Downy mildew resistance in spinach

Abstract

The present invention relates to a spinach plant having a gene or locus that confers broad-area resistance to Peronospora effusa (Pe). Furthermore, the present invention also relates to the progeny of the spinach plant, the propagation material of the spinach plant, the cells of the spinach plant, the seeds of the spinach plant, and the harvested leaves of the spinach plant. Furthermore, the present invention also relates to the use of the spinach plant in breeding to confer resistance to Peronospora effusa. Furthermore, the present invention also relates to a method for producing a spinach plant with broad-area resistance to Peronospora effusa (Pe).

Description

Technical Field

[0001] The present invention relates to spinach plants having a gene or locus showing broad resistance to Peronospora effusa (Pe). The present invention also relates to the progeny of the spinach plant, the propagation material of the spinach plant, the cells of the spinach plant, the seeds of the spinach plant, and the harvested leaves of the spinach plant. Furthermore, the present invention also relates to the use of the spinach plant in breeding for imparting resistance to Peronospora effusa. In addition, the present invention also relates to a method for producing a spinach plant having broad resistance to Peronospora effusa (Pe).

Background Art

[0002] Spinach (Spinacia oleracea) is an angiosperm belonging to the Amaranthaceae family and is cultivated as a vegetable. The edible part of spinach is the leaves during its vegetative growth stage. Spinach is sold in loose, bunch, pre-packaged bags, canned, or frozen forms. There are mainly three basic types of spinach: Savoy, semi-Savoy, and smooth. Savoy spinach has wrinkled, crinkled leaves. Flat-leaf or smooth-leaf spinach generally has broad, smooth leaves. Semi-Savoy spinach is a variety with slightly wrinkled leaves. The main market for spinach is baby leaf. Baby spinach leaves are usually from the flat-leaf variety, and harvested leaves typically do not exceed about 8 centimeters. These tender, sweet leaves are often sold loose rather than in bunches. They are often used in salads, but can also be lightly cooked. Downy mildew in spinach, caused by the pathogen Peronospora effusa (formerly known as P. farinosa f. sp. spinaciae), is a major threat to spinach growers because it affects the leaves, the harvested part of the plant. Infected leaves become unsuitable for sale or consumption, and phenotypic symptoms include yellow lesions on older leaves and the appearance of grayish mycelium on the underside of the leaves. Infection spreads very rapidly and can occur in both greenhouse and soil cultivation. The optimal temperature for the formation and germination of P. effusa is 9-12°C, and it is promoted by high relative humidity. When the pathogen adheres to a moist leaf surface, it easily germinates and infects the leaves. Pathogen growth is optimal at 8-20°C and above 80% relative humidity, and growth is observed within 6-13 days after infection. P. effusa can survive in soil for up to 3 years, or in seeds and living plants. In recent years, various resistance genes conferring downy mildew resistance to spinach have been identified. However, spinach varieties that were previously resistant have been observed to become susceptible to the pathogen again. Investigations have revealed that the varieties themselves have not changed, and therefore the loss of downy mildew resistance is due to P. effusa overcoming the resistance of these spinach varieties. Downy mildew strains capable of infecting resistant spinach varieties have been identified on differential strain sets used for resistance testing.The differential strain set consists of a series of spinach varieties (hybrids) that exhibit different resistance patterns to currently identified pathogen strains. To date, 19 pathogen strains of spinach downy mildew (Pe) have been officially identified and characterized. Strains 4 through 10 were identified between 1990 and 2009, demonstrating the diversity and adaptability of the pathogen in overcoming spinach resistance.

[0003] Different combinations of pathogen strains or isolates occur in different geographical regions, and therefore the spinach industry has a strong demand for spinach varieties that are resistant to as many relevant downy mildew strains as possible, preferably all strains that may occur in that region, and even to the latest threats that cannot be addressed by the resistance present in commercially available spinach varieties.

[0004] Staying at the forefront of advancements in this field is extremely important because the Peronospora genus is continuously acquiring the ability to overcome the resistances present in commercially available spinach varieties. Therefore, new resistance genes are extremely valuable assets and are an important research subject in spinach breeding. The goal of spinach breeders is to rapidly develop spinach varieties resistant to as many Peronospora strains as possible, including the latest ones. To date, 19 strains of Peronospora (Pe) in spinach have been officially recognized by the International Working Group on Peronospora in Spinach (IWGP), and are publicly available from the Department of Plant Pathology, University of Arkansas, Fayetteville, Ark. 72701, USA, and NAK Tuinbouw, Netherlands (Sotaweg 22, 2371 GD Roelofarendsveen). Recently identified isolates SP1924 and UA202001E have been named Pe 18 and Pe 19, respectively.

[0005] The object of the present invention is to provide spinach plants that confer broad resistance, i.e., resistance to various Peronospora strains and / or isolates, including those recently identified. [Overview of the project]

[0006] The present invention provides a spinach plant resistant to at least one of the following isolates of Peronospora efsa, also known as lines 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19, as well as isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+. The plant is obtained by cross-pollination from a representative sample of seeds deposited with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) Ltd. under the following registration numbers.

[0007] NCIMB number NCIMB 44186 NCIMB 44187 NCIMB 44188 NCIMB 44189 NCIMB 44190 NCIMB 44191 NCIMB 44192 NCIMB 44193 NCIMB 44194 NCIMB 44195

[0008] The plants possess broad resistance to Peronospora efsa, and this resistance is reliably transmitted to subsequent generations. [Modes for carrying out the invention]

[0009] definition Unless otherwise defined, all terms used in the disclosure of this invention (including technical and scientific terms) shall have the meanings that are ordinarily understood by those skilled in the art. For further guidance, definitions of terms are included to enhance the understanding of this invention.

[0010] The indefinite article "a" or "an" does not rule out the possibility of multiple elements unless the context explicitly requires that there be only one of them. The indefinite article "a" or "an" usually means "at least one."

[0011] A "plant variety" is a group of plants belonging to the lowest rank within the same plant classification (regardless of whether or not they meet the requirements for breeder's rights), defined based on the expression of traits resulting from a specific genotype or combination of genotypes, distinguished from any other plant group by the expression of at least one of these traits, and considered a single entity because it can be propagated without change. Therefore, the term "plant variety" cannot be used to refer to a group of plants of the same species that are characterized by one or two specific loci or genes (or phenotypic features resulting from these specific loci or genes), but which may differ significantly in other loci or genes.

[0012] In this specification, “spinach,” “cultivated spinach,” or “cultivated Spinacia oleracea” refers to plants of the Spinacia oleracea species (or seeds capable of growing such plants) or parts of such plants that have been artificially bred for food and possess superior agricultural traits. This includes any cultivated spinach, including breeding lines (e.g., backcross lines, self-pollinated lines), varieties, and cultivars (open pollination or hybridization). It also includes any type of spinach, such as Savoy, flat-leaved, or slippery-leaved varieties, or semi-Savoy. Wild spinach (i.e., anything other than cultivated spinach) and wild relatives of spinach, such as Spinacia tetrandra and Spinacia turkestanica, are not included in this definition.

[0013] In this specification, the term "plant" includes any part such as a seed (from which the plant can be grown), a whole plant or plant organ (e.g., harvested or unharvested leaves), plant cells, plant protoplasts, plant cells or tissue cultures capable of redifferentiating into a whole plant, proliferative or non-proliferative plant cells, plant cells not in tissue culture (e.g., present in the living body of a plant or part of a plant), plant callus, plant cell mass, plant graft, seedling, plant cell in a complete state within a plant, plant clone or microproliferator, or part of a plant (e.g., harvested tissue or organ), such as plant cuttings, vegetative propagators, embryos, pollen, ovules, flowers, leaves, inflorescences, seeds (produced on a plant after self-pollination or cross-pollination), clonally propagated plants, roots, stems, stalks, root tips, grafts, any part thereof and derivatives thereof, preferably having the same or very similar genetic makeup as the plant from which it was obtained. Furthermore, any developmental stage is included, such as seedlings, pre-rooting or post-rooting cuttings, mature or immature plants, and mature or immature leaves. "Plant seeds" refers to seeds capable of growing the plant, or seeds produced on a plant after self-pollination or cross-pollination.

[0014] Somatic cells and germ cells are distinguished. Somatic cells are all cells other than gametes (e.g., ovules and pollen), germ cells, and gametomother cells. Gametes, germ cells, and gametomother cells are all "germ cells."

[0015] "Tissue culture" or "cell culture" refers to an in vitro composition containing isolated cells of the same or different types, or in which such cells are organized as plant tissue. Tissue cultures and cell cultures of spinach, and the redifferentiation of spinach plants from them, are well known and widely published (see, for example, Nguyen et al., 2013, Plant Biotechnology Reports, Vol. 7 Issue 1, p. 99).

[0016] "Harvested plant material" refers to parts of a plant (e.g., leaves separated from the whole plant) that have been collected for further preservation and / or further use.

[0017] "Harvested seeds" refers to seeds harvested from a lineage or variety, that is, seeds produced and collected after self-pollination or cross-pollination.

[0018] In this specification, “harvested leaves” refers to the leaves of spinach, that is, the plant excluding the root system, for example, substantially all (harvested) leaves.

