Method for producing immortalized megakaryocytes from adult human hematopoietic stem cells and progenitor cells for large-scale functional platelet generation in vitro.

Abstract

The present invention relates to a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines (102) from adult CD34+ HSPCs (100) capable of maturing into functional megakaryocytes (103) that produce functional platelets (104), comprising at least the step of forcing the expression of at least one gene by introducing an expression cassette containing at least one gene into the CD34+ HSPCs (100) by transduction, particularly by lentivirus (LV) transduction, wherein the transduced CD34+ HSPCs (100) are configured to express at least one gene from the HOXL subclass of the TALE homeobox class family and / or the ANTP homeobox class family upon expression induction by an activator, and to constitutively express at least one anti-apoptotic gene from the BCL2 family, wherein the transduced CD34+ The present invention provides a method for immortalizing HSPCs(100) by expressing at least one gene from the HOXL subclass of the TALE homeobox class family and / or ANTP homeobox class family, where preferably, the at least one gene from the HOXL subclass comprises at least one of the HOXB8, HOXA7, HOXA10, or HOXB4 genes in combination with at least one of the MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 genes, while the at least one anti-apoptotic gene from the BCL2 family comprises BCL2L1 or BCL2L2. The present invention further provides a method for producing functional platelets using immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines obtained by the above method. Furthermore, the present invention provides a pharmaceutical composition comprising functional platelets obtained by the above method, and therapeutic uses thereof.

Description

[Technical Field]

[0001] The present invention relates to methods and the technical field for obtaining functional platelets, particularly functional clinical-grade platelets, from human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines.

[0002] In particular, the present invention relates to a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines from adult CD34+ hematopoietic stem cells and progenitor cells (HSPCs) capable of maturing into functional megakaryocytes that produce functional platelets.

[0003] Furthermore, the present invention relates to a method for producing functional platelets, particularly functional clinical-grade platelets, using immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines obtained by the above method.

[0004] Furthermore, the present invention relates to functional platelets obtained by the above method.

[0005] Ultimately, the present invention relates to a pharmaceutical composition containing functional platelets obtained by the above method, and its therapeutic applications. [Background technology]

[0006] Diseases such as thrombocytopenia cause a decrease in platelet count in affected patients.

[0007] In such cases, platelet transfusion is the only treatment option to prevent life-threatening bleeding.

[0008] Platelet transfusions in patients can also be used to treat other clinically significant conditions such as leukemia, bone marrow transplantation, and anti-cancer therapy.

[0009] Platelets can be isolated during voluntary blood donation.

[0010] However, the shelf life of platelets is short (in the range of about 5 to 7 days), which adversely affects their availability.

[0011] This becomes an even more serious problem in medical crisis situations such as epidemics.

[0012] Furthermore, platelets obtained from donors always contain human plasma, red blood cells and residual leukocytes, and if the concentrate is not treated by devices such as filters and pathogen inactivation technologies, it may cause adverse events after blood transfusion.

[0013] In vivo, platelets are formed by progenitor cells called megakaryocytes (MKs) derived from pluripotent hematopoietic and progenitor stem cells (HSPCs) present in the bone marrow (BM), and are released into the bloodstream (Wang and Zheng, 2016).

[0014] Megakaryocytopoiesis, also called megakaryopoiesis or thrombopoiesis, is the process by which megakaryocytes, and ultimately platelets, develop from HSPCs.

[0015] The differentiation of platelets from hematopoietic stem cells (HSCs) proceeds through multiple cell differentiation stages, which is regulated by many transcriptional programs controlled by transcription factor networks.

[0016] In principle, the hierarchical model of megakaryocytopoiesis is as follows. That is, HSCs differentiate into pluripotent progenitors, which differentiate into common myeloid progenitors, which differentiate into megakaryocyte-erythroid progenitors, which differentiate into megakaryoblasts.

[0017] Megakaryoblasts mature into megakaryocytes in the bone marrow.

[0018] Mature megakaryocytes migrate to sinusoidal blood vessels, form pseudopod-like extensions (proplatelets) through vascular endothelial cells, and produce platelets.

[0019] For many years, considerable effort has been devoted to developing technologies for in vitro production of platelets from different sources, particularly (1) HSPCs, (2) reprogrammed cells, (3) non-hematopoietic sources, and (4) artificial platelets, in order to meet the ongoing demand for fresh platelet concentrates.

[0020] Large-scale production of platelets from HSPCs for therapeutic purposes is difficult, mainly for the following reasons:

[0021] Firstly, MKs obtained in vitro do not generate as many platelets as those produced in vivo.

[0022] Furthermore, in vitro proliferation culture of megakaryocytes or their precursors exhibits limited self-renewal capacity.

[0023] Ultimately, the sources of megakaryocytes or their precursors are limited because they are isolated from the peripheral blood (PB) or bone marrow aspiration of volunteer donors.

[0024] In particular, even if large-scale supply of megakaryocyte precursors and / or platelets is possible, precise isolation, maturation, and platelet production protocols are extremely costly, leading to unresolved variability in platelet production and quality, which could adversely impact patient safety and efficacy.

[0025] Therefore, large-scale blood donation is not suitable for industrialization for therapeutic purposes.

[0026] By establishing a new technology for generating functional platelets in vitro, we can meet clinical requirements, reduce safety testing costs, and support patient treatment.

[0027] By developing megakaryocyte cell lines as a single source for platelet production, it becomes possible to produce platelets of comparable quality without limit, thereby improving patient safety and the effectiveness of blood transfusions.

[0028] To overcome the limited self-renewal capacity of HSPCs, scientists have developed human induced pluripotent stem cells (iPSCs) that can differentiate into megakaryocytes and produce platelet-like particles under appropriate growth conditions (including, but not limited to, a growth factor cocktail) (Chen, Sugimoto, Eto, 2023).

[0029] This solution provides a self-replicating megakaryocyte source that can be genetically modified to become a universal donor platelet (Figueiredo et al., 2010), can be cultured under serum-free conditions (Pick et al., 2013), and is inexhaustible.

[0030] However, the clinical usefulness of this technology has not yet been proven.

[0031] One limitation is that iPSCs are more likely to form tumors after transplantation, and current iPSC manufacturing methods do not guarantee reproducibility and maintenance because the raw materials are derived from differentiated tissue (Prochazkova et al., 2015). Experimental studies have shown that the maturation of iPSCs into megakaryocytes is not optimized (Mookerjee et al., 2020). Furthermore, because iPSCs have embryo-like biological characteristics, they may induce primitive megakaryocyte formation, potentially leading to reduced functionality by producing megakaryocytes and platelets that express low levels of major receptors such as CD9 or GPIV (Mattia et al., 2002; Bluteau et al., 2013).

[0032] EP2708597B1 discloses a method for producing polyploid megakaryocytes. In particular, the known method includes the step of forcing the expression of oncogenes selected from MYC family genes and Polycomb group genes such as BMI1 in cells at any differentiation stage from hematopoietic progenitor cells to MKs before polyploidization, forcing the expression of BCL-XL in the MKs before polyploidization, and culturing and growing the resulting cells to obtain polyploid megakaryocytes. Furthermore, a method for producing platelets from the obtained polyploid MKs is disclosed.

[0033] Other types of cells have also been used to produce megakaryocytes and platelets in vitro.

[0034] Endothelial cells and fibroblasts can transdifferentiate into megakaryocytes under specific conditions (Ono et al., 2012; Lis et al., 2017).

[0035] However, the most promising cell type is adipose tissue-derived stromal cells, which are particularly readily available, but have the limitation of being able to produce less than one platelet per cell (Tozawa et al., 2019).

[0036] Furthermore, although these megakaryocytes and resulting platelets are described as functional, they do not originate from their original precursors, i.e., HSPCs. Therefore, they may lack important characteristics such as hemostatic ability.

[0037] To overcome the limitations of platelet precursors, scientists have also been working on developing artificial platelets using biosynthetic particle structures that functionally mimic the various hemostatic mechanisms of platelets.

[0038] Methods for developing these artificial platelets include, for example, protein-modified artificial platelet systems, peptide-modified artificial platelet systems, and hetero-multivalent modifications (Luc et al., 2022).

[0039] Artificial platelets appear to be an excellent alternative solution, particularly due to their versatility, but accurate studies are still needed to evaluate the risk of thrombosis, scalability, potential immune responses with multiple doses, and overall cost. [Overview of the Initiative] [Problems that the invention aims to solve]

[0040] Based on the above, the object of the present invention is to provide an improved method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines that enable the production of clinically significant amounts of high-quality functional platelets from adult CD34+ HSPCs that are as similar as possible to naturally occurring platelets circulating in vivo.

[0041] Another object of the present invention is to provide a method for producing functional platelets using human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines obtained by the above method.

[0042] Another object of the present invention is to provide a pharmaceutical composition containing functional platelets obtained by the above method, and therapeutic uses thereof. [Means for solving the problem]

[0043] The above objective is achieved by providing the method according to claim 1.

[0044] According to the present invention, a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines from adult CD34+ hematopoietic stem cells and progenitor cells (HSPCs) capable of maturing into functional megakaryocytes that produce functional platelets, wherein at least,

[0045] S1: The step of forcing the expression of at least one gene by introducing an expression cassette containing at least one gene into the CD34+ HSPCs (100) by transduction, particularly by lentivirus (LV) transduction,

[0046] Here, transduced CD34+ HSPCs are configured to express at least one gene from the HOXL subclass of the 3-amino acid loop elongation (TALE) homeobox class family and / or the Antennapedia homeoprotein (ANTP) homeobox class family, and to constitutively express at least one anti-apoptotic gene from the BCL2 family, upon expression induction by an activator.

