Antibodies targeting serum amyloid A (SAA) and their use

Abstract

This disclosure relates to anti-SAA antibodies or fragments thereof, such as antibodies or fragments thereof against human SAA1, which can be used in various therapeutic, prophylactic, and diagnostic methods. These antibodies or fragments thereof can be used to treat hematological disorders, such as acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndromes.

Description

Cross-reference of related applications

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 519,621, filed on 15 August 2023, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Sequence List This application includes a sequence listing submitted electronically in XML format, which is incorporated herein by reference in its entirety. The XML copy prepared on 12 August 2024 is named 01001_012072-WO0_SL.xml and has a size of 51,526 bytes. [Technical Field]

[0003] This disclosure relates to the treatment of leukemia and myelodysplastic syndromes through inhibition of serum amyloid A1 (SAA1) and anti-SAA1 antibodies.

[0004] Government support This invention was made with government support under AR054447 and HL130937, awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]

[0005] Acute myeloid leukemia (AML) is a type of hematological cancer characterized by two features: the inability to form mature red blood cells and immune cells, and an excess number of dysfunctional white blood cells that affect the immune response. It often arises from pre-AML conditions, namely clonal hematopoiesis (CH) and myelodysplastic syndrome (MDS). Patients with MDS and AML typically have various immune system disorders, high levels of inflammatory proteins in the bone marrow, and a suppressed immune system.

[0006] Recent studies have shown that the tumor microenvironment plays a crucial role in disease development. For example, osteoblasts are essential cells for new bone formation. Osteoblast counts are reduced in MDS and AML patients, and their removal increases the leukemia burden, while maintaining the osteoblast pool reduces the tumor burden and extends survival. Alterations in the osteoblast compartment can cause MDS and AML in mice and are associated with myeloproliferative neoplasms, MDS, and AML in patients. Furthermore, osteoblasts may exert tumor suppressor roles in bone marrow disorders or may be remodeled by dysplastic cells to reinforce leukemia.

[0007] The progression of AML requires the presence of serotonin receptor-1b (HTR1B) in osteoblasts and is driven by AML-secreted kynurenin, which acts as a tumor metabolite and HTR1B ligand. AML cells utilize kynurenin to induce a pro-inflammatory state in osteoblasts, which acts on leukemia cells in a positive feedback loop by increasing the expression of indoleamine 2,3-dioxygenase (IDO1), the rate-limiting enzyme in kynurenin synthesis, via the acute-phase protein serum amyloid A (SAA), thereby enabling the progression of AML.

[0008] Standard of care (SOC) therapy relies on hypomethylating agents for MDS and chemotherapy for AML, as well as several new targeted therapies, including targeted IDH1 or IDH2 inhibitors. However, their effectiveness is short-lived and not curative. Furthermore, 30% of MDS patients progress to AML, at which point the disease is largely unresponsive to treatment and mortality rates are high. In addition to directly targeting tumor cells, treatment of other causes of AML, such as the tumor microenvironment, is needed (Krevvata M, et al., Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts. Blood. 2014 Oct;124(18): pp. 2834-46). Specifically, by targeting osteoblasts, it is possible to inhibit leukemia engraftment and disease progression (Krevvata M, et al., Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts. Blood. 2014 Oct;124(18): pp. 2834-46).

[0009] Therefore, new therapies are needed to limit the number of cancer cells in the blood or to reduce the suppression of the immune system. [Overview of the project]

[0010] This disclosure relates to an anti-SAA antibody, or its antigen-binding moiety, wherein the heavy chain variable region (V H ) and light chain variable region (V LThe heavy chain variable region comprises three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, having amino acid sequences that are approximately 80% to approximately 100% identical to the amino acid sequences described in SEQ ID NOs. 8, 9, and 10, SEQ ID NOs. 42, 43, and 44, SEQ ID NOs. 11, 12, and 13, or SEQ ID NOs. 14, 15, and 16, respectively; and the light chain variable region comprises three CDRs, namely CDR1, CDR2, and CDR3, having amino acid sequences that are approximately 80% to approximately 100% identical to the amino acid sequences described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54 (or SEQ ID NOs. 27, the WTS sequence, and SEQ ID NOs. 29, respectively), providing an anti-SAA antibody or its antigen-binding moiety.

[0011] This disclosure relates to an anti-SAA antibody, or its antigen-binding moiety, wherein the heavy chain variable region (V H The present invention provides an anti-SAA antibody or its antigen-binding moiety, comprising three CDRs, namely CDR1, CDR2, and CDR3, whose heavy chain variable region has an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequences described in SEQ ID NOs. 8, 9, and 10, SEQ ID NOs. 42, 43, and 44, SEQ ID NOs. 11, 12, and 13, or SEQ ID NOs. 14, 15, and 16, respectively.

[0012] This disclosure relates to an anti-SAA antibody, or its antigen-binding portion, wherein the light chain variable region (V L The present invention provides an anti-SAA antibody or its antigen-binding moiety, comprising three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequences described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54 (or SEQ ID NOs. 27, the WTS sequence, and SEQ ID NOs. 29, respectively), wherein the light chain variable region includes three CDRs.

[0013] Dissociation constant (K) of the antibody or its antigen-binding moiety D ) is approximately 2 × 10 -9 Less than M, approximately 1.5 × M10 -9 Less than, or approximately 1.2 × 10 -9 It may be less than M.

[0014] The heavy chain variable region (V H ) of the antibody or the antigen-binding portion thereof may comprise an amino acid sequence that is from about 80% to about 100% identical to the amino acid sequence set forth in SEQ ID NO: 6, 7, 40, or 41. The light chain variable region (V L ) of the antibody or the antigen-binding portion thereof may comprise an amino acid sequence that is from about 80% to about 100% identical to the amino acid sequence set forth in SEQ ID NO: 22, 23, 50, or 51.

[0015] The antibody or the antigen-binding portion thereof may be selected from the group consisting of: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a Fab fragment; (d) F(ab')2; and (e) a disulfide bond Fv.

[0016] The antibody or the antigen-binding portion thereof may comprise at least one constant domain selected from the group consisting of: (a) an IgG constant domain; and (b) an IgA constant domain.

[0017] The antibody or the antigen-binding portion thereof may comprise at least one human constant domain.

[0018] The antibody or the antigen-binding portion thereof is capable of binding to a peptide having an amino acid sequence that is from about 80% to about 100% identical to the amino acid sequence set forth in SEQ ID NO: 32, 33, or 34.

[0019] The present disclosure provides an anti-SAA antibody, or an antigen-binding portion thereof, wherein the heavy chain variable region (V H ) and the light chain variable region (V LThe present invention provides an anti-SAA antibody or its antigen-binding moiety, comprising: a heavy chain variable region comprising three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, each encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequences described in SEQ ID NOs. 3, 4, and 5, or SEQ ID NOs. 37, 38, and 39, respectively; and a light chain variable region comprising three CDRs, namely CDR1, CDR2, and CDR3, each encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequences described in SEQ ID NOs. 19, 20, and 21, or SEQ ID NOs. 47, 48, and 49, respectively.

[0020] This disclosure relates to an anti-SAA antibody, or its antigen-binding moiety, wherein the heavy chain variable region (V H ) and light chain variable region (V L The present invention provides an anti-SAA antibody, or its antigen-binding moiety, comprising, the heavy chain variable region being encoded by a nucleotide sequence that is approximately 80% to 100% identical to the nucleotide sequence described in SEQ ID NO: 1, 2, 35, or 36, and the light chain variable region being encoded by a nucleotide sequence that is approximately 80% to 100% identical to the nucleotide sequence described in SEQ ID NO: 17, 18, 45, or 46.

[0021] SAA can be human SAA1 or mouse SAA3.

[0022] The antibody or its antigen-binding portion may be humanized or chimeric.

[0023] This disclosure also provides isolated polypeptides comprising the antibody or its antigen-binding moiety.

[0024] Furthermore, compositions comprising an antibody or its antigen-binding moiety and at least one pharmaceutically acceptable carrier are also included in this disclosure.

[0025] This disclosure provides polynucleotides encoding antibodies or their antigen-binding moieties. This disclosure also provides vectors containing polynucleotides. This disclosure also provides cells containing vectors.

[0026] The disclosure also includes methods for treating cancer or blood disorders in a subject, which involve administering an effective amount of an antibody or its antigen-binding portion, polypeptide, or composition to the subject.

[0027] Blood disorders may include acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia (CMML), or acute lymphoblastic leukemia (ALL).

[0028] Cancer can be pancreatic cancer, lung cancer, liver cancer, breast cancer, or colon cancer.

[0029] The target could be a human.

[0030] Administration may be parenteral, intravenous, subcutaneous, intramuscular, transdermal, oral, topical, intrathecal, or topical.

[0031] The method may further include administering to the subject a chemotherapeutic agent, an indoleamine 2,3-dioxygenase (IDO1) inhibitor, a kynurenine synthesis inhibitor, a kynurenine breakdown-promoting agent, a PD1 inhibitor, a PD-L1 inhibitor, or a combination thereof.

[0032] This disclosure provides an anti-SAA1 antibody or its antigen-binding moiety, which binds to a linear amino acid sequence epitope comprising the amino acid sequence described in SEQ ID NO: 33 or SEQ ID NO: 32.

[0033] This disclosure provides a method for treating myelodysplastic syndrome or acute myeloid leukemia in a subject, comprising administering a therapeutically effective amount of an anti-SAA1 antibody or its antigen-binding moiety to the subject, wherein the anti-SAA1 antibody or its antigen-binding moiety binds to a linear amino acid sequence epitope comprising the amino acid sequence described in SEQ ID NO: 33 or SEQ ID NO: 32. [Brief explanation of the drawing]

[0034] [Figure 1] Effects of anti-SAA3 polyclonal antibodies. A: Inhibition of SAA3-induced NFκβ activation in RAW264.7 cells by anti-SAA3 polyclonal antibodies. B: Effect of anti-SAA3 polyclonal antibodies on leukemia progression in mice injected with MLL-AF9 cells. C: Effect of anti-SAA3 polyclonal antibodies on survival rate in mice injected with MLL-AF9 cells. [Figure 2] Synthetic peptide immunization strategy. The peptides used for immunization and ELISA screening are modified SAA1 / SAA3 amino acid 33-42 peptides, specifically Ac-RDMWRAYSDMC-amide. [Figure 3A] Evaluation of monoclonal antibody subclones in inhibiting SAA1-induced NFκβ activation and improving cell viability. [Figure 3B] Evaluation of monoclonal antibody subclones in inhibiting SAA1-induced NFκβ activation and improving cell viability. [Figure 3C] Evaluation of monoclonal antibody subclones in inhibiting SAA1-induced NFκβ activation and improving cell viability. [Figure 3D] Evaluation of monoclonal antibody subclones in inhibiting SAA1-induced NFκβ activation and improving cell viability. [Figure 4A] A competitive binding assay using reporter cell lines. [Figure 4B] A competitive binding assay using reporter cell lines. [Figure 4C] A competitive binding assay using reporter cell lines. [Figure 4D] A competitive binding assay using reporter cell lines. [Figure 4E] A competitive binding assay using reporter cell lines. [Figure 4F] A competitive binding assay using reporter cell lines. [Figure 5A]Inhibition of SAA1-induced proliferation in cancer cell lines by anti-SAA1 monoclonal antibodies using an EdU uptake assay. Purified 18A3 antibody effectively inhibited SAA1-induced proliferation in T-cell acute lymphoblastic leukemia (T-ALL) cell lines (CUTLL1, CEM, and Jurkat) and B-cell acute lymphoblastic leukemia (B-ALL) cell lines (Nalm6, REH, and 697). [Figure 5B] Inhibition of SAA1-induced proliferation in cancer cell lines by anti-SAA1 monoclonal antibodies using an EdU uptake assay. Purified 18A3 antibody effectively inhibited SAA1-induced proliferation in pancreatic cancer cell lines (BXPC3, HPAC, and PANC1). [Modes for carrying out the invention]

[0035] This disclosure relates to anti-SAA antibodies and antibody fragments (e.g., antigen-binding portions of antibodies) that can be used in a variety of therapeutic, prophylactic, diagnostic, and other applications. The antibodies or their fragments, or the compositions thereof, can be used to treat cancer or hematological disorders in a subject.

[0036] Applications of this antibody (or fragment thereof) and composition include: (i) treatment of cancer or hematological disorders (e.g., AML or myelodysplasia); (ii) combination therapy with chemotherapy / immunotherapy for cancer or hematological disorders (e.g., AML or myelodysplasia); (iii) modulation of bone marrow niche interactions in relation to stem cell transplantation and immunodeficiency disorders; and (iv) improvement of in vitro culture of hematopoietic stem cells.

[0037] Antibodies, or their antigen-binding moieties, include, but are not limited to, monoclonal antibodies, humanized antibodies, chimeric antibodies, polyclonal antibodies, recombinant expression antibodies, and the aforementioned antigen-binding moieties. The antigen-binding moiety of an antibody may include a portion of the antibody that specifically binds to SAA (e.g., SAA1).

[0038] This disclosure also provides methods for treating cancer or blood disorders. The methods may include administering a therapeutically effective amount of an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof to a subject in need. The methods may include administering a composition to a subject in need. The composition may include an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof. The blood disorders may be myelodysplastic syndromes (MDS) or leukemias (e.g., acute myeloid leukemia (AML), acute lymphoblastic leukemia (or acute lymphoblastic leukemia, ALL)).

[0039] In one embodiment, the present disclosure provides a method for treating or improving myelodysplastic syndrome (MDS) or leukemia in a subject. The method may include administering to a subject a composition comprising an amount sufficient to alleviate one or more symptoms of myelodysplastic syndrome (MDS) or leukemia in the subject.

[0040] In another embodiment, the antibody or antigen-binding fragment is administered to subjects having myelodysplastic syndrome (MDS) or leukemia, such as acute myeloid leukemia (AML) and acute lymphoblastic leukemia (or acute lymphoblastic leukemia, ALL).

[0041] Methods for blocking the function of SAA (e.g., SAA1) in a subject are also included in this disclosure. The method may include administering to a subject an amount sufficient to reduce or block at least one of the SAA-mediated functions in the subject, a composition comprising the antibody or its antigen-binding moiety.

[0042] This antibody, its antigen-binding portion, or this composition can be used to prevent or reduce the rate or likelihood of age-related transition from clonal hematopoiesis (ARCH) to mesenchymal diuresis (MDS), or from MDS to AML.

[0043] This method may further include administering, in addition to the antibody or a fragment thereof, a second therapeutic agent, such as a chemotherapeutic agent, an indoleamine 2,3-dioxygenase (IDO1) inhibitor, a kynurenine synthesis inhibitor, a kynurenine breakdown-promoting agent, a PD1 inhibitor, a PD-L1 inhibitor, or a combination thereof.

[0044] This antibody or its antigen-binding moiety can specifically bind to human SAA1, including recombinant human SAA1 and native human SAA1, and / or mouse SAA3.

[0045] The light or heavy chain variable region of an antibody consists of three hypervariable regions called complementarity-determining regions (CDRs). The CDRs are supported within the variable region by framework regions (FRs). In one embodiment, the heavy chain variable region (or light chain variable region) contains three CDRs and four framework regions (FRs), arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Kabat, EA, et al. Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242, 1991. Chothia, C. et al., J. Mol. Biol. 196:901-917, 1987.