[0019] In this specification, “progeny” or “(one or more) progeny” or “offspring” means progeny or first-generation and all subsequent offspring obtained (available or obtained) from the plant of the invention that contain (retain) the resistance genes described herein in homozygous or heterozygous form and / or possess the resistance phenotype. Progeny may be derived by cell culture or tissue culture, redifferentiation of a portion of the plant, self-pollination of the plant, or seed production of the plant. Furthermore, progeny may also include spinach plants obtained by crossing, backcrossing, introduction of loci and / or mutation with at least one spinach plant of the same or different variety or (breeding) lineage of other spinach plants. Progeny may be, for example, first-generation progeny, i.e., those derived, obtained, available, or obtainable directly from the parent plant by traditional breeding methods (self-pollination and / or cross) or redifferentiation. However, the term "progeny" generally also includes second, third, fourth, fifth, sixth, seventh, or later generations of plants obtained, acquired, available, or potentially acquired from previous generations through traditional breeding methods, redifferentiation, or genetic transformation techniques. For example, second-generation progeny can be produced from first-generation progeny by any of the methods described above. Diploid haploid plants are also progeny.

[0020] A "plant lineage" refers to a breeding line used, for example, to develop one or more varieties.

[0021] "F1, F2, F3, etc." refers to a series of related generations following the cross between two parent plants or parent lines. Plants grown from seeds obtained by crossing two plants or lines are called the F1 generation. When F1 plants are self-propagated, they become the F2 generation, and so on.

[0022] "Hybridization" refers to seeds obtained by crossbreeding one plant lineage or variety with another plant lineage or variety, and to plants or parts of plants grown from such seeds.

[0023] An "F1 hybrid" plant (or F1 hybrid offspring) is the generation obtained by crossing two non-isogenic self-pollinating parent lines. Therefore, an F1 hybrid offspring is the seed from which an F1 hybrid plant is grown.

[0024] "Interspecific hybridization" refers to a hybridization obtained by crossing a plant of one species (e.g., S. oleracea) with a plant of another species (e.g., S. tetrandra or S. turkestanica).

[0025] "Hybridization" refers to the crossing of two parent plants. Similarly, "cross-pollination" refers to fertilization by the union of two gametes derived from different plants.

[0026] "Self-pollination" refers to the self-fertilization of a plant, i.e., the union of gametes derived from the same plant.

[0027] "Backcrossing" refers to a breeding method for transforming a (single) trait such as Pe resistance conferred by a resistance gene from one genetic background (also called the "donor parent"; generally a recessive genetic background but not necessarily so) to another genetic background (also called the "recurrent parent"; generally a dominant genetic background but not necessarily so). The offspring of the cross (e.g., an F1 plant obtained by crossing a wild spinach or its wild relative with a cultivated spinach, or an F2 plant or F3 plant obtained by self-pollination of the F1) are "backcrossed" to the parent with the dominant genetic background, e.g., the cultivated parent.

[0028] By performing repeated backcrossing, the traits of the donor parent's genetic background, such as the resistance gene, will be incorporated into the recurrent parent's genetic background. "Gene transformation" or "introgressed plant" or "single-locus introgression" in this context refers to a plant developed by backcrossing, in which almost all of the desired morphological and / or physiological characteristics of the recurrent parent are restored, and which has one or more genes (e.g., resistance genes) transformed from the donor parent.

[0029] In this specification, "traditional breeding techniques" include hybridization, backcrossing, self-pollination, selection, chromosome doubling, diploid haploid generation, embryo rescue, bridge species utilization, protoplast fusion, marker selection, mutation breeding, etc. (i.e., methods other than genetic engineering / transformation / transgenic methods), and are used, for example, to obtain, identify, select, and / or transform resistance genes.

[0030] "Redifferentiation" refers to the process of developing plants from in vitro cell culture, tissue culture, or vegetative propagation.

[0031] "Vegetative propagation," "vegetative reproduction," or "clonal propagation" are used synonymously herein and mean a method by which a part of a plant is used to form at least a root, and the plant part is defined, for example, as a leaf, pollen, embryo, cotyledon, hypocotyl, cell, protoplast, meristematic cell, root, root tip, pistil, anther, flower, shoot tip, shoot, stem, fruit, petiole, or obtained from them (for example, by cutting). If the entire plant is regenerated by vegetative propagation, it is also called "vegetative propagation" or "vegetatively propagated plant."

[0032] A "single-locus introduced plant" refers to a plant developed by plant breeding techniques that include or consist of backcrossing, in which almost all of the desired morphological and / or physiological characteristics of the spinach plant are restored, and which also possesses the characteristics of a single locus introduced into the plant by backcrossing and / or genetic transformation.

[0033] A "transgene" or "chimeric gene" refers to a gene locus containing a DNA sequence that has been transformed into the genome of a spinach plant through genetic transformation. Plants in which transgenes are stably incorporated into their genome are called "transgenic plants."

[0034] A "transgene" or "chimeric gene" refers to a gene locus containing a DNA sequence that has been transformed into the genome of a spinach plant through genetic transformation. Plants in which transgenes are stably incorporated into their genome are called "transgenic plants."

[0035] "Pe," "Peronospora effusa," or "downy mildew" refers to a race of the pathogen Peronospora effusa. Pe 1-19 is an officially recognized race that can be distinguished in spinach identification varieties and is available through references from Naktuinbouw (PO Box 40, 2370 AA Roelofarendsveen, Netherlands) or the ISF (International Seed Federation).

[0036] "Identification test varieties" or "identification varieties" refer to spinach identification test varieties used to distinguish Pe 1-19, and are available through references from Naktuinbouw (PO Box 40, 2370 AA Roelofarendsveen, Netherlands) or the ISF (International Seed Federation).

[0037] A “Pe-resistant plant,” “downy mildew-resistant plant,” “Pe-resistant plant,” or “Pe-resistant phenotype” refers to a spinach plant that is resistant to one or more pathogenic races and / or pathogenic isolates of Pe, as determined by a qualitative resistance assay under controlled environmental conditions. In such a resistance assay, multiple plants of a certain genotype (e.g., at least 2 replicates from at least 10 plants) are inoculated with a sporangia suspension of the race or isolate and cultured under appropriate conditions. After an appropriate culture period (e.g., 7, 8, 9, 10, or 11 days or more after inoculation), the plants are evaluated for symptoms. Susceptible controls must show sporogenesis at the time of symptom evaluation. Plants showing sporogenesis on the cotyledons (and / or true leaves) are considered “susceptible,” and plants showing no sporogenesis on the cotyledons (and / or true leaves) are considered “resistant.” Furthermore, plants exhibiting sparse spore formation at the tips of their cotyledons (and / or true leaves) suggest a reduced infection level and are considered “intermediately resistant.” Plant genotypes in which 95–100% of inoculated plants are classified as “resistant” are considered resistant to the race or isolate. In testing, more than 95% (preferably 100%) of inoculated plants of a susceptible control plant (e.g., variety “Viroflay”) should exhibit spore formation. Appropriate testing is described in Irish et al. 2007 (Materials and Methods, Plant Disease Vol. 91 No. 11, pp. 1392–1394) or Correll et al. 2010 (Guidelines for Spinach Downy Mildew: Peronospora farinosa f sp. spinaciae (Ps) on the International Seed Federation website). In this specification, “+” indicates susceptibility, “-” indicates resistance, and “(-)” indicates intermediate resistance (also called field resistance).

[0038] "Loci" (plural: loci) refers to a specific location or site on a chromosome where, for example, a gene or genetic marker exists.

[0039] An "allele" (plural: alleles) refers to one or more alternative forms of a gene at a particular locus, all of which are associated with a single trait or characteristic at that locus. In diploid cells of organisms, alleles of a particular gene reside at a specific location on the chromosome, i.e., a locus (plural: loci). Each chromosome in a homologous pair contains one allele. Diploid plant species can have many different alleles at a particular locus. These can be the same gene allele (homozygote) or two different alleles (heterozygote).

[0040] A "gene" is defined as a (genomic) DNA sequence that includes a region transcribed into a messenger RNA molecule (mRNA) within a cell (transcription region) and a functionally linked regulatory region (e.g., promoter). Different alleles of a gene are therefore different subtypes of the gene and may exist, for example, in the form of differences in one or more nucleotides in the genomic DNA sequence (e.g., promoter sequence, exon sequence, intron sequence, etc.), mRNA, and / or the amino acid sequence of the protein it encodes.

[0041] An "allelic test" is a genetic test used to determine whether phenotypes (e.g., Pe resistance) observed in two plants are due to the same gene or different genes. For example, the plants to be tested are crossed, the F1 generation is self-pollinated, and the segregation of phenotypes in the F2 generation is determined. Other segregated populations (e.g., backcross populations) can be created in a similar manner. The segregation ratio of phenotypes indicates whether the gene is allele (an allele of the same gene) or non-allelic (different, independent genes).

[0042] A “gene intrusion fragment,” “gene intrusion segment,” or “gene intrusion region” refers to a chromosome fragment (or part or region of a chromosome) introduced into another plant of the same or closely related species through hybridization or traditional breeding techniques (e.g., backcrossing). In other words, the intrusion fragment is the result of a breeding method (e.g., backcrossing) expressed by the verb “introgression.” In spinach, wild spinach or its close relatives are often used to introduce fragments of the wild genome into the genome of cultivated spinach. Such a spinach plant will have the “genome of Spinacia oleracea,” but its genome will contain fragments of wild spinach or its close relatives. It is understood that the term “gene intrusion fragment” does not include an entire chromosome, but only a portion of one. The gene transfer fragments can be large, for example, equivalent to half a chromosome, but are preferably smaller, for example, less than or equal to about 15 Mb, less than or equal to about 10 Mb, less than or equal to about 9 Mb, less than or equal to about 8 Mb, less than or equal to about 7 Mb, less than or equal to about 6 Mb, less than or equal to about 5 Mb, less than or equal to about 4 Mb, less than or equal to about 3 Mb, less than or equal to about 2 Mb, less than or equal to about 1 Mb (1,000,000 base pairs), or less than or equal to about 0.5 Mb (500,000 base pairs), for example less than or equal to about 200,000 bp (200 kilobase pairs), less than or equal to about 100,000 bp (100 kb), less than or equal to about 50,000 bp (50 kb), or less than or equal to about 25,000 bp (25 kb).

