Compositions and methods for inhibiting the expression of complement component 3 (C3).

Abstract

The present invention provides compositions and methods that can be used to reduce the expression of the C3 gene and treat C3-related diseases and conditions. The present invention provides C3 dsRNA agents, C3 antisense polynucleotide agents, compositions comprising C3 dsRNA agents, and compositions comprising C3 antisense polynucleotide agents that can be used to reduce C3 expression in cells and subjects.

Description

[Technical Field]

[0001] The present invention partially relates to compositions and methods that can be used to inhibit the expression of the complement component 3 (C3) gene. [Background technology]

[0002] The complement system, or complement pathway, was first discovered in the 1890s, at which time it was found that heat-stable antibodies present in normal serum can help kill or "replenish" bacteria. The complement system, or complement pathway, is part of the innate immune system for host defense against invading pathogens. It consists of more than 30 proteins that circulate in the blood, mainly in precursor form, and plays important roles in both innate and adaptive immunity. Most of the proteins that make up the complement system include complement component protein C3 (also abbreviated as C3 herein), which are mainly synthesized by hepatocytes in the liver and secreted into the bloodstream.

[0003] Proteins in the complement system play a role in a series of enzyme cascades through various protein interactions and cleavage events. Three main pathways of complement activation have been identified, known as the classical pathway, the alternative pathway, and the lectin pathway. From a functional standpoint, complement activation itself occurs at a lower level (spontaneous cleavage of C3 produces C3a and C3b), and the conversion of inactive enzymes (zymogens) to active forms via the enzyme cascade is enhanced in the presence of microorganisms. One type of C3 convertase is a complex of C3b and complement factor B (CFB, factor B). Once formed, a C3 convertase can rapidly convert large amounts of C3 into its cleavage products, C3a and C3b. Certain C3 convertases are complexes of C3b and factor B, and are initially described in the context of the alternative pathway, but can also be formed in the context of the other two pathways. Inappropriate or excessive complement activation is a potential cause or contributing factor to many serious diseases and conditions, and over the past several decades, considerable effort has been made to explore various complement inhibitors as therapeutic agents.

[0004] Many diseases are associated with abnormal acquired or genetic activation of the complement pathway and abnormal or overexpression of C3. For example, these include C3 glomerulopathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease with bacterial flora, malarial anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

[0005] Accordingly, the C3 RNAi agents disclosed herein are used to treat diseases, symptoms, and conditions associated with subjects suffering from complement component C3-related diseases. [Overview of the project]

[0006] Overall, the present invention discloses novel complement component 3 (C3) gene-specific RNAi agents, compositions comprising C3 RNAi agents, and methods for inhibiting C3 gene expression in vitro and / or in vivo using the C3 RNAi agents and compositions comprising C3 RNAi agents described herein. The C3 RNAi agents described herein can selectively and effectively reduce, inhibit, or silence C3 gene expression in subjects (e.g., human or animal subjects).

[0007] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region complementary to a C3 RNA transcript, the complementary region comprising at least 15 consecutive nucleotides that differ by 1, 2, or 3 or fewer nucleotides from any one of the antisense sequences listed in any one of Tables 1 to 3, and optionally comprising a target ligand, wherein the sense strand and antisense strand may be partially, basically, or completely complementary to each other.

[0008] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the C3 RNA transcript, the complementary region comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprising a target ligand.

[0009] In some embodiments, the C3 RNA transcript is Sequence ID No. 1.

[0010] In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to any one target region of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one target region of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3.

[0011] In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a double-stranded sequence listed in any one of Tables 1 to 3.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region complementary to the C3 RNA transcript, the complementary region comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from any one of the antisense sequences of SEQ ID NOs. 25-28, 31-35, 39-41, or 45-47, and optionally comprising a target ligand.

[0013] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 2-5, 8-12, 16-18, and 22-24, and optionally comprising a target ligand.

[0014] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from the group consisting of: (a) The sequence numbers are 2 and 25, respectively. (b) The sequence numbers are 3 and 26, respectively. (c) The sequence numbers are 4 and 27, respectively. (d) The sequence numbers are 8 and 31, respectively. (e) The sequence numbers are 9 and 32, respectively. (f) The sequence numbers are 10 and 33, respectively. (g) The sequence numbers are 11 and 34, respectively. (h) The sequence numbers are 12 and 35, respectively. (i) The sequence numbers are 16 and 39, respectively. (j) The sequence numbers are 17 and 40, respectively. (k) The sequence numbers are 18 and 41, respectively. (l) The sequence numbers are 22 and 45, respectively. (m) The sequence numbers are 23 and 46, and (n) The sequence numbers are 24 and 47, respectively.

[0015] In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 2, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 3, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 26. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 4, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 27. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 8, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 31. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 9, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 32. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 10, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 33. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 11, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 34. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 12, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 35. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 16, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 39. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 17, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 40. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 18, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 41. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 22, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 45. In some embodiments, the sense strand includes the nucleotide sequence shown in SEQ ID NO: 23, of which the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 46.In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 24, of which the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 47.

[0016] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (I) by 0, 1, 2, or 3 or fewer nucleotides, where the nucleotide sequence of formula (I) is 5'-Z1UAUUCAUGAGCUUCGUAGZ2-3'(I), where Z1 is selected from one of C, G, A, or U, or is absent, and Z2 is a nucleotide sequence of 0 to 15 nucleotides in length. In some embodiments, Z1 is U. In some embodiments, Z2 is selected from A, AC, AU, AA, or AG, or is absent. In some embodiments, the sense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (II) by only 0, 1, 2, or 3 nucleotides, where the nucleotide sequence of formula (II) is 5'-Z3CUACGAAGCUCAUGAAUAZ4-3'(II), where Z3 is a nucleotide sequence of 0 to 15 nucleotides in length, and Z4 is selected from one of C, G, A, or U, or is absent. In some embodiments, Z4 is A. In some embodiments, Z3 is selected from U, GU, CU, UU, or AU, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (I) by only 0, 1, 2, or 3 nucleotides, and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (II) by only 0, 1, 2, or 3 nucleotides, wherein the nucleotide sequences of formula (I) and formula (II) are as described above. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the sense strand is complementary to or basically complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.In some embodiments, the complementary region is 19 to 21 nucleotides long. In some embodiments, Z1 is a nucleotide complementary to Z4. In some embodiments, Z2 is a nucleotide sequence complementary to Z3.

[0017] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (III) by only 0, 1, 2, or 3 nucleotides, where the nucleotide sequence of formula (III) is 5'-Z5UGUUCAUUCUGAUUCCUUZ6-3'(III), where Z5 is selected from one of c, g, a, or u, or is absent, and Z6 is a nucleotide sequence of 0 to 15 nucleotides in length. In some embodiments, Z5 is u. In some embodiments, Z6 is selected from C, CG, CC, CU, or CA, or is absent. In some embodiments, the sense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (IV) by only 0, 1, 2, or 3 nucleotides, where the nucleotide sequence of formula (IV) is 5'-Z7AAGGAAUCAGAAUGAACAZ8-3'(IV), where Z7 is a nucleotide sequence of 0 to 15 nucleotides in length, and Z8 is selected from one of C, G, A, or U, or is absent. In some embodiments, Z8 is A. In some embodiments, Z7 is selected from G, CG, AG, GG, or UG, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (III) by only 0, 1, 2, or 3 nucleotides, and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (IV) by only 0, 1, 2, or 3 nucleotides, wherein the nucleotide sequences of formula (III) and formula (IV) are as described above. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the sense strand is complementary to or basically complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.In some embodiments, the complementary region is 19 to 21 nucleotides long. In some embodiments, Z5 is a nucleotide complementary to Z8. In some embodiments, Z6 is a nucleotide sequence complementary to Z7.

[0018] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from (V) by only 0, 1, 2, or 3 nucleotides, where the nucleotide sequence of formula (V) is 5'-Z9GUAGUAGAAUUUCUCUGUZ 10 It is shown as -3'(V), of which Z9 is selected from one of C, G, A, U, or does not exist, Z 10 This is a nucleotide sequence with a length of 0 to 15 nucleotides. In some embodiments, Z9 is U. In some embodiments, Z2 is selected from A, AC, AU, AG, AA, or is absent. In some embodiments, the sense strand of dsRNA contains a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (VI) by only 0, 1, 2, or 3 nucleotides, and the nucleotide sequence of formula (VI) is 5'-Z 11 ACAGAGAAAUUCUACUACZ 12 -3'(VI), of which Z 11 Z is a nucleotide sequence with a length of 0 to 15 nucleotides. 12 is selected from one of C, G, A, and U, or is absent. In some embodiments, Z 12 is A. In some examples, Z 11is selected from U, GU, AU, CU, UU, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18 or 19 consecutive nucleotides that differs from formula (V) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18 or 19 consecutive nucleotides that differs from formula (VI) by 0, 1, 2 or 3 nucleotides, wherein the nucleotide sequences of formula (V) and formula (VI) are as defined above. In some embodiments, the length of each strand is not more than 40 nucleotides. In some embodiments, the length of each strand is not more than 30 nucleotides. In some embodiments, the length of each strand is not more than 23 nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In some embodiments, Z9 is Z 12 is a complementary nucleotide. In some embodiments, Z 10 is Z 11 is a complementary nucleotide sequence.

[0019] In some embodiments, the dsRNA reagent contains at least one modified nucleotide. In some embodiments, all or essentially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, reverse 2'-Ome nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotides containing a 5'-phosphorothioate group, or nucleotides containing cholesterol derivatives or terminal nucleotides linked to a dodecanoic acid bisdecaneamide group, 2'-amino-modified nucleotides, phosphoramidites, or non-natural bases.

[0020] In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

[0021] In some embodiments, the dsRNA agent contains a phos-15 nucleoside at the 5' end of the guide strand.

[0022] In some embodiments, the dsRNA agent includes at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand includes at least one phosphorothioate nucleotide linkage. In some embodiments, the antisense strand includes at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages.

[0023] In some embodiments, all or essentially all nucleotides in the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, of which fewer than 6 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand contains 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which fewer than 4 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand contains 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which at least 14 modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 2, 5, 7, 11, 12, 14, 16 and / or 18, when counted from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 16, when counted from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense chain comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 18 when starting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides.In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16 when counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16 when counting from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16 when counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16 when counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand contains five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 18 when counted from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the sense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably at least 18 of which are 2'-O-methylnucleotides, and the nucleotides at positions 9, 11, and / or 13 when counted from the first matching position at the 3' end of the sense strand are 2'-fluoronucleotides. In some embodiments, at least 18 modified nucleotides in the sense strand are 2'-O-methylnucleotides, and the nucleotides at positions 8, 11, and / or 13 when counted from the first matching position at the 3' end of the sense strand are 2'-fluoronucleotides. In some embodiments, the modified sense strand sequence is one of the modified sense strand sequences shown in Tables 2-3. In some embodiments, the modified antisense sequence is one of the modified antisense chain sequences shown in Tables 2-3.

[0024] In some embodiments, the dsRNA reagent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. In some embodiments, one or more target groups or binding groups are conjugated to the sense strand. In some embodiments, the target group or binding group comprises N-acetylgalactosamine (GalNAc).

[0025] In some embodiments, the target group includes the following structure: [ka] Each n'' is independently selected from 1 or 2.

[0026] In some embodiments, the target group has the following structure: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] .

[0027] In some embodiments, the dsRNA reagent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA reagent includes a target group conjugated to the 3' end of the sense strand.

[0028] In some embodiments, the antisense chain contains one reverse debase residue at its 3' end.

[0029] In some embodiments, the sense strand contains one or two reverse debasing residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense strand contains one reverse debasing residue. In some embodiments, each end of the sense strand contains one imann residue. In some embodiments, one or more reverse debasing residues or one or more imann residues are bonded to any one or two ends of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further bonded to any one end of the sense strand by a phosphorothioate bond. In some embodiments, the target group is further bonded to the 5' end of the sense strand by a phosphorothioate bond. In some embodiments, the 5' end of the sense strand contains one reverse debasing residue or imann residue, of which the reverse debasing residue or imann residue is ligated via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand nucleotide sequence. In some embodiments, the sense chain further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense chain, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and optionally the target group is N-acetylgalactosamine (GalNAc).

[0030] In some embodiments, the dsRNA reagent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least two strands contain a 3' overhang of at least one nucleotide.

[0031] In some embodiments, the dsRNA comprises a double-stranded molecule selected from the group consisting of AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, and AV04980, of which the double-stranded molecule optionally contains a target ligand. In some embodiments, the dsRNA includes a double-stranded molecule selected from the group consisting of AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, AD01447-3, and AD01447-4.

[0032] According to another aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand comprising a region complementary to a portion of the C3 RNA transcript, the length of each strand being approximately 15 to approximately 30 nucleotides, and the sense strand comprising a sequence that may be represented by formula (A).

[0033] 5′-(N′ L ) n′ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 N' N2 N' L N' L N' L N' L N' L (N' L ) m′ -3′ (A) Among them, each N' F represents a 2'-fluoromodified nucleotide, and each N' N1 and N' N2This independently indicates modified or unmodified nucleotides, and each N' L The terms represent modified or unmodified nucleotides independently, but do not represent 2'-fluoromodified nucleotides, and m' and n' are each independent integers from 0 to 7.

[0034] In some embodiments, N' N1 and N' N2 It contains only one 2'-fluoromodified nucleotide.

[0035] In some embodiments, N' N1 This independently represents 2'-fluoromodified nucleotides.

[0036] In some embodiments, N' N2 This independently represents 2'-fluoromodified nucleotides.

[0037] In some embodiments, m' is 2 and n' is 4, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2.