[0046] Variable area and CDR The heavy chain variable region, light chain variable region, and CDR of the mouse anti-SAA1 4B10 antibody are shown below. [Table 1] [Table 2] DNA encoding HCDR1 (heavy chain CDR1): AACTATGGATTGAAC (SEQ ID NO: 3) DNA encoding HCDR2 (heavy-chain CDR2): TGGATAAACACCTACACTGGAAAGCCAACGTATGCTGATGAATTCAAGGAG (Sequence No. 4) DNA encoding HCDR3 (heavy-chain CDR3): TCCCTCCGACGGGACAGGCACTTTGACTAC (Sequence No. 5) [Table 3] [Table 4] Kabat system: HCDR1: NYGLN (SEQ ID NO: 8) HCDR2: WINTYTGKPTYADEFKE (Sequence ID 9) HCDR3: SLRRDRHFDY (Sequence ID 10) Clothia system: HCDR1: GYTFTNY (Sequence ID 11) HCDR2: NTYTGK (Sequence ID 12) HCDR3: SLRRDRHFDY (Sequence ID 13) IMGT System: HCDR1: GYTFTNYG (Sequence ID 14) HCDR2: INTYTGKP (SEQ ID NO: 15) HCDR3: AKSLRRDRHFDY (Sequence ID 16) [Table 5] [Table 6] DNA encoding LCDR1 (light chain CDR1): AAGGCCAGTCAGGATGTAGATACTGCTGTAGCC (Sequence ID 19) DNA encoding LCDR2 (light chain CDR2): TGGACATCCACCCGACACACT (Sequence ID 20) DNA encoding LCDR3 (light chain CDR3): CAGCAATTTAACACCTATCCTCTCACG (Sequence ID 21) [Table 7] [Table 8] Kabat system (Clothia system): LCDR1: KASQDVDTAVA (Sequence ID 24) LCDR2: WTSTRHT (Sequence ID 25) LCDR3: QQFNTYPLT (Sequence ID 26) IMGT System: LCDR1: QDVDTA (Sequence ID 27) LCDR2: WTS LCDR3: QQFNTYPLT (Sequence ID 29)

[0047] The heavy chain variable region, light chain variable region, and CDR of the mouse anti-SAA1 18A3 antibody are shown below. [Table 9] [Table 10] DNA encoding HCDR1: AGGTTTGGAATGCAC (SEQ ID NO: 37) DNA encoding HCDR2: TACATTAGTCGTGGCAGTACTAAAATCTACTATGCAGACACAGTGAAGGGC (Sequence ID 38) DNA encoding HCDR3: TCTTTGATCTACTATGATTACGACGGTTTTGGTTAC (SEQ ID NO: 39) [Table 11] [Table 12] HCDR1: RFGMH (Sequence ID 42) HCDR2: YISRGSTKIYYADTVKG (Sequence ID 43) HCDR3: SLIYYDYDGFGY (Sequence ID 44) [Table 13] [Table 14] DNA encoding LCDR1: AGATCTAGTCAGAGCATTGTACATAGTAATGGAAACACCTATTTAGAA (Sequence ID 47) DNA encoding LCDR2: AAAGTTTCCAACCGATTTTCT (SEQ ID NO: 48) DNA encoding LCDR3: TTTCAAGGTTCACATGTTCCTCCGACG (SEQ ID NO: 49) [Table 15] [Table 16] LCDR1: RSSQSIVHSNGNTYLE (Sequence ID 52) LCDR2: KVSNRFS (Sequence ID 53) LCDR3: FQGSHVPPT (Sequence ID 54)

[0048] In certain embodiments, the antibody or its antigen-binding moiety contains a heavy chain variable region (V) that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% identical amino acid sequence to the amino acid sequence described in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 40, or SEQ ID NO: 41. H ) includes.

[0049] In certain embodiments, the antibody or its antigen-binding moiety contains a light chain variable region (V) that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% identical amino acid sequence to the amino acid sequence described in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 50, or SEQ ID NO: 51. L ) includes.

[0050] In certain embodiments, the antibody or its antigen-binding moiety contains a heavy chain variable region (V) that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% identical amino acid sequence to the amino acid sequence described in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 40, or SEQ ID NO: 41. H ); and a light chain variable region (V) containing an amino acid sequence that is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the amino acid sequence described in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 50, or SEQ ID NO: 51 L ) includes.

[0051] The heavy chain variable region of the antibody or its antigen-binding portion (V H ) is composed of at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, and at least or about 83% of the heavy chain variable region CDR of the 4B10 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 8, 9, and 10, respectively, or CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 11, 12, and 13, respectively, or CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 14, 15, and 16, respectively. It may include one, two, three, or more complementary determination regions (CDRs) that are identical by at least or approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%.

[0052] The heavy chain variable region of the antibody or its antigen-binding portion (V H) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or It may include one, two, three, or more complementary determination regions (CDRs) that are identical by approximately 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or approximately 100%.

[0053] The variable region of the light chain of an antibody or its antigen-binding portion (V L) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or It may contain one, two, three, or more CDRs that are approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100% identical.

[0054] The variable region of the light chain of an antibody or its antigen-binding portion (V L) may contain one, two, three, or more CDRs that are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the CDRs of the light chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 52, 53, and 54, respectively).

[0055] The heavy chain variable region of this antibody or its antigen-binding portion (V H) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about It may contain one, two, three or more complementarity-determining regions (CDRs) that are identical by 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100%, and the light chain variable region (V) of the antibody or its antigen-binding moiety. L) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or It may contain one, two, three, or more CDRs that are approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100% identical.

[0056] The heavy chain variable region of this antibody or its antigen-binding portion (V H) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about It may contain one, two, three or more complementarity-determining regions (CDRs) that are identical by approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%, and the light chain variable region (V) of the antibody or its antigen-binding portion. L ) may contain one, two, three, or more CDRs that are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the CDRs of the light chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 52, 53, and 54, respectively).

[0057] The heavy chain variable region of the antibody or its antigen-binding portion (V H ) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, and less than It may include three CDRs that are identical by at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100%.

[0058] The heavy chain variable region of the antibody or its antigen-binding portion (V H) may contain three CDRs that are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the CDRs of the heavy chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 42, 43, and 44, respectively).

[0059] In one embodiment, the light chain variable region (V) of the antibody or its antigen-binding portion. L) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, Includes three CDRs that are identical by at least or approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%.

[0060] In one embodiment, the light chain variable region (V) of the antibody or its antigen-binding portion. L) includes three CDRs that are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the CDRs of the light chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 52, 53, and 54, respectively).

[0061] The heavy chain variable region of the antibody or its antigen-binding portion (V H) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about It contains three CDRs that are identical by 83%, at least or approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%, and the light chain variable region (V) of the antibody or its antigen-binding portion. L) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, Includes three CDRs that are identical by at least or approximately 84%, at least or approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%.

[0062] In one embodiment, the heavy chain variable region of the antibody or its antigen-binding portion (V H) is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about It contains three CDRs that are approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or at least 100% identical, and the light chain variable region (V) of the antibody or its antigen-binding portion. L ) includes three CDRs that are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the CDRs of the light chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 as described in SEQ ID NOs. 52, 53, and 54, respectively).

[0063] In a particular embodiment, the heavy chain variable region (V) of the antibody or its antigen-binding moiety H ) includes three CDRs that are identical to the CDRs of the heavy chain variable region of the 4B10 antibody (CDR1, CDR2, and CDR3 described in SEQ ID NOs. 8, 9, and 10, respectively, or CDR1, CDR2, and CDR3 described in SEQ ID NOs. 11, 12, and 13, respectively, or CDR1, CDR2, and CDR3 described in SEQ ID NOs. 14, 15, and 16, respectively), and the light chain variable region (V) of the antibody or its antigen-binding portion. L ) contains three CDRs that are identical to the CDRs of the light chain variable region of the 4B10 antibody (CDR1, CDR2, and CDR3 described in SEQ ID NOs. 24, 25, and 26, respectively, or CDR1, CDR2, and CDR3 described in SEQ ID NOs. 27, the WTS sequence, and SEQ ID NOs. 29, respectively).

[0064] In a particular embodiment, the heavy chain variable region (V) of the antibody or its antigen-binding moiety H ) includes three CDRs which are identical to the CDRs of the heavy chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 described in SEQ ID NOs. 42, 43, and 44, respectively), and the light chain variable region of the antibody or its antigen-binding portion (V L ) contains three CDRs that are identical to the CDRs of the light chain variable region of the 18A3 antibody (CDR1, CDR2, and CDR3 described in SEQ ID NOs. 52, 53, and 54, respectively).

[0065] This disclosure includes a heavy chain variable region ((V)) having the same amino acid sequence as the heavy chain variable region (SEQ ID NO: 7 or SEQ ID NO: 6) and light chain variable region (SEQ ID NO: 23 or SEQ ID NO: 22) of antibody 4B10, respectively, at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100%. H ) and light chain variable region (V L Antibodies containing ) are included.

[0066] This disclosure includes a heavy chain variable region ((V)) having an amino acid sequence that is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to the heavy chain variable region ((V)) of antibody 18A3. H ) and light chain variable region (V L Antibodies containing ) are included.

[0067] In related embodiments, the anti-SAA (e.g., anti-SAA1) antibody or its antigen-binding moiety includes, for example, the heavy chain variable region and / or light chain variable region CDR of antibody 4B10 or 18A3.

[0068] In one embodiment, the antibody or its antigen-binding portion contains the same heavy chain variable region and light chain variable region as the 4B10 antibody (SEQ ID NO: 7 (or SEQ ID NO: 6) and SEQ ID NO: 23 (or SEQ ID NO: 22), respectively).

[0069] In one embodiment, the antibody or its antigen-binding portion contains the same heavy chain variable region and light chain variable region as the 18A3 antibody (SEQ ID NO: 41 (or SEQ ID NO: 40) and SEQ ID NO: 51 (or SEQ ID NO: 50), respectively).

[0070] In various embodiments, the antibody or its antigen-binding moiety specifically binds to an epitope that overlaps with the epitope to which the 4B10 or 18A3 antibody binds, or is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to such an epitope. The epitope may be located within the sequence of SEQ ID NO: 30, or it may be amino acids 33-42 of SEQ ID NO: 30. The epitope may be RDMWRAYSDMC (SEQ ID NO: 32) or RDMWRAYSDM (SEQ ID NO: 33).

[0071] In certain embodiments, the antibody or its antigen-binding moiety overlaps with, or is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or It specifically binds to epitopes that are approximately 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or approximately 100% identical.

[0072] In certain embodiments, the CDR has sequence variations. For example, an antibody (or its antigen-binding moiety) that binds to an SAA (e.g., SAA1) may have CDRs in which 1, 2, 3, 4, 5, 6, 7, or 8 residues, or less than 20%, 30%, or 40% of the total residues in the CDR are substituted or deleted.

[0073] Furthermore, antibodies or their antigen-binding moieties in which specific amino acids are substituted, deleted, or added are also within the scope of this disclosure. These changes do not substantially affect the biological properties of the peptide, such as binding activity. For example, an antibody may have amino acid substitutions within its framework region to improve binding to an antigen. In another example, a select few acceptor framework residues may be substituted with corresponding donor amino acids. The donor framework may be a mature or germline human antibody framework sequence or a consensus sequence. Guidelines for methods of phenotypically silent amino acid substitutions are provided below: Bowie et al., Science, 247: 1306-1310 (1990); Cunningham et al., Science, 244: 1081-1085 (1989); Ausubel (ed.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (1994). T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory, Cold Spring Harbor, NY (1989). Pearson, Methods Mol. Biol. 243:307-31 (1994). Gonnet et al., Science 256:1443-45 (1992).

[0074] The peptide may be a functionally active variant of the antibody or its antigen-binding moiety disclosed herein, for example, with substitutions or deletions of less than or about 30%, less than or about 25%, less than or about 20%, less than or about 15%, less than or about 10%, less than or about 5%, less than or about 3%, or less than or about 1%, but retaining essentially the same immunological properties, including but not limited to binding to SAA (e.g., SAA1).

[0075] Antibodies or their antigen-binding moieties may also include variants, analogs, orthologues, homologs, and derivatives that exhibit biological activity, such as antigen binding, including SAA (e.g., SAA1). Peptides may contain one or more amino acid analogs (e.g., non-natural amino acids, amino acids naturally occurring only in unrelated biological systems, modified amino acids of mammalian origin, etc.), peptides with substitutional bonds, and other modifications known in the art.

[0076] Antibodies or their antigen-binding moieties may be derivatizable or coupled to other functional molecules. For example, an antibody can be functionally coupled to one or more other molecular entities, such as another antibody, a detectable drug, an immunosuppressant, a cytotoxic drug, a pharmaceutical product, a protein or peptide that can mediate association with another molecule (such as a streptavidin core region or polyhistidine tag), an amino acid linker, a signal sequence, an immunogenicity carrier, or a ligand useful for protein purification, such as glutathione-S-transferase, a histidine tag, and Staphylococcus protein A (by chemical coupling, gene fusion, non-covalent interactions, etc.). Cytotoxic drugs may include radioisotopes, chemotherapeutic agents, and toxins such as enzyme-active toxins derived from bacteria, fungi, plants, or animals, as well as fragments thereof. Such cytotoxic drugs can be coupled to the antibodies of this disclosure using standard procedures and can be used, for example, to treat patients for whom antibody-based therapy is indicated.

[0077] One type of derivatized protein is produced by crosslinking two or more proteins (of the same or different types). Suitable crosslinking agents include those that are heterobifunctional and have two distinct reactive groups separated by a suitable spacer (e.g., m-maleimidobenzoyl-N-hydroxysuccinimidyl) or homobifunctional (e.g., disuccinimidyl suberate). Useful detectable agents that can derivatize (or label) proteins include fluorescent agents, various enzymes, prosthetic groups, luminescent materials, bioluminescent materials, and radioactive materials. Non-limiting exemplary fluorescent detectable agents include fluorescein, fluorescein isothiocyanate, rhodamine, and phycoerythrin. Proteins or antibodies can also be derivatized with detectable enzymes, such as alkaline phosphatase, horseradish peroxidase, beta-galactosidase, acetylcholinesterase, glucose oxidase, etc. Proteins can also be derivatized with prosthetic groups (e.g., streptavidin / biotin and avidin / biotin).

[0078] In another embodiment, an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof is used unlabeled and detected by a labeled antibody that binds to the anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof.

[0079] antibody fragment Antibodies may be full-length or may consist of antibody fragments (or multiple fragments) having antigen-binding sites, and these fragments include, but are not limited to, Fab, F(ab')2, Fab', F(ab)', Fv, single-chain Fv (scFv), bivalent scFv (bi-scFv), trivalent scFv (tri-scFv), Fd, and dAb fragments (e.g., Ward et al., Nature, 341:544-546 (1989)), isolated CDRs, diabodies, triabodies, tetrabodies, linear antibodies, single-chain antibody molecules, and multispecific antibodies formed from antibody fragments. Single-chain antibodies produced by linking antibody fragments using recombinant methods or synthetic linkers are also included in this disclosure. Bird et al. Science, 1988, 242:423-426. Huston et al., Proc. Natl. Acad. Sci. USA, 1988, 85:5879-5883.

[0080] The antibody or its antigen-binding moiety may be as follows: (a) the entire immunoglobulin molecule; (b) a single-strand variable fragment (scFv); (c) a Fab fragment; (d) F(ab')2; and (e) a disulfide bond Fv. The antibody or its antigen-binding moiety may be monoclonal, polyclonal, chimeric, or humanized. The antibody may be a mouse antibody, a rabbit antibody, or a human antibody / humanized antibody.

[0081] Antibody fragments can be produced by conventional means such as enzymatic digestion or by recombinant techniques.

[0082] Papain digestion of the antibody yields two identical antigen-binding fragments, called "Fab" fragments, each possessing a single antigen-binding site, and the remaining "Fc" fragment, whose name reflects its ability to readily crystallize. Pepsin treatment yields an F(ab')2 fragment, which has two antigen-binding sites and is still capable of crosslinking antigens.

[0083] Fv is the smallest antibody fragment containing a complete antigen-binding site. In one embodiment, a double-stranded Fv species consists of a dimer of one heavy chain variable domain and one light chain variable domain that are closely associated non-covalently. In a single-stranded Fv (scFv) species, the one heavy chain variable domain and the one light chain variable domain can be covalently linked by a flexible peptide linker so that the light and heavy chains can associate in a “dimer” structure similar to that in a double-stranded Fv species. The three CDRs of each variable domain are V H -V L It is in this arrangement that the interactions determine the antigen-binding site on the surface of the dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of the Fv containing only three antigen-specific CDRs) has the ability to recognize and bind to the antigen, albeit with lower affinity than the entire binding site.

[0084] The Fab fragment contains a heavy chain variable domain and a light chain variable domain, as well as the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. The Fab' fragment differs from the Fab fragment by the addition of several residues to the carboxyl terminus of the heavy chain CH1 domain, which contains one or more cysteines from the antibody hinge region. Fab'-SH is a designation for Fab' fragments in which the cysteine ​​residue(s) of the constant domain support a free thiol group. The F(ab')2 antibody fragment was originally prepared as a pair with a Fab' fragment having a hinge cysteine ​​in between. Other chemical couplings of antibody fragments are also known.

[0085] Single-stranded Fv or scFv antibody fragments are antibodies of V H Domain and V L It is composed of domains, and these domains reside within a single polypeptide chain. Generally, scFv polypeptides are V H Domain and V LThe inclusion of a polypeptide linker between the domain and the scFv allows it to form a structure desirable for antigen binding. For an overview of scFv, see, for example, Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-Verlag, New York, 1994), pp. 269-315.

