Non-systemic mRNA administration

Abstract

This invention relates to compositions intended for local delivery within a subject's body. More specifically, this invention relates to therapeutic compositions that remain locally in a specific organ or tissue and do not exhibit systemic distribution. These compositions include specific carriers and therapeutic agents suitable for various medical applications.

Description

[Background technology]

[0001] This invention relates to compositions designed for local delivery within the body of a subject. More specifically, this invention relates to therapeutic compositions that are localized to specific organs or tissues and do not exhibit systemic distribution. These compositions comprise specific carriers and therapeutic agents suitable for various medical applications and can be used for the prevention and / or treatment of medical conditions. Background of the Invention

[0002] Local delivery of therapeutic agents to specific tissues, organs, or sites of interest is desirable in the treatment of local diseases and conditions. Systemic administration of therapeutic agents can cause undesirable side effects and off-target effects. Therefore, there is a need for compositions that can deliver therapeutic agents specifically to local sites without systemic distribution. [Overview of the Initiative]

[0003] This invention provides a composition for delivery of therapeutic agents that does not diffuse into the systemic circulation. This is particularly important in the treatment of tumors and autoimmune diseases, as drug substances can cause serious "off-target" adverse effects if they diffuse into the circulation.

[0004] The present invention (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) Helper lipids and (iii) one or more pharmaceutically acceptable excipients or diluents as needed, The present invention provides a carrier comprising a composition for local delivery to an organ or tissue, or a local site of interest.

[0005] Therefore, the present invention provides a (pharmaceutical) composition particularly useful for the local administration of one or more therapeutic agents, because the composition (or preferably at least the therapeutic agent) remains localized at the administration site.

[0006] Therefore, the present invention provides a (pharmaceutical) composition for use in the treatment and / or prevention of a disease or disorder, the treatment comprising topical administration of the composition, (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients and / or diluents as needed, A carrier equipped with, The composition remains localized at the administration site and / or does not exhibit systemic distribution throughout the patient's body.

[0007] The (pharmaceutical) compositions provided herein are particularly useful for the topical administration of one or more therapeutic agents, and the composition (or preferably at least the therapeutic agent) has extended retention at the administration site (compared to prior art compositions, such as the DLin-MC3-DMA composition disclosed in U.S. Patent No. 8,158,601).

[0008] In the context of the present invention, extended retention at the administration site may result in the therapeutic agent exerting its (therapeutic) effect (primarily, primarily, or almost exclusively) at the administration site. This may be desirable, as it can reduce off-target effects (i.e., side effects) and the amount of therapeutic agent and / or (pharmaceutical) composition required.

[0009] Therefore, the present invention provides a (pharmaceutical) composition for use in the treatment and / or prevention of a disease, the treatment comprising topical administration of the composition, (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients and / or diluents as needed, A carrier equipped with, The composition has extended retention at the injection site, and / or, Therapeutic agents exert their effects at the injection site through prolonged retention there.

[0010] As described above, the (pharmaceutical) compositions provided herein are particularly useful for the local administration / localized administration / localized delivery / localized delivery of one or more therapeutic agents, and can reduce the amount of therapeutic agent and / or (pharmaceutical) composition used / administered while achieving equivalent therapeutic effects compared to the same therapeutic agent formulated in a composition that does not have extended retention at the administration site. In the context of the present invention, reducing the amount of therapeutic agent and / or (pharmaceutical) composition may be desirable in order to limit the possibility of side effects.

[0011] Therefore, the present invention provides a (pharmaceutical) composition for use in the treatment and / or prevention of a disease, the treatment comprising topical administration of the composition, (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients and / or diluents as needed, A carrier equipped with, equipped with.

[0012] Compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site, the dosage of the composition or therapeutic agent is reduced and / or to achieve equivalent therapeutic effects.

[0013] Compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the injection site, patients experience fewer (or milder) side effects.

[0014] The present invention also relates to cosmetic compositions that have or exhibit local retention, extended retention, etc., at the administration site, application site, etc. In this context, only the entire cosmetic composition or a part thereof may exhibit local retention, etc. Here, it is preferable that at least one or more active ingredients are retained locally.

[0015] Therefore, the present invention further, (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients and / or diluents as needed, A carrier equipped with, We provide cosmetic compositions.

[0016] The cosmetic composition may be an ointment, cream, foam, gel, lotion, aqueous liquid, or powder, or

[0017] Alternatively, the cosmetic composition may be formulated as an ointment, cream, foam, gel, lotion, aqueous liquid, or powder.

[0018] The inventors have surprisingly found that the ionizable lipids and / or ionizable lipidoids contained in the pharmaceutical or cosmetic compositions provided herein remain essentially local after the composition (or at least the therapeutic agent or active ingredient; hereinafter collectively referred to as the "agent") is administered / applied to a local site. This was unforeseen and, as previously described, has other dramatic and advantageous effects on the amount of composition to be administered, potential side effects, etc. Therefore, the compositions provided herein are particularly advantageous and lead to new clinical situations, for example, by reducing the amount of agent used.

[0019] This invention is based on the finding that the various ionizable lipids / ionizable lipidoids used herein remain localized at the administration site, and represents a significant advance in the field of lipid nanoparticle (LNP) technology. Local or targeted retention of these ionizable lipids at the administration / injection site addresses one of the key challenges associated with LNP-based drug delivery systems, namely the risk of complement system activation-related pseudoallergy (CARPA).

[0020] CARPA is a non-IgE-dependent hypersensitivity reaction (i.e., an immune response independent of immunoglobulin E (IgE)) that can occur during systemic distribution of LNPs, triggered by unintended activation of the complement system (see, for example, Ferraresso et al., 2014, Molecular Therapy: Methods & Clinical Development (2024), doi:https: / / do(i)org / 10.1016 / j.omtm.2024.101314). This reaction can cause a range of adverse effects, from mild symptoms to severe anaphylactic-like reactions, thus posing a risk to patient safety. By ensuring that the ionizable lipids / ionizable lipidoids and associated LNPs / related compositions used here remain at the injection site, the complement system's exposure to these particles is significantly reduced, minimizing the risk of systemic complement system activation and subsequent CARPA development. Therefore, the compositions for the treatment and / or prevention of diseases or disorders provided in the present invention are particularly advantageous in that they reduce side effects (e.g., symptoms related to or caused by CARPA and / or CARPA) that may occur when a composition that does not contain the (advantageous) ionizable lipids / lipidoids used herein (i.e., a composition that does not exhibit local retention at the administration site) is administered.

[0021] The use of formulations or compositions (e.g., pharmaceutical or cosmetic compositions) containing ionizable lipids / ionizable lipidoids as used herein enables targeted local delivery of the agent (e.g., therapeutic agent or active ingredient). This not only enhances the efficacy of these agents (or drugs) by concentrating them at the desired administration / action site, but also reduces the likelihood of adverse immune responses (e.g., CARPA) that may occur due to the widespread distribution of LNPs throughout the body.

[0022] In summary, the ionizable lipids / lipidoids used here, when incorporated into compositions (e.g., LNPs or pharmaceutical formulations), provide a reliable approach to reducing the risk of undesirable side effects (e.g., CARPA) by limiting systemic exposure of the complement system to LNPs, for example. This innovation improves the safety profile of LNP-based therapies, making them more suitable for broader clinical applications, particularly in patients with (high) sensitivity to hypersensitivity reactions.

[0023] This invention solves a long-standing problem, at least in the field of lipid nanoparticle (LNP) technology, by providing an innovative approach to drug delivery through local retention of ionizable lipids at the injection site. The invention's unique ability to limit the presence of lipids to the injection site represents a significant advance that has not been previously recognized or addressed. This local retention effect is crucial for enhancing the safety and efficacy of LNP-based therapies, ensuring that therapeutic agents remain concentrated at the desired site of action, and minimizing systemic exposure and potential side effects. This innovation fills a critical gap in the development of targeted and safe drug delivery systems.

[0024] The attached examples illustrate in detail the local retention of therapeutic agents / activators / active ingredients. In particular, Example 1 exemplifies that intramuscular injection of a composition containing an ionizable lipidoid according to the present invention and further containing chemically modified RNA encoding the luciferase gene results in luciferase expression being localized only to the administration site (see, for example, Figures 2-4). The inventors hypothesized that the compositions provided herein interact with the extracellular matrix and therefore co-administered the compositions according to the present invention with hyaluronidase (also referred herein as Hylase, an enzyme that degrades hyaluronic acid in the extracellular matrix). Figure 6 clearly shows that co-administration with hyaluronidase increases the distribution of luciferase expression, which indicates a loss or reduction of local retention compared to Figure 5 (without co-administration of hyaluronidase). A comparison of Figures 7 and 8 (i.e., evaluation of luciferase activity in organs extracted from mice shown in Figures 5 and 6) further supports these results, indicating that the compositions provided herein interact with the extracellular matrix, thereby being locally retained. While not intended to be theoretically bound, it is conceivable that the compositions provided herein may interact with (bind to) or be able to interact with (bind to) the extracellular matrix after local administration, thereby exerting the effects described herein, such as local retention, substantially no systemic distribution, extended retention, dose reduction of the composition or therapeutic agent, and / or reduction of side effects.

[0025] As described in detail in Appendix Example 4, interferons are cytokines that are relevant, for example, in the context of inflammation control, particularly in viral infections. Therefore, ectopic expression of interferons, such as human interferon lambda 1 (hIFNλ1), is very important, for example, in the treatment or prevention of viral diseases. However, the activity of hIFNλ1 (and many other therapeutic agents), and thus its therapeutic effect, may also depend on the tissue or organ in which it is expressed. We have surprisingly found that when the compositions provided herein contain or encapsulate mRNA encoding hIFNλ1 as a therapeutic agent, the mRNA is retained locally at the administration site (in this example, the lungs, see, for example, Figure 18). Thus, we have surprisingly demonstrated local retention of a therapeutically useful activator (here, mRNA encoding hIFNλ1).

[0026] Furthermore, it has been surprisingly found that the local retention effect disclosed herein (i.e., local retention of the composition administered according to the present invention) can be achieved by the lipidoid of formula (bI) (which, as described above, is thought to cause local retention), various helper lipids contained in the administered composition, and / or compositions with different concentrations of such cationic lipidoids and / or helper lipids (see, for example, Examples 8-10). This indicates that the compositions used in the context of the present invention are not particularly limited, as long as they include a suitable therapeutic or cosmetic agent and an ionizable lipid and / or ionizable lipid that can cause local retention of the composition. Such suitable ionizable lipids and agents are described in more detail below, and the general effects of local retention caused by ionizable lipids and lipidoids are illustrated by the exemplary and non-limiting ionizable lipids and lipidoids in the appended examples.

[0027] Furthermore, it has been exemplary shown that local retention of the composition can be achieved across a variety of different local administration routes, including intratracheal delivery (e.g., intratracheal infusion or intratracheal microspray), subcutaneous delivery, aerosol delivery to the airways (e.g., upper airways or lungs), intramuscular delivery, and nasal aerosol or nasal spray delivery (see, for example, Examples 1, 3, 4, and 11). This suggests that, in the context of the present invention, the type of local administration is not particularly limited, as long as the administered composition (particularly ionizable lipids and / or ionizable lipidoids) can interact with the extracellular matrix.

[0028] This localized expression is highly surprising compared to the known localization of compositions used to treat hereditary transthyretin amyloidosis (hATTR), such as conventional compositions, e.g., lipid nanoparticle-based mRNA vaccines, particularly Comirnaty® (containing ALC-0315), Spikevax® (containing SM-102), or Onpattro® (patisiran) (DLin-MC3-DMA, also referred to as "MC3" in the context of this invention). For example, after intramuscular injection of 50 micrograms of mRNA formulated as Comirnaty (i.e., formulated with ALC-0315), mRNA expression was observed in plasma, liver, adrenal glands, spleen, and ovaries (see Table 1). Similarly, systemic migration of LNP / mRNA after intramuscular injection of Spikevax® has also been observed (see Table 2 below) (Source: 1 EMA Assessment report, Community, December 21, 2020, and Spikevax: 1EMA Assessment report (Spikevax, March 11, 2021, EMA / 15689 / 2021 Corr.1*1, Committee for Medicinal Products for Human Use (CHMP)). Therefore, intramuscular injection of conventional compositions (particularly lipid nanoparticle compositions) results in the distribution of the active ingredient to various organs (systemically or partially systemically). As mentioned above, such widespread distribution can cause various side effects and is generally undesirable.

[0029] [Table 1]

[0030] [Table 2]

[0031] Therefore, it is necessary to find a novel delivery system that spatially limits expression to the tissue or organ to which it is intended.

[0032] The present invention solves the above problems according to embodiments of the invention.

[0033] As described above, without being bound by any theory, the present invention is considered to have achieved advantageous results by providing a formulation that effectively interacts with the extracellular matrix. Disruption of the extracellular matrix by hyaluronidase (hyalase) re-establishes the systemic delivery of therapeutic agents, particularly chemically modified mRNA.

[0034] In particular, the present invention relates to embodiments described in the following sections.

[0035] (Item 1) A composition for local delivery to an organ or tissue, or a localized site of interest, (a) Therapeutic agents, It is a career, (b) an ionizable cationic lipid or lipidoid, and (c) a helper lipid, and (d) optionally a pharmaceutically acceptable excipient or diluent, a carrier comprising comprising the composition, when administered to a localized site of interest in the body of a subject, remains local and does not essentially exhibit systemic distribution throughout the body of the subject, characterized in that.

[0036] (Item 2) The composition according to Item 1, wherein the ionizable cationic lipidoid is selected from compounds of the following formula (b-I).

Chem

[0037] (Item 3) A composition according to item 1 or 2, wherein the cationic lipidoid comprises a compound of formula (bV) and / or formula (b-VII). [ka] [ka]

[0038] (Item 4) A composition described in any of items 1 to 3, wherein the formulation or carrier contains lipids or lipidoid nanoparticles.

[0039] (Item 5) A composition described in any of items 1 to 4, wherein the therapeutic agent is (a) Anionic therapeutic substances and / or, (b) nucleic acids, preferably RNA, more preferably mRNA, miRNA and / or siRNA, most preferably mRNA encoding one or more polypeptides.

[0040] (Item 6) A composition described in item 5, wherein mRNA is (a) CAP, preferably an anti-reverse cap analog (ARCA) at its 5' end, (b) The 5' untranslated region (5'-UTR) upstream of the sequence encoding the polypeptide, (c) 5'-UTR containing an extended Kozak sequence: GCCACCAUG before the start codon sequence of mRNA, (d) 5'-UTR containing one of the following sequences immediately upstream of the mRNA start codon: (a)GGGAGACGCCACC(SEQ ID NO:11), (b)GAAGCGCCACC(SEQ ID NO:12), (c)GGGACGCCACC(SEQ ID NO:13), (d)GGGAGACTGCCACC(SEQ ID NO:14), (e)GAAGCTGCCACC(SEQ ID NO:15), (f) GGGACTGCCACC (SEQ ID NO: 16). (e) The 3' untranslated region (3'-UTR) downstream of the sequence encoding the polypeptide, and / or (d) Select a 3'-UTR sequence from the following: (a) GAAUU, or (b) CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA(SEQ ID NO:26), Something that contains one or more of the following.

[0041] (Item 7) A composition according to either item 5 or 6, wherein the mRNA is an in vitro transcription (IVT) product.

[0042] (Item 8) A composition according to any of items 5 to 7, wherein the mRNA contains a polyadenylated (poly(A)) tail downstream of the open reading frame (ORF) encoding the polypeptide.

[0043] (Item 9) A composition according to any of items 5 to 8, wherein the mRNA contains one or more modified nucleosides.

[0044] (Item 10) A composition described in any of items 5 to 9, wherein the mRNA contains one or more modified nucleosides selected from the following: Pseudouridine, N1-methylpseuduridine, N1-ethylpseuduridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseuduridine, 2-thio-1-methylpseuduridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydrouridine, 2-thiopseuduridine, 4-methoxy-2-thiopseuduridine, 4-methoxypseuduridine, 4-thio-1-methylpseuduridine, 4-thiopseuduridine, 5-aza-uridine, dihydropseuduridine, 5-ioduridine, 5-methoxyuridine, 2'-O-methyluridine, 5-iodocytidine, 5-methylcytosine, 5-methylcytidine, N1-methyladenosine, N6-methyladenosine.

[0045] (Item 11) A composition according to any of items 5 to 10, wherein the mRNA comprises one or more modified nucleosides selected from the following, and one or more modified nucleosides comprises a 1-methylpseudridine (m1ψ) modification.

[0046] (Item 12) A composition described in any one of items 5 through 11, which falls under any of the following: (a) If at least 50% of the uridine in the ORF is modified, (b) If at least 50% of the uridine in the mRNA is modified, (c) If at least 50% of the uridine in ORF is modified with m1ψ, (d) If at least 50% of the uridine in the mRNA is modified by m1ψ, (e) If 5-50% of the uridine nucleotide is 5-iodouridine and 5-50% of the cytidine nucleotide is 5-iodocytidine, (f) When 5-50% of the uridine nucleotides are 2-thiouridine and 5-50% of the cytidine nucleotides are 5-methylcytidine.

[0047] (Item 13) A composition according to any one of items 1 to 12, wherein the formulation of the composition comprises lipid or lipidoid nanoparticles which optionally contain any of the following: (a) nucleic acids, preferably RNA encoding a microRNA or mRNA encoding a functional protein or antigen, or an antigen as defined in any one of items 6 to 12, (b) A cationic lipidoid of formula (bI), preferably a cationic lipidoid of formula (bV) or (b-VII), most preferably a cationic lipidoid of formula (bV), and / or (c) One or more helper lipids, selected as needed from the following: (c1) Phospholipids, and / or, (c2) Sterols, and / or, (c3) Stealth lipids, If necessary, all components b) and c1) to c3) are included. They exist in molar ratios of approximately 8.0:5.3:4.4:0.9, respectively, as needed. If necessary, a triblock copolymer (containing one poly(propylene oxide) block and two poly(ethylene oxide) blocks) may be included as component (p) in the LNP or LiNP, or present in the aqueous phase of the vehicle or composition.

[0048] (Item 14) The composition described in item 13, wherein the cationic lipidoid is a cationic lipidoid of formula (bV), and optionally: (a) As shown in equation (b-VI), it is the R isomer of (bV), [ka] and / or, (b) Present in a molar ratio of 22-65%, preferably 34-52%, more preferably 36-50%, and most preferably 43.1%.

[0049] (Item 15) A composition as described in item 13, wherein the helper lipid is a phospholipid, preferably: (a) Selected from phosphatidylcholine (PC) or phosphatidylethanolamine (PE), most preferably phosphatidylcholine. (b) Carbon chain length is 14 to 18, most preferably 16, and / or (c) It is present in a molar ratio of 10-45%, preferably 18-39%, more preferably 24-33%, and most preferably 28.5%.

[0050] (Item 16) A composition as described in item 13, wherein the helper lipid is a sterol, preferably: (a) Cholesterol, (b) Present in a molar ratio of 12-38.5%, preferably 15-32%, more preferably 19-29%, and most preferably 23.7%.

[0051] (Item 17) A composition as described in item 13, wherein the helper lipid is a stealth lipid, preferably: (a) Glycerolipid-based (G) or phosphatidylethanolamine-based (PE) (b) The carbon chain length is 14 to 18, most preferably 14. (c) PEG is 2000 to 5000 Daltons, most preferably 2000 Daltons, and / or (d) It is present in a molar ratio of 1.5-7%, preferably 3-6%, more preferably 4-5%, and most preferably 4.7%.

[0052] (Item 18) The composition described in item 13, (i) The phospholipid of (c1) is preferably a phospholipid with a carbon chain length of C12 to C18, more preferably a C16 phospholipid, most preferably DPPC, and / or (ii)(c2) The sterol is cholesterol, or / and The stealth lipid in (iii)(c3) is a PEGylated lipid, preferably a PEGylated lipid with a molar mass of PEG chains of about 2000 to about 5000 daltons, more preferably a PEGylated lipid with a molar mass of PEG chains of about 2000 daltons, and most preferably DMG-PEG2000.

[0053] (Item 19) A composition according to any one of items 13 to 18, wherein the antigen is selected from the group consisting of viral antigens, bacterial antigens, cancer or tumor-related antigens, and allergens.

[0054] (Item 20) A composition according to any one of items 1 to 18, wherein the localization site includes a specific tissue, organ, or anatomical region, preferably the specific tissue, organ, or anatomical region is selected from the group consisting of the lungs, nose, heart, brain, spleen, lymph nodes, bones, tendons, skeletal muscles, joints, stomach, small intestine, large intestine, kidneys, bladder, breasts, testes, ovaries, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eyes, ears, tongue, skin, and / or tumors present in these tissues, organs, and anatomical regions.

[0055] (Item 21) A composition according to any one of items 1 to 20, further comprising a stabilizer, an adjuvant, or an immunomodulator.

[0056] (Item 22) A composition according to any one of items 1 to 21, wherein the therapeutic agent or carrier is encapsulated in a hydrogel or biocompatible matrix to enhance local retention.

[0057] (Item 23) A composition as described in any one of items 1 to 22, intended for use as a pharmaceutical.

[0058] (Item 24) A composition according to any one of items 1 to 18, for the prevention, treatment or improvement of a viral infection, preferably by immunity, more preferably by topical immunity.

[0059] (Item 25) A composition according to any one of items 1 to 18, wherein the disease to be treated is selected from: treatment of mutations, autoimmune diseases, metabolic disorders, neurodegenerative diseases, degenerative joint diseases, solid tumor diseases (e.g., soft tissue tumors, tumors of the heart, lungs, liver, spleen, kidneys, brain, oral cavity, intestines, skin, pancreas, prostate, mammary glands, ovaries, bladder, bone (including osteosarcoma, chondrosarcoma, Ewing's sarcoma)), tumors of the pleura and abdominal cavity, lung diseases, fractures or lesions thereof, tendon ruptures or lesions thereof, joint infections and ligament ruptures, arthropathy, arthritis, bacterial infections, preferably methicillin-resistant Staphylococcus aureus ( The following are selected from infections caused by multidrug-resistant tuberculosis (MRSA), viral infections, preferably influenza (Flu), hepatitis A, hepatitis B, human papillomavirus (HPV), measles, mumps, rubella, polio, rabies, varicella (chickenpox), herpes zoster (shingles), rotavirus, yellow fever, smallpox, Japanese encephalitis, tick-borne encephalitis (TBE), dengue fever, West Nile virus, chikungunya virus, Ebola virus, Marburg virus, human immunodeficiency virus (HIV), COVID-19, and most preferably coronavirus infections.

[0060] (Item 26) Use in the manufacture of pharmaceuticals for the prevention, treatment, or improvement of mutations, lung diseases, fractures or lesions thereof, tendon ruptures or lesions thereof, bacterial infections, viral infections, infections, preferably viral infections, more preferably influenza (Flu), hepatitis A, hepatitis B, human papillomavirus (HPV), measles, mumps, rubella, polio, rabies, varicella (chickenpox), herpes zoster (shingles), rotavirus, yellow fever, smallpox, Japanese encephalitis, tick-borne encephalitis (TBE), dengue fever, human immunodeficiency virus (HIV), COVID-19, most preferably coronavirus infections, of compositions described in any one of items 1 to 18.

[0061] (Item 27) A method for inducing an immune response in a subject, the method comprising administering an effective amount of any one of the compositions described in item 1 to 8 to the subject.

[0062] (Item 28) A method for immunizing a subject against a pathogen, the method comprising administering an effective amount of mRNA in a pharmaceutical composition described in any one of items 1 to 18 to the subject.

[0063] (Item 29) A method according to item 28, wherein the mRNA vaccine is administered by intradermal, subcutaneous, intramuscular, or intratumor injection.

[0064] (Item 30) A method or composition described in either item 28 or 29, wherein the mRNA vaccine primarily induces an immune response at localization sites, thereby reducing the risk of systemic adverse effects.

[0065] (Item 31) A method or composition described in any one of items 28 to 31, wherein the mRNA vaccine is designed to promote local production of antigen-specific antibodies or a cellular immune response at a site of localization.

[0066] (Item 32) A method or composition according to any one of items 29 to 31, wherein the mRNA vaccine further comprises a polymer coating or encapsulation for increasing local retention and preventing systemic spread.

[0067] (Item 33) A composition or method according to any one of items 1 to 18 or items 28 to 32, wherein the LNP further comprises a target site or ligand that specifically binds to cells or receptors present at a local site of interest, thereby enhancing the specificity and efficacy of the vaccine.

[0068] (Item 34) A composition or method described in any one of items 1 to 18 or items 28 to 33, wherein the pharmaceutically acceptable excipient or diluent further comprises a biodegradable or bioabsorbable material that promotes sustained release and local persistence of mRNA at a site of interest.

[0069] (Item 35) A composition or method according to any one of items 1 to 18 or items 28 to 34, wherein the mRNA further comprises a tissue-specific promoter and / or enhancer element for enhancing the expression of a target antigen at a local site of interest.

[0070] A composition or method described in any one of items 1 to 18 or items 28 to 35, wherein the mRNA is encapsulated within a biocompatible microneedle patch or implantable device and promotes controlled and sustained release of nucleic acid at a local site of interest.

[0071] A composition or method according to any one of items 1 to 18 or items 28 to 36, wherein the mRNA further comprises a self-amplifying mRNA (saRNA) molecule that enables enhancement of protein or antigen production at a local site of interest.

[0072] A composition or method according to any one of items 1 to 18 or items 28 to 37, wherein the mRNA encodes an antigen.

[0073] The present invention further relates to the following matters.

[0074] (Section 1) A composition for use in the treatment and / or prevention of a disease or disorder, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents, as needed. Equipped with a carrier, Equipped with, The composition remains localized at the administration site and / or does not exhibit systemic distribution throughout the patient's body. A composition for use in the treatment and / or prevention of a disease or disorder.

[0075] (Section 2) A composition for use in the treatment and / or prevention of a disease, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients and / or diluents as needed, Equipped with a carrier, Equipped with, The composition has extended retention at the injection site, and / or The therapeutic agent exerts its effect at the injection site by being retained there for an extended period. A composition for use in the treatment and / or prevention of a disease or disorder.

[0076] (Section 3) A composition for use in the treatment and / or prevention of a disease, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, Equipped with, The reduced amount of composition or therapeutic agent is administered and / or, in order to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the administration site. Patients experience fewer side effects compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the injection site. A composition for use in the treatment and / or prevention of disease.

[0077] (Section 4) The reduced amount of composition or therapeutic agent is administered and / or, in order to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the administration site. Patients experience fewer side effects compared to the same therapeutic agent formulated in a composition that does not have retention at the injection site. A composition for use as described in item 1 or 2.

[0078] (Section 5) The composition has extended retention at the injection site, and / or The therapeutic agent is a composition for use as described in item 1 or 3, which exerts its effect at the injection site by prolonged retention at the injection site.

[0079] (Section 6) A composition for use as described in item 2 or 3, which, when administered to the injection site, remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

[0080] (Section 7) A cosmetic composition, (a) One or more activators, (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, The cosmetic composition may be an ointment, cream, foam, gel, lotion, aqueous liquid, or powder, or The cosmetic composition may be formulated as an ointment, cream, foam, gel, lotion, aqueous liquid, or powder. Cosmetic composition.

[0081] (Section 8) The carrier is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, a nanostructured lipid carrier (NLCs), or a lipid-drug conjugate (LDC), preferably LNP or LiNP, and / or The agent is formulated as lipid nanoparticles (LNPs), lipidoid nanoparticles (LiNPs), liposomes, micelles, emulsions, nanostructured lipid carriers (NLCs), or lipid-drug conjugates (LDCs), preferably as LNPs or LiNPs, in the composition for use according to any one of claims 1 to 6, or the cosmetic composition according to claim 7.

[0082] (Section 9) The ionizable lipidoid in question is a compound of the following formula (bI): [ka] a is either 1 or 2, and b is an integer between 1 and 4, or a is an integer between 1 and 4, and b is either 1 or 2. p is either 1 or 2. m is either 1 or 2. n is either 0 or 1. m+n is 2 or greater, R 1A ~R 6A These are hydrogen, -CH2-CH(OH)-R, and hydrogen, -CH2-CH(OH)-R, independently of each other. 7A ,-CH(R 7A)-CH2-OH, -CH2-CH2-C(=O)-OR 7A -CH2-CH2-C(=O)-NH-R 7A , and -CH2-R 7A Selected from, R 7A These are selected from C3-C18 alkyl groups, C3-C18 alkenyl groups with one CC double bond, amino group protecting groups, -C(NH)-NH2 groups, polyethylene glycol chains, and acceptor ligands. R 1A ~R 6A At least two of these residues are -CH2-CH(OH)-R 7A ,-CH(R 7A )-CH2OH, -CH2-CH2-C(=O)-OR 7A -CH2-CH2-C(=O)-NH-R 7A , and -CH2R 7A Selected from, R 7A These are selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one CC double bond. One or more nitrogen atoms present in or contained in the compound of formula (bI) are optionally protonated to provide a compound having one or more positive charges. Preferably, variables a, b, p, m, n and R 1A ~R 6A It is defined as follows: a is 1 and b is an integer between 2 and 4, or a is an integer between 2 and 4 and b is 1. p is either 1 or 2. m is either 1 or 2. n is either 0 or 1. m+n is 2 or greater, R 1A ~R 6A These are hydrogen, -CH2-CH(OH)-R, and hydrogen, -CH2-CH(OH)-R, independently of each other. 7A ,-CH(R 7A )-CH2-OH, -CH2-CH2-C(=O)-OR 7A -CH2CH2C(=O)-NH-R 7A , and -CH2-R7A Selected from, R 7A These are selected from C3-C18 alkyl groups, C3-C18 alkenyl groups with one CC double bond, amino group protecting groups, -C(NH)-NH2 groups, polyethylene glycol chains, and acceptor ligands. R 1A ~R 6A At least two of these residues are -CH2-CH(OH)-R 7A ,-CH(R 7A )-CH2OH, -CH2CH2-C(=O)-OR 7A -CH2CH2-C(=O)-NH-R 7A , and -CH2R 7A Selected from, R 7A These are selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one CC double bond. A composition for use or cosmetic composition according to claim 8, wherein one or more nitrogen atoms provided in or contained in the compound of formula (bI) are optionally protonated to provide a compound having one or more positive charges.

[0083] (Section 10) The ionizable lipidoid in question is a compound of the following formula (b-II): [ka] a is 1 or 2, preferably 1. b is 1 or 2, preferably 2. R 1A ~R 6A It is defined as described in Section 9, A composition for use or cosmetic composition according to claim 8 or 9, wherein one or more nitrogen atoms provided in or contained in the compound of formula (b-II) are optionally protonated to provide a compound having one or more positive charges.

[0084] (Section 11) R 1A ~R 6AThese are hydrogen, -CH2-CH(OH)-R, and hydrogen, -CH2-CH(OH)-R, independently of each other. 7A -CH2-CH2-C(=O)-OR 7A -CH2-CH2-C(=O)-NH-R 7A Selected from, R 7A R is selected from C3-C18 alkyl and C3-C18 alkenyl groups having one CC double bond. 1A ~R 6A At least three, preferably at least four, of these are -CH2-CH(OH)-R 7A -CH2-CH2-C(=O)-OR 7A , and -CH2-CH2-C(=O)-NH-R 7A Selected from, R 7A The composition for use or cosmetic composition according to any one of claims 8 to 10, which is selected from C3-C18 alkyl and C3-C18 alkenyl having one CC double bond.

[0085] (Section 12) The ionizable lipidoid comprises or consists of compounds of formula (bV), formula (b-XI), and / or formula (b-XII), preferably the compound of formula (bV). [ka] [ka] [ka] A composition for use or cosmetic composition as described in any one of paragraphs 9 to 11.

[0086] (Section 13) The ionizable lipidoid comprises or consists of compounds of formula (b-IX) and / or formula (bX), preferably a compound of formula (bX). [ka] [ka] A composition for use or cosmetic composition as described in any one of paragraphs 8 to 12.

[0087] (Section 14) The carrier comprises at least two ionic lipids and / or at least two ionic lipidoids, the composition for use or cosmetic composition according to any one of claims 8 to 13.

[0088] (Section 15) The composition for use or cosmetic composition according to item 14, wherein the at least two ionic lipids and / or the at least two ionic lipidoids are as defined in any one of items 9 to 14.

[0089] (Section 16) The carrier comprises a lipidoid represented by formula (b-IX) and a lipidoid represented by formula (bX), the composition for use or cosmetic composition according to claim 15.

[0090] (Section 17) The ionic lipidoid comprises or consists of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII), as described in any one of claims 8 to 11. [ka] [ka]

[0091] (Section 18) The ionic lipidoid is a compound of formula (bv), preferably, (a) The R isomer of the compound of formula (bV), and / or (b) Present in a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%, A composition for use or cosmetic composition as described in any one of items 8 to 12.

[0092] (Section 19) The one or more helper lipids are (a) Phospholipids, (b) Sterols, and / or, (c) Stealth lipids, Selected from the group consisting of, A composition for use or cosmetic composition as described in any one of paragraphs 8 to 18.

[0093] (Section 20) The composition for use or cosmetic composition according to item 19, comprising the ionic lipid and / or the ionic lipidoid, the phospholipid, the sterol, and the stealth lipid, preferably in a molar ratio of about 8.0:about 5.3:about 4.4:about 0.9.

[0094] (Section 21) The phospholipid in question is, (a) Selected from phosphatidylcholine (PC) or phosphatidylethanolamine (PE), preferably PC, (b) Having a carbon chain length of about 14 to about 18, most preferably about 16, and / or (c) Present in a molar ratio of approximately 10 mol% to approximately 45 mol%, preferably approximately 18 mol% to approximately 39 mol%, more preferably approximately 24 mol% to approximately 33 mol%, and most preferably approximately 28.5 mol%. A composition for use or cosmetic composition as described in item 19 or 20.

[0095] (Section 22) The sterol in question is, (a) Cholesterol and / or (b) Present in a molar ratio of about 12 mol% to about 38.5 mol%, preferably about 15 mol% to about 32 mol%, more preferably about 19 mol% to about 29 mol%, and most preferably about 23.7 mol%, A composition for use or cosmetic composition as described in any one of paragraphs 19 to 21.

