal” refers to, but is not limited to, individuals belonging to the class Mammalia, including, humans, domesticated animals and livestock, zoo animals, sporting animals and companion animals. Non-exclusive examples of mammals include mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cattle; horses; primates, such as monkeys, chimpanzees and apes, and especially humans. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. In some embodiments, the subject has or is suspected of having an ALAS1-related disease or disorder.

[0059] 5'-aminolevulinic acid synthase 1 (ALAS1) and heme biosynthesis 5'-aminolevulinate synthase 1 or delta-aminolevulinate synthase 1 (ALAS1) is a nucleus-encoded mitochondrial protein that catalyzes the first step in heme biosynthesis. ALAS1 primarily functions in the liver, where heme is needed for, for example, the synthesis of P450 enzymes. Its paralog, ALAS2, is primarily active in the bone marrow. ALAS enzymes (e.g., ALAS1) catalyze the condensation of glycine with succinyl-CoA to form delta-aminolevulinic acid (ALA). The first step in heme biosynthesis is the rate-limiting step in the pathway in the liver. In some embodiments, ALAS1 levels are controlled via negative feedback, where heme negatively regulates ALAS1 expression and / or activity.

[0060] The next steps in heme biosynthesis are summarized below. From ALA, the enzyme ALA-dehydratase (ALAD) catalyzes the condensation of two ALA molecules to form porphobilinogen (PBG). Next, porphobilinogen deaminase (PBGD) activity converts four PBG molecules to hydroxymethylbilane (HMB). Uroporphyrinogen III synthase (UROS or UROIIIS) catalyzes the formation of uroporphyrinogen III from hydroxymethylbilane. Uroporphyrinogen decarboxylase (UROD) catalyzes the removal of four carboxyl groups from the carboxymethyl side chain in uroporphyrinogen to yield coproporphyrinogen. The enzymes coproporphyrinogen oxidase (CPO or CPOX) and protoporphyrinogen oxidase (PPO or PPOX) convert coproporphyrinogen to protoporphyrinogen IX, and then to protoporphyrin IX. In the final step, iron is inserted into protoporphyrin IX to form heme, a reaction catalyzed by ferrochelatase (FECH). The products of each of these reactions may be referred to as "porphyrins" in some embodiments.

[0061] As described above, the ALAS1 enzyme is the rate-limiting step in the heme biosynthesis pathway, and overexpression of ALAS1 may lead to diseases or disorders, such as porphyria, in subjects with mutations in other enzymes in the pathway. Mouse studies have found that the ubiquitously expressed isozyme ALAS1 has an essential function for early embryogenesis in mice. ALAS1-null embryos are lethal by embryonic day 8.5 (E8.5). However, no apparent abnormalities were observed in heterozygous knockout animals up to 20 weeks of age (A1+ / - mice). In some embodiments, heterozygous mice exhibited a prediabetic phenotype under normal dietary conditions, showing glucose intolerance and insulin resistance in an age-dependent manner (in contrast to the overt diabetic phenotype), as well as abnormalities in skeletal muscle mitochondria. Notably, dietary administration of ALA was found to reverse insulin resistance and glucose intolerance in aged A1+ / - mice. While there was no significant reduction in total heme levels, a reduction in the regulatory "free heme" pool was observed in the cytosolic or mitochondrial fractions of skeletal muscle from aged A1+ / - mice compared to aged wild-type (WT) mice. In contrast to ALAS2, there are no reports of human disease directly resulting from mutations in ALAS1.

[0062] Nervous System or Skin: There are mainly two types of porphyria, based on whether they primarily affect the nervous system or the skin. In acute hepatic porphyria, four types of acute porphyria affect the nervous system. Two of these may also affect the skin. Symptoms of acute porphyria (e.g., seizures) can develop over hours or days and last for days or weeks. There are at least four types of acute porphyria that can result from porphyrin accumulation, for example, in the liver. Acute intermittent porphyria (AIP) affects the nervous system, atypical porphyria (VP) affects the nervous system and skin, hereditary coproporphyria (HCP) affects the nervous system and skin, and delta-aminolevulinic acid (ALA) dehydratase deficiency porphyria (ALAD) affects the nervous system. Four types of cutaneous porphyria affect only the skin and produce chronic or persistent symptoms. Individuals with cutaneous porphyria may develop skin symptoms such as blistering or pain after their skin is exposed to sunlight. In porphyria cutaneous porphyria (PCT), porphyrins may accumulate in the liver. In congenital erythropoiesis (CEP), porphyrins may accumulate in the bone marrow. In myelohepatic porphyria (HEP), porphyrins may accumulate in the liver. In myeloid protoporphyria and X-linked porphyria (EP / XLP), porphyrins may accumulate in the bone marrow. In some embodiments, the onset of symptoms occurs later in life in humans, for example, between the ages of 12 and 65.

[0063] Acute intermittent porphyria (AIP) is the most common acute porphyria, with a prevalence of 5 to 10 cases per 100,000 people. In the United States, 1 in 1,675 people carry a genetic mutation related to AIP. This disorder is caused by a deficiency in the enzyme porphobilinogen deaminase (hydroxymethylbilan synthase, also known as HMBS) on chromosome 11 q23.3. Atypical porphyria (VP) is caused by a PPOX gene mutation (chromosome 1 q22-23) resulting in a deficiency in the function of the enzyme protoporphyrinogen oxidase. Hereditary coproporphyria (HCP) is caused by a CPOX gene mutation (chromosome 3 q11.2) resulting in a deficiency in the enzyme coproporphyrinogen oxidase. The above disorders and mutations are typically autosomal dominant mutations, meaning that, for example, only one copy of the gene needs to be mutated for the disorder to occur. ALA-dehydratase deficiency porphyria (ALAD), a rare condition, is caused by a recessive mutation (for example, both copies of the gene must be mutated). The ALAD gene mutation (chromosome 9 q34) results in a deficiency of the enzyme aminolevulinic acid dehydratase.

[0064] AIP results from a mutation in the hydroxymethylbilane synthase gene (HMBS), which encodes the third enzyme in the heme biosynthesis pathway. A deletion of functional HMBS prevents the breakdown of ALA and PBG, which are toxic to the liver and other organs. Knocking out ALAS1, the first enzyme in the pathway, can lower ALA and PBG levels and prevent future seizures and chronic symptoms (Figure 7). The prevalence of AIP (HMBS- / +) in the general population was estimated at 1:1,600 with a penetrant of approximately 2-3% (or 10-20%, NIH 2023). New data for the AIP family suggest low penetrants due to ambiguous symptoms / misdiagnosis / missed diagnoses. Penetrants in these studies are actually 20-40% (based on symptomatic diagnoses on questionnaires). Furthermore, many patients are symptomatic but do not believe they have clinical findings. Previous treatments (e.g., siRNA administration) are hindered by adverse effects such as elevated liver function test (LFT) levels in >15% of patients (transient, but administered monthly) and cannot be used to improve diagnosis.

[0065] Without being constrained by any particular theory, diseases such as porphyria result from the accumulation of precursor molecules (e.g., porphyrins) of the heme biosynthesis pathway, which can be toxic. Alcohol consumption, drug therapy, stress, hormonal changes, and other factors can trigger episodes or attacks of, for example, "acute porphyria." Acute porphyria may be characterized by multiple symptoms, but are not limited to, abdominal and / or chest pain, muscle weakness, autonomic neuropathy (e.g., hypertension, tachycardia, nausea, vomiting, and constipation), and neurological symptoms such as changes in mental state, and may also have symptoms on the skin. Nonacute (or cutaneous) porphyria primarily affects the skin. Both acute and cutaneous porphyria may produce, for example, photosensitivity, blisters, and painful redness and swelling of the skin. Porphyria attacks can be treated, for example, by providing hemins, but long-term and / or prophylactic, and more effective treatment and care are needed for diseases caused by ALAS1 overexpression.

[0066] gene editing This specification provides methods, compositions, and kits for editing the ALAS1 gene and thereby reducing the expression level of the ALAS1 protein (e.g., the concentration of ALAS1 protein in a target liver). Gene editing (including genome editing) is a type of genetic manipulation in which nucleotides / nucleic acids are inserted, deleted, and / or substituted into DNA sequences, such as the genome of a targeted cell. Targeted gene editing allows for insertion, deletion, and / or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or targeted DNA sequence). For example, if the sequence of an endogenous gene is edited by deletion, insertion, or substitution of nucleotides / nucleic acids, the endogenous gene containing the affected sequence may be knocked out or knocked down for the alteration of the sequence. Thus, targeted editing can be used to disrupt endogenous gene expression. "Targeted integration" refers to the process of inserting one or more exogenous sequences, with or without deletion of an endogenous sequence at the insertion site. If a donor template containing exogenous sequences is present, targeted integration may result from targeted gene editing.

[0067] Targeted editing can be achieved either through a nuclease-independent approach or a nuclease-dependent approach. In a nuclease-independent targeted editing approach, homologous recombination is guided by a homologous sequence adjacent to an exogenous polynucleotide introduced into an endogenous sequence via an enzymatic mechanism in the host cell. The exogenous polynucleotide can introduce nucleotide deletions, insertions, or substitutions into the endogenous sequence.

[0068] Alternatively, nuclease-dependent approaches can achieve high-frequency targeted editing through the specific introduction of double-strand breaks (DSBs) by specific low-frequency cleavage nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ) that occurs in response to DSBs. DNA repair by NHEJ often results in random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ-mediated repair, repair can also occur by homologous recombination repair (HDR). If a donor template containing exogenous genetic material is present adjacent to pairs of homologous arms, the exogenous genetic material is introduced into the genome by HDR, resulting in targeted integration of the exogenous genetic material.

[0069] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; associated with clustered, regularly arranged short palindromic sequence repeats). Additionally, DICE (Dual Integrase Cassette Exchange) systems utilizing phiC31 and Bxb1 integrases can also be used for targeted integration.

[0070] ZFNs are targeted nucleases containing a nuclease fused to a zinc finger DNA-binding domain (ZFBD), which are polypeptide domains that bind to DNA in a sequence-specific manner via one or more zinc fingers. A zinc finger is a domain of approximately 30 amino acids within a zinc finger-binding domain whose structure is stabilized through the coordination of a zinc ion. Examples of zinc fingers, but not limited to, include C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. Designed zinc finger domains are non-natural domains whose design / composition primarily arises from reasonable criteria, such as substitution rules and the application of computer-processed algorithms regarding processing information in databases of existing ZFP designs and binding data. For example, see U.S. Patents 6,140,081; 6,453,242; and 6,534,261; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496, the entire content of which is incorporated by reference. Selected zinc finger domains are domains not found in nature whose production arises primarily from empirical processes such as phage display, interaction trapping, or hybrid selection. ZFNs are described in detail in U.S. Patents 7,888,121 and 7,972,854. The most recognized example of a ZFN is a fusion of a FokI nuclease and a zinc finger DNA-binding domain.

[0071] TALENs are targeted nucleases containing nucleases fused to the TAL effector DNA-binding domain. The "transcription activator-like effector DNA-binding domain," "TAL effector DNA-binding domain," or "TALE DNA-binding domain" is the polypeptide domain of the TAL effector protein that enables the TAL effector protein to bind to DNA. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the nucleus of plant cells and bind to effector-specific DNA sequences via their DNA-binding domains, activating gene transcription at these sequences via their transactivation domains. TAL effector DNA-binding domain specificity depends on effector-variable number of incomplete 34-amino acid repeats, including polymorphisms at selective repeat sites called repeat variable-diresidues (RVDs). TALENs are described in more detail in US2011 / 0145940. The most recognized example of TALEN in this field is a fusion polypeptide of FokI nuclease to the TAL effector DNA-binding domain.

[0072] Additional examples of targeted nucleases suitable for use provided herein, but not limited to, Bxb1, phiC31, R4, PhiBT1, and Wb / SPBc / TP901-1, whether used individually or in combination, include. Other non-limiting examples of targeted nucleases include naturally occurring and recombinant nucleases, such as CRISPR / Cas9, restriction endonucleases, and meganuclease-homing endonucleases.

[0073] CRISPR-Cas gene editing system and RNA guide nuclease In some embodiments, the vectors, compositions, methods, and kits described herein may be used in gene editing systems, such as the CRISPR-Cas gene editing system, to genetically edit the ALAS1 gene. For example, the CRISPR-Cas9 system is a defense mechanism naturally present in prokaryotes and has been used for another purpose as an RNA-guided DNA-targeting platform for gene editing. It relies on the DNA nuclease Cas9 and two non-coding RNAs, s-crisprRNA (crRNA) and transactivating RNA (tracrRNA), to target DNA cleavage. The crRNA drives the sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing at a typically 20-nucleotide (nt) sequence in the target DNA. If the target sequence is followed by a specific short DNA motif (e.g., having the sequence NGG) called a protospacer proximity motif (PAM), the CRISPR-Cas9 complex will only bind to the DNA sequence containing the sequence match to the first 20nt of the crRNA, single guide RNA (sgRNA). TracrRNA hybridizes with the 3' end of crRNA to form an RNA double-strand structure to which the Cas9 endonuclease binds, forming a catalytically active CRISPR-Cas9 complex that can then cleave target DNA. Once the CRISPR-Cas9 complex binds to the DNA at the target site, the two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, resulting in a double-strand break (DSB) where both strands of DNA terminate with a base pair (blunt end). The next crucial step after the binding of the CRISPR-Cas9 complex to the DNA at the specific target site and the formation of a site-specific DSB is DSB repair. Cells use two main DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homologous recombination repair (HDR). In some embodiments, the CRISPR-Cas9 gene editing system includes an RNA guide nuclease and one or more guide RNAs targeting one or more target genes.

[0074] Where used herein, RNA guide endonucleases may be naturally occurring or not. Non-exclusive examples of RNA guide endonucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, and Csm3. Examples include Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases and their functional derivatives. In some embodiments, the RNA-guided endonuclease is a Cas9 endonuclease. The Cas9 endonuclease may be derived, for example, from Streptococcus pyogenes (SpCas9 or SpyCas9), Staphylococcus lugdunensis (SluCas9), or Staphylococcus aureus (SaCas9). In some embodiments, the RNA-guided endonuclease is a variant of Cas9, but is not limited to, low-molecular-weight Cas9, dead Cas9 (dCas9), and Cas9 nickase. In some embodiments, the Cas nuclease may comprise a RuvC or RuvC-like nuclease domain (e.g., Cpf1) and / or an HNH or HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 endonuclease is Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9, or variants thereof.

[0075] RNA guide endonucleases can be small RNA guide endonucleases. Small RNA guide endonucleases may be manipulated from a portion of RNA guide endonucleases derived from any of the RNA guide endonucleases described herein or known in the art. Small RNA guide endonucleases can be, for example, small Cas endonucleases. In some cases, small RNA guide endonucleases are shorter than approximately 1,100 amino acids in length.

[0076] RNA-guided endonucleases can be mutant RNA-guided endonucleases. For example, an RNA-guided endonuclease may be a mutant of a naturally occurring RNA-guided endonuclease. A mutant RNA-guided endonuclease may also be a mutant RNA-guided endonuclease with altered activity compared to a naturally occurring RNA-guided endonuclease, such as altered or repressed DNA endonuclease activity without substantially reducing its binding affinity to DNA. Such modifications, such as methylation, demethylation, acetylation or deacetylation, or any other modification of DNA-binding and / or DNA-modifying proteins known in the art, can enable sequence-specific DNA targeting of the mutant RNA-guided endonuclease for transcriptional regulation (e.g., activation or repression), epigenetic modification, or chromatin modification. In some embodiments, the mutant RNA-guided endonuclease does not have DNA endonuclease activity.

[0077] RNA guided endonucleases may be nickases that cleave the complementary strand of target DNA but have reduced ability to cleave the non-complementary strand, or cleave the non-complementary strand of target DNA but have reduced ability to cleave the complementary strand. In some embodiments, RNA guided endonucleases have reduced ability to cleave both the complementary and non-complementary strands of target DNA.

[0078] In some embodiments, a nucleic acid encoding an RNA guide endonuclease is administered to a subject. In some embodiments, the nucleic acid may be generated by an in vitro transcription reaction. In some embodiments, generating in vitro transcription RNA involves incubating a linear DNA template with RNA polymerase and a nucleotide mixture under conditions that allow (run-off) RNA in vitro transcription. The nucleotide mixture may be part of an in vitro transcription mix (IVT mix). In some embodiments, the RNA polymerase is T7 RNA polymerase.

[0079] The nucleotide mixture used in RNA in vitro transcription may additionally contain modified nucleotides as defined below. In some embodiments, the nucleotide mixture used for the RNA in vitro transcription reaction (e.g., fractions of each nucleotide in the mixture) may be optimized for a given RNA sequence (optimized NTP mix). Such a method is described, for example, in WO2015 / 188933. RNA obtained by the process using the optimized NTP mix is ​​characterized in some embodiments by a reduction in immunostimulatory properties.