[0086] A diabody is an antibody fragment having two antigen-binding sites, and these fragments have a light chain variable domain (V) within the same polypeptide chain. L ) connected to the heavy chain variable domain (V H )(V H -V L or V L -V H ) include. Diabodies may be divalent or bispecific. Diabodies are described, for example, in European Patent No. 404,097; PCT Publication WO1993 / 01161; Hudson et al., Nat. Med. 9:129-34, 2003; and Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-8, 1993. Triabodies and tetrabodies are also described in Hudson et al., Nat. Med. 9:129-34, 2003.

[0087] Various techniques have been developed for producing antibody fragments. Traditionally, these fragments were obtained by proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., J. Biochem Biophys. Methods 24:107-17, 1992; and Brennan et al., Science 229:81-3, 1985). Fragments can also be produced by recombinant techniques. Fab, Fv, and ScFv antibody fragments can be expressed in and secreted from E. coli, allowing for easy mass production of these fragments. Antibody fragments can be isolated from antibody phage libraries. Alternatively, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments (Carter et al., Bio / Technology 10:163-7, 1992). Another approach involves directly isolating F(ab')2 fragments from recombinant host cell cultures. Fab and F(ab')2 fragments with increased in vivo half-lives containing salvage receptor-binding epitope residues are described in U.S. Patent No. 5,869,046. Other techniques for producing antibody fragments will be apparent to those skilled in the art.

[0088] The antibody or its antigen-binding moiety may include at least one constant domain, for example, (a) an IgG constant domain; (b) an IgA constant domain.

[0089] All antibody isotypes, including IgG (e.g., IgG1, IgG2, IgG3, IgG4), IgM, IgA (IgA1, IgA2), IgD, or IgE, are encompassed in this disclosure. The antibody or its antigen-binding moiety may be a mammalian (e.g., mouse, human) antibody or its antigen-binding moiety. The light chain of the antibody may be kappa-type or lambda-type. Alternative anti-SAA (e.g., anti-SAA1) antibodies may contain sequences from two or more immunoglobulin classes or isotypes, and selecting specific constant domains to optimize desired effector function is within the scope of the usual art.

[0090] The antibodies or their antigen-binding moieties of this disclosure may be monospecific, bispecific, or multispecific. Multispecific or bispecific antibodies or fragments thereof may be specific to different epitopes of one target polypeptide (e.g., SAAs such as SAA1), or may contain antigen-binding domains specific to two or more target polypeptides (e.g., antigen-binding domains specific to SAA and other antigens associated with MDS or leukemia). In one embodiment, a multispecific antibody or its antigen-binding moiety comprises at least two distinct variable domains, each variable domain capable of specifically binding to separate antigens or different epitopes on the same antigen. (Tutt et al., 1991, J. Immunol. 147:60-69; Kufer et al., 2004, Trends Biotechnol. 22:238-244). These antibodies may be ligated to or co-expressed with other functional molecules, such as other peptides or proteins. For example, an antibody or a fragment thereof can be functionally linked (e.g., by chemical coupling, gene fusion, non-covalent bonding, or other means) with one or more other molecular entities, such as other antibodies or antibody fragments, to produce a bispecific or multispecific antibody having a second binding specificity. For example, the present disclosure includes a bispecific antibody in which one arm of the immunoglobulin is specific to SAA (e.g., SAA1) and the other arm of the immunoglobulin is specific to a second therapeutic target or conjugated to a therapeutic portion.

[0091] Humanized antibodies The humanized antibodies of this disclosure are antibodies derived from non-human species, and the amino acid sequence in the non-antigen-binding region (and / or antigen-binding region) is modified so that the antibody is more similar to a human antibody and still retains its original binding ability.

[0092] In certain embodiments, the humanized antibody is a non-human antibody molecule having one, two, three, or all CDRs derived from a non-human species and one, two, three, four, or all framework regions derived from a human immunoglobulin molecule.

[0093] The CDR of this antibody or its antigen-binding moiety may be derived from non-human or human sources. The framework of this antibody or its antigen-binding moiety may be human, humanized, non-human (e.g., a mouse framework modified to reduce antigenicity in humans), or synthetic (e.g., a consensus sequence).

[0094] In one embodiment, the antibody or its antigen-binding moiety contains at least one heavy chain variable region and / or at least one light chain variable region.

[0095] The humanized antibodies described herein can be prepared by methods known in the art. For example, a humanized antibody may have one or more amino acid residues introduced into it from a non-human source. These non-human amino acid residues are often referred to as “import” residues and are typically obtained from “import” variable domains. Humanization can be carried out by substituting the hypervariable region sequence with the corresponding sequence of a human antibody, according to the methods of Winter and collaborators (Jones et al., Nature 321:522-5, 1986; Riechmann et al., Nature 332:323-7, 1988; Verhoeyen et al., Science 239:1534-6, 1988). Thus, in such a humanized antibody, a substantially smaller portion than the intact human variable domain is replaced by the corresponding sequence from the non-human species. In a particular embodiment, the humanized antibody is a human antibody in which at least some hypervariable region residues and other variable region residues are replaced with residues derived from similar sites of a non-human antibody.

[0096] The selection of both light and heavy human variable domains used to produce humanized antibodies may reduce antigenicity. Following a “best-fit” method, the sequences of variable domains from non-human (e.g., rodent such as mouse) antibodies are screened against an entire library of known human variable domain sequences. The human sequence most closely resembling the non-human antibody sequence is then adopted as the human framework for the humanized antibody. See, for example, Sims et al., J. Immunol. 151:2296-308, 1993; Chothia et al., J. Mol. Biol. 196:901-17, 1987. Another method uses a specific framework derived from the consensus sequences of all human antibodies in a particular subgroup of the light or heavy chain. The same framework may be used for several different humanized antibodies. See, for example, Carter et al., Proc. Natl. Acad. Sci. USA 89:4285-9, 1992; Presta et al., J. Immunol. 151:2623-32, 1993.

[0097] Humanized antibodies can be produced by replacing sequences in variable regions not directly involved in antigen binding with equivalent sequences derived from human variable regions. These methods involve isolating, manipulating, and expressing nucleic acid sequences encoding all or part of a variable region from at least one of the heavy or light chains. Sources of such nucleic acids are well known to those skilled in the art and can be obtained, for example, from hybridomas producing antibodies against SAA. The humanized antibody, or recombinant DNA encoding a fragment thereof, can then be cloned into a suitable expression vector.

[0098] In another example, once a non-human (e.g., mouse) antibody is obtained, the variable region can be sequenced to determine the positions of the CDRs and framework residues. Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242. Chothia, C. et al. (1987) J. Mol. Biol., 196:901-917. The light and heavy chain variable regions can optionally be ligated to the corresponding constant region. CDR-grafted antibody molecules can be prepared by CDR grafting or CDR substitution. One, two, three, or all of the CDRs in the immunoglobulin chain can be replaced. For example, all of the CDRs in a particular antibody may originate from at least some of a non-human animal (e.g., mouse, as described herein), or only some of the CDRs may be replaced. It is only necessary to retain the CDR required for antibody binding to a specific antigen (e.g., SAA1). Morrison, SL, 1985, Science, 229:1202-1207. Oi et al., 1986, BioTechniques, 4:214. U.S. Patent Nos. 5,585,089; 5,225,539; 5,693,761; and 5,693,762. EP519596. Jones et al., 1986, Nature, 321:552-525. Verhoeyan et al., 1988, Science, 239:1534. Beidler et al., 1988, J. Immunol., 141:4053-4060.

[0099] It is sometimes desirable for antibodies to be humanized while retaining high affinity for antigens and other desirable biological properties. To achieve this goal, according to one method, humanized antibodies are prepared by an analytical process of the parent sequence and various conceptual humanized products using three-dimensional models of the parent sequence and the humanized sequence. Three-dimensional immunoglobulin models are generally available and well known to those skilled in the art. Computer programs are available that illustrate and display the estimated three-dimensional conformational structures of selected candidate immunoglobulin sequences. Examination of these displays allows for the analysis of possible roles of residues in the function of the candidate immunoglobulin sequence, i.e., the analysis of residues that affect the candidate immunoglobulin's ability to bind to its antigen. In this way, by selecting and combining FR residues from the recipient sequence and the transfer sequence, desired antibody properties, such as increased affinity for the target antigen(s), can be achieved.

[0100] In some embodiments, the humanized anti-SAA (e.g., anti-SAA1) antibody also includes at least a portion of the constant region of an immunoglobulin, e.g., the constant region of a human immunoglobulin. In one embodiment, the antibody includes both the light chain and at least the variable domain of the heavy chain. The antibody may also optionally include one or more of the constant domains of the heavy chain: CH1, hinge, CH2, CH3, and / or CH4.

[0101] In some aspects of this disclosure, one or more domains of a humanized antibody are recombinantly expressed. Such recombinant expression can utilize one or more regulatory sequences, i.e., polynucleotide sequences required for the expression of a coding sequence operably linked in a particular host organism. Suitable regulatory sequences for use in prokaryotic cells include, for example, promoters, operators, and ribosome binding site sequences. Suitable eukaryotic regulatory sequences include, but are not limited to, promoters, polyadenylation signals, and enhancers. These control sequences can be used for the expression and production of humanized anti-SAA (e.g., anti-SAA1) antibodies in prokaryotic and eukaryotic host cells.

[0102] Furthermore, antibodies or their antigen-binding moieties containing one, two, or all of the CDRs disclosed herein, in which other regions are replaced by sequences derived from at least one different species, including but not limited to humans, rabbits, sheep, dogs, cats, cattle, horses, goats, pigs, monkeys, apes, gorillas, chimpanzees, ducks, geese, chickens, amphibians, reptiles, and other animals, are also included in this disclosure.

[0103] Human antibodies The human antibodies described herein can be constructed by combining Fv clone variable domain sequences (or more) selected from a human-derived phage display library with known human constant domain sequences (or more) (Hoogenboom et al., J. Mol. Biol. 227:381-8, 1992; Marks et al., J. Mol. Biol. 222:581-97, 1991). Alternatively, the human antibodies can be produced by hybridoma synthesis. Human myeloma and mouse-human heterozygous myeloma cell lines for the production of human monoclonal antibodies are described, for example, by Kozbor, J. Immunol. 133:3001-5, 1984; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al., J. Immunol. 147: 86-95, 1991.

[0104] It is possible to produce transgenic animals (e.g., mice) that can produce the entire repertoire of human antibodies upon immunization in the absence of endogenous immunoglobulin production. For example, homozygous deletion of the antibody heavy chain binding region (JH) gene in chimeric and germline mutant mice has been shown to completely inhibit endogenous antibody production. The introduction of a human germline immunoglobulin gene array into such germline mutant mice results in the production of human antibodies upon antigen challenge. See, for example, Jakobovits et al., Proc. Natl. Acad. Sci. USA 90:2551-5, 1993; Jakobovits et al., Nature 362:255-8, 1993; Bruggemann et al., Year Immunol. 7:33-40, 1993.

[0105] Gene shuffling can also be used to obtain human antibodies from non-human antibodies, such as rodent antibodies, which have similar affinity and specificity to the starting non-human antibodies. According to this method, also known as "epitope imprinting," either the heavy chain variable region or the light chain variable region of a non-human antibody fragment obtained by the phage display technique described herein is replaced with a repertoire of human V domain genes to create a non-human / human chain scFv or Fab chimeric population. Antigen-based selection leads to the isolation of the non-human / human chain chimeric scFv or Fab, which restores the antigen-binding site that was disrupted during the removal of the corresponding non-human chain in the primary phage display clone; that is, this epitope determines (imprints) the selection of the human chain partner. This process is repeated to replace the remaining non-human chain to obtain a human antibody (see PCT Publication WO93 / 06213). Unlike conventional humanization of non-human antibodies by CDR grafting, this technique provides a complete human antibody that does not contain FR or CDR residues of non-human origin.

[0106] Chimeric antibodies A chimeric antibody is a molecule in which different parts originate from different animal species. For example, an antibody may contain a variable region derived from a mouse antibody and a human immunoglobulin constant region. Chimeric antibodies can be produced by recombinant DNA techniques. Morrison, et al., Proc Natl Acad Sci, 81:6851-6855 (1984). For example, the gene encoding a mouse (or other species) monoclonal antibody molecule is digested with restriction enzymes to remove the region encoding mouse Fc and replace it with the corresponding portion of the gene encoding the human Fc constant region. Chimeric antibodies can also be produced by recombinant DNA techniques in which the DNA encoding the mouse V region can be ligated with the DNA encoding the human constant region. Better et al., Science, 1988, 240:1041-1043. Liu et al. PNAS, 1987 84:3439-3443. Liu et al., J. Immunol., 1987, 139:3521-3526. Sun et al. PNAS, 1987, 84:214-218. Nishimura et al., Canc. Res., 1987, 47:999-1005. Wood et al. Nature, 1985, 314:446-449. Shaw et al., J. Natl. Cancer Inst., 1988, 80:1553-1559. International Patent Publications WO1987002671 and WO86 / 01533. European Patent Applications Nos. 184,187; 171,496; 125,023; and 173,494. U.S. Patent No. 4,816,567.

[0107] Antibody production This disclosure provides a method for producing an antibody or its antigen-binding moiety that specifically binds to SAA (e.g., SAA1).

[0108] For example, a non-human animal is immunized with a composition containing SAA (e.g., SAA1) or a fragment thereof (e.g., a peptide), and then a specific antibody is isolated from the animal. This method may further include evaluating the binding of the antibody to SAA (e.g., SAA1).

[0109] In one embodiment, the present disclosure provides a method for producing hybridomas that express antibodies specifically binding to SAA (e.g., SAA1). The method may include the following steps: immunizing an animal with a composition comprising SAA (e.g., SAA1) or a fragment thereof; isolating splenocytes from the animal; generating hybridomas from the splenocytes; and selecting hybridomas that produce antibodies specifically binding to SAA (e.g., SAA1). Kohler and Milstein, Nature, 256: 495, 1975. Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988.

[0110] In one embodiment, mice are immunized intraperitoneally or intravenously with SAA (e.g., SAA1) or a fragment thereof. One or more boosts may or may not be given. The titer of the antibody in plasma can be monitored, for example, by ELISA (enzyme-linked immunosorbent assay) or flow cytometry. Mice with sufficient titer of anti-SAA (e.g., anti-SAA1) antibody are used for fusion. The mice may or may not have been boosted with the antigen 3 days before sacrificial death and splenectomy. Mouse splenocytes are isolated and fused to a mouse myeloma cell line using PEG. The resulting hybridomas are then screened for the production of antigen-specific antibodies. The cells are plated and then incubated in selective medium. The supernatant from individual wells is then screened by ELISA for human anti-SAA (e.g., anti-SAA1) monoclonal antibody. The antibody-secreting hybridomas are replated and screened again, and if the anti-SAA (e.g., anti-SAA1) monoclonal antibody is still positive, they can be subcloned by limiting dilution.

[0111] Adjuvants that may be used to enhance the immunogenicity of SAA (e.g., SAA1) or its fragments include any one or more agents that act to enhance the immune response to a peptide or combination of peptides. Non-limiting examples of adjuvants include alum, aluminum phosphate, aluminum hydroxide, MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), CpG-containing nucleic acids, QS21 (saponin adjuvant), MPL (monophosphoryl lipid A), 3DMPL (3-O-deacylated MPL), Aquilla extract, ISCOMS (e.g., Sjolander et al. (1998) J. Leukocyte Biol. See 64:713;WO90 / 03184;WO96 / 11711;WO00 / 48630;WO98 / 36772;WO00 / 41720;WO06 / 134423 and WO07 / 026190), LT / CT variants, poly(D,L-lactide-co-glycolide) (PLG) microparticles, QuilA, interleukin, Freund's, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP1163) 7. Examples include N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-di-aluminoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP19835A, also known as MTP-PE), and RIBI, which contains three components extracted from bacteria, namely monophosphoryl lipid A, trehalose dimicholate, and cell wall skeleton (MPL+TDM+CWS), in a 2% squalene / Tween80 emulsion.