[0047] Here, the transduced CD34+ HSPCs are immortalized by the expression of at least one gene from the HOXL subclass of the TALE homeobox class family and / or the ANTP homeobox class family.

[0048] Here, preferably, at least one gene from the HOXL subclass comprises at least one of the HOXB8, HOXA7, HOXA10, or HOXB4 genes in combination with at least one of the MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 genes, while at least one anti-apoptotic gene from the BCL2 family comprises BCL2L1 or BCL2L2.

[0049] The present invention provides a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines.

[0050] In particular, according to the present invention, human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or human megakaryocyte cell lines are obtained from adult CD34+ hematopoietic stem cells and progenitor cells (HSPCs) capable of maturing into functional megakaryocytes.

[0051] In particular, these functional megakaryocytes can generate functional platelets.

[0052] This method includes a step of forcing the expression of at least one gene by introducing an expression cassette containing at least one gene into CD34+ HSPCs via transduction, particularly lentivirus (LV) transduction.

[0053] Transduction using lentiviruses allows for the integration of expression cassettes into the cell's genome, preventing loss of gene expression.

[0054] Preferably, a second-generation or third-generation lentivirus is used for transduction.

[0055] In particular, the cassette includes constitutive promoters (e.g., elongation factor (EF) 1a) and / or inductive promoters, such as tetracycline-dependent promoters (e.g., tetracycline response element (TRE)) promoters.

[0056] Transduced CD34+ HSPCs are configured to express at least one gene from the HOXL subclass of the 3-amino acid loop extension (TALE) homeobox class family and / or the Antennapedia homeoprotein (ANTP) homeobox class family, and to constitutively express at least one anti-apoptotic gene from the BCL2 family, upon expression induction by an activator.

[0057] Transduced CD34+ HSPCs are immortalized by the expression of at least one gene from the HOXL subclass of the TALE homeobox class family and / or the ANTP homeobox class family.

[0058] Preferably, at least one gene from the HOXL subclass comprises at least one of the HOXB8, HOXA7, HOXA10, or HOXB4 genes in combination with at least one of the MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 genes.

[0059] Preferably, at least one anti-apoptotic gene from the BCL2 family includes BCL2L1 or BCL2L2.

[0060] This invention is based on the fundamental idea that human adult CD34+ HSPCs, i.e., the natural source of stem cells and progenitor cells from which megakaryocytes and platelets originate, can be immortalized by inhibiting the differentiation process through transduction of at least one gene whose expression is controlled by an activator and at least one gene that is constitutively expressed, thereby ensuring continuous proliferation. Transduced CD34+ HSPCs are immortalized by reducing the expression of at least one transduced gene and can differentiate into mature megakaryocytes, thereby generating an immortalized megakaryocyte cell line with virtually unlimited proliferative capacity while simultaneously preserving the ability to differentiate into megakaryocytes.

[0061] Therefore, an essentially unlimited cell supply is provided for the in vitro production of clinically significant platelets.

[0062] In particular, this almost unlimited proliferative capacity eliminates the need to continuously search for new megakaryocyte precursor sources, potentially allowing for the acquisition of unlimited quantities of immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or human megakaryocyte cell lines.

[0063] This, in particular, can improve the homogeneity between batches of manufactured platelets.

[0064] By the above method, standardized platelets functionally similar to naturally occurring platelets circulating in the body can be obtained.

[0065] Furthermore, the above method can reduce overall manufacturing costs.

[0066] Immortalized cell lines can be defined as a population of cells from a multicellular organism that, while not normally able to proliferate indefinitely, have been genetically modified to avoid cellular senescence and continue to divide. Therefore, these cells can be cultured in vitro for extended periods. The genetic modifications for immortalization may occur spontaneously or may be intentionally introduced or induced.

[0067] CD34 is a transmembrane phosphorylated glycoprotein encoded by the CD34 gene in humans, mice, rats, and other species.

[0068] CD34 protein is a member of the single-pass transmembrane sialomucin protein family expressed in early hematopoietic and vascular synchronicity progenitor cells.

[0069] The immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or megakaryocyte cell lines obtained by the method of the present invention can provide functional platelets, particularly functional clinical-grade platelets, upon maturation into megakaryocytes.

[0070] As mentioned above, an unlimited cell supply for in vitro platelet production is provided, which allows for the production of sufficient quantities of platelets for transfusions, resulting in platelets that are functionally similar to naturally circulating platelets in the body, providing versatility and reducing overall production costs.

[0071] As will be discussed later, mature megakaryocytes can be mechanically manipulated to generate platelets as needed.

[0072] The method of the present invention makes it possible to overcome the drawbacks and limitations of the conventional technology described above.

[0073] Immortalized megakaryocyte cell lines derived from human HSPCs, particularly adult CD34+ HSPCs, have the advantage of being able to grow for longer periods in minimal growth medium compared to megakaryocyte progenitor cells derived from human HSPCs, especially adult CD34+ HSPCs.

[0074] Immortalized CD34+ HSPCs and / or mature megakaryocytes derived from immortalized CD34+ HSPCs can be frozen and thawed as needed, thereby providing an unlimited megakaryocyte supply for producing improved functional platelets at minimal cost.

[0075] Members of the B-cell lymphoma 2 (BCL2) family are widely known for their role as apoptotic regulators.

[0076] Anti-apoptotic proteins from the BCL2 family, particularly MCL1, BCL2L1, and BCL2L2, are known to increase pre-platelet formation by mature megakaryocytes (Kodama et al., 2012; Bhatlekar et al., 2019), and BCL2L1 expression has beneficial effects on platelet lifespan (Mason et al., 2007; Zhang et al., 2007; Debrincat et al., 2012).

[0077] In relation to this, leukemia patients treated with venetoclax, an inhibitor of the anti-apoptotic member of the BCL2 family, are more likely to develop thrombocytopenia (10.6004 / jadpro.2022.13.4.4).

[0078] The major transcription factors that control hematopoiesis are members of the homeobox family.

[0079] The HOXL subclass of the ANTP homeobox class family genes (HOX genes) is known to be deeply involved in the regulation of hematopoiesis, and when abnormally expressed in acute myeloid leukemia, it is associated with abnormal proliferation and inhibition of differentiation.

[0080] HOXB4, HOXA9, HOXA10, and HOXB8 can immortalize hematopoietic precursors in a proliferation-dependent manner, but when used alone, they reduce megakaryocyte formation and erythropoiesis (Ferrell et al., 2005; Redecke et al., 2013; Stahlhut et al., 2021).

[0081] Several HOX genes, such as HOXB8, HOXA10, or HOXA7, are expressed in the CD34+ subpopulation that enables CFU-GEMM proliferation and in the K562 cell line, which has the ability to differentiate into megakaryocytes, and are important for cell fate determination (Sauvageau et al., 1994; So et al., 2004; Ferrell et al., 2005).

[0082] As described above, in the method of the present invention, preferred HOXL subclasses are HOXB8, HOXA7, HOXA10, or HOXB4.

[0083] The transcription factor members of the TALE family are atypical homeodomain proteins characterized by a three-residue insertion between helix 1 and helix 2, and play an essential role in embryonic development by participating in the transcription factor network that interacts with HOX genes.

[0084] Members of the Myeloid Ecotropic Virus Integration Site (MEIS) homeobox family, along with Pre-B cell leukemia transcription factor (Pbx), act as cofactors of HOX genes to facilitate DNA binding of hematopoietic cells, maintaining their proliferation, while suppressing myeloid differentiation in the presence of growth factors (Calvo et al., 2001; Fujino et al., 2001; Wong et al., 2007; Bessa et al., 2008; Jolma et al., 2015).

[0085] In particular, MEIS1 has been described as an important regulatory factor in early hematopoiesis and megakaryocyte differentiation, and continuous expression of MEIS1 is necessary for determining the fate of precursors to the MK lineage (Cai et al., 2012).

[0086] Preferably, the manufactured immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or human megakaryocyte cell lines can provide mature functional platelets, particularly functional clinical-grade platelets, through differentiation and maturation in the absence of activators.

[0087] Preferably, the activator is a tetracycline or an estrogen receptor modulator.

[0088] As a non-limiting example, the activator may be tetracycline or a derivative thereof.

[0089] For example, the activator may be any one of the following: chlortetracycline, oxytetracycline, demectocycline, lymecycline, meclocycline, metacycline, minocycline, rolitetetracycline, doxycycline, tiigecycline, ervacycline, thalecycline, or omadacycline.

[0090] The estrogen receptor modulator may also be a selective estrogen receptor modulator.

[0091] In particular, the estrogen receptor modulator may be tamoxifene, toremifene, reloxifene, ospemifene, anordrin, bazedoxifene, broparestrol, clomifene, cyclofenil, lasofoxifene, or ormeloxifene.

[0092] Additionally, or alternatively, the activator may be isopropyl β-D-1-thiogalactopyranoside (IPTG) and / or lactose (e.g., via a system based on Lac operon).

[0093] Additionally, or alternatively, the activator may be a cumate (e.g., via a cumate-controlled operator system).

[0094] Gene expression can be activated (or induced) by the addition of activators (for example, via tetracycline-regulated transcriptional activation).

[0095] This has the advantage that genes are expressed only during the growth and culture stage, and decrease during the maturation stage.

[0096] Advantageously, the above method further includes the step of culturing transduced adult CD34+ HSPCs.