[0038] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably the target group is GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' end and / or 5' end. In some embodiments, each of the 3' and 5' ends of the sense strand independently contains one reverse debase residue. In some embodiments, each of the 3' and 5' ends of the sense strand independently contains one imann residue. In some embodiments, the sense strand contains two reverse debasing residues at its 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably the aforementioned GLS-15*. In some embodiments, the sense strand contains two imann residues at its 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably the aforementioned GLS-15*. In some embodiments, the sense strand contains two imann residues at its 3' and 5' ends, and the residues at the 3' or 5' ends are further conjugated to a target group, which is preferably the aforementioned GLS-15*. In some embodiments, the 5' end of the sense strand contains one reverse debasing residue or imann residue, of which the reverse debasing residue or imann residue is ligated via a phosphorothioate bond to the nucleotide adjacent to the 5' end of the sense strand nucleotide sequence. In some embodiments, the sense chain further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense chain, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and optionally the target group is N-acetylgalactosamine (GalNAc).

[0039] According to another aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand comprising a region complementary to the C3 RNA transcript, the length of each strand being approximately 18 to approximately 30 nucleotides, and the antisense strand comprising a sequence that may be represented by formula (B).

[0040] 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′ (B) Of these, each N F represents a 2'-fluoromodified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 and N M6 Each N independently represents a modified or unmodified nucleotide. L The nucleotides represent modified or unmodified nucleotides independently, but are not 2'-fluoromodified nucleotides, and n is an integer from 0 to 7.

[0041] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2'-fluoromodified nucleotides.

[0042] In some embodiments, N M2 , N M3 and N M5 each independently represent a 2'-fluoro modified nucleotide.

[0043] In some embodiments, N M2 , N M4 and N M5 each independently represent a 2'-fluoro modified nucleotide.

[0044] In some embodiments, N M1 , N M3 and N M6 each independently represent a 2'-fluoro modified nucleotide.

[0045] In some embodiments, N M2 , N M3 and N M6 each independently represent a 2'-fluoro modified nucleotide.

[0046] In some embodiments, N M2 , N M4 and N M6 each independently represent a 2'-fluoro modified nucleotide.

[0047] In some embodiments, N M1 , N M3 and N M6 each independently represent a 2'-fluoro modified nucleotide, and N M5 represents an UNA modified nucleotide.

[0048] In some embodiments, N M2 , N M3 and N M6 each independently represent a 2'-fluoro modified nucleotide, and N M5 represents an UNA modified nucleotide.

[0049] In some embodiments, N M2 , N M4 and NM6 Each independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0050] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0051] According to another aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the C3 RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides, and wherein the dsRNA duplex comprises a sequence represented by formula (C).

[0052] Sense chain: 5'-(N') L ) n’ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 N' N2 N' L N' L N' L N' L N' L (N' L ) m’ -3' Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 NL N M6 N L N L N F N L -5' (C) Of these, the length of each chain is approximately 18 to 30 nucleotides, and each N F and N' F This independently shows a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N' N1 and N' N2 Each of these independently represents a modified or unmodified nucleotide, and each N L and N' L The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7.

[0053] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2'-fluoromodified nucleotides, and N' N1 and N' N2 It contains only one 2'-fluoromodified nucleotide.

[0054] In some embodiments, m' is 2 and n' is 4, m' is 2 and n' is 6, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0055] In some embodiments, N' N1This independently represents 2'-fluoromodified nucleotides.

[0056] In some embodiments, N' N2 This independently represents 2'-fluoromodified nucleotides.

[0057] In some embodiments, N M2 , N M3 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0058] In some embodiments, N M2 , N M4 and N M5 These independently represent 2'-fluoromodified nucleotides.

[0059] In some embodiments, N M1 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0060] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0061] In some embodiments, N M2 , N M4 and N M6 These independently represent 2'-fluoromodified nucleotides.

[0062] In some embodiments, N M1 , N M3 and N M6 Each independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0063] In some embodiments, N M2 , N M3 and N M6Each independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0064] In some embodiments, N M2 , N M4 and N M6 Each independently shows a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.

[0065] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably the target group is GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' end and / or 5' end. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one reverse debase residue. In some embodiments, the 3' and 5' ends of the sense strand each independently contain one imann residue. In some embodiments, the sense strand contains two reverse debase residues at its 3' and 5' ends, and the residues at the 3' or 5' ends are further bound to a target group, which is preferably the aforementioned GLS-15*. In some embodiments, the sense strand contains two imann residues at its 3' and 5' ends, and the residues at the 3' or 5' ends are further bound to a target group, which is preferably the aforementioned GLS-15*. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least one strand contains 3' overhangs of at least two nucleotides. In some embodiments, one or more reverse debase residues or one or more imann residues are bound to any one or two ends of the sense strand by phosphorothioate bonds. In some embodiments, the target group is further bound to any one end of the sense strand by phosphorothioate bonds. In some embodiments, the target group is further attached to the 5' end of the sense chain by a phosphorothioate bond.In some embodiments, the 5' end of the sense strand contains one reverse debasing residue or imann residue, of which the reverse debasing residue or imann residue is ligated to an adjacent nucleotide at the 5' end of the sense strand nucleotide sequence via a phosphorothioate bond. In some embodiments, the sense strand further contains a target group ligated to the reverse debasing residue or imann residue at the 5' end of the sense strand, of which the target group is ligated to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and optionally the target group is N-acetylgalactosamine (GalNAc). In some embodiments of the dsRNA reagent, a region complementary to a portion of the C3 mRNA transcript contains at least 15, 16, 17, 18, or 19 consecutive nucleotides, where these nucleotides differ from the complementary sequence of any one target region in the C3 mRNA transcript by 0, 1, 2, or 3 or fewer nucleotides. In some embodiments, the antisense strand of the dsRNA reagent is essentially complementary to at least one target region of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments of the above dsRNA reagent, the C3 mRNA transcript is SEQ ID NO: 1.

[0066] In some embodiments, any one of the sense chains in Table 1 may be further modified in the mode shown by formula (A) or (C) above.

[0067] In some embodiments, any one of the antisense chains in Table 1 may be further modified in the mode shown by formula (B) or (C) above.

[0068] In some embodiments, any one of the double-stranded compounds in Table 1 may be further modified in the mode represented by formula (C) above.

[0069] In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of the Tables 1.

[0070] According to one aspect of the present invention, a composition is provided that includes any embodiment relating to the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous (IV) administration.

[0071] According to another aspect of the present invention, cells are provided, comprising any embodiment of the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0072] Another aspect of the present invention provides a method for inhibiting C3 gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention, or any embodiment of the composition of the present invention. In some embodiments, the method further comprises (ii) inhibiting C3 gene expression in the cells by maintaining the produced cells for a time sufficient to obtain degradation of the mRNA transcript of the C3 gene. In some embodiments, the cells are located in the body of a subject, and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are located in the body of a subject, and the dsRNA agent is administered to the subject by intravenous injection. In some embodiments, the method further includes evaluating C3 gene inhibition after administering a dsRNA agent to a subject, the evaluation method further includes (i) determining one or more physiological features of the subject's C3-related disease or condition, and (ii) comparing the determined physiological features with baseline pre-treatment physiological features of the C3-related disease or condition and / or control physiological features of the C3-related disease or condition, the comparison indicating one or more of the presence or absence of inhibition of C3 gene expression in the subject. In some embodiments, the physiological features are one or more C3 mRNA levels and C3 protein levels. In some embodiments, the determined physiological features are C3 levels in the blood. In some embodiments, paroxysmal nocturnal hemoglobinuria (PNH) is a relatively rare disease comprising acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure and a tendency to form blood clots. A reduction in blood C3 levels and / or C3 indicates a decrease in the subject's C3 gene expression.

[0073] Another aspect of the present invention provides a method for inhibiting C3 gene expression in a subject, the method comprising administering to the subject an effective amount of an embodiment of the dsRNA agent of the present invention or an embodiment of the composition of the present invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject by intravenous injection. In some embodiments, the method further comprises evaluating the inhibition of the C3 gene after administration of the dsRNA agent, the evaluation method further comprising (i) determining one or more physiological characteristics of a C3-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of a C3-related disease or condition and / or control physiological characteristics of a C3-related disease or condition, the comparison indicating one or more of the presence or absence of inhibition of C3 gene expression in the subject. In some embodiments, C3 gene expression can be evaluated based on the level or level change of any variable related to C3 gene expression, such as C3 mRNA level or C3 protein level.

[0074] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of a C3 protein, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention to inhibit C3 gene expression. In some embodiments, C3-related diseases, symptoms, or conditions are selected from the group consisting of C3 glomerulosis (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease with bacterial flora, malarial anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

[0075] In some embodiments, the method further comprises administering another therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen comprises the treatment of a C3-related disease or condition. In some embodiments, the additional therapeutic regimen comprises administering one or more C3 antisense polynucleotides of the present invention to the subject, administering a non-C3 dsRNA therapeutic agent to the subject, and inducing behavioral changes in the subject. The additional therapeutic agent is selected from C5 inhibitors, e.g., anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimube (REGN3918)), or C5 peptide inhibitors (e.g., Zircoplan), or C3 peptide inhibitors, e.g., Compstatin.

[0076] In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered intravenously to the subject. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0077] In some embodiments, a method for determining the therapeutic effect of a treatment on a subject includes (i) determining one or more physiological characteristics of a C3-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the C3-related disease or condition, the comparison result of which indicates one or more of the presence, absence, and level of the therapeutic effect of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0078] In some embodiments, C3 gene expression can be evaluated based on the level or level change of any variable related to C3 gene expression (e.g., the subject's C3 mRNA level, C3 protein level).

[0079] Another aspect of the present invention provides a method for reducing the level of C3 protein in a subject compared to a pre-treatment baseline level of C3 protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention to reduce the level of C3 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection.

[0080] Another aspect of the present invention provides a method for altering the physiological characteristics of a subject's C3-related disease or disorder, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent of the present invention, or any embodiment of the composition of the present invention, in order to alter the physiological characteristics of the subject's C3-related disease or disorder compared to baseline pre-treatment physiological characteristics of the subject's C3-related disease or disorder. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection. In some embodiments, the physiological characteristics and symptoms are one or more C3 mRNA levels or C3 protein levels in the subject. In some embodiments, paroxysmal nocturnal hemoglobinuria (PNH) is a relatively rare disorder comprising acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and thrombosis (tendency to form thrombi).

[0081] According to another aspect of the present invention, a method is provided for using the above-mentioned dsRNA agent to treat a disease or condition associated with the presence of the C3 protein. In some embodiments, the disease or condition is one or more of the following: C3 glomerulosis (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease with bacterial flora, malarial anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, or neurodegenerative diseases.

[0082] A brief explanation of arrays Sequence ID 1 is modern human C3 mRNA [NCBI reference sequence NM_000064.4]. Sequence numbers 2-24, 110, and 112 are shown in Table 1 and are sense strand sequences. Sequence numbers 25-47, 111, and 113 are shown in Table 1 and are antisense strand sequences. Sequence IDs 48-71 are shown in Table 2 and are chemically modified sequences. Sequence IDs 72-101 and 102-107 are shown in Table 3. The delivery molecule is indicated as "GLX-_" at the 3' or 5' end of each sense chain. [Brief explanation of the drawing]

[0083] [Figure 1] This figure shows the silencing effect of C3 siRNAs (AD01444, AD01428, AD01447) on monkey serum proteins after a single subcutaneous injection of 5 mg / kg of siRNA compounds. [Figure 2]This figure shows the silencing effect of C3 siRNAs (AD00193-3, AD01444, AD01444-3, AD01447-2) on monkey serum proteins after a single subcutaneous injection at a dose of 5 mg / kg. [Figure 3] This figure shows the C3 mRNA silencing effect of C3 siRNAs (AD00193-3, AD01447-2, AD01447-4, AD01447-5, AD01447-6) in monkey liver biopsies after a single subcutaneous injection of 6 mg / kg of siRNA compounds.

[0084] Detailed description of the invention The present invention partially comprises an RNAi agent capable of inhibiting the expression of the complement component 3 (C3) gene, for example, a double-stranded (ds) RNAi agent. The present invention further partially comprises a composition comprising a C3 RNAi agent and a method of using the composition. The C3 RNAi agents disclosed herein can be attached to a delivery compound so as to be delivered to cells, including hepatocytes. The pharmaceutical composition of the present invention may comprise at least one dsRNA C3 agent and a delivery compound. In some embodiments of the composition and method of the present invention, the delivery compound is a delivery compound containing GalNAc. The C3 RNAi agent delivered to cells can reduce the activity of the C3 protein product of the gene in the cells by inhibiting the expression of the C3 gene. The dsRNAi agents of the present invention can be used to treat C3-related diseases and conditions.

[0085] In some embodiments of the present invention, C3 expression in cells or subjects is reduced to treat diseases or conditions associated with C3 expression in cells or subjects, respectively. These are not limiting examples of diseases and conditions that can be treated by reducing C3 activity. In some embodiments, paroxysmal nocturnal hemoglobinuria (PNH) is a relatively rare disease that includes acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and thrombosis (a tendency to form blood clots). "Treatment" may also mean extending survival time compared to the expected survival time without treatment.

[0086] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, the terms “ribonucleotide” or “nucleotide” should be understood to refer to modified nucleotides (described in more detail below) or alternative substitutions. It will be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other parts without significantly altering the base-pairing properties of oligonucleotides containing such substitutions. For example, a nucleotide containing inosine as a base can pair with a nucleotide base containing adenine, cytosine, or uracil, but is not limited to these. Therefore, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine may be substituted with, for example, a nucleotide containing inosine. Sequences containing such substitutions are examples of the present invention.

[0087] As used herein, “complement component 3” is a term that can be used interchangeably with the term “C3” and, unless otherwise specified, refers to a naturally occurring gene encoding a complement 3 protein from any vertebrate or mammal, including, but not limited to, humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs. The term further refers to fragments and variants of natural C3 that retain at least one in vivo or in vitro activity of natural C3. The amino acid and complete coding sequences of the human C3 gene reference sequence can be found, for example, in GenBank Ref Seq Accession No. NM_000064.4 (SEQ ID NO: 1). Other examples of C3 mRNA sequences can be readily obtained using publicly available databases (e.g., GenBank, UniProt, Ensembl, and OMIM).