[0112] An immunized animal is any animal capable of producing recoverable antibodies upon administration of an immunogen, including, but not limited to, rabbits, mice, rats, hamsters, goats, horses, monkeys, baboons, and humans. In one embodiment, the host is transgenic and produces human antibodies, for example, a mouse expressing a human immunoglobulin gene segment. U.S. Patents 8,236,311; 7,625,559, and 5,770,429, the disclosures of which are incorporated herein by reference in their entirety. Lonberg et al., Nature 368(6474): 856-859, 1994. Lonberg, N., Handbook of Experimental Pharmacology 113:49-101, 1994. Lonberg, N. and Huszar, D., Intern. Rev. Immunol., 13: 65-93, 1995. Harding, F. and Lonberg, N., Ann. NY Acad. Sci., 764:536-546, 1995.

[0113] The antibody or a portion thereof can be produced by host cells transformed with DNA encoding the light and heavy chains (or portions thereof) of the desired antibody. The antibody (or portion thereof) can be isolated and purified from these culture supernatants and / or cells using standard techniques. For example, host cells can be transformed with DNA encoding the light chain, heavy chain, or both of the antibody. Alternatively, recombinant DNA techniques may be used to remove at least a portion of either or both of the light and heavy chains, such as a portion or all of the DNA encoding the constant region, that is not necessary for binding.

[0114] This disclosure also includes nucleic acids or polynucleotides that encode the antibody, its antigen-binding portion, or a portion thereof. The nucleic acids may be expressed in cells to produce the antibody, its antigen-binding portion, or a portion thereof.

[0115] The nucleic acids or polynucleotides of this disclosure are at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or It may contain at least one sequence encoding the same peptide in approximately 85%, at least or approximately 86%, at least or approximately 87%, at least or approximately 88%, at least or approximately 89%, at least or approximately 90%, at least or approximately 91%, at least or approximately 92%, at least or approximately 93%, at least or approximately 94%, at least or approximately 95%, at least or approximately 96%, at least or approximately 97%, at least or approximately 98%, at least or approximately 99%, or approximately 100%.

[0116] The nucleic acids or polynucleotides of this disclosure may contain at least one sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 97%, at least 98%, at least 99%, or about 100% identical to any of the nucleotide sequences described in SEQ ID NOs. 1-5, 17-21, 35-39, and 45-49.

[0117] This disclosure also relates to the amino acid sequences described in any of SEQ ID NOs. 6-16, 22-27, 29-33, 40-44, 50-54, and the WTS sequence, and at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or The expression vector is characterized by containing at least one nucleic acid or polynucleotide encoding a peptide that is approximately 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or approximately 100% identical.

[0118] The disclosure also features an expression vector comprising at least one nucleic acid or polynucleotide having a sequence that is at least or about 70%, at least or about 75%, at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 99%, at least or about 81%, at least or about 82%, at least or about 83%, at least or about 84%, at least or about 85%, at least or about 86%, at least or about 87%, at least or about 88%, at least or about 89%, at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, at least or about 99%, or about 100% identical to any of the nucleotide sequences described in SEQ ID NOs.

[0119] Nucleic acid molecules encoding functionally active variants of the antibody or its antigen-binding moiety are also included in this disclosure. These nucleic acid molecules can hybridize with nucleic acids encoding either the antibody or its antigen-binding moiety under moderate, high, or very high stringency conditions. Guidelines for performing the hybridization reaction can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY 6.3.1–6.3.6, 1989, which is incorporated herein by reference.

[0120] The nucleic acid or polynucleotide encoding this antibody or its antigen-binding portion may be introduced into an expression vector capable of expression in a suitable expression system, and subsequently, the expressed antibody or its antigen-binding portion may be isolated or purified. Optionally, the nucleic acid encoding this antibody or its antigen-binding portion can be translated in a cell-free translation system. U.S. Patent No. 4,816,567. Queen et al., Proc Natl Acad Sci USA, 86:10029-10033 (1989).

[0121] This nucleic acid can be expressed in a variety of suitable cells, including prokaryotic and eukaryotic cells, such as bacterial cells (e.g., E. coli), yeast cells, plant cells, insect cells, and mammalian cells. Several mammalian cell lines are known in the art, including immortalized cell lines available from the American Type Culture Collection (ATCC). Non-limiting examples of cells include, but are not limited to, all cell lines of mammalian origin or mammalian characteristics, such as monkey kidney cells (COS, e.g., COS-1, COS-7), HEK293, baby hamster kidney cells (BHK, e.g., BHK21), Chinese hamster ovary (CHO), NS0, PerC6, BSC-1, human hepatocellular carcinoma cells (e.g., HepG2), SP2 / 0, HeLa, Madin-Darby bovine kidney cells (MDBK), parental cells, derivatives, and / or engineered variants of myeloma and lymphoma cells. Examples of manipulated variants include modifications to the glycan profile and / or site-specific embedded site derivatives.

[0122] This disclosure also provides cells containing the nucleic acids described herein. These cells may be hybridomas or transfectants. The antibody or its antigen-binding moiety can be expressed in a variety of cells.

[0123] For example, when the antibody or its antigen-binding moiety is produced using recombinant techniques, the antibody or moiety may be produced intracellularly, in the perimembranous space, or secreted directly into the culture medium. If the antibody is produced intracellularly, the first step may be to disrupt the cells to release the protein. Particulate debris, host cells, or lysed fragments can be removed, for example, by centrifugation or ultrafiltration. Carter et al., 1992, Bio / Technology 10:163-167 describes a procedure for isolating antibodies secreted into the perimembranous space of E. coli. Briefly, the cell paste is thawed for about 30 minutes in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF). Cell debris can be removed by centrifugation. If the antibody is secreted into the culture medium, the supernatant from such an expression system may be first concentrated using a commercially available protein concentration filter, e.g., Amicon or Millipore Pellicon ultrafiltration unit. Antibodies can be isolated from host cells using a variety of methods. Antibodies or parts thereof prepared from cells can be purified using methods such as hydroxyapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being a typical purification technique.

[0124] The suitability of Protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain present in the antibody. Protein A can be used to purify antibodies based on human gamma 1, gamma 2, or gamma quadruple chains (see, e.g., Lindmark et al., 1983 J. Immunol. Meth. 62:1-13). Protein G is recommended for all mouse isotypes and human gamma 3 (see, e.g., Guss et al., 1986 EMBO J. 5:1567-1575). The matrix to which the affinity ligand binds is most often agarose, but other matrices are also available. Mechanically stable matrices such as pore-controlled glass or poly(styrene-divinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. If the antibody contains a CH3 domain, Bakerbond ABX® resin (JTBaker, Phillipsburg, NJ) is useful for purification. Other techniques for protein purification, such as fractionation on ion-exchange columns, ethanol precipitation, reverse-phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE® chromatography on anion or cation exchange resins (e.g., polyaspartate columns), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation, are also available depending on the antibody to be recovered. After any preliminary purification step(s), the mixture containing the antibody and contaminants of interest can be subjected to low-pH hydrophobic interaction chromatography, preferably performed with a low salt concentration (e.g., about 0–0.25 M salt) using elution buffer with a pH between about 2.5 and 4.5.

[0125] Hybridomas or other cells that produce antibodies that preferably bind to SAA (e.g., SAA1) with high affinity can then be subcloned and further characterized. From each hybridoma or cell, one clone that retains the reactivity of the parent cell (by ELISA) can then be selected and used for cell banking and antibody purification.

[0126] Alternatively, this antibody or its antigen-binding moiety can be synthesized by solid-phase procedures well known in the art. Solid-phase peptide synthesis: A Practical Approach by E. Atherton and RC Sheppard, published by IRL at Oxford University Press (1989). Methods in Molecular Biology, Vol. 35: Peptide Synthesis Protocols (ed. MWPennington and BM Dunn), chapter 7. Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984). G. Barany and RB Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 1 and Vol. 2, Academic Press, New York, (1980), pp. 3-254. M. Bodansky, Principles of Peptide Synthesis, Springer-Verlag, Berlin (1984).

[0127] Additional antibodies (e.g., monoclonal, polyclonal, multispecific, or monospecific antibodies) against the SAA (e.g., SAA1) epitope recognized by 4B10 or 18A3 can be prepared, for example, using a suitable method for antibody production. In one example, the coding sequence of the epitope recognized by the 4B10 or 18A3 antibody is expressed as a C-terminal fusion with glutathione S-transferase (GST) (Smith et al., Gene 67:31-40, 1988). The fusion protein is purified on glutathione-Sepharose beads, eluted with glutathione, cleaved with thrombin (at the manipulated cleavage site), and purified for rabbit immunization. Primary immunization is performed using Freund's complete adjuvant, and subsequent immunizations are performed using Freund's incomplete adjuvant. Antibody titers are monitored by Western blotting and immunoprecipitation analysis using thrombin-cleaved protein fragments of the GST fusion protein. Immunoserum is affinity-purified using CNBr-Sepharose coupling proteins. Antiserum specificity can be determined using a panel of unrelated GST proteins.

[0128] As an alternative or co-immunogen to the GST fusion protein, peptides corresponding to the relatively intrinsic immunogenic region of the polypeptide of this disclosure can be generated and coupled to keyhole limpet hemocyanin (KLH) via introduced C-terminal lysine. Antisera for each of these peptides can be similarly affinity-purified on peptides conjugated to BSA, and their specificity can be tested by ELISA or Western blot analysis using the peptide conjugate, or by Western blot or immunoprecipitation using the polypeptide expressed as the GST fusion protein.

[0129] Alternatively, monoclonal antibodies that specifically bind to SAA (e.g., SAA1) epitopes recognized by 4B10 or 18A3 antibodies can be prepared using standard hybridoma techniques (see, for example, Kohler et al., Nature 256:495-7, 1975; Kohler et al., Eur. J. Immunol. 6:511-9, 1976; Kohler et al., Eur. J. Immunol. 6:292-5, 1976; Hammerling et al., Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981). After preparation, the monoclonal antibodies can be tested for specific recognition by Western blot analysis or immunoprecipitation analysis. Alternatively, monoclonal antibodies can be prepared using the polypeptide and phage display library described above (Vaughan et al., Nat. Biotechnol. 14:309-14, 1996).

[0130] Epitope fragments can be generated using standard techniques, for example, by cloning the fragments into a pGEX expression vector using PCR. The fusion proteins are expressed in E. coli and purified using a glutathione agarose affinity matrix. To minimize potential problems such as low antiserum affinity or specificity, two or three such fusions are generated for each protein, and each fusion is injected into at least two rabbits. Antiserum levels are elevated by a series of injections, which may include, for example, at least three booster injections.

[0131] To produce polyclonal antibodies on a large scale and at low cost, appropriate animal species can be selected. Polyclonal antibodies can be isolated, for example, from the milk or colostrum of immunized cows. Polyclonal antibodies can also be isolated from the egg yolk of immunized chickens (Sarker et al., J. Pediatr. Gastroenterol. Nutr. 32:19-25, 2001).

[0132] Assay Various methods can be used to assay antibodies or their antigen-binding moieties to confirm their specificity for a target antigen and / or to study their properties. One method for performing such assays is the serum screening assay described in U.S. Patent Publication No. 2004 / 0126829. Anti-SAA (e.g., anti-SAA1) antibodies can be characterized for binding to SAA (e.g., SAA1) by various known techniques. For example, in ELISA, a microtiter plate is coated with SAA (e.g., SAA1) or SAA (e.g., SAA1) fragments in a buffer (e.g., phosphate-buffered saline, i.e., PBS), and then blocked with an unrelated protein such as bovine serum albumin (BSA) diluted in PBS. Dilutions of mouse plasma immunized with SAA (e.g., SAA1) or SAA (e.g., SAA1) fragments (or a solution containing anti-SAA (e.g., anti-SAA1) antibodies) are added to each well and incubated. The plate is washed and then incubated with a secondary antibody conjugated with an enzyme (e.g., alkaline phosphatase). After washing, the plate is stained with the enzyme substrate (e.g., ABTS) and analyzed with a specific OD. In other embodiments, the selected monoclonal antibody can be biotinylated to determine whether it binds to a specific epitope, and this can then be detected with a streptavidin-labeled probe. Anti-SAA (e.g., anti-SAA1) antibodies can be tested for reactivity with SAA (e.g., SAA1) by Western blotting.

[0133] The antibodies, or their antigen-binding fragments, variants, or derivatives thereof, may also be described or specified in relation to their binding affinity to antigens. The affinity of an antibody to an antigen can be experimentally determined using any suitable method (see, for example, Berzofsky et al., “Antibody-Antigen Interactions,” In Fundamental Immunology, Paul, WE, Ed., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company: New York, NY (1992); and the methods described herein). The measured affinity of a particular antibody-antigen interaction may differ when measured under different conditions (e.g., salt concentration, pH). Therefore, affinity and other antigen-binding parameters (e.g., K D , K a , K d The measurement can be performed using standardized solutions of antibodies and antigens, as well as standardized buffer solutions.

[0134] This antibody or its antigen-binding moiety has a dissociation constant (K) attached to SAA (e.g., SAA1). D ) is about 10 -7 Less than M, approximately 10 -8 Less than M, approximately 9 x 10 -9 Less than M, approximately 8 x 10 -9 Less than M, approximately 7 x 10 -9 Less than M, approximately 6 x 10 -9 Less than M, approximately 5 x 10 -9 Less than M, approximately 4 x 10 -9 Less than M, approximately 3 x 10 -9 Less than M, approximately 2 x 10 -9 Less than M, approximately 1.8 × 10 -9 Less than M, approximately 1.5 × 10 -9 Less than M, approximately 1.3 × 10 -9 Less than M, approximately 1.2 × 10 -9 Less than M, approximately 10 -9 Less than M, approximately 10 -10 Less than M, approximately 10 -11 Less than M, approximately 10 -12 M, about 10-7 M to about 10 -12 M, about 10 -8 M to about 10 -11 M, about 10 -9 M to about 10 -10 M, about 10 -8 M to about 10 -12 M, specifically binds at from about 0.9 nM to about 1.2 nM, from about 0.92 nM to about 1.15 nM, about 0.9 nM, about 0.95 nM, or about 1.1 nM.

[0135] The present antibody or an antigen-binding portion thereof has about 10 -7 less than M, about 10 -8 less than M, about 9×10 -9 less than M, about 8×10 -9 less than M, about 7×10 -9 less than M, about 6×10 -9 less than M, about 5×10 -9 less than M, about 4×10 -9 less than M, about 3×10 -9 less than M, about 2×10 -9 less than M, about 10 -9 less than M, about 10 -10 less than M, about 10 -11 less than M, about 10 -12 M, about 10 -7 M to about 10 -12 M, about 10 -8 M to about 10 -11 M, about 10 -9 M to about 10 -10 M, about 10 -8 M to about 10 -12 M, specifically binds to SAA (e.g., SAA1) with a half maximal effective concentration (EC₅₀) of from about 1 nM to about 3 nM, from about 1 nM to about 2.6 nM, from about 1 nM to about 2.5 nM, from about 2 nM to about 2.6 nM, about 2.5 nM, or about 2.6 nM.

[0136] This antibody or its fragments can be administered to subjects in doses ranging from approximately 1 mg / kg body weight to approximately 50 mg / kg body weight, approximately 2 mg / kg body weight to approximately 40 mg / kg body weight, approximately 3 mg / kg body weight to approximately 30 mg / kg body weight, approximately 5 mg / kg body weight to approximately 20 mg / kg body weight, approximately 8 mg / kg body weight to approximately 13 mg / kg body weight, approximately 1 mg / kg body weight, approximately 2 mg / kg body weight, approximately 5 mg / kg body weight, approximately 10 mg / kg body weight, approximately 15 mg / kg body weight, approximately 20 mg / kg body weight, approximately 25 mg / kg body weight, approximately 30 mg / kg body weight, approximately 35 mg / kg body weight, approximately 40 mg / kg body weight, approximately 50 mg / kg body weight, approximately 60 mg / kg body weight, approximately 70 mg / kg body weight, or approximately 80 mg / kg body weight.

[0137] Conditions that warrant treatment The disclosure also includes methods for treating cancer or blood disorders in a subject, which involve administering an effective amount of an antibody or its antigen-binding portion, polypeptide, or composition to the subject.

[0138] This antibody or its antigen-binding moiety has therapeutic, prophylactic, and / or diagnostic utility in vitro and in vivo. For example, cells can be cultured in vitro in culture medium and contacted with an anti-SAA (e.g., anti-SAA1) antibody or fragment thereof. The antibody or its antigen-binding moiety can be administered to a subject as part of an in vivo (e.g., therapeutic or prophylactic) protocol. In an in vivo embodiment, the contact step is performed on the subject and includes administering the anti-SAA (e.g., anti-SAA1) antibody or moiety to the subject under conditions effective in enabling the binding of the antibody or moiety to SAA (e.g., SAA1) in the subject. The antibody or its antigen-binding moiety can be administered to treat cancer or hematological disorders.