[0096] (Section 23) The stealth lipid in question is (a) Glycerolipid-based or PE lipid-based, (b) Carbon chain length of about 14 to about 18, most preferably about 14. (c) comprising polyethylene glycol (PEG), wherein the PEG has a molar mass of about 2000 to about 5000 daltons, most preferably about 2000 daltons, and / or (d) Present in a molar ratio of about 1.5 mol% to about 7 mol%, preferably about 3 mol% to about 6 mol%, more preferably about 4 mol% to about 5 mol%, most preferably about 4.7 mol%, A composition for use or cosmetic composition as described in any one of paragraphs 19 to 22.

[0097] (Section 24) (a) The phospholipid is preferably a phospholipid having a carbon chain length of about 12 to about 18, more preferably a phospholipid having a carbon chain length of about 16, and most preferably DPPC. (b) The sterol is cholesterol and / or (c) The stealth lipid is a PEGylated lipid, preferably a PEGylated lipid having a molar mass of PEG chains of about 2000 to about 5000 daltons, more preferably a PEGylated lipid having a molar mass of PEG chains of about 2000 daltons, and most preferably the PEGylated lipid is DMG-PEG2000. A composition for use or cosmetic composition as described in any one of paragraphs 19 to 23.

[0098] (Section 25) The composition further comprises a triblock copolymer as component (p), preferably the triblock copolymer comprising about one poly(propylene oxide) block and about two poly(ethylene oxide) blocks, as described in any one of claims 8 to 24, for use or as a cosmetic composition.

[0099] (Section 26) The one or more therapeutic agents are (a) anionic therapeutic substances, and / or (b) Nucleic acid, preferably RNA, more preferably mRNA, miRNA and / or siRNA, even more preferably mRNA, most preferably mRNA having an open reading frame (ORF) encoding one or more polypeptides. A composition for use as described in any one of items 8 to 25.

[0100] (Section 27)) The composition for use according to item 26, wherein the nucleic acid is RNA encoding a microRNA, or the nucleic acid is mRNA comprising an ORF encoding one or more polypeptides, preferably the one or more polypeptides being one or more functional proteins and / or one or more antigens.

[0101] (Section 28) The composition for use as described in item 27, wherein the one or more antigens are selected from the group consisting of viral antigens, bacterial antigens, cancer and / or tumor-related antigens, and / or allergens.

[0102] (Section 29) The mRNA in question is, (a) CAP, preferably an anti-reverse capping analog (ARCA) at its 5' end, (b) the 5'-UTR upstream of the ORF encoding one or more polypeptides, (c) 5'-UTR with an extended Kozak sequence (GCCACCAUG, SEQ ID NO:44) upstream of the ORF start codon, (d) Immediately upstream of the start codon of ORF, (i)GGGAGACGCCACC(SEQ ID NO:11), (ii)GAAGCGCCACC(SEQ ID NO:12), (iii)GGGACGCCACC(SEQ ID NO:13), iv.GGGAGACTGCCACC(SEQ ID NO:14), v.GAAGCTGCCACC(SEQ ID NO:15), v(i)GGGACTGCCACC(SEQ ID NO:16), A 5'-UTR having one of the following sequences, (e) the 3'-UTR downstream of the ORF encoding the one or more polypeptides, (f) (i) GAAUU, and, (ii) CCTCGCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA (SEQ ID NO:26); A 3'-UTR sequence downstream of the ORF encoding one or more of the polypeptides selected from, Having one or more features selected from the group consisting of, A composition for use as described in any one of paragraphs 26 to 28.

[0103] (Section 30) The mRNA is an in vitro transcription (IVT) product of the composition for use according to any one of claims 26 to 29.

[0104] (Section 31) The composition for use according to any one of claims 26 to 30, wherein the mRNA comprises a polyadenylation signal or a (poly(A)) tail group downstream of the ORF encoding the one or more polypeptides.

[0105] (Section 32) The composition for use according to any one of paragraphs 26 to 31, wherein the mRNA comprises one or more modified nucleosides.

[0106] (Paragraph 33) The one or more modified nucleosides are selected from the group consisting of N1-methylpseudouridine (m1ψ), pseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-iodouridine, 5-methoxyuridine, 2'-O-methyluridine, 5-iodocytidine, 5-methylcytosine, 5-methylcytidine, N1-methyladenosine, and N6-methyladenosine, and is preferably N1-methylpseudouridine, The composition for use according to any one of paragraphs 26 to 32.

[0107] (Paragraph 34) (a) when up to 100% of the uridine contained in the ORF is modified, preferably when at least about 50 mol% of the uridine contained in the ORF is modified, more preferably when any value between 50% and 100% is modified, even more preferably when 100% of the uridine is modified, (b) when at least about 50 mol% of the uridine contained in the mRNA is modified, (c) when at least about 50 mol% of the uridine contained in the ORF is modified to m1ψ, (d) when at least about 50 mol% of the uridine contained in the mRNA is modified to m1ψ, (e) when approximately 5 mol% to approximately 50 mol% of the uridine contained in the mRNA is 5-iodouridine and approximately 5 mol% to approximately 50 mol% of the cytidine contained in the mRNA is 5-iodocytidine, and / or (f) When approximately 0.5 mol% to approximately 50 mol% of the uridine contained in the mRNA is 2-thiouridine, preferably approximately 1 mol% to approximately 50 mol%, more preferably 1 mol% to approximately 5 mol%, of the uridine is 2-thiouridine, and 0.5 mol% to approximately 50 mol% of the cytidine contained in the mRNA is 5-methylcytidine, One or more of the following apply: A composition for use as described in item 32 or 33.

[0108] (Section 35) The composition is a composition for use according to any one of items 8 to 34, which is administered to a patient in need thereof.

[0109] (Section 36) The administration site comprises a tissue, organ, and / or anatomical region, preferably a solid tissue, organ, and / or anatomical region, and more preferably a solid tissue, organ, and / or anatomical region selected from the group consisting of the lung, nose, heart, brain, spleen, lymph node, bone, tendon, skeletal muscle, joint, stomach, small intestine, large intestine, kidney, bladder, breast, testis, ovary, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eye, ear, tongue, skin, and / or tumor present in the solid tissue, organ, and / or anatomical region, the composition for use according to any one of claims 8 to 35.

[0110] (Section 37) The composition according to any one of claims 8 to 36, further comprising one or more stabilizers, one or more adjuvants, and / or immunomodulators.

[0111] (Section 38) A composition according to any one of claims 8 to 37, wherein the therapeutic agent or carrier is encapsulated within a hydrogel or biocompatible matrix.

[0112] (Section 39) A method for preventing, treating, and / or improving a disease, comprising administering an effective amount of any one of the compositions described in paragraphs 1 to 6 and 8 to 38 to a target.

[0113] (Section 40) Use of any composition described in any one of paragraphs 1 to 6 and 8 to 38 in the manufacture of a medicinal product for the prevention, treatment, and / or improvement of a disease.

[0114] (Section 41) Prevention of the disease includes, more preferably, prevention by immunosuppression, the use of a composition for use according to any one of claims 1 to 6 and 8 to 38, a method of treatment according to claim 39, or a composition according to claim 40.

[0115] (Section 42) This disease includes gene mutations, autoimmune diseases, metabolic disorders, neurodegenerative diseases, degenerative joint diseases, arthropathy, arthritis, fractures, pseudoarthrosis, solid tumor diseases (including soft tissue tumors and tumors of the heart, lungs, liver, spleen, kidneys, brain, oral cavity, intestines, skin, pancreas, prostate, mammary glands, ovaries, bladder, and bone (including osteosarcoma, chondrosarcoma, and Ewing's sarcoma)), Inflammation of the pleura and abdominal cavity, respiratory diseases including rhinitis, asthma, viral asthma, COPD (including pulmonary autoimmune disease and ciliopathies), fractures or lesions of the bones, fractures or lesions of the tendons, joint infections, ligament ruptures, Staphylococcus aureus resistant (MRSA) and / or multidrug-resistant tuberculosis), viral infections, preferably viral infections, more preferably enteroviruses, rhinoviruses, influenza (Flu), respiratory syncytial virus (RSV), hepatitis A, hepatitis B, hepatitis C, human papillomavirus (HPV), measles, mumps, rubella, polio, rabies, varicella (chickenpox), herpes zoster (shingles), rotavirus, yellow fever, smallpox, Japanese encephalitis, tick-borne diseases Use of a composition for use as described in any one of claims 1 to 6, 8 to 38, and 41, a method of treatment as described in claim 39 or 41, or a composition for use as described in claim 40 or 41, selected from encephalitis (TBE), dengue fever, West Nile virus, chikungunya virus, Ebola virus, Marburg virus, human immunodeficiency virus (HIV), and coronavirus infection (including COVID-19), most preferably coronavirus infection.

[0116] (Section 43) The composition is administered to one or more solid tissues, solid organs and / or solid anatomical regions, preferably the one or more solid tissues, solid organs and / or solid anatomical regions being selected from the group consisting of the lungs, nose, heart, brain, spleen, lymph nodes, bones, tendons, skeletal muscles, joints, stomach, small intestine, large intestine, kidneys, bladder, breast, testes, ovaries, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eyes, ears, tongue, skin and / or tumors present in the one or more solid tissues, solid organs and / or solid anatomical regions, as described in any one of claims 1 to 6, 8 to 38, 41 and 42, as described in any one of claims 39, 41 and 42, as described in any one of claims 40 to 42.

[0117] (Section 44) Use of a composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 43, a method of treatment according to any one of claims 39, and 41 to 43, or a composition for use according to any one of claims 40 to 43, wherein at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the one or more therapeutic agents is limited to the tissue, organ, and / or anatomical region being treated and / or quantified by a method selected from the group consisting of qPCR, HPLC, mass spectrometry, or a combination of HPLC and mass spectrometry.

[0118] (Section 45) By limiting one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated, it is possible to reduce the dose of said one or more therapeutic agents administered by up to 20%, including any range within this range, such as a reduction of 1-20%, 5-15%, or 10-20%, but not limited to these, the composition for use described in any one of claims 1 to 6, 8 to 38, and 41 to 44, the method of treatment described in any one of claims 39, and 41 to 44, or the use of the composition described in any one of claims 40 to 44.

[0119] (Section 46) The composition for use according to any one of Items 1 to 6, 8 to 38, and 41 to 45, the treatment method according to any one of Items 39, and 41 to 45, or the use of a composition according to any one of Items 40 to 45, wherein confining the one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated reduces the number of administrations of the one or more therapeutic agents, preferably reduces the number of administrations by about 25% or less.

[0120] (Item 47) The composition for use according to any one of Items 1 to 6, 8 to 38, and 41 to 46, the treatment method according to any one of Items 39, and 41 to 46, or the use of a composition according to any one of Items 40 to 46, wherein confining the one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated reduces toxicity caused by and / or associated with accumulation of the one or more therapeutic agents in off-target organs, and preferably toxicity caused by and / or associated with the one or more therapeutic agents is reduced in the liver, brain, kidney, heart, and / or spleen.

[0121] (Item 48) The composition for use according to any one of Items 1 to 6, 8 to 38, and 41 to 47, the treatment method according to any one of Items 39, and 41 to 47, or the use of a composition according to any one of Items 40 to 47, wherein confining the one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated reduces and / or avoids off-target effects caused by and / or associated with the one or more therapeutic agents, and preferably off-target effects caused by and / or associated with the one or more therapeutic agents are reduced in the liver, brain, kidney, heart, and / or spleen.

[0122] (Item 49) The composition is not administered in combination with one or more hyaluronidases and / or enzymes having hyaluronidase activity, and is used in any one of the following cases: the composition for use described in any one of the following cases: claims 1 to 6, 8 to 38, and 41 to 48; the treatment method described in any one of the following cases: claim 39, and 41 to 48; or the composition for use described in any one of the following cases: claims 40 to 48.

[0123] (Section 50) Use of a composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 49, a method of treatment according to any one of claims 39 and 41 to 49, or a composition for use according to any one of claims 40 to 49, wherein the target of treatment is a mammal, preferably a human.

[0124] (Section 51) The composition is administered by intradermal, subcutaneous, intramuscular, or intratumor injection, aerosol delivery to the respiratory system including intranasal or lung delivery, or topical application, in the use of the composition for the use described in any one of claims 1 to 6, 8 to 38, and 41 to 50, the treatment method described in any one of claims 39 and 41 to 50, or the use of the composition for the use of the composition described in any one of claims 40 to 50.

[0125] (Section 52) A method for inducing an immune response in a subject, comprising administering to the subject an effective amount of a composition described in any one of items 1 to 6, 8 to 38, and 41 to 50.

[0126] (Section 53) A method for immunizing a subject against a pathogen, comprising administering an effective amount of an mRNA vaccine in a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises a composition according to any one of claims 1 to 6, 8 to 38, and 41 to 50.

[0127] (Section 54) The mRNA vaccine is administered by intradermal, subcutaneous, intramuscular, or intratumor injection according to the method of item 53.

[0128] (Section 55) The mRNA vaccine, according to the method of paragraph 53 or 54, primarily induces an immune response at the administration site, thereby reducing the risk of systemic adverse effects.

[0129] (Section 56) The method according to any one of claims 53 to 55, wherein the mRNA vaccine is designed to promote local production of antigen-specific antibodies or a cellular immune response at the administration site.

[0130] (Section 57) The method according to any one of claims 53 to 56, further comprising a polymer coating or encapsulation for enhancing local retention and preventing systemic dissemination of the mRNA vaccine.

[0131] (Section 58) The carrier further comprises a target site or ligand that specifically binds to cells or receptors present at the target site, thereby enhancing the specificity and efficacy of the therapeutic agent, as described in any one of claims 8 to 38, 41 to 51, or the method described in any one of claims 53 to 57.

[0132] (Section 59) The pharmaceutically acceptable excipient or diluent further comprises a biodegradable or bioabsorbable material to promote sustained release and local persistence of the therapeutic agent at the site of interest, as described in any one of claims 8 to 38, 41 to 51, and 58, or the method described in any one of claims 53 to 58.

[0133] (Section 60) The mRNA further comprises a tissue-specific promoter and / or enhancer element for enhancing antigen expression at the target site, as described in any one of claims 8 to 38, 41 to 51, 58, and 59, or the method described in any one of claims 53 to 59.

[0134] (Section 61) The therapeutic agent is encapsulated within a biocompatible microneedle patch or implantable device, and the composition for use described in any one of claims 8 to 38, 41 to 51, and 58 to 60, or the method described in any one of claims 53 to 60, facilitates controlled and / or sustained release of the therapeutic agent at the site of interest.

[0135] (Section 62) The mRNA further comprises a self-amplifying mRNA (saRNA) molecule, enabling enhancement of protein or antigen production at a site of interest, as described in any one of claims 8 to 38, 41 to 51, and 58 to 61, or the method described in any one of claims 53 to 61.

[0136] (Section 63) The one or more mRNA molecules in question include CFTR, erythropoietin (EPO), factor VIII, factor IX, chimeric antigen receptor (CAR), T cells, servibin (BIRC5) or its dominant-negative form, P53, vascular endothelial growth factor (VEGF), insulin, SARS-CoV-2 spike protein, α-synuclein, dystrophin, glucocerebrosidase (GCase), cytokines such as interleukin-2 (IL-2), interleukin-10 (IL-10), and interleukin-12 (IL-12), interferon, interferon-A (IFN-A), interferon-beta (IFN-β), interferon-gamma (IFN-γ), interferon-lambda 1 (IFN-λ1, also known as IL-29), IFN-λ2 (also called IL-28a), and IFN. Interferon lambda (IFNλ) such as -λ3 (also known as IL-28b) and / or IFN-λ4, human interferon lambda 1 (HIFNλ1), e.g., tumor necrosis factor alpha (TNF-α), granulocyte-macrophage colony-stimulating factor (GM-CSF), primary ciliary motility disorders proteins or factors, e.g., DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21ORF59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DNAAF5 (HEATR 2 A composition for use as described in any one of items 8 to 38, 41 to 51, and 58 to 62, comprising an ORF encoding HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1, preferably, one or more mRNA molecules comprising an ORF encoding interferon lambda 1 (IFNλ1), more preferably comprising an ORF encoding human interferon lambda 1 (HIFNλ1), or the method as described in any one of items 53 to 62.

[0137] (Section 64) The cosmetic composition according to any one of claims 7 to 25, wherein the active ingredient is selected from the group consisting of growth factors, peptides, antioxidants, retinoids, cytokines, siRNA, miRNA, mRNA, and asRNA.

[0138] (Section 65) Use of any one of the cosmetic compositions described in paragraphs 7 to 25 and 64 in improving skin condition.

[0139] (Section 66) A method for improving a skin condition, comprising administering a cosmetic composition described in any one of paragraphs 7 to 25 and 64.

[0140] (Section 67) A kit comprising a cosmetic composition as described in any one of paragraphs 7 to 25 and 64.

[0141] (Section 68) A drug conjugate comprising an ionizable lipidoid as described in any one of claims 9 to 18 and one or more therapeutic agents, preferably the one or more therapeutic agents being as described in any one of claims 26 to 34.

[0142] (Section 69) The ionic lipidoid is co-compounded with one or more therapeutic agents, preferably the ionic lipidoid is as defined in any one of claims 9 to 18, and preferably the one or more therapeutic agents are as defined in any one of claims 26 to 34, for in vitro use of the ionic lipidoid to limit the diffusion of one or more therapeutic agents to be administered.

[0143] (Section 70) An in vitro method for restricting the diffusion of one or more therapeutic agents to be administered, comprising the step of co-combining one or more therapeutic agents with an ionic lipidoid, wherein the ionic lipidoid is as defined in any one of items 9 to 18.

[0144] (Section 71) The drug conjugate described in claim 68, the in vitro use described in claim 69, or the in vitro method described in claim 70, wherein the ionic lipidoid comprises a compound of formula (bI), more preferably a compound of formula (bV) or formula (b-VII), and even more preferably a compound of formula (bV).

[0145] As described above, the present invention provides compositions (e.g., pharmaceutical compositions and cosmetic compositions) and their uses in the topical delivery of agents (e.g., therapeutic agents or activators). Therefore, in the context of the present invention, “composition” may also refer to the compositions (as pharmaceuticals) provided herein (also referred to herein as “pharmaceutical compositions”) and / or cosmetic compositions provided herein. In general, all definitions and specifications relating to “composition” (or corresponding pharmaceutical compositions) may apply to all applicable compositions herein (i.e., pharmaceutical compositions and cosmetic compositions). In this specification, “pharmaceutical composition” and “therapeutic composition” may be used synonymously. Furthermore, “composition” and “formulation” may also be used synonymously herein.

[0146] Therefore, the present invention provides a (pharmaceutical) composition for use in the treatment and / or prevention of a disease, the treatment comprising topical administration of the composition, (a) one or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, - Compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site, the dosage of the composition or therapeutic agent is reduced in order to achieve an equivalent therapeutic effect. - Compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site, it results in fewer side effects for patients (e.g., reduced risk of CARPA). - The composition has extended retention at the injection site. - The therapeutic agent exerts its effect at the injection site by prolonged retention at the injection site, and / or, - When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body. One or more of the following conditions apply.

[0147] As described above, the reduction of side effects in patients (compared to compositions that do not have prolonged retention at the administration site), such as the reduction of CARPA risk, is extremely advantageous (in the context of the present invention). This is particularly pronounced in patients prone to hypersensitivity reactions, in high-risk patients, and / or pediatric patients (i.e., patients under about 18 years of age). Therefore, in the context of the compositions for use provided herein, preferred patients (patients requiring treatment and / or prevention of disease) are patients belonging to the high-risk group, patients prone to hypersensitivity reactions (preferably patients prone to hypersensitivity reactions induced by the pharmaceutical composition or by the systemic or non-local distribution of the pharmaceutical composition), and / or pediatric patients. Those skilled in the art will readily recognize means and methods for evaluating whether a patient belongs to the high-risk group or is prone to hypersensitivity reactions (preferably patients prone to hypersensitivity reactions induced by the pharmaceutical composition or by the systemic or non-local distribution of the pharmaceutical composition). If the therapeutic agent of the present invention comprises or consists of an immunomodulatory or immunoactivating polypeptide (e.g., interferon, preferably interferon-lambda or human interferon-lambda) or a nucleic acid (e.g., mRNA) encoding such an immunomodulatory or immunoactivating polypeptide (e.g., interferon, preferably interferon-lambda or human interferon-lambda), limiting the risk of CARPA (which may be induced by systemic distribution of compositions that do not contain ionizable lipids and / or lipidoids according to the present invention) is particularly advantageous, especially in patients prone to hypersensitivity reactions. The disease to be treated and / or prevented may be any disease described in detail above or below herein (in particular, diseases or disorders caused by or associated with enteroviruses, such as rhinovirus-induced rhinitis). In particular, in the treatment of asthma (for example, the treatment of asthma using nucleic acids encoding human interferon lambda, which is described in detail herein and exemplified in SEQ ID NO:46), pediatric patients may be under approximately 18 years of age, under approximately 16 years of age, under approximately 14 years of age, under approximately 12 years of age, under approximately 10 years of age, under approximately 9 years of age, under approximately 8 years of age, under approximately 7 years of age, or under approximately 6 years of age.In particular, in the treatment of PCD, (pediatric) patients may be 6 months or older.

[0148] In the context of cosmetic compositions provided herein, limiting the distribution of the cosmetic composition or the activators contained therein and avoiding undesirable side effects (e.g., complement system activation and / or CARPA) is advantageous, especially in subjects prone to hypersensitivity reactions.

[0149] As described above, the present invention also relates to cosmetic compositions comprising the following: (a) one or more activators, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, The cosmetic composition is an ointment, cream, foam, gel, lotion, aqueous liquid, or powder, or the cosmetic composition is formulated as an ointment, cream, foam, gel, lotion, aqueous liquid, or powder.

[0150] In the context of the present invention, contact with a subject / tissue / organ with either a pharmaceutical composition or a cosmetic composition may be referred to as "treatment of the subject / tissue / organ." Therefore, terms such as "treatment" and "therapy" may refer to both therapeutic and cosmetic applications / administrations / compositions, etc.

[0151] Accordingly, in the context of the present invention, at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the one or more (therapeutic or active) agents may be limited to the tissue, organ, and / or anatomical region being treated, which is quantified by a method selected from the group consisting of qPCR, HPLC, mass spectrometry, or a combination of HPLC and mass spectrometry.

[0152] Therefore, in the context of the present invention, limitation of systemic distribution / extended retention at the administration site can be quantified / evaluated / determined by any suitable method, preferably selected from the group consisting of qPCR, HPLC, mass spectrometry, and / or a combination of HPLC and mass spectrometry. In this specification, after local administration (e.g., intradermal, subcutaneous, mucosal administration, submucosal, intramuscular or intratumor injection, aerosol delivery, or topical application), for example, about 10 hours, about 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration, about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or less of the (amount) of the (therapeutic or cosmetic) agent, preferably about 1 It is preferable that the amount reached / detected / evaluated / determined during (whole-body) circulation is 0% or less, more preferably about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, even more preferably about 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, and even more preferably less than about 0.01%.

[0153] As described above, means and methods for evaluating whether, for example, about 0.01% of the agent reaches the circulatory system (or is detected / discovered within the circulatory system) include qPCR, HPLC, mass spectrometry, and / or a combination of HPLC and mass spectrometry. For agents containing nucleic acids (e.g., mRNA), qPCR is preferred, and more preferably, the qPCR performed in the attached examples. In Example 7, it was found that less than 0.01% of the hIFNλ1 translated in the lungs reached the circulatory system within an average of about 2 hours (ranging from 33 minutes to 5 hours and 22 minutes) after administration. Therefore, Example 7 in particular demonstrates how to evaluate / detect / determine whether a composition remains localized at the administration site and / or does not essentially exhibit systemic distribution throughout the patient's body, whether the composition has extended retention at the administration site and / or whether the therapeutic agent exerts its effect at the administration site due to extended retention at the administration site, or conversely, whether a composition does not remain localized at the administration site and / or essentially exhibits systemic distribution throughout the patient's body, does not have extended retention at the administration site, or whether the therapeutic agent does not exert its effect at the administration site due to extended retention at the administration site.

[0154] In this specification, it is expected that the (therapeutic or cosmetic) agent is released after administration of the composition and exerts its (therapeutic or cosmetic) effect in particular. Therefore, the terms "the composition remains localized at the administration site" and / or "the composition does not essentially exhibit systemic distribution throughout the patient's body" and "the composition has extended retention at the administration site" are applied similarly and interchangeably to "the (therapeutic or cosmetic) agent remains localized at the administration site" and / or "the (therapeutic or cosmetic) agent does not essentially exhibit systemic distribution throughout the patient's body" and "the (therapeutic or cosmetic) agent has extended retention at the administration site," respectively. In particular, the term "the (therapeutic or cosmetic) agent exerts its effect at the administration site by extended retention at the administration site" means "the (therapeutic or cosmetic) agent exerts its effect at the administration site by extended retention at the administration site."

[0155] In other words, if the composition remains localized at the administration site and / or does not exhibit systemic distribution throughout the patient's body, or if the composition has extended retention at the administration site, for example, in amounts of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or less, preferably about 1% or less, more preferably about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less. More preferably, an amount of the (therapeutic or cosmetic) agent less than or equal to about 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, and more preferably less than about 0.01%, is reached / detected / evaluated / determined in the (systemic) circulatory system after local administration of the composition (e.g., intradermal, subcutaneous, submucosal, intramuscular, intratumor injection, mucosal delivery, aerosol delivery, or topical application). For example, at about 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration, the amount is quantified / evaluated / determined by any suitable method, preferably selected from the group consisting of qPCR, ligand-binding assay (e.g., ELISA), HPLC, mass spectrometry, a combination of HPLC and mass spectrometry, and / or a combination thereof.

[0156] Conversely, if the composition does not remain localized at the administration site, and / or if the composition essentially exhibits systemic distribution throughout the patient's body, or if the composition does not have extended retention at the administration site, or if the (therapeutic or cosmetic) agent does not exert its effect at the administration site due to extended retention (of the agent or composition), for example, about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more, preferably about 1% or more, more preferably about 0.1%, 0.2%, 0.3%, 0.4% An amount of the (therapeutic or cosmetic) agent in the form of %, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or more, more preferably about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09% or more, and more preferably more than about 0.01%, is reached / detected / evaluated / determined in the (systemic) circulatory system after local administration of the composition (e.g., intradermal, subcutaneous, submucosal, intramuscular, intratumor injection, mucosal delivery, aerosol delivery, or topical application). For example, it is quantified / evaluated / determined about 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration, by any suitable method, preferably selected from the group consisting of qPCR, HPLC, mass spectrometry, or a combination of HPLC and mass spectrometry.

[0157] The above relative values ​​(for example, about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or less, preferably about 1% or less, more preferably about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less, even more preferably about 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01% or less, even more preferably less than about 0.01% of the amount of the agent (for therapeutic or cosmetic use) (in the case of the composition of the present invention), and / or about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% The amount of the agent (for therapeutic or cosmetic use) (in the case of a reference composition) exceeding 10%, preferably about 1%, more preferably about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, even more preferably about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, and even more preferably about 0.01% represents the amount of the agent (for therapeutic or cosmetic use) detected / evaluated / determined in the (systemic) circulatory system (or the amount of the agent that reaches the (systemic) circulatory system) as a percentage of the total amount of the agent administered.

[0158] For example, if the therapeutic agent is mRNA or DNA, the percentage can be determined based on the ratio of the amount of translated gene products (peptides and / or proteins) in the (systemic) circulatory system to the amount of translated gene products (peptides and / or proteins) detected / evaluated / determined at the administration site (e.g., approximately 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration). The amount of translated gene products (proteins) detected / evaluated / determined at the administration site can also be calculated based on the amount of the administered therapeutic agent (e.g., mRNA) and the resulting expected amount of translated gene products (proteins).

[0159] In one embodiment of the present invention, the extent to which the therapeutic agent or the protein and / or peptide encoded by the therapeutic agent (e.g., mRNA agent) remains localized at the administration site may depend on the properties of the therapeutic agent or the encoded protein and / or peptide. For example, small peptides may be more mobile than larger proteins after expression. Therefore, it is preferable that the expressed protein has a molecular weight of approximately 20 kDa or more.

[0160] When a therapeutic agent is administered multiple times (for example, two, three, or four times consecutively), the relative value is determined by considering the amount of the (total) agent (or, in the case of mRNA / DNA, the (total) amount of the translated gene product (protein)) administered each time. For example, if a therapeutic agent is administered three times consecutively at two-hour intervals, the amount of the (therapeutic or cosmetic) agent detected / evaluated / determined in the (systemic) circulatory system (or the amount of the agent that reaches the (systemic) circulatory system) can be determined as a percentage of the total amount administered at that point, two hours after each administration.

[0161] For example, the quantification of the therapeutic agent in different organs is illustrated in the accompanying examples. Furthermore, the accompanying examples exemplify that both the therapeutic agent (i.e., hINFλ1 mRNA; SEQ ID NO: 42) and the ionizable lipidoid used (e.g., a compound of formula bV) were retained locally at the site of local administration (see, for example, Figures 18 and 19). Local retention of the composition (e.g., LiNP or its components, e.g., ionizable lipid or ionizable lipid) may suggest that the (therapeutic or active) agent is also retained locally. Accordingly, it is preferable that about 10%, preferably about 1%, more preferably about 0.1%, even more preferably about 0.01%, and still more preferably less than about 0.01% of the (ionizable) lipidoid or (ionizable) lipid reach the (systemic) circulation about 2 hours after local administration (e.g., intradermal, subcutaneous, submucosal, intramuscular, intratumor injection, mucosal delivery, aerosol delivery, or topical application). As described above, means and methods for evaluating whether, for example, about 0.01% of (ionizable) lipidoids or (ionizable) lipids reach (or are detected within) the circulatory system include HPLC, mass spectrometry, a combination of HPLC and mass spectrometry, preferably LC-MC / MS as described in detail in the attached examples.

[0162] In other words, if the composition remains localized at the administration site and / or does not exhibit systemic distribution throughout the patient's body, or if the composition has extended retention at the administration site, for example, about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or less, preferably about 1% or less, more preferably about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less, even more preferably Alternatively, an amount of (ionizable) lipidoid or (ionizable) lipid in the (systemic) circulatory system is detected / evaluated / determined in the (systemic) circulatory system after local administration of the composition (e.g., intradermal, subcutaneous, submucosal, intramuscular, intratumor injection, mucosal delivery, aerosol delivery, or topical application). For example, at approximately 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration, it is quantified / evaluated / determined by any suitable method, preferably selected from the group consisting of HPLC, mass spectrometry, a combination of HPLC and mass spectrometry, more preferably LC-MC / MS.

[0163] Conversely, if the composition does not remain localized at the administration site, and / or if the composition essentially exhibits systemic distribution throughout the patient's body, or if the composition does not have extended retention at the administration site, or if the (therapeutic or cosmetic) agent does not exert its effect at the administration site due to extended retention (of the agent or composition), for example, about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more, preferably about 1% or more, more preferably about 0.1%, 0.2%, 0.3% The amount of (ionizable) lipidoid or (ionizable) lipid in amounts of 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or more, more preferably about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09% or more, more preferably about 0.01%, is detected / evaluated / determined in the (systemic) circulatory system after local administration of the composition (e.g., intradermal, subcutaneous, intramuscular, intratumor injection, aerosol delivery, or topical application). For example, it is quantified / evaluated / determined at approximately 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration, by any suitable method, preferably selected from the group consisting of HPLC, mass spectrometry, a combination of HPLC and mass spectrometry, more preferably LC-MC / MS.

[0164] For example, when using HPLC-MS / MS, the lower limit of quantification (LLOQ) of (ionizable) lipidoids represented by formula bV (specifically "dL_05") in serum and lung was 100 ng / mL, and in the liver it was 200 ng / mL.

[0165] This specification provides methods (in vitro / ex vivo) for detecting / evaluating / determining whether "the composition remains localized at the injection site" and / or "the composition does not essentially exhibit systemic distribution throughout the patient's body," or "the composition has extended retention at the injection site." Such methods can be performed in subjects, such as (non-human) animals (rats, mice, etc.), using non-invasive imaging techniques. Therapeutic uses or therapeutic methods may include steps (in vitro or ex vivo) for detecting / evaluating / determining whether "the composition remains localized at the injection site" and / or "the composition does not essentially exhibit systemic distribution throughout the patient's body," or "the composition has extended retention at the injection site."

[0166] In the context of the present invention (for example, in the context of compositions for use provided herein, cosmetic compositions, therapeutic methods, or methods for detecting / evaluating / determining whether "the composition remains localized at the administration site" and / or "the composition does not essentially exhibit systemic distribution throughout the patient's body," or "the composition has extended retention at the administration site"), a person skilled in the art can easily evaluate whether "the composition remains localized at the administration site" and / or "the composition does not essentially exhibit systemic distribution throughout the patient's body," or "the composition has extended retention at the administration site," etc., by comparing a composition administered to a subject (for example, a composition having local retention at the administration site or a composition according to the present invention) with a reference composition such as a composition that does not remain localized at the administration site and / or a composition that exhibits systemic distribution throughout the patient's body, or a composition that has extended retention at the administration site. In this context, "comparison of a composition with a reference composition" may mean comparing the systemic distribution / local retention of a composition with the reference composition by means and methods described in detail above and illustrated in the appendix examples. As stated above, such methods are not particularly limited and may include methods selected from the group consisting of qPCR, ligand binding assays (e.g., ELISA), HPLC, mass spectrometry, combinations of HPLC and mass spectrometry, and / or combinations thereof.