[0080] In some embodiments, the nucleotide mixture consists of (chemically) unmodified ribonucleoside triphodes (NTPs) GTP, ATP, CTP, and UTP. In some embodiments, in vitro transcription may involve the presence of at least one cap analogue, e.g., cap1 trinucleotide cap analogue, m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG, m7G(5')ppp(5')(2'OMeA)pG, or rn7(3'OMeG)(5')ppp(5')(2'OMeA)pG. In some embodiments, the 5'-cap structure is formed via enzymatic capping using a capping enzyme (e.g., vaccinia virus capping enzyme and / or cap-dependent 2'-O-methyltransferase) that produces a cap0, cap1, or cap2 structure. The 5' cap structure (cap0 or cap1) may also be added using an immobilized capping enzyme and / or cap-dependent 2'-O-methyltransferase, using the methods and means disclosed in WO2016 / 193226. In some embodiments, some or all of at least one (ribo)nucleoside triphodes are replaced by a modified triphodes. In some embodiments, the modified triphodes include pseudouridine (ψ), N1-methylpsoiduridine (m1 ψ), 5-methylcytosine, or 5-methoxyuridine. In some embodiments, uracil nucleotides in a nucleotide mixture are replaced (either partially or completely) with pseudouridine (ψ) and / or N1-methylpsoiduridine (m1 ψ) to obtain modified RNA. In some embodiments, the chemically modified nucleotide is pseudouridine (ψ). In some embodiments, the chemically modified nucleotide is N1-methylpsoiduridine (m1ψ). In some embodiments, the nucleotide mixture comprises at least one modified nucleotide and / or at least one nucleotide analogue or nucleotide derivative for incorporation into RNA. For example, a modified nucleotide as defined herein may include nucleotide analogues / modifications, such as skeletal modifications, sugar modifications, or base modifications.Skeletal modifications may include modifications in which the phosphate group of the nucleotide skeleton is chemically modified. Sugar modifications may include chemical modifications of the sugar in the nucleotide. Furthermore, base modifications may include chemical modifications of the base portion of the nucleotide. In this context, nucleotide analogues or modifications may include nucleotide analogues applicable to transcription and / or translation. In some embodiments, the nucleotide mixture contains at least one modified nucleotide, and / or at least one nucleotide analogue is selected from skeletal modified nucleotides, sugar modified nucleotides, and / or base modified nucleotides, or a combination thereof.

[0081] Modified nucleosides and nucleotides, which are present in nucleotide mixtures and may be incorporated into RNA, may be modified at the sugar moiety. For example, the 2' hydroxyl group (OH) may be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxyl group modifications, but not limited to these, include alkoxy or aryloxy (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH 20Examples of “deoxy” modifications include nCH2CH2OR; a “locked” nucleic acid (LNA) in which the 2' hydroxyl is linked to the 4' carbon of the same ribose sugar, for example, by a methyllene crosslink; and an amino group (-O-amino, where the amino group may be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy. Examples of “deoxy” modifications include hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino or amino acid); or the amino group may be attached to the sugar via a linker, where the linker comprises one or more C, N, and O atoms. The sugar group may also contain one or more carbons having the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified RNA molecules may include, for example, nucleotides containing arabinose as the sugar.

[0082] The phosphate backbone may be further modified in modified nucleosides and nucleotides that are included in nucleotide mixtures and can be incorporated into modified in vitro transcription RNA. The phosphate group of the backbone may be modified by replacing one or more oxygen atoms with various substituents. Furthermore, modified nucleosides and nucleotides may also include complete replacement of the unmodified phosphate moiety with the modified phosphate described herein. Examples of modified phosphate groups, but not limited to, include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotryesters. In phosphorothioates, both unlinked oxygen atoms are replaced with sulfur. The phosphate linker may be modified by replacement of the linked oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate).

[0083] The nucleotides described herein may be modified at the nucleic acid base portion. Examples of nucleic acid bases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein may be chemically modified on the main groove surface. In some embodiments, examples of main groove chemical modifications include amino groups, thiol groups, alkyl groups, or halo groups.

[0084] In some embodiments, the nucleotide analogs / modifications are 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo(lodo)-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5- Iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'- Includes triphot, 8-azaadenosine-5'-triphot, 8-azidoadenosine-5'-triphot, benzimidazole-riboside-5'-triphot, N1-methyladenosine-5'-triphot, N1-methylguanosine-5'-triphot, N6-methyladenosine-5'-triphot, O6-methylguanosine-5'-triphot, pseudouridine-5'-triphot, puromycin-5'-triphot, and xanthosine-5'-triphot. Base-modified nucleotides include 5-methylcytidine-5'-triphot,7-Deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate, pyridine-4-onyribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-psoidouridine, 2-thio-psoidouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethylpsoidouridine, 5-propynyluridine, 1-propynylpsoidouridine, 5-taurinomethyluridine Zin, 1-taurinomethyl-psoidouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-psoidouridine, 4-thio-1-methyl-psoidouridine, 2-thio-1-methyl-psoidouridine, 1-methyl-1-deaz-psoidouridine, 2-thio-1-methyl-1-deaz-psoidouridine, dihydrouridine, dihydropsoidouridine, 2-thio-dihydrouridine, 2-thio-dihydropsoidouridine, 2-methoxyuridine, 2-methoxy-4 -Thio-uridine, 4-methoxy-psoidouridine, 4-methoxy-2-thio-psoidouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-psoidisocytidine, pyrrolocytidine, pyrrolocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thio-psoidisocytidine, 4-thio-1-methyl-psoidisocytidine, 4-thio-1-methyl-1-deaza -Pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebralin, 5-aza-zebralin, 5-methyl-zebralin, 5-aza-2-thio-zebralin, 2-thio-zebralin, 2-methoxycytidine, 2-methoxy-5-methylcytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine,7-Deaza-2,6-diaminopurine, 7-Deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine 2-methoxyadenine, inosine, 1-methylinosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl 8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-psoidouridine, 6-aza-cytidine, 2-thiocytidine, alpha-thiocytidine, pseudo-isocytidine, 5-aminoallyl-u Lysine, 5-iodouridine, N1-methylpsoidouridine, 5,6-dihydrouridine, alpha-thiouridine, 4-thiouridine, 6-azauridine, 5-hydroxyuridine, deoxythymidine, 5-methyluridine, pyrrolocytidine, inosine, alpha-thioguanosine, 6-methylguanosine, 5-methylcytidine, 8-oxoguanosine, 7-deazaguanosine, N1-methyladenosine, 2-amino-6-chloropurine, N6-methyl-2-aminopurine,It may contain pseudoisocytidine, 6-chloropurine, N6-methyladenosine, alpha-thioadenosine, 8-azidoadenosine, or 7-deazaadenosine.

[0085] At least one modified nucleotide and / or at least one nucleotide analogue is 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, 2'-O-methyladenosine, 2-methylthio-N6-methyladenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl-N 6-Threonylcarbamoyladenosine, N6-Hydroxynorvalylcarbamoyladenosine, 2-Methylthio-N6-Hydroxynorvalylcarbamoyladenosine, Inosine, 3-Methylcytidine, 2-O-Methylcytidine, 2-Thiocytidine, N4-Acetylcytidine, Lysidine, 1-Methylguanosine, 7-Methylguanosine, 2'-O-Methylguanosine, Quosin, EpoxyQuosin, 7-Cyano-7-Deazaguanosine, 7-Ami May contain nomethyl-7-deazaguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine', 5-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0086] In some embodiments, the chemical modifications include pseudouridine, N1-methylpsoiduridine, N1-ethylpsoiduridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-psoiduridine, 2-thio-1-methylpsoiduridine, 2-thio-5-aza-uridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-1-methylpsoiduridine, 4-thiopsoiduridine, 5-aza-uridine, dihydropsoiduridine, 5-methoxyuridine, or 2'-O-methyluridine.

[0087] In some embodiments, 100% of the uracil in the coding sequence may have chemical modifications as defined herein. In some embodiments, the chemical modification is at the 5' position of uracil. In some embodiments, 100% of the uracil in the RNA coding sequence (cds) may have chemical modifications, for example, at the 5' position of uracil. In other embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the uracil nucleotides in the cds have chemical modifications, for example, at the 5' position of the uracil nucleotides. Such modifications can reduce stimulation of the innate immune system (after in vivo administration of RNA containing such modified nucleotides).

[0088] As used herein, the terms “cds,” “coding sequence,” or “coding region” are sequences of several nucleotide triplets that are recognized and understood by those skilled in the art and can be translated into peptides or proteins, and may refer to, for example, RNA cds. RNA cds may comprise at least one modified nucleotide, where the at least one modified nucleotide may be selected from pseudouridine (ψ), N1-methylpsoiduridine (m1ψ), 5-methylcytosine, and 5-methoxyuridine.

[0089] As used herein, the terms “modified nucleotide” or “chemically modified nucleotide” may refer to all possible natural and non-natural chemical modifications of the components of RNA, namely ribonucleotides A, G, C, and U.

[0090] In various embodiments, the nucleotide mixture in the in vitro transcription reaction product contains a cap analogue. Therefore, in some embodiments, the cap analogue is a cap0, cap1, cap2, modified cap0 or modified cap1 analogue, or a cap1 analogue as described below.

[0091] As used herein, the terms “cap analogue” or “5'-cap structure” may refer to the 5' structure of RNA, in particular a guanine nucleotide located at the 5' end of RNA, such as mRNA. In some embodiments, the 5'-cap structure is ligated to the RNA via a 5'-5'-triphosphate bond. In some embodiments, the “5'-cap structure” or “cap analogue” is not considered to be a “modified nucleotide” or “chemically modified nucleotide.” Suitable 5'-cap structures include cap0 (methylation of the first nucleic acid base, e.g., m7GpppN), cap1 (additional methylation of the ribose of a nucleotide adjacent to m7GpppN), cap2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), cap3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), cap4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse cap analogue), modARCA (e.g., phosphothioate modARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0092] 5'-cap (cap0 or cap1) structures may be formed in chemoRNA synthesis using capping enzymes or in RNA in vitro transcription (capping in simultaneous transcription) using cap analogues. As used herein, the term “cap analogue” may refer to a non-polymerizable dinucleotide or trinucleotide having cap function that promotes translation or localization and / or prevents RNA degradation when incorporated into the 5' end of RNA. Non-polymerizable means that the cap analogue does not have a 5' triphosphate and is therefore incorporated only at the 5' end, and thus cannot be extended in the 3' direction by a template-dependent polymerase (e.g., DNA-dependent RNA polymerase). Examples of cap analogues include m7GpppG, m7GpppA, m7GpppC; non-methylated cap analogues (e.g., GpppG); dimethylated cap analogues (e.g., m2,7GpppG); trimethylated cap analogues (e.g., m2,2,7GpppG); dimethylated symmetric cap analogues (e.g., m7Gpppm7G); or anti-reverse cap analogues (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives). Further cap-like equivalents are described, for example, in WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347 and WO2013 / 059475. More preferred cap-like equivalents in this context are described, for example, in WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 053297, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797, in which disclosures relating to cap-like equivalents are incorporated herein by reference.

[0093] In some embodiments, the cap1 structure is produced using tri-nucleotide cap analogues disclosed in WO2017 / 053297, WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797. For example, any cap analogue derived from the structures disclosed in claims 1 to 5 of WO2017 / 053297 can be suitably used to produce the cap1 structure by co-transcription. In some embodiments, any cap analogue derived from the structures described in WO2018 / 075827 can be suitably used to produce the cap1 structure by co-transcription. In some embodiments, the cap1 analogue is a cap1 trinucleotide cap analogue. In some embodiments, the cap1 structure of in vitro transcribed RNA is formed by capping during co-transcription using the tri-nucleotide cap analogue m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG. In some embodiments, the cap1 analogue is m7G(5')ppp(5')(2'OMeA)pG.

[0094] In some embodiments, the RNA (e.g., mRNA) includes a 5' cap structure, e.g., a cap1 structure. In some embodiments, the 5' cap structure improves the stability and / or expression of the mRNA. mRNA containing a cap1 structure (e.g., produced by in vitro transcription) has several advantageous properties, including increased translation efficiency and reduced stimulation of the innate immune system. In some embodiments, the in vitro transcribed RNA includes at least one coding sequence encoding at least one peptide or protein. In some embodiments, the protein is an RNA guide endonuclease. In some embodiments, the RNA guide endonuclease is Cas9 or a derivative thereof.

[0095] This disclosure provides an optimized mRNA encoding *Streptococcus pyogenes* Cas9 endonuclease ("SpCas9 mRNA"), optionally containing chemically modified nucleotides, which, when administered with one or more gRNAs, results in effective genome editing of a target cell population. In some embodiments, this disclosure provides mRNA comprising (i) a 5' untranslated region (UTR); (ii) a translation region (ORF) containing a nucleotide sequence encoding a site-specific endonuclease; and (iii) a 3' untranslated region (UTR). In some embodiments, the site-specific endonuclease is a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide is a *Streptococcus pyogenes*-derived Cas9 (SpCas9) polypeptide. In some embodiments, the ORF further comprises one or more nucleotide sequences encoding a nuclear localization signal, such as those described herein. In some embodiments, the ORF comprises a nucleotide sequence encoding a site-specific endonuclease, such as a SpCas9 polypeptide, and at least one NLS, which is a nucleoplasmin and / or SV40 NLS. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal and / or C-terminal NLS operably ligated to a site-specific endonuclease, such as a SpCas9 polypeptide. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal SV40 NLS operably ligated to a site-specific endonuclease, such as a SpCas9 polypeptide, and a C-terminal nucleoplasmin NLS operably ligated to a site-specific endonuclease, such as a SpCas9 polypeptide.

[0096] In some embodiments, the disclosure provides mRNA containing a nucleotide sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the disclosure provides mRNA containing a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the mRNA contains a codon-optimized sequence containing a nucleotide sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence of SEQ ID NO: 51.

[0097] In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence of SEQ ID NO: 50. In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 50.

[0098] In some embodiments, the mRNA may contain at least one chemically modified nucleoside and / or nucleotide. In some embodiments, the chemically modified nucleoside and / or nucleotide is selected from pseudouridine, N1-methylpsoiduridine, and 5-methoxyuridine. In some embodiments, the chemically modified nucleoside is N1-methylpsoiduridine (e.g., 1-methylpsoiduridine). In some embodiments, at least about 80% or more of the uridine in the mRNA (e.g., about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) is modified or replaced with N1-methylpsoiduridine. In some embodiments, 100% of the uridine (e.g., uracil) in the mRNA is modified or replaced with N1-methylpsoiduridine. In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 50, wherein 100% of the uridine or uracil in the mRNA is modified or replaced with N1-methylpsoiduridine. In some embodiments, two or more (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 6 Uridine or uracil residues (0, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800 and above) are N1-methylpsoidouridine.

[0099] In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence of SEQ ID NO: 52. In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence having one, two, three, four, or five mismatches to the nucleotide sequence of SEQ ID NO: 52. In some embodiments, the Disclosure provides mRNA containing a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 52.

[0100] Some embodiments provide mRNA comprising a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 50, wherein 100% of the uridine (e.g., uracil) in the mRNA is modified or replaced with N1-methylpsoiduridine. In some embodiments, the mRNA comprises or consists of the nucleotide sequence of SEQ ID NO: 52. In some embodiments, the mRNA may further comprise a 5' cap, such as those described herein. The 5' cap may be, for example, a cap-0, cap-1, or cap-2 structure. SEQ ID NO: 51 is a non-limiting and exemplary sequence of parental Cas9 mRNA. SEQ ID NO: 52 is a codon-optimized sequence derived from parental Cas9 mRNA, where some u in SEQ ID NO: 52 are N1-methylpsoiduridine.

[0101] For example, the optimized mRNA encoding Cas9 is also described in US20210355463A1, which is incorporated herein by reference in its entirety.

[0102] Guide RNA (gRNA) In some embodiments, the CRISPR / Cas-mediated gene editing system used to genetically edit the ALAS1 gene includes a genome-targeted nucleic acid (e.g., guide RNA) that can direct the activity of an RNA-guided endonuclease to a specific target sequence within the ALAS1 gene. The guide RNA includes at least a spacer sequence that hybridizes to the specific nucleic acid sequence of interest and a CRISPR repeat sequence. The gRNA may be a single-molecule guide RNA (sgRNA) or a double-molecule guide RNA. The RNA-guided endonuclease may be a Cas endonuclease, including, for example, a Cas9 endonuclease. The Cas9 endonuclease may be, for example, a SpCas9, SaCas9, or SluCas9 endonuclease. In some embodiments, the RNA endonuclease is a Cas9 variant. In some embodiments, the RNA-guided endonuclease is a small-molecule RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a small-molecule Cas endonuclease.