[0043] The “physical distance” between loci on the same chromosome (e.g., between molecular markers and / or phenotypic markers) is the actual physical distance, expressed in base pairs (bp), kilobase pairs (kb), or megabase pairs (Mb).

[0044] The "genetic distance" between loci on the same chromosome (e.g., between molecular markers and / or phenotypic markers) is measured by crossover frequency or recombination frequency (RF), expressed in centimorgan units (cM). 1 cM corresponds to a recombination frequency of 1%. If no recombinants are found, the RF is zero, and the loci are extremely close or identical. The greater the distance between two loci, the higher the RF.

[0045] To say that a genetic element, locus, gene transfer fragment, gene, or allele conferring a trait (e.g., Pe resistance) is "obtained from," "derived from," "derived from," "present in," or "found in" a plant or seed means that, using traditional breeding techniques, it is possible to transform a plant or seed containing the genetic element, locus, gene transfer fragment, gene, or allele into another plant or seed (e.g., a line or variety) that lacks the element, without causing any phenotypic changes in the recipient plant other than the trait. These terms are used synonymously, and therefore, a genetic element, locus, gene transfer fragment, gene, or allele is transformable into any other genetic background lacking the trait. This includes not only deposited seeds and seeds containing the genetic element, locus, gene transfer fragment, gene, or allele, but also their progeny / offspring selected to retain the element. For example, commercial varieties developed from deposited seeds or their offspring are included. A person skilled in the art can determine whether a plant has the same genetic elements, loci, gene transfer fragments, genes, or alleles as those obtained from deposited seeds, using one or more techniques known in the art, such as phenotypic assays, whole-genome sequencing, molecular marker analysis, trait mapping, chromosome painting, and allergy testing.

[0046] In this specification, "traditional breeding techniques" include crossbreeding, backcrossing, self-pollination, selection, chromosome doubling, diploid production, embryo rescue, use of bridge species, protoplast fusion, marker-assisted selection, mutation breeding, etc. (i.e., methods other than genetic engineering / transformation / transgenic methods), and for example, resistance according to the present invention can be obtained, identified, selected and / or transformed.

[0047] A "molecular marker," "genetic marker," or simply "marker" refers to a nucleotide sequence containing, surrounding, or associated with a variation (polymorphism) at a specific genomic locus, which can be used to identify plants possessing a particular allele. Molecular markers can be developed based on polymorphisms including, but not limited to, single nucleotide polymorphisms (SNPs), insertions / deletions (InDel), simple repeat sequences (SSRs), presence / absence polymorphisms (PAVs), and copy number polymorphisms (CNVs). Methods and techniques for the development, identification, and genotyping of molecular markers are well known in the art.

[0048] A "single-nucleotide variant" or "SNV" refers to a type of variant in which one nucleotide base is substituted with another nucleotide base. While SNV is contextually similar to the more commonly used term "single-nucleotide polymorphism (SNP)," it is a preferred term when there is no indication of population frequency. In this application, SNV and SNP are used synonymously.

[0049] In this specification, “genetic determinants” refers to genetic information within the plant genome that causes or is associated with a trait of interest. Genetic determinants include, but are not limited to, genes, alleles, genetic markers, quantitative trait loci (QTLs), etc.

[0050] In this specification, “screening” refers to the process of evaluating or identifying plant material for a trait of interest. The trait of interest may be a phenotypic trait (e.g., disease resistance) or a genotypic trait (e.g., the presence of a specific allele).

[0051] The present invention relates to a spinach plant having resistance to at least one or more Peronospora effusa races 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201. The resistance is broad-spectrum and may further include resistance to other Pe races.

[0052] More specifically, the plants are those grown from seeds deposited with NCIMB under deposit numbers 44186, 44187, 44188, 44189, 44190, 44191, 44192, 44193, 44194, or 44195, or obtained (or obtained, derived from, or derived from) plants derived from such seeds.

[0053] The resistance trait may be inherited by a single gene, preferably a dominant gene. In another embodiment, the resistance may be conferred by two or more genes or loci. In fact, a resistance locus or locus (and the Pe resistance phenotype conferred thereby) can be introduced by conventional breeding techniques into any spinach line or variety from seeds deposited with any of the NCIMB registry numbers listed above, or from the progeny of such seeds, and can confer resistance to other spinach plants to isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201 (and, if necessary, novel pathogenic isolates), also known as Pe races 1-19, 4+. Therefore, for example, the spinach plants of the present invention can be used as male or female parents in hybridization with other spinach plants, and progeny such as F1, F2, F3, or even self-pollinated and / or back-cross progeny (e.g., BC1, BC2, BC1S1, BC2S1, BC1S2, etc.) can be identified and selected so that the progeny have the same Pe resistance phenotype as the initial plants of the present invention. Progeny selection for the presence of resistance can be carried out using the disease resistance assay described herein, which tests for resistance to one or more (or all) Pe races in the progeny.

[0054] Whether a spinach plant genotype (i.e., spinach line or variety) is resistant to one or more Pe races or isolates can be tested using qualitative disease resistance assays under controlled environmental conditions. Various protocols exist for such assays and are available to those skilled in the art. Briefly, seedlings of multiple plants of the plant genotype under test (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) are inoculated with Pe race inoculum, and the seedlings are cultured under conditions favorable to the pathogen. After several days of culture, the plants are evaluated for infection symptoms, particularly spore formation on the cotyledons and / or leaves (e.g., the first true leaf), and each plant is classified as "resistant" (no signs of spore formation) or "susceptible" (spore formation is observed). If, for example, more than 95%, 98%, 99% (or 100%) of all plants of a particular genotype are classified as "tolerant," then that spinach plant genotype will be tolerant to the race being tested. Naturally, to ensure that the assay functions as expected, one or more control plants (e.g., susceptible lines or varieties, tolerant lines or varieties) should also be included in the assay under the same treatment and environmental conditions.

[0055] Alternatively, or in addition to phenotypic assays, the selection or identification of spinach plants (e.g., progeny) possessing the resistance gene or locus of the present invention can be achieved by detecting one or more molecular markers linked to the resistance gene or locus. This aspect is described elsewhere.

[0056] In one embodiment of the present invention, the spinach plant is an inbred line, and in particular an inbred line that can be used as a parent for producing F1 hybrid offspring. In another embodiment, the spinach plant is a hybrid, in particular an F1 hybrid. The F1 hybrid can be produced by crossing a first inbred parent line having a resistance gene or locus (preferably homozygous) with a second inbred parent line. The first inbred parent line may be a line developed from seeds deposited under any of the NCIMB registry numbers shown above, or from the progeny of plants grown from these seeds, the progeny of which may retain the Pe resistance phenotype (and resistance gene or locus).

[0057] The second inbred parent line may be any spinach line, that is, it may not have any Pe resistance at all, it may have different Pe resistance genes (and different resistance phenotypes), or it may also have the resistance gene or locus according to the present invention.

[0058] As mentioned above, the spinach plant according to the present invention may be any type of spinach. For example, the spinach plant may be a crinkled-leaf type, a semi-crinkled-leaf type, or a flat-leaf / smooth-leaf type spinach.

[0059] In other words, resistance can be introduced into other spinach plants by introduction from plants grown from seeds deposited under any of the NCIMB registry numbers listed above, or from any spinach plant derived therefrom that possesses the gene or locus. Therefore, deposited seeds are a source of resistance in the present invention, as are spinach plants that are not obtained directly from the deposit but are obtained indirectly, for example, from later commercially available varieties, and that contain the resistance gene or locus of the present invention.

[0060] The resistance of the present invention was identified in wild material derived from a genetic resource bank and introduced into S. oleracea by backcrossing. Thus, in one embodiment, a spinach plant is provided that is resistant to one or more isolates of Pe1-19, also known as 4+, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, as well as to novel pathogenic isolates, wherein the resistance to Peronospora effusa is conferred by introduced fragments derived from wild spinach or wild relatives of spinach. In a preferred embodiment, spinach plants are provided that are resistant to at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+.

[0061] In one embodiment, the introduced fragment is a fragment found in spinach seeds (and obtained from, acquired from, derived from, or derived from thereto), and a representative seed sample is deposited with NCIMB under one of the NCIMB registry numbers listed above. The fragment can be identified by various methods, including chromosome painting, sequencing of the spinach genome, and identification of chromosomal portions derived from wild spinach or its wild relatives. The fragment can also be identified by one or more molecular markers (e.g., SNP markers, AFLP markers, RFLP markers, etc.), particularly molecular markers that show polymorphism between cultivated spinach and wild introduced fragments.

[0062] In another embodiment, the introducent fragment is a fragment derived from a fragment found in spinach seeds (a representative seed sample is deposited with NCIMB under one of the above NCIMB registry numbers), and the introducent fragment is shorter but retains a resistance gene or locus (and the Pe resistance phenotype conferred by the gene). Spinach plants having such short introducent fragments can be produced by crossing the plant of the present invention with another spinach plant and selecting recombinant progeny having shorter introducent fragments while retaining the resistance phenotype conferred by the resistance gene or locus.

[0063] In one embodiment, a method is provided for producing spinach plants resistant to at least Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, also known as 4+, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201. The method is as follows: (a) A step of providing a first spinach plant that is resistant to one or more Pe races, (b) The step of crossing the first spinach plant with a second spinach plant to produce F1 seeds, (c) If necessary, the plants grown from F1 seeds are self-pollinated once or more to produce F2, F3 or further self-pollinated progeny, (d) A step of identifying (or selecting) spinach plants that have resistance to one or more Pe races from F1, F2, F3 seeds or further self-pollinated progeny, (e) If necessary, the step of crossing the identified (or selected) F1 progeny or self-pollinated progeny with any spinach plant to produce backcross progeny, (f) The step of selecting backcross progeny that are resistant to one or more Pe races (for example, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+).