[0088] The following describes how compositions containing single-stranded C3 (ssRNA) and dsRNA are prepared and used to inhibit C3 gene expression, and compositions and methods for treating diseases and conditions caused or regulated by C3 gene expression. The term "RNAi" is also known in this field, and may also be called "siRNA".

[0089] As used herein, the term "RNAi" refers to a reagent that includes RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region refers to a continuous portion of the nucleotide sequence of an RNA molecule formed during the gene transcription process, including messenger RNA (mRNA), which is a processed product of primary transcript RNA. The target portion of the sequence is at least long enough to be used as a substrate for RNAi directed cleavage at or near that portion. The target sequence may be 8–30 nucleotides long (inclusive), 10–30 nucleotides long (inclusive), 12–25 nucleotides long (inclusive), 15–23 nucleotides long (inclusive), 16–23 nucleotides long (inclusive), or 18–23 nucleotides long (inclusive), and includes all relatively short lengths within each specified range. In some embodiments of the present invention, the target sequence has a nucleotide length of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the length of the target sequence is between 9 and 26 nucleotides (including both endpoints), encompassing all subranges and integers within that range. For example, but not intended to be limiting, in some embodiments of the present invention, the target sequence has a nucleotide length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and the sequence is completely or at least fundamentally complementary to at least a portion of the RNA transcript of the C3 gene. Some aspects of the present invention include a pharmaceutical composition comprising one or more C3 dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the present invention, C3 RNAi as described herein inhibits the expression of C3 protein.

[0090] As used herein, “dsRNA reagent” refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or repressing the translation of a target mRNA transcript. Without intending to limit ourselves to any particular theory, the dsRNA reagents of the present invention may function by an RNA interference mechanism (i.e., by inducing the production of RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Methods for achieving gene silencing in plant, invertebrate, and vertebrate cells are known in the art (see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), and their respective disclosures are incorporated herein by reference as a whole. Gene silencing methods known in the art can be used in combination with the disclosures provided herein to achieve inhibition of C3 expression.

[0091] The dsRNA agents disclosed herein consist of one sense strand and one antisense strand and include, but are not limited to, short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. In the art, dsRNA double-stranded structures of different lengths can be used to inhibit target gene expression. For example, dsRNA double-stranded structures having 19, 20, 21, 22, and 23 base pairs are known to be able to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. In some embodiments, the lengths of the sense strand and antisense strand are homologous or different. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 25 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the length of each strand is 21 nucleotides or less. In some embodiments, the length of the sense strand and antisense strand of the RNAi agent may be 15 to 49 nucleotides each. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense strand and the antisense strand length is 21 nucleotides.In some embodiments, the sense strand is complementary to or essentially complementary to the antisense strand, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The C3 dsRNA in some embodiments of the present invention may include at least one strand having a length of at least 21 nt, or it may have a shorter double-stranded body with 1, 2, 3, or 4 nucleotides reduced at one or two ends based on one of the sequences listed in any one of Tables 1 to 3, which may be more effective than the dsRNAs listed in Tables 1 to 3. In some embodiments of the present invention, the C3 dsRNA agent may have a sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and their ability to inhibit C3 gene expression differs by only 5%, 10%, 15%, 20%, 25%, or 30% or less compared to the inhibition level of dsRNA containing the complete sequence. The sense sequences, antisense sequences, and double-stranded bodies disclosed in Tables 1-3 may be referred to herein as “parent” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, substituted, etc., as described herein, and the resulting sequences retain the effectiveness of all or at least part of the parent sequence in the methods and compositions of the present invention. The sense strands and antisense strands contained in the dsRNA of the present invention are independently selected. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of the other elements. For example, though not intended to be limiting, when producing the dsRNA of the present invention, two strands of "elements" may be selected so as to be contained within a double strand.One selected element, i.e., the sense sequence, may be sequence number 56 (as shown in Table 2), while the other selected element, i.e., the antisense sequence, may be sequence number 68, or sequence number 68 that is modified, shortened, extended, and / or contains one, two, or three substitutions compared to its parent sequence, sequence number 68. It should be understood that the double strands of the present invention do not necessarily have to contain simultaneously the sense sequence and antisense sequence shown in the pairings in the double strands of Tables 1-3. Each sense strand sequence and antisense strand sequence in the tables is immediately followed by its sequence number.

[0092] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or single-stranded RNA administered to a subject. For example, the antisense strands listed in any one of Tables 1 to 3 may be compositions or compositions administered to a subject to reduce C3 polypeptide activity and / or C3 gene expression in the subject's body. Table 1 shows the core extension nucleotide sequences of the antisense and sense strands of a certain C3 dsRNA agent. A single-stranded antisense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded antisense agent” or “antisense polynucleotide agent.” A single-stranded sense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded sense agent” or “sense polynucleotide agent.” The term “nucleotide sequence” is used herein to refer to a polynucleotide sequence that is free from chemical modifications or delivery compounds. For example, the sense strand GUCUACGAAGCUCAUGAAUAA (SEQ ID NO: 10) shown in Table 1 is the nucleotide sequence of SEQ ID NO: 56 in Table 2 and SEQ ID NO: 83 or 84, 86 and / or 87 in Table 3, of which SEQ ID NO: 56 and SEQ ID NO: 83 or 84, 86 and / or 87 represent their chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be labeled with "sense strand SS#", a single-stranded antisense sequence may be labeled with "antisense strand AS#", and a double-stranded compound containing the sense strand and antisense strand may be labeled with "double-stranded compound AD# / AV#".

[0093] Table 1 includes a sense strand and an antisense strand, and provides the label numbers for the double-stranded sequences formed by the sense strand and antisense strand in the same row of Table 1. In some embodiments of the present invention, the antisense sequence includes a nucleic acid base u or a at position 1 of the antisense sequence. In some embodiments of the present invention, the antisense sequence includes a nucleic acid base u located at position 1 of the antisense sequence. As used herein, the term “matching position” in the sense strand and antisense strand is a position that “pairs” in each strand when the two strands are double-stranded. For example, in a sense strand of 21 nucleic acid bases and an antisense strand of 21 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 21 of the antisense strand are in a “matching position”. In yet another non-limiting example, in a sense strand of 23 nucleic acid bases and an antisense strand of 23 nucleic acid bases, the nucleic acid base 2 of the sense strand and position 22 of the antisense strand are in a matching position. In yet another non-limiting example, in an 18-base sense strand and an 18-base antisense strand, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 18 of the antisense strand are in matching positions, and nucleic acid base 4 in the sense strand and nucleic acid base 15 in the antisense strand are in matching positions. A person skilled in the art will understand how to identify, or become, matching positions in the sense strands and antisense strands of a double-stranded and paired strand.

[0094] The first column of Table 1 shows the double-stranded AV# containing the sense sequence and antisense sequence double-stranded AV# in the row of the same table. For example, Table 1 discloses a double-stranded AV01447.um identified as containing sense sequence number 10 and antisense sequence number 33. Thus, each row of Table 1 labels a double-stranded AV# of the present invention, each double-stranded AV# contains the sense sequence and antisense sequence shown in the same row, and the assigned identifier for each double-stranded AV# is shown in the first column of the row.

[0095] In some embodiments of the method of the present invention, an RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body, which contains at least one nucleotide sequence listed in Table 1 and includes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, the RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound containing a GalNAc compound or a GLS-15* compound.

[0096] [Table 2-1] [Table 2-2] [Table 2-3]

[0097] Table 2 shows the antisense and sense strand sequences of a certain chemically modified C3 RNAi agent of the present invention. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body labeled in the first row of Table 2 and includes sequence modifications in the sense strand sequence and antisense strand sequence shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as "bound to") a compound that can deliver the RNAi agent to cells and / or tissues in the subject. Non-limiting examples of deliverable compounds that can be used in some embodiments of the present invention are GalNAc-containing compounds or GLS-15*-containing compounds. In Table 2, the first column shows the double-stranded AV# of the nucleotide sequence as shown in Table 1. Table 2 discloses double-stranded AV# sequences and further shows the chemical modifications contained in the double-stranded sense and antisense sequences. For example, Table 1 shows the single-base sequences of SEQ ID NO: 10 (sense) and SEQ ID NO: 33 (antisense), which together constitute a double-stranded AV# labeled as AV01447.um, and Table 2 lists double-stranded AV# AV04977, which indicates that the double-stranded sequences of SEQ ID NO: 56 and SEQ ID NO: 68 contain the base sequences of SEQ ID NO: 10 and SEQ ID NO: 33, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in the third and sixth columns, respectively. In the second column of Table 2, "Sense Strand SS#" is an identifier assigned to the sense sequence (including modifications) shown in the third column in the same row. In the fifth column of Table 2, "Antisense Strand AS#" is an identifier assigned to the antisense sequence (including modifications) shown in the sixth column.

[0098] [Table 3-1] [Table 3-2]

[0099] Table 3 shows the antisense and sense strand sequences of a certain chemically modified C3 RNAi agent of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a double-stranded body labeled in the first row of the first column of Table 3, and includes sequence modifications and / or delivery compounds listed in the sense strand sequence and antisense strand sequence in the third and sixth columns of the same row of Table 3, respectively. These sequences are used in certain in vivo study described elsewhere in this specification. In some embodiments of the methods of the present invention, the sequences shown in Table 3 may be attached to (also referred to herein as "bound to") a delivery compound, a non-limiting example of which is a GalNAc-containing compound, of which the delivery compound is labeled as "GLX-n" in the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to indicate a "GLS-n*" or "GLO-n" delivery compound (where "X" may be "S" or "O"), and GLX-0 may be any "GLS-n*" or "GLO-n" delivery compound that can be attached to the 3' end of an oligonucleotide during the synthesis process. As used herein and as shown in Table 3, "GLX-n" is used to indicate a compound containing GalNAc attached thereto, namely any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structure of each of these compounds is provided elsewhere in this specification.Those skilled in the art can manufacture and use the dsRNA compounds of the present invention, of which the ligated delivery compound is any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. In some embodiments, the delivery compound L96 is represented as a GalNAc-containing compound for linkage disclosed in the prior art, but is not limited to, for example, a GalNAc-containing compound for adhesion disclosed in Jayaprakash, et al., (2014) J.Am.Chem.Soc., 136, 16958-16961 and / or WO2021222549. The first column of Table 3 provides double-stranded AD#s assigned to the double strands of the sense and antisense sequences in the row of the table. For example, double-stranded AD#AD01447 is the double strand of sense strand SEQ ID NO: 78 and antisense strand SEQ ID NO: 90. Each row of Table 3 provides one sense strand and one antisense strand and discloses the double strands of the sense and antisense strands shown. "Sense strand SS#" in the second column of Table 3 is an identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. In the fifth column of Table 3, “Antisense Chain AS#” is the assigned identifier for the antisense sequence (including modifications) shown in the sixth column. The identifier for a “GLO-n” or “GLS-n*” compound containing a certain linked GalNAc is shown as GLS-5*, GLS-15*, or GLX-0, and another “GLO-n” or “GLS-n*” compound may replace the compound shown as GLO-0, and the resulting compound should be understood to be included in the examples of the methods and / or compositions of the present invention.

[0100] [Table 4-1] [Table 4-2] [Table 4-3]

[0101] The double-stranded AD#AD00193-3 is a positive control sequence, its sense sequence is a*c*ccuacuCUGuuguucgaa*a (L96) (SEQ ID NO: 108), and its reverse sequence is u*U*uCgAaCaAcAgAgUaGg*G*u (SEQ ID NO: 109). L-96 refers to the GalNAc3 compound in Jayaprakash, et al., (2014) J.Am.Chem.Soc., 136, 16958-16961.

[0102] [Table 5-1] [Table 5-2] [Table 5-3]

[0103] In some embodiments of the present invention, the dsRNA (also referred to herein as the “double-stranded DNA”) is a dsRNA disclosed in one of Tables 1 to 3. Each row in Tables 1 to 3 discloses a double-stranded DNA comprising the sense strand sequence and antisense strand sequence in that row of the table. In addition to the double-stranded DNA disclosed in Tables 1 to 3, in some embodiments, the double-stranded DNA of the present invention may include the sense and antisense sequences shown in Tables 1 to 3, and should be understood to differ from the nucleotide sequences shown in Tables 1 to 3 by only 0, 1, 2, or 3 nucleotides. Accordingly, in non-limiting examples, in some embodiments, the antisense strand in the double-stranded DNA of the present invention may be a nucleotide sequence that differs from the nucleotides in SEQ ID NOs. 86, 87, 88, or 90 by only 0, 1, 2, or 3 nucleotides, respectively.

[0104] It should be understood that the sense strand sequence and antisense strand sequence in the double-stranded DNA of the present invention can be selected independently. Accordingly, the dsRNA of the present invention may include the double-stranded sense strand and antisense strand disclosed in the same row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense strand and antisense strand in the dsRNA may include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense strand may include one, two, three or more nucleic acid base substitutions derived from the parent sequence. In some embodiments, the selected sequence may be longer or shorter than its parent sequence. Therefore, the dsRNA agents included in the present invention may, but are not necessarily, include the exact sequences of the sense strand and antisense strand disclosed as double-stranded DNA in Tables 1-3.

[0105] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the C3 RNA transcript, the complementary region comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a target ligand. In some cases, the region complementary to the C3 RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 3 or fewer nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least fundamentally complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is fully complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence shown in any one of Tables 1 to 3. Some embodiments of the dsRNA agent of the present invention include a sense strand and an antisense strand disclosed as a double-stranded body in any one of Tables 1 to 3. As described herein, it should be understood that the sense strand and antisense strand in the double-stranded body of the present invention can be selected independently.