[0167] In the context of the present invention, the “reference composition” does not have local retention at the administration site. Terms such as “composition having local retention at the administration site” may also refer to “composition having extended retention at the administration site,” “composition that remains locally and does not essentially exhibit systemic distribution throughout the patient’s body,” “non-systemic composition,” “composition that does not have / do not exhibit systemic distribution,” and vice versa. Therefore, the “reference composition” may also be called a “systemic composition” (i.e., a composition with systemic distribution / a composition that does not have local retention at the administration site, etc.). In the attached examples, it is illustrated that local retention at the administration site, etc., is conferred by the ionizable lipid or ionizable lipidoid (capable of interacting with the extracellular matrix) used. Therefore, the “reference composition” in the context of the present invention does not include the ionizable lipid or ionizable lipidoid used herein that confers local retention at the administration site. Therefore, in the context of the present invention, the “reference composition” does not include, for example, ionizable lipids or ionizable lipidoids according to any of the formulas (bI), (b-II), (bV), (b-VI), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII). Such a reference composition may include, for example, a known lipid selected from DLin-MC3-DMA, ALC-0315, or SM-102, etc. (but does not include ionizable lipids or ionizable lipidoids according to any of the formulas (bI), (b-II), (bV), (b-VI), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII).

[0168] The attached examples illustrate that the local retention of a composition (or its components, such as activators and therapeutic agents) does not depend on the activator or therapeutic agent itself, and this is particularly evident when the agent is a nucleic acid such as mRNA. Therefore, those skilled in the art can use a reporter polypeptide (or a nucleic acid encoding such a reporter polypeptide), such as luciferase (or a nucleic acid encoding luciferase), to evaluate whether the composition has local retention at the administration site, by comparing it with the reference composition. Therefore, those skilled in the art can compare a composition according to the present invention (e.g., a composition comprising any of formulas (bI), (b-II), (bV), (b-VI), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII)) with a reference composition (e.g., one comprising MC3), each comprising a reporter polypeptide (e.g., luciferase as exemplified by SEQ ID NO: 46) or a nucleic acid encoding it (e.g., as exemplified by SEQ ID NO: 45), and evaluate the activity of the reporter polypeptide (e.g., luciferase activity) after topical administration of the composition (according to the present invention) and after topical administration (e.g., intranasal administration) of the reference composition. In this context, those skilled in the art will recognize that the composition and the reference composition should be administered topically to two different / independent subjects (for subsequent quantification of reporter polypeptide activity), and that the activity of the reporter polypeptide can be evaluated by means and methods used in the accompanying examples (e.g., IVIS imaging of the subject or IVIS imaging of an organ extracted from the subject). If an organ is extracted from a subject, the subject is non-human. Those skilled in the art will recognize that the agent (i.e., the reporter polypeptide or the nucleic acid encoding it) must be identical in both the composition (according to the present invention) and the reference composition. Preferably, the composition (according to the present invention) and the reference composition differ only in the ionizable lipidoid.

[0169] Those skilled in the art can easily compare reporter polypeptide activity (e.g., activity measured by IVIS imaging) by comparing the reporter polypeptide activity (e.g., activity measured by IVIS imaging) obtained after administration of the composition and the reference composition. For example, reporter polypeptide activity (e.g., activity measured by IVIS imaging) in a subject can be evaluated at approximately 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or preferably 2 hours after administration. Those skilled in the art can evaluate reporter polypeptide activity (e.g., activity measured by IVIS imaging) in, for example, non-target tissues or organs. Non-target tissues or organs are tissues or organs to which the administered composition was not administered. For example, if the lungs are targeted (i.e., the composition is administered locally to the lungs of a subject), the lungs are considered the "target organ" (or "target tissue"), and other organs (e.g., heart, spleen, etc.) are considered "non-target organs" (or "non-target tissues"). In this specification, the reference composition is compared to the composition (according to the present invention) by approximately 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 110 times, 120 times, 130 times, 140 times, 150 times, 160 times, 170 times, 180 times, 190 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 10 4 double, 10 5It is preferable to show an increase in reporter polypeptide activity of a factor of 10 (any value within these ranges is also assumed herein, and a larger increase is preferable). Such an increase (e.g., a 10-fold increase in reporter polypeptide activity) can be calculated by dividing the measured value obtained from the evaluation of reporter polypeptide activity in an untarget organ after local administration of the reference composition (e.g., IVIS imaging measurement) by the measured value obtained from the evaluation of reporter polypeptide activity in an untarget organ after local administration of the composition (according to the present invention) (e.g., IVIS imaging measurement). For example, if the IVIS imaging measurement is 10 after administration of the reference composition (e.g., containing mRNA encoding luciferase as exemplified by SEQ ID NO: 46) to an (local) target organ 6 p / s / cm 2 The result is / sr, and administration of the composition (containing mRNA encoding luciferase as exemplified by SEQ ID NO:46, for example) to a (local) target organ results in an IVIS imaging measurement of 10 5 p / s / cm 2 When the result is / sr, a person skilled in the art will recognize that this represents an increase of approximately 10 times (i.e., approximately 10 times increase in reporter polypeptide activity / 10 times increase in local retention in the target organ) (i.e., 10 6 p / s / cm 2 / sr 10 5 p / s / cm 2 (Divide by / sr). For example, a tenfold increase in local retention in a target organ corresponds to a tenfold decrease in systemic distribution.

[0170] Those skilled in the art will recognize that for both the composition (according to the present invention) and the reference composition, the same off-target organ (or reporter polypeptide activity in the off-target organ) must be evaluated at the same or nearly the same time point after administration of both compositions to subjects (for example, the heart (or reporter polypeptide activity in the heart) must be evaluated for both the composition (according to the present invention) and the reference composition).

[0171] Therefore, the present invention provides a method (in vitro / ex vivo) for detecting / evaluating / determining whether and / or to what extent a composition remains localized at the administration site. The method is as follows: (i) The step of administering a composition topically to the target organ of a first subject and a reference composition topically to the target organ of a second subject (each composition comprises a reporter polypeptide or a nucleic acid encoding it), (ii) A step of evaluating the reporter polypeptide activity in the extra-target organ obtained from both subjects, (iii) The step of comparing the reporter polypeptide activity in the extra-target organ obtained from both subjects, thereby determining whether and / or to what extent the composition remains localized at the administration site (comparison with a reference composition).

[0172] Other specifications and details described in the above sections may also apply to the method. Therefore, instead of evaluating reporter polypeptide activity, those skilled in the art can quantify (the therapeutic or active agent) by other means, such as qPCR, ligand binding assays (e.g., ELISA), HPLC, mass spectrometry, a combination of HPLC and mass spectrometry, and / or a combination thereof, selected from the group.

[0173] Those skilled in the art can use the methods described above in the context of therapeutic compositions, cosmetic compositions, therapeutic methods, etc., provided herein to evaluate whether and / or to what extent a composition remains localized.

[0174] As described above, if the composition remains localized at the administration site / target organ / target tissue, it becomes possible to reduce the amount of (therapeutic agent or activator) administered, and also to reduce the side effects of the administered composition.

[0175] Accordingly, this specification further provides a method for determining the (reduced) amount of (therapeutic or cosmetic agent) in a composition (as described herein) administered to a target organ. The amount of the (therapeutic or cosmetic agent) is reduced compared to a reference composition (e.g., a composition containing MC3), and preferably the amount of the (therapeutic or cosmetic agent) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17% compared to the amount contained in the reference composition. %, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54 The amount of the therapeutic agent is reduced by %, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (any value within these percentage ranges is also assumed herein, and a larger percentage increase is preferable), preferably such that the (reduced) amount of the therapeutic agent has a therapeutic effect essentially equivalent to the amount of the therapeutic agent in the reference composition.

[0176] Those skilled in the art can use the methods described above in the context of therapeutic compositions, cosmetic compositions, therapeutic methods, etc., provided herein to evaluate whether a reduced amount of agent is usable, and preferably whether an equivalent therapeutic / cosmetic effect can be obtained. Other specifications and details described in the above sections may also be applied to the methods.

[0177] Therefore, this specification further provides a method for determining the (reduced) amount of side effects caused by a composition (as described in the present invention) when administered to a target organ. The amount of the side effect is reduced compared to the amount of the side effect caused by the reference composition (e.g., a composition containing MC3), preferably by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 5% The decrease is by 4%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (any value within these percentage ranges is also assumed herein, and a larger percentage increase is preferable), preferably such that the administered composition (as described herein) has a therapeutic effect essentially equivalent to the amount of therapeutic agent in the reference composition.

[0178] Those skilled in the art can further use such methods in the context of the therapeutic compositions, cosmetic compositions, therapeutic methods, etc., provided herein, to evaluate whether and / or to what extent side effects can be reduced, preferably while maintaining equivalent therapeutic / cosmetic effects. Other specifications and details described in the above sections of this specification may also be applied to such methods.

[0179] In the context of the present invention, the systemic distribution of a (therapeutic or cosmetic) agent is preferably evaluated based on a blood sample of the subject being treated. In this context, the blood sample may be a whole blood sample, a plasma sample, a serum sample, or other similar samples.

[0180] Therefore, by limiting one or more (therapeutic or effective) agents to the tissue, organ, and / or anatomical region being treated, it is possible to reduce the dose of those one or more (therapeutic or effective) agents administered by up to 20%, within any range, including but not limited to reductions of 1-20%, 5-15%, or 10-20%.

[0181] Therefore, by limiting the one or more (therapeutic or effective) agents to the tissue, organ, and / or anatomical region to be treated, the number of administrations of the one or more (therapeutic or effective) agents is reduced, preferably by about 5% or less, more preferably by about 10% or less, even more preferably by about 20% or less, even more preferably by about 30% or less, even more preferably by about 40% or less, even more preferably by about 50% or less, even more preferably by about 60% or less, even more preferably by about 70% or less, even more preferably by about 80% or less, and most preferably by about 90% or less.

[0182] Therefore, by limiting the one or more (therapeutic or effective) agents to the tissue, organ, and / or anatomical region to be treated, the toxicity and / or related toxicity caused by the accumulation of the one or more (therapeutic or effective) agents in off-target organs is reduced, preferably, the toxicity and / or related toxicity caused by the one or more therapeutic agents is reduced in the liver, brain, kidneys, heart, and / or spleen. In the context of the present invention, off-target organs / off-target tissues / off-target sites etc. refer to organs / tissues / sites etc. that are not the (primary) target organs / tissues / sites etc. In contrast, in the context of the present invention, the (primary) target organs / tissues / sites etc. refer to organs / tissues / sites etc. that are treated with the compositions provided herein.

[0183] Therefore, by limiting the one or more (therapeutic or effective) agents to the target tissue, organ, and / or anatomical region, the off-target effects caused and / or associated with the one or more (therapeutic or effective) agents are reduced and / or avoided, preferably, the off-target effects caused and / or associated with the one or more (therapeutic or effective) agents are reduced in the liver, brain, kidneys, heart, and / or spleen.

[0184] As described above, and as illustrated in Figures 7 and 8, for example, the compositions provided herein locally restrict the diffusion of at least the (therapeutic or effective) agent contained therein, but this advantageous effect was surprisingly lost upon co-administration with hyaluronidase. Therefore, it is preferable that the (therapeutic or cosmetic) compositions provided herein are not administered in co-administration with one or more hyaluronidases and / or enzymes having hyaluronidase activity.

[0185] The compositions provided herein are suitable for therapeutic and / or cosmetic use and are not particularly limited in that they are locally limited to the administration site, have extended retention, do not exhibit systemic distribution, or otherwise similar.

[0186] However, the carrier is preferably a lipid nanoparticle (LNP), lipidoid nanoparticle (LiNP), liposome, micelle, emulsion, nanostructured lipid carrier (NLCs), or lipid-drug complex (LDC), and / or the agent is preferably formulated as a lipid nanoparticle (LNP), lipidoid nanoparticle (LiNP), liposome, micelle, emulsion, nanostructured lipid carrier (NLCs), or lipid-drug complex (LDC), and preferably as a LNP or LiNP. Therefore, in the context of the present invention, when nanoparticles / particles / complexes / LiNP / LNP etc. are referred to herein, this refers to a specific embodiment of the carrier contained in the composition provided herein. Generally, the definition for LNP may also apply to LiNP and vice versa, with the exception that LNP contains at least one ionizable lipid and LiNP contains at least one ionizable lipid.

[0187] One aspect of the present invention relates to a pharmaceutical composition comprising the nucleic acid (e.g., RNA or mRNA) of the present invention, the nucleic acid (e.g., RNA or mRNA) vaccine vector of the present invention, or the nucleic acid (e.g., RNA or mRNA) vaccine of the present invention, and a pharmaceutically acceptable carrier, excipient, or diluent.

[0188] The mRNA or mRNA vaccine of the present invention can be advantageously combined in a pharmaceutical composition with further components and / or compounds that facilitate the delivery of mRNA to target cells or target tissues or enhance its stability. One possibility in this regard is to form the RNA into liposomes or nanoparticles with suitable substances as described herein, for example, the substances described in EP3013964B1 (the entire specification is incorporated by reference). In particular, the mRNA or mRNA vaccine of the present invention can be formulated with liposomes to produce lipoplexes or with next-generation lipid nanocarriers, such as lipid nanoparticles (LNPs), lipidoid nanoparticles (LiNPs), nanostructured lipid carriers, and / or cationic lipid-nucleic acid complexes.

[0189] In some embodiments, the nucleic acids of the present invention can be delivered to target cells and / or target tissues in vivo, ex vivo, and / or in vitro using LNPs or LiNPs. LNPs and LiNPs are distinguished from other carriers by their small size, uniform size distribution, and structure, and are particularly suitable for immunization of subjects. Those skilled in the art know how to manufacture LNPs and LiNPs. The manufacture of LNPs or LiNPs involves mixing lipids or lipidoids, such as phospholipids, cholesterol, and other specialty lipids, in a solvent such as alcohol. This mixture is then subjected to a process called nanoprecipitation. This is a process in which the lipid solution is rapidly mixed with a non-solvent, such as nucleic acids dissolved in water, under controlled temperature, pressure, and stirring speed. In this process, the lipids self-assemble to form complex nanoscale structures that trap and protect the therapeutic nucleic acids of the present invention. The nanoparticles may also be further modified with various surface coatings, such as polyethylene glycol (PEG), to improve stability and reduce the tendency to be cleared by the immune system.

[0190] The compositions provided herein may further comprise one or more stabilizers, adjuvants, and / or immunomodulators. Such stabilizers may be defined above or below herein, and preferably the stabilizers may be triblock polymers (i.e., component (p)) as defined herein. Generally, stabilizers (e.g., cholesterol, polyethylene glycol, poloxamer) may help stabilize the composition (e.g., stabilizing the lipid bilayer or improving the structural integrity of nanoparticles).

[0191] In the context of the present invention, the adjutant may include, for example, a CPG oligonucleotide, and may be particularly included in the context of the vaccine composition provided herein.

[0192] LiNP may optionally contain mRNA, an ionizable lipid or ionizable lipidoid, and a helper lipid as defined below as component (a). Optionally, LiNP may also contain a triblock copolymer as component (p), comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks as described above.

[0193] In the context of the present invention, the surfactant may be a nonionic surfactant, and may optionally be at least one nonionic surfactant selected from aliphatic alcohol ethoxylates, fatty acid ethoxylates, block copolymers of ethylene oxide and propylene oxide, alkylphenol ethoxylates or oligomers of alkylphenol ethoxylates, fatty acid esters of sorbitol, ethoxylated fatty acid esters of sorbitol, fatty acid esters of glycerol, ethoxylated castor oil and ethoxylated vitamin E. Preferably, the surfactant is selected from the list consisting of poloxamer 188 (P188), poloxamer 338 (P338), poloxamer 407 (P407), Tween 20, Tween 80, BRIJ35, tyloxapole, VitE-PEG1000, and / or Kolliphor EL.

[0194] Preferably, the surfactant is a (tri)block copolymer of ethylene oxide and propylene oxide, more preferably a poloxamer, even more preferably a poloxamer selected from the list consisting of poloxamers 188, 338, and / or 407, most preferably poloxamer 188 (i.e., P188).

[0195] As component (a), the nanoparticles contained in the pharmaceutical composition of the present invention may, for example, be in the form of a formulation for intramuscular or aerosol administration, and may contain mRNA encoding one or more antigens, the one or more antigens being selected from the group consisting of viral antigens, bacterial antigens, cancer and / or tumor-related antigens, and / or allergens.

[0196] Nanoparticles in a pharmaceutical composition may further comprise ionizable lipids or ionizable lipidoids. This is understood to encompass the possibility that nanoparticles may comprise combinations of different ionizable lipids, combinations of different ionizable lipidoids, or combinations of one or more ionizable lipids and one or more ionizable lipidoids. Nanoparticles used in the context of the present invention typically comprise mRNA(a) and cationic lipids or cationic lipidoids as ionizable lipids or ionizable lipidoids(b), and are in the form of mixtures of these components.

[0197] The ionizable lipids and / or ionizable lipidoids applicable in the context of the present invention and therefore assumed are disclosed in WO 2014 / 207231, the entire document of which is incorporated herein by reference.

[0198] The pharmaceutical composition or mRNA vaccine according to the present invention may optionally contain a LiNP containing an ionizable lipidoid of formula (bI). [ka] Variables a, b, p, m, n and R 1A ~R 6A R is defined as follows: a is 1 and b is an integer between 2 and 4, or a is an integer between 2 and 4 and b is 1. p is 1 or 2. m is 1 or 2, n is 0 or 1, and m+n is 2 or greater. 1A ~R 6A These are, independently of each other, hydrogen, CH2CH(OH)R 7A CH(R 7A )-CH2-OH, -CH2-CH2-C(=O)-OR 7A , or CH2R 7A Selected from R. 7A The receptor ligand is selected from C3-C18 alkyl groups or C3-C18 alkenyl groups having one CC double bond, amino group protecting groups, -C(NH)-NH2 groups, polyethylene glycol chains, and receptor ligands. However, R 1A ~R 6Aat least two residues among are -CH2-CH(OH)-R 7A , -CH(R 7A )-CH2OH, -CH2CH2-C(=O)-O-R 7 , -CH2CH2-C(=O)-NH-R 7A or -CH2R 7 wherein R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond. One or more nitrogen atoms contained in the compound of formula (b-I) are optionally protonated to form a positively charged compound.

[0199] Accordingly, the composition according to the present invention comprises an ionizable lipidoid, and the ionizable lipidoid may be a compound of formula (b-I).

Chemical Formula

[0200] Therefore, the composition according to the present invention comprises an ionizable lipidoid, which may be a compound of formula (bI). [ka] a is 1 or 2 and b is an integer between 1 and 4, or a is an integer between 1 and 4 and b is 1 or 2. p is 1 or 2. m is 1 or 2. n is 0 or 1. m+n is 2 or greater. R 1A ~R 6A These are, independently of each other, hydrogen, CH2CH(OH)R 7A CH(R 7A )-CH2-OH, -CH2-CH2-C(=O)-OR 7A -CH2-CH2-C(=O)-NH-R 7A , and CH2R 7A Selected from R. 7A The receptor ligand is selected from C3-C18 alkyl groups, C3-C18 alkenyl groups having one CC double bond, amino protecting groups, -C(NH)-NH2 groups, polyethylene glycol chains, and receptor ligands. 1A ~R 6A At least two of these residues are -CH2-CH(OH)-R 7A ,-CH(R 7A )-CH2OH, -CH2-CH2-C(=O)-OR 7A -CH2-CH2-C(=O)-NH-R 7A , and -CH2R 7A Selected from, here R 7AThe C3-C18 alkyl group is selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one C-C double bond. Additionally, one or more nitrogen atoms in the compound of formula (bI) are protonated as needed to form a compound with one or more positive charges. Preferably, variables a, b, p, m, n and R 1A ~R 6A R is defined as follows: a is 1 and b is an integer between 2 and 4, or a is an integer between 2 and 4 and b is 1. p is 1 or 2. m is 1 or 2. n is 0 or 1. m+n is 2 or greater. 1A ~R 6A These are, independently of each other, hydrogen, CH2CH(OH)R 7A CH(R 7A )-CH2-OH, -CH2-CH2-C(=O)-OR 7A -CH2CH2C(=O)-NH-R 7A , and CH2R 7A Selected from R. 7A The receptor ligand is selected from C3-C18 alkyl groups, C3-C18 alkenyl groups having one CC double bond, amino protecting groups, -C(NH)-NH2 groups, polyethylene glycol chains, and receptor ligands. 1A ~R 6A At least two of these residues are -CH2-CH(OH)-R 7A ,-CH(R 7A )-CH2OH, -CH2CH2-C(=O)-OR 7A -CH2CH2-C(=O)-NH-R 7A , and -CH2R 7A Selected from, here R 7A The compounds are selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one C-C double bond. Additionally, one or more nitrogen atoms in the compound of formula (bI) are protonated as needed to form a compound with one or more positive charges.

[0201] The composition according to the present invention comprises an ionizable lipidoid, which may be a compound of formula (b-II). [ka] a is 1 or 2, preferably 1. b is 1 or 2, preferably 2. R 1A ~R 6A It is defined as described above (for example, as the compound of formula (bI)). In addition, one or more nitrogen atoms in the compound of formula (b-II) are protonated as needed to form a compound with one or more positive charges.

[0202] In this context, R 7A The C10-C12 alkyl group is preferably selected from C8-C16 alkyl groups or C8-C18 alkenyl groups having one C16 double bond, more preferably selected from C8-C12 alkyl groups or C8-C12 alkenyl groups, and most preferably selected from C10-C12 alkyl groups or C10-C12 alkenyl groups.

[0203] Furthermore, it is generally preferable here that the ionizable lipidoid has a structure that conforms to the following formula (IVb) or (IVc). 1 -NR 2 -CH2-(CH2)a-NR 3 -CH2-(CH2)b-NR 4 -CH2-(CH2)a-NR 5 -R 6 (IVb) R 1 -NR 2 -CH2-CH2-NR 3 -CH2-CH2-CH2-NR 4 -CH2-CH2-NR 5 -R 6 (IVc)

[0204] a, ear, R 1 ~R 6 is defined as any of the above, and one or more nitrogen atoms shown in formula (IVc) may be protonated to give a cationic lipidoid.

[0205] If necessary, the cationic lipidoid formula (bI) is R 1A ~R 6AAt least two of these, and optionally at least three, or at least four, are CH2CH(OH)R 7A CH(R 7A )CH2OH, CH2CH2C(=O)OR 7A CH2CH2C(=O)NHR 7A and CH2R 7A Selected from, here R 7A The C3-C18 alkyl group is selected from a C3-C18 alkyl group or a C3-C18 alkenyl group having one CC double bond.

[0206] If necessary, the ionizable lipidoid contained in the compositions described herein may be an ionizable lipidoid according to formula (bI), where R 1A ~R 6A CH2CH(OH)R 7A -CH2-CH2-C(=O)-OR 7A -CH2CH2-C(=O)-NH-R 7A Selected independently from each other, R 7A It is defined as described above or below.

[0207] Therefore, the ionizable lipidoid contained in the composition described herein may be an ionizable lipidoid according to formula (bI), where R 1A ~R 6A These are, independently of each other, hydrogen, CH2CH(OH)R 7A -CH2-CH2-C(=O)-OR 7A -CH2CH2-C(=O)-NH-R 7A Selected from, R 7A is selected from C3-C18 alkyl and C3-C18 alkenyl having one CC double bond, and R 1A ~R 6A At least three, preferably at least four, of these are CH2CH(OH)R 7A -CH2-CH2-C(=O)-OR 7A , and -CH2-CH2-C(=O)-NH-R 7A Selected from, here R 7AThe C3-C18 alkyl group is selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one CC double bond.

[0208] In any embodiment, the compound of formula (bI) is the compound of formula (b-Ib), and the ionizable lipidoid comprises or consists of the lipidoid compound of the following formula (b-Ib). [ka]

[0209] R 1A ~R 6A The definition is the same as in formula (bI) (including preferred embodiments). Alternatively, one or more nitrogen atoms shown in formula (b-Ib) may be protonated as needed to form a protonated compound having a positive charge.

[0210] Therefore, in a particularly preferred embodiment, the ionizable lipidoid includes or comprises the lipidoid of formula (b-Ib) or its protonated form, R 1A ~R 6A It is hydrogen and CH2CH(OH)R 7A Selected independently from each other, R 7A The C8-C18 alkyl group is selected from C8-C18 alkyl groups and C8-C18 alkenyl groups having one CC double bond, except R 1A ~R 6A At least two of them are -CH2-CH(OH)-R 7A And more preferably, at least three, and even more preferably at least four, -CH2-CH(OH)-R 7A And here R 7A The C8-C18 alkyl group is selected from C8-C18 alkyl groups and C8-C18 alkenyl groups having one CC double bond.

[0211] In the context of the present invention, formulas (bI) and (b-1) are interchangeable.

[0212] In certain embodiments, the mRNA vaccine or pharmaceutical composition according to the present invention may include LiNP nanoparticles containing a cationic lipidoid of formula (bV) (hereinafter also referred to as "dL_05", and the (R)-enantiomer of the compound of formula (bV) is also referred to as "dL_05(R)") and / or formula (b-VII). [ka] [ka]

[0213] In certain embodiments, the mRNA vaccine or pharmaceutical composition according to the present invention may include LiNP nanoparticles containing a cationic lipidoid of formula (b-XI) and / or formula (b-XII). [ka] [ka]

[0214] The inventors have found that certain ionizable lipidoids used in the context of the present invention are particularly biodegradable, which may be particularly useful. Therefore, in certain embodiments, the composition comprises an ionizable lipidoid comprising or consisting of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII). [ka] [ka]

[0215] In the compositions for use or cosmetic compositions described herein, the ionizable lipidoid comprises or consists of a compound of formula (b-IX) or a compound of formula (bX), preferably a compound of formula (bX). [ka] [ka]

[0216] As described above, and as shown in attached Example 10, the inventors have found that combinations of different ionizable lipidoids can also be used in the context of the present invention. In particular, Example 10 shows that a combination of the compound of formula (b-IX) and the compound of formula (bX) also results in the (desired) local retention of the administered composition.

[0217] Therefore, in the context of the present invention, the administered composition (or its carrier) may contain at least two ionic lipids and / or at least two ionic lipidoids. Preferably, the at least two ionic lipids and / or the at least two ionic lipidoids are two ionic lipids and / or two ionic lipidoids.

[0218] The at least two ionic lipids and / or the at least two ionic lipidoids may be defined as any of the above. Therefore, the at least two ionic lipids and / or the at least two ionic lipidoids may be, for example, compounds of formula (b-VI), (bV), (bI), (b-II), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII). In the context of the present invention, it is understood that the at least two ionic lipids or the at least two ionic lipidoids are not identical / different (e.g., a compound of formula (b-IX) and a compound of formula (bX)). In a preferred embodiment, the administered composition (or carrier thereof) comprises a lipidoid of formula (b-IX) and a lipidoid of formula (bX).

[0219] In the context of the present invention, the administered composition may contain ionizable lipids or ionizable lipidoids. In this context, it is preferable that the ionizable lipids (or ionizable lipidoids) are identical or different. In other words, it may be preferable that the composition contains only identical ionizable lipids (or identical ionizable lipidoids), i.e., that the composition does not contain different ionizable lipids (and / or different ionizable lipidoids). For example, the sole lipidoid in the composition may be a compound of formula (bI), (b-II), (bV), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII).

[0220] In the context of the present invention, the terms “cationic lipidoid,” “ionizable lipidoid,” and “lipidoid” are interchangeable without being bound by theory. Similarly, the terms “cationic lipid” and “ionizable lipid” are also interchangeable herein.

[0221] In the compositions provided herein, the ionizable lipidoid is a compound of formula (bV), preferably, (a) The R isomer of formula (bV), and / or (b) Present in a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%.

[0222] The LiNP of the pharmaceutical composition may contain one or more helper lipids as described below. In particular, the agents and reagents for delivering and / or introducing mRNA to target cells or target tissues as described herein, as well as the lipids and lipidoids described herein, may be combined with one or more (e.g., two, three, or four) other lipids (e.g., cholesterol, DPPC, DOPE, and / or PEG lipids (e.g., DMPE-PEG, DMG-PEG2000)). These other lipids support the desired function of the therapeutic agent and lipidoid (assistance and / or enhancement of RNA delivery and / or introduction to cells or tissues, and improvement of transfection efficiency) and each functions as a “helper lipid.” Specific examples of such “helper lipids” include cholesterol, DPPC, DOPE, and / or PEG lipids (e.g., DMPE-PEG, DMG-PEG (e.g., DMG-PEG2000)). The other lipids (e.g., “helper lipids”) may be part of the complexes / particles disclosed herein. Those skilled in the art can easily prepare the complexes / particles according to the present invention. Other examples of lipids (e.g., "helper lipids") are also known in the art. In the context of the present invention, such helper lipids are preferably selected from the group consisting of (a) to (c), (a) phospholipids, (b) sterols, and / or (c) stealth lipids.

[0223] Suitable phospholipids are known in the art. Examples of such phospholipids include dipalmitoylphosphatidylcholine (DPPC), DMPC, DSPC, or DOPC. In the context of the present invention, DPPC is a preferred phospholipid. Suitable sterols are also known in the art. A typical and preferred sterol is cholesterol. Suitable stealth lipids are also known in the art. Examples of such stealth lipids include DMG-PEG2000 and N-TETAMINE-pSaR25. In the context of the present invention, DMG-PEG2000 is a preferred stealth lipid. Those skilled in the art can easily select other suitable lipids (e.g., "helper lipids") and the ratio of cationic lipids to other lipids (e.g., "helper lipids"). Such ratios, as the molar ratio of cationic lipid to other lipids (e.g., "helper lipids"), include [1-4:1-5], [3-4:4-6], [about 4:about 5], [about 4:about 5.3] (narrower ranges are preferred). For example, the cationic lipidoid may be combined with three other lipids, namely DPPC, cholesterol, and DMG-PEG2000, with a molar ratio of approximately 8.0:5.3:4.4:0.9, or more specifically 8.00:5.29:4.41:0.88. Preferably, the lipidoids of formulas (bI), (b-Ib), (b-II), (bV), (b-VI), and (b-VII) are as described above and are used together with the helper lipids DPPC and cholesterol, and the PEG lipid DMG-PEG2000, in a molar ratio of 8.00:5.29:4.41:0.88 for the formulation of lipidoid nanoparticles. In preferred embodiments, the ionizable lipidoid (e.g., the lipidoid of formula bV) accounts for 20% to 60%, more preferably 25% to 52%, of the total lipid content of the composition provided herein. In preferred embodiments, phospholipids (e.g., DPPC) account for 10% to 60%, more preferably 13% to 53%, of the total lipid content of the composition provided herein. In preferred embodiments, sterols account for 10% to 30%, more preferably 12% to 29%, of the total lipid content of the composition provided herein.In preferred embodiments, stealth lipids account for 1% to 10%, more preferably 2% to 9%, of the total lipid content of the composition provided herein. In the context of the present invention, the percentage of total lipid content is expressed in weight percent (i.e., for example, 25% ionizable lipidoids means that ionizable lipidoids account for 25% of the weight of the composition). In preferred embodiments, the N / P ratio of the composition provided herein or the total lipids contained in the composition is 4 to 18, more preferably 6 to 16, and most preferably 8.

[0224] In a preferred embodiment, the composition provided herein comprises about 43.1% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 28.5% of DPPC, about 23.7% of cholesterol, and about 4.7% of DMG-PEG2000, with an N / P ratio of about 8.

[0225] In a preferred embodiment, the composition provided herein comprises about 34% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 43% of DPPC, about 19% of cholesterol, and about 4% of DMG-PEG2000, with an N / P ratio of about 8.

[0226] In other preferred embodiments, the compositions provided herein comprise about 50% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 33% of DPPC, about 12% of cholesterol, and about 5% of DMG-PEG2000, with an N / P ratio of about 8.

[0227] In other preferred embodiments, the compositions provided herein comprise about 44.4% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 29.3% of DPPC, about 24.2% of cholesterol, and about 2% of DMG-PEG2000, with an N / P ratio of about 8.

[0228] In other preferred embodiments, the compositions provided herein comprise about 25.6% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 52.3% of DPPC, about 14% of cholesterol, and about 8.1% of DMG-PEG2000, with an N / P ratio of about 8.

[0229] In other preferred embodiments, the compositions provided herein comprise about 51.5% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 13.9% of DPPC, about 28.7% of cholesterol, and about 5.9% of DMG-PEG2000, with an N / P ratio of about 16.

[0230] In other preferred embodiments, the compositions provided herein comprise about 44.4% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 29.3% of DPPC, about 24.2% of cholesterol, and about 2% of DMG-PEG2000, with an N / P ratio of about 16.

[0231] In other preferred embodiments, the compositions provided herein comprise about 22.6% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 39.2% of DPPC, about 32.2% of cholesterol, and about 6% of DMG-PEG2000, with an N / P ratio of about 6.

[0232] In other preferred embodiments, the compositions provided herein comprise about 42% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 39.2% of DPPC, about 32.2% of cholesterol, and about 7% of DMG-PEG2000, with an N / P ratio of about 6.

[0233] In other preferred embodiments, the compositions provided herein comprise about 50% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 24% of DMPC, about 19% of cholesterol, and about 7% of N-TETAMINE-pSaR25, with an N / P ratio of about 8.

[0234] In other preferred embodiments, the compositions provided herein comprise about 36% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 45% of DMPC, about 12% of cholesterol, and about 7% of N-TETAMINE-pSaR25, with an N / P ratio of about 8.

[0235] In other preferred embodiments, the compositions provided herein comprise about 36% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 45% of DMPC, about 12% of cholesterol, and about 7% of DMG-PEG2000, with an N / P ratio of about 8.

[0236] In other preferred embodiments, the compositions provided herein comprise about 50% of the (R)-enantiomer of the ionizable lipidoid of formula (bV), about 24% of DMPC, about 19% of cholesterol, and about 7% of N-TETAMINE-pSaR25, with an N / P ratio of about 8.

[0237] In other preferred embodiments, the compositions provided herein comprise about 21.6% of ionizable lipidoid of formula (b-IX), about 21.6% of ionizable lipidoid of formula (bX), about 28.5% of DMPC, about 23.7% of cholesterol, and about 4.7% of DMG-PEG2000, with an N / P ratio of about 8.

[0238] In other preferred embodiments, the compositions provided herein comprise approximately 43.1% of an ionizable lipidoid of formula (b-IX), approximately 28.5% of DPPC, approximately 23.7% of cholesterol, and approximately 4.7% of DMG-PEG2000, with an N / P ratio of approximately 8.