[0139] The subjects may be human subjects with blood disorders (including hematological malignancies or blood cancers). Blood disorders may refer to abnormalities relating to hematopoietic cells (e.g., blood cells including progenitor cells and stem cells). Hematological malignancies or blood cancers may refer to malignant abnormalities relating to hematopoietic cells (e.g., blood cells including progenitor cells and stem cells). Blood cancers may refer to cancers of the blood or bone marrow.

[0140] Blood disorders may include myelodysplastic syndrome (MDS), age-related clonal hematopoiesis (ARCH), and hematological malignancies or blood cancers.

[0141] Examples of blood cancers include, but are not limited to, lymphoma, leukemia, or multiple myeloma. Examples of leukemia include acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphoblastic leukemia, and chronic lymphocytic leukemia.

[0142] Examples of blood cancers (or hematogenous cancers) include leukemia, such as acute leukemia (acute myeloid leukemia (AML), acute lymphoblastic leukemia (or acute lymphoblastic leukemia, ALL), acute myeloid leukemia, acute myeloid leukemia, and myeloblastic leukemia, promyelocytic leukemia, myelomonocytic leukemia, monocytic leukemia, and erythroleukemia, etc.), chronic leukemia (chronic myelomonocytic leukemia (CMML), chronic myeloid (granulocytic) leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia, etc.), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin lymphoma (low-grade and high-grade), multiple myeloma, Waldenström macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia, and myelodysplasia.

[0143] Blood disorders include, but are not limited to, bone marrow disorders (including myeloid malignancies), lymphoid malignancies, malignant histiocytosis, and mast cell leukemia.

[0144] In certain embodiments, myelopathy refers to a condition associated with defects in the proliferation of hematopoietic cells. In certain embodiments, myelopathy refers to clonal blood disorders affecting the myeloid blood system, including chronic and acute conditions. Examples of myelopathy include myeloproliferative neoplasms, myelodysplastic syndromes, and acute myeloid leukemia. Myeloproliferative neoplasms may be primary myelofibrosis (PMF) or essential thrombocythemia (ET). Myelodysplastic syndromes may be refractory anemia with ring sideroblasts and thrombocythemia (RARS-T). Examples of myelopathy include, but are not limited to, myeloproliferative disorders (MPD), myelodysplastic syndromes (MDS), myelodysplastic / myeloproliferative disorders (MD / MPD), and acute myeloid leukemia (AML).

[0145] In one embodiment, the leukemia is acute myeloid leukemia (AML). AML is characterized as a heterogeneous, clonal, neoplastic disease arising from transformed cells that have gradually acquired significant genetic alterations that interfere with important differentiation and proliferation regulatory pathways (Dohner et al., NEJM, (2015) 373:1136).

[0146] In some embodiments, the blood disorder is T-cell acute lymphoblastic leukemia (T-ALL) or B-cell acute lymphoblastic leukemia (B-ALL).

[0147] Lymphoid malignancies include, but are not limited to, T / NK cell tumors, B cell tumors, and Hodgkin's disease.

[0148] This antibody or its antigen-binding moiety and composition may be used to treat lymphoma. Non-exclusive examples of lymphoma include Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, and immunoproliferative disorders (e.g., Epstein-Barr virus-associated lymphoproliferative disorder). Other non-exclusive examples of lymphoma include relapsed or refractory lymphoma, B-cell lymphoma, T-cell lymphoma, follicular lymphoma, double-hit lymphoma, mature B-cell neoplasms, mature T-cell and natural killer (NK) cell neoplasms, progenitor lymphoid neoplasms, immunodeficiency-associated lymphoproliferative disorders, small lymphocytic lymphoma, and Burkitt lymphoma. Lymphoma can be low-grade, intermediate-grade, high-grade, or low-grade lymphoma.

[0149] Cancer can be blood cancer or non-blood cancer, but includes, without limitation, lung cancer, ear, nose and pharynx cancer, colorectal cancer, melanoma, pancreatic cancer, breast cancer, prostate cancer, breast cancer, ovarian cancer, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; breast cancer; cervical cancer; choriocarcinoma; colorectal cancer; connective tissue cancer; gastrointestinal cancer; endometrial cancer; esophageal cancer; eye cancer; head and neck cancer; stomach cancer; carcinoma in situ; kidney cancer; laryngeal cancer; liver cancer; fibroma, neuroblastoma; oral cancer (e.g., lips, tongue, mouth and pharynx); ovarian cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; kidney cancer; respiratory cancer; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; urinary tract cancer, as well as other carcinomas and sarcomas.

[0150] Carcinoma is a cancer of epithelial origin. The carcinomas to be treated with the methods, antibodies or their antigen-binding moieties, polypeptides, or compositions of this disclosure include, but are not limited to, acinar carcinoma, acinous carcinoma, alveolar adenocarcinoma (also known as adenocystic carcinoma, adenomyoepithelial carcinoma, cribriform carcinoma, and columnoma), adenomatous carcinoma, adenocarcinoma, carcinoma of the adrenal cortex, alveolar epithelial carcinoma, alveolar cell carcinoma (also known as bronchiolar carcinoma, alveolar epithelial cell tumor, and pulmonary adenomatosis), basal cell carcinoma, carcinoma basocellulare (also known as basaloma or basiloma, and piloma cell carcinoma), basal carcinoid, and basosquamous cell carcinoma. Carcinoma, breast cancer, bronchoalveolar carcinoma, bronchiolar carcinoma, bronchogenic lung cancer, cerebral carcinoma, cholangiocarcinoma (also called cholangiomatous and cholangiocarcinoma), choriocarcinoma, colloidal carcinoma, comedone carcinoma, body carcinoma, cribriform carcinoma, armory carcinoma, skin carcinoma, columnar carcinoma, columnar cell carcinoma, ductal carcinoma, scirrhous carcinoma, fetal carcinoma, cerebral carcinoma, supraocular carcinoma, epidermoid carcinoma, adenoid carcinoma (carcinoma epitheliate adenoids), carcinoma exulcere, fibrocarcinoma, gelatinous carcinoma, colloidal carcinoma, giant cell carcinoma, giant cell carcinoma, adenoid carcinoma, granulosa cell carcinoma, piloma carcinoma, hematological carcinoma, hepatocellular carcinoma (also called hepatocellular tumor, malignant hepatocellular carcinoma and hepatocellular carcinoma), Hürthle cell carcinoma, hyaline carcinoma, adrenal carcinoma (hypernephroid carcinoma), infant-fetal carcinoma, carcinoma in situ (carcinoma) In situ), intraepidermal carcinoma, carcinoma in situ (intraepithelial carcinoma), Crompecher carcinoma, Krutschky's cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, mastoid carcinoma, medullary carcinoma, medullary carcinoma, carcinoma melanodes, melanotic carcinoma, mucinous carcinoma, mucinous secretory carcinoma, mucocellular carcinoma (carcinoma)Mucocellular carcinoma, mucoepidermoid carcinoma, mucinoma mucosum, mucous carcinoma, myxomatous carcinoma, nasopharyngeal carcinoma, carcinoma nigrum, oat cell carcinoma, ossifying carcinoma, osteoid carcinoma, ovarian carcinoma, papillary carcinoma, periportal carcinoma, pre-invasive carcinoma, prostate carcinoma, renal cell carcinoma of the kidney (also called renal adenocarcinoma and adrenal-like carcinoma (hypemephoroid carcinoma)), preserved cell carcinoma, sarcomatoid carcinoma, scheinderian carcinoma, scirrhous carcinoma, scrotal carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, solanoid carcinoma, spheroid cell carcinoma, spindle cell carcinoma, cavernous carcinoma, squamous carcinoma, squamous cell carcinoma, string carcinoma Examples include carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, and choriocarcinoma. In preferred embodiments, the methods of the present disclosure are used to treat subjects having breast cancer, cervical cancer, ovarian cancer, prostate cancer, lung cancer, colorectal cancer, pancreatic cancer, gastric cancer, or kidney cancer.

[0151] Sarcomas are mesenchymal neoplasms that develop in bone and soft tissue. Various types of sarcomas include: liposarcoma (including myxoid liposarcoma and pleomorphic liposarcoma), leiomyosarcoma, rhabdomyosarcoma, malignant peripheral nerve sheath tumors (also called malignant schwannomas, neurofibrosarcomas, or neurogenic sarcomas), Ewing's tumors (including Ewing's sarcoma of bone, extraosseous (i.e., non-osseous) Ewing's sarcoma, and primitive neuroectodermal tumors [PNETs]), synovial sarcoma, angiosarcoma, and hemangiosarcoma. These include sarcomas, lymphangiosarcoma, Kaposi's sarcoma, hemangioendothelioma, fibrosarcoma, desmoid tumor (also known as invasive fibromatosis), dermatofibrosarcoma protuberans (DFSP), malignant fibrous histiocytoma (MFH), hemangioepoid cell tumor, malignant mesenchymal tumor, alveolar soft part sarcoma, epithelioid sarcoma, clear cell sarcoma, fibroplastic small cell tumor, gastrointestinal stromal tumor (GIST) (also known as GI stromal sarcoma), osteosarcoma (also known as osteogenic sarcoma) - skeletal and extraskeletal, and chondrosarcoma.

[0152] In another embodiment, the antibody or a fragment thereof can be used to treat various disorders associated with the expression / overexpression of SAA (e.g., SAA1).

[0153] "Disorder" can be any condition that would benefit from treatment with this antibody or a fragment thereof. This includes chronic and acute disorders or diseases, including pathological conditions that make the subject susceptible to the disorder in question.

[0154] Combination therapy The antibody or its antigen-binding moiety can be administered alone or in combination with one or more other therapies or therapeutic agents (e.g., a second therapy or therapeutic agent). In some embodiments, a pharmaceutical composition comprising an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof may further comprise a second therapeutic agent that is conjugated to or unconjugated to the antibody or the fragment. In one embodiment, the second therapeutic agent is another monoclonal or polyclonal antibody, or their antigen-binding moiety. In another embodiment, the second agent is a chemotherapeutic agent. In a third embodiment, the second agent is a cytotoxic agent or a cell proliferation inhibitor. In a fourth embodiment, the second therapy may be a bone marrow transplant or a stem cell transplant. In a fifth embodiment, the second therapy may be radiotherapy.

[0155] The second therapy or treatment agent may be an indoleamine 2,3-dioxygenase (IDO1) inhibitor. IDO1 inhibitors may be indoximod (NLG8189), epacadostat (INCB024360), navoximod (GDC-0919) (NLG919), BMS-986205, PF-06840003, linrhodostat (BMS-986205), MK7162, NLG802, LY-3381916, LPM-3480226, HTI-1090 (SHR9146), DN1406131, or KHK2455. See Tang et al. J. Hematol Oncol, 2021, 14:68 and Wang et al., Expert Opinion on Therapeutic Patents, 2022, Vol. 32, No. 11, 1145-1159.

[0156] The second therapy or treatment agent may be an agent that promotes the breakdown / cleavage / disintegration of kynurenine, or an agent that promotes a decrease in kynurenine levels, for example, kynurinase, kynureninase, kynurenine aminotransferase 1, kynurenine aminotransferase 2, and kynurenine aminotransferase 3.

[0157] The second therapy or treatment agent may be an inhibitor of kynurenine synthesis.

[0158] The second therapy or treatment agent may be a PD1 inhibitor or a PD-L1 inhibitor. PD1 inhibitors may be anti-PD1 antibodies or compounds that inhibit PD1 (e.g., small molecule inhibitors), and include, but are not limited to, pembrolizumab, nivolumab, durvalumab, semiprimab (Libtayo), tisrelizumab, cintilimab, tripalimab, and camrelizumab. PD-L1 inhibitors may be anti-PD-L1 antibodies or compounds that inhibit PD-L1 (e.g., small molecule inhibitors), and include, but are not limited to, atezolizumab and avelumab.

[0159] Such combination therapies may have additive or synergistic effects on condition parameters (e.g., symptom severity, number of symptoms, or frequency of relapses).

[0160] The anti-SAA (e.g., anti-SAA1) antibody or fragment thereof of the present invention can be administered simultaneously with a second therapy or therapeutic agent. In another specific embodiment, the second therapy or therapeutic agent is administered before or after the administration of the anti-SAA (e.g., anti-SAA1) antibody or fragment thereof.

[0161] Non-therapeutic use The antibodies described herein are useful as affinity purifiers. In this process, the antibody or a fragment thereof is immobilized on a solid phase such as a protein A resin using methods well known in the art. The immobilized antibody or a fragment thereof is brought into contact with a sample containing the SAA (e.g., SAA1) protein (or a fragment thereof) to be purified, and the support is then washed with a suitable solvent that substantially removes all material from the sample except for the SAA (e.g., SAA1) protein (or a fragment thereof) bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that releases the SAA (e.g., SAA1) protein (or a fragment thereof) from the antibody. The antibody is also useful in diagnostic assays for detecting and / or quantifying the SAA (e.g., SAA1) protein, for example, for detecting the expression of SAA (e.g., SAA1) in specific cells, tissues, or serum.

[0162] The antibodies described herein can be used in any known assay method, including competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. See, for example, Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC Press, Inc. 1987).

[0163] Pharmaceutical composition This disclosure provides compositions, such as pharmaceutical compositions, containing the antibody or its antigen-binding moiety, in combination with a pharmaceutically acceptable carrier. In another embodiment, the composition may contain an isolated nucleic acid encoding the antibody or its antigen-binding moiety, and a pharmaceutically acceptable carrier. The composition may be effective in treating cancer or hematological disorders in a subject. The composition may be effective in treating MDS or leukemia in a subject. The composition may be effective in any of the methods described herein.

[0164] Pharmaceutically acceptable carriers include any physiologically compatible suitable solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents and absorption retarders. Depending on the route of administration, the antibody (or its antigen-binding moiety(s)) may be coated with a material to protect the antibody (or its antigen-binding moiety(s)) from the action of acids and other natural conditions that may inactivate the antibody (or its antigen-binding moiety(s)). The carrier may be a solvent or dispersion containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of a surfactant. In certain embodiments, the composition may contain an isotonic agent, such as sugar, polyalcohols such as mannitol and sorbitol, or sodium chloride. Sustained absorption of an injectable composition can be achieved by including an absorption-delaying agent in the composition, such as monostearate and gelatin.

[0165] The pharmaceutical composition may contain the antibody or a fragment thereof, and optionally a second therapeutic agent described herein.

[0166] The composition may be in the form of a solution, suspension, emulsion, injection device, or delivery device for implantation, or it may be presented as a solid form (e.g., dry powder) that is reconstituted with water or another suitable vehicle before use. The composition may be in the form of an oil emulsion, water-in-oil emulsion, water-in-oil emulsion in water, site-directed emulsion, long-lasting emulsion, sticky emulsion, microemulsion, nanoemulsion, liposomes, fine particles, microspheres, nanospheres, nanoparticles, and various natural or synthetic polymers that enable sustained release of vaccines, for example, non-absorbable, impermeable polymers such as ethylene vinyl acetate copolymer and Hytrel® copolymer, swelling polymers such as hydrogels, or absorbable polymers such as collagen and certain polyacids or polyesters used to make absorbable sutures, thereby being in the form of various natural or synthetic polymers.

[0167] The composition may be in the form of pills, tablets, capsules, liquids, or sustained-release tablets for oral administration; or liquids for intravenous, intrathecal, subcutaneous, or parenteral administration; or polymers or other sustained-release vehicles for topical administration.

[0168] In one embodiment, a solution of the composition is dissolved in a pharmaceutically acceptable carrier, for example, an aqueous carrier if the composition is water-soluble. Examples of aqueous solutions include, for example, water, physiological saline, phosphate-buffered saline, Hanks' solution, Ringer's solution, dextrose / physiological saline, glucose solution, etc. The composition may contain pharmaceutically acceptable auxiliary substances such as buffers, toxicity modifiers, wetting agents, detergents, and equivalents as needed to approximate physiological conditions. Additives may also contain additional active ingredients such as bactericides or stabilizers. For example, the solution may contain sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, or triethanolamine oleate.