[0106] Mismatch As is known to those skilled in the art, mispairs can be tolerated with respect to the effectiveness of dsRNA, particularly when the mispairs are located within the terminal region of the dsRNA. Some mispairs exhibit better resistance; for example, mispairs having fluctuating base pairs G:U and A:C exhibit better resistance to effectiveness (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the C3 dsRNA agent may contain one or more mispairs with the C3 target sequence. In some embodiments, the C3 dsRNA agent of the present invention does not contain mispairs. In some embodiments, the C3 dsRNA agent of the present invention contains one or fewer mispairs. In some embodiments, the C3 dsRNA agent of the present invention contains two or fewer mispairs. In some embodiments, the C3 dsRNA agent of the present invention contains three or fewer mispairs. In some embodiments of the present invention, the antisense strand of the C3 dsRNA agent contains a mispair with a C3 target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of the C3 dsRNA agent contains one, two, three, four or more mispairs located at the last 5, 4, 3, 2, or 1 nucleotide of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether a C3 dsRNA agent containing mispairs with a C3 target sequence effectively inhibits the expression of a C3 gene.

[0107] Complementarity Where used herein, unless otherwise specified, the term “complementary” means, when used to describe a first nucleotide sequence (e.g., the sense strand of a C3 dsRNA agent or a target C3 mRNA) to a second nucleotide sequence (e.g., the antisense strand of a C3 dsRNA agent or a single-stranded antisense polynucleotide), the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence [forming interbase-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)] and to form a double-stranded or double-helical structure under certain conditions. Other conditions, e.g., physiologically relevant conditions that may be encountered in vivo, are also applicable. Those skilled in the art can determine the optimal set of conditions for testing the two sequence complementarity from the final application of the nucleotides to hybridize. The complementary sequence includes natural or modified nucleotides or nucleotide mimeographs, including Watson-Crick base pairs or non-Watson-Crick base pairs, and within the range that at least satisfies the above hybridization requirements. Sequence identity or complementarity is not related to modification.

[0108] For example, complementary sequences within C3 dsRNA as described herein include base pairings of one or two nucleotide sequences over the full length of an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence. Such sequences may be referred to herein as “fully complementary.” In embodiments in which two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, it should be understood that such overhangs are not considered mispairs as determined herein based on complementarity. For example, a C3 dsRNA reagent includes an oligonucleotide having a 19-nucleotide length and another oligonucleotide having a 20-nucleotide length, of which the relatively longer oligonucleotide contains a 19-nucleotide sequence that is fully complementary to the relatively shorter oligonucleotide, and for the purposes described herein, this may be referred to as “fully complementary.” Thus, as used herein, “fully complementary” means that all (100%) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The continuous sequence may contain all or part of the first or second nucleotide sequence.

[0109] As used herein, the term “basically complementary” means that in a pair of nucleic acid base sequences being hybridized, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The term "basically complementary" can be used to mean that when two sequences hybridize, they contain one or more mispaired base pairs, e.g., at least 1, 2, 3, 4, or 5 mispaired base pairs, the first sequence forms a double-stranded structure with 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) compared to the second sequence, while simultaneously retaining the ability to hybridize under conditions most relevant to its ultimate application, such as the inhibition of C3 gene expression via the RISC pathway.

[0110] The term “partially complementary” can be used herein to refer to a pair of nucleic acid base sequences to be hybridized such that at least 75% (but not all) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. In some embodiments, “partially complementary” means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequence of the second polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide.

[0111] As used herein, the terms “complementary,” “fully complementary,” “basically complementary,” and “partially complementary” refer to base matching between the sense and antisense strands of a C3 dsRNA agent, between the antisense strand of a C3 dsRNA agent and the sequence of the target C3 mRNA, or between a single-stranded antisense oligonucleotide and the sequence of the target C3 mRNA. The term “antisense strand of a C3 dsRNA agent” should be understood to refer to the same sequence as “C3 antisense polynucleotide agent.”

[0112] As used herein, the terms “basically the same” or “basically identical,” when used to refer to a nucleic acid sequence, refer to a nucleic acid sequence having at least about 85% or more sequence identity compared to a reference sequence, preferably containing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of matching positions by determining the number of positions in which the same nucleic acid bases appear in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein cover nucleotide sequences that are basically identical to the nucleotide sequences disclosed herein. For example, these are shown in Tables 1-3. In some embodiments, the sequences disclosed herein are identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).

[0113] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing a nucleotide chain, which is described by a sequence indicated using standard nucleotide nomenclature. As used herein, the term “double-stranded RNA” or “dsRNA” refers to an RNAi containing an RNA molecule or molecular complex having a hybridization double-stranded region, which comprises two antiparallel and basically or completely complementary nucleic acid strands having “sense” and “antisense” directions with respect to the target C3 RNA. The double-stranded region may be of any length that allows for the specific degradation of the desired target C3 RNA by the RISC pathway, but is generally in the length range of 9 to 30 base pairs, for example, 15 to 30 base pairs. Considering a double-stranded body between 9 and 30 base pairs, the length of the double-stranded body may be within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subrange therein, such as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs This includes, but is not limited to, base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. The length of C3 dsRNA agents produced in cells by processing with Dicer and similar enzymes is typically in the range of 19-22 base pairs. One strand of the double-stranded region of the C3 dsDNA agent contains a sequence that is essentially complementary to the region of the gene's C3 RNA.The two strands forming a double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be formed from two or more individual RNA molecules. When the double-stranded region is formed from a single molecule, the molecule may have a double-stranded structure (referred to herein as a “hairpin ring”) formed from one strand at the 3'-end of a single-stranded nucleotide chain and another strand at the corresponding 5'-end. In some embodiments of the present invention, the hairpin ring structure contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two strands that are essentially complementary to a C3 dsRNA agent consist of individual RNA molecules, these molecules do not need to be covalently bonded, but they can be. When the two strands are covalently bonded in a manner other than a hairpin ring, the linking structure is referred to as a “linker”. The term "siRNA" is also used herein to refer to the dsRNA agents described herein.

[0114] In some embodiments of the present invention, the C3 dsRNA agent may include sense and antisense sequences that do not have unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA agent. Ends without unpaired nucleotides are called "blunt ends" and do not have nucleotide overhangs. When both ends of the dsRNA agent are blunt ends, the dsRNA is called a "blunt-ended" dsRNA. In some embodiments of the present invention, the first end of the dsRNA agent is a blunt end, in some embodiments, the second end of the dsRNA agent is a blunt end, and in some embodiments of the present invention, both ends of the C3 dsRNA agent are blunt ends.

[0115] In some embodiments of the dsRNA reagent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the dsRNA reagent has at least one unpaired nucleotide at the end of each strand. For example, a nucleotide overhang exists if the 3' end of one strand of dsRNA extends from the 5' end of the other strand, or vice versa. The dsRNA may contain at least one, two, three, four, five, six or more nucleotide overhangs. The nucleotide overhangs may contain or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). In some embodiments, the nucleotide overhangs are located on the sense strand of the dsRNA reagent, the antisense strand of the dsRNA reagent, or both ends of the dsRNA reagent, and the nucleotides at the overhangs may be located at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides at the overhangs are replaced by phosphorothioate nucleosides.

[0116] As used herein, the terms “antisense strand” or “guide strand” refer to the strand of a C3 dsRNA agent that contains a region that is essentially complementary to the C3 target sequence. As used herein, the terms “sense strand” or “passenger strand” refer to the strand of a C3 dsRNA agent that contains a region that is essentially complementary to the region of the antisense strand of the C3 dsRNA agent.

[0117] qualification The RNA of the C3 RNAi agent in some embodiments of the present invention is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the present invention can be synthesized and / or modified by methods known in the art, see, for example, "Current protocols in Nucleic Acid Chemistry," Beaucage, S. Let al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in some embodiments of the C3 dsRNA reagent of the present invention include, for example, terminal modifications such as (a) 5'-end modifications (phosphorylation, binding, reverse ligation, etc.) and 3'-end modifications (binding, DNA nucleotide, reverse ligation, etc.), (b) base modifications such as stable bases, unstable bases or base substitutions that base pair with an extended partner library, deletion bases (debased nucleotides) or conjugate bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and (d) skeletal modifications including modifications or substitutions of phosphodiester bonds. Specific examples of RNA compounds usable in some embodiments of the C3 dsRNA agent, C3 antisense polynucleotide, and C3 sense polynucleotide of the present invention include, but are not limited to, RNAs comprising a modified backbone or RNAs not comprising a native internucleoside bond. Non-limiting examples include RNAs having a modified backbone that do not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in the internucleoside backbone may be called oligonucleosides. In some embodiments of the present invention, the modified RNA has a phosphorus atom in its internucleoside backbone.

[0118] The terms “RNA molecule” or “RNA” or “ribonucleic acid molecule” should be understood to encompass not only RNA molecules expressed or discovered in nature, but also RNA analogs and derivatives, including one or more ribonucleotide / ribonucleoside analogs or derivatives, as described herein or known in the art. The terms “ribonucleoside” and “ribonucleotide” are interchangeable herein. RNA molecules can be modified in their nucleic acid base structure or ribose-phosphate backbone structure, for example, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double helixes. As a non-limiting example, an RNA molecule may further include at least one modified ribonucleoside, including, but not limited to, 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino nucleosides, phosphoramidates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the present invention, the RNA molecule contains modified ribonucleosides up to the full length of the ribonucleosides of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or C3 dsRNA reagent molecule. The modifications of each of the multiple modified ribonucleosides in such an RNA molecule do not necessarily have to be identical.

[0119] In some embodiments, the dsRNA agent, C3 antisense polynucleotide and / or C3 sense polynucleotide of the present invention may contain one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. As used herein, the term “independently selected” is used to refer to selected elements such as modified nucleotides and nonphosphodiester bonds, and means that two or more selected elements may be the same as, but not necessarily the same as, each other.

[0120] As used herein, “nucleotide base,” “nucleotide,” or “nucleic acid base” refers to heterocyclic pyrimidines or purine compounds that are standard components of all nucleic acids and that form nucleotides, including adenine, guanine, cytosine, thymine, and uracil. Nucleic acid bases can be further modified to include (but not limited to) universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” can be used herein to refer to unmodified nucleotides, modified nucleotides, or alternative substitutional moieties. It will be recognized by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other moieties without significantly altering the base-pairing properties of oligonucleotides containing such substitutional moieties.

[0121] In one embodiment, the modified RNA considered to be used in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and enables or mediates the specific degradation of the target RNA by the RISC pathway. In some embodiments of the present invention, the C3 RNA interferant comprises a single-stranded RNA that interacts with a target C3 RNA sequence to direct the cleavage of the target C3 RNA.

[0122] The modified RNA backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkylphosphotryesters, methyl and other alkylphosphonates (including 3'-alkylenephosphonates and chiralphosphonates), phosphinates, phosphoramidates (including 3'-aminophosphoramidates and aminoalkylphosphoramidates), phosphorothioates, thioalkylphosphonates, thioalkylphosphotryesters, and borate phosphates (having normal 3'-5' linkages and their 2'-5' linkage analogs, as well as those with opposite polarity, where adjacent nucleoside unit pairs are linked in the form of 3'-5'~5'-3' or 2'-5'~5'-2'). It further includes various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing bonds are common in this art, and such methods can be used to produce the modified C3 dsRNA reagent, the modified C3 antisense polynucleotide, and / or the modified C3 sense polynucleotide of the present invention.

[0123] The phosphorus atom-free modified RNA skeleton has a skeleton formed by short-chain alkyl or cycloalkyl nucleotide interbonding, mixed heteroatoms and alkyl or cycloalkyl nucleotide interbonding, or one or more short-chain heteroatoms or heterocyclyl nucleotide interbonding. It includes those having morpholine bonds (partially formed from the sugar portion of a nucleoside), siloxane skeletons, sulfides, sulfoxides and sulfone skeletons, methylacetyl and thiomethylacetyl skeletons, methylenemethylacetyl and thiomethylacetyl skeletons, olefin-containing skeletons, sulfamic acid skeletons, methyleneimino and methylenehydrazino skeletons, sulfonates and sulfonamide skeletons, amide skeletons, and other parts mixed with N, O, S and CH2 components. Methods for producing phosphorus atom-free modified RNA skeletons are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA agents, certain modified C3 antisense polynucleotides and / or certain modified C3 sense polynucleotides of the present invention.

[0124] In some embodiments of the present invention, the RNA mimetics include, but are not limited to, C3 dsRNA, C3 antisense polynucleotides, and / or C3 sense polynucleotides, in which, for example, the sugar and internucleotide bonds (i.e., the backbone) of the nucleotide units are substituted with new groups. In such embodiments, the base units are maintained for hybridization with suitable C3 nucleic acid target compounds. Such oligomeric compounds (RNA mimetics that have been proven to have excellent hybridization properties) are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is substituted with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleic acid bases are retained and directly or indirectly bonded to the aza nitrogen atoms of the amide portion of the backbone. Methods for producing RNA mimetics are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA reagents of the present invention.

[0125] Some embodiments of the present invention include RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as a methylene group (methylimino group) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [of which the natural phosphodiester backbone is represented as -OPO-CH2-]. Methods for producing RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA reagents, certain C3 antisense polynucleotides, and / or certain C3 sense polynucleotides of the present invention.