[0239] In other preferred embodiments, the compositions provided herein comprise about 43.1% of an ionizable lipidoid of formula (b-XI), about 28.5% of DPPC, about 23.7% of cholesterol, and about 4.7% of DMG-PEG2000, with an N / P ratio of about 8.

[0240] In other preferred embodiments, the compositions provided herein comprise approximately 43.1% of an ionizable lipidoid of formula (b-XII), approximately 28.5% of DPPC, approximately 23.7% of cholesterol, and approximately 4.7% of DMG-PEG2000, with an N / P ratio of approximately 8.

[0241] In the context of the detailed compositions described above, other descriptions herein (for example, those relating to therapeutic agents or active ingredients) may also apply.

[0242] Unless otherwise specified, the (ionizable) lipidoid or (ionizable) lipid according to the present invention is generally preferred to exist as either a (R)-enantiomer or a (L)-enantiomer, with the (R)-enantiomer being preferred. Accordingly, unless otherwise specified, the examples used herein use the (R)-enantiomer of the ionizable lipid or ionizable lipid in question. However, the present invention also envisions combinations of (R)-enantiomers and (L)-enantiomers (i.e., racemic mixtures). In the context of the present invention, terms such as "(R)-enantiomer" and "R-isomer" are mutually interchangeable.

[0243] In some embodiments, the mRNA vaccine or pharmaceutical composition of the present invention comprises a LiNP containing the following components: (a) mRNA according to the present invention, (b) Cationic lipidoids of formula (bI), (b-II), (b-Ib), (bV), (b-VI), (b-VII), or (b-VIII), and as needed (c) One or more helper lipids, helper lipids are (c1) DPPC, and / or, (c2) Cholesterol, and / or, (c3) Selected from PEG lipid DMG-PEG2000, Components (b) and (c1) to (c3) are present as needed, and components (b) and (c1) to (c3) are present as needed in molar ratios of approximately 8.0:5.3:4.4:0.9, respectively. If necessary, the LNP may further comprise a triblock copolymer comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks as component (p), where component (p) is defined in the vehicle described above.

[0244] Therefore, the composition according to the present invention, preferably, (a) one or more therapeutic agents and / or one or more active agents, (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) one or more pharmaceutically acceptable excipients or diluents as necessary, A carrier equipped with, One or more (therapeutic and / or active) agents may be defined in either of the above or below provisions of this specification, and carriers may also be defined in either of the above or below provisions of this specification. Accordingly, the ionizable lipids and / or ionizable lipidoids may also be defined in either of the above or below provisions of this specification. Accordingly, the one or more helper lipids may also be defined in either of the above or below provisions of this specification. Accordingly, the one or more pharmaceutically acceptable excipients or diluents may also be defined in either of the above or below provisions of this specification.

[0245] A composition comprising the R isomer of formula (bV), i.e., formula (b-VI), with lipid DPPC and cholesterol, and PEG lipid DMG-PEG2000 in a molar ratio of 8.00:5.29:4.41:0.88 is also referred herein as "Formulation I" or LF92. A composition comprising the lipidoid of formula (b-VII) with lipid DPPC and cholesterol, and PEG lipid DMG-PEG2000 in a molar ratio of 8.00:5.29:4.41:0.88 is also referred herein as "Formulation II". In some embodiments, the LiNP in the pharmaceutical composition of the present invention comprises Formula I and / or Formula II.

[0246] The ratio of cationic lipidoid to mRNA in LiNP is controlled by the molar ratio (N / P ratio) of nitrogen atoms (N) in the cationic lipidoid to phosphate groups (P) in the mRNA. Other lipid components are calculated according to the target molar lipid ratio to cationic lipidoid described above, and may be, for example, 8.00:5.29:4.41:0.88 for cationic lipidoid, DPPC, cholesterol, and PEG lipid DMG-PEG2000, respectively. In some embodiments, the final N / P ratio between the cationic lipidoid of formula (bI), (b-II), (b-Ib), (bV), (b-VI), (b-VII), (b-VIII), (b-IX), (bX), (b-XI) and / or (b-XII) and one phosphate group of the mRNA molecule is preferably 4 to 44, more preferably 4 to 16, and even more preferably 8 nitrogen atoms of the cationic lipidoid of formula (bI), (b-Ib), (bV), (b-VI), (b-VII), (b-VIII), (b-IX), (bX), (b-XI) and / or (b-XII) are present per one phosphate group of the mRNA molecule.

[0247] The lipid or lipidoid nanoparticles contained in the suspension formulation and aerosol according to the present invention preferably have a Z-mean diameter of 10 to 500 nm, more preferably in the range of 10 to 250 nm, and even more preferably in the range of 20 to 200 nm. The particle size described is the hydrophilic diameter of the particle measured by dynamic light scattering (DLS). The measurement is generally performed at 25°C.

[0248] The polydispersity index of the nanoparticles contained in the suspension formulation and aerosol according to the present invention is preferably in the range of 0.05 to 0.4, more preferably in the range of 0.05 to 0.2. The polydispersity index can be measured by dynamic light scattering (DLS). The measurement is generally performed at 25°C.

[0249] In some embodiments, the composition comprises a pharmaceutically acceptable carrier and / or adjuvant. For example, the adjuvant may be alum, Freund's complete adjuvant, a biological adjuvant, or an immunostimulatory oligonucleotide (e.g., CpG oligonucleotide).

[0250] The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventionally known. Remington's Pharmaceutical Sciences (by EW Martin, Mack Publishing Co., Easton, PA, 15th edition (1975)) describes compositions and formulations suitable for the pharmaceutically effective delivery of one or more therapeutic compositions and additional pharmaceuticals.

[0251] Generally, the properties of the carrier depend on the type of administration route used. For example, parenteral formulations typically contain an injectable liquid, which may include pharmaceutically and physiologically acceptable liquids such as water, saline, equilibrium salt solutions, aqueous dextrose, or glycerol as the vehicle. In the case of solid compositions (e.g., in powder, tablet, or capsule form), conventional non-toxic solid carriers include, for example, pharmaceutical-grade mannitol, lactose, starch, or magnesium stearate. In addition to a biologically neutral carrier, the administered pharmaceutical composition may contain small amounts of non-toxic auxiliary substances such as humectants or emulsifiers, preservatives, or pH buffers, such as sodium acetate or sorbitan monolaurate.

[0252] If necessary, the mRNA vaccine of the present invention is administered intramuscularly.

[0253] If necessary, the mRNA vaccine of the present invention is administered intramuscularly, intradermally, subcutaneously, by needle or geen gun, or by electroporation.

[0254] If necessary, the mRNA, vector, pharmaceutical composition, or vaccine of the present invention may be administered via the respiratory system. In some embodiments, administration is carried out in a form that can be administered to the respiratory system via inhalation, nebulizer, spray, or droplet, such as a nasal spray or nasal droplet.

[0255] The pharmaceutical composition may contain a vehicle solution and / or a pharmaceutically acceptable carrier. The vehicle solution and / or pharmaceutically acceptable carrier may include, but are not limited to, physiological saline, buffered physiological saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition may be sterile, and the formulation may be suitable for the route of administration. The composition may contain small amounts of wetting agents or emulsifiers, or pH buffers. The composition may be a liquid solution, suspension, emulsion, tablet, capsule, sustained-release formulation, or powder. The composition may be formulated as a suppository using conventional binders and carriers (e.g., triglycerides). Oral formulations may contain standard carriers such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. Common pharmaceutical carriers, such as sterile physiological saline or sesame oil, may also be used. The medium may also contain conventional pharmaceutical adjuncts such as pharmaceutically acceptable salts for osmotic adjustment, buffers, and preservatives. Other media that can be used in the compositions and methods provided herein include ordinary physiological saline and sesame oil.

[0256] In the context of the present invention, the term “pharmaceutically acceptable carrier” may be used synonymously with “pharmaceutically acceptable excipient or diluent.” Therefore, the compositions provided herein generally include a carrier, and such carrier is: (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, (iii) optionally comprising one or more pharmaceutically acceptable excipients or diluents (i.e., also referred to herein as “pharmaceutically acceptable carriers”). Thus, in the context of the present invention, the carrier may optionally include one or more pharmaceutically acceptable carriers. As described above, the carrier of the present invention is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, a nanostructured lipid carrier (NLCs), or a lipid-drug conjugate (LDC), preferably LNP or LiNP. Thus, for example, the LNP may include one or more pharmaceutically acceptable excipients or diluents. In the context of the present invention, the carrier (e.g., LNP or LiNP) may further be contained in one or more pharmaceutically acceptable excipients or diluents, which may be defined herein either above or below. Such pharmaceutically acceptable excipients or diluents may also be referred to herein as “vehicle solution” or “pharmaceutically acceptable carrier.” In particular, the vehicle is any solution in a pharmaceutical composition in which LNP or LiNP can be suspended.

[0257] The vehicle solution and / or pharmaceutically acceptable carrier may contain a triblock copolymer comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks. Preferably, the triblock copolymer is an ABA-type triblock copolymer comprising one poly(propylene oxide) block B represented by formula (p-1). [ka] s is an integer between 15 and 67, preferably between 20 and 40. It also contains two poly(ethylene oxide) blocks A represented by formula (p-2). [ka] r is an integer from 2 to 130 independently for each block, preferably from 50 to 100, and more preferably from 60 to 90. Even more preferably, the triblock copolymer has the following structure. [ka] r and t are integers from 2 to 130, preferably from 50 to 100, more preferably from 60 to 90, and s is an integer from 15 to 67, preferably from 20 to 40. Most preferably, poloxamer P188 is used as the triblock copolymer.

[0258] The vehicle solution and / or carrier may contain the triblock copolymer in a dissolved form. However, as those skilled in the art will understand, this does not preclude the possibility that a certain amount of copolymer molecules are adsorbed onto lipid or lipidoid nanoparticles contained in the composition, and that these may be considered component (p) of the LNP / LiNP. Preferably, compositions for intramuscular administration or aerosol formation contain the triblock copolymer at a concentration of 0.05 to 5% (w / v) (i.e., grams per 100 mL), preferably 0.1 to 2%, based on the total volume of the composition. In addition to the triblock copolymer, other excipients may be present in the vehicle solution. Preferably, the vehicle solution further contains at least one of sucrose and NaCl, more preferably both sucrose and NaCl.

[0259] The pharmaceutical formulation according to the present invention can be easily prepared by, for example, a method including adding a triblock copolymer to a suspension containing a vehicle solution and lipids or lipidoid nanoparticles, or a method including adding lipids or lipidoid nanoparticles to a vehicle solution containing a triblock copolymer.

[0260] In the context of the present invention, the (therapeutic or active) agent or carrier may be encapsulated within a hydrogel or biocompatible matrix. Therefore, the LiNP / LNPs provided herein may be encapsulated within a hydrogel or biocompatible matrix.

[0261] As described above, the (pharmaceutical or cosmetic) compositions provided herein are particularly useful in that they result in local retention of the (therapeutic or active) agents contained herein. Therefore, particularly in the context of the pharmaceutical compositions provided herein, it is possible to induce local expression of therapeutically useful mRNA at the administration site, for example, and reduce accumulation in undesirable non-target tissues or organs, such as the liver. For this reason, in some embodiments, the present invention provides means and methods for vaccination / immunization (using the compositions provided herein).

[0262] Accordingly, the present invention provides a method for systemic immunization via local expression. In particular, the present invention provides an mRNA vaccine comprising the carrier described above. Accordingly, the present invention provides a method for immunizing a subject, comprising administering the subject a pharmaceutical composition comprising an effective amount of the mRNA vaccine, the pharmaceutical composition comprising a composition as defined herein, preferably for immunization of the subject against a pathogen, cancer antigen, or autoantigen.

[0263] If necessary, the mRNA used in this invention may include the RNA sequence of SEQ ID NO:1.

[0264] Furthermore, the present invention also provides an isolated RNA containing the sequence of SEQ ID NO:1 or its complementary strand, or an RNA sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleotide identity with the RNA sequence of SEQ ID NO:1 over its entire length, and that encodes the amino acid sequence of SEQ ID NO:2.

[0265] Furthermore, the present invention also provides isolated RNA encoding the amino acid sequence of SEQ ID NO:1. If necessary, the RNA may include an RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID 28, SEQ ID NO:29, or SEQ ID NO:30, or an RNA sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length with the RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID 28, SEQ ID NO:29, or SEQ ID NO:30, and that encodes the amino acid sequence of SEQ ID NO:1.

[0266] Furthermore, the present invention also provides isolated RNA encoding the amino acid sequence of SEQ ID NO:3. If necessary, the RNA may include an RNA sequence encoding the amino acid sequence of SEQ ID NO:3, or

[0267] Furthermore, as another aspect of the present invention, an isolated RNA encoding the amino acid sequence of SEQ ID NO:43 is also provided. Optionally, the RNA may contain the RNA sequence of SEQ ID NO:42, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length with the RNA sequence of SEQ ID NO:43. Optionally, the mRNA may be a modified mRNA containing modified nucleosides. Optionally, one or more modified nucleosides may be 5-iodouridine and 5-iodocytidine. Optionally, at least 50% of the uridine in the ORF may be modified. Optionally, at least 50% of the uridine in the mRNA may be modified. Optionally, at least 50% of the uridine in the ORF may be modified with m1ψ. If necessary, 5-50% of the uridine nucleotides may be 5-iodouridine and 5-50% of the cytidine nucleotides may be 5-iodocytidine. If necessary, 5-50% of the uridine nucleotides may be 2-thiouridine and 5-50% of the cytidine nucleotides may be 5-methylcytidine.

[0268] We found that mRNA immunogens encoding tethered coronavirus spike protein receptor-binding domains yield favorable immunogenicity (e.g., enhanced antibody response and / or increased immune response breadth).

[0269] The present invention also provides isolated mRNA encoding a polypeptide comprising the amino acid sequence of a coronavirus spike protein receptor-binding domain (RBD), the C-terminus of which is directly or via a linker amino acid sequence of up to 10 amino acid residues to the amino acid sequence of a transmembrane domain.

[0270] If necessary, the nucleic acids, RNA, or mRNA of the present invention may be in vitro transcription (IVT) products.

[0271] If necessary, the nucleic acids, RNA, or mRNA of the present invention may include a polyadenylation signal or a (poly(A)) tail downstream of the open reading frame (ORF) encoding the polypeptide.

[0272] If necessary, the nucleic acid, RNA, or mRNA of the present invention may contain one or more modified nucleosides.

[0273] If necessary, the modified nucleoside is selected from the following:

[0274] Pseudouridine, N1-methylpseuduridine, N1-ethylpseuduridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseuduridine, 2-thio-1-methylpseuduridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydrouridine, 2-thiopseuduridine, 4-methoxy-2-thiopseuduridine, 4-methoxypseuduridine, 4-thio-1-methylpseuduridine, 4-thiopseuduridine, 5-aza-uridine, dihydropseuduridine, 5-methoxyuridine, 5-ioduridine, 2'-O-methyluridine, 5-methylcytidine, 5-iodocytidine, N1-methyladenosine, N6-methyladenosine.

[0275] If necessary, one or more modified nucleosides may contain 1-methylpseuduridine (m1ψ) modifications. If necessary, one or more modified nucleosides may contain at least one N1-methylpseuduridine (N1ψ) modification.

[0276] If necessary, one or more modified nucleosides may be 5-iodouridine and 5-iodocytidine.

[0277] If necessary, at least 50% of the uridine in the ORF may be modified.

[0278] If necessary, at least 50% of the uridine in the ORF may be modified with m1ψ.

[0279] If necessary, 5-50% of the uridine nucleotides may be 5-iodouridine and 5-50% of the cytidine nucleotides may be 5-iodocytidine. If necessary, 5-50% of the uridine nucleotides may be 2-thiouridine and 5-50% of the cytidine nucleotides may be 5-methylcytidine.

[0280] Furthermore, the present invention also provides an mRNA vaccine vector containing the mRNA of the present invention.

[0281] Furthermore, the present invention also provides nucleic acids, RNA, or mRNA of the present invention, or nucleic acids, RNA, or mRNA vaccine vectors of the present invention, or nucleic acids, RNA, or mRNA vaccines of the present invention encapsulated in lipid nanoparticles (LNPs).

[0282] Furthermore, the present invention also provides a pharmaceutical composition comprising the nucleic acid, RNA or mRNA, nucleic acid, RNA or mRNA vaccine vector, or nucleic acid, RNA or mRNA vaccine, and a pharmaceutically acceptable carrier, excipient or diluent.

[0283] Furthermore, the present invention also provides for the use of the nucleic acid, RNA or mRNA, nucleic acid, RNA or mRNA vaccine vector, nucleic acid, RNA or mRNA vaccine, or pharmaceutical composition of the present invention as a pharmaceutical.

[0284] Furthermore, the present invention also provides the use of the nucleic acid, RNA or mRNA, nucleic acid, RNA or mRNA vaccine vector, nucleic acid, RNA or mRNA vaccine, or pharmaceutical composition of the present invention for the prevention, treatment, or improvement of coronavirus infection.

[0285] Furthermore, the present invention also provides for the use of the nucleic acid, RNA or mRNA, nucleic acid, RNA or mRNA vaccine vector, nucleic acid, RNA or mRNA vaccine, or pharmaceutical composition of the present invention in the manufacture of pharmaceuticals for the prevention, treatment, or improvement of coronavirus infection.

[0286] Furthermore, the present invention also provides a method for inducing an immune response to coronavirus in a subject, comprising administering to the subject an effective amount of the mRNA, mRNA vaccine vector, mRNA vaccine, or pharmaceutical composition of the present invention.

[0287] Furthermore, the present invention also provides a method for immunizing a subject against coronavirus, comprising administering to the subject an effective amount of the nucleic acid, RNA or mRNA, mRNA vaccine vector, nucleic acid, RNA or mRNA vaccine, or pharmaceutical composition of the present invention.

[0288] If necessary, the method of the present invention may include administering to a subject, as part of a prime boost regimen, a nucleic acid, RNA or mRNA, a nucleic acid, RNA or mRNA vaccine vector, a nucleic acid, RNA or mRNA vaccine, or a pharmaceutical composition of the present invention.

[0289] If necessary, the coronavirus may be a beta coronavirus.

[0290] If necessary, the beta-coronavirus may be a beta-coronavirus of lineage B or C.

[0291] If necessary, the beta-coronavirus may be a beta-coronavirus of lineage B.

[0292] If necessary, the beta-coronavirus of lineage B may be SARS-CoV or SARS-CoV-2.

[0293] If necessary, the beta-coronavirus of lineage C may be MERS-CoV.

[0294] If necessary, the beta-coronavirus may be a volatile organic compound (VOC).

[0295] If necessary, the beta-coronavirus may also be the VOC of SARS-CoV-2.

[0296] If necessary, the beta-coronavirus may be the beta, gamma, delta, or omicron VOC of SARS-CoV-2.

[0297] If necessary, the subjects may be human subjects.

[0298] The present invention provides a method for inducing an immune response to coronavirus in a subject, the method comprising administering to the subject an effective amount of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention.

[0299] The present invention also provides a method for immunizing a subject against a virus, the method comprising administering to the subject an effective amount of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention.

[0300] The effective dose is the amount that elicits an antigen-specific immune response in a subject.

[0301] If necessary, the method may include administering an effective amount of the mRNA, vector, pharmaceutical composition, or vaccine of the present invention to a subject who has been pre-serum-converted with mRNA, vector, pharmaceutical composition, or vaccine encoding or containing the full-length spike protein of coronavirus. If necessary, the coronavirus may be Salvecovirus. If necessary, the mRNA, vector, pharmaceutical composition, or vaccine of the present invention may contain or consist of SEQ ID NO:4 or SEQ ID NO:7.

[0302] Furthermore, according to the present invention, the mRNA, vector, pharmaceutical composition, or vaccine of the present invention can be used as a pharmaceutical product.

[0303] Furthermore, according to the present invention, the mRNA, vector, pharmaceutical composition, or vaccine of the present invention can be used for the prevention, treatment, or improvement of coronavirus infection.

[0304] Furthermore, the present invention provides for the use of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention in the manufacture of pharmaceuticals for the prevention, treatment, or improvement of coronavirus infection (including longcovid).

[0305] If necessary, the coronavirus may be a beta coronavirus.

[0306] If necessary, the beta-coronavirus may be a beta-coronavirus of lineage B or C.

[0307] If necessary, the beta-coronavirus may be a beta-coronavirus of lineage B.

[0308] If necessary, the beta-coronavirus of lineage B may be SARS-CoV or SARS-CoV-2.

[0309] If necessary, the beta-coronavirus of lineage C may be MERS-CoV.

[0310] If necessary, an immune response to multiple strains of B beta coronavirus may be induced.

[0311] If necessary, an immune response to SARS-1 and SARS-2 beta-coronaviruses may be induced.

[0312] If necessary, an immune response to SARS-1 and MERS beta-coronavirus may be induced.

[0313] If necessary, an immune response to SARS-2 and MERS beta-coronavirus may be induced.

[0314] If necessary, an immune response to SARS-1, SARS-2, and MERS beta-coronavirus may be induced.

[0315] If necessary, the beta-coronavirus may be a volatile organic compound (VOC).

[0316] If necessary, the beta-coronavirus may also be the VOC of SARS-CoV-2.

[0317] If necessary, the beta-coronavirus may be the VOC of SARS-CoV-2 strain B1.248 (Brazilian P1 strain).

[0318] If necessary, the beta-coronavirus may be the VOC of SARS-CoV-2 strain B1.351 (South Africa).

[0319] If necessary, the beta-coronavirus may be the beta, gamma, or delta VOC of SARS-CoV-2.

[0320] If necessary, the beta-coronavirus may be the beta-VOC of SARS-CoV-2.

[0321] If necessary, the beta-coronavirus may also be the gamma VOC of SARS-CoV-2.

[0322] If necessary, the beta-coronavirus may also be the delta-VOC of SARS-CoV-2.

[0323] If necessary, the beta-coronavirus may also be the alpha-VOC of SARS-CoV-2.

[0324] If necessary, the beta-coronavirus may also be the omicron VOC of SARS-CoV-2.

[0325] If necessary, the beta-coronavirus may be SARS-CoV-2 omicron BA.1.

[0326] If necessary, the beta-coronavirus may be SARS-CoV-2 omicron BA.2.

[0327] Whether or not an immune response to betacoronavirus has been induced can be easily determined using methods well known to those skilled in the art. For example, a pseudo-neutralization assay as described in the following examples can be used.

[0328] If necessary, the subjects may be human subjects.

[0329] As stated above, the compositions provided herein comprise one or more (therapeutic or activating) agents, the properties of which are not particularly limited. Such agents may comprise one or more of the following: growth factors, peptides, antioxidants, retinoids, cytokines, siRNAs, miRNAs, mRNAs, and asRNAs.

[0330] However, the agent is preferably the following: (a) Anionic therapeutic substances and / or, (b) A nucleic acid, preferably RNA, more preferably mRNA, miRNA and / or siRNA, even more preferably mRNA, most preferably mRNA comprising an open reading frame (ORF) encoding one or more polypeptides. In the context of the present invention, nucleic acids, particularly mRNA encoding one or more polypeptides, are preferred. In the context of the present invention, the term "mRNA comprising an open reading frame (ORF) encoding one or more polypeptides" may be used synonymously with "mRNA encoding one or more polypeptides," etc.

[0331] The one or more polypeptides (encoded by the mRNA) are not particularly limited, but may be, for example, growth factors, copper peptides, or cytokines. Preferred growth factors include, for example, epidermal growth factor (EGF), which stimulates skin growth and wound healing, and fibroblast growth factors (FGFs), which promote the proliferation of dermal fibroblasts and enhance skin elasticity. Preferred peptides include copper peptides, which stimulate collagen production and regenerate skin tissue, and palmitoyl pentapeptide-4 (i.e., matrixyl), which reduces wrinkles and improves skin texture. In this context, cytokines are preferably interleukins specifically modified to regulate inflammatory responses in the skin.

[0332] In one embodiment of the present invention, the one or more polypeptides (encoded by the mRNA) may include a reporter polypeptide. The reporter polypeptide is not particularly limited and is widely known to those skilled in the art, and includes, for example, luciferase and luminescent or fluorescent proteins such as green fluorescent protein (GFP). A preferred reporter polypeptide in the context of the present invention is luciferase (exemplified in SEQ ID NO: 46). The accompanying examples exemplify the local retention of a luciferase reporter polypeptide encoded by mRNA administered according to the present invention. Furthermore, it is assumed that a therapeutic active substance (e.g., one or more therapeutic polypeptides, or mRNA encoding one or more therapeutic polypeptides) may be administered together with such reporter polypeptide or mRNA encoding such reporter polypeptide. Furthermore, a fusion polypeptide or encoding mRNA in which a therapeutic polypeptide and a reporter polypeptide are (covalently) linked is also assumed. Means and methods for fusion / joining / linking two polypeptides or encoding regions are widely known to those skilled in the art. Such reporter peptides / proteins are particularly useful in (in vitro / ex vivo) methods for detecting / evaluating / determining whether the composition remains localized at the administration site, whether the composition does not essentially exhibit systemic distribution throughout the patient's body, or whether the composition has extended retention at the administration site, as described herein.

[0333] The therapeutic substance (i.e., therapeutic agent or active agent) may be selected from antioxidants or retinoids. Such antioxidants are preferably selected from vitamin C (ascorbic acid) for photoprotection, reduction of pigmentation and collagen stimulation, and coenzyme Q10 for reducing oxidative stress and preventing skin aging. A typical retinoid is retinol, which promotes skin regeneration, increases collagen production and reduces signs of aging.

[0334] As described above, such (therapeutic or cosmetic) agents are preferably nucleic acids, more preferably antisense RNA (asRNA), non-coding RNA or mRNA, even more preferably small interfering RNA (siRNA), microRNA (miRNA), mRNA, and most preferably mRNA.

[0335] The siRNA may preferably be an siRNA that targets a specific mRNA involved in melanin synthesis (for example, one that targets the TYR gene for skin whitening), or an siRNA that targets matrix metalloproteinase (MMP) mRNA to reduce collagen degradation and alleviate wrinkles.

[0336] The miRNA may preferably be a miRNA-145 inhibitor (i.e., a miRNA that targets miRNA-145) that enhances collagen production by dermal fibroblasts or suppresses hypertrophic scar formation, or a miRNA or miRNA mimic that can suppress the expression of genes involved in inflammation and aging.

[0337] The asRNA may preferably contain sequences that can suppress the expression of genes involved in undesirable skin conditions such as excessive pigmentation or excessive hair growth.

[0338] The mRNA may preferably encode an antioxidant or a growth factor, and may be an mRNA that is endogenously produced at the application site to improve the appearance and health of the skin.

[0339] The mRNA (molecule) in question is a protein, particularly a therapeutic protein, such as CFTR, erythropoietin (EPO), factor VIII, factor IX, chimeric antigen receptor (CAR) T cells, servibin (BIRC5) or its dominant-negative form, P53, vascular endothelial growth factor (VEGF), insulin, SARS-CoV-2 spike protein, α-synuclein, dystrophin, glucocerebrosidase (GCase), cytokines (such as interleukin-2 (IL-2), interleukin-10 (IL-10), interleukin-12 (IL-12)), interferons (interferon-α (IFN-α), interferon-β (IFN-β), interferon-γ (IFN-γ), and / or interferon-lambda (IFNλ), such as interferon-lambda 1 (IFN-λ1, IL-29) Also known as, preferably, human interferon lambda 1 (hIFNλ1), IFN-λ2 (also known as IL-28A), IFN-λ3 (also known as IL-28B), and / or IFN-λ4), tumor necrosis factor alpha (TNF-α), granulocyte-macrophage colony-stimulating factor (GM-CSF), primary ciliary dysplasia (PCD) proteins or factors (e.g., DNAH5, DNAH11, CCDC39, DN) AI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1(LRRC50), DNAAF2( KTU), LRRC6, C21orf59, CCDC65(DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1(CCDC164), DYX1C1, DNAAF5(HEATR 2 The mRNA(s) may also contain ORFs encoding ), HYDIN, MCIDAS, NME8(TXNDC3), RSPH3, RSPH9, or FOXJ1. Preferably, the mRNA(s) contain an ORF encoding interferon-lambda 1 (IFNλ1), and more preferably an ORF encoding human interferon-lambda 1 (hIFNλ1).

[0340] Preferably, the above-mentioned proteins, especially therapeutic proteins, are human proteins. For example, CFTR is human CFTR, erythropoietin (EPO) is human EPO, factor VIII is human factor VIII, and so on.

[0341] A typical sequence of mRNA (molecule) containing an ORF encoding human interferon-lambda 1 (hIFNλ1) is shown in SEQ ID NO: 41, 42, or 43. In this specification, SEQ ID NO: 42 is preferred. Accordingly, one or more mRNAs may contain an ORF encoding human interferon-lambda 1 (hIFNλ1), preferably the ORF is a nucleic acid sequence of SEQ ID NO: 41, 42, or 43, or a variant having approximately 90% / 91% / 92% / 93% / 94% / 95% / 96% / 97% / 98% / 99% / 100% sequence identity with the nucleic acid sequences of SEQ ID NO: 41, 42, and 43, and the variant sequence encodes functional hIFNλ1.

[0342] mRNA (molecules) containing ORFs encoding interferon, particularly interferon lambda, more specifically interferon lambda 1, most preferably human interferon lambda 1 (hIFNλ1), may be used for the treatment or prevention of viral-induced or viral-associated diseases, particularly viral-induced or viral-associated respiratory diseases. These diseases may include chronic obstructive pulmonary disease (COPD) and / or asthma. These diseases may also include respiratory viral infections, such as seasonal and / or emerging viral infections, as well as exacerbations of viral-induced or viral-associated chronic respiratory diseases (e.g., exacerbations of viral-induced or viral-associated asthma or COPD). The viruses causing and / or associated with these viral-induced or viral-associated respiratory diseases are selected from the group consisting of enteroviruses (e.g., rhinoviruses), influenza viruses, parainfluenza viruses, metapneumoviruses, respiratory syncytial viruses, adenoviruses, and coronaviruses. The virus causing the virus-induced respiratory illness may be a virus that enters cells via the ACE2 receptor, and may be SARS-CoV, SARS-CoV-2, or HCoV-NL63.

[0343] The above interferon-encoding mRNA may be used in methods for preventing (e.g., virus-induced) rhinitis. The above interferon-encoding mRNA may be used in methods for preventing viral infections that can reduce the risk of (serious and potentially life-threatening) infections, particularly in immunocompromised or immunosuppressed (e.g., post-transplant) patients. The above interferon-encoding mRNA may also be used in methods for preventing or mitigating respiratory viral infections in patients with hereditary lung diseases (e.g., PCD).

[0344] The preferred dose for administering nucleic acids, preferably (m)RNA, is any amount ranging from 0.01 mg to a maximum of 60 mg of nucleic acid (mRNA), preferably in the range of 0.05 to 30 mg. For diseases requiring therapeutic proteins other than cytokines, such as protein replacement therapy in PCD, a more preferred inhalation dose is 1 mg to 20 mg, more preferably 10 mg to 20 mg.

[0345] For diseases requiring administration of inhaled cytokines such as interferon-lambda-1, the preferred dose is 0.001 mg to 30 mg, more preferably 0.01 mg to 20 mg, even more preferably 0.05 mg to 10 mg, even more preferably 0.05 to 5 mg, and even more preferably 0.05 to 2 mg.

[0346] For intranasal administration, in diseases requiring therapeutic proteins other than cytokines, such as protein replacement therapy in PCD, the dose is selected from a range of approximately 0.001 mg to approximately 6 mg of nucleic acid, more preferably approximately 0.01 mg to approximately 2.8 mg, and even more preferably 0.25 mg to 1 mg.

[0347] For diseases requiring administration of nasal cytokines such as interferon-lambda-1, the preferred dose is 0.001 mg to 10 mg, more preferably 0.01 mg to 5 mg, even more preferably 0.05 mg to 1 mg, and even more preferably 0.1 to 1 mg.

[0348] The preferred administration regimen for any route of administration, preferably nasal or pulmonary administration, is once, twice, or three times per week. Administration may also be a chronic regimen of once or twice per week.

[0349] In this context, it is preferable that mRNA is administered locally, particularly by delivery / local administration to the respiratory system. Preferably, such delivery / local administration to the respiratory system is by inhalation and / or nasal spray or aerosol. Inhalation may be by inhalation of an aerosol containing mRNA.