[0064] In the embodiments described above, the term “any spinach plant” includes the first spinach plant in step (a), the second spinach plant in step (b), or any other spinach plant.

[0065] In another embodiment, a method is provided for producing spinach plants resistant to at least Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, also known as 4+, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201. The method is as follows: (a) A step of providing a spinach plant having an introduction fragment, wherein the introduction fragment is available under one of the following registration numbers: NCIMB44186, NCIMB44187, NCIMB44188, NCIMB44189, NCIMB44190, NCIMB44191, NCIMB44192, NCIMB44193, NCIMB44194 or NCIMB44195, and the introduction fragment is conferred with resistance to at least Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, also known as 4+, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, (b) A step of crossing a spinach plant with a second spinach plant, for example, a spinach plant that is sensitive to one or more isolates, such as Pe races 1-19, 4+, including isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, to produce F1 seeds, (c) If necessary, the plants grown from F1 seeds are self-pollinated once or more to produce F2, F3 or further self-pollinated progeny, (d) A step of identifying spinach plants grown from F1, F2, F3 seeds or further self-pollinated progeny that have resistance to at least Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, also known as 4+, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, and / or have introduced fragments or resistance-constituting parts, (e) If necessary, the step of crossing the identified F1 progeny or self-pollinated progeny with any spinach plant to produce backcross progeny, (f) If necessary, the step of selecting a backcross progeny that is resistant to or has an introduced fragment or resistance-constituting portion to one or more of the isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+, Includes.

[0066] With regard to both methods, the following matters are included in this specification.

[0067] In one embodiment, the plant in a) contains a tolerance trait found in seeds deposited under NCIMB registration numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195. The spinach plant may be a plant grown from deposited seeds, or any spinach plant produced using or utilizing seed deposit and possessing the Pe tolerance phenotype (and the gene or locus that confers it). This also includes commercial spinach varieties produced using seed deposit. Therefore, the spinach plant in a) contains the resistance gene / locus according to the present invention, for example, a resistance gene / locus found in (or obtainable from, acquired from, derived from, or derived from) NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195. The plant in a) may therefore be a plant grown from a representative sample of seeds deposited under any of the above NCIMB registry numbers.

[0068] The selection (or identification) in steps d) and / or f) may be based on phenotype (i.e., using a Pe resistance assay), or on molecular methods such as detection of molecular markers linked to resistance genes or loci, or on other methods such as sequencing.

[0069] According to one aspect of the present invention, the plant according to the present invention contains an allele identifiable by one or more SEQ ID NO: 1 to 15. According to yet another aspect, the plant according to the present invention contains an allele identifiable by at least six, at least seven, at least eight, at least nine, or at least ten sequences from SEQ ID NO: 1 to 15. Preferably, the plant according to the present invention contains an allele or sequence comprising one or more SEQ ID NO: 1 to 15. According to another embodiment, different S. tetrandra introduction fragments can be identified by generating specific haplotypes (shown in Table III) through screening of KASP (Competitive Allele-Specific PCR) markers designed based on SEQ ID NO: 1 to 15.

[0070] Preferably, the plant according to the present invention can be identified by using a primer directed to one or more of SEQ ID NO:1 to 15, and the presence of at least one, preferably at least six, of the above sequences is a prerequisite for the plant according to the present invention. In another embodiment, the selection of the plant or its progeny according to the present invention is based on the presence of at least one, preferably at least six, of the sequences selected from SEQ ID NO:1 to 15 in the plant or its progeny. In step (b), the first spinach plant is crossed in one embodiment with a spinach plant that is sensitive to at least one Pe race to which the plant in (a) is resistant. If the second parent in (b) is a spinach plant that is sensitive to at least one Pe race to which the plant in (a) is resistant, the selection in steps (d) and / or (f) can be based on selecting a plant resistant to the race. Steps (e) and (f) can be repeated one or more times, preferably based on sequences shown in one or more of SEQ ID NO:1 to 15.

[0071] In the above method, plants having smaller introduced fragments that retain the Pe tolerance phenotype according to the present invention can be selected and / or identified. This can be advantageous because it allows for the removal of negative traits associated with wild-derived introduced fragments. Wild-derived initial introduced fragments can be quite large, for example, 20 Mb or 30 Mb. Therefore, it is preferable to reduce the size of the introduced fragment by recombination and select plants containing smaller introduced fragments that retain the tolerance-constituting portion. Accordingly, spinach having introduced fragments of any size derived from (or obtained from, derived from, obtainable, or obtainable from) seeds deposited under any of the above NCIMB registry numbers is also included herein, provided that the Pe tolerance-constituting portion is retained within the spinach plant. As previously stated, its presence can be tested and selected phenotypically or using molecular methods known to those skilled in the art. Preferably, selection is based on the sequences shown in one or more of SEQ ID NO: 1 to 15.

[0072] In another embodiment, the plant according to the present invention is obtained by introducing one or more resistance alleles, preferably identifiable by one or more SEQ ID NO:1-15, using genome editing technology such as CRISPR-Cas or mutagenesis technology.

[0073] Furthermore, plants obtainable or obtained by any of the above methods are also embodiments of the present invention. The plants according to the present invention may be any cultivated spinach, such as Savoy spinach, semi-Savoy spinach, flat-leaved spinach, or smooth-leaved spinach. These may be self-pollinated lines, F1 hybrids, diploid haploids, transgenic plants, mutant plants, etc.

[0074] The plants of the present invention can be used to produce progeny having or retaining a Pe tolerance phenotype, which will have a Pe tolerance phenotype obtainable from (or present therein, derived from, obtained or derived from) seeds deposited under any of the above NCIMB registry numbers. To produce progeny, spinach plants according to the present invention can be self-pollinated and / or crossed with other spinach plants one or more times, and seeds can be collected. Whether the tolerance according to the present invention or the gene / locus conferring it is present in the progeny can be determined by molecular methods such as the Pe tolerance phenotype and / or molecular markers (e.g., SNP markers closely linked to the gene or locus).

[0075] Furthermore, seeds capable of cultivating the plants of the present invention are also provided. In one embodiment, a spinach plant having representative seeds deposited under any of the above NCIMB registry numbers, or its offspring (e.g., obtained by self-pollination), is provided for producing spinach plants that are Pe-resistant to at least one of Pe races 1-19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201. Preferably, the spinach plants have resistance to at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0076] In another embodiment, a method is provided for producing spinach plants resistant to at least one of Pe races 1-19, preferably Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, using spinach plants resistant to at least one of Pe races 1-19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, by introducing fragments obtainable from seeds deposited under any of the above NCIMB registry numbers or their descendants (e.g., obtained by self-pollination).

[0077] Furthermore, allergy testing can be used to determine whether the resistance gene in a spinach plant is identical or different from the resistance gene / locus present in any of the NCIMB registry numbers (or their progeny) mentioned above. For example, NCIMB 44186 (or its progeny) can be crossed with another spinach plant having the same resistance phenotype, and the proportion of phenotypic segregation in the resulting cross progeny can be determined. Accordingly, in one embodiment, a spinach plant is provided that is resistant to one or more of the following: Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, and that the resistance gene / locus conferring the resistance phenotype is determined by allel testing to be a gene / locus present in NCIMB 44186 (or its progeny). Allel testing of dominant genes is known to those skilled in the art (see, for example, Hibberd et al., 1987, Phytopathology 77:1304-1307).

[0078] Furthermore, seeds capable of growing any of the plants of the present invention are also provided, as well as containers or packages containing or housing the seeds. The seeds can be distinguished from other seeds by the presence of resistance genes / locuses, which can be determined by phenotypic and / or molecular methods based on plants having the resistance phenotype according to the present invention.

[0079] In one embodiment, the seeds are packaged in small and / or large containers (e.g., bags, cartons, cans, etc.). The seeds may be pelletized (formed into tablets or pellets) and / or treated with various compounds, such as seed coating agents, before packaging.

[0080] Pelletization creates a round or rounded shape that can be easily sown with modern seeders. The pellet mixture typically contains seeds and at least an adhesive and a filler. The latter may be, for example, clay, mica, chalk, or cellulose. In addition, certain additives may be included to improve specific properties of the pellets. For example, a seed treatment formulation containing at least one insecticide, acaricide, nematicide, or fungicide can be added directly to the pellet mixture or to a separate layer. The seed treatment formulation may contain only one of these compounds, a mixture of two or more of the same compounds, or a mixture of one or more of the same compounds with at least one other insecticide, acaricide, nematicide, or fungicide.

[0081] Formulations particularly suitable for seed treatment can be added to seeds in the form of a film coating, and the coating can be used in or on the pellets, or the seed treatment formulation can be added directly to the pellet mixture. The film coating is characteristically a uniform, dust-free, water-permeable film that evenly covers the surface of all individual seeds.

[0082] In addition to the formulation, coating mixtures generally also include other components, such as water, adhesives (usually polymers), fillers, pigments, and specific additives to enhance certain properties of the coating. Multiple coatings can also be combined on a single seed.

[0083] Furthermore, various combinations with film coating are possible. Film coating can be applied to the outside of the pellet, between two layers of pellet material, or directly to the seeds before adding the pellet material. Multiple film coating layers can also be incorporated into a single pellet. A special form of pelletization is encrusting. This technique reduces the amount of filler used, resulting in "mini-pellets."