[0126] The modified RNA may further contain one or more substituted sugar moieties. The C3 dsRNA, C3 antisense polynucleotide and / or C3 sense polynucleotide of the present invention may contain at the 2' position one of OH, F, O-, S- or N-alkyl groups, O-, S- or N-alkenyl groups, O-, S- or N-alkynyl groups, or O-alkyl-O-alkyl groups, of which alkyl groups, alkenyl groups and alkynyl groups may be substituted or unsubstituted C1-C 10 Alkyl alkyl group or C2-C 10 The group may be an alkenyl group or an alkynyl group. An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n It contains CH3)2, of which n and m are 1 to about 10. In other embodiments, dsRNA has C1-C at the 2' position. 10The group comprises a lower alkyl group, a substituted lower alkyl group, an alkylaryl group, an arylalkyl group, an O-alkylaryl group or an O-aralkyl group, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, a heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleavage group, a reporter group, an intercalator agent, a group for improving the pharmacokinetic properties of a C3 dsRNA reagent, or a group for improving the pharmacodynamic properties of a C3 dsRNA reagent, a C3 antisense polynucleotide and / or a C3 sense polynucleotide, and one of other substituents having similar properties. In some embodiments, the modifications include a 2'-methoxyethoxy group (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Other exemplary modifications include a 2'-dimethylaminoethoxyethoxy group, also known as 2'-DMAOE, i.e., an O(CH2)2ON(CH3)2 group, and a 2'-dimethylaminoethoxyethoxy group (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for producing the above modified RNAs are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA agents of the present invention.

[0127] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications may occur at other positions on the RNA of the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide of the present invention, particularly on the 3' terminal nucleotide, or at the 3' position of the sugar in the C3 dsRNA, C3 antisense polynucleotide, or C3 sense polynucleotide ligated from 2' to 5', and at the 5' position of the 5' terminal nucleotide. The C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide may further have a cyclobutyl group moiety that replaces a sugar mimetic, such as pentofuranose. Methods for producing modified RNA (e.g., the methods described) are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the present invention.

[0128] In some embodiments, the C3 dsRNA agent, C3 antisense polynucleotide and / or C3 sense polynucleotide may include modifications or substitutions of nucleic acid bases (usually abbreviated as “bases” in the art). As used herein, “unmodified” or “natural” nucleic acid bases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleic acid bases include other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, the 6-methyl group and other alkyl derivatives of adenine and guanine, the 2-propyl group and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine This includes 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino groups, 8-thiols, 8-thioalkyl groups, 8-hydroxyl groups and other 8-substituted adenines and guanines, 5-halogens (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-azaadenine, and 3-deazaguanine and 3-deazaadenine.Other nucleic acid bases that may be included in some embodiments of the C3 dsRNA reagent of the present invention are known in the art, see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302; Crooke, STand Lebleu, B., Ed., CRC Press, 1993. Methods for producing dsRNA, C3 antisense strand polynucleotides, and / or C3 sense strand polynucleotides containing nucleic acid base modifications and / or substitutions (e.g., those described herein) are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA agents, C3 sense polynucleotides, and / or C3 antisense polynucleotides of the present invention.

[0129] In some embodiments, the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide comprises RNA modified to include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety that includes additional crosslinks linking the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-internal structural conformation. By adding locked nucleic acids to the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide of the present invention, serum stability can be increased and off-target effects can be reduced (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for producing dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides containing locked nucleic acids are commonly practiced in the art, and such methods can be used to produce certain modified C3 dsRNA agents of the present invention.

[0130] In some embodiments, the C3 dsRNA compound, sense polynucleotide and / or antisense polynucleotide comprises at least one modified nucleotide, of which the at least one modified nucleotide comprises 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotides containing a 5'-phosphorothioate group, or terminal nucleotides linked to a cholesterol derivative or dodecanoic acid bisdecanamide group, 2'-amino-modified nucleotide, phosphoramidate, or nucleotides containing a non-natural base. In some embodiments, the C3 dsRNA compound comprises an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0131] In some embodiments of the present invention, the C3 dsRNA compound includes at least one modified nucleotide at the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide, wherein the at least one modified nucleotide includes a debased nucleotide, a ribitol, a reverse nucleotide, a reverse debased nucleotide, a reverse 2'-OMe nucleotide, and a reverse 2'-deoxynucleotide. It is known to those skilled in the art that stability can be enhanced by including a debased or reverse debased nucleotide at the oligonucleotide terminus (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716.doi:10.1093 / nar / gkg393). In some embodiments, the C3 dsRNA compound includes one or more reverse debased residues (invab) at the 3' end or 5' end, or at both the 3' and 5' ends. Exemplary invab residues include, but are not limited to, the following:

[0132] [ka] In some embodiments, the 3' and 5' ends of the C3 dsRNA compound, sense polynucleotide and / or the 3' end of the antisense polynucleotide include at least one modified nucleotide, of which at least one modified nucleotide includes isomannitol nucleotide or a stereoisomer of the isomannitol nucleotide. Specific examples of isomannitol nucleotide or a stereoisomer of the isomannitol nucleotide are: [ka] This includes, but is not limited to, the terms "Olig" each independently represent a polynucleotide portion. An example is the isomannitol residue (imann), [ka] This includes, but is not limited to, the following:

[0133] In some embodiments, the isomannitol nucleotide may be conjugated to one or more target groups or delivery molecules, such as the GalNAc moiety.

[0134] In some embodiments, the C3 dsRNA compound comprises at least one modified nucleotide, of which at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) and / or ethylene glycol nucleic acid nucleotide (GNA). UNA and GNA are thermally unstable chemical modifications and are known to those skilled in the art to significantly improve the off-target properties of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723.doi:10.1038 / s41467-018-02989-4; Laurens et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862-70).

[0135] Another possible modification of the RNA of a certain C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide in embodiments of the present invention includes one or more ligands, moieties, or conjugates chemically linked to the RNA, thereby enhancing one or more properties of the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide, respectively. Non-limiting examples of properties that can be enhanced are the activity, cell distribution, delivery of the C3 dsRNA agent, pharmacokinetic properties of the C3 dsRNA agent, and cell uptake of the C3 dsRNA agent. In some embodiments of the present invention, the C3 dsRNA agent includes one or more target groups or binding groups conjugated to the sense strand in embodiments of the C3 dsRNA agent of the present invention. Non-limiting examples of target groups include compounds containing N-acetylgalactosamine (GalNAc). The terms “target group,” “targeting agent,” “conjugate,” “target compound,” “delivery molecule,” “delivery compound,” and “target ligand” are interchangeable herein. In some embodiments of the present invention, the C3 dsRNA agent comprises a target compound conjugated to the 5' end of the sense strand. In some embodiments of the present invention, the C3 dsRNA agent comprises a target compound conjugated to the 3' end of the sense strand. In some embodiments of the present invention, the C3 dsRNA agent comprises a target group containing GalNAc. In some embodiments of the present invention, the C3 dsRNA agent does not contain a target compound conjugated to either or both of the 3' and 5' ends of the sense strand. In some embodiments of the present invention, the C3 dsRNA agent does not contain a target compound containing GalNAc conjugated to either or both of the 5' and 3' ends of the sense strand.

[0136] Other targeting agents and binders are well known in the art, and for example, targeting agents and binders usable in some embodiments of the present invention include lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), beryl-S-trityl mercaptan (Manoharan et al., Ann. NYAcad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Thioethers such as Res., 1992, 20:533-538; dodecanediol or undecyl residues such as Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54; fatty acid chains such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther.This includes, but is not limited to, phospholipids such as those listed in (1996, 277:923-937).

[0137] Some embodiments of compositions comprising a C3 dsRNA reagent, a C3 antisense polynucleotide, and / or a C3 sense polynucleotide may include ligands that alter the properties of the C3 dsRNA reagent, such as its distribution and targeting. In some embodiments of compositions comprising the C3 dsRNA reagent of the present invention, the ligands increase affinity to selected targets (e.g., molecules, cells or cell types, compartments, e.g., cell or organ compartments, tissues, organs or body regions) compared to species in which such ligands are absent. Ligands useful in the compositions and / or methods of the present invention may be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, amylopectin, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands may also be synthetic polymers, such as recombinant or synthetic components of synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-coglycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptide-mimicking polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.

[0138] Ligands included in the compositions and / or methods of the present invention may include target groups, non-limiting examples of which are cell or tissue targeting agents such as lectins, glycoproteins, lipids or proteins, antibodies that bind to specific cell types such as renal cells or hepatocytes. Target groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamates, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0139] Other examples of ligands include dyes, intercalators (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3- (Oleoyl) lithocholic acid, O3-(oleoyl)cholic acid, dimethoxytrityl chloride group or phenoxazine and peptide conjugate (e.g., Antenna peptide, Tat peptide), alkylating agents, phosphates, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole coupling, Eu of the tetraazal macrocycle) 3+ It contains a complex, dinitrophenyl group, HRP, or AP.

[0140] The ligands included in the compositions and / or methods of the present invention may be proteins such as glycoproteins, peptides such as molecules having a specific affinity for coligands, or antibodies such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, cardiac cells, or osteocytes). Ligands useful in the embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Ligands useful in the embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, or polyvalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention may be substances that can increase the entry of C3 dsRNA agents into cells by, for example, disrupting the cytoskeleton of cells, such as by disrupting microtubules, microfilaments, and / or intermediate filaments of cells. Non-exclusive examples of this type of drug include Taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlaquinolide, latranculine A, phalloidin, swinford A, indanosine, and myoserbine.

[0141] In some embodiments, ligands linked to the C3 dsRNA reagent function as pharmacokinetic (PK) modifiers. Examples of PK modifiers usable in the compositions and methods of the present invention include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, bile acids, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and aptamers that bind to serum proteins. Furthermore, since oligonucleotides containing a large number of phosphorothioate bonds are known to be able to bind to serum proteins, short oligonucleotides containing multiple phosphorothioate bonds in their backbone (e.g., oligonucleotides with about 5, 10, 15, or 20 bases) can also be used as ligands in the compositions and / or methods of the present invention.

[0142] C3 dsRNA formulation In some embodiments of the present invention, the C3 dsRNA agent is present in the composition. The composition of the present invention may include one or more C3 dsRNA agents and one or more optionally pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. According to some embodiments of the methods of the present invention, a non-limiting example of a potentially useful targeting agent is a targeting agent that guides the C3 dsRNA agent of the present invention to cells to be treated. The selection of the targeting agent depends on factors such as the nature of the C3-related disease or disorder and the cell type to be targeted. In non-limiting examples, in some embodiments of the present invention, it may be desirable to guide the C3 dsRNA agent to hepatocytes. In some embodiments of the methods of the present invention, the therapeutic agent should be understood to include a C3 dsRNA agent having only a delivery agent, without any additional elements, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, the C3 dsRNA reagent may be included in a composition containing a delivery compound comprising GalNAc and a pharmaceutically acceptable carrier, and may be administered to cells or subjects without any detectable label or targeting agent linked to the C3 dsRNA reagent.

[0143] When the C3 dsRNA reagent of the present invention is administered and / or ligated thereto with one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will be able to recognize, select, and use appropriate reagents for use in the methods of the present invention. In some methods of the present invention, the location of the C3 dsRNA reagent in cells and tissues can be determined using a labeling reagent, and can be used in the methods of the present invention to determine the location of cells, tissues, or organs to which a therapeutic composition containing the C3 dsRNA reagent has been administered. Means of attaching and using labeling reagents, such as enzyme labeling, dyes, and radiolabeling, are known in the art. In some embodiments of the compositions and methods of the present invention, it should be understood that the labeling reagent is ligated to one or both of the sense polynucleotides and antisense polynucleotides contained in the C3 dsRNA reagent.

[0144] Delivery of C3 dsRNA agents and C3 antisense polynucleotide agents Some embodiments of the methods of the present invention involve delivering a C3 dsRNA reagent to cells. As used herein, the term “delivery” means promoting or influencing cellular uptake or absorption. Absorption or uptake of the C3 dsRNA reagent may occur by independent diffusion or cell activation processes, or by the use of delivery agents, targeting agents, etc., which may be associated with the C3 dsRNA reagent of the present invention. Delivery methods applied to the methods of the present invention include, but are not limited to, in vivo delivery, such as injecting the C3 dsRNA reagent into a tissue site or administering it systemically. In some embodiments of the present invention, the C3 dsRNA reagent is ligated to a delivery agent.

[0145] Non-exclusive examples of methods usable for delivering C3 dsRNA agents to cells, tissues, and / or subjects include C3 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have successfully delivered therapeutic RNAi agents to treat a variety of diseases and conditions in this field, including, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, and pulmonary fibrosis. Details of various delivery methods can be found in the publications, namely Nikam, RR & KRGore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018, Springer AD & SFDowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118, Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874, and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, all of which are incorporated herein by reference.

[0146] Some embodiments of the present invention involve delivering the C3 dsRNA agent of the present invention to cells, tissues and / or subjects using lipid nanoparticles (LNPs). LNPs are typically used for in vivo delivery of C3 dsRNA agents, including therapeutic C3 dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the C3 RNA agent is increased when delivered to subjects using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs include cationic LNPs on which one or more C3 RNAi molecules of the present invention are supported. LNPs containing C3 RNAi molecules are administered to a subject, and the LNPs and the C3 RNAi molecules attached to them are taken up by cells via endocytosis, and their presence leads to the release of RNAi-inducing molecules, thereby mediating RNAi.

[0147] In embodiments of the present invention, another non-limiting example of a delivery agent usable for delivering the C3 dsRNA agent of the present invention to cells, tissues and / or subjects is a GalNAc-containing agent that is ligated to the C3 dsRNA agent of the present invention and delivers the C3 dsRNA agent to cells, tissues and / or subjects. An example of an additional GalNAc-containing delivery agent usable in several embodiments of the methods and compositions of the present invention is disclosed in PCT application WO2020191183A1 (which is incorporated herein in its entirety). A non-limiting example of a GalNAc target ligand usable in the compositions and methods of the present invention for delivering the C3 dsRNA agent to cells is a target ligand cluster. Examples of target ligand clusters presented herein are referred to as phosphodiester-linked GalNAc ligands (GLOs) and phosphorothioate-linked GalNAc ligands (GLSs). The term "GLX-n" here refers to the linked GalNAc-containing compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4 This can be used to indicate that it is any one of the compounds GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, of which the structure of each compound is as follows, and below, the attachment position of the GalNAc target ligand and the RNAi agent of the present invention is on the far right of each ligand (" [ka] (As shown in ''). Any RNAi and dsRNA molecule of the present invention should be understood to be able to be linked to GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, and the structures of GLO-1~GLO-16 and GLS-1*~GLS-16* are as follows. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4]

[0148] In some embodiments, the isomannitol nucleotide may be further conjugated to one or more GalNAc target ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc target ligands are: [ka] This includes, but is not limited to, the terms "olig" each independently refer to the polynucleotide portion.