[0350] Therefore, the present invention provides compositions for use in the treatment and / or prevention of diseases or disorders, the treatment comprising topical administration of the composition, (a) One or more therapeutic agents and, (b) A carrier, said carrier (i) Ionizable lipidoids, (ii) One or more helper lipids, (iii) one or more pharmaceutically acceptable excipients or diluents, Equipped with a carrier, The one or more therapeutic agents are one or more mRNAs, The ionizable lipidoid is a lipidoid represented by formula (bI) or (b-II), preferably a lipidoid represented by any of formulas (bV), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), more preferably a lipidoid represented by formula (bV), and even more preferably a (R)-enantiomer of a compound represented by formula (bV). Preferably, the disease or disorder is a respiratory disease or respiratory disorder, more preferably a disease or disorder caused by or related to an enterovirus (e.g., rhinovirus rhinitis). Preferably, the composition is administered by nasal spray delivery. Furthermore, one or more of the following apply: - The dosage of the composition or therapeutic agent is reduced to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site. - Patients experience fewer side effects (e.g., reduced complement system activation and / or reduced CARPA risk) compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the injection site. - The composition has extended retention at the administration site. - The therapeutic agent exerts its effect at the injection site by being held there for an extended period. -When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

[0351] Therefore, the present invention provides compositions for use in the treatment and / or prevention of diseases or disorders, the treatment comprising topical administration of the composition, (a) One or more therapeutic agents and, (b) A carrier, said carrier (i) Ionizable lipidoids, (ii) One or more helper lipids, (iii) one or more pharmaceutically acceptable excipients or diluents, A carrier equipped with, The one or more therapeutic agents are one or more mRNAs, The ionizable lipidoid is a lipidoid represented by formula (bI) or (b-II), preferably a lipidoid represented by any of formulas (bV), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), more preferably a lipidoid represented by formula (bV), and even more preferably a (R)-enantiomer of a compound represented by formula (bV). Preferably, the disease or disorder is a respiratory disease or respiratory disorder, more preferably a disease or disorder caused by or related to an enterovirus (e.g., rhinovirus rhinitis). Preferably, the composition is administered by nasal spray delivery. The one or more helper lipids are phospholipids, sterols, and / or stealth lipids, and preferably the phospholipid is phosphatidylcholine (PC). Preferably, the sterol is cholesterol. Preferably, the stealth lipid is a glycerolipid or phosphatidylethanolamine lipid. Furthermore, one or more of the following apply: - The dosage of the composition or therapeutic agent is reduced to achieve equivalent therapeutic effects compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site. - Patients experience fewer side effects (e.g., reduced complement system activation and / or reduced CARPA risk) compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site. - The composition has extended retention at the administration site. - The therapeutic agent exerts its effect at the injection site by being held there for an extended period. -When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

[0352] Therefore, the present invention provides compositions for use in the treatment and / or prevention of diseases or disorders, the treatment comprising topical administration of the composition, a) One or more therapeutic agents and, b) A carrier, said carrier (i) Ionizable lipidoids, (ii) One or more helper lipids, (iii) one or more pharmaceutically acceptable excipients or diluents, The one or more therapeutic agents are one or more mRNAs, Furthermore, the one or more mRNAs contain an ORF encoding human interferon lambda 1 (hIFNλ1), preferably the ORF has a nucleotide sequence of SEQ ID NO:42 or approximately 90% / 91% / 92% / 93% / 94% / 95% / 96% / 97% / 98% / 99% / 100% sequence identity with respect to the nucleotide sequence of SEQ ID NO:42, and the mutant sequence contains a nucleotide sequence of a variant encoding functional hIFNλ1. The ionizable lipidoid is a lipidoid represented by formula (bI) or (b-II), preferably a lipidoid represented by any of formulas (bV), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), more preferably a lipidoid represented by formula (bV), and even more preferably a (R)-enantiomer of a compound represented by formula (bV). Preferably, the disease or disorder is a respiratory disease or respiratory disorder, more preferably a disease or disorder caused by or related to an enterovirus (e.g., rhinovirus rhinitis). Preferably, the composition is administered by nasal spray delivery. Furthermore, one or more of the following apply: - The dosage of the composition or therapeutic agent is reduced to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site. - Patients experience fewer side effects (e.g., reduced complement system activation and / or reduced CARPA risk) compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the injection site. - The composition has extended retention at the administration site. - The therapeutic agent exerts its effect at the injection site by being held there for an extended period. -When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

[0353] Therefore, the present invention provides a composition for use in the treatment and / or prevention of a disease or disorder, the treatment comprising topical administration of the composition, the composition comprising: (a) One or more therapeutic agents, and (b) A carrier, said carrier (i) Ionizable lipidoids, (ii) One or more helper lipids, (iii) one or more pharmaceutically acceptable excipients or diluents, The one or more therapeutic agents are one or more mRNAs, Furthermore, the one or more mRNAs contain an ORF encoding human interferon lambda 1 (hIFNλ1), preferably the ORF has a nucleotide sequence of SEQ ID NO:42 or approximately 90% / 91% / 92% / 93% / 94% / 95% / 96% / 97% / 98% / 99% / 100% sequence identity with respect to the nucleotide sequence of SEQ ID NO:42, and the mutant sequence contains a nucleotide sequence of a variant encoding functional hIFNλ1. The ionizable lipidoid is a lipidoid represented by formula (bI) or (b-II), preferably a lipidoid represented by any of formulas (bV), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), more preferably a lipidoid represented by formula (bV), and even more preferably a (R)-enantiomer of a compound represented by formula (bV). Preferably, the disease or disorder is a respiratory disease or respiratory disorder, more preferably a disease or disorder caused by or related to an enterovirus (e.g., rhinovirus rhinitis). Preferably, the composition is administered by nasal spray delivery. The one or more helper lipids are phospholipids, sterols, and / or stealth lipids, and preferably the phospholipid is phosphatidylcholine (PC). Preferably, the sterol is cholesterol. Preferably, the stealth lipid is a glycerolipid or phosphatidylethanolamine lipid. Furthermore, one or more of the following apply: - The dosage of the composition or therapeutic agent is reduced to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site. - Patients experience fewer side effects (e.g., reduced complement system activation and / or reduced CARPA risk) compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the injection site. - The composition has extended retention at the administration site. - The therapeutic agent exerts its effect at the injection site by being held there for an extended period. -When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

[0354] The nucleic acids, RNA, or mRNA of the present invention may also be provided as part of a nucleic acid, RNA, or mRNA vaccine.

[0355] Messenger RNA (mRNA) vaccines are a new type of vaccine (see recent reviews: Pardi et al., Nature Reviews Drug Discovery Volume 17, pages 261-279 (2018); Wang et al., Molecular Cancer (2021) 20:33: mRNA vaccine: a potential therapeutic strategy). The first mRNA vaccines approved during the COVID-19 pandemic were BNT162b2 (Pfizer) and mRNA-1273 (Moderna). mRNA vaccines have the unique characteristic of temporarily promoting antigen expression (usually for several days). The expression of exogenous antigens is controlled by the lifespan of the encoding mRNA, which is regulated by intracellular degradation pathways. This transient nature of protein expression is extremely useful in vaccines, as it is sufficient to induce highly specific adaptive immunity with only the initial or initial / booster immunization, without exposure to infection, although repeated administration is necessary for the treatment of genetic diseases and cancer.

[0356] mRNA-based vaccines induce an immune response after synthetic mRNA encoding viral antigens is transfected into human cells. The mRNA molecules in the cytoplasm are translated into specific viral antigens by the host's own cellular mechanisms. These antigens are then presented on the cell surface, recognized by immune cells, and can trigger an immune response.

[0357] The structural elements of the vaccine vector mRNA molecule are similar to those of natural mRNA and include a 5' cap, a 5' untranslated region (UTR), a coding region (e.g., including an open reading frame encoding the polypeptide of the present invention), a 3' UTR, and a poly(A) tail base. The 5' UTR (also called the leader sequence, transcript reader, or leader RNA) is the region located immediately upstream of the start codon of the mRNA. This region is crucial for the translational regulation of the transcript. In many organisms, the 5' UTR forms a complex secondary structure that regulates translation. The 5' UTR begins at the transcription start site and ends one nucleotide before the start sequence of the coding region (usually AUG). In eukaryotes, the length of the 5' UTR varies from 100 nucleotides to several thousand nucleotides. This size difference is thought to be due to the complexity of eukaryotic regulation embodied in the 5' UTR and the large preinitiation complex formed for translation initiation. The eukaryotic 5' UTR may contain a Kozak consensus sequence (ACCAUG (start codon underline), including AUG). In some cases, GCCACCAUG (underlined start codon) is used as an extended Kossack sequence.

[0358] The 5' and 3' UTR elements surrounding the coding sequence significantly affect mRNA stability and translation, and are both critical elements for vaccines. These regulatory sequences are derived from viral or eukaryotic genes and can greatly increase the half-life and expression level of therapeutic mRNA. For example, the 5' UTR of the mRNA of the present invention may include a Kosack consensus sequence or an extended Kosack sequence along with the mRNA start codon. Optionally, the 5' UTR of the mRNA of the present invention may include one of the following sequences immediately upstream of the start codon sequence: GGGAGACGCCACC (SEQ ID NO: 11) or GGGAGACUGCCACC (SEQ ID NO: 14).

[0359] Optionally, the 5'UTR of the mRNA of the present invention may include a T7, T3, SP6, or K11 polymerase-binding domain, a minimal UTR, and a Kozak sequence immediately upstream of the start codon sequence, such as GGGAGACGCCACC(SEQ ID NO:11), GGGACGCCACC(SEQ ID NO:12), GGGACGCCACC(SEQ ID NO:13), GGGAGACUGCCACC(SEQ ID NO:14), GAAGCTGCCACC(SEQ ID NO:15), or GGGACTGCCACC(SEQ ID NO:16).

[0360] The 5' cap structure is necessary for efficient protein production from mRNA. Various versions of the 5' cap can be added during or after transcription using vaccinia virus capping enzymes, or synthetic caps or anti-reverse cap analogs can be incorporated (see Pardi et al., op. cit.). Anti-reverse cap analogs (ARCA) are cap analogs used in vitro during transcription to produce capped transcripts. ARCA is modified to be incorporated only in the forward direction. Anti-reverse cap analogs (ARCA) have a 3'OH group (m 7 This is a modified capped analog where the side closer to G is replaced with -OCH3. [ka]

[0361] Conventional cap analog: R=H, m 7 G(5')pppG;

[0362] ARCA: R=CH3, 3'-O-Me-m 7 G(5')pppG

[0363] This substitution allows RNA polymerase to initiate transcription only at the remaining hydroxyl group, thus ensuring that ARCA is incorporated only in the forward direction. As a result, unlike transcripts synthesized with conventional cap analogs, transcripts with ARCA at the 5' end are 100% translatable, resulting in a strong promotion of translation.

[0364] The 3'UTR may contain a sequence (e.g., GAAUU) for generating restriction enzyme sites within the vector. Alternatively, a usable 3'UTR is the 3'UTR of CYBA (CCUCGCCCCGGACCUGCCCUCCCGCCAGGUGCACCCACCUGCAAUAAAUGCAGCGAAGCCGGGA, SEQ ID NO:26).

[0365] The poly(A) tail also plays an important regulatory role in mRNA translation and stability; therefore, a poly(A) of the optimal length must be added to the mRNA either directly from the encoding DNA template using poly(A) polymerase (see Pardi et al., op. cit.) or by ligation after in vitro transcription. Poly(A) consists of 90 or more A nucleotides (A 90 ), 100 or more (A 100 ), 110 or more (A 110 ), 120 or more (A 120 ), 130 or more (A 130 ), 150 or more (A 150 ), 180 or more (A 180 ), 190 or more (A 190 ) may also be an example of a poly(A) tail of appropriate length, which is poly(~A120 The poly(A) tail base may be a segmented poly(A) tail base as disclosed in International Patent Publication No. 2020074642, which is incorporated herein by reference. Optionally, the segmented poly(A) is A 55-65 -SA 55-65 (S may have the structure of a single nucleotide selected from C, G, T, or U). Optionally, poly(A) may be A 55-65 -N-S4-NA 55-65 The structure may have the following characteristics: (N is a nucleotide other than adenine, and S4 is four nucleotides selected from A, C, G, T, or U). Optionally, the split poly(A) may be poly(A) of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40.

[0366] Codon usage also influences protein translation. Replacing rare codons with frequently used synonymous codons that have abundant corresponding tRNAs in the cytoplasm is a common technique to increase protein production from mRNA. Increasing the G:C content is also a form of sequence optimization and has been shown to increase steady-state mRNA levels in vitro and protein expression in vivo (see Pardi et al., op. cit.).

[0367] Currently, there are two main types of RNA being studied as vaccines: non-replicating mRNA and virus-derived self-amplified RNA. Both types of vaccines share a common mRNA construct structure, but self-amplified RNA vaccines include additional sequences for RNA replication (such as RNA-dependent RNA polymerase) in their coding region.

[0368] The BNT162b2 vaccine construct consists of an mRNA molecule encoding the trimerized full-length SARS2 S protein (with a PP mutation at residues 986-987) encapsulated in lipid nanoparticles (LNPs). The mRNA is encapsulated within 80 nm ionized cationic lipid nanoparticles. The mRNA-1273 vaccine construct is also based on an LNP vector, and the synthetic mRNA encapsulated within the lipid structure encodes the full-length SARS2 S protein.

[0369] U.S. Patent No. 10,702,600B1 (ModernaTX) describes beta-coronavirus mRNA vaccines and LNPs suitable for use in such vaccines.

[0370] The mRNA vaccine of the present invention may be formulated into lipid nanoparticles.

[0371] mRNA vaccines offer several advantages over conventional vaccines containing inactivated (or live) disease-causing organisms. Firstly, mRNA-based vaccines can be developed rapidly due to their design flexibility and the ability of constructs to mimic antigenic structures and expressions observed during natural infection. mRNA vaccines, based on target virus sequence information, can be developed in days to months, while conventional vaccines often take years and require a deep understanding of the target virus to be effective and safe. Secondly, these novel vaccines can be produced rapidly. Due to high yields from in vitro transcription reactions, mRNA production is rapid, low-cost, and scalable. Thirdly, vaccine risks are low. mRNA does not contain infectious viral elements that pose a risk of infection or insertion mutagenicity. Furthermore, because mRNA is a gene vector with minimal immunogenicity, anti-vector immunization is avoided, and repeated vaccine administration is possible. A challenge in the effective application of mRNA vaccines lies in intracellular delivery. mRNA alone is rapidly degraded by extracellular RNases and cannot cross the cell membrane to be transcribed into the cytoplasm. However, by formulating mRNA into carrier molecules, efficient delivery in vivo becomes possible, enabling rapid uptake and expression into the cytoplasm. Numerous delivery methods have been developed to date, including lipid, polymer, or peptide-based delivery, virus-like replicon particles, cationic nanoemulsions, naked mRNA, and dendritic cell-based delivery (each reviewed by Wang et al., cited above). Cationic lipid nanoparticle (LNP) delivery is the most attractive and commonly used mRNA vaccine delivery tool.

[0372] Exogenous mRNA can be highly immunostimulant. Single-stranded RNA (ssRNA) molecules are considered pathogen-associated molecular patterns (PAMPs) and are recognized by various Toll-like receptors (TLRs), inducing pro-inflammatory responses. While a strong cellular and humoral immune response is desirable in response to vaccination, innate immune responses induced by exogenous mRNA can cause undesirable side effects in subjects. U-rich sequences in mRNA are a major component of TLR activation (Wang et al., op. cit.). Furthermore, enzymatically synthesized mRNA preparations contain double-stranded RNA (dsRNA) contaminants as abnormal products of the in vitro transcription (IVT) process. dsRNA is a potent PAMP and induces downstream reactions that result in translational inhibition and degradation of intracellular mRNA and ribosomal RNA (Pardi et al., op. cit.). Therefore, mRNA can suppress antigen expression and reduce vaccine efficacy.

[0373] Studies over the past decade have shown that the immunostimulatory effects of mRNA can be regulated by purifying IVT mRNA, introducing modified nucleosides, conjugating mRNA with various carrier molecules (Pardi et al., op. cit.), adding poly(A) tails, or optimizing mRNA with GC-rich sequences (Wang et al., op. cit.). Uridine chemical modification is a common approach to minimize the immunogenicity of exogenous mRNA. The introduction of pseudouridine (ψ) and N1-methylpseudridine (m1ψ) into IVT mRNA prevents activation of TLRs and other innate immune sensors, reducing pro-inflammatory signaling to exogenous mRNA. Such nucleoside modifications can also suppress dsRNA species recognition (Pardi et al., op. cit.) and may reduce the recognition of exogenous mRNA translation by innate immune sensors (Hou et al., Nature Reviews Materials, 2021).

[0374] Any RNA modification described above or below may be applied in the context of the present invention to the mRNA vaccine described in detail above and to any other RNA used or included in the composition as a (therapeutic or active) agent.

[0375] Other nucleoside chemical modifications include, but are not limited to, 5-methylcytidine (m5C), 5-methyluridine (m5U), N1-methyladenosine (m1A), N6-methyladenosine (m6A), 2-thiouridine (s2U), and 5-methoxyuridine (5moU) (Wang et al., cited above).

[0376] The RNA of the present invention may include mRNA.

[0377] The mRNA, pharmaceutical composition, or vector of the present invention may be provided as part of an mRNA vaccine.

[0378] The vector of the present invention comprises a corresponding DNA sequence encoding a peptide and / or protein of interest, and may have one of the following sequences immediately upstream of the start codon sequence: TAATACGACTCACTATA GGGAGACGCCACC (SEQ ID NO: 17), AATTAACCCTCACTAAA GGGAGACGCCACC (SEQ ID NO: 18), ATTTAGGTGACACTATA GAAGCGCCACC (SEQ ID NO: 19), AATTAGGGCACACTATA GGGACGCCACC (SEQ ID NO: 20), TAATACGACTCACTATA GGGAGA CTGCCACC (SEQ ID NO: 21), AATTAACCCTCACTAAAGGGAGA CTGCCACC (SEQ ID NO: 22), ATTTAGGTGACACTATAGAAG CTGCCACC (SEQ ID NO: 23), AATTAGGGCACACTATAGGGA CTGCCACC (SEQ ID NO:24), or CGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCC (SEQ ID NO:25). The above sequence may be positioned upstream of the ATG in any mRNA sequence of the present invention (including the full-length spike (SEQ ID NO:1)). The mRNA, pharmaceutical composition, vector, or vaccine of the present invention may contain one or more modified nucleosides.

[0379] One or more modified nucleosides may be present in the RNA or mRNA of the present invention, or in the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention.

[0380] If necessary, at least one chemical modification is selected from pseudouridine, N1-methylpseudridine, N1-ethylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-1-methylpseudridine, 4-thiopseudridine, 5-aza-uridine, dihydropseudridine, 5-methoxyuridine, 5-iodouridine, and 2'-O-methyluridine. In some embodiments, the chemical modification is located at the 5-position of uracil. In one embodiment, the chemical modification is N1-methylpseuduridine. In another embodiment, the chemical modification is N1-ethylpseuduridine.

[0381] For example, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may contain one or more of the following modified nucleosides: pseudouridine (ψ), N1-methylpseudridine (m1ψ), 5-methylcytidine (m5C), 5-methyluridine (m5U), N1-methyladenosine (m1A), N6-methyladenosine (m6A), 2-thiouridine (s2U), 5-methoxyuridine (5moU), 5-iodouridine, and 5-iodocytidine. In some embodiments, 100% of the uracil in the total mRNA is chemically modified. In some embodiments, 100% of the uracil in the open reading frame is chemically modified. In some embodiments, the chemical modification is located at position 5 of the uracil. In some embodiments, the chemical modification is N1-methylpseudridine. In one embodiment, 100% of the uracil in mRNA has N1-methylpseudridine at position 5 of uracil. In one embodiment, 100% of the uracil in the open reading frame has N1-methylpseudridine at position 5 of uracil. In one embodiment, 5-50% of the uridine nucleotides are 5-iodouridine, and 5-50% of the cytidine nucleotides are 5-iodocytidine. In one embodiment, 5-50% of the uridine nucleotides are 2-thiouridine, and 5-50% of the cytidine nucleotides are 5-methylcytidine.

[0382] The RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, contains approximately 1% to approximately 100% modified nucleotides (or nucleosides) (relative to the total nucleotide content, or relative to one or more nucleotides (or nucleosides), i.e., A, G, U, or C) or any intermediate value (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%). It may include 10%~70%, 10%~80%, 10%~90%, 10%~95%, 10%~100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20%~80%, 20%~90%, 20%~95%, 20%~100%, 50%~60%, 50%~70%, 50%~80%, 50%~90%, 50%~95%, 50%~100%, 70%~80%, 70%~90%, 70%~95%, 70%~100%, 80%~90%, 80%~95%, 80%~100%, 90%~95%, 90%~100%, and 95%~100%). The remaining proportions are filled by the presence of unmodified A, G, U, or C.

[0383] If necessary, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may include RNA molecules in which the nucleic acid sequence of the molecule is identical to the corresponding SEQ ID, but each "U" is replaced with m1ψ.

[0384] If necessary, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may include RNA molecules in which the nucleic acid sequence of the molecule is identical to the corresponding SEQ ID, but in which at least 50% of the "U"s are substituted with m1ψ. The remaining "U"s may all be unmodified, or may include unmodified and one or more other modified nucleosides.

[0385] If necessary, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may include RNA molecules in which the nucleic acid sequence of the molecule is identical to the corresponding SEQ ID, but in which at least 70% of the "U"s are substituted with m1ψ. The remaining "U"s may all be unmodified, or may include unmodified and one or more other modified nucleosides.

[0386] If necessary, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may include RNA molecules in which the nucleic acid sequence of the molecule is identical to the corresponding SEQ ID, but in which at least 90% of the "U"s are replaced with m1ψ. The remaining "U"s may all be unmodified, or may include unmodified and one or more other modified nucleosides.

[0387] If necessary, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the present invention, may include RNA molecules in which the nucleic acid sequence of the molecule is identical to the corresponding SEQ ID, but 100% of the "U"s are replaced with m1ψ.

[0388] The mRNA vaccine of the present invention may be administered in combination with an immune adjuvant, such as MF59 (Novartis), TriMix, RNActive (CureVac AG), or RNA adjuvant (again, Wang et al., reviewed in the aforementioned literature).

[0389] The compositions provided herein can be administered by any means and methods commonly used by those skilled in the art, and therefore any suitable route of administration can be used. Methods of administration, particularly local administration, include, but are not limited to, intradermal, intramuscular, intraperitoneal, subcutaneous, submucosal, mucosal, vaginal, rectal, nasal, inhalation, or oral administration. The term “local administration” is used in contrast to “systemic administration,” such as intravenous administration. Therefore, local administration as envisioned herein does not include “systemic administration,” such as intravenous administration. Injectable preparations can be prepared in conventional forms, such as liquid solutions or suspensions, solid forms suitable for dissolution or suspension in liquid before injection, or emulsions. Injectable solutions and suspensions can be prepared from the sterile powders, granules, and tablets of the types described above. Common local administration routes include, for example, topical administration, as well as intradermal, transdermal, subcutaneous, submucosal, mucosal, aerosol delivery (including delivery to the respiratory system, e.g., intranasal or lung delivery), intramuscular injection, intralesional, intracranial, intrapulmonary, intracardiac, and sublingual injection, with mucosal or aerosol delivery being preferred. In this specification, "aerosol delivery" refers to the (local) administration of the composition to the nasal cavity and / or lungs via the airway, and therefore can be used synonymously with intranasal and / or "pulmonary drug delivery" in this specification. Similarly, the terms "local administration site" or "local site" in this specification refer to a site (of the body) suitable for local administration, such as muscle tissue or the respiratory system (e.g., lungs or nasal cavity). In contrast to "local administration site," as described above, intravenous administration, for example, is understood in the context of the present invention as a form of systemic administration.

[0390] The route of administration can be adjusted according to individual needs. The route of administration for the cosmetic compositions provided herein is preferably the external route. Therefore, the cosmetic compositions are preferably formulated for external application / administration. Generally, the application of the cosmetic composition preferably targets the skin of the subject, and can target the skin of any part of the body.

[0391] In the context of the present invention, the cosmetic composition can also be formulated for injection, preferably for intradermal, subcutaneous, submucosal, mucosal, or intramuscular injection.

[0392] The cosmetic composition can also be contained in a patch, preferably a transdermal patch. In the context of the present invention, the transdermal patch may be equipped with microneedles to facilitate intradermal injection of the composition, and therefore, in the context of a transdermal patch, the composition is preferably formulated for injection.

[0393] In the context of pharmaceutical compositions, the route of administration depends on the disease to be treated and / or prevented. Generally, the pharmaceutical compositions provided herein are particularly useful for the treatment and / or prevention of various diseases, and therefore, the diseases are not particularly limited. Such diseases include gene mutations, autoimmune diseases, metabolic disorders, neurodegenerative diseases, joint degenerative diseases, arthropathy, arthritis, fractures, pseudoarthrosis, solid tumor diseases (including soft tissue tumors and tumors of the heart, lungs, liver, spleen, kidneys, brain, oral cavity, intestines, skin, pancreas, prostate, mammary glands, ovaries, bladder, and bone (including osteosarcoma, chondrosarcoma, and Ewing's sarcoma)), tumors of the pleura and abdominal cavity, respiratory diseases (including rhinitis and asthma, viral asthma, and lung diseases such as COPD (including pulmonary autoimmune disease, ciliopathies, and alveolar proteinosis (PAP))), fractures or lesions thereof, tendon fractures or lesions thereof, joint infections, ligament ruptures, resistant Staphylococcus aureus (MRSA) and / or multidrug-resistant tuberculosis, viral infections, preferably selected from viral infections, more preferably enteroviruses, rhinoviruses, influenza (Flu), respiratory syncytial virus (RSV), hepatitis A, hepatitis B, hepatitis C, and human papillomavirus HPV, measles, mumps, rubella, polio, rabies, varicella (chickenpox), herpes zoster, rotavirus, yellow fever, smallpox, Japanese encephalitis, tick-borne encephalitis (TBE), dengue fever, West Nile virus, chikungunya virus, Ebola virus, Marburg virus, human immunodeficiency virus (HIV), coronavirus infection (including COVID-19), rhinovirus, influenza virus, parainfluenza virus, metapneumovirus, respiratory syncytial virus, adenovirus, more preferably rhinovirus, influenza virus, parainfluenza virus, metapneumovirus, respiratory syncytial virus, adenovirus, hepatitis C virus and coronavirus, even more preferably coronavirus infection, influenza, hepatitis C, most preferably coronavirus infection.

[0394] Preferably, the disease is a lung disease. In one embodiment, the lung disease is ciliopathy, particularly primary ciliary dysplasia (PCD). In a preferred embodiment, the primary ciliary dysplasia (PCD) is DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1(LRRC50), DNAAF2(KTU), LRRC6, C21orf59, CCDC65(DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1(CCDC164), DYX1C1, DNAAF5(HEATR 2 ), caused by mutations in a protein or factor selected from HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9 and / or FOXJ1.

[0395] In the context of the pharmaceutical compositions and therapeutic methods provided herein, when the disease to be treated is trichorrhinitis or PCD, those skilled in the art will recognize suitable therapeutic agents. Such therapeutic agents are also disclosed in WO 2020 / 165352, the entirety of which is incorporated herein by reference. Therapeutic agents particularly suitable for the treatment of trichorrhinitis or PCD include nucleic acids (e.g., mRNA) encoding coiled-coil domain 39 (CCDC39) and / or coiled-coil domain 40 (CCDC40). Particularly preferred nucleic acid sequences encoding CCDC39 and CCDC40 are exemplified in SEQ ID NO: 47 and 48 for CCDC39 and SEQ ID NO: 49 and 50 for CCDC40. The local retention at the administration site and the non-systemic distribution of the pharmaceutical compositions described herein are particularly advantageous in the treatment of ciliopathies or PCD because they limit the distribution of the therapeutic agent (e.g., mRNA encoding CCDC39 or CCDC40) to the administration site (preferably the respiratory system, e.g., nose, pharynx, larynx, trachea, bronchi, or lungs).

[0396] Therefore, in one preferred embodiment of the present invention, provided herein is a (pharmaceutical) composition for use in the treatment of cilia or PCD, the treatment comprising topical administration of the composition, preferably to the respiratory system (e.g., nose, pharynx, larynx, trachea, bronchi or lungs), the composition comprising: (a) One or more therapeutic agents comprising or comprising nucleic acids (e.g., mRNA) encoding CCDC39 and / or CCDC40, preferably mRNA comprising nucleic acid sequences described in any of SEQ ID NO: 47 to 50, and (b) A carrier, said carrier (i) Ionizable lipids and / or ionizable lipidoids, (ii) one or more helper lipids as needed, and (iii) one or more pharmaceutically acceptable excipients or diluents, as needed. Includes, Compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site, a reduced amount of the composition or therapeutic agent is administered to achieve an equivalent therapeutic effect. Compared to the same therapeutic agent formulated in a composition that does not have extended retention at the injection site, patients experience fewer side effects (e.g., reduced risk of CARPA). • The composition has extended retention at the administration site. Therapeutic agents exert their effects at the injection site through prolonged retention at the injection site. • When administered to the injection site, the composition remains locally and does not essentially exhibit systemic distribution throughout the patient's body. One or more of the following conditions apply.

[0397] Other specifications and details (e.g., carrier components and therapeutic agent dosages) may be defined by either the above or below descriptions in this specification.

[0398] Depending on the disease to be treated and / or prevented, the pharmaceutical composition may be administered to one or more solid tissues, solid organs and / or solid anatomical regions, preferably selected from the group consisting of the lungs, nose, heart, brain, spleen, lymph nodes, bones, tendons, skeletal muscles, joints, stomach, small intestine, large intestine, kidneys, bladder, breasts, testes, ovaries, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eyes, ears, tongue, skin and / or tumors present in the one or more solid tissues, solid organs and / or solid anatomical regions.

[0399] The composition can be administered by any suitable method with a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is determined in part by the specific composition and method of administration. Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleic acid. Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions (including saline and buffer solutions). Vehicles for parenteral administration include sodium chloride solution, Ringer's glucose, glucose-sodium chloride, Ringer's lactate solution, or fixative oils. Vehicles for intravenous administration include fluid and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based ones), etc. Preservatives and other additives (e.g., antimicrobial agents, antioxidants, chelating agents, inert gases, etc.) may also be included.

[0400] Some compositions may also be administered as pharmaceutically acceptable acid or base addition salts, which are formed by reactions with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, or with organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reactions with inorganic bases such as sodium hydroxide, ammonium hydroxide, and potassium hydroxide, or with organic bases such as mono, di, trialkyl and arylamines and substituted ethanolamines.

[0401] The administration may be a single or multiple dose. In the context of this disclosure, the dose administered to a subject should be sufficient to induce a beneficial therapeutic response over time or to suppress or prevent infection. The required dose will vary from subject to subject depending on the subject's species, age, weight, general condition, the severity of the infection being treated, the specific composition used, and the method of administration. An appropriate dose can be determined by a person skilled in the art through standard experimentation.

[0402] This disclosure includes a method for administering an mRNA vaccine to subjects who require it. The exact amount required will vary from subject to subject depending on the subject's species, age, general health, disease severity, specific composition, method of administration, and mode of action.

[0403] mRNA vaccines are typically formulated in dose units for ease of administration and uniformity of dosage. However, it is understood that the total daily dose of mRNA vaccine should be determined by the attending physician within the bounds of appropriate medical judgment. The therapeutically effective, prophylactically effective, or appropriate imaging dose level for a particular patient depends on a variety of factors, including the disorder being treated and its severity, the activity of the specific compound used, the specific composition used, the patient's age, weight, general condition, sex, and diet, timing of administration, route of administration, excretion rate of the specific compound used, duration of treatment, concomitant or concurrent use of other medications, and other factors well known in the medical field.

[0404] The effective dose of mRNA provided herein may be a low dose, such as 20 pg, as a single dose or two 10 pg doses. In some embodiments, the effective dose is 20 μg to 300 μg or 25 μg to 300 μg in total. For example, the effective dose may be 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg in total. In some embodiments, the effective dose is 20 μg in total. In one embodiment, the effective amount is 25 pg in total. In another embodiment, the effective amount is 50 μg in total. In another embodiment, the effective amount is 75 μg in total. In another embodiment, the effective amount is 100 μg in total. In another embodiment, the effective amount is 150 μg in total. In another embodiment, the effective amount is 200 μg in total. In another embodiment, the effective amount is 250 pg in total. In another embodiment, the effective amount is 300 μg in total.

[0405] The mRNA vaccines described herein can be formulated into the administration methods described herein, such as intranasal, intratracheal, or injection (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, subcutaneous, etc.).

[0406] If necessary, mRNA vaccines are formulated in a quantity effective in eliciting an antigen-specific immune response in the subject.

[0407] In some embodiments, the effective dose is 1 μg to 1000 μg, 25 μg to 1000 μg, or 50 μg to 1000 μg as a total dose. In some embodiments, the effective dose is 100 μg as a total dose. In some embodiments, the effective dose is a 25 μg dose administered to the subject in a total of two doses. In some embodiments, the effective dose is a 100 μg dose administered to the subject in a total of two doses. In some embodiments, the effective dose is a 400 μg dose administered to the subject in a total of two doses. In some embodiments, the effective dose is a 500 μg dose administered to the subject in a total of two doses.

[0408] If necessary, subjects are administered a dose of mRNA vaccine ranging from 10 μg / kg to 400 μg / kg. In some embodiments, the mRNA dose is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 100-200 μg. The dosage is 120-250 μg, 150-250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100-400 μg, 200-400 μg, or 300-400 μg per dose.

[0409] In some embodiments, the mRNA vaccine is administered to subjects by intradermal or intramuscular injection. In some embodiments, the mRNA vaccine is administered to subjects on day 0. In some embodiments, the second dose of the mRNA vaccine is administered to subjects on day 21.

[0410] In a strategy called "prime-boost," the first dose of the mRNA vaccine is administered as primary immunization (priming), followed by a second dose as additional immunization (booster). The prime-boost strategy aims to provide a stronger overall immune response. The boost may be administered at least one day, at least one week, or at least two, three, four, five, six, or seven weeks after the primer, or at least two, three, four, five, or six months after the primer. For example, the boost may be administered at least three weeks after the primer.

[0411] The similarity between amino acid sequences or nucleic acid sequences is expressed as sequence similarity, or sequence identity. Sequence identity is often measured as percentage identity (or similarity, homology), with a higher percentage indicating greater similarity between the two sequences. Homologs or variants of a given gene or protein exhibit relatively high sequence identity when aligned using standard methods. Alignment methods for sequence comparison are widely known to those skilled in the art. Various programs and alignment algorithms are cited from Smith and Waterman, Adv.Appl.Math.2:482,1981; Needleman and Wunsch, J.Mol.Biol.48:443,1970; Pearson and Lipman, Proc.Natl.Acad.Sc(i)USA85:2444,1988; Higgins and Sharp, Gene 73:237-244,1988; Higgins and Sharp, CABIOS 5:151-153,1989; Corpet et al., Nucleic Acids' Research 16:10881-10890,1988; and Pearson and Lipman, Proc.Natl.Acad.Sc(i)USA85:2444,1988. Altschul et al., Nature It is described in Genet. 6:119-129, 1994. The NCBI Basic Local Alignment Search Tool (BLAST®) (Altschul et al., J.Mol.Biol. 215:403-410, 1990) is available from multiple sources, including the National Center for Biotechnology Information (NCBI) in Bethesda, USA, and on the internet, and can be used in conjunction with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx.