[0084] Seeds may be primed. Spinach is often primed. Priming is a water-based treatment applied to seeds to improve the uniformity of germination and emergence from the soil surface and to promote the uprooting of the vegetable. Priming reduces the time difference between the appearance of the first and last seedlings. Methods for priming spinach seeds are widely known to those skilled in the art.

[0085] In yet another embodiment, plant parts obtained (or obtainable) from the plant of the present invention and containers or packages containing such plant parts are provided. In a preferred embodiment, the plant parts are leaves of the spinach plant of the present invention, preferably harvested leaves or a portion thereof. The leaves may be loose, in bunches, fresh (e.g., bagged), frozen, blanched, or boiled. The leaves may be fresh or processed and may be part of a food or feed product such as a salad. Other plant parts of the plant of the present invention include stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, pedicels, ovules, buds, seeds, embryos, embryo sacs, cells, meristematic tissue, and the like.

[0086] The seeds include, for example, seeds produced on the plant of the present invention after self-pollination, or seeds produced after cross-pollination, that is, seeds produced when other spinach plants are pollinated with pollen from the plant of the present invention, or when the plant of the present invention is pollinated with pollen from other spinach plants.

[0087] In yet another embodiment, the plant body part is a plant cell. In yet another embodiment, the plant body part is a non-regenerative cell or a regenerative cell.

[0088] In another embodiment, the plant cells are somatic cells. Non-regenerative cells are cells that cannot be regenerated in the entire plant by in vitro culture, but non-regenerative cells may be present in the plant or plant part (e.g., a leaf) of the present invention.

[0089] Furthermore, the present invention also provides in vitro cell culture or tissue culture of spinach plants, the cell culture or tissue culture derived from the plant body parts described above, such as leaves, pollen, embryo, cotyledon, hypocotyl, callus, meristematic cells, root, root tip, anther, flower, seed or stem, somatic cells, germ cells, etc.

[0090] Also provided are spinach plants regenerated from the above-mentioned plant body portion or from the above-mentioned cell or tissue culture, wherein the regenerated plants possess a Pe-resistant phenotype, i.e., the resistance gene / locus (or introduced fragment containing the resistance gene / locus) of the present invention. These plants may also be called vegetative propagates of the plant of the present invention.

[0091] Furthermore, the present invention also provides harvested leaves of the plant and a package containing multiple leaves of the plant. These leaves are therefore resistant to the present invention and can be detected, for example, by linked molecular markers or phenotype (for the original whole plant and / or regenerated plant).

[0092] The present invention also provides a food product containing or comprising the plant or a part of the plant of the present invention, which is suitable for human consumption. Preferably, the plant part is a leaf or a plurality of leaves.

[0093] Furthermore, the present invention also provides a feed composition or product containing or comprising the plant or a part of the plant of the present invention.

[0094] Food or feed products may be fresh, unprocessed, or processed, such as crushed or chopped, heat-treated (e.g., steamed, boiled, fried, blanched), packaged (e.g., canned, packaged), and / or frozen. Examples of food products according to the present invention include salads or salad mixes, or frozen vegetable mixes containing leaves or parts of leaves of the plants of the present invention.

[0095] The spinach plants of the present invention, or their offspring that possess the Pe-resistant phenotype conferred by the above-mentioned gene / locus and / or introduced fragment containing the gene / locus, and which exist in any of the NCIMB registry numbers shown above, and parts of the plant, can be appropriately packaged for transport, for example, or sold fresh. These parts include, but are not limited to, any cells, tissues, and organs obtained from seedlings or plants, such as leaves, cuttings, pollen, leaf fragments, etc.

[0096] The leaves may be harvested in an immature state, i.e., as baby leaves or baby spinach, or in a mature state. The plant, multiple plants, or parts thereof may be packaged in containers (e.g., bags, cartons, cans, etc.) alone or together with other plants or materials. The parts may be preserved and / or further processed. Thus, food or feed products containing the plant of the present invention, or these parts obtained from its offspring and plant parts, one or more of these leaves or parts thereof, are also provided herein. For example, containers such as cans, boxes, crates, bags, cartons, improved air packaging, and films (e.g., biodegradable films) containing plant body parts of the plant of the present invention (fresh and / or processed) are also provided herein.

[0097] Other embodiments of the present invention include spinach plants and parts thereof, as well as progeny of the spinach plants of the present invention. For example, plants grown from seeds, produced by sexual or vegetative propagation, regenerated from the above plant parts, or regenerated from cell or tissue culture, wherein the regenerated (seed-propagated or vegetatively propagated) plants have resistance to at least one of Pe races 1-19, preferably at least one of Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0098] As described above, whether or not a plant, progeny, or vegetative propagates possess the Pe resistance phenotype conferred by the present invention can be determined using phenotypic methods such as the Pe disease resistance assay described above, or by molecular techniques such as molecular marker analysis, DNA sequencing (e.g., whole-genome sequencing for the identification of wild species introduction), or chromosome painting.

[0099] In one embodiment, a resistance gene / locus obtained from (or found therein) a plant deposited under any of the above NCIMB registry numbers, or from its progeny, can be combined with resistance to other Peronospora effusa resistance genes or loci, or other traits, such as bacteria (e.g., Pseudomonas syringae pv. spinacea; Erwinia carotovora), fungi (e.g., Albugo occidentalis; Colletotrichum dematium f sp. spinaciae; Stemphylium beticola (formerly known as Stemphylium botryosum f sp. spinaciae), Stemphylium vesicarium, Stemphylium drummondi), viruses (e.g., viruses that cause curly top disease), or nematodes. This can be done to introduce one or more traits into the plant of the present invention by conventional breeding techniques, such as backcrossing, or to introduce the genes / locuses of the plant of the present invention into spinach plants having other additional traits. Therefore, in one embodiment, the plant of the present invention is used as a resistance donor according to the present invention, and in other embodiments, the plant of the present invention is used as a recipient of one or more other traits.

[0100] Furthermore, the present invention also provides progeny obtained by, for example, one or more self-pollinations and / or crosses with other spinach plants of a different variety or breeding line than the plant of the present invention, or with the spinach plant of the present invention one or more times, which include or retain the Pe resistance phenotype. In particular, the present invention provides progeny that retain the resistance gene / locus (conferring the Pe resistance phenotype) found in any of the above NCIMB registry numbers. In one embodiment, progeny plants produced by one or more methods selected from the group consisting of a resistant progeny plant according to the present invention, for example a resistant spinach plant according to the present invention: self-pollination, crosses, mutations, diploid haploid production or transformations.

[0101] The mutation may be a spontaneous mutation, an artificially induced mutation, or a somaclonal mutation. In one embodiment, the plant or seed of the present invention can be mutated (e.g., by irradiation, chemical mutagens, heat treatment, tilling, etc.), or mutated seeds or plants (e.g., natural variants, somaclonal variants, etc.) can be selected to modify one or more characteristics of the plant. According to one embodiment of the present invention, an introduction fragment or a part thereof that confers resistance to one or more of the above Pe races 1 to 19 is introduced into plant cells by genome editing technology, such as CRISPR gene editing.

[0102] In some embodiments, the resistance allele can be modified or mutated using mutagenesis, gene editing techniques, or other methods known to those skilled in the art to obtain the plants of this disclosure. In some embodiments, the gene editing technique is selected from activator-like effector nuclease (TALEN) gene editing techniques, CRISPR / Cas9 gene editing techniques, or zinc finger nuclease (ZFN) gene editing techniques. In some embodiments, the mutation is introduced using one or more vectors containing gene editing components, including a CRISPR / Cas9 system, TALEN, zinc finger, or meganuclease, designed to target the nucleic acid sequence encoding the resistance gene.

[0103] Similarly, the plants of the present invention can be transformed and regenerated, thereby introducing one or more chimeric genes into the plants. Transformation can be carried out using standard methods such as Agrobacterium tumefaciens-mediated transformation or bioristics, and transformed cells can be selected and regenerated into plants.

[0104] A desired trait (for example, a gene that confers resistance to pests or diseases, herbicides, fungicides, or insecticides) can be introduced into the plant of the present invention or its offspring by transforming it with a transgene that confers the desired trait. In this case, the transformed plant retains the resistance and the Pe resistance phenotype conferred therefrom, and also contains the desired trait.

[0105] Resistance genes or loci can be transmitted to progeny through further breeding. In one embodiment, the progeny are F1 progeny obtained by crossing the plant of the present invention with another plant, or S1 progeny obtained by self-pollination of the plant of the present invention. It also includes F2 progeny obtained by self-pollination of F1 plants, or even later generations. "Further breeding" includes conventional breeding techniques (e.g., self-pollination, crossing, backcrossing), marker-assisted breeding, and / or mutation breeding. In one embodiment, the progeny have a Pe resistance phenotype of a plant that can be derived from seeds deposited under any of the above NCIMB registry numbers.

[0106] The present invention further relates to a method for producing spinach seeds, comprising self-hybridization or hybridization with different spinach plants and harvesting the resulting seeds. In one embodiment, the present invention relates to seeds produced by this method and / or spinach plants obtained by growing the seeds. Thus, the plants of the present invention are used as male and / or female parents in the production of spinach seeds, and plants grown from such seeds have resistance to at least one or more of Pe races 1 to 19, preferably Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US (also called 4+), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201.

[0107] Accordingly, in one embodiment, a progeny of the spinach plant of the present invention is provided, which is produced by self-pollination, hybridization, mutation or transformation and retains the resistance gene / locus (and the phenotype conferred thereby) described herein, i.e., obtained by hybridizing a spinach plant grown from seeds deposited under any of the above NCIMB registry numbers with another spinach plant. In other words, a resistance gene or locus (or introduced fragment containing a gene or locus) present in or derivable from seeds deposited under any of the above NCIMB registry numbers is retained in the progeny.