[0149] In some embodiments of the present invention, in vivo delivery may be carried out by a β-dextran delivery system, for example, as described in U.S. Patents 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. Furthermore, C3 RNAi agents can be introduced into cells in vitro using methods known in the art (e.g., electroporation and lipofection). In some embodiments of the methods of the present invention, C3 dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. In non-limiting examples, the C3 dsRNA of the present invention can be administered to a subject in the form of a pharmaceutical composition containing an RNAi agent but without a targeting agent (e.g., a GalNAc target compound) to treat a C3-related disease or condition (e.g., cardiovascular disease) in the subject.

[0150] It should be understood that, in addition to certain delivery methods described herein, RNAi delivery methods (e.g., methods described herein and methods used in the art) can be used in combination with embodiments of C3 RNAi agents and therapeutic methods described herein.

[0151] The C3 dsRNA agents of the present invention can be administered to a subject in an amount and manner that effectively reduces the level and activity of C3 polypeptides in cells and / or subjects. In some embodiments of the methods of the present invention, one or more C3 dsRNA agents are used in cells and / or subjects to treat diseases or conditions related to C3 expression and activity. In some embodiments, the methods of the present invention include using one or more C3 dsRNA agents in subjects requiring such treatment to reduce diseases or conditions related to C3 expression in subjects. The C3 dsRNA agents or C3 antisense polynucleotide agents of the present invention can be administered to reduce C3 expression and / or activity in one or more in vitro, ex vivo, and in vivo cells.

[0152] In some embodiments of the present invention, the level of C3 polypeptide in cells is reduced by delivering (e.g., introducing) a C3 dsRNA agent or a C3 antisense polynucleotide agent to cells, thereby reducing its activity. Targeting agents and methods can be used to help deliver the C3 dsRNA agent or C3 antisense polynucleotide agent to specific cell types, cell subtypes, organs, spatial regions and / or intracellular subcellular regions in a subject. In some methods of the present invention, the C3 dsRNA agent can be administered alone or in combination with one or more additional C3 dsRNA agents. In some embodiments, two, three, four or more independently selected C3 dsRNA agents are administered to the subject.

[0153] In some embodiments of the present invention, the C3 dsRNA agent is administered to a subject in combination with one or more additional therapeutic regimens for treating a C3-related disease or condition. Non-limiting examples of additional therapeutic regimens include the administration of one or more C3 antisense polynucleotides of the present invention, the administration of non-C3 dsRNA therapeutic agents, and behavioral changes. The additional therapeutic regimens may be administered before, concurrently with, and at one or more time points after the administration of the C3 dsRNA agent of the present invention. As used herein, “concurrent” refers to within 5 minutes, 10 minutes, 30 minutes, 45 minutes, and 60 minutes from zero time, where “zero time” should be understood as the time at which the subject is administered the C3 dsRNA reagent of the present invention. Non-C3 dsRNA therapeutic agents are non-exclusive examples of C5 inhibitors, such as anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimub (REGN3918)) or C5 peptide inhibitors (e.g., Zircoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that specifically binds to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of terminal complement complex C5b-9. Rabulizumab-cwvz is a humanized monoclonal IgG2 / 4 antibody that specifically binds to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the formation of terminal complement complex C5b-9. Pozelimab (also known as H4H12166P, described in US20170355757) is a fully human IgG4 monoclonal antibody intended to block complement factor C5. Zircoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolecular affinity and allosterically inhibits its cleavage to C5a and C5b after activation of the classical, alternative, or lectin pathways. Preferably, the additional therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is compstatin. Compstatin is a cyclic tridecapeptide with potent and selective C3 inhibitory activity.These and other therapeutic agents and behavioral alterations are known in the art and have been used to treat C3-related diseases or conditions in subjects, and can be administered to subjects in combination with one or more C3 dsRNA agents of the present invention to treat C3-related diseases or conditions. The C3 dsRNA agents of the present invention, administered to cells or subjects to treat C3-related diseases or conditions, can function synergistically with one or more other therapeutic agents or activities, enhance the efficacy of one or more therapeutic agents or activities, and / or enhance the efficacy of treating C3-related diseases or conditions with the C3 dsRNA agents.

[0154] The therapeutic method of the present invention comprises the administration of a C3 dsRNA agent and can be used before the onset of a C3-related disease or disorder and / or during the presence of a C3-related disease or disorder, including the early, middle, and late stages of the disease or disorder, as well as all time before and after these stages. The method of the present invention can be further used to treat subjects who have previously been treated with one or more other therapeutic agents and / or therapeutic activities for a C3-related disease or disorder, provided that these therapeutic agents and / or therapeutic activities have failed to treat the subject's C3-related disease or disorder, with a very low success rate, and / or have not been successful again.

[0155] dsRNA encoded by the vector In some embodiments of the present invention, a C3 dsRNA reagent can be delivered to cells using a vector. The transcription units of the C3 dsRNA reagent may be contained in a DNA or RNA vector. The manufacture and use of such vectors encoding genetic recombination for delivering sequences to cells and / or subjects is known in the art. In the methods of the present invention, a vector that results in transient expression of C3 dsRNA can be used, for example, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more, or for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The length of transient expression can be determined using a general method based on factors such as a selected specific vector construct and target cells and / or tissues, but not limited thereto. Such genetic recombination can be introduced as a linear construct, circular plasmid, or viral vector, which may be an integrated or non-integrated vector. Genetic recombination can also be constructed to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0156] The single-stranded or multi-stranded C3 dsRNA agent can be transcribed from a promoter in an expression vector. For example, when expressing two individual strands to produce dsRNA, two individual expression vectors can be co-introduced into cells using methods such as transfection or infection. In some embodiments of the present invention, each individual strand of the C3 dsRNA agent can be transcribed by a promoter contained in the same expression vector. In some embodiments of the present invention, the C3 dsRNA agent is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence such that the C3 dsRNA agent has a stem-loop structure.

[0157] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. Expression vectors useful in the embodiments of the present invention may be compatible with eukaryotic cells. Eukaryotic cell expression vectors are commonly used in the art and are available from many commercial sources. Delivery of the C3 dsRNA expression vector may be systemic, for example, by intravenous or intramuscular administration to target cells isolated from the subject and then reintroduced into the subject's body, or by any other method that enables introduction into desired target cells.

[0158] The viral vector systems included in embodiments of the method include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors including, but not limited to, lentivirus vectors, Moloney's mouse leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors, e.g., orthopoxvirus vectors or avipoxvirus vectors, e.g., canarypoxvirus vectors or foulpoxvirus vectors, and (j) helper-dependent or enteric-free adenovirus vectors. Constructs used for recombinant expression of C3 dsRNA agents may include selectable regulators such as promoters and enhancers to provide constitutive or regulatory / inducible expression. The use of viral vector systems, promoters and enhancers is a common technique in the art and can be used in combination with the methods and compositions described herein.

[0159] Some embodiments of the present invention involve delivering a C3 dsRNA agent into cells using a viral vector. In the art, various adenovirus-based delivery systems are commonly used for delivery to the lungs, liver, central nervous system, endothelial cells, and muscles, among others. Non-limiting examples of viral vectors that can be used in the methods of the present invention include AAV vectors, poxviruses (e.g., vaccinia virus), modified Ankara virus (MVA), NYVAC, and AviPox (e.g., FoulPox or CanaryPox).

[0160] Some embodiments of the present invention include a method for delivering a C3 dsRNA agent to cells using a vector, wherein such a vector may be located in a pharmaceutically acceptable carrier, which may, but does not have to, include a sustained-release matrix into which the gene delivery vector is embedded. In some embodiments, the vector for delivering C3 dsRNA can be produced from recombinant cells, and the pharmaceutical composition of the present invention may include one or more cells that produce a C3 dsRNA delivery system.

[0161] Pharmaceutical composition of C3 dsRNA or ssRNA drug Some embodiments of the present invention involve the use of a pharmaceutical composition containing a C3 dsRNA agent or a C3 antisense polynucleotide agent and a pharmaceutically acceptable carrier. A pharmaceutical composition containing a C3 dsRNA agent or a C3 antisense polynucleotide agent can be used in the methods of the present invention to reduce C3 gene expression and C3 activity in cells, and can be used to treat C3-related diseases or conditions. Such pharmaceutical compositions can be prepared according to the method of administration. Non-limiting examples of formulations for delivery methods include compositions prepared for subcutaneous delivery, compositions prepared for systemic administration by parenteral delivery, compositions prepared for intravenous (IV) delivery, compositions prepared for intrathecal delivery, and compositions prepared for direct delivery into the brain. Administration of the pharmaceutical compositions of the present invention to deliver a C3 dsRNA agent or a C3 antisense polynucleotide agent to cells can be carried out by one or more methods, including, for example, topical (e.g., by a transdermal patch), intrapulmonary, intranasal, epidermal and transdermal, oral or parenteral, by inhalation or blowing of powder or aerosol formulations, including by a sprayer. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, subcutaneous administration such as via implantation devices, or intracranial, intrathecal, or intraventricular administration such as within the brain parenchyma. C3 dsRNA agents or C3 antisense polynucleotide agents can also be delivered directly to target tissues, such as by direct delivery to the liver or direct delivery to the kidneys. "Delivery of C3 dsRNA agents" or "delivery of C3 antisense polynucleotide agents" to cells should be understood to include direct delivery of C3 dsRNA agents or C3 antisense polynucleotide agents, expression of C3 dsRNA agents in cells from a coding vector delivered intracellularly, or the presence of C3 dsRNA or C3 antisense polynucleotide agents in cells by any appropriate method, respectively. The preparation and use of formulations and means for delivering suppressor RNA are known and commonly used in the art.

[0162] As used herein, “pharmaceutical composition” comprises a pharmacokinetically effective amount of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term explicitly excludes cell culture media. For orally administered drugs, a pharmaceutically acceptable carrier includes, but is not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If necessary, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The drugs contained in the drug formulation are further described below.

[0163] As used herein, terms such as “pharmacologically effective dose,” “therapeutic effective dose,” and “effective dose” refer to the amount of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention that produces the expected pharmacological, therapeutic, or prophylactic effect. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutic effective dose of the agent for treating the disease or condition is the amount required to reduce that parameter by at least 10%. For example, the therapeutic effective dose of a C3 dsRNA agent or C3 antisense polynucleotide agent can reduce C3 polypeptide levels by at least 10%.

[0164] Effective amount In some embodiments, the method of the present invention involves contacting cells with an effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent to reduce C3 gene expression in the cells being contacted. Some embodiments of the method of the present invention involve administering an effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent to a subject in order to reduce C3 gene expression in the subject and to treat a C3-related disease or condition in the subject. The “effective amount” for reducing C3 expression and / or treating a C3-related disease or condition is the amount necessary or sufficient to achieve the desired biological effect. For example, the effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent for treating a C3-related disease or condition may be the amount necessary to (i) slow or halt the progression of the disease or condition, and (ii) reverse, reduce or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, the effective amount is the amount of the C3 dsRNA reagent or C3 antisense polynucleotide agent that, when administered to a subject requiring treatment for a C3-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. According to some aspects of the present invention, the effective amount is the amount of the C3 dsRNA reagent or C3 antisense polynucleotide agent of the present invention that, when combined with or in combination with another therapeutic treatment for a C3-related disease or condition, produces a therapeutic response to prevent and / or treat the disease or condition. In some embodiments of the present invention, the biological effect of treating a subject with the C3 dsRNA reagent or C3 antisense polynucleotide agent of the present invention may be improvement and / or complete elimination of symptoms caused by a C3-related disease or condition. In some embodiments of the present invention, the biological effect is the complete elimination of a C3-related disease or condition, as demonstrated, for example, by a diagnostic test indicating that the subject does not have a C3-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in lipid accumulation in the liver of a subject after administration of the reagent of the present invention. Other methods known in the art for evaluating the state of C3-related diseases or conditions can be used to determine the effect of the reagents and / or methods of the present invention on C3-related diseases or conditions.

[0165] Typically, clinical trials determine the effective dose of a C3 dsRNA reagent or C3 antisense polynucleotide agent that reduces C3 polypeptide activity to a level that treats C3-related diseases or conditions. Such clinical trials, conducted in blinded studies, establish effective doses for both the test and control populations. In some embodiments, the effective dose is the amount that elicits the desired response, for example, the amount that reduces C3-related diseases or conditions in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, the effective dose of a C3 dsRNA reagent or C3 antisense polynucleotide agent for treating C3-related diseases or conditions that can be treated by reducing C3 polypeptide activity may be the amount that, when administered, reduces the amount of C3 polypeptide activity in the subject to a level lower than that present in cells, tissues, and / or the subject when the C3 dsRNA reagent or C3 antisense polynucleotide agent is not administered. In some embodiments of the present invention, the level of C3 polypeptide activity and / or C3 gene expression present in cells, tissues, and / or subjects that have not been contacted with or administered the C3 dsRNA reagent or C3 antisense polynucleotide agent of the present invention is referred to as the “control” level. In some embodiments of the method of the present invention, the control level of the subject is the pre-treatment level of the subject, in other words, the level in the subject before administration of the C3 agent may be the control level of the subject and is used to compare with the level of C3 polypeptide activity and / or C3 gene expression after administration of siRNA to the subject. When treating a C3-related disease or condition, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in the cells, tissues, and / or subject. The reduction or elimination may be temporary or permanent. It should be understood that the state of a C3-related disease or condition can be monitored using methods such as determining C3 polypeptide activity, C3 gene expression, evaluating symptoms, and clinical trials. In some embodiments of the present invention, the desired response to the treatment of C3-related diseases or conditions is the delay of the onset of the disease or condition, or even the prevention of the onset of the disease or condition.