[0169] This disclosure allows for the use of solid formulations. Solid formulations can be formulated, for example, as pills, tablets, powders, or capsules. In the case of solid compositions, conventional solid carriers can be used, for example, those containing mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, etc. Suitable pharmaceutical excipients include, for example, starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, glycerol, propylene glycol, water, and ethanol.

[0170] Well-known methods in the art for preparing pharmaceutical formulations can be found, for example, in “Remington: The Science and Practice of Pharmacy” (20th ed., ed. AR Gennaro AR., 2000, Lippincott Williams & Wilkins, Philadelphia, PA).

[0171] In one embodiment, a pharmaceutical formulation comprising the composition of the present disclosure or a nucleic acid, polypeptide, or antibody is incorporated into a lipid monolayer or lipid bilayer, for example, a liposome. (See U.S. Patents 6,110,490; 6,096,716; 5,283,185; and 5,279,833). The embodiments of the present disclosure also provide formulations in which the water-soluble nucleic acid, peptide, or polypeptide of the present disclosure is conjugated to a monolayer or bilayer surface. For example, a peptide can be conjugated to a hydrazide-PEG-(distearoylphosphatidyl)ethanolamine-containing liposome (see, for example, Zalipsky, Bioconjug. Chem. 6: 705-708, 1995). Liposomes, or any form of lipid membrane, such as a planar lipid membrane or an intact cell, such as the cell membrane of an erythrocyte, can be used. Liposome formulations may be administered by any means, including intravenous, transdermal (see, e.g., Vutla, J. Pharm. Sci. 85: 5-8, 1996), transmucosal, or oral administration. This disclosure also provides pharmaceutical preparations in which nucleic acids, peptides, and / or polypeptides are incorporated into micelles and / or liposomes (see, e.g., Suntres, J. Pharm. Pharmacol. 46: 23-28, 1994; Woodle, Pharm. Res. 9: 260-265, 1992). Liposomes and liposome formulations can be prepared according to standard methods, which are also well known in the art. Akimaru, Cytokines Mol. Ther. 1: 197-210, 1995; Alving, Immunol. Rev. 145: 5-31, 1995. Szoka, Ann. Rev. Biophys. Bioeng. 9: 467, 1980. U.S. Patent Nos. 4,235,871; 4,501,728 and 4,837,028.

[0172] In one embodiment, the composition is prepared using a controlled-release formulation that includes a carrier, such as an implant and a microencapsulation delivery system, to protect the peptide from rapid elimination from the body. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. U.S. Patent No. 4,522,811.

[0173] The compositions of this disclosure can be administered by various methods known in the art. As will be understood by those skilled in the art, the route and / or mode of administration will vary depending on the desired outcome. Administration may be parenteral, intravenous, intrathecal, subcutaneous, oral, topical, intramuscular, intradermal, percutaneous, subdermal, rectal, spinal, or epidermal. Intravenous delivery by serial infusion is one exemplary method for administering the antibody.

[0174] To administer this drug via a specific route of administration, it may be necessary to coat the drug with a material that prevents its inactivation, or to administer the material and the drug simultaneously. For example, the drug can be administered to the target in a suitable carrier, such as a liposome or diluent. Pharmaceutically acceptable diluents include physiological saline and buffered aqueous solutions. Liposomes include water-in-oil-in-water CGF emulsions, as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7:27-41, 1984).

[0175] Parenteral administration may include, but is not limited to, methods of administration other than enteral and topical administration, usually by injection, and may include intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injections and infusions. Examples of suitable aqueous and non-aqueous carriers that may be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Appropriate fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersion, and by the use of surfactants.

[0176] Methods for preparing parenterally administered compositions are known or obvious to those skilled in the art and described in detail. Bai, J. Neuroimmunol. 80: 65-75, 1997. Warren, J. Neurol. Sci. 152: 31-38, 1997. Tonegawa, J. Exp. Med. 186: 507-515, 1997.

[0177] Parenteral formulations may contain, for example, excipients, sterile water, saline solution, polyalkylene glycols such as polyethylene glycol, plant-derived oils, or hydrogenated naphthalene. The release of the drug can be controlled using biocompatible, biodegradable lactide polymers, lactide / glycolide copolymers, or polyoxyethylene-polyoxypropylene copolymers. The in vivo distribution of the drug can be controlled using nanoparticle formulations (e.g., biodegradable nanoparticles, solid lipid nanoparticles, liposomes). Other possible useful delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, intrathecal pumps, implantable infusion systems, and liposomes. The concentration of the drug in the formulation varies depending on several factors, including the dosage of the drug administered and the route of administration.

[0178] Sterile injectable solutions can be prepared by incorporating the required amount of the drug into a suitable solvent containing, as necessary, one or a combination of the components listed above, followed by microfiltration sterilization. Generally, dispersions are prepared by incorporating the drug into a sterile vehicle containing a basic dispersion medium and other necessary components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method includes vacuum drying and freeze-drying, which yield a powder from the pre-sterile filtered solution containing the active ingredient plus any additional desired components. The dosing regimen is adjusted to provide the optimal desired response (e.g., therapeutic response). For example, a single bolus may be administered, multiple divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the urgent requirements of the treatment situation. For example, the antibody may be administered by subcutaneous injection once or twice a week, or once or twice a month.

[0179] For ease of administration and uniformity of dosage, parenteral compositions can be formulated in unit dosage forms. As used herein, a unit dosage form refers to a physically distinct unit suitable as a unit dose for treating a target; each unit contains a predetermined amount of activator, calculated to produce the desired therapeutic effect, along with the required pharmaceutical carrier.

[0180] When administered orally, this composition can be protected from digestion. This can be achieved by either conjugating the antibody or its antigen-binding portion with a composition that confers resistance to hydrolysis by acids and enzymes, or by packaging the antibody or its antigen-binding portion in a suitable resistant carrier such as a liposome. Means of protecting drugs from digestion are well known in the art. Fix, Pharm Res. 13: 1760-1764, 1996. Samanen, J. Pharm. Pharmacol. 48: 119-135, 1996. U.S. Patent No. 5,391,377.

[0181] For transmucosal or transdermal administration, penetration agents suitable for the barrier of penetration can be used in the formulation. Such penetration agents are generally known in the art and include, for example, bile salts and fusidic acid derivatives for transmucosal administration. In addition, surfactants can be used to enhance penetration. Transmucosal administration may be by the use of nasal sprays or suppositories. Sayani, Crit. Rev. Ther. Drug Carrier Syst. 13: 85-184, 1996. For topical and transdermal administration, the drug is formulated into ointments, creams, plasters, powders, and gels. Transdermal delivery systems may also include, for example, patches.

[0182] The compositions of the present invention can also be administered by a sustained delivery or sustained release mechanism. For example, biodegradable microspheres or capsules, or other biodegradable polymer structures capable of sustained delivery of peptides, can be included in the formulations of the present invention (see, for example, Putney, Nat. Biotechnol. 16: 153-157, 1998).

[0183] For inhalation, the composition can be delivered using any system known in the art, such as a dry powder aerosol, a liquid delivery system, an air jet nebulizer, or a propellant system. (Patton, Biotechniques 16: 141-143, 1998). The disclosure also allows the use of products and inhalation delivery systems for polypeptide polymers, such as those from Dura Pharmaceuticals (San Diego, Calif.), Aradigrn (Hayward, Calif.), Aerogen (Santa Clara, Calif.), and Inhale Therapeutic Systems (San Carlos, Calif.). For example, the pharmaceutical formulation can be administered in the form of an aerosol or mist. In the case of aerosol administration, the formulation can be supplied in a finely powdered form with a surfactant and a propellant. In another embodiment, the device for delivering the formulation to respiratory tissue is an inhaler from which the formulation vaporizes. Other liquid delivery systems include, for example, an air jet nebulizer.

[0184] The composition can be administered in single-dose or multi-dose therapy on a schedule and over a period of time appropriate to the age, weight and condition of the subject, the specific composition used, and the route of administration. The frequency of administration may vary depending on any of several factors, such as the severity of the symptoms, whether the composition is for preventive or therapeutic purposes, etc. For example, in one embodiment, the composition according to the present invention may be administered once a month, twice a month, three times a month, every other week (qow), once a week (qw), twice a week (biw), three times a week (tiw), four times a week, five times a week, six times a week, every other day (qod), daily (qd), twice a day (qid), or three times a day (tid).

[0185] The duration of administration of this composition, for example, the period over which the composition is administered, may vary depending on various factors, such as the subject's response. For example, the composition can be administered over periods of approximately 1 day to 1 week, 2 weeks to 4 weeks, 1 month to 2 months, 2 months to 4 months, 4 months to 6 months, 6 months to 8 months, 8 months to 1 year, 1 year to 2 years, or 2 years to 4 years, or longer.

[0186] For ease of administration and uniformity of dosage, it may be advantageous to formulate oral or parenteral compositions into unit dosage forms. As used herein, a unit dosage form refers to a physically distinct unit suitable as a unit dose for treating a target; each unit contains a predetermined amount of activator, calculated to produce the desired therapeutic effect, along with the required pharmaceutical carrier.

[0187] The actual dosage level of the active ingredient in the pharmaceutical compositions of this disclosure may be varied to obtain an amount of the active ingredient effective in achieving the desired therapeutic response for a particular patient, composition, and mode of administration without causing toxicity to the patient. The selected dosage level will depend on various pharmacokinetic factors, including the activity of the particular composition of this disclosure used, the route of administration, the time of administration, the excretion rate of the particular drug used, the duration of treatment, other drugs, agents, and / or materials used in combination with the particular composition used, the age, sex, weight, condition, overall health, and prior medical history of the patient being treated, as well as similar factors well known in the medical field. A physician or veterinarian with ordinary art skills can easily determine and prescribe the therapeutically effective dose of the required pharmaceutical composition. For example, a physician or veterinarian can start with a dose of the drug used in the pharmaceutical composition at a level lower than the level required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. Generally, a preferred daily dose of the composition is the amount of the drug that is the minimum effective dose to produce a therapeutic effect. Such an effective dose generally depends on the factors described above. If desired, the effective daily dose of the therapeutic composition may be administered separately at appropriate intervals throughout the day, in unit dosage form, as one, two, three, four, five, six, or more supplemental doses.

[0188] Data obtained from cell culture assays and animal studies can be used to determine the range of dosages for use in humans. In one embodiment, the dosage of such a drug is less or no toxic ED 50 It is within the circulating concentration range, including [specific concentration range]. The dosage may vary within this range depending on the dosage form used and the route of administration utilized. In another embodiment, the therapeutically effective dose can be initially estimated from a cell culture assay. The dose is determined by the IC2020 cell culture assay. 50Animal models can be formulated to achieve a circulating plasma concentration range that includes the concentration of the test drug that achieves median symptom inhibition (i.e., the concentration of the test drug that achieves median symptom inhibition). Sonderstrup, Springer, Sem. Immunopathol. 25: 35-45, 2003. Nikula et al., Inhal. Toxicol. 4(12): 123-53, 2000.

[0189] The exemplary, non-limiting range of therapeutic or prophylactic effective amounts of the antibody or antigen-binding moiety of this disclosure is approximately 0.001 to approximately 100 mg / kg body weight or more, approximately 0.1 to approximately 100 mg / kg body weight, approximately 0.01 to approximately 80 mg / kg body weight, approximately 0.001 to approximately 60 mg / kg body weight, approximately 0.01 to approximately 30 mg / kg body weight, approximately 0.01 to approximately 25 mg / kg body weight, approximately 0.5 to approximately 25 mg / kg body weight, approximately 0.1 to approximately 15 mg / kg body weight, approximately 0.1 to approximately 20 mg / kg body weight, and approximately 10 to approximately 20 mg / kg body weight. The dosage may be approximately 0.75 to 10 mg / kg body weight, approximately 1 to 10 mg / kg body weight, approximately 2 to 9 mg / kg body weight, approximately 1 to 2 mg / kg body weight, approximately 3 to 8 mg / kg body weight, approximately 4 to 7 mg / kg body weight, approximately 5 to 6 mg / kg body weight, approximately 8 to 13 mg / kg body weight, approximately 8.3 to 12.5 mg / kg body weight, approximately 4 to 6 mg / kg body weight, approximately 4.2 to 6.3 mg / kg body weight, approximately 1.6 to 2.5 mg / kg body weight, approximately 2 to 3 mg / kg body weight, or approximately 10 mg / kg body weight. The dosage administered to the subject may also be approximately 0.1 mg / kg to 50 mg / kg, approximately 1 mg / kg to 30 mg / kg, approximately 1 mg / kg to 20 mg / kg, approximately 1 mg / kg to 15 mg / kg, or approximately 1 mg / kg to 10 mg / kg per body weight of the subject. Exemplary doses include, but are not limited to, 1 ng / kg to 100 mg / kg. In some embodiments, the dose is approximately 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, or 16 mg / kg per body weight of the subject. WO94 / 04188.

[0190] The composition is formulated to contain an effective amount of the antibody or its antigen-binding moiety, the amount of which depends on the target and condition being treated. In one embodiment, the antibody or its antigen-binding moiety is present in amounts of approximately 0.01 mg to 10 g, approximately 0.1 mg to 9 g, approximately 1 mg to 8 g, approximately 1 mg to 7 g, approximately 5 mg to 6 g, approximately 10 mg to 5 g, approximately 20 mg to 1 g, approximately 50 mg to 800 mg, approximately 100 mg to 500 mg, approximately 0.01 mg to 10 g, approximately 0.05 μg to 1.5 mg, approximately 10 μg to approx The drug is administered in doses ranging from 1 mg of protein, approximately 30 μg to 500 μg, approximately 40 pg to 300 pg, approximately 0.1 mg to 200 mg, approximately 0.1 mg to 5 mg, approximately 5 mg to 10 mg, approximately 10 mg to 25 mg, approximately 25 mg to 50 mg, approximately 50 mg to 100 mg, approximately 100 mg to 500 mg, approximately 500 mg to 1 mg, and approximately 1 mg to 2 mg. The specific dose level for any particular subject depends on a variety of factors, including the activity of the specific peptide, age, weight, overall health, sex, diet, time of administration, route of administration, and excretion rate, drug combinations, and the severity of the specific disease being treated.

[0191] manufactured goods In another embodiment, the manufactured article includes a material useful for treating the condition or disorder described herein. The manufactured article may be a kit. The manufactured article includes a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container can be formed from a variety of materials, such as glass or plastic. The container may hold a composition effective for treating the condition and may have a sterile access port. For example, the container may be an intravenous solution bag or vial with a stopper that can be punctured by a subcutaneous needle. The activator in the composition may be an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof, or any other antibody or fragment thereof as described herein. A label on or associated with the container indicates that the composition is used to treat a selected condition. The manufactured article may further include a second container containing a pharmaceutically acceptable buffer, for example, phosphate-buffered saline, Ringer's solution, and dextrose solution. The manufactured article may further include other materials desirable from a commercial and user perspective, including other buffers, diluents, filters, needles, syringes, and accompanying documentation with instructions for use.

[0192] In one embodiment, the Disclosure provides a kit containing an anti-SAA (e.g., anti-SAA1) antibody or its antigen-binding moiety. Additional components of the kit may include one or more of the following: instructions for use, other reagents, therapeutic agents, or agents useful for labeling the antibody or coupling it to the therapeutic agent, or other materials for preparing the antibody for administration; a pharmaceutically acceptable carrier; and a device or other material for administration to a subject.

[0193] The kit may or may not contain the second therapeutic agent described herein. The agents may be mixed together in the kit or packaged separately. The kit may or may not contain at least one nucleic acid encoding an anti-SAA (e.g., anti-SAA1) antibody or a fragment thereof, and instructions for nucleic acid expression. Other possible components of the kit include expression vectors and cells.

[0194] The antibody or fragments thereof can be used in a diagnostic kit, i.e., a packaged combination of a predetermined amount of reagents and instructions for performing a diagnostic assay. If the antibody is enzyme-labeled, the kit may include the enzyme, and the substrates and cofactors required by the substrate precursor that provides a detectable chromophore or fluorophore, for example. In addition, other additives such as stabilizers and buffers (e.g., blocking buffer or lysis buffer) may be included. The relative amounts of various reagents can be widely varied to provide reagent concentrations in solution that substantially optimize the sensitivity of the assay. The reagents may be supplied as dry powders, usually lyophilized dry powders, containing excipients that provide a reagent solution with the appropriate concentration upon dissolution.

[0195] The term "therapeutic dose" refers to an amount sufficient to treat a particular disorder or disease, or to produce an alternative pharmacological response that treats the disorder or disease.