[0412] Sequence identity between nucleic acid sequences or amino acid sequences can be determined by comparing their alignments. If the same nucleotide or amino acid exists at equivalent positions in the sequences being compared, the molecules are identical at those positions. Scoring alignment identity as a percentage is a function of the number of identical nucleotides or amino acids at shared positions between the sequences being compared. When comparing sequences, optimal alignment may require introducing gaps in one or more sequences to account for insertions and deletions. Sequence comparison methods may employ a gap penalty; if the number of identical molecules in the sequences being compared is the same, alignments with fewer gaps (i.e., reflecting a higher degree of relevance between the two sequences) will score higher than alignments with more gaps. Calculating maximum percentage identity involves creating optimal alignments that account for the gap penalty.

[0413] Suitable computer programs for performing sequence comparisons are widely available in both the commercial and public sectors. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4:29;), Gap (Needleman & Wunsch, 1970, J.Mol.Biol.48:443-453), FASTA (Altschul et al., 1990, J.Mol.Biol.215:403-410;), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23:2947-2948); (eds), pp 1-44, Addison Wesley is one example. All programs can be executed with default parameters.

[0414] For example, sequence comparison can be performed using the "needle" method of EMBOSS Pairwise Alignment Algorithms, which determines the optimal alignment (including gaps) of two sequences over their entire length and provides a percentage identity score. The default parameters for amino acid sequence comparison ("Protein Molecule" option) are Gap Extend penalty: 0.5, Gap Open penalty: 10.0, and Matrix: Blosum 62.

[0415] Sequence comparison may be performed over the entire length of the reference sequence.

[0416] The polypeptide encoded by the mRNA of the present invention may contain one or more conservative amino acid substitutions. Conservative amino acid substitutions are those that preserve the properties of the original polypeptide, i.e., the protein structure, and especially its function, and that do not change significantly as a result of such substitution. Examples of conservative substitutions include substitutions from Ala to Ser, Arg to Lys, Asn to Gln or His, Asp to Glu, Cys to Ser, Gln to Asn, Glu to Asp, His to Asn or Gln, Ile to Leu or Val, Leu to Ile or Val, Lys to Arg or Gln, Met to Leu or Ile, Phe to Met, Leu or Tyr, Ser to Thr, Thr to Ser, Trp to Tyr, Tyr to Trp or Phe, and Val to Ile or Leu. Conservative substitutions generally maintain (a) the structure of the polypeptide backbone at the substitution site (e.g., sheet or helix structure), (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulkiness of the side chain.

[0417] Generally, substitutions that are expected to bring about the greatest changes in the properties of a protein are non-conservative substitutions, such as (a) when a hydrophilic residue (e.g., serine or threonine) is replaced with a hydrophobic residue (e.g., leucine, isoleucine, phenylalanine, valine or alanine), (b) when cysteine ​​or proline is replaced with any of the other residues, (c) when a residue with an electronegative side chain (e.g., lysine, arginine or histidine) is replaced with an electronegative residue (e.g., glutamic acid or aspartic acid), or (d) when a residue with a bulky side chain (e.g., phenylalanine) is replaced with a residue without a side chain (e.g., glycine).

[0418] In this specification, “broad neutralizing immune response” means an immune response sufficient to inhibit (i.e., reduce), neutralize, or prevent infection and / or progression of infection by coronaviruses in a subject. Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by multiple types of betacoronaviruses (e.g., SARS-CoV and SARS-CoV-2). Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by multiple types of betacoronaviruses within the same betacoronavirus lineage (e.g., SARS-CoV, SARS-CoV-2, Bat SL-CoV-WIV1, etc., within the Salvecovirus subgenus). Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by coronaviruses of different betacoronavirus lineages (e.g., lineage B (SARS-CoV, SARS-CoV-2) and lineage C (MERS-CoV)). Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by most or all different betacoronaviruses. Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by most or all different coronaviruses. Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by most or all vocitable variants (VOCs) of SARS-CoV-2, such as beta, gamma, delta, and omicron (BA.1). Where necessary, a broad neutralizing immune response may be sufficient to inhibit, neutralize, or prevent infection and / or progression of infection by SARS-CoV, WIV16, RaTG13, SARS-CoV-2, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta, and SARS-CoV-2 omicron (BA.1).

[0419] An immune response may be a humoral immune response and / or a cellular immune response. A cellular immune response is the response of cells in the immune system (e.g., B cells, T cells, macrophages, or polymorphonuclear leukocytes) to stimuli such as antigens or vaccines. An immune response includes any cells in the body that are involved in the host defense response, such as epithelial cells that secrete interferons or cytokines. An immune response also includes, but is not limited to, innate immune responses or inflammation.

[0420] If necessary, polypeptides encoded by the mRNA of the present invention can induce a protective immune response. A protective immune response is an immune response that protects a subject from infection or disease (i.e., prevents infection or the development of an infection-related disease). Methods for measuring immune responses are widely known to those skilled in the art and include, for example, the measurement of lymphocyte proliferation and / or activity (such as B cells or T cells), cytokine or chemokine secretion, inflammation, or antibody production.

[0421] If necessary, polypeptides encoded by the mRNA of the present invention can induce antibody production and / or T cell responses in administered human or non-human animals (for example, when expressed from an administered mRNA vaccine).

[0422] The present invention also relates to the (cosmetic / non-therapeutic) use of the cosmetic compositions described in detail above in improving skin conditions. Accordingly, the present invention also relates to (cosmetic / non-therapeutic) methods for improving skin conditions, the methods comprising the administration of cosmetic compositions as defined herein.

[0423] In the context of (cosmetic / non-therapeutic) use and method as described herein, it is particularly preferable that the active ingredient be selected from growth factors, peptides, antioxidants, retinoids, cytokines, siRNA, miRNA, mRNA, and asRNA. Each of the ingredients listed herein may be as defined above. In this context, the cosmetic composition may be as defined above.

[0424] The present invention also relates to a kit comprising the cosmetic and / or pharmaceutical compositions described in detail above.

[0425] As described in the attached examples and above, ionizable lipidoids used herein (e.g., lipidoids represented by formula (bV)) have been found to remarkably cause compositions containing them (e.g., LiNP compositions containing the lipidoid of formula (bV)) to remain locally confined at the injection site after administration to a patient. Therefore, it is conceivable that such lipidoids may also restrict the systemic distribution of the drug to which they are bound.

[0426] Therefore, in the context of the present invention, the ionizable lipidoid may be bound / linked / fused / conjugated to an active ingredient and / or therapeutic agent (e.g., a drug). Accordingly, the present invention further relates to a drug conjugate comprising the ionizable lipidoid defined above (preferably a compound of formula (bI) or formula (b-II), more preferably any compound of formula (bV), (b-VII), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), even more preferably a compound of formula (bV), most preferably the (R)-enantiomer of formula (bV)) and one or more therapeutic agents, preferably the one or more therapeutic agents being any of the above definitions.

[0427] The present invention further relates to the in vitro use of an ionizable lipidoid for limiting the diffusion of one or more therapeutic agents to be administered, wherein the ionizable lipidoid is co-compounded with the one or more therapeutic agents, preferably the ionizable lipidoid is as defined above (preferably a compound of formula (bI) or formula (b-II), more preferably any compound of formula (bV), (b-VII), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), even more preferably a compound of formula (bV), most preferably the (R)-enantiomer of formula (bV)), and preferably the one or more therapeutic agents are as defined above.

[0428] Accordingly, the present invention also relates to an (in vitro) method for limiting the diffusion of one or more therapeutic agents to be administered, the method comprising the step of co-compounding an ionizable lipidoid with the one or more therapeutic agents, wherein the ionizable lipidoid is defined as any of the above (preferably a compound of formula (bI) or formula (b-II), more preferably a compound of any of formulas (bV), (b-VII), (b-VII), (b-VIII), (b-IX), (bX), (b-XI), or (b-XII), even more preferably a compound of formula (bV), most preferably the (R)-enantiomer of formula (bV)), and the therapeutic agent is defined as any of the above.

[0429] In the context of such use or method, the co-combination of a lipidoid with a therapeutic agent may further include co-combining any of the components of the composition described in detail herein (e.g., pharmaceutically acceptable excipients or diluents).

[0430] The present invention further provides compounds of formula (b-VII).

[0431] The present invention further provides compounds of formula (b-VIII).

[0432] The present invention further provides compounds of formula (b-IX).

[0433] The present invention also provides compounds of formula (bX).

[0434] The present invention further provides compounds of formula (b-XI).

[0435] The present invention also provides compounds of formula (b-XII).

[0436] Unless otherwise specified, all technical terms, symbols, and other scientific terms used herein have the meaning generally understood by those skilled in the art. In some cases, commonly understood terms are defined herein for clarity and / or convenience of reference, but the inclusion of such definitions does not necessarily mean that they differ from the generally understood meaning of those skilled in the art. The techniques and methods described or referenced herein are generally understood and widely used by those skilled in the art using conventional methods. Where appropriate, procedures using commercially available kits and reagents are carried out according to the protocols and conditions specified by the manufacturer unless otherwise specified.

[0437] As used herein, the terms “treatment” or “therapy” include the prevention and / or treatment of any disease, disorder or condition, including vaccination or immunization.

[0438] As used herein, "subject" means an individual. In the sense of the present invention, a subject may generally be a mammal, preferably a human.

[0439] Disclosures regarding the methods described herein are also disclosed so as to apply to the corresponding uses, as necessary. The disclosures relating to use described herein are also disclosed to the corresponding methods as applicable, as necessary.

[0440] Concentration, quantity, and other numerical data may be expressed or presented in this specification in the form of “range.” Such range formatting is used solely for convenience and conciseness, and therefore, not only the numerical values ​​explicitly stated as limits of the range, but also all individual numerical values ​​or subranges included within that range should be interpreted flexibly as if each numerical value and subrange were explicitly stated. For example, the numerical range “150 mg to 600 mg” should be interpreted to include not only the explicitly stated 150 mg and 600 mg, but also the individual values ​​and subranges within the range. Thus, this numerical range includes individual values ​​such as 150, 160, 170, 180, 190, ..., 580, 590, 600 mg, as well as subranges such as 150 to 200, 150 to 250, 250 to 300, 350 to 600, etc. This principle also applies to ranges in which only one numerical value is stated. Furthermore, such interpretation should apply regardless of the breadth of the range or the characteristics described.

[0441] When used in relation to numbers, the term "approximately" means that the number is included within a range that has a lower limit of 10% less than the number and an upper limit of 10% more than the number.

[0442] In the context of the present invention, several individual elements, characteristic configurations, techniques, and / or processes are disclosed. It is readily apparent that each of these elements is beneficial not only when considered or used individually, but also when considered or used in combination with each other. Therefore, in order to avoid overly repetitive and redundant descriptions, this specification refrains from repeatedly describing all combinations and permutations. However, whether explicitly stated or not, such combinations are understood to be fully included within the scope of the subject matter of this disclosure.

[0443] In this specification, the singular forms "a," "an," and "the" include multiple subjects unless the context clearly indicates otherwise. "Includes," "for example," and "etc." mean unrestricted inclusion unless otherwise specified. In this specification, the term "or" is used in the usual sense to include "and / or" unless the context clearly indicates otherwise. "And / or" means one or all of the listed elements, or any combination of two or more. In this specification, the term "includes" also expressly includes the forms "consisting of" and "essentially consisting of" the listed elements unless otherwise specified.

[0444] All publications, patent applications, patents, and patent documents referenced in this document are incorporated into this document as a whole by reference and are treated as if they were incorporated as individual references. In the event of any inconsistency in the usage of terminology between this document and any references incorporated herein, the usage in the references shall supplement the usage in this document, and in the event of an irreconcilable inconsistency, the usage in this document shall prevail.

[0445] Embodiments of the present invention will be described below with reference only to the accompanying drawings. [Brief explanation of the drawing]

[0446] [Figure 1]Bioluminescence images of excised organs. Animals were intratracheally administered 1 μg of chemically modified mRNA luciferase encapsulated in Formulation I (i.e., luciferase prepared with Formulation I). D-luciferin substrate was administered to the animals intraperitoneally and intranasally before euthanasia 4 hours after administration. Luciferase activity was measured in excised organs using the Lumina XR In Vivo Imaging system (Perkin Elmer, USA). In this context, luciferase activity was detected only in the lungs and not in the liver or spleen. Luciferase radiance was measured in p / sec / cm² / sr, which represents the number of photons per steradian per square centimeter per second. Therefore, the scale represents radiance in p / sec / cm² / sr. [Figure 2] BALB / c strain experimental mice were briefly anesthetized by inhalation of isoflurane (2-3%). Luciferase-encoding modified RNA (i.e., formulation I), prepared with formulation I, was injected into the anterior tibial muscle of both hind limbs at a dose of 20 μg / 20 μL using a 0.3 mL insulin injection syringe (BD, Germany). Luciferase activity was measured on day 1 (Figure 2) after administration of 3 mg D-luciferin / 100 μL PBS intraperitoneally under complete anesthesia. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. An ROI on the thoracic region was used as an internal control. The scale represents radiance in p / sec / cm2 / sr. As a result, on day 1 after administration of the test substance (Figure 2), equivalent levels of luciferase expression were observed in both hind limbs. No luciferase activity was observed in other body parts, indicating that the test substance does not have a systemic distribution. [Figure 3]BALB / c strain experimental mice were briefly anesthetized by inhalation of isoflurane (2-3%). Luciferase-encoding modified RNA (i.e., formulation I), prepared with formulation I, was injected into the anterior tibial muscle of both hind limbs at a dose of 20 μg / 20 μL using a 0.3 mL insulin injection syringe (BD, Germany). Luciferase activity was measured on day 4 (Figure 3) after administration of 3 mg D-luciferin / 100 μL PBS, administered intraperitoneally under complete anesthesia. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. An ROI on the thoracic region was used as an internal control. The scale represents radiance in p / sec / cm2 / sr. As a result, luciferase activity remained stable for at least 4 days after administration (Figure 3). Luciferase activity was not observed in other body parts, indicating that the test substance does not have a systemic distribution. [Figure 4]Intramuscular injection of firefly luciferase using chemically modified RNA prepared with Formulation I. BALB / c strain experimental mice were briefly anesthetized by isoflurane (2-3%) inhalation. Luciferase-encoding chemically modified RNA prepared with Formulation I was injected into the anterior tibial muscle of both hind limbs at a dose of 20 μg / 20 μL using a 0.3 mL insulin injection syringe (BD, Germany). Luciferase activity was measured on day 1 and day 4, respectively, after administration of 3 mg D-luciferin / 100 μL PBS intraperitoneally under complete anesthesia. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. An ROI on the thoracic region was used as an internal control. The scale represents radiance in p / sec / cm2 / sr. As a result, comparable levels of luciferase expression were observed in both hind limbs on day 1 after administration of the test substance. Luciferase activity remained stable for 4 days after administration. No luciferase activity was observed in other body parts, indicating that the test substance did not have a systemic distribution. [Figure 5]BALB / c strain experimental mice were briefly anesthetized by inhalation of isoflurane (2-3%). Luciferase-encoding chemically modified RNA prepared with Formulation I was administered subcutaneously to the back of the animals using a 0.3 mL insulin injection syringe (BD, Germany) either alone (diluted in 300 μL of 0.9% NaCl) (Figure 5) or in combination with hyaluronidase (Hylase "Dessau" 150(I)U. diluted in 300 μL of 0.9% NaCl, prepared according to the manufacturer's instructions) (Figure 6). Hyaluronidase is an enzyme that promotes the degradation of the extracellular matrix and is commonly used in dermatology for the cosmetic treatment of scar tissue. Due to its extracellular matrix-degrading ability, hyaluronidase allows locally administered Formulation I-prepared luciferase-modified RNA to diffuse into the systemic circulation. Luciferase activity was measured 6 hours after administration of the test substance, under complete anesthesia, and after intraperitoneal administration of 3 mg D-luciferin / 100 μL PBS. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. The scale represents radiance in p / sec / cm2 / sr. As a result, when hyaluronidase was not added (Figure 5), luciferase activity was observed only at the injection site. On the other hand, when hyaluronidase was added (Figure 6), the diffusion of luciferase activity after administration was shown to be (2 times) wider, and the activity increased compared to when formulation I was diluted in 0.9% NaCl. [Figure 6]BALB / c strain experimental mice were briefly anesthetized by inhalation of isoflurane (2-3%). Luciferase-encoding chemically modified RNA prepared with Formulation I was administered subcutaneously to the back of the animals using a 0.3 mL insulin injection syringe (BD, Germany) either alone (diluted in 300 μL of 0.9% NaCl) (Figure 5) or in combination with hyaluronidase (Hylase "Dessau" 150(I)U. diluted in 300 μL of 0.9% NaCl, prepared according to the manufacturer's instructions) (Figure 6). Hyaluronidase is an enzyme that promotes the degradation of the extracellular matrix and is commonly used in dermatology for the cosmetic treatment of scar tissue. Due to its extracellular matrix-degrading ability, hyaluronidase allows locally administered Formulation I-prepared luciferase-modified RNA to diffuse into the systemic circulation. Luciferase activity was measured 6 hours after administration of the test substance, under complete anesthesia, and after intraperitoneal administration of 3 mg D-luciferin / 100 μL PBS. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. The scale represents radiance in p / sec / cm2 / sr. As a result, when hyaluronidase was not added (Figure 5), luciferase activity was observed only at the injection site. On the other hand, when hyaluronidase was added (Figure 6), the diffusion of luciferase activity after administration was shown to be (2 times) wider, and the activity increased compared to when formulation I was used diluted in 0.9% NaCl. [Figure 7]Luciferase mRNA prepared with Formulation I was diluted in 0.9% NaCl or hyaluronidase solution, and animals were necropsied 4 hours after administration. Subsequently, ex vivo and in vivo imaging using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA) showed no activity in the liver and spleen when Formulation I dissolved in 0.9% NaCl (see organs at the top and far left of Figure 7). Regardless of the type of diluent, no activity was observed in the heart, right kidney, or lung. The scale represents radiance at p / sec / cm2 / sr. [Figure 8] Luciferase mRNA prepared with Formulation I was diluted in 0.9% NaCl or hyaluronidase solution, and animals were necropsied 4 hours after administration. Subsequently, ex vivo and in vivo imaging using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA) revealed luciferase activity in the excised liver and spleen of animals treated with Formulation I and treated with hyaluronidase solution (see upper and leftmost organs in Figure 8, spleen and liver). Regardless of the type of diluent, no activity was observed in the heart, right kidney, or lung. The scale represents radiance at p / sec / cm2 / sr. [Figure 9] Effect of phospholipid chain length. This figure shows the effect of phospholipid chain length on SARS-CoV-2 spike protein expression levels, measured as the area under the curve (AUC) of antibody production targeting the expressed protein (coronavirus spike protein receptor-binding domain (RBD)). The phospholipid chain lengths tested were 14, 16, and 18 carbon atoms. Each dot represents an individual mouse. PE: phosphatidylethanolamine. PC: phosphatidylcholine (see Table 5). The diameter of the dots corresponds to the area under the curve (AUC) value. [Figure 10]Immunotherapy effects of phospholipid species (PC (phosphatidylcholine) or PE (phosphatidylethanolamine)). This figure shows how phospholipid species affect the level of immunization against expressed SARS-CoV-2 spike protein. This was quantified by measuring the mean area under the curve (AUC) of antibodies targeting the expressed protein 36 days after immunization. The phospholipid chain lengths tested were 14, 16, and 18 carbon atoms. Each dot in the figure represents data from an individual mouse. PE: phosphatidylethanolamine. PC: phosphatidylcholine. The diameter of the dot corresponds to the area under the curve (AUC) value. [Figure 11] Effects of stealth PEG chain length (14-18 carbon PEG2000 or 5000Da). This figure shows the effect of stealth PEG chain length on SARS-CoV-2 spike protein expression, quantified as area under the curve (AUC) of a protein-targeting antibody 36 days after initial immunization in mice. In addition, the effects of stealth lipid chain lengths consisting of 14, 16, and 18 carbon atoms were also evaluated. Each dot in the figure represents data from an individual mouse. G: Dimyristoylglycerin-polyethylene glycol, PE: Dipalmitoylglycerin-polyethylene glycol phosphatidylethanolamine. The diameter of the dot corresponds to the area under the curve (AUC) value. [Figure 12] Effect of stealth PEG%. This figure shows the effect of PEG lipid % on SARS-CoV-2 spike protein expression, quantified as the area under the curve (AUC) of a protein-targeting antibody 36 days after initial immunization in mice. G: Dimyristoyl glycerin-polyethylene glycol-2000 or dimyristoyl glycerin-polyethylene glycol-5000, PE: Dimyristoyl phosphatidylethanolamine-polyethylene glycol-2000 or dimyristoyl phosphatidylethanolamine-polyethylene glycol-5000 (see Table 5). [Figure 13] Effect of sterol percentage. This figure shows the effect of sterol lipid percentage on SARS-CoV-2 spike protein expression / immunization, quantified as the area under the curve (AUC) of an antibody targeting RBD 36 days after initial immunization in mice. [Figure 14] Effect of cationic lipidoid %. This figure shows the effect of cationic lipidoid amount (%) on SARS-CoV-2 spike protein expression / immunization, quantified as the area under the curve (AUC) of an antibody targeting RBD 36 days after initial immunization in mice. [Figure 15] Effect of N / P ratio. This figure shows the effect of the nitrogen-to-phosphorus ratio on SARS-CoV-2 spike protein expression, quantified as the area under the curve (AUC) of an antibody targeting RBD 36 days after initial immunization in mice. [Figure 16] (A-D) hIFNλ1-mRNA levels in lung homogenates after a single inhalation administration (measured by qPCR). (A) hIFNλ1 mRNA copy number in lung homogenates 24 hours after administration of 0.024 mg / m² of hIFNλ1-LiNP, (B) hIFNλ1 mRNA copy number in lung homogenates 24 hours after administration of 0.048 mg / m² of hIFNλ1-LiNP, (C) hIFNλ1 mRNA copy number in lung homogenates 24 hours after administration of 0.096 mg / m² of hIFNλ1-LiNP, (D) hIFNλ1 mRNA copy number in lung homogenates 24 to 144 hours after administration of 0.024 mg / m² of hIFNλ1-LiNP. hIFNλ1-mRNA was quantified in lung homogenates by RT-qPCR. The control was non-coding mRNA-LiNP. mRNA concentration was calculated using a standard curve. Each dot represents one animal. The mean and standard deviation are shown. "Vehicle" does not include LiNP. [Figure 17]In vivo distribution of hIFNλ1-mRNA in lung homogenates 24 hours after single (1 dose) and repeated (4 doses) inhalation administration in rats. hIFNλ1 LNP-mRNA was measured by RT-qPCR in serum and organ homogenates 24 hours after single or repeated inhalation administration of the test product hIFNλ1 LNP. The vehicle group was obtained from study WP2_3_14 (see Table 10). Values ​​were quantified by interpolating a standard curve of mRNA spiked in the native matrix of untreated animals. The signal from vehicle-administered animals is considered the background level of the assay. Each dot represents one animal. Columns and error bars indicate the mean and standard deviation. "Vehicle" does not contain LiNP. [Figure 18] In vivo distribution of hIFNλ1-mRNA in the lungs, serum, and major organs 24 hours after single (1 dose) (Figure 18A) and multiple (3 doses) (Figure 18B) administration in rats. Test product hIFNλ1 LNP-mRNA was measured by RT-qPCR in serum and organ homogenates 24 hours after single or repeated inhalation administration of test product hIFNλ1 LNP. The vehicle group was obtained from study WP2_3_14. Values ​​were quantified by interpolating a standard curve of mRNA spiked in the native matrix of untreated animals. Each dot represents one animal. Columns and error bars indicate the mean and standard deviation. No mRNA was detected in serum, liver, brain, heart, spleen, or kidney after single or repeated administration. "Vehicle" does not contain LiNP. [Figure 19] In vivo distribution of the ionizable lipidoid dL_05 in the lungs, serum, and major organs after single (1) and multiple (3) inhalation administrations in rats. Lipid fractions of serum and organ lysates were analyzed by LC-MS / MS validated for dL_05 after single or repeated inhalation administration of the test product hIFNλ1 LNP. Values ​​were quantified by interpolating a standard curve of dL_05 spiked on the native matrix of untreated animals. Values ​​for all matrices except the lungs are below the detection limit. Each dot represents one animal. Columns and error bars indicate the mean and standard deviation. "Vehicle" does not contain LiNP. [Figure 20]hIFNλ1 protein concentration in lung homogenates after a single nasal inhalation administration of the test product hIFNλ1 LNP (Formulation I) in mice. Figure 20A shows the results after administration of 0.020 mg / m2 of hIFNλ1 LNP. Figure 20B shows the results after administration of 0.056 mg / m2 of hIFNλ1 LNP, indicating that hIFNλ1 protein was produced in a dose-dependent manner in the lung homogenate 5 hours after administration. No hIFNλ1 protein concentrations exceeding LLOQ were observed in the lungs of animals necropped at later time points (24-96 hours). Mean and standard deviations for three animals are shown. "Vehicle" does not contain LiNP. [Figure 21] (A-D) hIFNλ1 protein concentrations in lung homogenates after a single inhalation administration of hIFNλ1 LNP in rats. Doses were 0.012 mg / m2 (A), 0.024 mg / m2 (B), 0.048 mg / m2 (C), 0.096 mg / m2 (D), and 0.103 mg / m2 (E) (Study WP2_3_10, see Table 6). The highest hIFNλ1 protein concentration was measured 6 hours after administration and returned to baseline at 48 hours. Error bars indicate the mean and standard deviation. Animals receiving 0.012 mg / m2 (A), 0.024 mg / m2 (B), 0.096 mg / m2 (D), and 0.103 mg / m2 (E) were euthanized after 24 hours. Animals receiving 0.048 mg / m2(C) were euthanized at 6, 24, 48, 72, 96, and 144 hours after administration of the satellite animals. The "vehicle" does not contain LiNP. [Figure 22] (A-C) hIFNλ1 protein levels in rat lung homogenates and serum after single and repeated inhalation administration of the test product hIFNλ1LiNP in GLP toxicity studies. Serum and lung homogenates were analyzed using a validated hIFNλ1 ECL assay. Measurements were reported per lung tissue mass or per 1 mL of serum. Each dot represents one animal. Error bars indicate the mean and standard deviation. In all vehicle-administered animals, hIFNλ1 concentrations were BLQ in both matrices. hIFNλ1 was detected in both lung and serum, but at much lower levels in serum. These results support local expression after administration to the lung. The "vehicle" does not contain LiNP. [Figure 23](A-I) IVIS imaging in BALB / c mice (left column) and isolated lungs, hearts, livers, spleens, and right kidneys (right column, top to bottom) of the same animals. Six hours after intratracheal infusion of 50 μL (0.06 mg luciferase mRNA / mL), formulation I (dL_05(R), DPPC, cholesterol, DMG-PEG2000) and different carrier formulations with the same component ratios were used. (A): Formulation I, (B): Formulation M01-007, (C): Formulation M01-009, (D): Formulation M01-011, (E): Formulation M01-017, (F): Formulation M01-034, (G): Formulation M01-006, (H): Formulation M01-021, (I): Formulation M01-027. Circles indicate radiance values ​​measured in the region of interest (ROI). The scale represents radiance at p / sec / cm2 / sr. [Figure 24] Ex vivo luciferase activity was measured in the entire lung 6 hours after intratracheal infusion. Normally distributed data were analyzed using Ordinary One-Way ANOVA with Dunnett's test for multiple comparison correction (**p=0.0010). Each dataset is shown as a Box-Whiskers plot (minimum to maximum and median, n=5). [Figure 25] (A-D) IVIS imaging in BALB / c mice (left column) and isolated lungs, hearts, livers, spleens, and right kidneys (right column) of the same animals. Six hours after intratracheal infusion of 50 μL (0.06 mg luciferase mRNA / mL), formulations containing dL_05(R) (formula b-VI) and cholesterol, but with different helper and stealth lipids and lipid-to-lipid ratios, were used. (A): Formulation M02-102-006, (B): Formulation M02-103-003, (C): Formulation M02-002-003, (D): Formulation M02-109-006. Scales represent radiance at p / sec / cm2 / sr. All test formulations resulted in luciferase signals localized in the lungs of BALB / c mice. Expression was not detected in other tissues (isolated heart, liver, spleen, right kidney). This indicates that the administered formulation is localized and retained at the administration site (i.e., lungs). [Figure 26]Figures 26A and B show IVIS imaging in BALB / c mice (left column) and isolated hearts, lungs, right kidneys, livers, and spleens (right column). Six hours after intratracheal infusion of 50 μL (0.06 mg luciferase mRNA / mL), a formulation (formulation M03-076-3) containing two ethyl-propyl-ethyl lipidoids different from dL_05(R) (used in formulation I) and different helper lipids and lipid-to-lipid ratios was used. (A): Experiment with 3 mice, (B): Experiment with 2 mice. Formulation M03-076-3 contains lipidoids LG2C (formula b-IX) and LE1D (formula bX). Scales represent radiance at p / sec / cm2 / sr. All test formulations induced luciferase signals localized in the lungs of BALB / c mice. Expression was not detected in other tissues (isolated heart, liver, spleen, right kidney). This indicates that the administered drug is localized and retained at the injection site (i.e., the lungs). [Figure 27] IVIS imaging in BALB / c mice (left) and corresponding organs (lungs, liver, spleen). Although the EPE strain dL differs from dL_05(R), other lipids and lipid-to-lipid molar ratios are the same as formulation I. 50 μL (0.2 mg luciferase mRNA / mL) was administered via intratracheal microspray, and imaging was performed 4 hours later. (A): Formulation LF110, (B): Formulation LF181, (C): Formulation LF53. The scale in the figure represents radiance measured in p / sec / cm2 / sr. [Figure 28] IVIS imaging showing local expression 4 hours after intranasal administration of luciferase-encoding modified mRNA (formulation I, i.e., dL_05(R)) at 0.15 mg / mL (A), 0.5 mg / mL (B), and 1.5 mg / mL (C) in adult female C57BL6&JRj mice. The left image is a color image, and the right image is a grayscale image of the same mouse. The circles indicate radiance values ​​measured in the region of interest (ROI). The scale represents radiance in p / sec / cm2 / sr.

[0447] Sequence Listing: SEQ ID NO: Description 1 CoV spike protein 11. 5'-UTR sequence of mRNA of the present invention (Min UTR C) 12 DNA / mRNA sequences encoding 5'-GAAG-MinUTR-CT 13 DNA / mRNA sequences encoding 5'-MinUTR-CT 14. 5'-UTR sequence (Min UTR CT) in the vector of the present invention 15. 5'-UTR sequence (5'-GAAG-Min UTR CT) in the vector of the present invention 16. 5'-UTR sequence (5'-GGGA-Min UTR CT) in the vector of the present invention 17 DNA sequence of T7 promoter + MinUTR-C + Kozak 18 DNA sequence of T3 promoter + Min UTR-C + Kozak 19. DNA sequence of SP6 promoter + Min UTR-C + Kozak 20 DNA sequences of K11 promoter + Min UTR-C + Kozak 21 DNA sequence of T7 promoter + Min UTR-CT + Kozak 22 DNA sequences of T3 promoter + Min UTR-CT + Kozak 23. DNA sequence of SP6 promoter + Min UTR-CT + Kozak 24 K11 promoter + Min UTR-CT + Kozak DNA sequence 25 5'CYBA UTR DNA / mRNA sequence 26 3'CYBA UTR DNA / mRNA sequence 35-part poly A(1) array 36-part poly A(2) array 37-part poly A(3) array 38-part poly A(4) array 39-part poly A(5) array 40-part poly A(6) array 41 Codon-optimized hIFN-λ1 (DNA and RNA) sequences 42 mRNA encoding hIFN-λ1 43 mRNA encoding hIFN-λ1 without 3'UTR 44 Extended Kozak Array 45 Luciferase mRNA 46 Luciferase protein 47 CCDC39 sequence (with CYBA UTR) (ETH047T04) - Codon-optimized sequence encoding functional human CCDC39 protein 48 ETH047T02 (CCDC39 with minimal Ethris UTR) - Codon-optimized sequence encoding functional human CCDC39 protein 49 CCDC40 sequence (with CYBA 5 and 3 UTR) (ETH031T09) - Codon-optimized sequence encoding functional human CCDC40 protein 50 Ethris minimum 5 UTR sequence (ETH031T06) - Codon-optimized sequence encoding functional human CCDC40 protein

[0448] Specific embodiments of the present invention will be described with reference to the following examples, which are for illustrative purposes only and do not limit the scope of the generality described above. [Examples]

[0449] Specific embodiments of the present invention will be described with reference to the following examples, but these are for illustrative purposes only and do not limit the scope of the generality described above.

[0450] Example 1 - Evaluation of in vivo gene transfer efficiency of Formulation I after intratracheal administration

[0451] The purpose of this study was to investigate whether Formulation I could deliver genes to respiratory tissue after intratracheal administration, and whether the delivered mRNA remained locally or migrated systemically within the patient's body. For this, the same lipid nanoparticle (LNP) mRNA encoding firefly luciferase (Composition I (also referred to herein as Formulation I or LF92)) used in the hIFNλ1 LNP test reagents used in Examples 3-7 was used. The only difference between this tool product and the therapeutic hIFNλ1 LNP test reagent is that the mRNA in Examples 3-7 is the coding sequence for hIFNλ1, whereas in Example 1, the mRNA encodes luciferase, a reporter protein that is easier to measure.

[0452] Summary and Conclusion: Intratracheal administration of mRNA formulated in Composition I efficiently delivers mRNA to respiratory tissues, followed by translation of the encoded target gene (luciferase).

[0453] Furthermore, the absence of detection of the target protein in the liver and spleen (target organs after systemic administration) suggests that the formulation remains locally and does not enter the systemic circulation.

[0454] (1. Method) Test composition I (also referred to herein as formulation I or LF92) containing mRNA encoding luciferase was tested in vivo in mice by intratracheal infusion (1 μg / 50 μL).

[0455] Euthanasia and detection of luciferase in organs (using the IVIS 100 In Vivo Imaging System (Perkin Elmer, USA), parameters: Binning: High, FOV, f1, 1 min).