[0166] The effective amount of a compound that reduces C3 polypeptide activity can also be determined by evaluating the physiological effects on cells or subjects upon administration of the C3 dsRNA agent or C3 antisense polynucleotide agent, for example, the reduction of C3-related disease or symptoms after administration. Measurement and / or monitoring of symptoms in subjects can be used to determine the efficacy of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention, which can be administered in the form of the drug compound of the present invention, and to determine whether there is an effect on treatment. In one non-limiting example, the related disease is paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease including acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and a tendency to form blood clots. In another non-limiting example, the state of C3-related lipid imbalance in subjects can be determined by one or more liver function tests known in the art before and after treatment of subjects with the C3 dsRNA agent of the present invention.

[0167] Some embodiments of the present invention include a method for determining the therapeutic effect of a dsRNA agent or C3 antisense polynucleotide agent of the present invention administered to a subject, the method of which is determined by evaluating and / or monitoring one or more "physiological features" of a C3-related disease or condition in the subject. Non-limiting examples of physiological features of a C3-related disease or condition are C3 mRNA levels, C3 protein levels. Standard methods for determining such physiological features are known in the art and include, but are not limited to, blood tests, imaging studies, and health checkups.

[0168] It should be understood that the amount of C3 dsRNA or C3 antisense polynucleotide administered to a subject can be adjusted, at least in part, based on the results of measurements of the subject's disease and / or pathological state and / or physiological characteristics. The therapeutic dose can be changed, for example, by increasing or decreasing the amount of C3 dsRNA or C3 antisense polynucleotide administered, for example, by changing the composition of the C3 dsRNA or C3 antisense polynucleotide administered, changing the route of administration, changing the time of administration, etc. The effective dose of C3 dsRNA or C3 antisense polynucleotide varies depending on the specific disease being treated, the age and physical condition of the subject being treated, the severity of the disease, the duration of treatment, the nature of concurrent treatment (if any), the specific route of administration, and other factors within the scope of the healthcare professional's knowledge and expertise. For example, the effective dose may depend on the required level of C3 peptide activity and / or C3 gene expression that is effective in treating C3-related diseases or symptoms. Those skilled in the art can empirically determine the effective amount of a particular C3 dsRNA reagent or C3 antisense polynucleotide agent used in the method of the present invention without performing excessive experiments. In accordance with the teachings provided herein, an effective prophylactic or therapeutic treatment plan can be designed to effectively treat a particular subject by selecting from the various C3 dsRNA reagents or C3 antisense polynucleotide agents of the present invention and making trade-offs of factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred administration method. As used in embodiments of the present invention, the effective amount of the C3 dsRNA reagent or C3 antisense polynucleotide agent of the present invention may be the amount that, upon contact with the cell, produces the desired biological effect on the cell.

[0169] It should be recognized that C3 gene silencing can be determined in any cell expressing C3, whether constitutively or by genomic engineering, and by any appropriate measurement. In some embodiments of the present invention, C3 gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% by administration of the C3 dsRNA agent of the present invention. In some embodiments of the present invention, C3 gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100% by administration of the C3 dsRNA agent of the present invention.

[0170] Administration C3 dsRNA agents and C3 antisense polynucleotide agents are delivered in a pharmaceutical composition at a dose sufficient to inhibit C3 gene expression. In some embodiments of the present invention, the dose of the C3 dsRNA agent or C3 antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kilogram of body weight per day of the recipient, and is generally in the range of 1 to 50 mg per kilogram of body weight per day, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight (including the extreme values). For example, C3 The single doses for dsRNA drugs or C3 antisense polynucleotides are approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, and 1 mg / kg. .9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9m g / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6m g / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / k g, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5m g / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg The dosage can also be in kg, or 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg to 50 mg / kg per kilogram of body weight.

[0171] Various factors can be considered when determining the dose and administration time of the C3 dsRNA agent of the present invention. The absolute amount of the C3 dsRNA agent or C3 antisense polynucleotide agent administered depends on various factors, including concurrent treatment, dose quantity, and parameters of the individual subject, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved by conventional experiments alone. In some examples, the maximum dose, i.e., the safest dose based on reasonable medical judgment, can be used.

[0172] In some embodiments, the method of the present invention may comprise administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a C3 dsRNA agent or a C3 antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., comprising a C3 dsRNA agent or comprising a C3 antisense polynucleotide agent) can be administered to the subject at least daily, every other day, weekly, every other week, monthly, or the like. The dose can be administered once per day or multiple times per day, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention can be administered once per day, alternatively, the C3 dsRNA agent or C3 antisense polynucleotide agent can be administered in two, three or more subdoses at appropriate intervals throughout a day, or can even be delivered using continuous infusion or through a sustained release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention is administered to a subject once or multiple times per day, once or multiple times per week, once or multiple times per month, or once or multiple times per year.

[0173] In some embodiments, the methods of the present invention include the administration of a drug compound alone, in combination with one or more other C3 dsRNA reagents or C3 antisense polynucleotides, and / or in combination with other drug therapies or therapeutic activities or schemes administered to subjects suffering from C3-related diseases or conditions. The drug compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may contain a sterile, fixed amount of a C3 dsRNA reagent or C3 antisense polynucleotide that reduces the activity of the C3 polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to a subject. The dose of the pharmaceutical composition containing the C3 dsRNA reagent or C3 antisense polynucleotide administered to a subject to reduce C3 protein activity may be selected based on different parameters, in particular, the method of administration used and the condition of the subject. Other factors include the desired treatment time. If the subject's response to the initial dose is insufficient, a higher dose may be used (or the dose may be effectively increased by a different, more localized delivery route) within the patient's tolerance tolerance.

[0174] treatment As used herein, "C3-related disease", "C3-related diseases and conditions", and "diseases or conditions caused and / or regulated by C3" are intended to include any disease associated with the C3 gene or protein. Such diseases may be caused by, for example, overproduction of C3 protein, mutation of the C3 gene, abnormal cleavage of C3 protein, or abnormal interaction between C3 and other proteins or other endogenous or exogenous substances. Exemplary C3-related diseases include, but are not limited to, C3 glomerulopathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), anti-neutrophil cytoplasmic antibody-associated vasculitis (ANCA-AV), dysbiotic periodontal disease, malarial anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

[0175] In some embodiments of the present invention, a subject is administered the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention at one or more time points before or after a C3-related disease or condition. In some embodiments of the present invention, the subject has or is at risk of developing a C3-related disease or condition. A subject at risk of developing a C3-related disease or condition is a subject whose likelihood of developing a C3-related disease or condition is increased compared to a control risk of developing a C3-related disease or condition. In some embodiments of the present invention, the risk level may be statistically significant compared to a control risk level. Subjects at risk may include, for example, subjects with pre-existing diseases and / or genetic abnormalities that make them more susceptible to C3-related disease or condition compared to a control subject without pre-existing diseases or genetic abnormalities, subjects with a family history and / or personal history of C3-related disease or condition, and subjects who have previously received or will receive treatment for a C3-related disease or condition. Pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to C3-related disease or disorder should be understood to be diseases or genetic abnormalities that, if present, have been previously determined to be associated with a higher likelihood of developing C3-related disease or disorder.

[0176] It should be understood that a subject may be administered a C3 dsRNA agent or a C3 antisense polynucleotide agent based on the medical status of the individual subject. For example, the healthcare provider to a subject may evaluate the C3 level measured in a sample obtained from the subject and determine that it is desirable to reduce the subject's C3 level by administering the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention. In this example, even if the subject has not been diagnosed with a C3-related disease (e.g., a disease disclosed herein), the C3 level may be considered a physiological characteristic of a C3-related disease. The healthcare provider may monitor changes in the subject's C3 level as a criterion for measuring the effectiveness of the administered C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention. In non-limiting examples, a biological sample (e.g., blood or serum sample) may be obtained from the subject, and the subject's C3 level may be determined in the sample. A C3 dsRNA agent or a C3 antisense polynucleotide agent is administered to a subject, and a blood sample is obtained from the subject after administration. The C3 level is determined using this sample, and the result is compared to the result determined in a sample taken before administration to the subject. A reduction in the subject's C3 level in the later sample compared to the pre-administration level indicates that the administered C3 dsRNA agent or C3 antisense polynucleotide agent is effective in reducing the subject's C3 level.

[0177] Some embodiments of the methods of the present invention include a modulated therapy, which involves administering the subject a dsRNA agent or C3 antisense polynucleotide agent of the present invention, at least in part on an assessment of changes in one or more physiological characteristics of a C3-related disease or condition caused by treating the subject. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or C3 antisense polynucleotide agent of the present invention on the subject can be determined and used to assist in adjusting the amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention administered to the subject later. In one non-limiting example, the subject is administered the dsRNA agent or C3 antisense polynucleotide agent of the present invention, the subject's C3 level is measured after administration, and at least in part on the measured level, the dose of the dsRNA agent or C3 antisense polynucleotide agent required to increase the physiological effect of the administered reagent, for example, to reduce or further reduce the subject's C3 level. In yet another non-limiting example, it is necessary to administer the dsRNA agent or C3 antisense polynucleotide agent of the present invention to a subject, measure the subject's C3 level after administration, and administer a relatively low amount of the dsRNA agent or C3 antisense polynucleotide agent to the subject, at least in part, based on the measured level.

[0178] Accordingly, some embodiments of the present invention include evaluating changes in one or more physiological characteristics caused by the subject's prior treatment in order to adjust the amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention administered to the subject later. Some embodiments of the method of the present invention include measuring the physiological characteristics of a C3-related disease or condition one, two, three, four, five, six or more times to evaluate and / or monitor the effectiveness of the administered C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention, and optionally using these measurement results to adjust one or more of the dose, administration scheme and / or frequency of the dsRNA agent or C3 antisense polynucleotide agent of the present invention to treat a C3-related disease or condition in a subject. In some embodiments of the method of the present invention, the desired result of administering an effective amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention to a subject is a reduction in the subject's C3 mRNA level and / or C3 protein level. Paroxysmal nocturnal hemoglobinuria (PNH) is a relatively rare disease that includes acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, physiological features of hemoglobinuria, bone marrow failure, and a tendency to form blood clots.

[0179] As used herein, when used in relation to C3-related disease or condition, the terms “to treat,” “treated,” or “being treated” may refer to prophylactic treatment that reduces the likelihood of a subject developing a C3-related disease or condition, or to treatment performed after a subject has developed a C3-related disease or condition to eliminate or reduce the level of the C3-related disease or condition, to prevent the C3-related disease or condition from becoming more severe (e.g., more severe), and / or to reduce C3 peptide activity in the subject, in order to delay the progression of the C3-related disease or condition in the subject compared to a subject that has not received such treatment.

[0180] Some embodiments of the agents, compositions, and methods of the present invention can be used to inhibit C3 gene expression. In this specification, with respect to C3 gene expression, the terms “inhibition,” “silencing,” “reduction,” “downregulation,” and “knockdown” refer to altering C3 gene expression by one or more circumstances, such as when a cell, cell population, tissue, organ, or subject comes into contact with (e.g., is treated with) the C3 dsRNA reagent or C3 antisense polynucleotide agent of the present invention, compared to, for example, a control level of RNA transcribed by the C3 gene, a control level of expressed C3 activity, or a control level of C3 translated from mRNA, respectively, resulting in a reduction in the level of RNA transcribed by the gene, the level of expressed C3 activity, and the level of C3 polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject. In some embodiments, the control level is the level in a cell, tissue, organ, or subject that has not come into contact with (e.g., been treated with) the C3 dsRNA reagent or C3 antisense polynucleotide agent.

[0181] Method of administration Multiple routes of administration of C3 dsRNA agents or C3 antisense polynucleotide agents can be used in the methods of the present invention. The specific method of administration selected depends at least in part on the specific disease being treated and the dose required for the therapeutic effect. Generally, the methods of the present invention can be carried out by any medically acceptable method of administration, i.e., any method that can produce an effective therapeutic level for C3-related diseases or conditions without causing clinically unacceptable side effects. In some embodiments of the present invention, C3 dsRNA agents or C3 antisense polynucleotide agents can be administered orally, intraintestinally, mucosally, subcutaneously and / or parenterally. The term "parenterally" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a nasogastric tube), cutaneous, vaginal, rectal, sublingual and inhalation. The delivery routes of the present invention may include intrathecal, ventricular or intracranial. In some embodiments of the present invention, a C3 dsRNA agent or a C3 antisense polynucleotide agent can be administered by placing it on a sustained-release matrix and placing the matrix in the body of a subject. In some embodiments of the present invention, a C3 dsRNA agent or a C3 antisense polynucleotide agent can be delivered to subject cells using nanoparticles coated with a delivery agent that targets specific cells or organelles. Various delivery means, methods, and agents are known in the art. Other parts of this specification further provide non-limiting examples of delivery methods and delivery agents. In some embodiments of the present invention, the term “delivery” with respect to C3 dsRNA agents or C3 antisense polynucleotide agents may refer to administering one or more “naked” C3 dsRNA agent or C3 antisense polynucleotide agent sequences to cells or subjects, and in certain embodiments of the present invention, “delivery” may refer to administering to cells or subjects by transfection means, delivering cells containing the C3 dsRNA agent or C3 antisense polynucleotide agent to subjects, delivering vectors encoding the C3 dsRNA agent or C3 antisense polynucleotide agent to cells and / or subjects, etc.The delivery of a C3 dsRNA agent or a C3 antisense polynucleotide agent using transfection means may include administering the vector to cells and / or subjects.