[0103] In some embodiments, the gRNA includes a 5'-to-3' spacer sequence and a tracrRNA, where the crRNA and tracrRNA hybridize to form a double helix. In some embodiments, the crRNA includes a spacer sequence and a crRNA repeat sequence that can target a target sequence in a target nucleic acid (e.g., a genomic DNA molecule). In some embodiments, the tracrRNA includes a tracrRNA antirepeat sequence and a 3' tracrRNA sequence. In some embodiments, the 3' end of the crRNA repeat sequence is ligated to the 5' end of the tracrRNA antirepeat sequence, for example, by a tetraloop, where the crRNA repeat sequence and the tracrRNA antirepeat sequence hybridize to form an sgRNA. In some embodiments, the sgRNA includes a 5'-to-3' spacer sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA antirepeat sequence, and a 3' tracrRNA sequence. In some embodiments, the sgRNA includes a 5' spacer extension sequence. In some embodiments, the sgRNA includes a 3' tracrRNA extension sequence. 3' tracrRNA may contain or consist of one or more stem-loops, for example, one, two, three, or more stem-loops.

[0104] In some embodiments, the sgRNA sequence includes the nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 49), or a nucleotide sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide deletions, insertions, or substitutions compared to SEQ ID NO: 49. In some embodiments, the sgRNA is intended for use in combination with Streptococcus pyogenes Cas9 endonuclease (also referred to herein as SpCas9 or SpyCas9).

[0105] The guide RNAs disclosed herein can target any desired sequence via a spacer sequence. The spacer sequence in the gRNA is a sequence (e.g., a 20-nucleotide sequence) that determines the target sequence (e.g., a DNA target sequence such as a genomic target sequence) of the target gene (e.g., the ALAS1 gene). In some embodiments, the spacer sequence is in the range of 15 to 30 nucleotides. For example, the spacer sequence may be, at least obtain or at most obtain nucleotides of length 10, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50 or any of these values. In some embodiments, the spacer sequence contains 20 nucleotides. In some embodiments, the gRNA can hybridize to the forward strand of the target dsDNA. In some embodiments, the gRNA can hybridize to the reverse strand of the target dsDNA. In some embodiments, the gRNA can hybridize to a DNA strand complementary to the target PAM strand in the dsDNA.

[0106] The terms “target nucleic acid,” “target site,” and “target sequence” may be used interchangeably throughout this document and may refer to any nucleic acid sequence that can be targeted by the gRNA sequences described herein. In some embodiments, the “target sequence” is located in a target gene, which is a sequence adjacent to a PAM sequence and modified by an RNA guide nuclease (e.g., Cas9). The “target sequence” may be located on the so-called PAM strand in the “target nucleic acid,” which is a double-stranded molecule containing a PAM strand and a complementary non-PAM strand. Those skilled in the art will recognize that the gRNA spacer sequence hybridizes to a complementary sequence located on the non-PAM strand of the target nucleic acid of interest. Thus, in some embodiments, the gRNA spacer sequence is the RNA equivalent of the target sequence. The gRNA spacer interacts with the target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). Thus, the nucleotide sequence of the spacer varies depending on the target sequence of the target nucleic acid of interest. In some embodiments, the target sequence of the ALAS1 gene is located within exons 3, 4, 5, or 6 of the ALAS1 gene.

[0107] In the CRISPR / Cas system used herein, the spacer sequence is designed to hybridize to a region of the target nucleic acid located at 5' of the PAM recognizable by the Cas9 enzyme used in the system. The spacer may or may not be a perfect match to the target sequence. Each Cas9 enzyme has a specific PAM sequence in the target DNA that it recognizes. For example, Streptococcus pyogenes recognizes a PAM containing the sequence 5'-NRG-3' in its target nucleic acid, where R is either A or G, N is any nucleotide, and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[0108] In some embodiments, the target nucleic acid sequence is 20 nucleotides long. In some embodiments, the target nucleic acid is less than 20 nucleotides long. In some embodiments, the target nucleic acid is greater than 20 nucleotides long. In some embodiments, the target nucleic acid is at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides long. In some embodiments, the target nucleic acid is at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides long. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' of the first nucleotide of the PAM. For example, 5'-NNNNNNNNNNNNNNNNNNNN NRG In sequences containing -3', the target nucleic acid may be the sequence corresponding to N, where N may be any nucleotide, and the underlined NRG sequence (R is G or A) is the Streptococcus pyogenes PAM. In some embodiments, the PAM sequence used in the compositions and methods of this disclosure as the sequence recognized by SpCas9 is NGG, where N may be A, T, C or G.

[0109] In some embodiments, the complementarity percentage between the spacer sequence and the target nucleic acid is about, at least, at least about, at most or at most about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer sequence of the guide RNA and the target nucleic acid in the target gene are 100% complementar. In some embodiments, the complementarity percentage between the spacer sequence and the target nucleic acid is 100% for the six consecutive 5' nucleotides of the target sequence in the complementary strand of the target nucleic acid. In some embodiments, the complementarity percentage between the spacer sequence and the target nucleic acid is at least 60% for about 20 consecutive nucleotides. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, for example, up to 9, 8, 7, 6, 5, 4, 3, 2, or 1 mismatch.

[0110] In some embodiments, the gRNA is a chemically modified gRNA. Various types of RNA modifications may be introduced into the gRNA to enhance stability, reduce the likelihood or degree of the innate immune response, and / or enhance other properties described in the art. The gRNAs described herein may include one or more modifications, including nucleoside-to-nucleoside bonds, purine pyrimidine bases, or sugars. In some embodiments, the modifications are introduced into the gRNA terminus by chemical synthesis or by polymerase enzymes. Examples of modified nucleic acids and their synthesis are disclosed in WO2013 / 052523. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

[0111] In some embodiments, the chemically modified gRNA contains phosphorothioated 2'-O-methyl nucleotides at the 3' and 5' ends of the gRNA. In some embodiments, the chemically modified gRNA contains phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA. In some embodiments, the chemically modified gRNA contains phosphorothioated 2'-O-methyl nucleotides at the 5' end of the gRNA. In some embodiments, the chemically modified gRNA contains 3 or 4 phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA and / or 3 or 4 at the 5' end. In some embodiments, any one of the gRNAs containing SEQ ID NOs. 25-48 and 83-112 may be chemically modified to contain 4 or more phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA and / or 3 at the 5' end.

[0112] The number and location of phosphorothioate bonds may vary. In some embodiments, the bonds may be located between the 1st and 2nd, 2nd and 3rd, 3rd and 4th positions from the 5' end of the gRNA, between the 4th and 5th, 5th and 6th, 6th and 7th, 7th and 8th, between the 8th and 9th, 9th or 10th, or further positions. In some embodiments, the bonds may be located between the 1st and 2nd, 2nd and 3rd, 3rd and 4th positions from the 3' end of the gRNA, between the 4th and 5th, 5th and 6th, 6th and 7th, 7th and 8th, 8th and 9th, 9th or 10th, or further positions.

[0113] In some embodiments, the nucleotide analogs / modifications are 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2 '-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-azacitidine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate This may include phosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate. The base-modified nucleotide is 5-methylcytidine-5'-triphosphate,7-Deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate, pyridine-4-onyribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-psoidouridine, 2-thio-psoidouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethylpsoidouridine, 5-propynyluridine, 1-propynylpsoidouridine, 5-taurinomethyluridine Zin, 1-taurinomethyl-psoidouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-psoidouridine, 4-thio-1-methyl-psoidouridine, 2-thio-1-methyl-psoidouridine, 1-methyl-1-deaz-psoidouridine, 2-thio-1-methyl-1-deaz-psoidouridine, dihydrouridine, dihydropsoidouridine, 2-thio-dihydrouridine, 2-thio-dihydropsoidouridine, 2-methoxyuridine, 2-methoxy-4 -Thio-uridine, 4-methoxy-psoidouridine and 4-methoxy-2-thio-psoidouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-psoidisocytidine, pyrrolocytidine, pyrrolocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thio-psoidisocytidine, 4-thio-1-methyl-psoidisocytidine, 4-thio-1-methyl-1- Aza-psoidisocytidine, 1-methyl-1-deaza-psoidisocytidine, zebralin, 5-aza-zebralin, 5-methyl-zebralin, 5-aza-2-thio-zebralin, 2-thio-zebralin, 2-methoxycytidine, 2-methoxy-5-methylcytidine, 4-methoxy-psoidisocytidine, 4-methoxy-1-methyl-psoidisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine,7-Deaza-2,6-diaminopurine, 7-Deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio Luthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine and 2-methoxy-adenine, inosine, 1-methyl-inosine, waiosin, waibutosin, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7 -Methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1 -thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-psoidouridine, 6-azacytidine, 2-thiocytidine, alpha-thiocytidine, pseudoisocytidine, 5-aminoallyl-uridine, 5-iodouridine, N1 -Methyl-psoidouridine, 5,6-dihydrouridine, alpha-thiouridine, 4-thiouridine, 6-azauridine, 5-hydroxyuridine, deoxythymidine, 5-methyluridine, pyrrolocytidine, inosine, alpha-thioguanosine, 6-methylguanosine, 5-methylcytidine, 8-oxoguanosine, 7-deazaguanosine, N1-methyladenosine, 2-amino-6-chloropurine, N6-methyl-2-aminopurine, pseudoisocytidine, 6-chloropurine, N6-methyladenosine,It may contain alpha-thio-adenosine, 8-azido-adenosine, or 7-deaza-adenosine.

[0114] At least one modified nucleotide and / or at least one nucleotide analogue is 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, 2'-O-methyladenosine, 2-methylthio-N6-methyladenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl-N 6-Threonylcarbamoyladenosine, N6-Hydroxynorvalylcarbamoyladenosine, 2-Methylthio-N6-Hydroxynorvalylcarbamoyladenosine, Inosine, 3-Methylcytidine, 2-O-Methylcytidine, 2-Thiocytidine, N4-Acetylcytidine, Lysidine, 1-Methylguanosine, 7-Methylguanosine, 2'-O-Methylguanosine, Quosin, EpoxyQuosin, 7-Cyano-7-Deazaguanosine, 7-Ami May contain nomethyl-7-deazaguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine', 5-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0115] In some embodiments, the chemical modifications include pseudouridine, N1-methylpsoiduridine, N1-ethylpsoiduridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-psoiduridine, 2-thio-1-methylpsoiduridine, 2-thio-5-aza-uridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-1-methylpsoiduridine, 4-thiopsoiduridine, 5-aza-uridine, dihydropsoiduridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modification includes 2'-O-methyluridine (2'OMe-rU), 2-O-methylcytidine (2'OMe-rC), 2'-O-methyladenosine (2'OMe-rA), or 2'-O-methylguanosine (2'OMe-rG).

[0116] gRNA may contain any number of modified nucleic acids. In some embodiments, the percentage of modified nucleic acids in the gRNA molecule is 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39% of the gRNA sequence. It may be, at least possible, about possible or at least about possible, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, at least possible, about possible or at least about possible. In some embodiments, less than 50% of the nucleotides of the gRNA contain 2'-O-methyl modifications.

[0117] In some embodiments, more than one guide RNA may be used with the CRISPR / Cas nuclease system. Each guide RNA may contain a different targeting sequence so that the CRISPR / Cas system cleaves more than one target nucleic acid. In some embodiments, one or more guide RNAs may have the same or different properties, such as activity or stability, within the Cas9 RNP complex. When more than one guide RNA is used, each guide RNA may be encoded in the same or different vectors.

[0118] In some embodiments, the gRNAs described herein may be produced by in vitro transcription (IVT), synthesis and / or chemical synthesis, or a combination thereof. One or more of the following methods may be used: enzymatic IVT, solid-phase, liquid-phase, combined synthetic method, small region synthesis, and ligation method. In some embodiments, the gRNAs are prepared using enzymatic IVT synthesis. Methods for preparing polynucleotides by IVT are well known in the art and are described in WO2013 / 151666. Polynucleotide constructs and vectors may be used to prepare the gRNAs described herein for in vitro transcription.

[0119] The disclosure herein includes guide RNA (gRNA) for targeting the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA includes a spacer sequence containing one of the sequences SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes a spacer sequence containing one of the sequences SEQ ID NOs. 25-48 and 83-112, or a variant thereof having three or fewer mismatches compared to one of the sequences SEQ ID NOs. 25-48 and 83-112. The spacer sequence may include a sequence selected from the group consisting of SEQ ID NOs. 25-48 and 83-112.

[0120] The gRNA may contain a spacer sequence containing one of the sequences of SEQ ID NOs. 25-37 and 101-112. In some embodiments, the gRNA may contain a spacer sequence containing one of the sequences of SEQ ID NOs. 25-37 and 101-112, or a variant thereof having three or fewer mismatches compared to one of the sequences of SEQ ID NOs. 25-37 and 101-112.

[0121] In some embodiments, the gRNA includes a spacer sequence containing the sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA includes a spacer sequence containing any one of the sequences of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87, or a variant thereof having three or fewer mismatches compared to any one of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 45. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 83. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 86. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 87.

[0122] In some embodiments, the gRNA includes a spacer sequence containing the sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer sequence containing any one of the sequences of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30, or a variant thereof having three or fewer mismatches compared to any one of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 25. In some embodiments, the gRNA includes a spacer sequence containing or consisting of the sequence of SEQ ID NO: 26. In some embodiments, the gRNA includes a spacer sequence containing or consisting of the sequence of SEQ ID NO: 27. In some embodiments, the gRNA includes a spacer sequence containing the sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer sequence containing the sequence of SEQ ID NO: 29 or SEQ ID NO: 30, or a variant thereof having three or fewer mismatches compared to SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer sequence containing or consisting of the sequence of SEQ ID NO: 29. In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 30.

[0123] In some embodiments, the gRNA is at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%) of the target ALAS1 genomic locus. Cutting efficiency can be induced to be %, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% or any number or range between any two of these values.

[0124] In some embodiments, the gRNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%) of the target ALAS1 genomic locus. Cutting efficiency can be induced to be 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0125] In some embodiments, the gRNA can induce a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values) for the target ALAS1 genomic locus.

[0126] gRNA can be a single guide RNA (sgRNA). gRNA can be a chemically modified gRNA. Chemically modified gRNA may contain one or more phosphorothioate bonds. Chemically modified gRNA may contain one or more 2'-O-methyl nucleotides at its 3' end, 5' end, or both. In some embodiments, less than 50% of the gRNA's nucleotides contain 2'-O-methyl modifications. For example, in a gRNA of length 100 nucleotides (e.g., sgRNA), 50 or fewer nucleotides may be 2'-O-methylnucleotides (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides may be or may contain 2'-O-methylnucleotides).

[0127] 2'-O-methylnucleotides may be located at any position within the gRNA. In some embodiments, the three nucleotides at the 5' end of the gRNA may or may contain 2'-O-methylnucleotides. In some embodiments, the last approximately 35 or fewer nucleotides at the 3' end of the gRNA (for example, the last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, and 35 nucleotides at the 3' end of the sgRNA) may or may contain 2'-O-methylnucleotides. In some embodiments, for example, for an sgRNA of length 100 bp, the nucleotides at positions 25 to 41 of the sgRNA may or may contain 2'-O-methylnucleotides. Approximately 48% of gRNA nucleotides can contain 2'-O-methyl modifications.

[0128] The 5' end of the gRNA may contain three phosphorothioate bonds, and the 3' end of the gRNA may contain three phosphorothioate bonds. In some embodiments, the bonds may be located between the 1st and 2nd, 2nd and 3rd, and / or 3rd and 4th positions from the 5' end of the gRNA. In some embodiments, the bonds may be located between the 1st and 2nd, 2nd and 3rd, and / or 3rd and 4th positions from the 3' end of the gRNA.

[0129] Base editing In some embodiments, genes may be edited using base editing. Base editing is a genome editing method that directly introduces point mutations within specific regions of genomic DNA without producing double-strand breaks (DSBs). DNA base editing factors (BEs) comprise a fusion of a degraded Cas nuclease as a catalyst and a base-modifying enzyme. Typically, nucleic acid base editing factors include a polynucleotide programmable nucleotide-binding domain and a nucleic acid base editing domain (e.g., adenosine deaminase, cytidine deaminase). The polynucleotide programmable nucleotide-binding domain, when used in conjunction with a binding guide polynucleotide (e.g., gRNA), can specifically bind to a target polynucleotide sequence, thereby localizing the base editing factor to the target nucleic acid sequence to be edited. In some embodiments, base editing may be used to introduce loss-of-function mutations (e.g., immature stop codons, destabilizing mutations, splicing alterations, etc.). In other embodiments, base editing may be used to correct mutations (e.g., disease-causing mutations).