[0108] Molecular markers can also be used to aid in the identification of plants (or plant parts or nucleic acids derived therefrom) containing resistance genes, loci, or alleles. For example, one or more suitable molecular markers closely linked genetically (preferably physically) to resistance genes, loci, or alleles can be developed. This can be done by crossing resistant spinach plants with susceptible spinach plants and generating segregates (e.g., F2 or backcross populations) from the cross. The segregates can be phenotypic evaluated for Pe resistance, genotyped using molecular markers such as SNPs (single nucleotide polymorphisms), AFLPs (amplification fragment length polymorphisms; see e.g., EP534858), and identified by software analysis of molecular markers co-segregating with the Pe resistance trait within the segregates, their order, and their genetic distance (centimorgan distance, cM) to the resistance gene or locus. Molecular markers closely linked to or from resistance loci, such as markers within 5 cM, can be used to detect and / or select plants (e.g., the plants of the present invention or their progeny) or plant parts that contain or retain transposition fragments containing resistance genes or loci. Such closely linked molecular markers can be used in breeding programs as an alternative (or addition) to phenotypic selection, i.e., in marker-assisted selection (MAS). Preferably, MAS uses flanking markers, i.e., one marker on each side of the resistance gene or locus.

[0109] Other types of molecular markers and / or assays that can identify the relative presence or absence of traits of interest in plants or plant parts are also useful for breeding purposes.

[0110] The progeny plant according to the present invention contains an allele identifiable by one or more SEQ ID NO: 1 to 15. Furthermore, the plant according to the present invention contains an allele identifiable by at least six, at least seven, at least eight, at least nine, or at least ten sequences from SEQ ID NO: 1 to 15. Furthermore, the plant according to the present invention contains an allele or sequence comprising one or more SEQ ID NO: 1 to 15. Preferably, the plant according to the present invention contains at least six sequences selected from SEQ ID NO: 1 to 15. In yet another embodiment, different S. tetrandra introduction fragments can be identified by creating specific haplotypes through screening of KASP (Competitive Allele-Specific PCR) markers designed based on SEQ ID NO: 1 to 15 (see Table III).

[0111] Preferably, the progeny plant according to the present invention can be identified using a primer directed to one or more of SEQ ID NO:1 to 15, and the presence of at least one, preferably at least six, of the above sequences is a requirement for the plant according to the present invention. In some embodiments, the selection of the plant according to the present invention is based on the presence of at least one, preferably at least six, sequences selected from SEQ ID NO:1 to 15. (Deposit Information)

[0112] A total of 6,250 seeds of spinach strain X21-018-XX (where XX is selected from 50-4, 58-1, 5-2, 56-5, 19-12, 23-1, 31-1, 15-11, 10-2, 16-6) were deposited by KWS Vegetables BV on July 25, 2023, with NCIMB Ltd. (NCIMB), located at Ferguson Building, Cravestone Estate, Backsburn, Aberdeen AB21 9YA, UK, under the registration number described in Example 1. In accordance with 37 CFR §1.808(b), all restrictions imposed by the depositor with respect to the public availability of the deposit become irrevocable upon grant of the patent. The deposit will be maintained for 30 years, or 5 years from the most recent claim, or the term of the patent, whichever is longer, and will be replaced if it becomes non-viable during that period. Neither this application nor any rights granted by this application under the Plant Variety Protection Act (7 USC 2321 et seq.) shall be waived. The biological material shall be provided only by the delivery of samples to experts in accordance with PCT Rule 13bis.6 and EPC Rule 32(1). (Enumerated embodiments)

[0113] The embodiments listed below represent some aspects of the present invention.

[0114] 1. Spinach plants resistant to at least one Pe strain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe strain 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, as well as isolates of 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

[0115] 2. The spinach plant according to Embodiment 1, obtained by introducing a sample from any of the following plants, or derived from a plant, for which a representative sample is deposited with NCIMB: access numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, or NCIMB 44195.

[0116] 3. The spinach plant according to Embodiment 1 or 2, wherein the spinach plant contains an allele identifiable by one or more SEQ ID NO: 1 to 15.

[0117] 4. The spinach plant according to Embodiment 3, wherein the allele or sequence is linked to resistance.

[0118] 5. The spinach plant according to any one of Embodiments 1 to 4, wherein the spinach plant is a hybrid plant.

[0119] 6. The spinach plant according to any one of Embodiments 1 to 5, wherein the spinach plant is an inbred plant.

[0120] 7. The spinach plant according to any one of embodiments 1 to 6, wherein the plant is selected from the group consisting of Savoy, semi-Savoy, flat-leaved, or smooth-leaved species.

[0121] 8. A progeny plant of a spinach plant according to any one of Embodiments 1 to 7, wherein the progeny plant retains resistance to at least one Pe strain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe strain 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, as well as isolates of 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

[0122] 9. The progeny plant according to Embodiment 8, wherein the progeny plant is produced by one or more methods selected from the group consisting of self-pollination, hybridization, mutation, genome editing, or transformation.

[0123] 10. The progeny plant according to Embodiment 8 or 9, wherein the progeny plant contains an allele identifiable by one or more SEQ ID NO: 1 to 15.

[0124] 11. Seeds capable of growing spinach plants according to any of Embodiments 1 to 7.

[0125] 12. Access numbers for NCIMB: NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, NCIMB Use of one or more seeds or their progeny deposited in any of 44195 to produce spinach plants resistant to at least one or more Pe strains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe strains 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, as well as 4US, 21A (UA2016-21A or 2016-21A), PV2144, PE22-53, PV2240, and PV2201, also known as 4+.

[0126] 13. A part of a spinach plant described in any of Embodiments 1 to 7, or a part of a progeny plant described in any of Embodiments 8 to 10, wherein a part is selected from the group consisting of a stem, cutting, petiole, cotyledon, flower, anther, pollen, ovary, root, root tip, protoplast, callus, microspore, pedicel, ovule, shoot, seed, embryo, embryo sac, cell, meristematic tissue, bud, and leaf.

[0127] 14. A cell culture or tissue culture comprising cells or tissue derived from the site described in Embodiment 13.

[0128] 15. Spinach plants regenerated from the cell or tissue culture of Embodiment 14, wherein the spinach plants are resistant to at least one or more Pe strains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe strains 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, as well as isolates of 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

[0129] 16. The spinach plant according to Embodiment 15, wherein the spinach plant contains at least one allele or sequence selected from the group consisting of SEQ ID NO: 1 to 15.

[0130] 17. A food product comprising plant parts suitable for human consumption, preferably the plant described in any of Embodiments 1 to 7 or the leaves of a later-grown plant described in any of Embodiments 8 to 10.

[0131] 18. A container comprising one or more spinach plants according to any one of embodiments 1 to 10 or 15 to 16 in a growing medium for harvesting plant parts, preferably the leaves of the plant.

[0132] 19. A method for producing spinach plants resistant to at least one Peronospora effusa (Pe) strain or isolate, preferably multiple Peronospora effusa (Pe) strains or isolates, (a) Providing a spinach plant comprising an introduction piece obtained from any of access numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, or NCIMB 44195, wherein the introduction piece confers resistance to one or more Pe strains; (b) The step of crossing the spinach plant with another spinach plant that is susceptible to one or more Pe strains to produce F1 seeds, (c) If necessary, the plants grown from F1 seeds are self-pollinated one or more times to produce self-pollinated progeny of F2, F3 or later generations, (d) A step of identifying (or selecting) spinach plants grown from F1, F2, F3 seeds or subsequent generations of self-pollinated progeny obtained in step (c) that have resistance to one or more Pe strains and / or contain introduced fragments or resistance-constituting parts, (e) If necessary, the F1 progeny or self-pollinated progeny identified (or selected) in step (d) are crossed with any spinach plant to produce backcross progeny, (f) If necessary, the step of selecting a backcross progeny that has resistance to one or more Pe strains and / or includes an introduced piece or resistance-constituting portion, A method that includes this.

[0133] 20. The method according to Embodiment 19, wherein the multiple Pe strains include isolates of Pe strains 1 to 19, preferably at least Pe strains 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, as well as isolates of 4US(), 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+.

[0134] 21. The method according to any one of embodiments 19 to 20, wherein the identification step in step (d) is performed by marker selection.

[0135] 22. The method according to any one of embodiments 19 to 21, wherein the identification of the spinach plant and / or the selection of the backcross progeny is performed by identifying the presence of one or more alleles with SEQ ID NO: 1 to 15 in the plant or progeny.

[0136] 23. Spinach plants having resistance to at least one Peronospora effusa (Pe) strain 1-19, wherein such resistance is conferred by a resistance gene present in seeds deposited under access numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, and NCIMB 44195.

[0137] 24. The plant according to Embodiment 23, wherein the spinach plant is resistant to one or more Pe isolates, also known as 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201.

[0138] 25. The spinach plant according to any one of embodiments 23 to 24, wherein the spinach plant contains at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 15, or at least one nucleotide sequence having at least 95% identity, preferably at least 98%, and more preferably at least 99% identity with one or more of the group consisting of SEQ ID NO: 1 to 15.

[0139] 26. Seeds capable of growing the plant described in Embodiment 23.

[0140] 27. The leaves of the plant described in Embodiment 23.

[0141] 28. The progeny plant of the plant according to Embodiment 23, wherein the progeny plant possesses a resistance gene that confers resistance to at least one Pe strain 1-19.

[0142] 29. The progeny plant according to Embodiment 28, wherein the progeny plant is resistant to at least one Pe isolate, namely 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

[0143] 30. The progeny plant according to any one of embodiments 28 to 29, wherein the progeny plant is produced by one or more methods of self-pollination, hybridization, mutation, genome editing technology, or transformation.