[0097] In particular, the above step of culturing transduced adult CD34+ HSPCs includes a step of growing and culturing the transduced adult CD34+ HSPCs in the presence of an activator and at least one growth factor cocktail.

[0098] In particular, the step of culturing transduced CD34+ HSPCs is performed in a growth medium composition.

[0099] The presence of activators compels gene expression controlled by inducible promoters, thereby promoting or facilitating the growth and culture of transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or human megakaryocyte cell lines.

[0100] For example, the inductive promoter may include a tetracycline response element (TRE) or a cumate operator (CuO).

[0101] The specific effects can be determined by selecting a combination of single growth factors and adjusting their concentrations in the cocktail.

[0102] Preferably, the growth factor cocktail includes at least one of thrombopoietin (TPO), a TPO receptor agonist, stem cell factor (SCF), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-9 (IL-9), and interleukin-11 (IL-11).

[0103] In particular, these growth factors, either alone or in combination, are beneficial for the growth culture of transduced CD34+ HSPCs.

[0104] Advantageously, the above method may further include the step of differentiating and maturing transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized cell lines into mature functional megakaryocytes.

[0105] In particular, this step is carried out in the absence of activators and in the presence of at least one growth factor cocktail.

[0106] Therefore, gene expression controlled by inductive promoters is reduced.

[0107] Furthermore, growth factors enable, and / or promote, and / or induce differentiation into mature megakaryocytes.

[0108] Preferably, this step is carried out in a culture medium composition for differentiation and maturation.

[0109] The culture medium composition for differentiation and maturation is different from the culture medium composition for growth.

[0110] Preferably, the above method may further include the step of culturing immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines.

[0111] In particular, this stage takes place in the absence of the activating factor.

[0112] In principle, cell culture allows for the maintenance of a cell line for a certain period of time.

[0113] Preferably, the step of culturing transduced CD34+ HSPCs and / or transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines is carried out in the absence of serum and / or feeder cells.

[0114] Serum is very expensive and its price fluctuates from batch to batch.

[0115] Therefore, culturing under serum-free conditions can reduce manufacturing costs and minimize undesirable variability.

[0116] Feeder cells support cell proliferation in culture by providing an uncertain and complex mixture of extracellular matrix (ECM) components and growth factors.

[0117] Using feeder cells in cell culture is generally costly and complex.

[0118] Therefore, culturing without using feeder cells can reduce manufacturing costs and minimize undesirable contamination of platelets by non-hematopoietic cells.

[0119] Preferably, adult CD34+ HSPCs are derived from the peripheral blood (PB) or bone marrow (BM) of a healthy adult donor, particularly a single human donor.

[0120] A single donor is advantageous because it eliminates the need for a donor pool, thus minimizing manufacturing time and costs (for example, only one health check and one blood draw are required).

[0121] Methods for differentiating HSPCs into megakaryocytes are now widely known, and several sources of CD34+ HSPCs can be used (e.g., umbilical cord blood (CB), bone marrow (BM), and recruited or unrecruited peripheral blood (PB)).

[0122] In principle, the CD34+ HSPCs used in the production of megakaryocytes according to the present invention may be derived from adult BM and / or PB.

[0123] CD34+ HSPCs derived from CB, BM, or PB may not be identical in availability, and the quality of mature megakaryocytes and / or megakaryocyte-derived platelets may also not be identical.

[0124] CBs are an abundant source of immature HSPCs, and due to the high proliferation rate of CB CD34+ HSPCs, they have been widely used in megakaryocyte production.

[0125] Experimental evidence has shown that megakaryocytes derived from CD34+ HSPCs isolated from CB differ from those derived from CD34+ HSPCs isolated from BM or PB because their size decreases during maturation (Ignatz et al., 2007), which can ultimately lead to a decrease in platelet yield and adversely affect the function of the platelets produced (Miyazaki et al., 2000; Gaur et al., 2006).

[0126] Adult BMs may be an interesting source of HSPCs because CD34+ HSPCs are more abundant in BMs than in PBs.

[0127] However, access is limited due to the invasive procedures required to obtain the BM.

[0128] Ultimately, private banking (PB) could be the appropriate solution.

[0129] Blood donation is an easily accessible method, and although the number of adult CD34+ HSPCs in PB is small, they can be mobilized from donors by using mobilization agents such as G-CSF and / or prelixafor.

[0130] CD34+ HSPCs derived from PB can be used to obtain functionally mature megakaryocytes, ultimately leading to the acquisition of functional platelets during differentiation in vitro.

[0131] In all cases, CD34+ HSPCs (i.e., non-immortalized HSPCs) have limited proliferation and self-renewal capabilities and are therefore unsuitable for providing platelets as needed over long periods.

[0132] The cell culture conditions serve two main purposes: proliferation and survival of CD34+ HSPCs and / or transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines, and differentiation and maturation into mature megakaryocytes.

[0133] Chemically defined culture conditions can prevent a decline in the quality of the final product and reduce variability.

[0134] The step of culturing transduced CD34+ HSPCs, immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines is preferably carried out for about 1 day to at least 3 months.

[0135] Furthermore, the step of culturing transduced CD34+ HSPCs, immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines is preferably carried out in a humid incubator at 37°C and 5% CO2.

[0136] Another important aspect of platelet production is the versatility of the product.

[0137] In fact, alloplatelet refractory disorder is often caused by incompatibility between the recipient's human leukocyte antigen (HLA) and the antibodies that bind to the donor's epitopes.

[0138] Universal platelets can be generated primarily through genetic modification techniques targeting β-2-microglobulin (B2M), which encodes the β2m-light chain component of HLA class I antigens.

[0139] RNA interference technology-based B2M knockdown reduces HLA class I expression, while endonuclease-based B2M knockout (e.g., CRISPR / Cas9) generates HLA class I null cells.

[0140] Experimental evidence has shown that cultured HLA-null or decontaminated megakaryocytes and platelets are functional while evading immunodetection (Suzuki et al., 2020). In the proposed experimental procedure, the addition of a lentiviral vector encoding miRNA B2M (SEQ ID1) may be considered when transducing adult human CD34+ HSPCs to induce the expression of the gene described below.

[0141] SEQ ID1: 5'- GAATCTTTGGAGTACGCTGGATGTTTTGGCCACTGACTGACATCCAGCGCTCCAAAGATT-3'

[0142] This makes it possible to produce a source of human platelets suitable for all blood types that can avoid destruction by natural killer cells, and thus avoid harmful immune responses in patients who require platelet transfusions.

[0143] A more important aspect is the ability to freeze mature megakaryocytes derived from transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines and / or immortalized cells.

[0144] In particular, the selection of the gene set and promoter described above enhances the viability of megakaryocytes after freezing and thawing, enabling the generation of transduced CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines and / or banks of mature megakaryocytes.

[0145] In particular, transduced gene members of the BCL2 family (e.g., BCL2L1) that possess anti-apoptotic function are constitutively expressed through the above process.

[0146] The present invention further provides a method for producing functional platelets.

[0147] Functional platelets are then produced using immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines obtained by the above method.

[0148] In particular, the above method includes the step of obtaining immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines by carrying out the above method.

[0149] The above method further comprises the step of culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines.

[0150] Furthermore, the above method includes a step of differentiating the immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines into mature, functional megakaryocytes.

[0151] Ultimately, the above method includes the step of obtaining functional platelets by mechanically manipulating mature functional megakaryocytes.

[0152] Preferably, the latter step is carried out in a bioreactor.

[0153] Alternatively, the latter step may be performed using a microfluidic device.

[0154] The functional platelets obtained in this way have functions similar to those of natural platelets circulating in the body.

[0155] In particular, the above method makes it possible to obtain a clinically significant quantity of high-quality functional platelets.

[0156] Furthermore, the above method makes it possible to obtain high-quality functional platelets while reducing manufacturing costs.

[0157] The present invention further provides functional platelets produced by carrying out the above method.

[0158] Furthermore, the present invention provides a pharmaceutical composition containing functional platelets obtained by the above method.

[0159] The pharmaceutical composition can be used to treat diseases.

[0160] In particular, the pharmaceutical composition can be used for targeted treatment of specific diseases.

[0161] In particular, the disease may be thrombocytopenia.

[0162] Alternatively, the disease may be a bleeding disorder.

[0163] Furthermore, the pharmaceutical composition can be used in regenerative medicine.