[0456] Data Acquisition / Evaluation: Luciferase signals were recorded 6 hours after administration, and bioluminescence was quantified using an in vivo imaging system (IVIS) after organ exposure to luciferin (see Figure 1). Bioluminescence in isolated mouse lungs (p / s / cm²) 2( / sr).

[0457] (1.1. Test specimens and test systems) Test product: Formulation I, containing chemically modified mRNA encoding luciferase, modified to 30% I5U / 3% I5C at a final concentration of 0.02 mg / mL during in vitro transcription.

[0458] For this study, we used 8-10 week old female mice of the C57BL / 6J strain, obtained from Charles River Laboratories.

[0459] (1.2. Formulation of Lipidoid Nanoparticles) Formulation I consists of an excipient mixture dL_05(R) (i.e., the (R) enantiomer of the compound according to formula (bV) of the present invention), DPPC, cholesterol, and DMG-PEG200 in a molar mixture ratio of 8:5.29:4.41:0.88 and an N / P ratio of 8 (referring to the ratio of the number of nitrogen atoms in the lipid to the number of phosphorus atoms in the encapsulated therapeutic agent (preferably nucleic acid). A lipid / lipidoid with a high N / P ratio (e.g., 8) can encapsulate the same amount of RNA in LiNP / LNP compared to a lipid / lipidoid with a low N / P ratio).

[0460] (1.3.LNP manufacturing method) The mRNA sequence encoding the luciferase sequence was synthesized from a linearized plasmid DNA template by in vitro transcription (IVT), and modified nucleotides were used to obtain partially modified mRNA. IVT was performed using T7-RNA polymerase at 37°C for 120 minutes, including co-transcriptional capping with an anti-reverse cap analog (ARCA), followed by template digestion with DNAse I. After IVT, the mRNA was dephosphorylated with alkaline phosphatase at 37°C for 15 minutes, and then enzymatically polyadenylated with PolyA polymerase at 37°C for 10-30 minutes, adding a PolyA tail of approximately 120 nucleotides. Purification was performed by precipitation, and the mRNA was then formulated in sterile water for injection at a concentration of 1 mg / mL. The mRNA was stored at -80°C until LNP encapsulation. Each mRNA was encapsulated as LNPs using nanoprecipitation with a microfluidic mixture (NanoAssemblr Ignite+, Precision Nanosystems, Vancouver) containing mRNA in citrate buffer (pH 4.5) and ionizable lipids, structural lipids, helper lipids, and polyethylene glycol (PEG) lipids in ethanol. Buffer exchange and concentration were then performed by tangential flow filtration. The mRNA LNPs were filtered through a 0.2 μm membrane and stored at -20°C until use. After preparation and freezing, the products were analytically characterized for particle size (≤100 nm), particle size distribution (≤0.2), encapsulation efficiency (≥90%), mRNA integrity (90-105%), and mRNA identification (length confirmation). The products were evaluated as suitable for in vivo use.

[0461] (1.4. Animal Husbandry) All procedures were approved by the local animal welfare authority (Regierung von Oberbayern) and carried out in accordance with the German Animal Protection Act (Tierschutzgesetz). Mice were kept in individual ventilated cages under specific pathogen-free conditions (negative for FELASA list pathogens based on the 2017 annual health and hygiene survey), under circadian rhythms (lights on from 7am to 7pm). Feed and water were available at any time. The animals underwent a acclimatization period of at least 7 days before the start of the experiment.

[0462] (1.5. Intratracheal infusion) The animals were anesthetized by inhaling pure oxygen containing 4% isoflurane (Isothesia, Henry Shine, Germany). Intubation was performed on the unconscious animals using a 20-gauge catheter shortened to 37 mm. The test sample was added as a single drop to the proximal end of the catheter, with a final volume of 50 μL, and aspirated by the animal's physiological inspiratory movements. Finally, 150 μL of air was injected to ensure no liquid remained in the catheter.

[0463] (1.6. Euthanasia and Autopsy) The animals were completely anesthetized by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). D-luciferin (3 mg / 100 μL PBS) was administered intraperitoneally and intranasally (1.5 mg / 5 μL PBS) by the "sniffing" method. Ten minutes later, the mice were euthanized by cervical dislocation immediately after blood collection. Blood samples were centrifuged at 4°C and 2,000 × g for 5 minutes. The abdominal cavity was opened along the midline. The diaphragm was carefully incised to bring the thoracic cavity to atmospheric pressure and immediately collapse the lungs. All ribs were dissected to expose the trachea. The left renal artery was dissected. The small circulation was perfused by injecting 5 mL of PBS into the right ventricle. The lungs, liver, and spleen were removed and placed ventrally downwards on a petri dish. Ex vivo imaging was performed using the IVIS 100 In Vivo Imaging System (Perkin Elmer, USA) with the following parameters: Binning: High, FOV, f1, and 1 minute.

[0464] (1.7.Results) The purpose of this study was to investigate whether the mRNA encapsulated in formulation I could be introduced into respiratory tissue cells after intratracheal administration, and whether the formulation remained localized in the administered organ or tissue.

[0465] As a result, a clear signal of mRNA-encoded reporter protein (luciferase) was detected at an animal dose of 1 μg. A clear signal was detected in the lungs, while the protein was not detected in the liver or spleen (Figure 1). This confirmed that formulation I (M01-001) remained localized in the administered organ.

[0466] (1.8. Discussion and Conclusion) Experiments demonstrated that formulation I (M01-001) efficiently delivered mRNA to respiratory cells, leading to translation into the target protein. The formulation remained localized, and no expression was observed in the liver or spleen.

[0467] This is surprising because previous studies have shown transfection to the liver and spleen after intravenous administration of formulation I (M01-001). Therefore, since the reporter protein is not detected in the liver and spleen, we can conclude that formulation I (M01-001) remains localized in the administered organ or tissue, particularly the lung tissue, and does not cross into the systemic circulation. Based on both of these observations, we can conclude that formulation I (M01-001) is a suitable candidate for further development into clinical administration for local expression.

[0468] Example 2 - Long-term monitoring of localized expression

[0469] BALB / c strain experimental mice were briefly anesthetized by inhalation of isoflurane (2-3%). Luciferase-encoding chemically modified mRNA prepared with Formulation I was injected into the pretibialis muscle of both hind limbs at a dose of 20 μg / 20 μL using a 0.3 mL insulin injection syringe (BD, Germany). Luciferase activity was measured on days 1 and 4 under total anesthesia and after intraperitoneal administration of 3 mg D-luciferin / 100 μL PBS. Luciferase activity was measured using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Local luciferase activity was measured using a defined region of interest (ROI) drawn on the injection site. An ROI on the thoracic region was used as an internal control.

[0470] The results (Figures 2-4) showed that equivalent levels of luciferase expression were observed in both hind limbs on day 1 after administration of the test substance. Luciferase activity remained stable for 4 days after administration. No luciferase activity was observed in other body parts, indicating that the test substance was not distributed throughout the body.

[0471] Example 3 - Local expression in subcutaneous tissue after subcutaneous administration

[0472] Luciferase mRNA (20 μg) prepared as Formulation I was dissolved in 300 μL of physiological saline (0.9% NaCl) or 300 μL of hyaluronidase solution (Hylase ''Dessau'' 150 (I)U., HWI Pharma Services GmbH, Germany) and subcutaneously administered to the dorsal neck of female BALB / c mice that had been briefly anesthetized by isoflurane inhalation. Luciferase activity was measured 4 hours after administration using the Lumina XR In Vivo Imaging System (Perkin Elmer, USA). Luciferase activity was observed after administration of both the saline-dissolved and hyaluronidase-dissolved LF92 (Formulation I) LUC mRNA. However, luciferase activity after administration of hyaluronidase-dissolved LF92 (Formulation I) LUC mRNA was significantly higher (2 times) compared to administration of saline-dissolved mRNA. After in vivo measurements of luciferase activity (Figures 5 and 6), the animals were euthanized, and organs were removed for ex vivo measurements of luciferase activity. In this study, no luciferase activity exceeding background levels was observed in any of the measured organs (liver, spleen, heart, lung, and right kidney) after administration of LF92 (formulation I) LUC mRNA dissolved in physiological saline. However, after administration of LF92 (formulation I) LUC mRNA dissolved in hyaluronidase, a significant increase in luciferase activity was observed, 37 times in the liver and 52 times in the spleen (Figures 7 and 8).

[0473] In Figure 7, no detectable luciferase signal is observed in any organ. The values ​​correspond to the background signal, and the images correspond to visible light images acquired from the organs. In Figure 8, a significant signal derived from luciferase is observed. To detect this signal, the camera was set to maximum sensitivity, which generated a pixelated image. Therefore, a comparison of Figure 7 and Figure 8 shows that significant luciferase expression was observed in at least the liver and spleen after intramuscular administration with hyaluronidase, suggesting a decrease in local retention (or an increase in systemic distribution) of luciferase-encoding mRNA.

[0474] Example 4

[0475] (4.1. Scope) To understand the effect of the molar ratio of each component of the formulation of the present invention on activity / expression levels and immunogenicity, multiple alternative formulations were prepared for all components, as summarized in Tables 3 and 4, and administered intramuscularly to mice, as summarized in Figures 9 to 15. Each formulation was administered to different mice. Figure 9 summarizes the effect of phospholipid chain length. Figure 10 summarizes the effect of phospholipid type (PC (phosphatidylcholine) or PE (phosphatidylethanolamine)). Figure 11 summarizes the effect of stealth PEG chain length (14-18 carbon PEG2000 or 5000Da). This figure shows the effect of stealth PEG chain length on spike protein expression, quantified by AUC (area under the curve) of antibodies targeting the SARS-CoV-2 spike protein at 36 days post-initial immunization in mice. In addition, the effects of stealth lipid chain lengths consisting of 14, 16, or 18 carbons were also evaluated. All tested stealth lipids showed excellent immunogenicity. In particular, the use of 14-carbon PEG2000Da yielded the best results (i.e., the highest immune levels). Figure 12 also highlights the effects of using G (glycerol DMG PEG) or PE (DMG PEG2000 phosphatidylethanolamine) as shown in Figure 11. Both showed good immune levels. Dot size indicates the immune AUC at 36 days.

[0476] Screening was performed in a mouse model. LiNPs were conjugated with mRNA encoding the SARS-CoV-2 (Wuhan strain) spike protein and administered intramuscularly on days 1 and 21. Treated animals were evaluated for spike protein receptor-binding domain (RBD) specific antibodies after the first and second immunizations, and the cytokine expression profile of spleen cells was assessed using ELISpot analysis.

[0477] In summary, all ratios tested showed significant expression and significant immunity in the tests. M01-001 is indicated by an open circle (O) in Figures 9-15. M04-001 contains the same LNP component as M01-001 (also known as Formulation I or LF92 above) and further contains poloxamer (P188), and is indicated by a cross (+). The addition of poloxamer improved immunogenicity.

[0478] Figures 13, 14, and 15 show that cholesterol, dL_05(R), and different N / P ratio ranges can induce high immune levels, recorded as the AUC of protein-targeting antibodies 36 days after initial immunization, respectively.

[0479] In summary, all alternatives provided demonstrated significant immunity, as measured by the area under the curve (AUC) at day 36 (see Example 4.6).

[0480] (4.2.LiNP preparation) The carrier was mixed using the NanoAssemblr™ benchtop system described in Example 1. The lipid mixture was prepared according to Tables 3 and 4. Downstream processing (buffer exchange) was performed by dialysis using a Slide-A-Lyzer MINI dialyzer. The instrument was prepared according to the manufacturer's manual. 2 mL of the formulation was transferred to a sample reservoir and dialyzed against water using a 300 rpm orbital shaker. After 1.5–2 hours, the dialysis buffer was replaced with fresh water, and the formulation was dialyzed overnight (14–18 hours). Subsequently, 920 μL of each formulation was transferred to a reaction tube and concentrated to 0.5 mL (c=0.3125 mg / mL) using speed vacuum (45°C, V-AQ mode (vacuum-water system)). Aggregates were removed by centrifugation (16,000 × g, 30 min). Transfer 400 μL of the supernatant to a new reaction tube, add 100 μL each of 5% (w / v) P188, 50% (w / v) sucrose, and 250 mM NaCl, and pipette 4-5 times. For M04-001, add 100 μL each of 5% (w / v) P188, 50% (w / v) sucrose, and 125 mM NaCl. Store the preparation at 4°C.

[0481] (4.3.Immunity) On the first day of immunization, 0.020 mL of each test substance was administered intramuscularly (i.m.) into the quadriceps femoris muscle of the right leg of each animal. All animals received a second dose of 0.020 mL of each test substance intramuscularly (i.m.) into the same leg on day 22 of the study.

[0482] (4.4. Blood test) Approximately 100 μL of blood was collected from each animal via the facial vein on day 1 (before administration of the test substance) and on day 15, and placed in a serum separation tube. At the time of euthanasia, blood was collected via cardiac puncture and placed in a serum separation tube (day 36 of the experiment).

[0483] Whole blood samples collected from all animals were allowed to stand at room temperature for approximately 30 minutes to allow for blood coagulation. The samples were then centrifuged at approximately 1000g at 4°C for 10 minutes. After centrifugation, the serum was transferred to a separate tube. Samples collected on day 36 of the study were divided into two tubes.

[0484] (4.5. Autopsy) On the scheduled euthanasia day (day 36 of the experiment), all animals were euthanized using anesthesia (ketamine / xylazine). The spleens of all animals were removed and transferred to 50 mL Falcon tubes filled with 5 mL of pre-warmed 1×CTL washing buffer. The spleens were kept at 37°C until further processing.

[0485] (4.6. Quantification of RBD-specific antibodies) SARS-CoV-2 RBD-specific antibodies were quantified by ELISA. For this purpose, 384-well plates were coated overnight at 4°C with 20 μL of recombinant SARS-CoV-2 spike protein RBD (Sino Biological, 40592-V08B) diluted in CBB buffer per well. The plates were washed three times with PBST using a microplate washer. The plates were blocked at room temperature and 600 rpm for 1 hour with 50 μL of 1% casein blocking solution (ThermoFisher Scientific, Cat.Nr.37528) per well. The plates were washed three times with PBST using a microplate washer. Anti-RBD IgG standard curves (0.06–1,000 ng / mL) were prepared in PBST using mouse anti-SARS-CoV-2 RBD antibody (R&D Systems, Cat.Nr.MAB105808-100). Standard curves and samples (serum was applied in serial dilutions of 1:4, starting at 1:50) were added to the plate in 20 μL in each well and incubated at room temperature and 600 rpm for 1 hour. The plates were washed three times with PBST using a microplate washer. Detection antibody (Abcam, ab205719) was diluted 1:2000 with PBST and added to the plate in 20 μL in each well and incubated at room temperature and 600 rpm for 1 hour. The plates were washed three times with PBST using a microplate washer. Finally, 20 μL of TMB was added to each well and incubated at room temperature and 600 rpm for 1.5 minutes. The reaction was stopped by adding 10 μL of H2SO4 to each well. Absorbance was measured at 450 / 650 nm using a microplate reader. Results were interpolated using the standard curve to obtain the IgG concentration in the samples. The lower limit of quantification (LLOQ) and upper limit of quantification (ULOQ) for this assay are 0.5 ng / mL and 100 ng / mL, respectively. The serum MRD is 1:800. In addition to antibody level quantification, the reciprocal titer was also measured. Titer is defined as the highest measured concentration that yields a result exceeding the limit of detection (LOD). The LOD for this assay is defined as three times the mean OD of pure PBST.Calculation of Area Under Curve (AUC): For each sample collected, the optical density (OD) of the ELISA was measured within the dilution range. For the OD data, a nonlinear fit: log(inhibitor) versus response was confirmed. R. 2 The values ​​were over 95%, indicating a very high correlation between inhibitor dilution and measured optical concentration. AUC was calculated for OD data using dilution factors of 1.69897, 2.30103, 2.90308999, 3.50514998, 4.10720997, and 4.70926996. This data was used as AUC in all downstream analyses.

[0486] [Table 3]

[0487] [Table 4]

[0488] [Table 5]

[0489] Table 5 discloses the standard names of the helper lipids and stealth lipids used in all formulations.

[0490] Abbreviations for Examples 4-6

[0491] [Table A]

[0492] Example 4: Local delivery of LiNP based on formulation I, carrying mRNA encoding the therapeutic protein human interferon lambda 1 (hIFNλ1).

[0493] 4.1. Introduction

[0494] The local delivery of the target therapeutic polypeptide was tested using a 2.5 mg / mL frozen LiNP formulation I suspension containing modified messenger RNA (mRNA) encoding human interferon lambda 1 (hIFNλ1) (hereinafter referred to as the test drug product hIFNλ1 LNP).

[0495] Interferons (IFNs) are potent cytokines that play a crucial role as a first line of defense against viral infections by controlling inflammation and directly inducing antiviral mechanisms. Among them, type III interferons such as interferon-lambda 1 (IFNλ1) play a critically important direct role in viral defense in the respiratory epithelium, a common site of entry for respiratory viruses. The advantage of local expression of therapeutic proteins such as IFNλ1 lies in the avoidance of side effects caused by the activation of systemic downstream targets. This document demonstrates that local expression can be achieved using the lipidoid of the present invention.

[0496] 4.2. Test mRNA

[0497] mRNA (average length 788 nucleotides) encoding human codon-optimized interferon lambda 1 (SEQ ID NO: 41) was produced from a linearized plasmid DNA template by in vitro transcription (IVT) using T7 RNA polymerase. Partially modified mRNA was generated using 25% 5-methylcytosine, 75% cytidine, 25% 2-thiouridine, and 75% uridine as modifying bases in the mixture. The use of modified nucleosides in mRNA reduces the affinity and recognition of the mRNA by intracellular Toll-like receptors (TLRs), retinoid-inducible gene 1 (RIG-1), etc., significantly reducing the activation of the innate immune system in vitro and in vivo, while simultaneously improving mRNA stability, enabling high levels of intracellular translation over long periods. LiNP contains a lipidoid component (dL_{05}(R)) and excipients optimized for aerosol delivery of LNP-formulated mRNA. The complete structure of the mRNA includes a 5' cap, a 5' minimum UTR, a human codon-optimized IFNλ1 coding sequence, and a poly(A) tail (SEQ ID NO: 42). The poly(A) may be encoded polyA or enzymatically added. In the mRNA tested, the poly(A) was enzymatically added.

[0498] 4.3. Preparation of hIFNλ1 test LiNP

[0499] The tested drug was a preservative-free sterile dispersion containing mRNA encoding hIFNλ1 formulated in Formulation I lipidoid nanoparticles (LiNPs) dispersed in an aqueous cryoprotectant solution. The lipidoid nanoparticles were prepared by mixing the mRNA with a solution of one lipidoid and three lipid excipients (lipidoid dL_{05}(R), lipid DPPC[1,2-dipalmitoyl-sn-glycero-3-phosphocholine], cholesterol, and DMG-PEG 2000[1,2-dimiristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000]). The excipients associate with the mRNA, protect it from degradation, and assist in delivery to target cells in the respiratory epithelium. Downstream steps after the mixing of lipids and mRNA include buffer exchange and concentration. After preparing a buffer solution containing sucrose, poloxamer P188, and sodium chloride from water for injection, the solution was aseptically filtered and aseptically packed to a nominal volume of 1.0 mL with an mRNA concentration of 2.50 ± 0.50 mg / mL. The solution was then frozen and stored at -20 ± 5°C. This drug is characterized as a white to off-white suspension.

[0500] 4.4 Calculation of lung surface exposure

[0501] The dosage for inhalation toxicity studies was calculated according to the recommendations of the Japanese Society of Inhalation Toxicology, taking into account aerosol concentration, respiratory rate per minute, and inhalation time (Alexander et al. 2008). The resulting exposure to the nasal cavity and lung surface depends on the droplet size of the aerosol. When the measured median mass aerodynamic diameter (MMAD) of hIFNλ1 LNP aerosol droplets was 1.5–2 μm, 60% of the administered dose was deposited in the upper respiratory tract and 10% in the lower respiratory tract (Snipes, MB, ROMcClellan, JLMauderly, and RKWolff. 1989. "Retention patterns for inhaled particles in the lung: comparisons between laboratory animals and humans for chronic exposures," Health Phys, 57 Suppl 1:69-77; discussion 77-8; Wong, BA2007. "Inhalation exposure systems: design, methods and operation," Toxicol Pathol, 35:3-14). This deposition pattern was also confirmed by modeling using the Multiple Path Particle Dosimetry (MPPD) model (Anjilvel, S., and B. Asgharian. 1995. "A multiple-path model of particle deposition in the rat lung," Fundam Appl Toxicol, 28:41-50).

[0502] Example 5: In vivo pharmacokinetics of hIFNλ1 mRNA

[0503] 5.1. In vivo distribution of hIFNλ1 mRNA in mice and rats - Methods

[0504] The in vivo distribution of hIFNλ1 LNP-mRNA (pharmaceutical active pharmaceutical ingredient) was analyzed by RT-qPCR in the lungs, serum, and liver in rat inhalation DRF studies, and in serum and all major perfused organs (i.e., lungs, liver, spleen, heart, kidneys, and brain) in rat GLP toxicity studies. In DRF studies, tissues were pulverized in liquid nitrogen and homogenized in Lysing Matrix D tubes (MP Biomedicals). RNA was isolated using the RNeasy Mini Kit (QIAGEN). RNA from serum was isolated using the miRNeasy Serum / Plasma Advanced Kit (QIAGEN). cDNA synthesis was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with Oligo(dT) priming. qPCR was performed using customized TaqMan primers / probes and TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). In the GLP toxicity study, hIFNλ1 LNP-mRNA was extracted from rat tissue using the QIAGEN RNeasy Mini Kit (QIAGEN) and from serum using the miRNeasy Serum / Plasma Advanced Kit (QIAGEN). Rat tissue and serum RNA extracts were quantified by two-step reverse transcription RT-qPCR using Oligo(dT) priming with the Roche Transcriptor High Fidelity cDNA synthesis Kit, followed by qPCR using TaqMan® Environmental Master Mix (2.0) (Thermo Fisher Scientific). mRNA extraction and RT-qPCR in the GLP study were performed using validated methods.

[0505] 5.2. mRNA pharmacokinetics of test sample hIFNλ1 LNP

[0506] The whole-body bioavailability of hIFNλ1 LNP-mRNA was evaluated by quantitative PCR (qPCR) after inhalation administration in rat dose-range setting (DRF) and GLP toxicity studies (studies WP2_{3}_{10}, WP2_{3}_{13}, and WP2_{3}_{15} are summarized in Tables 6, 7, 8, and Figure 16 below, respectively).

[0507] In a non-GLP dose-ranging (DRF) study using Wistar Han rats, the peak concentration of hIFNλ1 LNP-mRNA derived from the test product was detected in lung homogenate 6 hours after a single inhalation (the first measurement after drug administration). Lung levels at 24 hours were lower than at 6 hours but were consistently maintained up to 48 hours. After 48 hours, lung hIFNλ1 LNP-mRNA levels decreased further (see Figure 16D). Notably, lung hIFNλ1 LNP-mRNA levels 24 hours after administration increased in a dose-dependent manner, consistent with a dose-dependent increase in lung hIFNλ1 protein concentration (see Figures 21A-E).

[0508] After a single inhalation administration to rats (WP2315, see Table 7 below for details), test hIFNλ1 LNP-mRNA was measured by RT-qPCR in serum and homogenates of major perfused organs within 2 hours post-inhalation administration. Values ​​were quantified by interpolation using a standard curve of mRNA spiked into the native matrix of untreated animals. The signal from vehicle-administered animals is considered the background level of the assay. Each dot represents one animal. Columns and error bars indicate the mean and standard deviation. hIFNλ1-coding mRNA from the test product was not detected in serum, and liver copy numbers were consistent with the background level of vehicle-administered animals (Figure 17). Vehicle copy numbers / ng or copy numbers / mL exceeding the LOD are considered artifacts because the vehicle does not contain mRNA. These results support the idea that drug substance mRNA encoding therapeutic proteins (e.g., hIFNλ) does not exhibit substantial systemic bioavailability upon inhalation.

[0509] In GLP toxicity studies, test product hIFNλ1 LNP-mRNA was detected in the lungs after a single inhalation dose. Low signals were observed in serum and major perfusion organs within the background level range (i.e., Ct value > 35) in vehicle-administered animals. The hypothetical copy numbers in these organs corresponded to less than 0.01% of the copy number detected in the lungs and were not considered biologically significant.

[0510] These data support the results of the biodistribution assessment in the non-GLP DRF trial, indicating that the test product hIFNλ1 LNP does not exhibit systemic bioavailability to a relevant degree after inhalation administration.

[0511] [Table 6]

[0512] [Table 7]

[0513] [Table 8]

[0514] Example 6: Pharmacokinetics of ionizable lipidoid dL_05 in hIFNλ1 LNP

[0515] To evaluate the biodistribution of LiNPs lipid components, the biodistribution of defined ionizable lipidoid 05 (dL_05) was measured in the lungs, serum, and liver of rats in a GLP toxicity study (Test WP2_3_13, see Table 7 above) using validated HPLC-MS / MS (High Performance Liquid Chromatography Tandem Mass Spectrometry). Detection of LNPs using dL_05 is particularly suitable as a specific biomarker for LNP biodistribution because endogenous levels are not assumed. Other lipid components of LNPs include cholesterol (endogenously present), DPPC, and DMG-PEG. DPPC is naturally occurring and is the major phospholipid of lung surfactant, while the detection of DMG-PEG in humans may be biased by exposure to PEG from other sources, as PEG is a widely used excipient in many pharmaceutical and cosmetic products. Therefore, dL_05 is a highly specific translational biomarker for the systemic detection of drug products. When using HPLC-MS / MS, the limit of quantification (LLOQ) for detecting dL_05 in serum and lung was 100 ng / mL, and in liver it was 200 ng / mL.

[0516] The focus of the in vivo biodistribution evaluation was serum and liver, as known LNPs and LNP-formulated mRNAs typically distribute to the liver when they become systemically bioavailable. Consistent with the distribution pattern of the test product hIFNλ1 LNP-mRNA (Figures 18A and 18B), the biodistribution of dL_05 was detected only in the lungs after inhalation of the test product hIFNλ1 LNP, and no systemic bioavailability was observed in serum or any major perfused organs after a single dose (Figure 19A) or multiple doses (Figure 19B). Therefore, the absence of exposure in serum and liver supports the conclusion that the LiNP containing the lipidoid of the present invention does not have systemic bioavailability.

[0517] Example 7: In vivo pharmacokinetics of hIFNλ1 protein

[0518] 7.1 hIFNλ1 protein expression in mice

[0519] Intrapulmonary hIFNλ1 production following local delivery of hIFNλ1 LNP to the lungs was confirmed in multiple studies in mice and rats by measuring hIFNλ1 in lung homogenates.

[0520] In study WP2_2_4 (Table 9), lung surface exposure levels were 0.020 or 0.056 mg / m² for wild-type C57BL / 6 mice. 2 The test product hIFNλ1 LNP was administered as a single dose via nasal inhalation. The control group received 0.020 mg / m². 2 A group was established that received a non-translating control mRNA. Animals were euthanized at 5, 24, 48, 72, and 96 hours after administration, and their lungs were removed for endpoint measurement. The test results showed that the test product hIFNλ1 LNP was well tolerated after administration to the lungs of mice and resulted in dose-dependent intrapulmonary hIFNλ1 production at 5 hours (Figures 20A and 20B). Protein levels returned to background levels after 24 hours. No increase in hIFNλ1 protein levels was observed with the formulation control mRNA, confirming that the hIFNλ1 concentration increased due to translation of the test product hIFNλ1 LNP-mRNA.

[0521] hIFNλ1 protein was produced in a dose-dependent manner in lung homogenates 5 hours after administration. No hIFNλ1 protein concentrations exceeding the limit of quantification (LLOQ) were observed in the lungs of animals necropsied at later time points (24–96 hours). The mean and standard deviations for three animals are shown.

[0522] [Table 9]

[0523] 7.2 hIFNλ1 protein expression in rats

[0524] 7.2.1 Test WP2_3_10

[0525] Single-dose and multi-dose inhalation studies were conducted in rats to analyze hIFNλ1 production. Furthermore, a single-dose DRF study was performed in rats, measuring serum and lung hIFNλ1 concentrations after exposure to the test product, hIFNλ1 LNP, solely through the nasal cavity. A summary of these rat DRF studies is shown in Tables 5 and 6 above, and in Table 11 below.

[0526] In the inhalation test (Test WP2_3_10, summarized in Table 6 above), Wistar Han rats were exposed to lung doses of 0.012, 0.024, 0.048, and 0.096 mg / m². 2 The test product hIFNλ1 LNP was administered via nasal inhalation, and the lung exposure was 0.024 mg / m². 2 The animals were administered a formulation of non-translating control mRNA (Figures 21A-21E). A control group was also established that received only a vehicle solution containing all components of the drug formulation. All animals in the administration group were euthanized 24 hours after administration. 0.024 mg / m² 2 In the treatment groups, satellite animals were euthanized at 6, 24, 48, 72, 96, and 144 hours post-administration. A single inhalation of the test product hIFNλ1 LNP in rats resulted in dose- and time-dependent hIFNλ1 production in the lungs at 24 hours, although hIFNλ1 protein concentrations were below the lower limit of quantification in non-coding control mRNA and vehicle-administered animals. The highest hIFNλ1 protein level was measured 6 hours after administration of 0.024 mg / m² and returned to baseline at 48 hours (Figure 19B). hIFNλ1 was not detected in serum.

[0527] 7.2.2 Test WP2_3_13

[0528] In a GLP-compliant inhalation toxicity study using Wistar Han rats (Study WP2_3_13, see Table 7 above), each subject received a single dose of LiNP hIFNλ1. The dose was 2.05 mg / kg of body weight and administered via nasal inhalation. The main group of this study consisted of 10 males and 10 females, with an additional subgroup of 5 males and 8 females for biodistribution and lung safety evaluation. The calculated nasal exposure in this dose was 176 mg / m² per surface area, as described below.

[0529] To facilitate comparison of studies using different administration routes in different animal species, the dose is measured based on lung or nasal surface exposure [mg / m²]. 2 It is defined as follows. Surface exposure was calculated based on hIFNλ1 LNP deposited after nasal inhalation and the corresponding surface area in animal models (Fernandes, CA, and R. Vanbever. 2009. 'Preclinical models for pulmonary drug delivery', Expert Opin Drug Deliv, 6:1231-45; Gizurarson, S. 1990. 'Animal models for intranasal drug delivery studies. A review article', Acta Pharm Nord, 2:105-22). The principle of calculating surface exposure and extrapolation between species are described in further detail in Section 7.1.

[0530] In mice, the amount of deposition in the nasal cavity and lungs after intranasal administration, i.e., surface exposure, depends on the volume of the administered solution (Southam, DS, M. Dolovich, PMO'Byrne, and MD Inman. 2002.'Distribution of intranasal instillations in mice: effects of volume, time, body position, and anesthesia', Am J Physiol Lung Cell Mol Physiol, 282:L833-9). The administered solution volumes related to the studies described herein were 15, 20, and 50 μl, with 35%, 40%, and 55.7% of the administered volume deposited in the lungs, respectively.

[0531] Animals in the primary group and the biodistribution / pulmonary safety group were euthanized 24 hours after the final dose. Animals in the recovery group were euthanized 14 days after the final exposure. The test product hIFNλ1 LNP was administered by nasal inhalation. This included a single-dose group receiving the highest dose once, and a vehicle group receiving three doses of a vehicle solution containing all components of the drug formulation. In addition, satellite animals for pharmacokinetic (PK) analysis were euthanized immediately after plethysmography on the day of the final dose (day 1 for the single-dose group).

[0532] Lung homogenate and serum hIFNλ1 protein levels were measured using a validated ECL assay. Within two hours of a single dose of hIFNλ1 LNP, lung concentrations reached a maximum of 60,000 ng per g of tissue (Figure 22A). Serum concentrations, on the other hand, were less than 600 pg / mL (see Figures 22B and 22C). Normalizing these data to the absolute amount of hIFNλ1, and using an average lung weight of 1.7 g and total blood volume of approximately 18 mL, it was found that, on average, less than 0.01% of the hIFNλ1 translated in the lungs reached the circulatory system approximately two hours after administration (ranging from 33 minutes to 5 hours and 22 minutes, see Figure 22). Repeated administration of hIFNλ1 LNP resulted in lower lung and serum hIFNλ1 concentrations compared to single-dose administration. While dL_05 concentrations increased in a dose-dependent manner in the lungs, serum and liver levels remained below the lower limit of quantification. No significant findings were observed in clinical laboratory tests, clinical chemistry tests, or urinalysis.

[0533] [Table 10-1] [Table 10-2] [Table 10-3]

[0534] 7.2.3 In a dose-finding study for intranasal administration (Study WP2_3_14, see Figure 22 below), the test product hIFNλ1 LNP was administered to Wistar Han rats at nasal surface exposure levels of 3, 11, and 44 mg / m², respectively. 2The drug was administered at the following doses. Nasal administration was performed as a single drop of 13 μL per nostril (the maximum volume that could be held in the nasal cavity). Single dose (all dose levels of hIFNλ1 LNP, vehicle, control mRNA, and rat IFNλ1 coding mRNA were administered at 0.075 mg / kg body weight). The vehicle was a buffer for diluting the test product hIFNλ1 LNP after purification, containing 10% sucrose (w / v), 1% P188 (w / v), 50 mM NaCl, and sterile water for injection. The control mRNA was an mRNA with a shuffled ATG sequence that did not express any protein. Repeated doses were performed (dose level 0.075 mg / kg body weight, days 1, 3, 5, and 7). The control group received either untranslatable control mRNA or rat IFNλ1 coding mRNA, with a nasal surface exposure of 11 mg / m². 2 The animals were administered at the doses indicated above. The animals were euthanized one day after the final dose. In addition, the two highest dose groups included animals that were euthanized five days after the final dose. An additional multiple-dose group received four doses of the test product hIFNλ1 LNP at a dose resulting in a nasal surface exposure of 11 mg / m²^, and the animals in this group were euthanized one day after the final exposure. No hIFNλ1 protein was measured in serum or lung, confirming the absence of systemic bioavailability of hIFNλ1 protein derived from the test product hIFNλ1 LNP after nasal administration.