[0144] 31. The progeny plant according to any one of embodiments 28 to 30, wherein the progeny plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 15, or at least one nucleotide sequence having at least 95% identity, preferably at least 98%, and more preferably at least 99% identity with one or more of the group consisting of SEQ ID NO: 1 to 15.

[0145] 32. A method for producing spinach plants with broad resistance to Pe strains, comprising cultivating plants from a group consisting of seeds selected from any of the seeds or progeny of any of the seeds with access numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, and NCIMB 44195, wherein the progeny possess resistance genes that confer broad resistance to Pe strains.

[0146] 33. The method according to Embodiment 32, wherein the resistance gene confers resistance to isolates of Pe strains 1-19, at least Pe strains 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, as well as 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+.

[0147] 34. The method according to Embodiments 32 and 33, wherein the introduction of one or more resistance alleles of the resistance gene is achieved by genome editing technology such as CRISPR-Cas or mutagenesis technology.

[0148] 35. A method for producing spinach plants with broad resistance to Pe strains, comprising the introduction of one or more resistance alleles identifiable by one or more SEQ ID NO:1-15, wherein the introduction of said alleles is achieved by genome editing technology such as CRISPR-Cas or mutagenesis technology.

[0149] 36. A part of a spinach plant according to any of embodiments 23 to 25, wherein part of the part is selected from the group consisting of a stem, cutting, petiole, cotyledon, flower, anther, pollen, ovary, root, root tip, protoplast, callus, microspore, pedicel, ovule, shoot, seed, embryo, embryo sac, cell, meristematic tissue, bud, or leaf.

[0150] 37. A cell culture or tissue culture containing cells or tissue derived from the site of Embodiment 34.

[0151] 38. A spinach plant regenerated from a cell culture or tissue culture of Embodiment 35, having resistance to at least one Pe strain 1-19, wherein the resistance is conferred by a resistance gene present in seeds deposited under access number NCIMB as defined in Embodiment 23.

[0152] 39. The spinach plant according to any one of embodiments 23, 28, and 38, wherein the spinach plant contains at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 15, which has at least 95% identity with one or more of the group consisting of SEQ ID NO: 1 to 15, preferably at least 98%, and more preferably at least 99% identity.

[0153] 40. A food product comprising harvested leaves of a spinach plant as described in Embodiment 23.

[0154] 41. A container containing the spinach plant described in Embodiment 23 in a growing medium for harvesting the leaves of the plant.

[0155] 42. The spinach plant according to Embodiment 1, wherein the spinach plant is obtained by introducing one or more resistance alleles identifiable by genome editing technology such as CRISPR-Cas or mutagenesis technology, preferably one or more SEQ ID NO:1 to 15. [Examples]

[0156] This disclosure will be better understood by referring to the following embodiments, however, they should not be construed as limiting the scope of this disclosure. The embodiments and aspects described herein are provided for illustrative purposes only, and it should be understood that various modifications or changes can be proposed in view of them by those skilled in the art, which are within the spirit of this application and the scope of the attached claims.

[0157] Example 1: Downy mildew-resistant spinach line X21-18-XX (corresponding to NCIMB registration numbers 44186-44195)

[0158] Origin of breeding:

[0159] The "X21-18 progeny" spinach line was first developed by crossing the "Viroflay" variety (S. oleracea) with 19 lines of Spinacia tetrandra (see hybridization scheme 1 below).

[0160] [ka]

[0161] Step 1: Crossbreed the variety 'Viroflay' (S. oleracea) with 19 strains of Spinacia tetrandra (see Table 1);

[0162] [Table I] [Table 1] Table I. Spinacia tetrandra strains used in Step 1 of the hybridization scheme. CGN numbers are collection numbers from the Netherlands Genetic Resources Centre. PI numbers were obtained from USDA plant introduction stations.

[0163] Step 2: Cross the F1 progeny from Step 1 with a S. oleracea variety having the internal reference "B11-509-7-41-2";

[0164] Step 3: Cross the F1 progeny from Step 2 with an elite S. oleracea variety having the internal reference "W03-324-4-6-3 / 5" to obtain (BC2)X21-018 progeny;

[0165] Step 4: Thousands of progeny seedlings of X21-018 were inoculated with a mixture of isolates 4US, also known as Peronospora effusa(Pe)Pe 16, Pe 19, and 4+.

[0166] Step 5: The plants that survived (i.e., were resistant) inoculation in Step 4 were self-propagated to obtain the (BC2S1)X21-018-X line;

[0167] Step 6: The 74 inbred lines obtained in Step 5 were re-tested with isolates 4US and 21A (UA2016-21A or 2016-21A), also known as Pe 16, Pe 19, and Pe4+. Genotyping of the inbred lines was performed using 80 different SNP markers.

[0168] Step 7: The 10 self-pollinated lines obtained in Step 6 were fully resistant to isolates 4US, Pe 16, Pe 19, and unnamed isolate 21A (UA2016-21A or 2016-21A), also known as Pe4+, and were self-pollinated to obtain the (BC2)X21-018-XX line. These 10 self-pollinated lines were also tested for resistance to Pe isolates Pe 7, Pe 8, Pe 10, Pe 12, Pe 13, Pe 17, Pe 18, and two isolates with internal reference Pe PV2144 and Pe PV2201. The screening results are shown in Table II. Lines X21-018-50-4 (allele 1), X21-018-58-1 (allele 2), X21-018-56-5 (allele 5), X21-018-19-12 (allele 6), X21-018-23-1 (allele 7), X21-018-15-11 (allele 10), and X21-018-16-6 (allele 12) are resistant to all tested Pe isolates.

[0169] [Table II] [Table 2] Table II. Summary of different Pe isolates tested for each BC2S1 line and their scores. R indicates resistance, S indicates susceptibility, and "?" indicates no clear result was obtained.

[0170] Seeds obtained from 10 self-pollinated lines were deposited with NCIMB, as shown in Table IV below.

[0171] [Table IV] [Table 3] Table IV: Deposit of seeds obtained from self-pollinating lines to NCIMB

[0172] Example 2: Haplotype analysis of novel resistant alleles

[0173] A subset of 80 SNP markers from Step 6 (SEQ ID NO: 1-15, see Example 1) was used for genotyping of BC2S1 self-pollinated lines. The genotyping results are shown in Table III. These results indicate that the resistance introduced into 10 lines is not from the background derived from S. turkestanica in the elite line B11-509-7-41-2 from Step 2, or from the elite line W03-324-4-6-3 / 5 from Step 3. Therefore, the screening pattern is derived from the introduction of a mixture of 19 S. tetrandra access ions mentioned in Step 1.

[0174] [Table III] [Table 4] Table III. KASP scores for SEQ ID NO: 1-15 of the BC2S1 family. Each allele corresponds to an allele in the SEQ ID NO: 1-15 sequence.

[0175] Each of the sequences shown below consists of two options, with the variant indicated in parentheses.

[0176] SEQ ID NO 1: CCCCGGCCGTTTTCTTAGGCTTCTCGTCGTTCACCTCGGCTTCTCCGGCCACCAGAGAATCATCGGACACGCACGGTTTTCCGATCAAAACACCACATAA[T / A]CCCTCATTACCCACAAATGATGATGGGTGCAAATTAGGGAAAATTGACCCAGATGATGGTATAGCACCACTCAAGAGATTATATGACACATTAAAAGTCT

[0177] SEQ ID NO 2: CATATGTTATATTTTTTATGCAACTGCTACACAAGCTAACCAATAGCTGC[T / C]GAATTCCACTCTTCAACTCTCCCTAACCCCAAACTTCTTGCACTTTGAGG

[0178] SEQ ID NO 3: CGGGTTCGAATCTTCAATTCGTATCGGTAAGAGTCGGGGGAGAGAGTTTGATGTTGGTGTTGTGCCACCTGGCCTCTAGATTGACCGCGAGAGACAATTT[C / T]CCGTAGAATATGTGATTTGAATGGAAAAACAAAGAAAGTAACAAATAAAAAGGGAGAAAGCACACTATAACCATTAGAGAGAGAAGTATTAGTTGGTGATCA

[0179] SEQ ID NO.

[0180] SEQ ID NO 5: TTTTGCAAGAATTGGAGTATGTAGATTTCGAGTGATTTTATAAATGGGTTAATTTCGAGCATGAAGGAAGTCAGATAGAACAGCAAGTAAACTTTTGCTA[C / T]GATTTTAGGAGAAATCTTATCAGGCAAAGTAGTATTTTAAGTCCCTTCATCTGAAAATGATTGTTACTTTTATTGCCAACGTTTTCTAGATGATGAGGAT

[0181] SEQ ID NO 6: CATGGGGTAGAGACTTGGAGTATGTAGATTTCGAGTGATTTTAGAAATGG[G / T]TTAATCTCGAGCATGATTGAAGGCAGTCAGATAAACTGAAAGTAAACTTT

[0182] SEQ ID NO.