[0164] An advantage of the present invention is that adult human CD34+ HSPCs are the natural source of megakaryocytes and ultimately platelets. Compared to other techniques using different cell sources, megakaryocytes and / or platelets produced by the method(s) of the present invention are more physiologically closer to those found in vivo. During the immortalization process, adult human CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or mature megakaryocytes may be modified to produce universal platelets. Overall, the approach of the present invention can be a substantial and economical solution to support clinical needs in transfusion units, therapeutic and / or preventive applications and / or regenerative medicine. [Brief explanation of the drawing]

[0165] Further details and advantages of the present invention are disclosed below, along with the drawings. [Figure 1] This is a block diagram illustrating a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines from CD34+ HSPCs capable of maturing into functional megakaryocytes, according to an embodiment of the present invention. [Figure 2] This is a block diagram showing a method for producing functional platelets according to an embodiment of the present invention. [Figure 3] Figures 1 (refer to the area indicated by the dotted line) and 2 (overall view) illustrate the method. [Figure 4] This figure shows the plasmid maps of TRE-HOXB8, TRE-MEIS1, EF1a-rtTA, and EF1a-BCL2L1 used in the described experiment. [Figure 5] This is a list of cloning primers suitable for use in the described experiments. In particular, these figures provide a list of primers and restriction enzymes suitable for cloning constructs. [Figure 6] Figures 6A-I show the experimental results of the described experiment, particularly demonstrating the advantage of obtaining long-term proliferating cells that maintain the ability to differentiate into mature megakaryocytes by transduction of HOXB8, MEIS1, BCL2L1, and rtTA into adult human CD34+ HSPCs. [Figure 7] This table summarizes the different trait introduction conditions tested in experiments H-I in Figure 6. [Figure 8] Figures 8A-H show experimental evidence demonstrating the clinical quality of platelets produced using mature megakaryocytes derived from adult human CD34+ HSPCs transduced with HOXB8, MEIS1, BCL2L1, and rtTA. [Figure 9] This figure shows the effect of B2M reduction and HLA-I surface expression in transduced adult human CD34+ HSPCs. [Modes for carrying out the invention]

[0166] Figure 1 provides a block diagram showing steps S1 to S4 of a method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines from 100 adult human CD34+ hematopoietic stem cells and progenitor cells (HSPCs) according to an embodiment of the present invention.

[0167] In particular, CD34+ HSPCs can mature into functional megakaryocytes 103 that produce functional platelets 104.

[0168] This method includes step S1, which forces the expression of at least one gene by introducing an expression cassette containing at least one gene into CD34+ HSPCs100 by transduction, particularly by lentivirus (LV) transduction.

[0169] Transduced CD34+ HSPCs100 are configured to express at least one gene from the HOXL subclass of the Antennapedia homeoprotein (ANTP) homeobox class family and / or the 3-amino acid loop extension (TALE) homeobox class family upon activator-induced expression.

[0170] In this embodiment, the activator may be tetracycline or an estrogen receptor modulator and / or isopropyl β-D-1-thiogalactopyranoside (IPTG) and / or a cumate control operator system.

[0171] Different types of activators can also be used if they are suitable for the purpose.

[0172] Transduced CD34+ HSPCs100 constitutively express at least one anti-apoptotic gene from the BCL2 family.

[0173] Transduced CD34+ HSPCs100 are immortalized by the expression of at least one gene from the HOXL subclass of the TALE homeobox class family and / or the ANTP homeobox class family.

[0174] In this embodiment, at least one gene of the HOXL subclass includes a combination of one of the HOXB8, HOXA7, HOXA10, or HOXB4 genes and at least one of the MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 genes.

[0175] Furthermore, in this implementation, at least one anti-apoptotic gene of the BCL2 family includes either BCL2L1 or BCL2L2.

[0176] The manufactured immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or human megakaryocyte cell line 102 can provide functional platelets 104, particularly functional clinical-grade platelets 104, through differentiation and maturation in the absence of activators.

[0177] In this implementation, the method further includes step S2 of culturing transduced CD34+ HSPCs100.

[0178] In particular, the culture of transduced CD34+ HSPCs100 is performed by growing and culturing transduced adult CD34+ HSPCs100 in the presence of an activator and at least one growth factor cocktail.

[0179] Here, step S2 is carried out in the growth medium composition.

[0180] In this implementation, at least one growth factor cocktail includes at least one of the following: thrombopoietin (TPO), TPO receptor agonist, stem cell factor (SCF), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-9 (IL-9), and interleukin-11 (IL-11).

[0181] In this implementation, the method further includes step S3, which involves differentiating and maturing transduced and / or cultured CD34+ HSPCs 100 and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors 102 and / or immortalized cell lines into mature functional megakaryocytes 103.

[0182] Here, step S3 is carried out in the absence of an activator and in the presence of at least one growth factor cocktail.

[0183] In this implementation, differentiation and maturation are carried out in a culture medium composition for differentiation and maturation.

[0184] In particular, the culture medium compositions for differentiation and maturation are different from the culture medium compositions for growth.

[0185] In this embodiment, the method further comprises step S4 of culturing immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines.

[0186] Here, step S4 is carried out in the absence of the activator.

[0187] In this implementation, the steps of culturing transduced CD34+ HSPCs 100 (step S2) and culturing immortalized megakaryocytes 102 and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell line 102 (step S4) are performed in the absence of serum and / or feeder cells.

[0188] In this embodiment, it is not explicitly stated that the CD34+ HSPCs100 originate from the adult peripheral blood or bone marrow of a single adult donor.

[0189] Furthermore, in this implementation model, it is not explicitly stated that a single adult donor is a single human adult donor.

[0190] Figure 2 shows a block diagram of steps S11 to S14 of a method for producing functional platelets 104 according to an embodiment of the present invention.

[0191] In particular, this method includes step S11, which involves performing the above method to obtain immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell line 102 (Figure 1).

[0192] This method further comprises step S12 of culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell line 102.

[0193] Furthermore, this method includes step S13, which differentiates immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell line 102 into mature functional megakaryocytes 103.

[0194] Ultimately, the method includes step S14, which involves mechanically manipulating mature functional megakaryocytes 103 to obtain functional platelets 104.

[0195] This method makes it possible to obtain clinically significant amounts of high-quality functional platelets 104, similar to those naturally circulating in the body.

[0196] Figure 3 is an illustrative diagram showing the method in Figure 1 (the area indicated by the dotted line) and the method in Figure 2 (the overall view).

[0197] In this implementation, as shown in Figure 3, step S14 can be easily carried out within a bioreactor (or microfluidic device).

[0198] The starting material is 100 human adult CD34+ HPSCs extracted from the peripheral blood or bone marrow of a single donor.

[0199] All blood cell lineages are generated by the functional maturation of a rare population of pluripotent HPSCs capable of proliferating through self-renewal and differentiation.

[0200] HSPCs can be found in several organs, including peripheral blood, bone marrow, and umbilical cord blood.

[0201] The first lentivirus LV is used to transduce the first expression cassette into cells.

[0202] The second lentivirus LV is used to transduce the second expression cassette into the cell.

[0203] The first expression cassette contains a constitutive promoter (EF1a).

[0204] The second expression cassette contains a tetracycline-dependent promoter (TRE).

[0205] In principle, lentivirus LV may contain one or more expression cassettes or expression cassettes containing a constitutive promoter and an inducible promoter.

[0206] Transduction using lentivirus LV allows for the integration of expression cassettes into the genome of transduced cells, preventing loss of gene expression.

[0207] The cell culture conditions serve two purposes: the proliferation and survival of transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or megakaryocyte cell line 102, and their differentiation into mature megakaryocytes 103.

[0208] This process should be carried out under chemically defined conditions to improve process standardization and prevent a decline in the quality of the final product.

[0209] In this implementation, it is not explicitly stated that a specific combination of genes, namely HOXB8, was used in conjunction with MEIS1, BCL2L1, and rtTA to immortalize CD34+ HSPCs100.

[0210] HOXB8 protein, along with MEIS1 protein, is a sequence-specific transcription factor that suppresses myeloid differentiation and enables the indefinite division of progenitor cells. BCL2L1 protein is an important anti-apoptotic protein that improves platelet quality.

[0211] In this experimental environment, rtTA and BCL2L1 are continuously expressed under the control of the EF1a promoter, while HOXB8 and MEIS1 are under the control of the TER promoter, which depends on the presence of doxycycline, a cotransduction and activator of the reverse tetracycline-regulated transactivator (rtTA) (LV-EF1a-rtTA).

[0212] The present invention further provides functional platelets 104, in particular functional platelets 104 produced by carrying out the method described above (Figure 3).

[0213] The present invention further provides pharmaceutical compositions, in particular pharmaceutical compositions comprising functional platelets 104 obtained by the method described above (Figure 3).

[0214] This pharmaceutical composition is suitable for the treatment of diseases, and preferably for targeted treatment of specific diseases.

[0215] In a lesser-known example, the disease could be thrombocytopenia.

[0216] As a further example, the disease could be a bleeding disorder.

[0217] Alternatively, the pharmaceutical composition can be used in regenerative medicine.

[0218] Experimental data

[0219] The inventors conducted experiments to implement the method of the above invention (Figures 1 to 3).

[0220] The experimental evidence obtained will be explained with reference to Figures 4 through 9.

[0221] Figure 4 provides a map of the plasmids used in the described experiments.

[0222] Here, the MEIS1 and HOXB8 coding sequences were placed next to the tetracycline response element (TRE) promoter. The rtTA and BCL2L1 coding sequences were placed next to the EF1A promoter.

[0223] In the presence of an activator, the TRE promoter is activated by rtTA.

[0224] In this experiment, doxycycline was used as an activator.

[0225] Upon activation of the TRE promoter, HOXB8 and MEIS expression increases in transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or megakaryocyte cell lines.

[0226] In the absence of an activator, rtTA is inactivated as a TRE promoter.

[0227] When the TRE promoter is inactivated, the expression of HOXB8 and MEIS1 decreases.

[0228] The EF1a promoter enables constitutive expression of genes.

[0229] BCL2L1 and rtTA are continuously expressed in transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or megakaryocyte cell lines and / or mature megakaryocytes.

[0230] Figure 5 provides a list of cloning primers suitable for use in experimental settings (see also Figure 6H).

[0231] In particular, Figure 5 shows a list of primers and restriction enzymes that can be used for construct cloning.

[0232] Figure 6A shows experimental evidence of transduction into adult CD34+ HSPCs using lentiviral (LV) vectors encoding HOXB8, rtTA, and BCL2L1 or HOXB8, MEIS1, rtTA, and BCL2L1 proteins (see Figure 4 for the dotted line in Figure 3 and the plasmid map).