[0196] The terms “subject,” “individual,” and “patient” are used interchangeably and refer to vertebrates, preferably mammals such as humans. Mammals include, but are not limited to, human primates, non-human primates, or species of mice, cattle, horses, dogs, or felines. The antibody, its antigen-binding moiety, composition, and method can be used in subjects such as mammals and non-mammals, including vertebrates such as humans, mice, rats, guinea pigs, hamsters, dogs, cats, cattle, horses, goats, sheep, pigs, monkeys, apes, gorillas, chimpanzees, rabbits, ducks, geese, chickens, amphibians, reptiles, and other animals. In the context of this disclosure, the term “subject” also includes tissues and cells that can be cultured in vitro or ex vivo, or manipulated in vivo.

[0197] The following examples of specific ways of implementing this disclosure are provided for illustrative purposes only and are not intended to limit the scope of this disclosure. [Examples]

[0198] The inventors have recently demonstrated crosstalk between myelodysplastic syndrome (MDS) cells and acute myeloid leukemia (AML) cells and osteoblasts. In this crosstalk, malignant cells utilize kynurenine to induce a pro-inflammatory state in osteoblasts via the acute-phase protein serum amyloid A1 (SAA1). Subsequently, SAA1 increases the expression of IDO1, the rate-limiting enzyme in kynurenine synthesis, thereby strongly promoting the proliferation of MDS and AML cells, acting on MDS and AML cells in a positive feedback loop, thereby enabling the progression of MDS and AML. This pathway is independent of the mutation and cytogenetic status of either disease and shows a potent universal effect in MDS and AML. In particular, this pathway is active in CMML patient-derived samples examined by the inventors. The inventors have found that SAA1 selectively stimulates the expansion of leukemia stem cells (LSCs) by increasing proliferation and suppressing apoptosis, but does not stimulate the expansion of healthy hematopoietic stem cells (HSCs). SAA1 also selectively inhibits the differentiation of ASXL1 CRISPR-edited CD34 cells and enhances their stem cell properties.

[0199] The action of the SAA1-IDO1 axis is also related to the effect of IDO as a major immunomodulatory enzyme. IDO1 expands the immunotolerogenic environment by, among other mechanisms, expanding regulatory T cells and regulating dendritic cell (DC) plasticity, and is therefore favorable to the immunotolerogenic environment. The tumor microenvironment is a site of chronic immune activation where both immunogenic and immunotolerogenic processes are constitutively activated. Therapeutic success depends not only on killing tumor cells but also on shifting the immune balance so that a sustained immunogenic response becomes dominant. Indeed, scRNAseq in patient-derived AML cells shows that SAA1 triples the number of LSCs and doubles the number of conventional DCs (cDCs) and plasma cell-like DCs (pDCs). In particular, it also upregulates the expression of MHC class I and MHC class II antigens in LSCs, as well as the expression of antipharmacological signaling proteins such as CD47. In DCs, SAA1 upregulates the expression of IDO1.

[0200] Our research has shown that SAA1 is a novel regulator of the inflammatory response and a biomarker secreted from the BM niche that correlates with the onset of MDS and progression to AML in patients. SAA1 levels increase with age, are characteristic of MDS and AML patients regardless of disease category, increase further with progression to AML, and correlate with decreased survival. SAA1 potently promotes the proliferation of patient-derived MDS and AML cells, independently of cytogenetic or mutational profiles, without affecting the proliferation of healthy CD34+ cells from healthy, age-matched subjects.

[0201] Human SAA1 levels are higher in the bone marrow plasma of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML) patients than in healthy controls. Similarly, SAA3, a mouse ortholog of SAA1, has been found to be elevated in mouse models of leukemia and xenograft models derived from AML patients compared to non-leukemic wild-type controls or healthy CD34+ transplanted mice. SAA1 levels are strongly correlated with disease progression in MDS and AML patients.

[0202] SAA levels correlate with kynurenine levels. The inventors have elucidated the relationship between the two molecules: Kynurenine, secreted from AML cells, acts on the bone marrow (BM) niche, particularly on osteoblasts, via serotonin receptor 1b (HTR1B), inducing a pro-inflammatory environment that acts as a positive feedback loop to maintain leukemia progression. In particular, the inventors identified SAA as an osteoblast-secreted molecule that can upregulate indoleamine 2,3-dioxygenase (IDO1), the rate-limiting enzyme in kynurenine synthesis. The inventors confirmed this mechanism in vitro using mouse and human MDS and AML cell lines, and in vivo using mononuclear cells and bone marrow plasma and / or serum samples from MDS and AML patients. Furthermore, the inventors demonstrated, using a patient-derived xenograft model, that in vivo administration of SAA1 increased leukemia cell proliferation only in patient-derived leukemia cells, and not in healthy control cells isolated from PDX mice. A positive feedback mechanism in which kynurenine secreted from AML associates with and activates HTR1B induces SAA1 secretion by osteoblasts, which then upregulates IDO1 expression in AML cells, increasing the proliferation rate of AML cells and perpetuating leukemia.

[0203] Example 1: Effect of polyclonal antibody against SAA3 The inventors treated leukemia mice with a polyclonal anti-SAA3 (mouse ortholog of human SAA1) antibody (pAb) and showed that even though the pAb exhibited less than 20% SAA blocking ability, its administration reduced the leukemia burden and extended survival in the leukemia mice.

[0204] Figures 1A-1C show the inhibition of SAA3-induced NFκβ activation in RAW264.7 cells by anti-SAA3 polyclonal antibody. This assay aims to measure SAA3-induced NFκβ activation in RAW264.7 cells (mouse reporter cell line) and to evaluate the inhibitory effect of anti-SAA3 polyclonal antibody. RAW264.7-NFκB-Luc reporter cells contain a luciferase reporter gene under the control of the NFκB response element. NFκβ activation leads to luciferase production, which can be quantified by luminescence. NFκβ was activated in reporter cells using the SAA3 protein. Anti-SAA3 polyclonal antibody (pAb) may inhibit SAA3-induced NFκβ activation. Control IgG was used as a control treatment.

[0205] Specifically, Raw264.7-NFκβ-Luc cells were seeded at a density of 60,000 cells in 40 μl of medium / well (DMEM containing 10% FBS (HiMedia)) in a 96-well plate. The plate was then incubated overnight at 37°C in a 5% CO2 incubator to allow the cells to adhere.

[0206] For the untreated control (UT), 10 μL of DMEM containing 0.5% FBS was added to the well. For SAA3 treatment, 5 μL of SAA3 protein (150 ng / ml) was added to the well. For anti-SAA3 pAb pretreatment, 10 μL of anti-SAA3 polyclonal antibody was added to the well, followed by 5 μL of SAA3 protein.

[0207] This plate was incubated at 37°C for 2 hours in a 5% CO₂ incubator to allow binding between the antibody and antigen. Then, 10 μL of a viability dye (Cell Titer Fluor reagent) was added. The plate was shaken for 5 minutes, followed by incubation at 37°C for 30 minutes in a 5% CO₂ incubator. Next, luminescence was read with 7-amino-4-trifluoromethyl-coumarin (AFC) (excitation 405 nm / emission 495 to 505 nm). After 3 hours, 1:1 Bright Glo luciferase reagent (Promega) was added, the plate was shaken for 5 minutes in the dark (covered with aluminum foil), and reading was performed thereafter.

[0208] The measured luminescence values (NFκB activity) were plotted for each treatment group.

[0209] The inhibitory effect was evaluated by comparing the luminescence value of the anti-SAA3 pAb pretreatment group with that of the SAA3 treatment group.

[0210] Figure 1A shows that NFκβ activity was significantly increased in cells treated with SAA3 compared to the untreated control. Pretreatment with anti-SAA3 pAb significantly reduced SAA3-induced NFκβ activation, demonstrating that the antibody effectively inhibited the effect of SAA3.

[0211] Figures 1B to 1C show the effect of anti-SAA3 polyclonal antibody on leukemia progression and survival rate in mice injected with MLL-AF9 cells. Leukemia burden was quantified using bioluminescence imaging, and survival analysis was performed to evaluate the protective effect of antibody treatment.

[0212] Specifically, 0.2×10 6Nine MLL-AF9 dsRed cells (leukemia cells) were intravenously injected into C57BL / 6J mice, an animal model of leukemia. The mice were randomly assigned to two groups: an anti-SAA3 pAb group (mice were treated with anti-SAA3 pAb after being injected with MLL-AF9 dsRed cells) and an IgG control group (mice were treated with control IgG after being injected with MLL-AF9 dsRed cells). Either anti-SAA3 pAb or control IgG was administered intraperitoneally daily, starting 7 days after MLL-AF9 injection. D-luciferin substrate was administered intraperitoneally at a dose of 150 mg / kg body weight, followed by imaging. Leukemia progression was monitored on days 7, 14, and 15 using an IVIS spectral optical imaging system. Leukemia burden was measured by quantifying total photon flux (photons / second).

[0213] Mice were monitored daily, and their survival time was recorded. Survival curves were recorded using the Kaplan-Meier method. A log-rank test was performed to assess significance.

[0214] The total luminescence (bioluminescence) was compared between the anti-SAA3 pAb group and the IgG control group. The reduction in leukemia burden in mice treated with anti-SAA3 pAb was analyzed. Survival curves were compared between the α-SAA3 pAb and IgG control groups. The effect of anti-SAA3 pAb on the survival of MLL-AF9 injected mice was also analyzed.

[0215] In Figure 1B, total luminescence (bioluminescence) was significantly higher in the IgG control group compared to the anti-SAA3 pAb group, indicating a reduction in leukemia burden in the antibody treatment group and suggesting that anti-SAA3 pAb inhibits leukemia progression in the MLL-AF9 mouse model.

[0216] The survival curve in Figure 1C shows that survival was significantly extended in mice treated with anti-SAA3 pAb compared to the IgG control group. The difference in survival rates was statistically significant (p-value: 0.0442), demonstrating the protective effect of anti-SAA3 pAb against MLL-AF9-induced leukemia.

[0217] Example 2: Synthetic peptide immunization strategy for generating monoclonal antibodies The inventors also generated a monoclonal antibody against human SAA1. The sequence targeted by the inventors to block SAA1 function is the Ac-RDMWRAYSDMC-amide peptide. The peptide RDMWRAYSDM within the human SAA1 protein is a conserved region between mouse SAA3 and human SAA1. The inventors selected mAb clones based on their ability to specifically cross-react with human SAA1 and its mouse ortholog SAA3, thereby enabling testing of this novel mAb-based therapeutic approach in mouse models, xenografts, and patient-derived primary cells. The inventors demonstrated that the monoclonal SAA1 antibody suppressed the proliferation of primary AML cells. This approach, which targets the niche instead of malignant cells, can overcome resistance to standard of care (SOC).

[0218] Figure 2 shows that the synthetic peptide immunization strategy involves: the synthesis of a specific peptide sequence and its conjugation to a carrier protein. Mice were immunized with the peptide to generate antibodies, which were then affinity-purified.

[0219] Synthetic peptides were conjugated to carrier proteins (such as KLH or BSA) to enhance the immune response. Mice were immunized with the peptide-carrier conjugate to produce antibodies. The generated antibodies were purified using affinity chromatography, and antibodies specific to the synthetic peptides were isolated.

[0220] Example 3: Evaluation of monoclonal antibody subclones in inhibition of SAA1-induced NFκβ activation and cell viability. The inventors initiated the development of a monoclonal antibody blocking SAA1 as a means of inhibiting its potent carcinogenic effect against malignant HSCs and investigating its potential therapeutic activity. Using the RAW 264.7 NFκB-luciferase reporter cell line, 51 clones were screened for their ability to selectively block SAA1-mediated NFκB activation. After testing, seven candidate hybridomas were identified that showed a dose-dependent decrease in NFκB activity upon SAA1 challenge in unpurified supernatant. Importantly, these candidate clones were specific to SAA1 and did not affect NFκB activation mediated by lipopolysaccharide (LPS)-mediated activation. Using supernatants from further subcloning of previously selected candidates, a reduction of up to 85% in SAA1-mediated activity was observed. Furthermore, cell proliferation of SAA1-stimulated human AML cell lines (OCI-AML3) was significantly reduced in the presence of the candidate antibody, suggesting antiproliferative activity.

[0221] The efficacy of 12 monoclonal antibody subclones that inhibit SAA1-induced NFκβ activation in RAW264.7 cells and their effects on cell viability in OCI-AML3 cells were evaluated.

[0222] Figure 3A shows the relative luminescence units (RLU) against relative antibody concentration for various subclones (8G2, 3E7, 4B10, 5B2, 17E5, 18A3, 21F10). As antibody concentration increased, luminescence decreased, indicating that the inhibition of NFκβ activity was dose-dependent and specific.

[0223] Figure 3B compares the relative luminescence of monoclonal antibody supernatants at different concentrations (1×, 2×, and 4×) relative to a fixed concentration of SAA1 (150 ng / mL, Peprotech). LPS (Peprotech) was used as a positive control for NFκβ activation. Higher antibody concentrations indicate greater inhibition of luminescence and thus higher efficacy. Anti-SAA1 mAb subclones show dose-dependent inhibition.

[0224] Figure 3C shows that the two selected monoclonal clones (i.e., 4B10 and 18A3) inhibited SAA1 activity by more than 80% compared to the polyclonal antibody that inhibited SAA1 activity by less than 20%.

[0225] Figure 3D shows the viability (multiplier change) of OCI cells treated over 48 hours with the vehicle ("OCI+Veh"), SAA1 ("OCI+SAA1"), antibody alone ("OCI+Ab"), and antibody + SAA1 ("OCI+SAA1+AB"). Monoclonal antibodies 18A3 (subclone 18A3-S1-F) and 4B10 (subclone 4B10-S2-F) showed significant inhibition of SAA1-induced NFκβ activation and a decrease in cell viability in OCI cells treated with SAA1. Both subclones exhibited high specificity and efficacy, making them suitable for targeted therapy against SAA1-induced activity.

[0226] Example 4: Competitive binding assay using a reporter cell line. Using a competitive binding assay, the concentration of a specific antibody in a sample (e.g., 18A3-S1-F) can be quantified by utilizing the competition for binding to an antibody between a fixed-concentration antigen (e.g., SAA1 antigen, fixed at 150 ng / mL) and competing antigens of varying concentrations (e.g., a competing peptide whose concentration ranges from 80 nM to 0.625 nM). This assay was also used to determine the antibody's dissociation constant (Kd). In the following assays, a reporter cell line is used to measure the resulting cellular response, which reflects the binding activity.

[0227] Competitive antigen standard solutions were prepared at the following concentrations: 80 nM, 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, and 0.625 nM.

[0228] Raw264.7-NFκβ-Luc cells were seeded at a density of 60,000 cells per well into 40 μl of medium per well in 96-well plates. The plate was placed overnight at 37°C in a 5% CO2 incubator to allow the cells to adhere. 5 μL of SAA1 antigen solution (150 ng / mL) was added to each well. 10 μL of competitive antigen standard solution was added to each well. 10 μL of purified antibody (18A3-S1-F) solution was added to each well.

[0229] The plate was incubated at 37°C for 2 hours in a 5% CO2 incubator to allow binding of the antibody to the antigen. 10 μL of viability dye (i.e., Cell Titer Fluor Reagent; Promega) was added, the plate was shaken for 5 minutes, and incubated at 37°C for 30 minutes in a 5% CO2 incubator. Luminescence readings were then performed with 7-amino-4-trifluoromethyl-coumarin (AFC) (excitation 405 nm / emission 495 to 505 nm). After 3 hours, 1:1 Bright Glo Luciferase Reagent (Promega) was added, the plate was shaken for 5 minutes in the dark (covered with foil), and readings were then taken.

[0230] The experimental groups include the following: 1. Empty wells 2. Medium only 3. Untreated cells 4. Cells treated with SAA1 only 5. Cells treated with SAA1 and antibody 6. Cells treated with SAA1 and treated with increasing concentrations of competing peptide.

[0231] The measured luminescence (NFκβ activity) was plotted against the concentration of the competitive antigen standard solution. A standard curve was generated, and linear regression analysis was performed to obtain the equation of the straight line (y=mx+b).

[0232] Using this equation, the luminescence value was substituted into the equation and solved for x to determine the concentration of antibody in the sample.

[0233] Figure 4A shows that cell viability was not significantly affected by the addition of the reagents, and that the purified antibody was not cytotoxic.