[0183] SEQ ID NO 8: AGTAATTAATGATAAAAAGAGAAACATAACTTGTTACTAACTACCTG[G / A]TTTAGGAAGATTGTAATGCATAAATTCAATACACTTCTATAACTTTTACT

[0184] SEQ ID NO 9: TTGACAGAAGTACTAAATGTTTCCTCTTTGTATAGGGCACAATTTCACAATTGCCAAAATAAACAGTAATCACAACACCAGAACCAACCACAACTACAAT[G / A]AACATATGTCTAGGGTTCTGAAACCATGATTTAAAACCTCTTGGTTTAAAGTGTTGAATTTGGTTACTATCAACATAGTAATTTCTCCTAGTAATAATAC

[0185] SEQ ID NO 10: TCAGTTCGTACAGATTTAAGCTCTACTCTGAGGAACCCTACAATAGCGTAAATGCATAATCCCATATCGGATGTGAGGTGTGATAAGTTACCTTTATAT[A / G]CGCCAATTCTTAATATGTATATTGTTTGTCAGATGGGAAACACCGTCGATAAGAGCAAGCCTAATAGATACCATTGACCCAATAAGGTTCTATAGAGGA

[0186] SEQ ID NO 11: AAAAATGAATGTAACCTAGATTTTTTCTGTAATCACACTTGTTGCAAGATTTGAAGGACCTCATCTTTTGTTGGTAAATCGGGAATCGCTCCTTTCTTTG[T / C]AATCGTAACAGCACCACATGCGTTTGAGAAATACAAAGCCTCCTTTAACCGCTTTTCATCCTGCCAGAAGAGCCAAAAGCAAAATAAAATTTGAAGAAAA

[0187] SEQ ID NO 12: CGTTGCATGTACTATTAGATTTGCCACTGATTGACGCAAAATACCTTTCC[G / A]AACATTACTAAGTGATATCAAATCGTGAACATAATTTCAAAGATTTAT

[0188] SEQ ID NO 13: CTGTAACCATACACATACACAGAGGGTCATGAATGTAAGAAGATTATAAC[C / A]ATCGTTTTTAACTGTAAATGTTTTTATGTAATACTTATAATCACAAAATG

[0189] SEQ ID NO 14: ATGTAGTTCAAGTCGAGGGACAACATTCGAATATAAAAGAGATGAATATCACGTTAGTTATTCAAAGCGTTCCATACATAAGTTTATCTTTGTGTTGTTA[G / A]AAACAATAGCATATATATGTCGGTCAAGGGTAGTTCTCTCGAAAAGTCGAAGTCCCATGAAAATAAAAAATACTGGAGTAACAAATTCATGTAAGTTTTCT

[0190] SEQ ID NO 15: CTTGTAAAGTACTCCGTAGTAATGTATCCCTATGTCATGTAAACTTTACAGCACTCACTCCAAAGCTCATACCAAAAGTCAACTGTGTAATCTCATAACA[C / T]ATGATATTCTTGTGAAAGTTGTGATGCAAGTACTCGTATTAACAATATGCACCTTACAACTAACAGGTTCTGTGACACTGAAAGTTTAAAAGTAAAAGCA

Claims

1. A spinach plant having resistance to at least one Pe race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe race 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

2. The spinach plant according to claim 1, wherein the plant is a plant grown from seeds of strain numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, and NCIMB 44195, or is obtainable by gene transfer from any plant derived therefrom.

3. The spinach plant according to claim 1 or 2, wherein the spinach plant comprises an allele identifiable by one or more SEQ ID NO: 1-15.

4. The spinach plant according to claim 3, wherein the allele or sequence is linked to the resistance.

5. The spinach plant according to any one of claims 1 to 4, wherein the spinach plant is a hybrid plant.

6. The spinach plant according to any one of claims 1 to 5, wherein the spinach plant is a self-pollinating plant.

7. The spinach plant according to any one of claims 1 to 6, wherein the plant is selected from the group consisting of savoy, semi-savoy, flat-leaved, or smooth-leaved.

8. The spinach plant according to claim 1, wherein the spinach plant is obtained by introducing one or more resistant alleles, preferably identifiable by one or more SEQ ID NO: 1-15, using genome editing technology or mutagenesis technology such as CRISPR Cas.

9. Progeny of a spinach plant according to any one of claims 1 to 8, wherein the progeny retain resistance to at least one Pe race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe race 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

10. The progeny plant according to claim 9, wherein the progeny plant is produced by one or more methods selected from the group consisting of self-pollination, hybridization, mutation, genome editing, or transformation.

11. The progeny plant according to claim 9 or 10, wherein the progeny plant comprises an allele identifiable by one or more SEQ ID NOs: 1-15.

12. Seeds from which a spinach plant can grow according to any one of claims 1 to 8.

13. For the production of spinach plants resistant to at least one Pe race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, preferably at least Pe race 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, PE22-53, PV2240 and PV2201, also known as 4+, strain numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB Use of one or more seeds having 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195, or their progeny.

14. A portion of the spinach plant according to any one of claims 1 to 8, or a portion of the progeny plant according to any one of claims 9 to 11, selected from the group consisting of stem, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, pedicels, ovules, buds, seeds, embryos, embryo sacs, cells, meristematic tissue, buds, and leaves.

15. A cell culture or tissue culture comprising cells or tissues derived from a part of a spinach plant as described in claim 14.

16. The spinach plants are spinach plants regenerated from a cell culture or tissue culture according to claim 15, wherein the spinach plants are resistant to at least one Pe race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

17. The spinach plant according to claim 16, wherein the spinach plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO: 1-15.

18. A method for producing spinach plants that are resistant to at least one or more Peronospora effusa (Pe) races or isolates, preferably multiple Peronospora effusa (Pe) races or isolates, (a) A step of preparing a spinach plant comprising a gene transfer fragment available from line NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, 44193, NCIMB 44194, or NCIMB 44195, wherein the gene transfer fragment confers resistance to one or more Pe races; (b) A step of crossing the spinach plant with another spinach plant that is sensitive to one or more of the Pe races to produce F1 seeds, (c) If necessary, the plants grown from F1 seeds are self-pollinated once or more to produce self-pollinated progeny of F2, F3 or further generations, (d) Identifying (or selecting) spinach plants grown from F1, F2, F3 seeds or further generations of self-pollinated progeny obtained as a result of step (c) that have resistance to one or more Pe races and / or are equipped with the gene transfer fragment or the resistance-constituting portion of the gene transfer fragment, (e) If necessary, the step of crossing the identified (or selected) F1 progeny or self-pollinated progeny of step (d) with any spinach plant to produce backcross progeny, (f) A step of selecting a backcross progeny that, if necessary, possesses resistance to one or more of the plurality of Pe races and / or possesses the gene transfer fragment or the resistance-constituting portion of the gene transfer fragment, A method that includes this.

19. The method according to claim 18, wherein the plurality of Pe races comprises Pe races 1-19, preferably at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+.

20. The method according to claim 18 or 19, wherein the identification step in step (d) is performed via marker-assisted selection.

21. The method according to any one of claims 18 to 20, wherein the identification of the spinach plant and / or selection of the backcross progeny is performed by identifying the presence of one or more alleles from SEQ ID NO: 1-15 in the plant or progeny.

22. The aforementioned resistance is conferred by a resistance gene present in line NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195, and the spinach plant possesses resistance to at least one or more Peronospora effusa (Pe) races 1-19.

23. The spinach plant according to claim 22, further comprising resistance to one or more isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

24. The spinach plant according to claim 22 or 23, comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1-15, or at least one nucleotide sequence having at least 95% identity, preferably at least 98% identity, and more preferably at least 99% identity with one or more of the group consisting of SEQ ID NO: 1-15.

25. A seed capable of growing the plant described in claim 22, or a leaf of the plant described in claim 22.

26. The progeny plant according to claim 22, wherein the progeny plant possesses a resistance gene that confers resistance to at least one Pe race 1-19.

27. The progeny plant according to claim 26, wherein the progeny plant is resistant to one or more isolates 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240, and PV2201, also known as 4+.

28. The progeny plant according to claim 26 or 27, wherein the progeny plant is produced by one or more methods of self-pollination, hybridization, mutation, genome editing technology, or transformation.

29. The progeny plant according to any one of claims 26 to 28, wherein the progeny plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1-15, or at least one nucleotide sequence having at least 95% identity, preferably at least 98%, more preferably at least 99% identity with one or more of the group consisting of SEQ ID NO: 1-15.

30. A method for producing spinach plants having broad resistance to Pe races and comprising cultivating plants from seeds selected from a group consisting of line numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195, or seeds of their progeny, wherein the progeny possess resistance genes that confer broad resistance to Pe races.

31. The method according to claim 30, wherein the resistance gene confers resistance to Pe races 1-19, at least Pe races 7, 8, 9, 10, 11, 12, 13, 16, 17, 18 and 19, isolate 4US, 21A (UA2016-21A or 2016-21A), PV2144, Pe22-53, PV2240 and PV2201, also known as 4+.

32. The method according to claim 30 or 31, wherein the introduction of one or more resistance alleles of the resistance gene is achieved by genome editing technology or mutagenesis technology such as CRISPR Cas.

33. A method for producing spinach plants that exhibit broad resistance to Pe races, comprising the introduction of one or more resistance alleles identifiable by one or more SEQ ID NO: 1-15, wherein the introduction of the alleles is achieved by genome editing technology or mutagenesis technology such as CRISPR Cas, and the plants exhibit broad resistance to Pe races.

34. A spinach plant regenerated from a cell culture or tissue culture derived from a portion of a spinach plant according to claims 22 to 24 and / or 26, wherein the regeneration is conditioned to resistance to at least one Pe race 1-19, the resistance being conditioned to a resistance gene present in seeds deposited in line numbers NCIMB 44186, NCIMB 44187, NCIMB 44188, NCIMB 44189, NCIMB 44190, NCIMB 44191, NCIMB 44192, NCIMB 44193, NCIMB 44194, or NCIMB 44195.

35. The spinach plant according to any one of claims 23, 26, and 34, comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1-15, and at least one nucleotide sequence having at least 95% identity with one or more of the group consisting of SEQ ID NO: 1-15, preferably at least 98%, and more preferably at least 99% identity.

Images