[0130] In some embodiments, a base editing factor containing a polynucleotide programmable nucleotide-binding domain includes all or part of a CRISPR protein (e.g., a functional portion). In some embodiments, the polynucleotide programmable nucleotide-binding domain includes a nickase domain. Hereinafter, the term “nickase” is given its usual meaning and also refers to a polynucleotide programmable nucleotide-binding domain that includes a nuclease domain capable of cleaving only one of two strands in a double-stranded nucleic acid molecule (e.g., DNA). For example, if the polynucleotide programmable nucleotide-binding domain includes a Cas9-derived nickase domain, the Cas9-derived nickase domain may include a D10A mutation and a histidine at position 840. In another example, the Cas9-derived nickase domain may include an H840A mutation while the amino acid residue at position 10 remains D. In some embodiments, the Cas9 nuclease has an inactive (e.g., deactivated) DNA-cleaving domain (e.g., Cas9 is a nickase and is referred to as the “nCas9” protein). Suitable Cas9 nickases should be obvious to those skilled in the art based on the present disclosure and knowledge of the art, and are within the scope of the disclosure. In some embodiments, the base editing factor includes a catalytically dead (e.g., unable to cleave a target polynucleotide sequence) polynucleotide programmable nucleotide-binding domain. For example, in the case of a base editing factor including a Cas9 domain, Cas9 may include both D10A and H840A mutations. In further embodiments, the catalytically dead polynucleotide programmable nucleotide-binding domain includes point mutations (e.g., D10A or H840A) and deletions of all or part of the nuclease domain (e.g., a functional moiety).

[0131] In some embodiments, the base-editing factor includes an adenosine deaminase domain. Such an adenosine deaminase domain of the base-editing factor can facilitate the editing of adenine (A) nucleic acid bases to guanine (G) nucleic acid bases by deaminating adenine (A) to form inosine (I) exhibiting the base-pairing properties of guanine (G). In some embodiments, the A-to-G base-editing factor further includes an inosine base excision repair inhibitor, e.g., a uracil glycosylase inhibitor (UGI) domain or a catalytically inactive inosine-specific nuclease. While we do not wish to be constrained by any particular theory, the UGI domain or a catalytically inactive inosine-specific nuclease can inhibit or interfere with the base excision repair of the deaminated adenosine residue (e.g., inosine), thereby improving the activity or efficiency of the base-editing factor. Adenosine deaminase can be of any suitable biological origin [e.g., Escherichia coli, e.g., ecTadA deaminase]. In some embodiments, the adenine deaminase is a naturally occurring adenosine deaminase containing one or more mutations. Details of A-to-G nucleic acid base editing proteins are described in their entirety in WO2018 / 027078 and in Gaudelli, NM, et al., “Programmable base editing of A>>T to G>>C in genomic DNA without DNA cleavage” Nature, 551, 464-471 (2017), the entire contents of which are incorporated herein by reference.

[0132] In some embodiments, the base-editing factor comprises a fusion protein or complex containing a cytidine deaminase capable of deaminating a target cytidine (C) base in a polynucleotide to produce uridine (U) having thymine base-pairing properties. In some embodiments, for example, when the polynucleotide is double-stranded (e.g., DNA), the uridine base may be substituted with a thymidine base to result in a C:G to T:A transition (e.g., by a cellular repair mechanism). In other embodiments, the deamination of C to U in a nucleic acid by the base-editing factor may not involve a U to T substitution. Deamination of a target C in a polynucleotide to produce U is a non-limiting example of the types of base editing that can be performed by the base-editing factors described herein. In another example, a base-editing factor containing a cytidine deaminase domain can mediate the conversion of cytosine (C) bases to guanine (G) bases. For example, the U in a polynucleotide produced by the deamination of cytidine by the cytidine deaminase domain of a base editing factor may be excised from the polynucleotide by the base excision repair mechanism (e.g., by the uracil DNA glycosylase (UDG) domain), creating an abasic site. The nucleic acid base opposite the abasic site may then be replaced with another base, such as C, by a damage-overcoming polymerase (e.g., by the base repair mechanism). While substitution with C is typical for the nucleic acid base opposite the abasic site, other substitutions (e.g., A, G, or T) may also occur.

[0133] Therefore, in some embodiments, the base editing factors described herein include a deamination domain (e.g., a cytidine deaminase domain) that can deaminate a target C in a polynucleotide to U. Furthermore, as described below, the base editing factors may include additional domains that facilitate the conversion of U from deamination, resulting in T or G in some embodiments. For example, a base editing factor comprising a cytidine deaminase domain may further include a uracil glycosylase inhibitor (UGI) domain that mediates the substitution of U with T, thereby completing the C-to-T base editing event. In another example, the base editing factor may include a uracil-stabilizing protein described herein. In yet another example, the base editing factor may incorporate a damage-overcoming polymerase to improve the efficiency of C-to-G base editing, since the damage-overcoming polymerase can facilitate the incorporation of C on the opposite side of the debase site (i.e., resulting in the incorporation of G at the debase site, completing the C-to-G base editing event). Base-editing factors containing cytidine deaminase as a domain can deaminate target C in any polynucleotide, including DNA, RNA, and DNA-RNA hybrids.

[0134] In some embodiments, the cytidine deaminase of a base-editing factor comprises all or part (e.g., a functional moiety) of the apolipoprotein B mRNA editing complex (APOBEC) family deaminases. APOBEC is an evolutionarily conserved family of cytidine deaminases. Members of this family are C-to-U editing enzymes. The N-terminal domain of APOBEC-like proteins is a catalytic domain, while the C-terminal domain is a pseudocatalytic domain. More specifically, the catalytic domain is the zinc-dependent cytidine deaminase domain, which is important for cytidine deamination. APOBEC family members include APOBEC1, AP0BEC2, AP0BEC3A, AP0BEC3B, APOBEC3C, AP0BEC3D ("AP0BEC3E" now refers to this), APOBEC3F, AP0BEC3G, AP0BEC3H, AP0BEC4, and activation-inducible (cytidine) deaminase. In some embodiments, the deaminase is an activation-inducible deaminase (AID). In some embodiments, the APOBEC deaminase incorporated into the base editing factor may include one or more mutations selected from the group consisting of H121R, H122R, R126A, R126E, R118A, W90A, W90Y and R132E of rAPOBECl; D316R, D317R, R320A, R320E, R313A, W285A, W285Y and R326E of hAPOBEC3G; and any alternative mutations at the corresponding positions or one or more corresponding mutations in another APOBEC deaminase. Numerous modified cytidine deaminases, though not limited to these, are commercially available from Addgene, including SaBE3, SaKKH-BE3, VQR-BE3, EQR-BE3, VRER-BE3, YE1-BE3, EE-BE3, YE2-BE3, and YEE-BE3 (plasmids 85169, 85170, 85171, 85172, 85173, 85174, 85175, 85176, and 85177). In some embodiments, the deaminase incorporated into the base editing factor comprises all or part of the APOBEC1 deaminase (e.g., the functional portion).

[0135] Details of the C-to-T nucleic acid base editing protein are described in their entirety in WO2017 / 070632, which is incorporated herein by reference, and in Komor, AC, et al., “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage” Nature 533, 420-424 (2016).

[0136] A polynucleotide programmable nucleotide-binding domain, when used in conjunction with a binding guide polynucleotide (e.g., gRNA), can specifically bind to a target polynucleotide sequence (i.e., via complementary base pairing between the bases of the binding guide nucleic acid and the bases of the target polynucleotide sequence), thereby localizing to a target nucleic acid sequence (e.g., a double-stranded DNA target) that is desired to be edited by a base editing factor. In one embodiment, the guide polynucleotide is a gRNA. In some embodiments, the guide polynucleotide is at least one single guide RNA ("sgRNA" or "gRNA"). In some embodiments, the methods described herein can utilize an engineered Cas protein. The guide RNA (gRNA) is a short synthetic RNA consisting of a scaffold sequence required for Cas binding and a user-defined approximately 20-nucleotide spacer that determines the genomic target to be modified. Thus, the specificity of the Cas protein to the genomic target is determined in part by how specific the gRNA targeting sequence is to the genomic target compared to other parts of the genome. In some embodiments, the spacer is approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25 nucleotides in length or more. The spacer of the gRNA may be 19, 20, or 21 nucleotides in length or approximately these nucleotides.

[0137] Additional illustrative edits In some embodiments, genes may be edited using additional exemplary edits. In some embodiments, additional edits may be used to introduce loss-of-function mutations (e.g., immature stop codons, destabilizing mutations, splicing alterations, etc.). In other embodiments, edits may be used to correct mutations (e.g., disease-causing mutations). The editing system generally includes editing factors that include polynucleotide programmable nucleotide-binding domains (e.g., nickase Cas9) and DNA-polymerase domains [e.g., reverse transcriptase (RT), Moloney's mouse leukemia virus reverse transcriptase (M-MLV RT), etc.]. The guide nucleic acid may contain an editing template. The gRNA may also contain a primer-binding site (PBS). The PBS may be designed to hybridize to the substituted strand on the 5' side of the introduced cleavage, generated by nickase. The PBS may be complementary to a portion of the protospacer sequence. The editing template sequence contains the edits to be incorporated and is typically located between the tracr region (e.g., scaffold or core region) and the PBS. The length of the edits incorporated may vary, for example, from the deletion of 10 or fewer nucleotides to the insertion of more than 80 nucleotides. In some embodiments, the edits involve the substitution of one or more nucleotides.

[0138] In some embodiments, the target sequence is bound to the nickase Cas9 (e.g., the Cas9-H840A domain) via a spacer region of the guide RNA (gRNA). Hybridization of the spacer sequence to the complementary target sequence may result in the replacement of the other strand (e.g., the PAM strand or the edited strand). The Cas9-H840A domain can cleave the replaced strand, which can then pair with PBS. RT can recognize the RNA-DNA double helix formed by the replaced strand and PBS, and using an editing template of the gRNA (e.g., the RT template) as a template, extends the DNA of the replaced strand in the 3' direction. This can create a single-stranded DNA "flap" in the replaced strand, including the desired edit. The editing factor can then dissociate from the DNA, leaving two redundant "flaps" in the replaced strand, one of which is the original sequence and the other is the edited sequence. Through a process called "flap equilibration," one strand of the sequence binds to the target sequence, while the other remains bound to the strand replaced by the single-stranded flap. When the target sequence binds to a flap containing the edited sequence, the complex is sometimes called a "DNA heteroduplex" due to the mismatch caused by the editing. Cellular DNA repair mechanisms can then act on the DNA heteroduplex to incorporate the edit.

[0139] In some embodiments, when the editing factor includes a Cas9-derived nickase domain, the Cas9-derived nickase domain may include a D10A mutation and a histidine at position 840. In another example, the Cas9-derived nickase domain includes an H840A mutation while the amino acid residue at position 10 remains D. In some embodiments, the Cas9 nuclease has an inactive (e.g., deactivated) DNA cleavage domain, i.e., Cas9 is a nickase and is referred to as an "nCas9" protein. The Cas9 nickase may be a Cas9 protein capable of cleaving only one strand of a double-stranded nucleic acid molecule (e.g., a double-stranded DNA molecule). Additional suitable Cas9 nickases will become apparent to those skilled in the art based on the present disclosure and the art, and are within the scope of the present disclosure. In some embodiments, the editing factor includes an RNA-dependent DNA polymerase domain, e.g., reverse transcriptase (RT). In some embodiments, the editing factor includes a viral RT, e.g., a retroviral RT [e.g., Molony's mouse leukemia virus (M-MLV or MLVRT)]. In some embodiments, the editing factor may include a fusion of a Streptococcus pyogenes Cas9 polypeptide and a Molony's mouse leukemia virus (M-MLV) reverse transcriptase polypeptide.

[0140] A gRNA may refer to a guide polynucleotide containing one or more targeted nucleotide edits for integration into target DNA. In some embodiments, the gRNA associates with and directs an editing factor to integrate one or more targeted nucleotide edits into the target gene via editing. “Nucleotide editing” or “targeted nucleotide editing” is given its usual meaning and also refers to the specific deletion of one or more nucleotides at one particular site, the insertion of one or more nucleotides at one particular site, the substitution of a single nucleotide, or any other modification at one particular site that is integrated into the sequence of the target gene. Targeted nucleotide editing may refer to editing on an editing template compared to the sequence on the target strand of the target gene, or editing encoded by the editing template on newly synthesized single-stranded DNA. In some embodiments, the gRNA includes a spacer sequence that is complementary or substantially complementary to the sequence on the target strand of the target gene. In some embodiments, the gRNA includes a gRNA core that associates with the DNA-binding domain of the editing factor, e.g., the aCRISPR-Cas protein domain. In some embodiments, the gRNA further comprises an elongated nucleotide sequence containing one or more desired nucleotide edits compared to the endogenous sequence of the target gene, where the elongated nucleotide sequence may be referred to as an elongation arm.

[0141] The extension arm may include a primer-binding site (PBS) that can initiate target-primed DNA synthesis. In some embodiments, the PBS is complementary or substantially complementary to the free 3' end of the edited strand of the target gene at the nick site generated by the editing factor. In some embodiments, the extension arm further includes an editing template containing one or more nucleotide edits of interest that are incorporated into the target gene by editing. In some embodiments, the editing template is an RNA-dependent DNA polymerase domain or a polypeptide of the editing factor, e.g., a template for a reverse transcriptase domain. In some embodiments, the editing template has partial complementarity to the target editing sequence in the target gene. In some embodiments, the editing template has substantial or partial complementarity to the target editing sequence, except for the location(s) of the nucleotide edit(s) of interest that are incorporated into the target gene.

[0142] Some editing factors include Cas9 mutants containing the H840A mutation (i.e., Cas9 nickase) and M-MLV RT wild-type, as well as an N-terminal NLS sequence (19 amino acids) and an amino acid linker (32 amino acids) that links the C-terminus of the Cas9 nickase domain to the N-terminus of the RT domain. The fusion protein may have the following structure: [NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(wt)]. In some cases, the editing factor protein may include Cas9 mutants containing the H840A mutation (i.e., Cas9 nickase) and M-MLV RT containing mutants D200N, T330P, L603W, T306K and W313F, as well as an N-terminal NLS sequence (19 amino acids) and an amino acid linker (33 amino acids) that links the C-terminus of the Cas9 nickase domain to the N-terminus of the RT domain. The fusion protein may have the following structure: [NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)].

[0143] In some embodiments, the editing system or composition further comprises a nick guide polynucleotide, e.g., a nick guide RNA (ngRNA). While we do not wish to be constrained by any particular theory, the unedited strand of double-stranded target DNA in a target gene may be nicked by a CRISPR-Cas nickase directed by the ngRNA. In some embodiments, the nick on the unedited strand directs an endogenous DNA repair mechanism to use the edited strand as a template for repairing the unedited strand, which may increase the efficiency of the editing. Some editing factor systems have, in addition to the editing factor, a second strand nicking guide RNA that complexes with the editing factor and introduces a nick into the unedited DNA strand to induce preferential replacement of the edited strand. In some editing factors, the second strand nicking guide RNA is designed for transient regulation so that the nick on the second strand is not introduced until after the incorporation of the desired edit. This is achieved by designing a gRNA with a spacer sequence that matches only the edited strand and not the original allele. Using this strategy, the mismatch between the protospacer and the unedited allele should resist nicking by sgRNA until an editing event occurs on the PAM strand. Some additional editing factors include fusion proteins containing Cas9(R221K N39K H840A) and the mutant MMLV RT pentamutant(D200N T306K W313F T330P L603W) with the following structure: [binodelux NLS]-[Cas9(R221K)(N394K)(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)]-[binodelux NLS]-[NLS]+desired gRNA.

[0144] Some of the editing methods and compositions disclosed herein are also described in WO2023015309, WO2022150790, WO2022067130, WO2020191233, WO2020191234, WO2020191239, WO2020191241, WO2020191242, WO2020191243, WO2020191245, WO2020191246, WO2020191248, WO2020191249, WO2020191153 and WO2020191171, the contents of which are incorporated herein by reference in their entirety.

[0145] Method for editing the ALAS1 gene Provided herein are methods for editing ALAS1 and thereby using genome editing to functionally reduce the expression of the ALAS1 gene. The methods may be used to treat subjects, for example, patients with ALAS1-related diseases or conditions.