[0233] After culturing CCD34+ HSPCs for several weeks (over 100 days) in the presence of a transduction and activator (doxycycline in this case), the surface expression of CD41 and CD42b was measured by flow cytometry at different days during the culture period.

[0234] During the culture period, untransduced cells cultured under the same conditions (control cells cultured under the same conditions) did not survive (data not presented). This suggests that only cells transduced with the gene in question became immortalized. Furthermore, the vector containing rtTA includes a puromycin-resistant cassette, allowing for the selection of cells expressing rtTA by puromycin treatment (0.25 μg / mL, 3 days).

[0235] Figure 6B shows that MEIS1 expression in transduced adult CD34+ HSPCs in the presence of an activator is associated with megakaryocyte precursor (CD45RA). - CD9 + CD49f + Evidence is presented demonstrating an increase in the number of HSPCs. Transduced adult CD34+ HSPCs maintained a growth culture state for more than one month in the presence of an activator. Expression of surface markers CD45RA, CD9, and CD49f was measured by flow cytometry.

[0236] Figure 6C shows CD34+ HSPCs transduced with HOXB8, rtTA, and BCL2L1 or HOXB8, MEIS1, rtTA, and BCL2L1, which were cultured in the presence of doxycycline (DOX ON) for more than one month and then differentiated into megakaryocytes for one week in the absence of doxycycline (DOX OFF). Surface expression of CD41 and CD42b was measured by flow cytometry. It is noteworthy that cells that forcibly expressed MEIS1 during the culture stage (DOX ON) showed an even higher CD41+CD42b+ double-positive rate during the differentiation stage (DOX OFF) compared with cells that were not transduced with an LV vector expressing MEIS1.

[0237] Figures 6D to 6G show adult CD34+ HSPCs transduced with lentiviral vectors encoding BCL2L1, HOXB8, MEIS1, and rtTA proteins, cultured in the presence of doxycycline (DOX ON) or in the absence of doxycycline (DOX OFF) for one week.

[0238] Figure 6D shows evidence that the expression of doxycycline-inducible genes MEIS1 and HOXB8 decreased one week after doxycycline removal (DOX OFF) compared with transduced CD34+ HSPCs whose proliferation state was maintained with doxycycline (DOX ON). Since MEIS1 and HOXB8 are also expressed in untransduced cells, complete suppression is unlikely.

[0239] Figure 6E shows evidence demonstrating that the CD41+CD42b+ population was increased in transduced adult CD34+ HSPCs one week after doxycycline removal (DOX OFF) compared to transduced adult CD34+ HSPCs maintained in proliferation culture in the presence of doxycycline (DOX ON). Cells were cultured in the presence of doxycycline for more than one month, and then differentiation was induced by doxycycline removal.

[0240] Figure 6F shows evidence of GPVI surface expression in both transduced adult CD34+ HSPCs one week after doxycycline removal (DOX OFF) and transduced adult CD34+ HSPCs maintained in a cultured state in the presence of doxycycline (DOX ON).

[0241] Figure 6G shows evidence that transduced adult CD34+ HSPCs maintained in a cultured state in the presence of doxycycline (DOX ON) are even smaller and mononuclear, while adult CD34+ HSPCs transduced one week after doxycycline removal (DOX OFF) may become polyploid and even larger than those under DOX ON conditions.

[0242] Combining Figures 6A to 6G, it is confirmed that co-expression of HOXB8, MEIS1, BCL2L1, and rtTA in transduced adult CD34+ HSPCs in the presence of doxycycline enables long-term culture (Figures 6A to 6B), and allows for the proliferation and culture of cells that maintain megakaryocyte differentiation ability (Figures 6C-G).

[0243] Figures 6H to 6I show evidence that combining HOXB8, MEIS1, BCL2L1, and rtTA with transduced adult CD34+ HSPCs provides the best combination for producing immortalized megakaryocytes and / or immortalized megakaryocyte precursors.

[0244] Figure 6H shows the growth culture of transduced adult CD34+ HSPCs in the presence of doxycycline (DOX ON), particularly using the combination exemplified in Figure 7. After transduction of CD34+ HSPCs, growth culture was carried out for several weeks (here exceeding 100 days) in the presence of the activator doxycycline. Surface expression of CD41 and CD42b was measured by flow cytometry at different time points during culture. During the culture period, untransduced cells cultured under the same conditions (control cells cultured under the same conditions) did not survive (data not shown). This suggests that only cells transduced with the gene were immortalized. Furthermore, the vector containing rtTA includes a puromycin-resistant cassette, making it possible to select cells expressing rtTA after puromycin treatment (0.25 μg / mL, 3 days).

[0245] Figure 6I shows typical conditions illustrating the process of cell maturation after growth culture in the presence of doxycycline for up to 100 days, followed by culture in the absence of doxycycline for 7 days. Flow cytometry results showed that the amount of CD41+CD42b+ cells was relatively low after doxycycline removal (DOX OFF) compared to the growth culture stage in the presence of doxycycline (DOX ON).

[0246] Figure 7 summarizes the various gene combinations tested, as shown in Figure 5H, and confirms that the HOXB8-MEIS1-BCL2L1-rtTA combination is best suited for producing mature megakaryocytes from transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines.

[0247] Figure 8 shows that functional platelets can be produced using transduced adult CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines, which differentiated into mature megakaryocytes one week after doxycycline removal.

[0248] Figure 8A shows the production of platelets (CD42b+CalcineAM+) at different time points (up to 120 minutes) in a modified bioreactor. The yield of platelets produced per megakaryocyte (CD42b+CalcineAM+ cell) was calculated as follows: (number of platelets at time T(t) - number of platelets at time T(0)) / megakaryocyte T(0).

[0249] The yields at each stage are shown in Figure 8B.

[0250] The evidence presented in Figures 8C-8D, in particular using CD41 and CD42b as platelet surface markers, supports the data illustrated in Figures 8A-B.

[0251] Figures 8E to 8H show platelets produced using adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA, respectively, activated with conbulxin (Figure 8F), thrombin (Figure 8G), or a mixture of thrombin and conbulxin (Figure 8H).

[0252] Figure 9A: Evidence is shown demonstrating a method for producing universal platelets in adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA by reducing B2M expression using lentivirus (LV) particles (Figure 9A).

[0253] Figure 9B presents evidence demonstrating that B2M can be reduced in 50.28% of adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA compared to adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA that do not express siRNA.

[0254] Configuration of the experimental apparatus

[0255] Materials and methods

[0256] Human fetal kidney (HEK) 293T cell culture

[0257] HEK 293T cells were cultured and maintained in Dulbecco's Modified Eagle Medium (DMEM) (Gibco, 41966-029) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin in a wet incubator containing 5% CO2 at 37°C. For lentivirus production, cells were pretreated in 0.002% poly-L-lysine solution (Sigma-Aldrich, P407) for 30 minutes at room temperature and placed in 10 cm petri dishes in quantities of 2 × 10⁶. 6 The seeds were seeded at a cell density of [number] cells.

[0258] Lentiviral vector cloning

[0259] Lentiviral clones expressing rtTA, HOXB8, and E6 / E7 were purchased from VectorBuilder (pLV[Exp]-EF1A>rtTA(ns):T2A:Puro(VB220725-1177cms), pLV[Exp]TRE>HPV16E6(ns):T2A:HPV16E7(ns):P2A:EGFP(VB2207271102pym), pLV[Exp]TRE>hHOXB8[NM_024016.4](ns):T2A:EGFP(VB2207271200nbb)).

[0260] For subsequent structures, pLV[Exp]-EF1A>rtTA(ns):T2A:Puro and pLV[Exp]TRE>hHOXB8[NM_024016.4](ns):T2A:EGFP were modified respectively, and pLV[Exp]-EF1A>MCS (multi-cloning site) and pLV[Exp]-TRE>MCS were obtained. BCL2L1, ERG, FLI1, MEIS1, CDK4 R24C -CCND1, hTERT, MLL-AF9, JAK2 V617F YAP S127A The open reading frame was amplified using the primers shown in Figure 5. The PCR product underwent gel purification before digestion with the specified restriction enzyme (Figure 5). Subsequently, the digested fragments were cloned into a lentiviral backbone containing elongation factor-1a (EF1a) or the tetracycline response element (TRE) (Figure 5). Ligation was performed using T3 DNA ligase (NEB). The rtTA-containing vector also contained a puromycin antibiotic resistance gene for sorting transduced mammalian cells.

[0261] Lentivirus production and concentration

[0262] Vesicular stomatitis virus (VSV-G) pseudoviral particles comprising third-generation self-inactivated glycoproteins were produced by transient co-transfection of not only the packaging plasmids pMD.G (VSV-G), pMDLg / p.RRE (gag and pol), and pRSV-Rev (Rev gene), but also a lentiviral transfer vector. Viral supernatants were collected 48 hours later. Viral particles were concentrated using PEG8000 or the sucrose gradient method. Viral titer was determined by infecting HEK293T cells and quantifying Psi copy number via integration quantitative polymerase chain reaction (PCR).

[0263] Integration quantitative PCR

[0264] Genomic DNA (gDNA) was isolated using QuickExtract (Biosearch technologies) in accordance with the manufacturer's recommendations. Fluorescence detection was performed on a Mic Real-Time PCR system using a total reaction volume of 10.5 μL containing PrimeTime Gene Expression Master Mix, Psi-specific primers and probe (236481330, IDT), albumin-specific primers and probe (236892403, IDT), and 10 ng of gDNA.