[0234] Figure 4B shows that the antibody was blocked by an 80 nM peptide, resulting in high NFκβ activity. At low concentrations of the peptide, the antibody was able to suppress SAA1-induced NFκβ activity. TMVAD and unrelated peptides did not result in a decrease in NFκβ activity.

[0235] Figures 4C and 4D show the luminescence response plotted against the concentration of the competing peptide. The antibody concentration is given by a linear equation.

number

[0236] The dissociation constant (Kd) was calculated from the competitive binding curve (Figure 4E). A lower Kd value indicates higher antibody binding affinity. The Kd values ​​ranged from approximately 0.9398 nM to 1.119 nM, indicating strong binding affinity.

[0237] Example 5: Determination of EC50 for 18A3 antibody using NFκβ reporter assay. The half-effect concentration (EC50) of the 18A3-S1 antibody was determined using a reporter assay. This was done by measuring the inhibition of SAA1-induced NFκB activation at various antibody dilutions.

[0238] 5 μL of SAA1 antigen solution (150 ng / mL) was added to each well. 10 μL of 18A3-S1 antibody, diluted in various ratios from 1 to 1:10000, was added to each well.

[0239] The LogEC50 value was determined from the dose-response curve, which indicates the concentration at which the antibody achieves half-inhibition of NFκB activity. The EC50 of the 18A3-S1 antibody was calculated to be 2.548 nM (Figure 4F), which indicates the concentration at which the antibody achieves half-inhibition of SAA1-induced NFκB activation. A low EC50 value suggests that the 18A3-S1 antibody is highly effective in inhibiting NFκB activation, making it a potent SAA1 blocker.

[0240] Example 6: Inhibition of SAA1-induced proliferation in cancer cell lines by anti-SAA1 antibody. To evaluate whether SAA1 induces proliferation in different cancer cell lines, an EdU (5-ethynyl-2'-deoxyuridine) uptake assay was performed. This assay allows for the evaluation of cell proliferation in response to SAA1 treatment and antibody intervention by measuring the uptake of the nucleoside analog EdU into newly synthesized DNA.

[0241] CUTLL1, CEM, Jurkat, Nalm6, REH, 697, BXPC3, HPAC, and PANC1 are cancer cell lines. Of these, CUTLL1, CEM, and Jurkat are T-cell acute lymphoblastic leukemia (T-ALL) cell lines; Nalm6, REH, and 697 are B-cell acute lymphoblastic leukemia (B-ALL) cell lines.

[0242] Cancer cells were seeded at a rate of 20,000 cells per well in 96-well plates. CUTLL1, CEM, Jurkat, Nalm6, REH, and 697 cell lines were cultured in RPMI medium supplemented with 0.5% FBS. BXPC3, HPAC, and PANC1 cell lines were cultured in DMEM medium supplemented with 0.5% FBS. These plates were incubated overnight at 37°C in a 5% CO2 incubator to allow cell adhesion.

[0243] Cells were treated with SAA1 protein (5 μg / ml) for 48 hours to induce proliferation. These cells were then treated with either purified 18A3 antibody (1:1000) or PAP Fx7 (18A3 antibody purified from subclonal supernatant using the Protein A purification kit (Invitrogen)) to evaluate their inhibitory effects on SAA1-induced proliferation. For comparison, untreated (UT) controls and SAA1-only controls were included.

[0244] 100 μl of EdU (10 μM) was added to each well to label the newly synthesized DNA. The plate was incubated for 3 hours to incorporate the EdU. The wells were then washed with PBS.

[0245] Cells were fixed with 4% paraformaldehyde (PFA), permeabilized with 0.1% Triton, and washed with PBS. 100 μl of Click-iT® EdU HCS assay cocktail (Invitrogen) was added and incubated for 30 minutes. Cells were washed with PBS. 100 μl of HCS nuclear mask was added and incubated at room temperature for 30 minutes. Cells were washed with PBS and then resuspended in PBS.

[0246] The number of EdU-positive cells was measured using a fluorescence microscope or a high-content imaging system.

[0247] Figure 5A shows the frequency of EdU-positive cells (indicating proliferating cells) across various T-ALL (CUTLL1, CEM, Jurkat) and B-ALL (Nalm6, REH, 697) cell lines. Treatment with purified 18A3 antibody reduced the frequency of EdU-positive cells across all leukemia cell lines, demonstrating inhibition of SAA1-induced proliferation.

[0248] Figure 5B shows the frequency of EdU-positive cells in pancreatic cancer cell lines (BXPC3, HPAC, PANC1) in response to SAA1 treatment. Similar to the results in T-ALL and B-ALL cells, treatment with purified 18A3 antibody inhibited SAA1-induced proliferation in pancreatic cancer cell lines.

[0249] SAA1 treatment resulted in increased proliferation in various cancer cell lines, including T-ALL, B-ALL, and pancreatic cancer cell lines. Purified 18A3 antibody effectively inhibited SAA1-induced proliferation in all cell lines tested.

[0250] Example 7 Targeting SAA1 to reduce MDS progression Primary co-cultures of osteoblasts and hemoglobin stem cells (HSCs) are established using mesenchymal stem cells (MSCs) and patient bone marrow mononuclear cells (BM-MNCs). Experiments are performed using MSCs and BM-MNCs derived from MDS patients, as well as co-cultures of osteoblasts with TET2 and DNMT3A mutant CD34+ stem cells. Replicated samples are treated with SAA1 and then with either anti-SAA1 antibody or a control vehicle. Proliferation, apoptosis, and differentiation rates into myeloid and erythroid lines are evaluated. The inventors investigate changes in cell clonality using whole exome sequencing (WES), track changes in the mutation status of dominant clones in each population, and compare clonal differences between co-cultures treated with anti-SAA1 antibody and untreated co-cultures. Cells are fixed, stained with erythroid and myeloid markers, and off-target effects on these cell lines are evaluated compared to untreated cells using an in-house Incell Analyzer. The effects of each antibody on differentiation into erythrocytes and myeloid cells will be tested at various concentrations to establish the maximum ex vivo tolerated dose (MTD) for further testing.

[0251] Experimental materials and methods mouse Wild-type (WT) C57BL / 6J (IMSR catalog number JAX:000664, RRID:IMSR_JAX:000664) mice were purchased from Jackson Laboratories. All other animals used in the study were bred in the inventors' mouse facility, maintained in a C57BL / 6J background, and used between 8 and 10 weeks of age. Male and female mice were used without distinction.

[0252] Cell lines and primary cell cultures OCI-AML3 cells (DSMZ catalog number ACC-582, RRID: CVCL_1844) were obtained from the DSMZ repository.

[0253] OCI-AML3 cells and primary human osteoblasts were grown in MEM-Alpha 1× (Corning). Primary human osteoblasts, OCI-AML3, and HL-60 cells requiring 20%, 1% GlutaMAX (Gibco), and 1% antibiotic-antifungal agent (Corning) were excluded. All media were supplemented with 10% FBS (Gibco) and cultured at 37°C under 5% CO2.

[0254] Primary MLL / AF9 cells were maintained in StemSpan medium (StemCell Technologies) containing mGM-CSF (10 ng / ml), mSCF (25 ng / ml), mRNA-6 (25 ng / ml), mRNA-3 (10 ng / ml), mTPO (25 ng / ml) (Prepotech), and 1% P / S.

[0255] Evaluation of leukemia progression in a leukemia syngeneic mouse model and in vivo. All leukemia models were introduced intravenously (IV) and transplanted into non-irradiated secondary recipient experimental animals. MLL / AF9-dsRed leukemia model (0.2 × 10⁻¹⁰) 6 C57BL / 6J mice were used for the cell / mouse study. Leukemia progression was assessed by fluorescence (MLL / AF9 dsred) using the IVIS-Spectrum optical imaging system (Caliper, Perkin Elmer). Mice were shaved to reduce light attenuation.

[0256] Immunofluorescence staining Histology: After excision, the spleen and liver were fixed overnight in 4% PFA, washed with PBS, and held in a 30% sucrose gradient for at least 16 hours before OCT. For bone, decalcification was performed in 14% EDTA pH 7 for 7 days, followed by fixation for 72 hours, then sucrose gradient and OCT embedding. All tissues were cut using a Leyca cryostat, dried at room temperature, and stored at -80°C. Sections were rehydrated in PBS for 10 minutes and stained with DAPI. Cells: Osteoblasts were grown and differentiated on 12 mm coverslips, exposed to OCI-AML3 cell-derived conditioned medium in a 1:10 ratio for 30-60 minutes, fixed with 4% PFA at room temperature for 15 minutes, permeabilized at room temperature for 15 minutes (PBS, 0.3% Triton X-100), blocked (PBS, 5% donkey normal serum, 0.3% Triton X-100), and stained overnight at 4°C with p65 (Cell Signaling Technology catalog number 8242, RRID: AB_10859369) and DAPI (nucleus). Slides were mounted with Prolong Gold (Invitrogen) mounting medium to prevent discoloration, and images were acquired with a Zeiss LSM710 confocal microscope. Images were analyzed using ImageJ software (RRID: SCR_003070).

[0257] Specific embodiments of the present invention are described and illustrated, but such embodiments should be considered only as examples of the present invention and not as limiting the invention as interpreted in accordance with the appended claims. All publications and patent applications referenced herein are incorporated herein by reference in whole for all purposes as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference for all purposes. Although the invention described herein in some detail with illustrations and examples for clarity of understanding, it will be readily apparent to those skilled in the art that certain changes and modifications can be made thereto without departing from the spirit and scope of the appended claims, in light of the teachings of the present invention.

Claims

1. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ ) and light chain variable region (V Ｌ The anti-SAA antibody, or its antigen-binding moiety, comprises the following: the heavy chain variable region comprises three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 8, 9, and 10, or SEQ ID NOs. 42, 43, and 44, respectively; and the light chain variable region comprises three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54, respectively.

2. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ The anti-SAA antibody, or its antigen-binding moiety, comprises the heavy chain variable region, wherein the heavy chain variable region comprises three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 8, 9, and 10, or SEQ ID NOs. 42, 43, and 44, respectively.

3. Anti-SAA antibody, or its antigen-binding portion, wherein the light chain variable region (V Ｌ The anti-SAA antibody, or its antigen-binding moiety, comprises the light chain variable region having three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54, respectively.

4. An antibody or antigen-binding portion according to any one of claims 1 to 3, wherein the dissociation constant (K) of the antibody or antigen-binding portion Ｄ ) is approximately 2 x 10 －９ The antibody or its antigen-binding portion, which is less than M.

5. The heavy chain variable region (V Ｈ ) contains an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in Sequence ID No. 6, 7, 40, or 41, and the light chain variable region (V Ｌ The antibody or antigen-binding moiety according to any one of claims 1 to 4, wherein the moiety comprises an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 22, 23, 50, or 51.

6. Said heavy chain variable region (V Ｈ ) comprises an amino acid sequence that is about 80% to about 100% identical to the amino acid sequence set forth in SEQ ID NO: 6, 7, 40 or 41, the antibody or antigen-binding portion thereof according to any one of claims 1 to 3.

7. The light chain variable region (V Ｌ The antibody or antigen-binding moiety according to any one of claims 1 to 3, wherein the moiety comprises an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 22, 23, 50, or 51.

8. An antibody or antigen-binding portion according to any one of claims 1 to 7, wherein the antibody or antigen-binding portion is selected from the group consisting of (a) the entire immunoglobulin molecule; (b) scFv; (c) Fab fragment; (d) F(ab')2; and (e) disulfide bond Fv.

9. An antibody or antigen-binding moiety according to any one of claims 1 to 8, comprising at least one constant domain selected from the group consisting of a) an IgG constant domain and (b) an IgA constant domain.

10. An antibody or its antigen-binding portion according to any one of claims 1 to 9, comprising at least one human constant domain.

11. An antibody or antigen-binding portion according to any one of claims 1 to 10, wherein the antibody or antigen-binding portion binds to a peptide having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NO: 32, 33, or 34.

12. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ The anti-SAA antibody, or its antigen-binding portion, comprising, wherein the heavy chain variable region contains an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs: 6, 7, 40, or 41.

13. Anti-SAA antibody, or its antigen-binding portion, wherein the light chain variable region (V Ｌ The antibody or its antigen-binding portion, comprising, wherein the light chain variable region contains an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 22, 23, 50, or 51.

14. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ ) and light chain variable region (V Ｌ The anti-SAA antibody, or its antigen-binding moiety, comprising, wherein the heavy chain variable region comprises an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NO: 6, 7, 40, or 41, and the light chain variable region comprises an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NO: 22, 23, 50, or 51.

15. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ ) and light chain variable region (V Ｌ The anti-SAA antibody, or its antigen-binding moiety, comprising, the heavy chain variable region comprising three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, each encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequence described in SEQ ID NOs. 3, 4, and 5, or SEQ ID NOs. 37, 38, and 39, respectively, and the light chain variable region comprising three CDRs, namely CDR1, CDR2, and CDR3, each encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequence described in SEQ ID NOs. 19, 20, and 21, or SEQ ID NOs. 47, 48, and 49, respectively.

16. Anti-SAA antibody, or its antigen-binding portion, wherein the heavy chain variable region (V Ｈ ) and light chain variable region (V Ｌ The anti-SAA antibody, or its antigen-binding moiety, comprising, wherein the heavy chain variable region is encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequence described in SEQ ID NO: 1, 2, 35, or 36, and the light chain variable region is encoded by a nucleotide sequence that is approximately 80% to approximately 100% identical to the nucleotide sequence described in SEQ ID NO: 17, 18, 45, or 46.

17. The antibody or its antigen-binding portion according to any one of claims 1 to 16, wherein the SAA is human SAA1 or mouse SAA3.

18. An antibody or its antigen-binding portion according to any one of claims 1 to 17, wherein the antibody or its antigen-binding portion is humanized or chimeric.

19. An isolated polypeptide comprising an antibody or its antigen-binding moiety according to any one of claims 1 to 18.

20. A composition comprising an antibody or its antigen-binding moiety according to any one of claims 1 to 18, and at least one pharmaceutically acceptable carrier.

21. A polypeptide encoding an antibody or its antigen-binding portion according to any one of claims 1 to 18.

22. A vector comprising the polynucleotide described in claim 21.

23. A cell comprising the vector according to claim 22.

24. A method for treating cancer or a blood disorder in a subject, comprising administering to the subject an effective amount of an antibody or antigen-binding portion thereof according to any one of claims 1 to 18, a polypeptide according to claim 19, or a composition according to claim 20.

25. The method according to claim 24, wherein the blood disorder is acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia (CMML), or acute lymphoblastic leukemia (ALL).

26. The method according to claim 24, wherein the cancer is pancreatic cancer, lung cancer, liver cancer, breast cancer, or colon cancer.

27. The method according to any one of claims 24 to 26, wherein the subject is a human.

28. The method according to any one of claims 24 to 27, wherein the administration is parenteral, intravenous, subcutaneous, intramuscular, transdermal, oral, topical, intrathecal, or topical.

29. The method according to any one of claims 24 to 28, further comprising administering to the subject a chemotherapeutic agent, an indoleamine 2,3-dioxygenase (IDO1) inhibitor, a kynurenine synthesis inhibitor, a kynurenine breakdown promoting agent, a PD1 inhibitor, a PD-L1 inhibitor, or a combination thereof.

30. The anti-SAA1 antibody or its antigen-binding portion, which binds to a linear amino acid sequence epitope containing the amino acid sequence described in SEQ ID NO:

33.

31. The anti-SAA1 antibody according to claim 30, or the antigen-binding moiety thereof, comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 8, 9, and 10, or SEQ ID NOs. 42, 43, and 44, respectively, and the light chain variable region comprises three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54, respectively.

32. A method for treating myelodysplastic syndrome or acute myeloid leukemia in a subject, comprising administering a therapeutically effective amount of an anti-SAA1 antibody or its antigen-binding portion to the subject, wherein the anti-SAA1 antibody or its antigen-binding portion binds to a linear amino acid sequence epitope containing the amino acid sequence described in SEQ ID NO:

33.

33. The method according to claim 32, wherein the anti-SAA1 antibody or its antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 8, 9, and 10, or SEQ ID NOs. 42, 43, and 44, respectively, and the light chain variable region comprises three CDRs, namely CDR1, CDR2, and CDR3, each having an amino acid sequence that is approximately 80% to approximately 100% identical to the amino acid sequence described in SEQ ID NOs. 24, 25, and 26, or SEQ ID NOs. 52, 53, and 54, respectively.

Images