[0146] Provided herein are methods for treating ALAS1-related disease or disorder in subjects in urgent need (e.g., mammalian subjects). In some embodiments, the method involves administering a plurality of nanoparticles to a subject that are complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets the ALAS1 gene, and (b) a nucleic acid encoding an RNA guide endonuclease, thereby mitigating ALAS1-related disease or disorder in the subject. The subject may be administered the plurality of nanoparticles at once. The subject may be administered the plurality of nanoparticles for treatment two or more times, for example, two times. The two administrations of nanoparticles to the subject may be separated by a preferred period of time. In some embodiments, the preferred period of time is one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, three months, four months, five months, six months, one year, two years, three years or longer, or about these. In some embodiments, two of the two or more administrations are separated by about two weeks to about two months, for example, about three weeks. In some embodiments, each of two or more doses is spaced about two weeks to about two months apart, for example, about three weeks apart. The preferred period between two doses may be the same as or different from the preferred period between another two doses. In some embodiments, multiple nanoparticles are administered to the subject at doses of about 0.01–5 mg / kg per dose, for example 0.05–2 mg / kg, 0.5–3 mg / kg, or 0.1–1 mg / kg. In some embodiments, ALAS1 gRNA or nucleic acid encoding ALAS1 gRNA is administered to the subject at doses of 0.01–5 mg / kg per dose, for example 0.1–1 mg / kg gRNA, or about these doses. In some embodiments, nucleic acid encoding RNA guide endonuclease is administered to the subject at doses of 0.1–5 mg / kg per dose, for example 0.5–3 mg / kg, or 0.3–2 mg / kg, or about these doses. The doses may be the same or different for each dose to the subject.

[0147] In some embodiments, the gRNA targets within or near the coding sequence in the ALAS1 gene. In some embodiments, the gRNA targets a sequence in one of the 12 exons of the ALAS1 gene. In some embodiments, the gRNA targets a sequence in exon 3, 4, 5, or 6 of the ALAS1 gene. In some embodiments, the gRNA targets a sequence in exon 3, 4, 5, or 6 of the ALAS1 gene. The gRNA may contain a spacer sequence complementary to the target sequence in exon 3, 4, 5, or 6 of the ALAS1 gene. In some embodiments, the spacer(s) are complementary to a sequence within or near exon 3, 4, 5, or 6 of the ALAS1 gene (for example, within a range of any or more of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 bases therefrom). The complementarity between the gRNA spacer and the target sequence in the ALAS1 gene may be perfect or imperfect. In some embodiments, the complementarity may be at least 70%, 80%, 90%, 100%, or a number or range between any two of these values. In some embodiments, the complementarity is perfect, i.e., 100%.

[0148] In some embodiments, the gRNA includes a spacer sequence containing one of the sequences of SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes a spacer sequence selected from SEQ ID NOs. 25-48 and 83-112, or a variant thereof having approximately at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to any of the spacers of SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes a spacer sequence selected from SEQ ID NOs. 25-48 and 83-112, or a variant thereof having three or fewer mismatches compared to any one of SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes or consists of the spacer sequence of SEQ ID NOs. 25, 26, or 27. In some embodiments, the gRNA includes or comprises a spacer sequence containing or consisting of the sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer sequence containing or consisting of the sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86 or SEQ ID NO: 87. In some embodiments, the gRNA includes a spacer sequence containing or consisting of the sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 29 or SEQ ID NO: 30.

[0149] In some embodiments, the gRNA used in the methods described herein may include two or more gRNAs, each containing a spacer complementary to the sequence of the ALAS1 gene locus (for example, one of SEQ ID NOs. 25-48 and 83-112, or a variant thereof having at least 85% homology to one of SEQ ID NOs. 25-48 and 83-112, or a variant having three or fewer mismatches compared to one of SEQ ID NOs. 25-48 and 83-112).

[0150] In some embodiments, the gRNA used in the methods described herein may include two or more gRNAs, each containing a spacer complementary to the sequence of the ALAS1 gene locus (for example, one of SEQ ID NOs. 25-48 and 83-112, or a variant thereof having at least 85% homology to one of SEQ ID NOs. 25-48 and 83-112, or a variant having three or fewer mismatches compared to one of SEQ ID NOs. 25-48 and 83-112).

[0151] In some embodiments, the guide sequence includes the spacer sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 30, or a variant thereof having approximately 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the guide sequence includes the spacer sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 87, or a variant thereof having approximately 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the guide sequence includes or consists of the spacer sequence of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. In some embodiments, the gRNA includes a spacer sequence containing the sequence of SEQ ID NO: 29 or SEQ ID NO: 30, or a variant thereof having approximately at least or at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the guide sequence includes or consists of the spacer sequence of SEQ ID NO: 29 or SEQ ID NO: 30.

[0152] The gRNAs used herein can enhance on-target activity while significantly reducing potential off-target effects (i.e., cleaving genomic DNA at undesirable locations other than the ALAS1 gene). In some embodiments, off-target binding is reduced by approximately, or at least, about 80%, 85%, 90%, 95%, 98%, 99%, or 100%.

[0153] In some embodiments, gRNA is at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (for example, at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%) Induce a cutting efficiency of 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0154] In some embodiments, the gRNA induces a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values).

[0155] In some embodiments, the DNA endonucleases are Cas endonucleases described herein or known in the art. Cas endonucleases may be naturally occurring or not (e.g., recombinant or mutant). In some embodiments, the DNA endonucleases are Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm The group is selected from 4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonucleases, or functional derivatives thereof. In some embodiments, the DNA endonuclease is Cas9 endonuclease or a variant thereof. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (SpyCas9 or SpCas9). In some embodiments, the Cas9 endonuclease is derived from Staphylococcus rugdunensis (SluCas9).

[0156] Composition and therapeutic application Provided herein are pharmaceutical compositions for carrying out the methods disclosed herein. A composition may comprise one or more gRNAs, an RNA-guided endonuclease, or a nucleotide sequence encoding an RNA-guided endonuclease described herein. In some embodiments, the composition may further comprise a polynucleotide (e.g., a donor template) inserted into the ALAS1 gene to influence the desired gene modification of the methods disclosed herein.

[0157] The disclosures herein include compositions. In some embodiments, the compositions include (a) any of the gRNAs disclosed herein or a polynucleotide encoding a gRNA, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0158] In some embodiments, the composition comprises (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA, which targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus and includes a spacer sequence containing one of the sequences 25-48 and 83-112; and (b) a Cas9 endonuclease or nucleic acid encoding a Cas9 endonuclease.

[0159] The composition may comprise either a spacer and / or gRNA disclosed herein. In some embodiments, the spacer sequence comprises a sequence selected from the group consisting of SEQ ID NOs. 25-48 and 83-112. The gRNA may be a single guide RNA (sgRNA). The gRNA may be a chemically modified gRNA. The chemically modified gRNA may comprise one or more phosphorothioate bonds. The chemically modified gRNA may comprise one or more 2'-O-methylnucleotides at its 3' end, 5' end, or both. In some embodiments, less than 50% of the gRNA nucleotides contain 2'-O-methyl modifications (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or any number or range between any two of these values). In some embodiments, approximately 48% of the gRNA nucleotides contain 2'-O-methyl modifications (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or any number or range between any two of these values). In some embodiments, the 5' end of the gRNA contains three phosphorothioate bonds, and the 3' end of the gRNA contains three phosphorothioate bonds. In some embodiments, the Cas9 endonuclease is selected from the group consisting of Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, and T. denticola Cas9.

[0160] The composition may comprise (a) ALAS1 gRNA and (b) Cas9 endonuclease, which may be formulated as ribonucleoprotein particles (RNPs). The composition may comprise (a) nucleic acid encoding ALAS1 gRNA and (b) nucleic acid encoding Cas9 endonuclease. In some embodiments, (a) and / or (b) are present in a viral vector. The viral vector may be an adeno-associated virus vector.

[0161] (a) gRNA or nucleic acid encoding gRNA, (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, or both, can be complexed with liposomes or lipid nanoparticles (LNPs). Lipid nanoparticles may contain one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids. Lipid nanoparticles may contain cholesterol, polyethylene glycol (PEG) lipids, or both.

[0162] In some embodiments, one or more gRNAs each contain spacers complementary to a genomic sequence within or near any exon of the ALAS1 gene (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases therefrom). In some embodiments, the gRNAs target a sequence in any one of exons 3–6 of the ALAS1 gene. The gRNAs may contain spacer sequences complementary to or identical to the target sequence in any one of exons 3–6 of the ALAS1 gene. In some embodiments, the gRNAs contain spacer sequences from any one of sequence numbers 25–48 and 83–112, or variants thereof having at least 85% homology to any one of sequence numbers 25–48 and 83–112. In some embodiments, the gRNA includes one of the spacers SEQ ID NOs. 25-48 and 83-112, or a variant thereof having at least 85% homology to a spacer having the sequences SEQ ID NOs. 25-48 and 83-112. In some embodiments, the gRNA includes the spacer SEQ ID NOs. 45, 83, 86, and 87, or a variant thereof having at least 85% homology to a spacer having the sequences SEQ ID NOs. 45, 83, 86, or 87. In some embodiments, the gRNA includes the spacer SEQ ID NOs. 25, 26, and 27, or a variant thereof having at least 85% homology to a spacer having the sequences SEQ ID NOs. 25, 26, or 27. In some embodiments, the gRNA includes a spacer containing or consisting of the sequences SEQ ID NOs. 45, 83, 86, or 87. In some embodiments, the gRNA includes a spacer containing or consisting of the sequences SEQ ID NOs. 25, 26, or 27. In some embodiments, the gRNA includes a spacer with sequence number 29 or sequence number 30, or a variant thereof having at least 85% homology to a spacer having sequence number 29 or sequence number 30.In some embodiments, the gRNA includes a spacer containing or consisting of the sequence of SEQ ID NO: 29 or SEQ ID NO: 30.

[0163] In some embodiments, the RNA guide endonucleases are Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, These are Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases or their functional derivatives. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is derived from Staphylococcus rugduensis (SluCas9). In some embodiments, the DNA sequence transcribed into the nucleic acid encoding the DNA endonuclease is codon-optimized. In some embodiments, the nucleic acid encoding the DNA endonuclease (e.g., mRNA) includes a 5' CAP structure and a 3' poly-A tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is ligated to the gRNA via a covalent bond.

[0164] In some embodiments, one or more nucleic acid sequences and / or polypeptides may be delivered to cells either in vitro or in vivo via virus-based or non-virus-based delivery systems, including adenovirus vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, lentiviral vectors, herpesvirus vectors, liposomes, lipid nanoparticles, poxviruses, naked DNA administration, plasmids, cosmids, phages, and encapsulated cell technology.

[0165] In some embodiments, the compounds of the compositions disclosed herein (e.g., ALAS1 gRNA or nucleic acids encoding ALAS1 gRNA and nucleic acids encoding RNA guide endonucleases) may be formulated in liposomes or lipid nanoparticles. In some embodiments, the compounds of the compositions are formulated in lipid nanoparticles (LNPs). LNPs are nonviral delivery systems capable of safely and effectively delivering nucleic acids to target organs (e.g., the liver). The term “lipid nanoparticles” refers to nanoscale particles composed of lipids having a size measured in nanometers (e.g., 1 to 5,000 nm). In some embodiments, the lipids contained in the lipid nanoparticles include cationic lipids and / or ionizable lipids. Any suitable cationic lipids and / or ionizable lipids known in the art may be used to formulate LNPs for the delivery of gRNA and Cas endonucleases to cells. Exemplary cationic lipids include one or more positively charged amine groups. In some embodiments, cationic lipids are ionizable to be positively charged depending on pH or to exist in a neutral state. In some embodiments, the cationic lipids of the lipid nanoparticles include a protonable tertiary amine head that exhibits a positive charge at low pH. The lipid nanoparticles may further include one or more neutral lipids [e.g., as helper lipids, distearoylphosphatidylcholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dipalmitoyl-sn-glycero-3-phosphorylethanolamine (DPPE), etc.], charged lipids, steroids, and polymer-bound lipids. In some embodiments, the LNP may include cholesterol. In some embodiments, the LNP may include polyethylene glycol (PEG) lipids.

[0166] Lipid nanoparticles may have varying concentrations of constituent lipids. In some embodiments, the molar percentage of ionizable lipids in the total lipids of lipid nanoparticles is about, at least, at least about, at most, or at most about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or any two of these values. In some embodiments, the molar percentage of ionizable lipids in lipid nanoparticles is in the range of about 40–70% (e.g., about 60%). In some embodiments, lipid nanoparticles may further comprise helper lipids (e.g., DSPC), sterol lipids (e.g., cholesterol), and PEG lipids or phospholipid PEG conjugates. In some embodiments, the molar percentage of helper lipids in lipid nanoparticles is about 5%–20% (e.g., about 10.5%), the molar percentage of sterol lipids is about 10%–40% (e.g., about 21%), and the molar percentage of PEG lipids is about 0.5%–10% (e.g., about 8.5%).

[0167] LNP uptake into hepatocytes may be mediated by the apolipoprotein E-low-density lipoprotein receptor (ApoE-LDLR) or the N-acetyl-D-galactosamine / asialoglycoprotein receptor pathway (GalNAc-ASGPR) (Sato et al., 2020, Journal of Controlled Release, 322, 217-226). In some embodiments, the LNPs described herein for the delivery of gRNA and Cas endonucleases to cells may be formulated according to the ApoE-LDLR uptake pathway. In some embodiments, the LNPs described herein for the delivery of gRNA and Cas endonucleases to cells may be formulated according to the GalNAc-ASGPR uptake pathway. In some embodiments, the LNP formulations described herein may be used to treat subjects with diseases or disorders exhibiting heterozygosity (HeFH) or homozygosity (HoFH) with respect to a decrease in low-density lipoprotein receptor (LDLR).

[0168] In some embodiments, the lipid nanoparticles contain N-acetylgalactosamine (GalNAc), an amino sugar derivative of galactose. In some embodiments, GalNAc is present in the LNP at a molar percentage of about, at least, at least about, at most, or at most about 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, or 6.0%. In some embodiments, GalNAc is present in the LNP at a molar percentage of about 2.5%. In some embodiments, the lipid nanoparticles disclosed herein do not contain GalNAc. In some embodiments, the lipid nanoparticles contain GalNAc in molar percentages of about 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, or less than 0.001%.

[0169] In some embodiments, the concentration of nanoparticles in the composition disclosed herein is about 58.2 mg / mL (e.g., of total lipids), and the nanoparticles are complexed with a total of about 2 mg / mL of nucleic acids consisting of (a) ALAS1 gRNA and (b) Cas9 mRNA. In some embodiments, the concentration of multiple nanoparticles is about 58.2 mg / mL, and the nanoparticles are complexed with (a) about 1.5 mg / mL of ALAS1 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

[0170] The relative amounts of total RNA [(a) ALAS1 gRNA or nucleic acid encoding gRNA that targets the ALAS1 gene, and (b) nucleic acid encoding an RNA guide endonuclease] and total lipids in the nanoparticles may vary depending on the embodiment. For example, the nanoparticles may contain total lipids and total RNA in weight ratios of approximately 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, or 30:1. In some embodiments, the nanoparticles may contain total lipids and total RNA in a weight ratio of approximately 30:1. In some embodiments, the nanoparticles may contain total lipids and total RNA in molar ratios of approximately 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, or 50:1. In some embodiments, the nanoparticles may contain total lipids and total RNA in molar ratios of approximately 40:1.

[0171] In some embodiments, the concentration of nanoparticles in the compositions disclosed herein is about, at least, at least about, at most or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 mg / mL, or any number or range between any two of these values. In some embodiments, the RNA in nanoparticles is formulated at concentrations of approximately, at least, at least about, at most, or at most about 50, 75, 100, 200, 400, 600, 800, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 μg / ml or a number or range between any two of these values.

[0172] The amounts in the nanoparticles [for example, the relative amounts of (a) ALAS1 gRNA or nucleic acid encoding gRNA that targets the ALAS1 gene, and (b) nucleic acid encoding an RNA guide endonuclease [for example, mRNA encoding a Cas protein (e.g., Cas9 mRNA)]] may vary. For example, the nanoparticles may contain nucleic acid encoding an RNA guide endonuclease (e.g., SpCas9 mRNA) and ALAS1 gRNA in ratios of 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, or 5:1 (by weight). In some embodiments, the nanoparticles may contain nucleic acid encoding an RNA guide endonuclease and ALAS1 gRNA in a ratio of 3:1 (by weight).

[0173] In some embodiments, multiple nanoparticles are administered to a subject in doses of approximately 0.01–5 mg / kg per dose [determined by the total nucleic acid (e.g., the sum of ALAS1 gRNA and Cas9 mRNA)]. For example, the single dose or individual doses of multiple nanoparticles administered to a subject could be 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1. The nanoparticles may be complexed with 7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg, or a number or range between any two of these values, representing the sum of RNA (e.g., the sum of ALAS1 gRNA and Cas9 mRNA). In some embodiments, multiple nanoparticles are administered to subjects in doses of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg (determined by the sum of ALAS1 gRNA and Cas9 mRNA), or approximately these doses.