[0535] [Table 11]

[0536] Example 8

[0537] 8.1. Scope

[0538] To understand the effect of the molar ratio of each component of Formulation I on its local retention capacity, several alternatives for all components of Formulation I were summarized in Table 12 and evaluated in vivo using an in vivo imaging system (IVIS) in mice. The results are shown in Figures 23 (A) to (I).

[0539] 8.2. Experimental Design:

[0540] The following formulations were prepared using the method described above for Formulation I.

[0541] [Table 12-1]

[0542] [Table 12-2]

[0543] Similar to Example 1, 50 μL of a LiNPs formulation containing 0.06 mg of chemically modified mRNA encoding luciferase mRNA per 1 mL was administered to five BALB / c mice by intratracheal infusion of the encapsulated formulation. The D-luciferin substrate was administered to the animals by intraperitoneal and intranasal administration, and the animals were euthanized 6 hours after administration. Luciferase activity was measured in excised organs using the Lumina XR In vivo Imaging system (Perkin Elmer, USA).

[0544] Table 12 shows that for each treatment group, five BALB / c mice were tested with carrier formulations containing the same components (dL_05(R), DPPC, cholesterol, DMG-PEG2000) but in different ratios. Figure 23 shows the results for (A): Formulation I, (B): Formulation M01-007, (C): Formulation M01-009, (D): Formulation M01-011, (E): Formulation M01-017, (F): Formulation M01-034, (G): Formulation M01-006, (H): Formulation M01-021, and (I): Formulation M01-027 in whole-body BALB / c mice (left column) and in isolated lungs, hearts, livers, spleens, and right kidneys (right column) of the same animals. In all tested animals, the same localization limited to the lungs was observed.

[0545] All tested formulations showed high expression in the delivered organ (lungs). In particular, formulations M01-006, M01-021, and M01-027 showed significantly higher luciferase activity compared to formulation I (see Figure 23(GI), mean radiance p / s / cm²). 2 (Measured with / sr). Comparative values ​​of the tested formulations are shown in Figure 24, with formulations M01-006, M01-021, and M01-027 having an average of 10 7 p / s / cm 2 Radiance exceeding / sr is shown.

[0546] 8.3 Summary and Conclusion

[0547] All test ratios of lipidoids, helpers, sterols, stealth lipids, or N / P ratios functioned efficiently and showed high luciferase expression. Furthermore, all test formulations showed limited localization similar to formulation I. This is quite surprising and supports the idea that the localization of the formulations is due to the lipidoids of the present invention, rather than to specific lipid or mRNA ratios. In addition, formulations M01-006, M01-021, and M01-027 showed remarkably high expression compared to the already good expression of formulation I.

[0548] Example 9

[0549] 9.1 Scope

[0550] To understand the effects of using different helper lipids and stealth lipids than those used in Formulation I in combination with lipidoid DL05, the components summarized in Table 13 below were prepared and administered intratracheally to BALB / c mice as described in Example 8. The results are summarized in Figure 25.

[0551] [Table 13-1]

[0552] [Table 13-2]

[0553] 9.2 Methods and Results

[0554] Five mice were euthanized 6 hours after intratracheal administration of 50 μL (0.06 mg luciferase mRNA / mL) of formulations containing dL_05(R) and cholesterol, but with different helper and stealth lipids and lipid ratios. The results are shown in Figure 25(AD), which shows IVIS imaging of BALB / c mice (left column) and isolated lungs, hearts, livers, spleens, and right kidneys of the same animals (right column): (A): Formulation M02-102-006, (B): Formulation M02-103-003, (C): Formulation M02-002-003, (D): Formulation M02-109-006. The scale is p / sec / cm. 2 This represents the radiance at / sr.

[0555] 9.3. Conclusion

[0556] All tested additional helper lipids (DSPC or DOPC) and stealth lipids (MPG-PEG2000 or polysarcosine-based stealth lipid N-TETAMINE-pSaR25) showed similar local localization after intratracheal infusion, supporting the idea that good expression and local expression can be achieved with helper lipids and stealth lipids other than those used in Formulation I. These results also support the idea that tissue localization is caused by the lipidoids of the present invention.

[0557] Example 10 - Localization of Lipidoid Combinations

[0558] 10.1. Purpose

[0559] To determine whether other lipidoids defined by formula (b-1) exhibit similar local localization after delivery, and to test whether lipidoid combinations exhibit local localization, the following components were formulated as summarized in Table 14. The results after IVIS in mice are shown in Figures 26(A) and (B).

[0560] 10.2. Test Formulation

[0561] Test formulations containing the combination of LG2C and LE1D were prepared together with luciferase-encoding mRNA and administered by injection to five BALC mice according to the methods described in Examples 8 and 9, as shown in Table 14.

[0562] LG2C:N 1 ,N 17 -Didecyl-4,7,11,14-Tetrakis(3-(decylamino)-3-oxopropyl)-4,7,11,74-Tetraazaheptadecanediamide [ka]

[0563] LE1D:(13R,27R)-15,18,22-Tris((R)-2-hydroxytetradecyl)-15,18,22,25-Tetraazanonatriacontane-13,27-diol [ka]

[0564] [Table 14-1]

[0565] [Table 14-2]

[0566] result

[0567] Figures 26(A and B) summarize the results for three mice: local luciferase expression in BALB / c mice (left column) and ex vivo analysis after resection of the heart, lung, right kidney, liver, and spleen 6 hours after intratracheal administration (right column). Formulation M03-076-3 contains two different ethyl-propyl-ethyl lipidoid combinations, different helper lipids, and different lipid-to-lipid ratios than dL_05(R), and surprisingly showed local luciferase expression. These results support the idea that the lipidoids of the present invention generally have the ability to remain localized in the administered tissue. Figure 26(A) shows the experiment using three mice, and Figure 26(B) shows the experiment using two mice. Formulation M03-076-3 contains the lipidoids DL_F(LG2C) (formula b-IX) and LE1D (formula bX). Scale is p / sec / cm 2 This shows the radiance at / sr.

[0568] Example 11 - Localization of other DL-lipidoids

[0569] 11.1. Purpose

[0570] To determine whether other lipidoids defined by formula (bI) exhibit similar limited localization / retention after delivery, and whether lipidoid combinations exhibit limited localization, lipidoids DL_F (formula b-IX above), DL_L (formula b-XI), and DL_N (formula b-XII) were formulated as summarized in Table 15 below. The results after IVIS in mice and isolated organs are shown in Figures 27(A), (B), and (C).

[0571] DL_L [ka]

[0572] DL_N [ka]

[0573] 11.2 Test formulation

[0574] The test formulation was prepared using mRNA encoding luciferase and administered by intratracheal infusion to three BALC mice according to the methods described in Examples 8 and 9, as shown in Table 15. The tested lipidoid contains an amide bond in its lipid side chain, which is expected to be biodegradable and therefore advantageous in terms of long-term tolerability after administration to subjects. This study aimed to explore a library of lipidoid structures with varying degrees of alkyl chain substitution and alkyl chain length per oligoamine. For this purpose, a complex was formed using modified RNA generated in vitro in the presence of 25% m5C and 25% S2U, and mRNA encoding firefly luciferase. 50 μL of the test mRNA was administered to mice under isofl...

Claims

1. A composition for use in the treatment and / or prevention of a disease or disorder, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, wherein the carrier is i. Ionizable lipids and / or ionizable lipidoids, ii. If necessary, one or more helper lipids, iii. One or more pharmaceutically acceptable excipients or diluents, as needed. Equipped with a carrier, Equipped with, The composition remains localized at the administration site and / or does not exhibit systemic distribution throughout the patient's body. A composition for use in the treatment and / or prevention of a disease or disorder.

2. A composition for use in the treatment and / or prevention of a disease, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, wherein the carrier is i. Ionizable lipids and / or ionizable lipidoids, ii. If necessary, one or more helper lipids, iii. With one or more pharmaceutically acceptable excipients and / or diluents as needed, Equipped with a carrier, Equipped with, The composition has extended retention at the administration site, and / or The aforementioned therapeutic agent exerts its effect at the injection site by being retained there for an extended period. A composition for use in the treatment and / or prevention of a disease or disorder.

3. A composition for use in the treatment and / or prevention of a disease, wherein the treatment comprises topical administration of the composition, (a) One or more therapeutic agents, (b) A carrier, wherein the carrier is i. Ionizable lipids and / or ionizable lipidoids, ii. If necessary, one or more helper lipids, iii. With one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, Equipped with, The reduced amount of the composition or the therapeutic agent is administered and / or, in order to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the administration site. The patient experienced fewer side effects compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the administration site. A composition for use in the treatment and / or prevention of disease.

4. The reduced amount of the composition or the therapeutic agent is administered and / or, in order to achieve an equivalent therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have extended retention at the administration site. The patient experienced fewer side effects compared to the same therapeutic agent formulated in a composition that does not have retention at the administration site. A composition for use according to claim 1 or 2.

5. The composition has extended retention at the administration site, and / or The composition for use according to claim 1 or 3, wherein the therapeutic agent exerts its effect at the administration site by prolonged retention at the administration site.

6. The composition for use according to claim 2 or 3, which, when administered to the administration site, remains locally and does not essentially exhibit systemic distribution throughout the patient's body.

7. A cosmetic composition, (a) One or more activators, (b) A carrier, wherein the carrier is i. Ionizable lipids and / or ionizable lipidoids, ii. If necessary, one or more helper lipids, iii. With one or more pharmaceutically acceptable excipients or diluents as needed, A carrier equipped with, The cosmetic composition may be an ointment, cream, foam, gel, lotion, aqueous liquid, or powder, or The cosmetic composition is formulated as an ointment, cream, foam, gel, lotion, aqueous liquid, or powder. Cosmetic composition.

8. The carrier is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, a nanostructured lipid carrier (NLCs), or a lipid-drug conjugate (LDC), preferably an LNP or a LiNP, and / or The agent is formulated as lipid nanoparticles (LNPs), lipidoid nanoparticles (LiNPs), liposomes, micelles, emulsions, nanostructured lipid carriers (NLCs), or lipid-drug conjugates (LDCs), preferably as LNPs or LiNPs, according to any one of claims 1 to 6, or the cosmetic composition according to claim 7.

9. The ionizable lipidoid is a compound of the following formula (b-I), 【Chemistry 1】 a is either 1 or 2, and b is an integer between 1 and 4, or a is an integer between 1 and 4, and b is either 1 or 2. p is either 1 or 2, m is either 1 or 2. n is either 0 or 1, m+n is 2 or greater, R １Ａ to R ６Ａ , each independently, are selected from hydrogen, -CH ２ -CH(OH)-R ７Ａ , -CH(R ７Ａ )-CH ２ -OH, -CH ２ -CH ２ -C(=O)-O-R ７Ａ , -CH ２ -CH ２ -C(=O)-NH-R ７Ａ , and -CH ２ -R ７Ａ , and are selected from R ７Ａ C3-C18 alkyl, C3-C18 alkenyl having one C-C double bond, amino group protecting group, -C(NH)-NH ２ Selected from polyethylene glycol chains and receptor ligands, R １Ａ ~R ６Ａ At least two of these residues are -CH ２ -CH(OH)-R ７Ａ , -CH(R ７Ａ ) - CH ２ OH, -CH ２ -CH ２ -C(=O)-OR ７Ａ ien-CH ２ -CH ２ -C(=O)-NH-R ７Ａ , and -CH ２ R ７Ａ Selected from, R ７Ａ These are selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one C-C double bond. The compound of formula (b-I) provides a compound having one or more nitrogen atoms provided or contained therein, which are optionally protonated to possess one or more positive charges. Preferably, variables a, b, p, m, n and R １Ａ ~R ６Ａ It is defined as follows: a is 1 and b is an integer between 2 and 4, or a is an integer between 2 and 4 and b is 1. p is either 1 or 2, m is either 1 or 2. n is either 0 or 1, m+n is 2 or greater, R １Ａ ~R ６Ａ These are, independently of each other, hydrogen, -CH ２ -CH(OH)-R ７Ａ , -CH(R ７Ａ ) - CH ２ -OH, -CH ２ -CH ２ -C(=O)-OR ７Ａ ien-CH ２ CH ２ C(=O)-NH-R ７Ａ , and -CH ２ -R ７Ａ Selected from, R ７Ａ C3-C18 alkyl, C3-C18 alkenyl having one C-C double bond, amino group protecting group, -C(NH)-NH ２ Selected from polyethylene glycol chains and receptor ligands, R １Ａ ~R ６Ａ At least two of these residues are -CH ２ -CH(OH)-R ７Ａ , -CH(R ７Ａ ) - CH ２ OH, -CH ２ CH ２ -C(=O)-OR ７Ａ ien-CH ２ CH ２ -C(=O)-NH-R ７Ａ , and -CH ２ R ７Ａ Selected from, R ７Ａ These are selected from C3-C18 alkyl groups and C3-C18 alkenyl groups having one C-C double bond. The composition for use or cosmetic composition according to claim 8, wherein one or more nitrogen atoms provided in or contained in the compound of formula (b-I) are optionally protonated to provide a compound having one or more positive charges.

10. The ionizable lipidoid is a compound of the following formula (b-II): 【Chemistry 2】 a is 1 or 2, preferably 1. b is 1 or 2, preferably 2. R １Ａ ~R ６Ａ is defined as described in claim 9, The composition for use or cosmetic composition according to claim 8 or 9, wherein one or more nitrogen atoms provided in or contained in the compound of formula (b-II) are optionally protonated to provide a compound having one or more positive charges.

11. R １Ａ ~R ６Ａ These are, independently of each other, hydrogen, -CH ２ -CH(OH)-R ７Ａ ien-CH ２ -CH ２ -C(=O)-OR ７Ａ ien-CH ２ -CH ２ -C(=O)-NH-R ７Ａ Selected from, R ７Ａ R is selected from C3-C18 alkyl and C3-C18 alkenyl compounds having one C-C double bond. １Ａ ~R ６Ａ At least three of these, preferably at least four, are -CH ２ -CH(OH)-R ７Ａ ien-CH ２ -CH ２ -C(=O)-OR ７Ａ , and -CH ２ -CH ２ -C(=O)-NH-R ７Ａ Selected from, R ７Ａ The composition for use or cosmetic composition according to any one of claims 8 to 10, wherein is selected from C3-C18 alkyl and C3-C18 alkenyl having one C-C double bond.

12. The ionizable lipidoid comprises or consists of compounds of formula (b-V), formula (b-XI), and / or formula (b-XII), preferably a compound of formula (b-V). 【Transformation 3】 【Chemistry 4】 【Transformation 5】 A composition for use or cosmetic composition according to any one of claims 9 to 11.

13. The ionizable lipidoid comprises or consists of compounds of formula (b-IX) and / or formula (b-X), preferably a compound of formula (b-X). 【Transformation 6】 【Transformation 7】 A composition for use or cosmetic composition according to any one of claims 8 to 12.

14. The composition for use or cosmetic composition according to any one of claims 8 to 13, wherein the carrier comprises at least two ionic lipids and / or at least two ionic lipidoids.

15. The composition for use or cosmetic composition according to claim 14, wherein the at least two ionic lipids and / or the at least two ionic lipidoids are as defined in any one of claims 9 to 14.

16. The composition for use or cosmetic composition according to claim 15, wherein the carrier comprises a lipidoid represented by formula (b-IX) and a lipidoid represented by formula (b-X).

17. The composition for use or cosmetic composition according to any one of claims 8 to 11, wherein the ionic lipidoid comprises or consists of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII). 【Transformation 8】 【Chemistry 9】

18. The ionic lipidoid is a compound of formula (b-v), preferably, (a) The R isomer of the compound of formula (b-V), and / or (b) Present in a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%, The composition for use or cosmetic composition according to any one of claims 8 to 12.

19. The one or more helper lipids are, (a) Phospholipids, (b) Sterols, and / or, (c) Stealth lipids, Selected from the group consisting of, A composition for use or cosmetic composition according to any one of claims 8 to 18.

20. The composition for use or cosmetic composition according to claim 19, wherein the composition comprises the ionic lipid and / or the ionic lipidoid, the phospholipid, the sterol, and the stealth lipid, preferably in a molar ratio of about 8.0:about 5.3:about 4.4:about 0.

9.

21. The phospholipids mentioned above are (a) Selected from phosphatidylcholine (PC) or phosphatidylethanolamine (PE), preferably PC, (b) Having a carbon chain length of about 14 to about 18, most preferably about 16, and / or (c) Present in a molar ratio of about 10 mol% to about 45 mol%, preferably about 18 mol% to about 39 mol%, more preferably about 24 mol% to about 33 mol%, and most preferably about 28.5 mol%, A composition for use or cosmetic composition according to claim 19 or 20.

22. The aforementioned sterols (a) Cholesterol, and / or, (b) Present in a molar ratio of about 12 mol% to about 38.5 mol%, preferably about 15 mol% to about 32 mol%, more preferably about 19 mol% to about 29 mol%, and most preferably about 23.7 mol%, A composition for use or cosmetic composition according to any one of claims 19 to 21.

23. The aforementioned stealth lipid is (a) Glycerolipid-based or PE lipid-based, (b) Carbon chain length of about 14 to about 18, most preferably about 14. (c) comprising polyethylene glycol (PEG), wherein the PEG has a molar mass of about 2000 to about 5000 daltons, most preferably about 2000 daltons, and / or (d) Present in a molar ratio of about 1.5 mol% to about 7 mol%, preferably about 3 mol% to about 6 mol%, more preferably about 4 mol% to about 5 mol%, most preferably about 4.7 mol%, A composition for use or cosmetic composition according to any one of claims 19 to 22.

24. (a) The phospholipid is preferably a phospholipid having a carbon chain length of about 12 to about 18, more preferably a phospholipid having a carbon chain length of about 16, and most preferably DPPC. (b) The sterol is cholesterol and / or (c) The stealth lipid is a PEG-modified lipid, preferably a PEG-modified lipid having a molar mass of PEG chains of about 2000 to about 5000 daltons, more preferably a PEG-modified lipid having a molar mass of PEG chains of about 2000 daltons, and most preferably the PEG-modified lipid is DMG-PEG2000. A composition for use or cosmetic composition according to any one of claims 19 to 23.

25. The composition for use or cosmetic composition according to any one of claims 8 to 24, further comprising a triblock copolymer as component (p), preferably the triblock copolymer comprising about one poly(propylene oxide) block and about two poly(ethylene oxide) blocks.

26. The one or more therapeutic agents are, (a) Anionic therapeutic substances, and / or (b) Nucleic acid, preferably RNA, more preferably mRNA, miRNA and / or siRNA, even more preferably mRNA, most preferably mRNA having an open reading frame (ORF) encoding one or more polypeptides. A composition for use according to any one of claims 8 to 25.

27. The composition for use according to claim 26, wherein the nucleic acid is RNA encoding a microRNA, or the nucleic acid is mRNA comprising an ORF encoding one or more polypeptides, preferably the one or more polypeptides are one or more functional proteins and / or one or more antigens.

28. The composition for use according to claim 27, wherein the one or more antigens are selected from the group consisting of viral antigens, bacterial antigens, cancer and / or tumor-related antigens, and / or allergens.

29. The aforementioned mRNA is (a) CAP, preferably an anti-reverse cap analog (ARCA) at its 5' end, (b) Upstream 5' untranslated region (5'-UTR) of the ORF encoding one or more polypeptides, (c) 5'-UTR having an extended Kosack sequence upstream of the ORF start codon (GCCACCAUG, SEQ ID NO: 44), (d) Immediately upstream of the start codon of ORF, i. GGGAGACGCCACC (SEQ ID NO: 11), ii. GAAGCGCACC (SEQ ID NO: 12), iii. GGGACGCCACC (SEQ ID NO: 13), iv. GGGAGACTGCCACC (SEQ ID NO: 14), v. GAAGCTGCCACC (SEQ ID NO: 15), vi. GGGACTGCCACC (SEQ ID NO: 16), A 5'-UTR having one of the following sequences, (e) a 3'-UTR downstream of the ORF encoding one or more polypeptides, (f) i. GAAUU, and, ii. CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA (SEQ ID NO: 26), A 3'-UTR sequence downstream of the ORF encoding one or more polypeptides selected from, Having one or more features selected from the group consisting of, A composition for use according to any one of claims 26 to 28.

30. The composition for use according to any one of claims 26 to 29, wherein the mRNA is an in vitro transcription (IVT) product.

31. The composition for use according to any one of claims 26 to 30, wherein the mRNA comprises a polyadenylation signal or a (poly(A)) tail downstream of the ORF encoding the one or more polypeptides.

32. The composition for use according to any one of claims 26 to 31, wherein the mRNA comprises one or more modified nucleosides.

33. The one or more modified nucleosides mentioned above are N1-methylpseuduridine (m1ψ), pseudouridine, N1-ethylpseuduridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseuduridine, 2-thio-1-methylpseuduridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydrouridine, 2-thio-pseuduridine, 4-methoxy-2-thio-pseuduridine, A selection from the group consisting of 4-methoxypseuduridine, 4-thio-1-methylpseuduridine, 4-thiopseuduridine, 5-azauridine, dihydropseuduridine, 5-ioduridine, 5-methoxyuridine, 2'-O-methyluridine, 5-iodocytidine, 5-methylcytosine, 5-methylcytidine, N1-methyladenosine, and N6-methyladenosine, preferably N1-methylpseuduridine. A composition for use according to any one of claims 26 to 32.

34. (a) When up to 100% of the uridine provided in the ORF is modified, preferably at least about 50 mol% of the uridine provided in the ORF is modified, more preferably any value between 50 and 100% is modified, and even more preferably 100% of the uridine is modified, (b) If at least about 50 mol% of the uridine contained in the mRNA is modified, (c) When at least about 50 mol% of the uridine provided in the ORF is modified with m1ψ, (d) When at least about 50 mol% of the uridine contained in the mRNA is modified with m1ψ, (e) when about 5 mol% to about 50 mol% of the uridine contained in the mRNA is 5-iodouridine and about 5 mol% to about 50 mol% of the cytidine contained in the mRNA is 5-iodocytidine, and / or (f) When about 0.5 mol% to about 50 mol% of the uridine contained in the mRNA is 2-thiouridine, preferably about 1 mol% to about 50 mol%, more preferably 1 mol% to 5 mol%, of the uridine is 2-thiouridine, and 0.5 mol% to about 50 mol% of the cytidine contained in the mRNA is 5-methylcytidine, One or more of the following apply: A composition for use according to claim 32 or 33.

35. The composition for use according to any one of claims 8 to 34, which is administered to a patient in need thereof.

36. The composition for use according to any one of claims 8 to 35, wherein the administration site comprises a tissue, organ, and / or anatomical region, preferably the solid tissue, organ, and / or anatomical region is a solid tissue, organ, and / or anatomical region, and more preferably the solid tissue, organ, and / or anatomical region is selected from the group consisting of the lung, nose, heart, brain, spleen, lymph node, bone, tendon, skeletal muscle, joint, stomach, small intestine, large intestine, kidney, bladder, breast, testis, ovary, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eye, ear, tongue, skin, and / or tumor present in the solid tissue, organ, and / or anatomical region.

37. The composition according to any one of claims 8 to 36, further comprising one or more stabilizers, one or more adjuvants, and / or immunomodulators.

38. The composition according to any one of claims 8 to 37, wherein the therapeutic agent or carrier is encapsulated within a hydrogel or a biocompatible matrix.

39. A method for preventing, treating, and / or improving a disease, comprising administering an effective amount of the composition according to any one of claims 1 to 6 and 8 to 38 to a target.

40. Use of the composition according to any one of claims 1 to 6 and 8 to 38 in the manufacture of a pharmaceutical product for the prevention, treatment, and / or improvement of a disease.

41. The prevention of the disease includes prevention by immunity, and more preferably by local immunity, the use of the composition for use according to any one of claims 1 to 6 and 8 to 38, the treatment method according to claim 39, or the use of the composition according to claim 40.

42. The aforementioned diseases include gene mutations, autoimmune diseases, metabolic disorders, neurodegenerative diseases, degenerative joint diseases, arthropathy, arthritis, fractures, pseudoarthrosis, solid tumor diseases (including soft tissue tumors and tumors of the heart, lungs, liver, spleen, kidneys, brain, oral cavity, intestines, skin, pancreas, prostate, mammary glands, ovaries, bladder, and bone (including osteosarcoma, chondrosarcoma, and Ewing's sarcoma)). Inflammation of the pleura and abdominal cavity, respiratory diseases including rhinitis, asthma, viral asthma, COPD (including pulmonary autoimmune disease and ciliopathies), fractures or lesions thereof, tendon fractures or lesions thereof, joint infections, ligament ruptures, resistant Staphylococcus aureus (MRSA) and / or multidrug-resistant tuberculosis), viral infections, preferably viral infections, more preferably enteroviruses, rhinoviruses, influenza (Flu), respiratory syncytial virus (RSV), hepatitis A, hepatitis B, hepatitis C, human papillomavirus (HPV), measles, mumps, rubella, polio, rabies, varicella (chickenpox), herpes zoster (shingles), rotavirus, yellow fever, smallpox, Japanese encephalitis, tick-borne diseases A composition for use according to any one of claims 1 to 6, 8 to 38, and 41, selected from encephalitis (TBE), dengue fever, West Nile virus, chikungunya virus, Ebola virus, Marburg virus, human immunodeficiency virus (HIV), and coronavirus infection (including COVID-19), most preferably coronavirus infection; a method of treatment according to claim 39 or 41; or use of the composition according to claim 40 or 41.

43. The composition is administered to one or more solid tissues, solid organs and / or solid anatomical regions, preferably the one or more solid tissues, solid organs and / or solid anatomical regions being selected from the group consisting of the lungs, nose, heart, brain, spleen, lymph nodes, bones, tendons, skeletal muscles, joints, stomach, small intestine, large intestine, kidneys, bladder, breasts, testes, ovaries, uterus, spleen, thymus, brainstem, cerebellum, spinal cord, eyes, ears, tongue, skin and / or tumors present in the one or more solid tissues, solid organs and / or solid anatomical regions, the composition for use according to any one of claims 1 to 6, 8 to 38, 41 and 42, the method of treatment according to any one of claims 39, 41 and 42, or the use of the composition according to any one of claims 40 to 42.

44. The composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 43, the treatment method according to any one of claims 39, and 41 to 43, or the use of the composition according to any one of claims 40 to 43, wherein at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the one or more therapeutic agents is limited to the tissue, organ, and / or anatomical region being treated and / or quantified by a method selected from the group consisting of qPCR, HPLC, mass spectrometry, or a combination of HPLC and mass spectrometry.

45. A composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 44, a method of treatment according to any one of claims 39, and 41 to 44, or a use of a composition according to any one of claims 40 to 44, which makes it possible to reduce the dose of the one or more therapeutic agents administered by limiting one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated by up to 20%, including any range within this range, such as a reduction of 1 to 20%, 5 to 15%, or 10 to 20%, but not limited thereto.

46. A composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 45, a treatment method according to any one of claims 39, and 41 to 45, or a use of a composition according to any one of claims 40 to 45, wherein the number of administrations of the one or more therapeutic agents is reduced, preferably by about 25% or less, by limiting the one or more therapeutic agents to a tissue, organ, and / or anatomical region to be treated.

47. By limiting the one or more therapeutic agents to a target tissue, organ, and / or anatomical region, toxicity and / or related toxicity caused by the accumulation of the one or more therapeutic agents in extra-target organs is reduced, preferably the toxicity and / or related toxicity caused by the one or more therapeutic agents is reduced in the liver, brain, kidneys, heart, and / or spleen, the composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 46, the method of treatment according to any one of claims 39, and 41 to 46, or the use of the composition according to any one of claims 40 to 46.

48. By limiting the one or more therapeutic agents to a target tissue, organ, and / or anatomical region, the off-target effects caused and / or associated with the one or more therapeutic agents are reduced and / or avoided, preferably the off-target effects caused and / or associated with the one or more therapeutic agents are reduced in the liver, brain, kidneys, heart, and / or spleen, the composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 47, the method of treatment according to any one of claims 39, and 41 to 47, or the use of the composition according to any one of claims 40 to 47.

49. The composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 48, the therapeutic method according to any one of claims 39 and 41 to 48, or the use of the composition according to any one of claims 40 to 48, wherein the composition is not administered in combination with one or more hyaluronidases and / or enzymes having hyaluronidase activity.

50. The composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 49, the treatment method according to any one of claims 39 and 41 to 49, or the use of the composition according to any one of claims 40 to 49, wherein the target of treatment is a mammal, preferably a human.

51. The composition for use according to any one of claims 1 to 6, 8 to 38, and 41 to 50, administered by intradermal, subcutaneous, intramuscular, or intratumor injection, aerosol delivery to the respiratory system including delivery to the nasal cavity or lungs, or topical application, the treatment method according to any one of claims 39, and 41 to 50, or the use of the composition according to any one of claims 40 to 50.

52. A method for inducing an immune response in a subject, comprising administering an effective amount of a composition according to any one of claims 1 to 6, 8 to 38, and 41 to 50 to the subject.

53. A method for immunizing a subject against a pathogen, comprising administering an effective amount of mRNA vaccine in a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises the composition described in any one of claims 1 to 6, 8 to 38, and 41 to 50.

54. The method according to claim 53, wherein the mRNA vaccine is administered by intradermal, subcutaneous, intramuscular, or intratumor injection.

55. The method according to claim 53 or 54, wherein the mRNA vaccine primarily induces an immune response at the administration site, thereby reducing the risk of systemic adverse effects.

56. The method according to any one of claims 53 to 55, wherein the mRNA vaccine is designed to promote local production of antigen-specific antibodies or a cellular immune response at the administration site.

57. The method according to any one of claims 53 to 56, further comprising polymer coating or encapsulation of the mRNA vaccine to enhance local retention and prevent systemic dissemination.

58. The composition for use according to any one of claims 8 to 38, 41 to 51, or the method according to any one of claims 53 to 57, wherein the carrier further comprises a target site or ligand that specifically binds to cells or receptors present at the target site, thereby enhancing the specificity and efficacy of the therapeutic agent.

59. The pharmaceutically acceptable excipient or diluent further comprises a biodegradable or bioabsorbable material to promote sustained release and local persistence of the therapeutic agent at the site of interest, the composition for use according to any one of claims 8 to 38, 41 to 51, and 58, or the method according to any one of claims 53 to 58.

60. The composition for use according to any one of claims 8 to 38, 41 to 51, 58, and 59, or the method according to any one of claims 53 to 59, wherein the mRNA further comprises a tissue-specific promoter and / or enhancer element for enhancing antigen expression at a site of interest.

61. The therapeutic agent is encapsulated within a biocompatible microneedle patch or implantable device, and the composition for use according to any one of claims 8 to 38, 41 to 51, and 58 to 60, which facilitates controlled and / or sustained release of the therapeutic agent at the site of interest, or the method according to any one of claims 53 to 60.

62. The mRNA further comprises a self-amplified mRNA (saRNA) molecule, enabling enhancement of protein or antigen production at a site of interest, as described in any one of claims 8 to 38, 41 to 51, and 58 to 61, or the method according to any one of claims 53 to 61.

63. The one or more mRNA molecules mentioned above include cytokines such as CFTR, erythropoietin (EPO), factor VIII, factor IX, chimeric antigen receptor (CAR), T cell, servibin (BIRC5) or its dominant-negative form, P53, vascular endothelial growth factor (VEGF), insulin, SARS-CoV-2 spike protein, alpha-synuclein, dystrophin, glucocerebrosidase (GCase), interleukin-2 (IL-2), interleukin-10 (IL-10), and interleukin-12 (IL-12). Interferon, interferon-A (IFN-A), interferon-beta (IFN-β), interferon-gamma (IFN-γ), interferon-lambda 1 (IFN-λ1, also known as IL-29), IFN-λ2 (also known as IL-28a), IFN-λ3 (also known as IL-28b), and / or IFN-λ4, interferon-lambda (IFNλ) such as human interferon-lambda 1 (HIFNλ1), for example tumor necrosis factor alpha (TNF-α), granulocyte-macrophage colony stimulation. Factors (GM-CSF), primary ciliary dysphagia proteins or factors, e.g., DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21ORF59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DN A composition for use according to any one of claims 8 to 38, 41 to 51, and 58 to 62, comprising an ORF encoding AAF5 (HEATR2), HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1, preferably the one or more mRNA molecules comprising an ORF encoding interferon lambda 1 (IFNλ1), and more preferably an ORF encoding human interferon lambda 1 (HIFNλ1), or the method according to any one of claims 53 to 62.

64. The cosmetic composition according to any one of claims 7 to 25, wherein the active ingredient is selected from the group consisting of growth factors, peptides, antioxidants, retinoids, cytokines, siRNA, miRNA, mRNA, and asRNA.

65. Use of the cosmetic composition according to any one of claims 7 to 25 and 64 in improving skin condition.

66. A method for improving a skin condition, comprising administering a cosmetic composition according to any one of claims 7 to 25 and 64.

67. A kit comprising the cosmetic composition according to any one of claims 7 to 25 and 64.

68. A drug conjugate comprising an ionizable lipidoid according to any one of claims 9 to 18 and one or more therapeutic agents, preferably the one or more therapeutic agents being according to any one of claims 26 to 34.

69. The ionic lipidoid is co-compounded with the one or more therapeutic agents, preferably the ionic lipidoid is as defined in any one of claims 9 to 18, and preferably the one or more therapeutic agents are as defined in any one of claims 26 to 34, for in vitro use of the ionic lipidoid to restrict the diffusion of the one or more therapeutic agents administered.

70. A method (in vitro) for restricting the diffusion of one or more therapeutic agents to be administered, comprising the step of co-combining one or more therapeutic agents with an ionic lipidoid, wherein the ionic lipidoid is as defined in any one of claims 9 to 18.

71. The drug conjugate according to claim 68, the in vitro use according to claim 69, or the in vitro method according to claim 70, wherein the ionic lipidoid comprises a compound of formula (b-I), more preferably a compound of formula (b-V) or formula (b-VII), and even more preferably a compound of formula (b-V).

Images