[0265] Vector copy number (VCN) was calculated as follows.

[0266] VCN (per cell) = (nb of Psi molecules / average albumin gene copy number) × 2

[0267] Lentiviral titer was determined as follows.

[0268] Titer (IP / mL) = (number of cells on transduction day × VCN) / volume of virus (mL).

[0269] CD34 + Isolation and Transduction of Human Hematopoietic Cells

[0270] CD34 +Human hematopoietic stem and progenitor cells (HSPCs) were isolated from granulocyte colony-stimulating factor (GCSF)-mobilized leukopaks (Jackson) by immunomagnetic selection (Miltenyi Biotec) in accordance with the manufacturer's protocol. Briefly, cells were diluted 1:1 in D-PBS. 30 mL of diluted cells was carefully added onto 10 mL of Ficoll and centrifuged at 300 g (acceleration 4, brake 0) for 30 minutes at room temperature. Thereafter, leukocytes are collected and washed twice with D-PBS. Cells were then adjusted to 30×10 8 / mL in buffer (PBS, 0.5% BSA, 2mM EDTA) and resuspended. Cells were then incubated with Fc block and CD34 beads for 30 minutes at 4°C and purified using an LS column (Miltenyi). Purification was confirmed by flow cytometry using CD34 PerCPCy5.5 (Biolegend). The purified CD34 + cells were frozen in freezing solution (40% IMDM, 50% FBS, 10% DMSO) and then stored in liquid nitrogen.

[0271] Cells were thawed 24 hours before transduction and resuspended at 0.3×10 6 / mL in 4Cell®. Nutri-T GMP medium (Sartorius) supplemented with 10 nM thrombopoietin receptor agonist peptide (TPOR-AP, Sigma-Aldrich, IEGPTLRQWLAARA-betaAla)2-K-NH2), 5.37 U / mL SCF (Miltenyi Biotec), 4 U / mL IL-3 (Miltenyi Biotec), and 1% penicillin-streptomycin (Sigma-Aldrich), and cultured in 24-well plates (Sarstedt) in a humidified incubator at 37°C with 5% CO2.

[0272] For transduction, cells are centrifuged at 200 g for 5 minutes, then resuspended in complete medium containing 100 μg / mL poloxamer P470, 4 μg / mL protamine sulfate, 10 μM prostaglandin E2, 8 μM cyclosporin H, and lentiviral particles at an MOI of 10 (see Figure 7), at a concentration of 1×10 6 cells / mL, 50 μL of the cell suspension is seeded into a U-shaped 96-well plate, or 500 μL into a 24-well plate, followed by 24 hours of culture. The medium is replaced, and 48 hours later, doxycycline (DOX) at a concentration of 1 μg / mL is added to activate the expression of the gene controlled by the TRE promoter. To eliminate non-transduced cells, after 3 weeks of culture in a humidified incubator at 37°C with 5% CO2, puromycin at a concentration of 0.25 ng / mL is used for 72 hours.

[0273] Cells are maintained in culture in proliferation medium supplemented with DOX for at least 60 days before undergoing the differentiation process.

[0274] Cell Characterization

[0275] Flow Cytometry

[0276] For immunophenotypic analysis, antibodies including allophycocyanin (APC)-labeled anti-human CD41 (1 / 400, Catalog No.: 303710, Biolegend), phycoerythrin (PE)-labeled anti-human CD42b (1 / 100, Catalog No.: 303906, Biolegend), PE-labeled anti-human CD45RA (1:200, Catalog No.: 304108, Biolegend), fluorescein isothiocyanate (FITC)-labeled anti-human CD49f (1:200, Catalog No.: 313605, Biolegend), PE-cyanine 7-labeled anti-human CD9 (1:200, Catalog No.: 312115, Biolegend), and APC-labeled anti-human GPVI were used.

[0277] In short, cells were collected, and 20 μL of cell suspension was diluted with PBS 0.1% BSA. The cells were then incubated with 100 μL of antibody mixture diluted with PBS 0.1% BSA for 20 minutes at room temperature in the dark. Data was acquired using a BD Fluorescence Accuri C6 PLUS flow cytometer and analyzed with FCSalyzer software.

[0278] May Grünwald Giemsa dyes

[0279] 12-well slides were coated with 50 μL of PBS 5% BSA solution by centrifugation at 500 rpm for 5 minutes. 1,000–50,000 cells were collected, centrifuged at 200 g for 5 minutes, and resuspended in 50 μL of PBS 5% BSA. The cell suspension was then placed on 12-well slides and centrifuged at 500 rpm for 5 minutes. The slides were allowed to air dry. May-Grünwald-Giemsa staining was performed according to the manufacturer's recommendations. Briefly, cells were stained with May-Grünwald stain for 5 minutes and washed for 1.5 minutes. Then, cells were stained with Giemsa stain diluted 1:20 for 15–20 minutes. The slides were washed with deionized water before microscopic observation.

[0280] Quantitative real-time reverse transcription PCR

[0281] Following the manufacturer's recommendations, total RNA was extracted from the dried cell pellet using a Cell-to-Ct kit (Thermofisher A35374) and transmuted to cDNA. Fluorescence detection was performed using a microreal-time PCR system with 10 μL of the total reaction mixture containing primers and probes for sensiFAST noROX Mix, MEIS1, or HOXB8. Albumin primers and probes, along with 2 μL of cDNA template, were used as gene references.

[0282] platelet production

[0283] Small-scale platelet production system

[0284] A small-scale platelet production device was prepared as described in WO2022167676A1.

[0285] 200,000 cells were placed in 5 mL of complete medium supplemented with 0.02 U / mL apirase and 25 mM HEPES, and then placed in a 50 mL tube fixed to an orbital mixer (IKA MS3 basic) in a sealed chamber containing 5% CO2. The tube was connected to the inlet and outlet of a microfluidic chip using flexible 0.51 mm ID tubing (Tygon ST R-3607, Idex Health and Science, Germany). To ensure cell circulation, the cell suspension was flowed through a platelet production apparatus at a rate of 1 mL / min for 90 minutes using a peristaltic pump (IPC8, ISMATEC, Germany). The entire apparatus for small-scale platelet production was housed in a chamber with a temperature controlled to 37°C using an air conditioning system (The Box, Life Imaging Services, Switzerland). Cell and platelet suspension samples were collected at the end of the experiment for platelet and MK counting and characterization.

[0286] Large-scale setup for platelet production

[0287] Prior to platelet production, 50 mg of Cellulobaze was incubated overnight at 4°C with 40 μg / mL of von Willebrand factor (VWF).

[0288] 20×10 6A 40 mL cell suspension containing transduced cells was diluted to a final volume of 250 mL (HEPES 25 mM and apirase 0.02 U / mL). The cells were placed in a 500 mL jacketed glass baffle vessel (Vessel V2, SpinChem, Sweden), into which a 28 mL bed reactor (RBR S2, Spinchem, Sweden) filled with VWF-coated cellulose beads was placed and mounted on a rotor shaft (Rotor IKA RW 20 Digital). The rotation speed was set to 900 rpm for 120 minutes. A gas mixer unit (CO2Biobrick, Life Imaging Services, Switzerland) supplied air with 5% CO2 into the chamber at a rate of 22 L / hour. The jacket surrounding the vessel was connected to a temperature control device (Colora) set to 37°C, which circulated temperature-controlled water through the jacket.

[0289] Platelet characterization

[0290] The following dyes and antibodies were used for this purpose: Calcein AM (final concentration: 625 nM), APC-labeled anti-human CD41 antibody (1 / 400, catalog number: 303710, Biolegend), PE-labeled anti-human CD42b antibody (1 / 100, catalog number: 303906, Biolegend), and APC-labeled anti-human CD42b antibody (1 / 200, catalog number: 303912, Biolegend).

[0291] Cells and platelets were sampled from the culture medium at the start and end of platelet generation. 20 μL of cell suspension was diluted with PBS 0.1% BSA solution. The cells were then incubated with 100 μL of antibody mixture diluted with PBS 0.1% BSA for 20 minutes at room temperature in the dark. Two types of mixtures were used: Calcein AM and APC-CD42b, or APC-CD41 and PE-CD42. Data were acquired using a BD Fluorescence Accuri C6 PLUS flow cytometer and analyzed with FCSalyzer software.

[0292] Platelet activation

[0293] Platelets were activated with self-prepared Tyrode's buffer (137 mM NaCl, 2.68 mM KCl, 11.9 mM NaHCO₃, 0.43 mM NaH₂PO₄, 1 mM MgCl₂, 5.55 mM glucose, 5 mM HEPES, 0.35% albumin, and 2 mM CaCl₂, pH 7.35), then incubated with 5 ng / mL to 5000 ng / mL convulxin (CVX), 2 U / mL thrombin (FIIa), or a combination of 10 ng / mL CVX and 0.5 U / mL FIIa.

[0294] Platelets were stained with APC-labeled anti-human CD41 or APC-labeled anti-human CD42b, and activation was assessed by fluorescent fibrinogen binding (AF488-labeled fibrinogen). Data were acquired using a BD Fluorescence Accuri C6 PLUS flow cytometer and analyzed with FCSalyzer software.