[0174] In some embodiments, lipid nanoparticles may have an average diameter of approximately 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, or any of these values ​​or a range of numbers or values. In some embodiments, the lipid nanoparticle size is approximately 50 to approximately 100 nm in diameter, or approximately 70 to approximately 90 nm in diameter, or approximately 55 to approximately 95 nm in diameter.

[0175] In some embodiments, the compounds of the compositions described herein are encapsulated in the lipid portion of lipid nanoparticles, or in an aqueous portion enclosed by some or all of the lipid portion of lipid nanoparticles. Encapsulation may be complete, partial, or both. In some embodiments, nucleic acids and / or polypeptides are encapsulated completely or substantially (e.g., more than 90% of RNA) within lipid nanoparticles.

[0176] In some embodiments, one or more compounds described herein associate with liposomes or lipid nanoparticles via covalent or non-covalent bonds. In some embodiments, any of the compounds in the composition may be contained in liposomes or lipid nanoparticles separately or together.

[0177] Recombinant adeno-associated virus (AAV) vectors can be used for delivery. Techniques for producing rAAV particles, in which the AAV genome containing the polynucleotides, rep, and cap genes to be delivered is packaged and the helper virus function is provided to the cell, are standard in the art. Typically, the production of rAAV requires the following components to be present within a single cell (referred to herein as a packaging cell): the rAAV genome, the AAV rep and cap genes separately from (i.e., not within) the rAAV genome, and the helper virus function. The AAV rep and cap genes may be derived from any AAV serotype from which the recombinant virus may originate, and may be derived from a variety of different AAV serotypes other than the rAAV genome ITR, including, but not limited to, the AAV serotypes described herein. The production of pseudotyped rAAV is disclosed, for example, in International Patent Application Publication No. WO2001 / 83692.

[0178] The compositions of the present disclosure, for example, the AAV particle packaging polynucleotides encoding the endonuclease, donor sequence, or RNA guide molecule of the present disclosure, may contain or be derived from any natural or recombinant AAV serotype. The present disclosure allows AAV particles to contain any serotype selected from, but not limited to, AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV12, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, A AV16.12 / hu.11, AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2, AAV2.5T, AAV2-1 5 / rh.62, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV 27.3, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV2G9, AAV-2-pre-miRNA-101, AAV3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV3 3.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AA V42-12, AAV42-13, AAV42-15, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29、AAV4-8 / r11.64、AAV4-8 / rh.64、AAV4-9 / rh.54、AAV5、AAV52.1 / hu.20、AAV52 / hu.19、AAV5-22 / rh.58、AAV5-3 / rh.57、AAV54.1 / hu.21、AAV54.2 / hu.22、AAV54.4R / hu.27、AAV54.5 / hu.23、AAV54.7 / hu.24、AAV58.2 / hu.25、AAV6、AAV6.1、AAV6.1.2、AAV6.2、AAV7、AAV7.2、AAV7.3 / hu.7、AAV8、AA V-8b、AAV-8h、AAV9、AAV9.11、AAV9.13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAV3.3、AAV3.4、AAV3.5、AAV3. .7、AAV-b、AAVC1、AAVC2、AAVC5、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、 AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAV-h、AAVH-1 / hu.1、AAVH2、AAVH-5 / hu.3、AAVH6、AAVhE1.1、AAVhER1.14、AAVhEr1.16、AAVhEr1.18、AAVhEr1.23、AAV hEr1.35、AAVhEr1.36、AAVhEr1.5、AAVhEr1.7、AAVhEr1.8、AAVhEr2.16、AAVhEr2.29、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhEr2.4、AAVhEr3.1、AAVhEr1. AVhu.1、AAVhu.10、AAVhu.11、AAVhu.12、AAVhu.13、AAVhu.14 / 9、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.19、AAVhu.2、AAVhu.20、AAVhu.21、 AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.3、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47 、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5、AAVhu.51、AAVhu.52、AAVhu.53、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AA Vhu.58、AAVhu.6、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.7、AAVhu.8、AAVhu.9、AAVhu.t19、AAVLG-10 / rh.40、AAVLG- 4 / rh.38、AAVLG-9 / hu.39、AAVLG-9 / hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK03、AAV-LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、 AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、AAVN721-8 / rh.43、AAV-PAEC、AAV-PAEC11、AAV-PAEC C12、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAVpi.1、AAVpi.2、AAVpi.3、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVpi.1 AVrh.17、AAVrh.18、AAVrh.19、AAVrh.2、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.2R、AAVrh.31、AAVrh.32、AAVrh.33、 AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.43、AAVrh.44、AAVrh.45、AAVrh.46、AAVrh.47、AAVrh.48, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.50, AAVrh.51, AAV rh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60 , AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R The following variants may be available or based on them: A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, goat AAV, Japanese AAV10, true type AAV (ttAAV), UPENN AAV10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0179] In some embodiments, the AAV serotype is an AAV9 sequence, or one containing mutations within it, such as AAV99, AAV99.9, AAV99.11, AAV99.13, AAV99.16, AAV99.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, etc., as described by N Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011)), but not limited to these.

[0180] In some embodiments, the AAV serotype is or comprises a sequence or derivative thereof, such as, but not limited to, AAV3B (SEQ ID NOs. 1 and 10 in U.S. Patent No. 6,156,303), AAV6 (SEQ ID NOs. 2, 7 and 11 in U.S. Patent No. 6,156,303), AAV2 (SEQ ID NOs. 3 and 8 in U.S. Patent No. 6,156,303), AAV3A (SEQ ID NOs. 4 and 9 in U.S. Patent No. 6,156,303), etc.

[0181] In some embodiments, the serotype may be AAVDJ or a variant thereof, e.g., AAVDJ8 (or AAV-DJ8), as described in Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008)). The amino acid sequence of AAVDJ8 may contain two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as Sequence ID No. 1 in U.S. Patent No. 7,588,772 may contain two mutations: (1) R587Q, where arginine (R;Arg) at amino acid 587 is changed to glutamine (Q;Gin); (2) R590T, where arginine (R;Arg) at amino acid 590 is changed to glutamine (Q;Gin); ;Arg) is changed to threonine (T;Thr). Another non-limiting example could include the following three mutations: (1) K406R, where lysine (K;Lys) at amino acid 406 is changed to arginine (R;Arg), (2) R587Q, where arginine (R;Arg) at amino acid 587 is changed to glutamine (Q;Gin), and (3) R590T, where arginine (R;Arg) at amino acid 590 is changed to threonine (T;Thr).

[0182] In some embodiments, the AAV serotype is or has sequences described in the international publication WO2015121501, for example, but not limited to, true-type AAV (ttAAV) (sequence number 2 in WO2015121501), "UPenn AAV10" (sequence number 8 in WO2015 / 121501), "Japanese AAV10" (sequence number 9 in WO2015 / 121501), or variants thereof.

[0183] This disclosure allows for the selection or use of AAV capsid serotypes from various species. In some embodiments, AAV is avian AAV (AAAV). The AAAV serotype may be or may have sequences described in U.S. Patent No. 9,238,800, for example, AAAV (Sequence IDs 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. 9,238,800) or variants thereof.

[0184] In some embodiments, AAV is bovine AAV (BAAV). The BAAV serotype may be or may have a sequence described in U.S. Patent No. 9,193,769, for example, but not limited to BAAV (sequences 1 and 6 of U.S. 9,193,769) or a variant thereof. The BAAV serotype may be or may have a sequence described in U.S. Patent No. 7,427,396, for example, but not limited to BAAV (sequences 5 and 6 of U.S. 7427396) or a variant thereof.

[0185] In some embodiments, AAV is goat AAV. The goat AAV serotype may be or may have a variant of the sequence described in U.S. Patent No. 7,427,396, for example, goat AAV (Sequence ID 3 of U.S. 7427,396) or a variant thereof.

[0186] In some embodiments, the AAV is operated as a hybrid AAV derived from two or more parent serotypes. In some embodiments, the AAV is AAV2G9, which contains sequences derived from AAV2 and AAV9. The AAV2G9 AAV serotype may or may have sequences described in US2016 / 0017005.

[0187] In some embodiments, AAV is a serotype generated by an AAV9 capsid library having mutations in amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011)). Serotypes and corresponding nucleotide and amino acid substitutions are not limited to, but include, AAV9.1 (G1594C;D532H), AAV6.2 (T1418A and T1436X;V473D and I479K), AAV9.3 (T1238A;F413Y), AAV9.4 (T1250C and A1617T;F417S), AAV9.5 ( A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676) C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G 1713A;L447H), AAV9.16(A1775T;Q592L), AAV9.24(T1507C, T1521G;W503R), AAV9.26(A1337G, A1769C;Y446C, Q590P), AAV9.33(A1667C;D 556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L6 02F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1 301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54(C1531A, T1609A; L511I, L537 M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AA V9.61(A1493T;N498I), AAV9.64(C1531A, A1617T;L511I), AAV9.65(C1335T, T1530C, C1568A;A523D ), AAV9.68(C1510A;P504T), AAV9.80(G1441A;G481R), AAV9.83(C1402A, A1500T;P468T, E500D), AA V9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806 This could be C;L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T;S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T;M559L), and AAV9.95 (T1605A;F535L).

[0188] In some embodiments, AAV is a serotype containing at least one AAV capsid CD8+ T cell epitope. In non-limiting examples, the serotype may be AAV1, AAV2, or AAV8. In some embodiments, AAV may be a variant, e.g., PHP.A or PHP.B, as described in Deverman et al. 2016, Nature Biotechnology. 34(2): 204-209.

[0189] The general principles of rAAV production are outlined, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial, and Immunol., 158:97-129). Various approaches have been used. Ratschin et al, Mol. Cell. Biol. 4:2072 (1984); Hermonat et al, Proc. Natl. Acad. Sci. USA, 81:6466 (1984); (1988); and Lebkowski et al, 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al (1989, J. Virol., 63:3822-3828); US Patent No. 5,173,414; WO95 / 13365 and corresponding US Patent No. 5,658,776; WO95 / 13392; WO96 / 17947; PCT / US98 / 18600; WO97 / 09441 (PCT / US96 / 14423); WO97 / 08298 (PCT / US96 / 13872); WO97 / 21825 (PCT / US96 / 20777); WO97 / 06243 (PCT / FR96 / 01064); WO99 / 11764; Perrin et al (1995) Vaccine 13: 1244-1250; Paul et al (1993) Human Gene Therapy 4:609-615; Clark et al (1996) Gene Therapy 3: 1124-1132; U.S. Patent Nos. 5,786,211; 5,871,982; and 6,258,595.

[0190] AAV vector serotypes can be adapted to target cell types. For example, the following exemplary cell types can be transduced in particular by the indicated AAV serotypes.

[0191] In addition to adeno-associated virus vectors, other viral vectors may also be used. Such viral vectors include, but are not limited to, lentiviruses, alphaviruses, enteroviruses, pestiviruses, baculoviruses, herpesviruses, Epstein-Barr viruses, papovaviruses, poxviruses, vaccinia viruses, and herpes simplex viruses.

[0192] In some embodiments, Cas9 mRNA, sgRNA targeting one or two loci in the ALAS1 gene, and donor DNA may be formulated separately in lipid nanoparticles, or all may be formulated simultaneously in a single lipid nanoparticle.

[0193] In some embodiments, Cas9 mRNA may be formulated in lipid nanoparticles, while sgRNA and donor DNA may be delivered in an AAV vector.

[0194] A choice is available for delivering the Cas9 nuclease as a DNA plasmid, mRNA, or protein. Guide RNA can be expressed from the same DNA or delivered as RNA. RNA can be chemically modified to alter or improve its half-life, or to reduce the likelihood or degree of the immune response. Endonuclease proteins can be complexed with gRNA before delivery. Viral vectors allow for efficient delivery; split versions of Cas9 and small orthologues of Cas9 can be packaged in AAVs to serve as donors for HDRs. Various non-viral delivery methods also exist that can deliver each of these components, or non-viral and viral methods can be used in conjunction. For example, nanoparticles can be used to deliver proteins and guide RNA, while AAVs can be used to deliver donor DNA.

[0195] The compositions described above may further comprise one or more additional reagents, such as buffers, buffers for introducing polypeptides or polynucleotides into cells, washing buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, and adapters for sequencing. Buffers may include stabilizing buffers, restoring buffers, and diluting buffers. In some embodiments, the compositions may also comprise one or more components that can be used to promote or enhance on-target binding or endonuclease-mediated DNA cleavage, or to improve targeting specificity.

[0196] One or more components of the composition may be formulated with pharmaceutically acceptable excipients, such as carriers, solvents, stabilizers, adjuvants, and diluents, depending on the specific mode of administration and dosage form. In some embodiments, the guide RNA composition is generally formulated to achieve a physiologically compatible pH range of approximately pH 3 to approximately pH 11, or approximately pH 3 to approximately pH 7, depending on the formulation and route of administration. In some embodiments, the pH is adjusted to a range of approximately pH 5 to approximately pH 8.

[0197] Suitable excipients may include, for example, carrier molecules containing large, slowly metabolized polymers such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, and inactivated virus particles. Other exemplary excipients include antioxidants (e.g., ascorbic acid, without limitation), chelating agents (e.g., EDTA, without limitation), carbohydrates (e.g., dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose, without limitation), stearic acid, liquids (e.g., oil, water, physiological saline, glycerin, and ethanol, without limitation), wetting agents or emulsifiers, and pH buffering agents.

[0198] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing no other materials besides the active ingredient and water, or containing both a buffer such as sodium phosphate, physiological saline, or phosphate-buffered saline at a physiological pH value. Aqueous carriers may contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, glucose, polyethylene glycol, and other solutes. Liquid compositions may also contain liquid phases in addition to and excluding water. Exemplary such additional liquid phases include glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound used in a cell composition that is effective in treating a particular disorder or condition depends on the nature of the disorder or condition and can be determined by standard clinical techniques.

[0199] As used herein, the term “stable” or “stability” refers to the ability of a compound described herein (e.g., an RNA-guided endonuclease or a nucleic acid and / or gRNA encoding an RNA-guided endonuclease) to maintain therapeutic efficacy (e.g., all or most of its intended biological activity and / or physiological integrity) over a long period of time. The stability of one or more compounds described herein (e.g., RNA guide endonucleases or nucleic acids and / or gRNAs and nanoparticles encoding RNA guide endonucleases) may be 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, or longer than 3 years. The storage temperature may vary. For example, the storage temperature may be -80°C, -65°C, -20°C, 5°C, or any number or range between any two of these values, about these, at least these, or at least about these. In some embodiments, the storage temperature is -65°C or lower.

[0200] In some embodiments, the compounds described herein in the composition (e.g., RNA-guided endonucleases or nucleic acids and / or gRNAs encoding RNA-guided endonucleases) may be delivered via transfection, such as calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, electrical nuclear transport, chemotransduction, electrotransduction, lipofectamine-mediated transfection, effectene-mediated transfection, lipid nanoparticle (LNP)-mediated transfection, or any combination thereof. In some embodiments, the composition is introduced into cells via lipid-mediated transfection using lipid nanoparticles.

[0201] The compositions described herein may be administered to subjects in need to treat ALAS1-related conditions. Accordingly, this disclosure also provides gene therapy approaches for treating ALAS1-related conditions in subjects by editing the subject's ALAS1 gene. In some embodiments, the ALAS1 gene in relevant cells (e.g., hepatocytes) in a subject is edited using materials and methods described herein that utilize an RNA-guided endonuclease such as Cas9 to edit a genome-derived target sequence, thereby reducing ALAS1 expression in the liver, thereby providing long-term or sustained treatment of ALAS1-related conditions by sustainably reducing ALAS1 protein levels and / or preventing upregulation of ALAS1, for example, preventing attacks of acute porphyria. As used herein, the term “related” referring to two items (e.g., ALAS1 and disease / condition) indicates a relationship between two items such that the occurrence of one item (e.g., ALAS1 protein levels) is accompanied by the occurrence of the other item (e.g., disease or condition), but does not include, cause-and-effect relationships and symptom-disease relationships.