[0295] Results

[0296] The combination of transgenes enables long-term culture and differentiation into megakaryocytes

[0297] Adult CD34 + HSPCs were transduced at an MOI of 10 with various combinations of genes including DOX-inducible genes (MEIS1 and / or HOXB8) and constitutively expressed genes (BCL2L1 and rtTA). After gene induction by doxycycline (DOX), the cells were cultured long-term and compared (Figure 6A) to evaluate the ability to mature into CD41 + CD42b + cells (Figure 6C). Both cell lines (HOXB8-BCL2L1 or HOXB8-MEIS1-BCL2L1) could be maintained in serum-free, feeder-free culture for more than 3 months (Figure 6A). Next, the cell phenotype was characterized. Megakaryocyte progenitors are CD45RA - CD41 + CD49f + CD9+ The surface markers CD45RA, CD49f, and CD9 were compared by flow cytometry, and cells expressing HOXB8-MEIS1-BCL2L1 showed even higher expression levels compared to cells expressing HOXB8-BCL2L1 (Figure 6B). Next, the ability of two different combinations to mature into megakaryocytes was tested. Adult CD34 + HSPCs were transduced at MOI 10 with different gene combinations containing DOX-inducible genes (MEIS1 and / or HOXB8) along with constitutively expressed genes (BCL2L1 and rtTA), and cultured in the presence of doxycycline for at least one month. Afterward, doxycycline was removed for one week, and the surface expression of CD41 and CD42b was evaluated by flow cytometry. Adult CD34 transduced with HOXB8-MEIS1-BCL2L1-rtTA + In HSPCs, adult CD34 was transduced using HOXB8-BCL2L1-rtTA. + Compared to HSPCs, CD41 + CD42b + The proportion of the cell population was high (Figure 6C). Subsequently, a decrease in DOX-inducible genes was confirmed after DOX removal (Figure 6D). Adult CD34 transduced with HOXB8-MEIS1-BCL2L1-rtTA + HSPCs were cultured in the presence of doxycycline for more than one month, and then, one week in the absence of doxycycline, were confirmed to have the ability to mature into megakaryocytes (Figure 6E-G). May-Grünwald-Giemsa staining confirmed that the cells became polyploid 7 days after DOX removal (Figure 6G), and flow cytometry confirmed increased expression of the surface markers CD41 and CD42b in the cells (Figure 6E). Furthermore, 5% of the cells expressed GPVI on their surface (Figure 6F).

[0298] Overall, it was demonstrated that the combination of the BCL2L1, HOXB8, and MEIS1 genes enables the long-term proliferation of cells capable of differentiating into polyploid megakaryocytes.

[0299] To determine if this approach is best suited for producing clinically significant in vitro platelets, various methods of immortalizing cells using known genes for immortalizing adult hematopoietic precursors or other types of cells were tested. The genes were first selected based on their expression in megakaryocyte lineage (ERG, FLI1, JAK2 V617F GATA1s were selected, followed by other hematopoietic lineages based on their ability to immortalize (MLL-AF9, E6 / E7). hTERT was selected to stabilize genetically immortalized cells, and BCL2L1 was selected as an anti-apoptotic factor. YAP S127A and CDK4 R24C -CCND1 was added as a standard immortalization factor. DOX-inducible gene (CDK4 R24C -CCND1, hTERT, MLL-AF9, JAK2 V617F YAP S127A To compare different gene combinations including E6 / E7, or constitutively expressed genes (ERG, FLI1, GATA1s), several CD34 combinations were identified from Figures 6A to 6H. + Transduction was carried out sequentially (Figure 7). As shown in Figures 6H to 6I, these approaches allowed for long-term propagation (CDK4). R24C -CCND1 and YAP S127A ), or failure to successfully mature into mature megakaryocytes (MLL-AF9 and E6 / E7 and hTERT) or both (Figures 6H to 6I).

[0300] Megakaryocytes derived from HOXB8-MEIS1-BCL2L1 can generate functional platelets.

[0301] Next, we aimed to produce functional platelets from megakaryocytes derived from cells expressing HOXB8-MEIS1-BCL2L1. HOXB8-MEIS1-BCL2L1 cells were seeded in xeno-free medium containing thrombopoietin, differentiated into MKs, and then transferred to a specially modified rotating bed reactor consisting of pods containing cellulose beads. The cells were treated in a 200 mL bioreactor at 900 RPM for 2 hours. Over time, Calcein AM was detected within the platelet-like particle gate. + CD42b + An increase in events was detected by flow cytometry (Figure 8A). After 120 minutes, each Calcein AM + CD42b + Cells contain Calcein AM + CD42b + 20 Calcein AM per MK + CD42b + It was revealed that platelet-like particles (PLPs) are produced (Figure 8B). These data are from CD41 + CD42b + This was confirmed by staining (Figures 8C-8D).

[0302] In the presence of a PLP agonist such as conbulxin (CVX), thrombin, or a combination of both, CD41 is bound to fibrinogen by flow cytometry. + CD42b + Evaluations were performed to confirm that the PLPs were functional platelets (Figure 8E). 5% to 10% of the platelets produced in vitro bound to fibrinogen even without an agonist (Figures 8F to 8H). CD41 was identified by titration with CVX. + Fibrinogen binding in PLP increased in a dose-response manner (Figure 8F). Furthermore, up to 37.8% of CD41 was increased in the presence of 2 U / mL thrombin. + PLP bound to fibrinogen (Figure 8G). When 10 ng / mL CVX and 0.5 U / mL thrombin are used together, CD42b + PLP fibrinogen +This reached 56.2% (Figure 8H). Overall, in vitro platelets generated by megakaryocytes derived from HOXB8-MEIS1-BCL2L1 were able to bind to fibrinogen upon activation, indicating that no prior activation occurred.

[0303] Inhibition of β-2-microglobulin in immortalized megakaryocyte cell lines

[0304] To produce universal platelets in vitro (Figure 9A), β-2-microglobulin knockdown was tested in adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA after proliferation culture in the presence of doxycycline for more than 20 days. Transduction was performed into adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA using lentiviral particles with an MOI of 10. After two weeks, surface expression of β-2-microglobulin was evaluated by flow cytometry. A decrease in B2M expression was observed in 50.28% of the population (Figure 9B). This result confirms that B2M can be reduced in adult CD34+ HSPCs transduced with HOXB8-MEIS1-BCL2L1-rtTA. [Explanation of Symbols]

[0305] 100 (CD34+) hematopoietic stem cells and progenitor cells (HSPC(s)) 102 Immortalized megakaryocytes / Immortalized megakaryocyte precursors / Human megakaryocyte cell lines 103 Mature functional megakaryocytes (MK(s)) 104 platelets LV lentivirus S1 Method Step S2 Method Steps S3 Method Steps S4 Method Steps S11 Method Steps S12 Method Step S13 Method Steps S14 Method Steps List of References Bessa, J. et al. (2008) "meis1 regulates cyclin D1 and c-myc expression, and controls the proliferation of the multipotent cells in the early developing zebrafish eye," Development (Cambridge, England), 135(5), pp.799~803. Available at https: / / doi.org / 10.1242 / dev.011932. Bhatlekar, S. et al. (2019) "Anti-apoptotic protein BCL2L2 increases megakaryocyte proplatelet formation in cultures of human cord blood," Haematologica, 104(10), pp.2075~2083. Available at https: / / doi.org / 10.3324 / haematol.2018.204685. Bluteau, O. et al. (2013) "Developmental changes in human megakaryopoiesis," Journal of Thrombosis and Haemostasis, 11(9), pp.1730~1741. Available at https: / / doi.org / 10.1111 / jth.12326. Cai, M. et al. (2012) "Dual actions of Meis1 inhibit erythroid progenitor development and sustain general hematopoietic cell proliferation," Blood, 120(2), pp.335~346. Available at https: / / doi.org / 10.1182 / blood-2012-01-403139. Calvo, KR et al. (2001) "Meis1a suppresses differentiation by G-CSF and promotes proliferation by SCF: Potential mechanisms of cooperation with Hoxa9 in myeloid leukemia," Proceedings of the National Academy of Sciences, 98(23), pp.13120~13125. Available at https: / / doi.org / 10.1073 / pnas.231115398. Chen, SJ, Sugimoto, N., and Eto, K. (2023) "Ex vivo manufacturing of platelets: beyond the first-in-human clinical trial using autologous iPSC-platelets," International Journal of Hematology, 117(3), pp.349~355. Available at https: / / doi.org / 10.1007 / s12185-022-03512-8. Debrincat, MA et al. (2012) "Mcl-1 and Bcl-xL coordinately regulate megakaryocyte survival," Blood, 119(24), pp.5850~5858. Available at https: / / doi.org / 10.1182 / blood-2011-12-398834. Ferrell, CM et al. (2005) "Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34+ Human Cord Blood Cells," Stem Cells, 23(5), pp.644~655. Available at https: / / doi.org / 10.1634 / stemcells.2004-0198. Figueiredo, C. et al. (2010) "Generation of HLA-deficient platelets from hematopoietic progenitor cells: GENERATION OF HLA-DEFICIENT PLTs," Transfusion, 50(8), pp.1690~1701. Available at https: / / doi.org / 10.1111 / j.1537-2995.2010.02644.x. Fujino, T. et al. (2001) "Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes," Experimental Hematology, 29(7), pp.856~863. Available at https: / / doi.org / 10.1016 / S0301-472X(01)00655-5. Gaur, M. et al. (2006) "Megakaryocytes derived from human embryonic stem cells: a genetically tractable system to study megakaryocytopoiesis and integrin function," Journal of thrombosis and haemostasis: JTH, 4(2), pp.436~442. Available at https: / / doi.org / 10.1111 / j.1538-7836.2006.01744.x. Ignatz, M. et al. (2007) "Umbilical Cord Blood Produces Small Megakaryocytes After Transplantation," Biology of Blood and Marrow Transplantation, 13(2), pp.145~150. Available at https: / / doi.org / 10.1016 / j.bbmt.2006.10.032. Jolma, A. et al. (2015) "DNA-dependent formation of transcription factor pairs alters their binding specificity," Nature, 527(7578), pp.384-388. Available at https: / / doi.org / 10.1038 / nature15518. Kodama, T. et al. (2012) "Mcl-1 and Bcl-xL regulate Bak / Bax-dependent apoptosis of the megakaryocytic lineage at multistages," Cell Death & Differentiation, 19(11), pp.1856~1869. Available at https: / / doi.org / 10.1038 / cdd.2012.88. Lis, R. et al. (2017) "Conversion of adult endothelium to immunocompetent hematopoietic stem cells," Nature, 545(7655), pp.439~445. Available at https: / / doi.org / 10.1038 / nature22326. Luc, NF et al. (2022) "Bioinspired artificial platelets: past, present and future," Platelets, 33(1), pp.35-47. Available at https: / / doi.org / 10.1080 / 09537104.2021.1967916. Mason, KD et al. (2007) "Programmed Anuclear Cell Death Delimits Platelet Life Span," Cell, 128(6), pp.1173~1186. Available at https: / / doi.org / 10.1016 / j.cell.2007.01.037. Mattia, G. et al. (2002) "Different ploidy levels of megakaryocytes generated from peripheral or cord blood CD34+ cells are correlated with different levels of platelet release," Blood, 99(3), pp.888~897. Available at https: / / doi.org / 10.1182 / blood.v99.3.888. Miyazaki, R. et al. (2000) "Comparative analyses of megakaryocytes derived from cord blood and bone marrow," British Journal of Haematology, 108(3), pp.602~609. Available at https: / / doi.org / 10.1046 / j.1365-2141.2000.01854.x. Mookerjee, S. et al. (2020) "In vitro-derived platelets: the challenges we will have to face to assess quality and safety," Platelets, 31(6), pp.724-730. Available at https: / / doi.org / 10.1080 / 09537104.2020.1769051. Ono, Y. et al. (2012) "Induction of functional platelets from mouse and human fibroblasts by p45NF-E2 / Maf", Blood, 120(18), pp.3812~3821. Available at https: / / doi.org / 10.1182 / blood-2012-02-413617. Pick, M. et al. (2013) "Generation of Megakaryocytic Progenitors from Human Embryonic Stem Cells in a Feeder- and Serum-Free Medium," PLoS ONE. ET Zambidis, 8(2), p.e55530, available at https: / / doi.org / 10.1371 / journal.pone.0055530. Prochazkova, M. et al. (2015) “Chapter 18-Embryonic Versus Adult Stem Cells”, in A. Vishwakarma et al. (eds) Stem Cell Biology and Tissue Engineering in Dental Sciences. Boston: Academic Press, pp. 249–262. Available at https: / / doi.org / 10.1016 / B978-0-12-397157-9.00020-5. Redecke, V. et al. (2013) "Hematopoietic progenitor cell lines with myeloid and lymphoid potential," Nature Methods, 10(8), pp.795-803. Available at https: / / doi.org / 10.1038 / nmeth.2510. Sauvageau, G. et al. (1994) "Differential Expression of Homeobox Genes in Functionally Distinct CD34+ Subpopulations of Human Bone Marrow Cells," Proceedings of the National Academy of Sciences of the United States of America, 91(25), pp.12223~12227. So, CW et al. (2004) "Leukemic transformation of hematopoietic progenitors by MLL-GAS7 in the absence of Hoxa7 or Hoxa9", Blood, 103(8), pp.3192~3199. Available at https: / / doi.org / 10.1182 / blood-2003-10-3722. Stahlhut, M. et al. (2021) "Conditionally immortalized leukemia-initiating cells co-expressing Hoxa9 / Meis1 demonstrate microenvironmental adaptation properties ex vivo while maintaining myelomonocytic memory," Scientific Reports, 11(1), p.5294. Available at https: / / doi.org / 10.1038 / s41598-021-84468-3. Suzuki, D. et al. (2020) "iPSC-Derived Platelets Depleted of HLA Class I Are Inert to Anti-HLA Class I and Natural Killer Cell Immunity," Stem Cell Reports, 14(1), pp.49~59. Available at https: / / doi.org / 10.1016 / j.stemcr.2019.11.011. Tozawa, K. et al. (2019) "Megakaryocytes and platelets from a novel human adipose tissue-derived mesenchymal stem cell line," Blood, 133(7), pp.633~643. Available at https: / / doi.org / 10.1182 / blood-2018-04-842641. Wang, B. and Zheng, J. (2016) "Platelet generation in vivo and in vitro," SpringerPlus, 5(1), p.787. Available at https: / / doi.org / 10.1186 / s40064-016-2384-1. Wong, P. et al. (2007) "Meis1 is an essential and rate-limiting regulator of MLL leukemia stem cell potential," Genes & Development, 21(21), pp.2762~2774. Available at https: / / doi.org / 10.1101 / gad.1602107. Zhang, H. et al. (2007) "Bcl-2 family proteins are essential for platelet survival," Cell Death & Differentiation, 14(5), pp.943~951. Available at https: / / doi.org / 10.1038 / sj.cdd.4402081.

Claims

1. A method for producing human immortalized megakaryocytes and / or human immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) from adult CD34+ hematopoietic stem cells and progenitor cells (HSPCs) (100) capable of maturing into functional megakaryocytes (103) that produce functional platelets (104), wherein at least, S1: The process includes the step of forcing the expression of at least one gene by introducing an expression cassette containing at least one gene into the CD34+ HSPCs (100) by transduction. Here, the transduced CD34+ HSPCs (100) are configured to express at least one gene from the HOXL subclass of the 3-amino acid loop extension (TALE) homeobox class family and / or the Antennapedia homeoprotein (ANTP) homeobox class family, and to constitutively express at least one anti-apoptotic gene from the BCL2 family, upon expression induction by an activator. Here, the transduced CD34+ HSPCs (100) are immortalized by the expression of at least one gene from the TALE homeobox class family and / or the HOXL subclass of the ANTP homeobox class family. method.

2. The method according to claim 1, characterized in that the manufactured immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) can provide the mature functional platelets (104) by differentiation and maturation in the absence of activators.

3. The method according to claim 1, characterized in that the activator is one of tetracycline or an estrogen receptor modulator and / or isopropyl β-D-1-thiogalactopyranoside (IPTG) and / or lactate and / or cumate.

4. S2: Further comprising the step of culturing transduced CD34+ HSPCs (100), The method according to any one of claims 1 to 3, characterized in that the step of culturing transduced CD34+ HSPCs (100) comprises culturing the transduced CD34+ HSPCs (100) in a growth medium composition in the presence of an activator and at least one growth factor cocktail.

5. The method according to claim 4, characterized in that the growth factor cocktail comprises at least one of thrombopoietin (TPO), a TPO receptor agonist, stem cell factor (SCF), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-9 (IL-9), and interleukin-11 (IL-11).

6. S3: A step of differentiating and maturing transfected CD34+ HSPCs and / or immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) into the mature functional megakaryocytes (103) in the absence of activators and in the presence of at least one growth factor cocktail. The method according to claim 4, further comprising:

7. The method according to claim 6, characterized in that differentiation and maturation are carried out in a differentiation and maturation medium composition different from the growth medium composition.

8. S4: Step of culturing immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) in the absence of activators. The method according to any one of claims 1 to 3, further comprising:

9. The method according to claim 4, characterized in that the step of culturing transduced adult CD34+ HSPCs (100) is carried out in the absence of serum and / or feeder cells.

10. The method according to claim 8, characterized in that the step of culturing immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) is carried out in the absence of serum and / or feeder cells.

11. The method according to claim 1, wherein the at least one gene from the HOXL subclass comprises at least one of the HOXB8, HOXA7, HOXA10, or HOXB4 genes in combination with at least one of the MEIS1, MEIS2, MEIS3, PBX1, PBX2, PBX3, and / or PBX4 genes, while the at least one anti-apoptotic gene from the BCL2 family comprises BCL2L1 or BCL2L2.

12. The method according to claim 1, characterized in that the expression of the at least one gene by transduction of an expression cassette containing the at least one gene into a CD34+ HSPC (100) is performed by lentivirus (LV) transduction.

13. The method according to any one of claims 1 to 3, characterized in that adult CD34+ HSPCs (100) are derived from the peripheral blood or bone marrow of one or more human donors.

14. A method for producing functional platelets (104), S11: A step of obtaining immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) by carrying out the method described in any one of claims 1 to 3, S12: A step of culturing the obtained immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell line (102), S13: A step of differentiating and maturing immortalized megakaryocytes and / or immortalized megakaryocyte precursors and / or immortalized megakaryocyte cell lines (102) into the mature functional megakaryocytes (103), S14: A method comprising the step of obtaining functional platelets (104) by mechanically manipulating mature functional megakaryocytes (103) in a bioreactor or microfluidic device.

15. A functional platelet (104) obtained by carrying out the method described in claim 14.

16. A pharmaceutical composition comprising the functional platelet (104) described in claim 15.

17. A use of the pharmaceutical composition according to claim 16 for the treatment of a disease, wherein the disease is either thrombocytopenia or a hemorrhagic disorder.

18. Uses of the pharmaceutical composition according to claim 16 in regenerative medicine.

Images