[0202] As described herein, in some embodiments, (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA that targets the ALAS1 gene, and (b) nanoparticles (e.g., LNPs containing ionizable lipids) complexed with a nucleic acid encoding an RNA guide endonuclease (e.g., Cas9 mRNA) are administered by IV injection to the target in question. The administration may be, for example, a single dose or two or more doses. For example, the nanoparticles may be rapidly distributed to, for example, the liver of the target, and the nanoparticles can enter the hepatocytes of the target (e.g., via endocytosis). In some embodiments, ionizable lipid disruption of endosomes can disrupt the nanoparticles, thereby releasing the nucleic acid encoding the RNA guide endonuclease (e.g., Cas9 mRNA) from the nanoparticles. The RNA guide endonuclease (e.g., Cas9) is synthesized and forms an endonuclease-gRNA RNP complex to achieve gene editing. In some embodiments, endogenous DNA repair via non-homologous end joining (NHEJ) results in the introduction of indels into the ALAS1 gene, leading to frameshift mutations that prevent the production of functional ALAS1 protein. In some embodiments, the methods disclosed herein result in regulation (e.g., reduction) of ALAS1 expression. As demonstrated herein, robust on-target editing of the ALAS1 gene can be achieved without off-target editing using the methods, compositions, systems, and kits described herein.

[0203] The disclosures herein include methods for treating diseases or disorders caused by 5'-aminolevulinate synthase 1 (ALAS1) overexpression in subjects where there is an urgent need. In some embodiments, the method includes administering one of the compositions disclosed herein to a subject to treat a disease or disorder caused by ALAS1 overexpression in the subject. The disclosures herein also include methods for treating subjects who have or are suspected of having porphyria. In some embodiments, the method includes administering one of the compositions disclosed herein to a subject to treat porphyria.

[0204] The disclosure herein includes methods for treating diseases or disorders caused by ALAS1 overexpression in subjects where there is an urgent need. In some embodiments, the method includes administering to a subject a composition comprising (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA, which targets the ALAS1 genomic locus and includes a spacer sequence containing one of the sequences SEQ ID NOs. 25-48 and 83-112; and (b) a Cas9 endonuclease or a plurality of nanoparticles complexed with a nucleic acid encoding a Cas9 endonuclease, thereby treating diseases or disorders caused by ALAS1 overexpression in the subject.

[0205] The disclosures herein include methods for treating subjects having or suspected of having porphyria. In some embodiments, the methods include administering to a subject a composition comprising (a) a gRNA or nucleic acid encoding a gRNA that targets the ALAS1 genomic locus and includes a spacer sequence containing one of the sequences SEQ ID NOs. 25-48 and 83-112; and (b) a plurality of nanoparticles complexed with Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating the porphyria.

[0206] Cas9 endonucleases may include, for example, Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, or T. denticola Cas9. Multiple nanoparticles may be lipid nanoparticles. Lipid nanoparticles may include one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids. Lipid nanoparticles may include cholesterol, polyethylene glycol (PEG) lipids, or both.

[0207] The method may involve administering the composition to a subject in a single dose of approximately 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg, or 2.0 mg / kg or more, as a total of the nucleic acids of (a) and (b). For example, the single dose or individual dose of multiple nanoparticles administered to the subject could be 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1 The nanoparticles may be complexed with a total RNA (e.g., the sum of ALAS1 gRNA and Cas9 mRNA) in doses of 0.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg, or a number or range between any two of these values. In some embodiments, multiple nanoparticles are administered to a subject in doses of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg (determined by the sum of ALAS1 gRNA and SpCas9 mRNA) or approximately this dose.

[0208] The method may include a single dose of the composition to a subject. The compositions described herein (e.g., LNPs containing ALAS1 gRNA) or nucleic acids encoding ALAS1 gRNA; and nucleic acids encoding RNA guide endonucleases) may be administered to a subject in need of them once or more times, for example, once, twice, three times, four times, five times, or six times. In some embodiments, it may be advantageous to provide a single dose of the composition to a subject. In some embodiments, it may be advantageous to provide the subject with up to three doses of the composition (e.g., once, twice, or three times). Either of the two doses may be separated, for example, from one day to one year. For example, the first dose may be separated from the second dose by 1 to 21 days (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 2 weeks, 3 weeks, or any two of these values ​​or a range) or about this amount. In another example, the second dose may be separated from the third dose by 1 day to 1 year (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 2 months, 3 months, 6 months, 1 year, or any value or range between any two of these values) or by approximately this amount. If there are three or more doses, the length of the interval between any two adjacent doses may be the same or different. For example, in some embodiments, the first dose is separated from the second dose by approximately 1 week (e.g., 7 days), and the second dose is separated from the third dose by approximately 5 weeks (e.g., 35 days). The methods described herein do not, in some embodiments, involve regular scheduled doses of the composition, e.g., every 2 days, every 3 days, every 5 days, weekly, bi-weekly, monthly, bi-monthly, quarterly, bi-quarterly, annually, or bi-yearly doses. In some embodiments, the methods described herein do not involve any administration of the composition for 3 months, 6 months, 9 months, 1 year, 2 years, or longer after the first, second, or third administration of the composition. In some embodiments, the methods described herein do not involve any administration of the composition after the second or third administration of the composition.For example, the methods described herein may, in some embodiments, be effective such that a subject does not need to receive any additional treatment for conditions associated with ALAS1 (e.g., porphyria) for the rest of their life after a single treatment using the composition described herein.

[0209] ALAS1 expression in a subject may be reduced in the subject (e.g., after administration). ALAS1 expression may be reduced in the liver of the subject. The reduction may be compared to (a) the ALAS1 expression of the subject before administration of the composition; (b) the ALAS1 expression in one or more untreated subjects; and / or (c) the reference level of ALAS1 expression in a healthy subject. ALAS1 expression in a subject may be reduced by at least 20% after administration. ALAS1 mRNA expression may be reduced by at least 90% after administration. ALAS1 protein expression may be reduced by at least 75% after administration. In some embodiments, ALAS1 (e.g., ALAS1) mRNA and / or ALAS1 protein expression increased in subjects after administration by approximately 20% or at least 20% (e.g., 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%). The values ​​(58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values) are reduced in the target. In some embodiments, genetic modification of the ALAS1 gene results in a significant reduction of ALAS1 protein or mRNA in the liver.In some embodiments, ALAS1 protein or mRNA levels are 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, and 6%. 0%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values. In some embodiments, the methods described herein can reduce ALAS1 protein or mRNA levels in the liver by approximately, at least, or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0210] In some embodiments, the level of ALAS1 mRNA in the urine of a subject is reduced after administration of the composition; where the reduction is a reduction compared to (a) the ALAS1 mRNA level of the subject before administration of the composition; (b) the ALAS1 mRNA level in one or more untreated subjects; and / or (c) a reference level of ALAS1 mRNA in a healthy subject. In some embodiments, the method described herein involves ALAS1 mRNA in the urine of a subject. mRNA levels of approximately, at least or at least about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61% %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0211] In some embodiments, gene modification of the ALAS1 gene results in a significant reduction in the levels of plasma porphyrin, urinary porphyrin, fecal porphyrin, or any combination thereof. In some embodiments, plasma porphyrin, urinary porphyrin and / or fecal porphyrin levels are 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 5 8%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values. In some embodiments, the methods described herein reduce plasma porphyrin, urinary porphyrin and / or fecal porphyrin levels to approximately, at least or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, and 69%. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0212] In some embodiments, gene modification of the ALAS1 gene results in a significant reduction in plasma and / or urinary 5-aminolevulinic acid (e.g., δ-aminolevulinic acid, e.g., ALA) levels in subjects (e.g., mammals, NHPs, human subjects). In some embodiments, gene modification of the ALAS1 gene results in a significant reduction in plasma and / or urinary porphobilinogen (PBG) levels in subjects (e.g., mammals, NHPs, human subjects).

[0213] In some embodiments, ALAS1 protein and / or ALAS1 mRNA levels in genetically modified subjects (e.g., mammals, NHP, human subjects) are approximately 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, and 60% higher compared to the corresponding unmodified mammals. %, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, less than or about less than these.

[0214] In some embodiments, the frequency of acute porphyria attacks is reduced in a subject compared to a subject before administration of any of the compositions disclosed herein. In some embodiments, the frequency of acute porphyria attacks is 5% or more (e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 5%) compared to the subject before administration of any of the compositions disclosed herein. Reduced by 5%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% (or any number or range between any two of these values). Reduced by approximately these, reduced by at least these, or at least approximately these. In some embodiments, subjects do not experience acute porphyria attacks after administration.

[0215] The reduction may last for at least two weeks, at least three weeks, at least four weeks, or at least one month.

[0216] The method may include administering a therapeutically effective dose of at least one additional therapeutic agent to a subject. The additional therapeutic agent may be or include hematin (e.g., hemin), hemearginite, ALAS1-specific siRNA, or a combination thereof. In some embodiments, the additional treatment is administered to the subject 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week or earlier before the administration of multiple nanoparticles to the subject. In some embodiments, the additional treatment is administered to the subject up to 2 hours before the administration of multiple nanoparticles. In some embodiments, the additional treatment and the multiple nanoparticles are administered simultaneously.

[0217] In some embodiments, the method may involve administering a therapeutically effective dose of at least one additional therapeutic agent to treat one or more symptoms of porphyria (e.g., acute porphyria). In some embodiments, the additional treatment is an analgesic (e.g., acetaminophen, opioids, or nonsteroidal anti-inflammatory drugs (NSAIDs), or a combination thereof). In some embodiments, the additional therapeutic agent may be, for example, a phenothiazine (e.g., chlorpromazine) to reduce nausea. In some embodiments, insomnia may be treated with a non-barbiturate hypnotic, such as chloral hydrate or a benzodiazepine. In some embodiments, epileptic seizures may be treated with, for example, levetiracetam. In some embodiments, the additional treatment is siRNA therapy.

[0218] In some embodiments, subjects have or are suspected of having cutaneous porphyria. Cutaneous porphyria may be congenital erythropoiesis (CEP), myelohepatic porphyria (HEP), patent cutaneous porphyria (PCT), or myeloid protoporphyria and X-linked porphyria (EP / XLP). In some embodiments, subjects have, are suspected of having, or have had acute porphyria. Acute porphyria may be acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), atypical porphyria (VP), or delta-aminolevulinic acid dehydratase deficiency porphyria (ADP).

[0219] As will be understood by those skilled in the art, several tests may be used to diagnose and / or assess the state of disease or disorder associated with ALAS1 overexpression in a subject. A subject may have elevated urinary porphobilinogen (PBG), elevated urinary aminolevulinic acid (ALA), elevated urinary porphyrin, elevated fecal porphyrin, elevated plasma porphyrin, or any combination thereof. In some embodiments, these are compared to reference values.

[0220] The levels of urinary porphobilinogen (PBG), urinary aminolevulinic acid (ALA), urinary porphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof may be reduced in subjects after administration of the composition.

[0221] In some embodiments, the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of ALAS2, ALAD, HMBS, UROD, UROS, CPOX, PPOX, and FECH. The mutation may result in a reduction in the expression, stability, and / or activity of the RNA and / or protein products of at least one gene. The mutation can be dominant or recessive. In some embodiments, the subject has a mutation in one copy of the gene (e.g., heterozygous for the mutation). In some embodiments, the subject has a mutation in both copies of the gene (e.g., homozygous for the mutation). In some embodiments, the mutation is a dominant mutation, e.g., one copy of the mutation is sufficient to produce a mutant phenotype. In some embodiments, the mutation is a recessive mutation, e.g., both copies of the gene are mutated to produce a phenotype.

[0222] In some embodiments, the target tissue for the compositions and methods described herein is liver tissue. In some embodiments, the target cells for the compositions and methods described herein are hepatocytes.

[0223] In some embodiments, these pharmaceutical compositions may be administered by aerosol delivery, nasal delivery, transvaginal delivery, rectal delivery, buccal delivery, oral delivery, local delivery, topical delivery, intracisional delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous injection, subcutaneous injection, intra-lymph node injection, intratumor injection, intraperitoneal injection and / or intradermal injection or any combination thereof. Administration may be local or systemic. Systemic administration includes enteral and parenteral administration. In some embodiments, more than one dose may be used to achieve desired levels of gene expression over periods of varying intervals, e.g., daily, weekly, monthly, or yearly.

[0224] These pharmaceutical compositions may be administered in pharmaceutically effective doses to subjects in urgent need. As used herein, the term “pharmaceutically effective dose” means the amount of a pharmaceutical composition that would produce a desired therapeutic effect and / or biological or medical response in a tissue, system, animal, or human. Administration may result in a desired reduction in the expression of the ALAS1 gene, such as a desired reduction in the levels of the ALAS1 protein and one or more porphyrins.

[0225] Some aspects of the embodiments discussed above are further disclosed in subsequent embodiments, which are not intended to limit the scope of this disclosure in any way. [Examples]

[0226] [Example 1] Method for editing the ALAS1 gene Provided in this embodiment are methods and compositions for editing the ALAS1 gene in, for example, mouse, monkey, and human cells.

[0227] Editing efficiency was tested in mouse, monkey, and human cell lines. Cell lines were seeded in 100 μL of medium / well in tissue culture-treated 96-well flat-bottom plates prior to transfection. MK2 (rhesus monkey kidney cell line) was seeded the day before transfection, and Huh-7-Cas9 (human liver cancer cell line with constitutive SpCas9 expression) and AML12 (mouse hepatocyte cell line with constitutive SpCas9 expression) were seeded on the day of transfection. Cells were seeded at the following concentrations: Huh-7-Cas9: 15,000 cells / well, MK2: 20,000 cells / well, and AML12-Cas9: 30,000 cells / well. For transfection, MessengerMAX Lipofectamine (Thermo Scientific, Waltham, MA) was used, with 150 ng / well guides for Huh-7-Cas9 and AML12-Cas9, and 200 ng / well guides and 200 ng / well Cas9 for MK2. The plates were then incubated at 37°C. After 24 hours, the transfection mixture was removed and replaced with 100 μL of fresh medium. The cells were incubated for a further 48 hours, and then the DNA was isolated from the cells using the Quick-DNA 96 kit (Zymo Research, Irvine, CA). PCR was performed on each unique guide to amplify the region of interest, and TIDE analysis was performed to determine the guide-specific level of the edits.

[0228] The exemplary editing efficiencies of the gRNAs disclosed herein are shown in Figures 1 to 3 and Table 3.

[0229] For experiments with primary human hepatocytes (PHH, see Table 4, for example), PHH cells were thawed in 25 mL of hepatocyte thawing medium (Lonza, Basel, Switzerland). The cells were centrifuged at 100 × g for 8 minutes, resuspended in 4 mL of hepatocyte plating medium containing plating medium supplement (Lonza, Basel, Switzerland), and counted. Cell count was 0.65 × 10⁶ cells. 6Cells were cultured to a concentration of cells / mL, and 500 μL / well was seeded into CellAdhere® Collagen I-coated 24-well plates (STEMCELL, Vancouver, BC). For the first hour after seeding, the plate(s) were shaken from side to side and back and forth every 10 minutes to ensure even cell distribution, and the plates were placed in a 37°C, 5% CO2 incubator. After 24 hours, the medium was removed and replaced with 500 μL of pre-warmed hepatocyte culture medium (Lonza, Basel, Switzerland). In some experiments, INVITROGRO CP medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY) was used for cell thawing, plating, and culture.

[0230] PHH cells were transfected with MessengerMAX Lipofectamine (Thermo Scientific, Waltham, MA) using gRNA and Cas9 mRNA in a 1:3 ratio. The culture medium was replaced 3 days after transfection. Cells were incubated at 37°C, 5% CO2, for a total of 6 days. DNA was isolated from cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany). PCR was performed to amplify the region of interest, and TIDE analysis or augmentation byproduct sequencing was performed to determine the guide-specific level of editing. Exemplary editing efficiencies of the gRNAs disclosed herein are shown in Figure 4 and Table 4.

[0231] Tables 1 and 2 show, below, the gRNA spacer sequences [and their corresponding PAM strand protospacer (e.g., target) sequences and PAMs].

[0232] [Table 1]

[0233] [Table 2]

[0234] [Table 3] TIFF2026526090000005.tif25169

[0235] [Table 4] [Example 2]

[0236] A method for editing the ALAS1 gene in mouse liver. An exemplary method for editing ALAS1 in mouse liver is provided in this embodiment.

[0237] Target product (article) administration protocol The animals were warmed using a heating lamp for approximately 5 minutes. The mice were placed in a restraint device, and their tails were cleaned with isopropanol wipes. Lipid nanoparticles (LNPs) formulated with Cas9 mRNA and mRNA, either mRNA1_E2_G5 (SEQ ID NO: 38), mRNA1_E4_G17 (SEQ ID NO: 29), or mRNA1_E5_G11 (SEQ ID NO: 45) gRNA were administered at 1.0 mg / kg and 2.0 mg / kg by bolus injection into one of the lateral tail veins using a 1 mL syringe fitted with a 26-gauge needle. After administration, the needle was removed, and the area was directly compressed with a square gauze pad until hemostasis occurred, after which the animals were returned to their cages.

[0238] Tissue recovery for molecular analysis I removed the liver and placed it on a cutting board. It was about 5mm thick. 3 A tissue sample was removed and placed in a vial containing crushed beads. The vial was placed under dry ice to rapidly freeze the tissue.

[0239] molecular analysis DNA was isolated from flash-frozen mouse liver using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. PCR was then performed to amplify the region of interest, and TIDE analysis was carried out to determine the total editing level. Exemplary results are shown in Figure 5. [Example 3]

[0240] Method for editing the ALAS1 gene in hepatocytes This embodiment provides an exemplary method for editing ALAS1 in human cells, such as primary human hepatocytes.

[0241] Primary human hepatocytes (PHH) from six donors were thawed in 15 mL of INVITROGRO CP Medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY). The cells were centrifuged at 100 × g for 8 minutes, resuspended in 4 mL of INVITROGRO CP Medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY), and counted. Cell count was 0.65 × 10⁶ 6 Cells were cultured to a concentration of cells / mL. 500 μL / well of cells was seeded into CellAdhere® Collagen I-coated 24-well plates (STEMCELL, Vancouver, BC). For the first hour after seeding, the plates were shaken from side to side and back and forth every 10 minutes to ensure even cell distribution, and the plates were placed in a 37°C, 5% CO2 incubator. The following day, the medium was removed and replaced with 500 μL of pre-warmed INVITROGRO CP medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY) containing the corresponding amounts of Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30) and formulated lipid nanoparticles (LNPs). Three days after LNP treatment, DNA was isolated from the cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany). PCR was performed to amplify the target region, and augmentation byproduct sequencing was carried out to determine the total editing level. Exemplary results are shown in Figure 6.

[0242] The objective of editing the ALAS1 gene is to knock down ALAS1 protein expression. To evaluate the effectiveness of editing for protein knockdown, primary human hepatocytes and primary NHP hepatocytes from one donor each were thawed in 15 mL of INVITROGRO CP Medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY). The cells were centrifuged at 100 × g for 8 minutes, resuspended in 4 mL of INVITROGRO CP Medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY), and counted. Cell count was 0.65 × 10⁶ cells. 6 Cells were cultured to a concentration of cells / mL. 500 μL / well was seeded into CellAdhere® Collagen I-coated 24-well plates (STEMCELL, Vancouver, BC). For the first hour after seeding, the plates were shaken from side to side and back and forth every 10 minutes to ensure even cell distribution, and the plates were placed in a 37°C, 5% CO2 incubator. The following day, the medium was removed and replaced with 500 μL of pre-warmed INVITROGRO CP medium + TORPEDO Antibiotic Mix (BioIVT, Westbury, NY) containing the corresponding amounts of Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30) and formulated lipid nanoparticles (LNPs). Three days after LNP treatment, the medium was replaced with pre-warmed fresh medium. Five days after LNP treatment, DNA was isolated from cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany), and protein solubilizes were extracted. PCR was performed to amplify the target region on the DNA, and augmentation byproduct sequencing was performed to determine the total editing level. ALAS1 protein expression levels were determined via capillary-based immunoassay and expressed as relative expression of the treated sample compared to the untreated sample. Exemplary results are shown in Figures 9A and 9B. [Example 4]

[0243] Method for editing the ALAS1 gene in vivo Methods and data related to in vivo editing of ALAS1 are provided in this embodiment.

[0244] NHP Data Method Lipid nanoparticles (LNPs) formulated with Cas9 mRNA and xhALAS1_E5_G5 gRNA (SEQ ID NO: 30) were intravenously administered to cynomolgus macaques (NHP) at a dose of 2.0 mg / kg. ALAS1 editing in the liver was evaluated by sequencing of augmented byproducts from isolated DNA using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol (Figure 8).

[0245] In at least some of the embodiments described above, one or more elements used in one embodiment may be used interchangeably in another embodiment, unless such substitution is not technically feasible. It will be understood by those skilled in the art that various other omissions, additions, and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to be within the scope of the subject matter as defined by the appended claims.

[0246] With regard to substantially all use of plural and / or singular terms herein, a person skilled in the art can interpret them plural-to-singular and / or singular-to-plural where appropriate to the context and / or application. Various singular / plural exchanges may be specifically described herein for clarity. Where used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context explicitly indicates otherwise. Any reference to “or” herein is intended to include “and / or” unless otherwise stated.

[0247] It will be understood by those skilled in the art that, in general, the terms used herein and in particular in the appended claims (e.g., in the text of the appended claims) are intended to be generally “open” terms (for example, the term “contains” should be interpreted as “contains but not limited to,” the term “has” should be interpreted as “has at least,” and the term “includes” should be interpreted as “includes but not limited to,” etc.). Where a certain number of introduced claims are intended, such intention will be clearly stated in the claims, and where there is no such statement, it will be understood by those skilled in the art that such intention does not exist. For example, for the sake of understanding, the following appended claims may include the use of the introductory phrases “at least one” and “one or more” to introduce the claims. However, the use of such phrases should not be interpreted as meaning that the introduction of a claim description by the indefinite article "a" or "an" limits any particular claim containing such introduced claim description to only one embodiment containing such description, even if the same claim includes the introductory phrase "one or more" or "at least one" and the indefinite article "a" or "an" (for example, "a" and / or "an" should be interpreted as meaning "at least one" or "one or more"); the same is true for the use of definite articles used to introduce claim descriptions. In addition, even if a particular number of introduced claim descriptions are explicitly stated, a person skilled in the art will understand that such a description should be interpreted as meaning at least the number described (for example, the statement "two descriptions" alone, without other modifying phrases, means at least two descriptions or two or more descriptions).Furthermore, when idiomatic expressions similar to "at least one of A, B, and C" are used, such constructions are generally intended to be understood by those skilled in the art (for example, "a system having at least one of A, B, and C" includes, but is not limited to, systems having only A, only B, only C, A and B together, A and C together, B and C together, and / or systems having A, B, and C together). When idiomatic expressions similar to "at least one of A, B, or C" are used, such constructions are generally intended to be understood by those skilled in the art (for example, "a system having at least one of A, B, or C" includes, but is not limited to, systems having only A, only B, only C, A and B together, A and C together, B and C together, and / or systems having A, B, and C together). It will also be understood by those skilled in the art that virtually any separate word and / or phrase representing two or more alternative terms should be understood as construing the possibility of including one of those terms, either or both of those terms in the description, claims, or drawings.

[0248] In addition, if any characteristic or aspect of the disclosure is described in terms of the Markush group, a person skilled in the art will understand that the disclosure is also described in terms of any individual member or subgroup of a member of the Markush group.

[0249] As will be understood by those skilled in the art, for any and all purposes, for providing, for example, written explanations, all scopes disclosed herein also encompass any and all possible subscopes and combinations thereof. Any enumerated scope can be readily understood as sufficiently describing and enabling that the same scope may be divided into at least two, three, four, five, ten, etc. As a non-restrictive example, each scope considered herein may be readily divided into a lower third, a middle third, and an upper third. As will also be understood by those skilled in the art, all words such as “at most,” “at least,” “greater than,” and “less than” include the number described and refer to a scope that may later be divided into subscopes as considered above. Finally, as will be understood by those skilled in the art, a scope includes each individual member. Thus, for example, a group having 1 to 3 elements refers to a group having 1, 2, or 3 elements. Similarly, a group having 1 to 5 elements refers to a group having 1, 2, 3, 4, or 5 elements, and so on.

[0250] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will also be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for illustrative purposes only and are not intended to limit, and the true scope and spirit are indicated by the following claims.

Claims

1. A guide RNA (gRNA) that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus and contains a spacer sequence with 80% sequence identity to one of the sequences 25-48 and 83-112.

2. The gRNA according to claim 1, comprising a spacer sequence containing one of the sequences of sequence numbers 25-48 and 83-112.

3. The gRNA according to claim 1, comprising a spacer sequence containing any one of sequences 25-37 and 100-112.

4. The gRNA according to claim 1, comprising a spacer sequence including the sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO:

87.

5. The gRNA according to claim 1, comprising a spacer sequence including the sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO:

30.

6. The gRNA according to any one of claims 1 to 5, which can induce a cleavage efficiency of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% with respect to the target ALAS1 genomic locus.

7. The gRNA according to claim 6, which can induce a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% with respect to the target ALAS1 genomic locus.

8. The gRNA according to claim 6, which can induce a cleavage efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% with respect to the target ALAS1 genomic locus.

9. A single guide RNA (sgRNA) gRNA according to any one of claims 1 to 8.

10. A chemically modified gRNA, as described in any one of claims 1 to 9.

11. The gRNA according to claim 10, wherein the chemically modified gRNA comprises one or more phosphorothioate bonds and / or one or more 2'-O-methyl nucleotides at its 3' end, 5' end, or both.

12. The gRNA according to any one of claims 10 to 11, wherein 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications.

13. The gRNA according to any one of claims 10 to 12, wherein approximately 48% of the gRNA nucleotides contain 2'-O-methyl modifications, the 5' end of the gRNA contains three phosphorothioate bonds, and / or the 3' end of the gRNA contains three phosphorothioate bonds.

14. (a) a gRNA according to any one of claims 1 to 13 or a polynucleotide encoding a gRNA according to any one of claims 1 to 13, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

15. (a) Guide RNA (gRNA) or nucleic acid encoding gRNA that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus; and (b) Endonucleases or nucleic acids encoding endonucleases A composition containing the following:

16. (a) Guide RNA (gRNA) or nucleic acid encoding gRNA that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease A composition containing the following:

17. The composition according to any one of claims 15 to 16, wherein the gRNA is a single guide RNA (sgRNA).

18. The composition according to any one of claims 15 to 17, wherein the gRNA is a chemically modified gRNA.

19. The composition according to claim 18, wherein the chemically modified gRNA comprises one or more phosphorothioate bonds and / or one or more 2'-O-methyl nucleotides at its 3' end, 5' end, or both.

20. The composition according to any one of claims 18 to 19, wherein 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications.

21. The composition according to any one of claims 18 to 20, wherein 48% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications, the 5' end of the gRNA contains three phosphorothioate bonds, and / or the 3' end of the gRNA contains three phosphorothioate bonds.

22. The composition according to any one of claims 14 to 21, wherein the Cas9 endonuclease is selected from the group consisting of Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, and T. denticola Cas9.

23. The composition according to any one of claims 14 to 22, comprising (a) ALAS1 gRNA and (b) Cas9 endonuclease, wherein the ALAS1 gRNA and Cas9 endonuclease are formulated as ribonucleoprotein particles (RNPs).

24. The composition according to any one of claims 14 to 22, comprising (a) a nucleic acid encoding ALAS1 gRNA and (b) a nucleic acid encoding Cas9 endonuclease, wherein (a) and / or (b) are present on a viral vector.

25. The composition according to claim 24, wherein the viral vector is an adeno-associated virus vector.

26. The composition according to any one of claims 14 to 23, wherein (a) gRNA or a nucleic acid encoding gRNA, (b) Cas9 endonuclease or a nucleic acid encoding Cas9 endonuclease, or both, are complexed with liposomes or lipid nanoparticles (LNPs).

27. The composition according to claim 26, wherein the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids.

28. The composition according to claim 26, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.

29. A method for treating a disease or disorder caused by overexpression of 5'-aminolevulinate synthase 1 (ALAS1) in a subject requiring such treatment, comprising administering one of the compositions described in claims 14 to 28 to the subject, thereby treating the disease or disorder caused by overexpression of ALAS1 in the subject.

30. A method for treating a subject having or suspected of having porphyria, comprising administering a composition comprising a gRNA that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus to the subject, thereby treating the porphyria.

31. A method for treating diseases or disorders caused by overexpression of 5'-aminolevulinate synthase 1 (ALAS1) in subjects requiring it, (a) Guide RNA (gRNA) or nucleic acid encoding gRNA that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease A method comprising administering a composition containing multiple nanoparticles complexed with ALAS1 to a subject, thereby treating a disease or disorder caused by ALAS1 overexpression in the subject.

32. The method according to any one of claims 30 to 31, wherein the composition is the composition according to any one of claims 14 to 28.

33. The method according to any one of claims 30 to 32, wherein the gRNA targeting the ALAS1 genomic locus includes a spacer sequence comprising one of the sequences 25 to 48 and 83 to 112.

34. A method for treating subjects who have or are suspected of having porphyria, (a) Guide RNA (gRNA) or nucleic acid encoding gRNA that targets the 5'-aminolevulinate synthase 1 (ALAS1) genomic locus; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease A method comprising administering a composition containing multiple nanoparticles complexed with a subject to treat porphyria.

35. The method according to claim 34, wherein the gRNA targeting the ALAS1 genomic locus includes a spacer sequence comprising any one of the sequences SEQ ID NOs. 25-48 and 83-112.

36. The method according to any one of claims 31 to 35, wherein the Cas9 endonuclease is selected from the group consisting of Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, and T. denticola Cas9.

37. The method according to any one of claims 31 to 36, wherein the plurality of nanoparticles are lipid nanoparticles.

38. The method according to claim 37, wherein the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids.

39. The method according to claim 37, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipid, or both.

40. The method according to any one of claims 29 to 39, comprising administering the composition to a subject in a single dose of about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg, or 2.0 mg / kg as the sum of the nucleic acids of (a) and (b).

41. The method according to any one of claims 29 to 40, comprising administering a single dose of the composition to a subject.

42. The method according to any one of claims 29 to 40, wherein the subject is administered the composition two or more times.

43. The method according to claim 42, wherein each of the two or more administrations is spaced approximately two weeks to approximately four weeks apart.

44. The method according to claim 42, wherein each of the two or more administrations is spaced at least three months apart.

45. The method according to any one of claims 29 to 44, wherein the expression of ALAS1 in the subject is reduced in the subject; optionally, the expression of ALAS1 is reduced in the liver of the subject; and the reduction is a reduction compared to (a) the ALAS1 expression of the subject before administration of the composition; (b) the ALAS1 expression in one or more untreated subjects; and / or (c) the reference level of ALAS1 expression in a healthy subject.

46. The method according to claim 45, wherein the expression of ALAS1 in the subject is reduced by at least 20% after administration.

47. The method according to any one of claims 45 to 46, wherein the expression of ALAS1 in the subject is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% after administration.

48. The method according to claim 47, wherein the level of ALAS1 mRNA is reduced by at least 90% following administration.

49. The method according to any one of claims 47 to 48, wherein the level of ALAS1 protein is reduced by at least 75% following administration.

50. The method according to any one of claims 45 to 49, wherein the reduction lasts for at least two weeks, at least three weeks, at least four weeks, or at least one month.

51. The method according to any one of claims 29 to 50, further comprising administering to the subject a therapeutically effective amount of at least one additional therapeutic agent.

52. The method according to claim 51, wherein the additional therapeutic agent is hematin, hemearginite, ALAS1 siRNA, or a combination thereof.

53. The method according to any one of claims 29 to 52, wherein the subject has or is suspected of having cutaneous porphyria, and the cutaneous porphyria is congenital erythropoiesis (CEP), myelohepatic porphyria (HEP), pterocutaneous porphyria (PCT), or myeloid protoporphyria and X-linked porphyria (EP / XLP).

54. The method according to any one of claims 29 to 53, wherein the subject has, is suspected of having, or has had acute porphyria, and the acute porphyria is acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), atypical porphyria (VP), or delta-aminolevulinic acid dehydratase deficiency porphyria (ADP).

55. The method according to claim 54, wherein the frequency of acute porphyria attacks is reduced in the subjects compared to the subjects before administration.

56. The method according to any one of claims 29 to 55, wherein the subject has elevated plasma and / or urinary porphobilinogen (PBG), elevated plasma and / or urinary aminolevulinic acid (ALA), elevated urinary porphyrin, elevated fecal porphyrin, elevated plasma porphyrin, or any combination thereof, compared to a reference value as appropriate.

57. The method according to claim 56, wherein the levels of plasma and / or urinary porphobilinogen (PBG), plasma and / or urinary aminolevulinic acid (ALA), urinary porphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof are reduced in a subject following administration of the composition.

58. The method according to any one of claims 29 to 57, wherein the level of ALAS1 mRNA in the urine of the subject is reduced following administration of the composition; the reduction is a reduction compared to (a) the level of ALAS1 mRNA in the subject before administration of the composition; (b) the level of ALAS1 mRNA in one or more untreated subjects; and / or (c) a reference level of ALAS1 mRNA in a healthy subject.

59. The method according to any one of claims 29 to 58, wherein the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of ALAS2, ALAD, HMBS, UROD, UROS, CPOX, PPOX, and FECH; and optionally, the mutation results in a reduction in the expression, stability, and / or activity of the RNA and / or protein product of at least one gene.

Images