[0182] In some methods of the present invention, one or more C3 dsRNA agents or C3 antisense polynucleotide agents may be administered in the form of a formulation, which may be administered in the form of a pharmaceutically acceptable solution, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optional other therapeutic components. In some embodiments of the present invention, the C3 dsRNA agent or C3 antisense polynucleotide agent may be prepared together with another therapeutic agent for co-administration. According to the methods of the present invention, the C3 dsRNA agent or C3 antisense polynucleotide agent may be administered in the form of a pharmaceutical composition. Generally, the pharmaceutical composition comprises the C3 dsRNA agent or C3 antisense polynucleotide agent and an optional pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the efficacy of the biological activity of the active ingredient (e.g., the ability of a C3 dsRNA agent or C3 antisense polynucleotide agent to inhibit C3 gene expression in cells or subjects). Various methods for administering and delivering dsRNA agents or C3 antisense polynucleotide agents used for therapeutic purposes are known in the art and can be used in the methods of the present invention.

[0183] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are well known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and other optional therapeutic agents. While salts are pharmaceutically acceptable when used in drugs, pharmaceutically unacceptable salts can be suitably used in the production of their pharmaceutically acceptable salts and are not excluded from the scope of the present invention. Such pharmacokinetic and pharmaceutically acceptable salts include, but are not limited to, salts produced from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Furthermore, pharmaceutically acceptable salts can be produced as alkali metal salts or alkaline earth salts, such as sodium salts, potassium salts, or calcium salts.

[0184] Some embodiments of the methods of the present invention involve directly administering one or more C3 dsRNA agents or C3 antisense polynucleotide agents to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which C3-related disease or pathology is present or likely to develop, a non-limiting example being the heart. Direct administration to tissue can be achieved by direct injection or by other means. Many orally delivered compounds naturally reach and pass through the liver and kidneys, and some embodiments of the therapeutic methods of the present invention involve orally administering one or more C3 dsRNA agents to a subject. The C3 dsRNA agents or C3 antisense polynucleotide agents can be administered in a single dose or in multiple doses, whether administered alone or in combination with other therapeutic agents. In the case of multiple doses, the C3 dsRNA agents or C3 antisense polynucleotide agents can be administered by different routes. For example, though not intended to be limiting, the initial (or first few) doses may be administered subcutaneously, and one or more additional doses may be administered orally and / or systemically.

[0185] In embodiments of the present invention requiring systemic administration of a C3 dsRNA drug or a C3 antisense polynucleotide, the C3 dsRNA drug or C3 antisense polynucleotide can be prepared for parenteral administration by injection, for example, bolus injection or continuous infusion. The injectable formulation may exist in unit dosage forms such as ampoules or multi-dose containers, and may or may not contain preservatives. The C3 dsRNA drug formulation (also called a pharmaceutical composition) may take the form of a suspension, solution or emulsion on an oily or aqueous carrier, and may contain preparing agents such as suspending agents, stabilizers and / or dispersants.

[0186] Parenteral formulations include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and a buffer medium. Parenteral carriers include sodium chloride solution, ringer's dextrose, glucose and sodium chloride solution, lactated ringer's solution, or non-volatile oils. Intravenous carriers include liquids and nutritional supplements, electrolyte supplements (e.g., supplements based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may be present. Doses for other forms of administration (e.g., intravenous administration) are relatively low. If the subject's response to the initial dose is insufficient, a higher dose may be used within the patient's tolerance range (or the dose may be effectively increased by a different, more localized delivery route). If necessary, multiple doses can be administered daily to achieve appropriate systemic or local levels of one or more C3 dsRNA agents or C3 antisense polynucleotide agents, and to achieve appropriate reduction of C3 protein activity.

[0187] In other embodiments, the method of the present invention includes using a delivery carrier, for example, biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a test subject). An example of a bioerosive implant that may be useful by the method is described in PCT publication number WO95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for housing biomacromolecules.

[0188] In the method of the present invention, one or more C3 dsRNA agents or C3 antisense polynucleotide agents can be delivered to a subject using non-biodegradable and biodegradable polymer matrices. In some embodiments, the matrix may be biodegradable. The matrix polymer may be natural or synthetic. The polymer can be selected depending on the period for which release is required, typically from a few hours to one year or longer. Typically, release times from a few hours to 3 to 12 months can be used. The polymer is optionally in the form of a hydrogel capable of absorbing up to about 90% of its weight in water, and further optionally, crosslinked with polyvalent ions or other polymers.

[0189] In general, in some embodiments of the present invention, C3 dsRNA agents or C3 antisense polynucleotide agents can be delivered by diffusion using bioerosive implants or by degradation of a polymer matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver C3 dsRNA agents or C3 antisense polynucleotide agents by methods known in the art. Bioadhesive polymers such as bioerosive hydrogels (see HSSawhney, CPPathak and JAHubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used to deliver C3 dsRNA agents or C3 antisense polynucleotide agents to treat C3-related diseases or conditions. Other suitable delivery systems may include timed release, delayed release, or gradual delivery systems. Such systems can avoid repeated administration of C3 dsRNA agents or C3 antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare providers. Many types of discharge delivery systems are available and known to those skilled in the art. (See, for example, U.S. Patents 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974 and 5,407,686 (the teachings of each patent are incorporated herein by reference)). Furthermore, pump-based hardware delivery systems, some of which are applicable to implantation, can be used.

[0190] The use of long-acting sustained-release implants is suitable for prophylactic treatment of subjects and may also be suitable for subjects at risk of recurrent C3-related disease or condition. As used herein, long-acting release refers to constructing and positioning an implant to deliver therapeutic levels of C3 dsRNA or C3 antisense polynucleotide agents over periods of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or longer. Long-acting sustained-release implants are well known to those skilled in the art and include some of the release systems described above.

[0191] Therapeutic formulations of C3 dsRNA agents or C3 antisense polynucleotide agents can be prepared for storage by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions [Remington's Pharmaceutical Sciences]. 21[Edition, (2006)]. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dose and concentration used, and include buffers such as phosphates, citrates, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (e.g., benzyldimethylstearylammonium chloride hydrate, hexamethonium, benzalkonium chloride, benzethonium chloride, phenol, butanol, or benzyl alcohol, alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol), and low molecular weight (less than about 10 residues). This includes polypeptides, proteins such as serum albumin, gelatin, or immunoglobulin, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose, or sorbitol, salt-forming counterions such as sodium, metal complexes (e.g., Zn-protein complexes), and / or nonionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0192] Cells, subjects, and controls The methods of the present invention can be used in combination with cells, tissues, organs and / or subjects. In some embodiments of the present invention, the subjects are humans or vertebrate mammals, including but not limited to dogs, cats, horses, cattle, goats, mice, rats and monkeys. Accordingly, the present invention can be used for the treatment of C3-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subjects may be farm animals, zoo animals, domesticated animals or non-domesticated animals, and the methods of the present invention can be used in veterinary preventive and therapeutic schemes. In some embodiments of the present invention, the subjects are humans, and the methods of the present invention can be used in human preventive and therapeutic schemes.

[0193] Non-limiting examples of subjects to which the present invention is applicable include subjects diagnosed as suffering from, suspected of suffering from, or at risk of suffering from a disease or condition associated with higher than desired C3 expression and / or activity, which is also referred to as "increased C3 expression level". Non-limiting examples of diseases and conditions associated with higher than expected C3 expression and / or activity are described elsewhere herein. The methods of the present invention can be applied to subjects diagnosed as suffering from a disease or condition associated with higher than desired C3 expression and / or activity at the time of treatment, or subjects considered to be suffering from or at risk of developing a disease or condition associated with higher than desired C3 expression and / or activity. In some aspects of the present invention, the disease or condition associated with higher than desired C3 expression and / or activity is an acute disease or condition, and in some aspects of the present invention, the disease or condition associated with higher than desired C3 expression and / or activity is a chronic disease or condition.

[0194] In one non-limiting example, the C3 dsRNA agent of the present invention is administered to a subject diagnosed as suffering from, suspected of suffering from, or at risk of suffering from statin-resistant hypercholesterolemia, wherein said hypercholesterolemia is a disease for which reduction of C3 expression is required. The methods of the present invention can be applied to subjects diagnosed as suffering from the disease or condition at the time of treatment, or subjects considered to be suffering from or at risk of developing the disease or condition.

[0195] In yet another non-limiting example, the C3 dsRNA agent of the present invention is administered to a subject diagnosed as suffering from, suspected of suffering from, or at risk of suffering from hyperlipidemia, wherein hyperlipidemia is a disease for which reduction of C3 expression is required. The methods of the present invention can be applied to subjects diagnosed as suffering from the disease or condition at the time of treatment, or subjects considered to be suffering from or at risk of developing the disease or condition.

[0196] Cells to which the methods of the present invention can be applied include in vitro, in vivo, and ex vivo cells. The cells may be present in the body of a subject, in a culture, and / or in a suspension, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may also be hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments of the present invention, the cells to which the methods of the present invention can be applied are healthy and normal cells that are not known to be disease cells. In some examples of the present invention, the cells to which the methods and compositions of the present invention can be applied are hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In some embodiments of the present invention, while the control cells are normal cells, it should be understood that in certain cases, cells suffering from disease or illness may be used as control cells, for example, in the results of comparing treated cells suffering from disease or illness with untreated cells suffering from the same disease or illness.

[0197] According to the method of the present invention, the level of C3 polypeptide activity can be measured and compared to a control level of C3 polypeptide activity. The control may be a predetermined value employing various forms. It may be a single cutoff value such as the median or mean. It can be established based on comparison groups such as a group having normal levels of C3 polypeptide and / or C3 polypeptide activity, and a group having increased levels of C3 polypeptide and / or C3 polypeptide activity. Another non-limiting example of the comparison group may be a group having one or more symptoms or diagnoses of a C3-related disease or condition, a group not having one or more symptoms or diagnoses of such disease or condition, a group of subjects treated with the siRNA of the present invention, and a group of subjects not treated with the siRNA of the present invention. Typically, the control may be based on normal individuals or cells that appear healthy in an appropriate age group. In addition to predetermined values, it should be understood that the control according to the present invention may be a material sample tested in parallel with the experimental material. Examples include a sample from a control population, or a control sample produced by manufacturing for simultaneous testing with the experimental sample. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted with or treated with the C3 dsRNA agent of the present invention, in which case the control level of C3 polypeptide and / or C3 polypeptide activity can be compared to the level of C3 polypeptide and / or C3 polypeptide activity in cells or subjects that have been contacted with the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention.

[0198] In some embodiments of the present invention, the level of C3 polypeptide measured in a subject may be a control level and may be compared to the level of C3 polypeptide measured in the same subject at different times. In non-limiting examples, C3 levels are measured in biological samples obtained from subjects who have not received the C3 treatment of the present invention. In some embodiments, the biological sample is a serum sample. The C3 polypeptide level measured in a sample obtained from a subject may be used as a baseline or control value for the subject. In the treatment method of the present invention, after administering a C3 dsRNA agent to a subject once or more times, one or more additional serum samples may be obtained from the subject, and the C3 polypeptide level in the subsequent samples may be compared to the subject's control / baseline level. Such comparisons may be used to assess the onset, progression, or regression of C3-related disease or condition in the subject. For example, if the C3 peptide level in a baseline sample obtained from a subject is higher than the level obtained from the same subject after administration of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention to the same subject, this indicates regression of C3-related disease or condition, and also indicates the efficacy of the administered C3 dsRNA agent of the present invention in treating C3-related disease or condition.

[0199] In some embodiments of the present invention, one or more values ​​at the level of C3 polypeptide and / or C3 polypeptide activity determined for a subject can be used as a control value and subsequently used to compare the level of C3 polypeptide and / or C3 activity in the same subject, thereby enabling the evaluation of changes in the subject's C3 polypeptide activity relative to the "baseline". Accordingly, when the initial level is used as the control level for the subject, the initial C3 polypeptide level and / or initial C3 polypeptide activity level can be used as an indication and / or determination of the level in the subject of the method and compound of the present invention that can reduce the C3 polypeptide and / or C3 polypeptide activity in the subject.

[0200] By using the method of the present invention, the C3 dsRNA agent and / or C3 antisense polynucleotide agent of the present invention can be administered to a subject. The effectiveness of the administration and treatment of the present invention can be evaluated if the level of C3 polypeptide in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, compared to the pre-administration level of C3 polypeptide in a serum sample obtained from the subject at a prior point in time, or compared to a non-contact control level (e.g., compared to the level of C3 polypeptide in the serum sample). It should be understood that both the level of C3 polypeptide and the level of C3 polypeptide activity correlate with the level of C3 gene expression. Some embodiments of the method of the present invention involve administering an effective amount of the C3 dsRNA and / or C3 antisense agent of the present invention to a subject to inhibit C3 gene expression, thereby reducing the level of C3 polypeptide and the level of C3 polypeptide activity in the subject.

[0201] In some embodiments of the present invention, the presence, absence, and / or amount (also referred to herein as level) of C3 polypeptide in a biological sample obtained from a subject is measured. This determination can be used to evaluate the effectiveness of the therapeutic method of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of C3 polypeptide in a biological sample obtained from a subject previously treated with the C3 dsRNA agent and / or C3 antisense agent of the present invention. If the level of C3 polypeptide determined in a serum sample obtained from a treated subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-treatment level of C3 polypeptide determined for the subject, or compared to the level of an uncontacted control biological sample, the level of effectiveness of the treatment administered to the subject is indicated.

[0202] In some embodiments of the present invention, the physiological characteristics of a C3-related disease or condition determined in a subject may be control measurements, compared with measurements of physiological characteristics at different times in the same subject. In non-limiting examples, the physiological characteristics are, for example, the subject's C3 mRNA level and C3 protein level. The C3 mRNA level (and / or other physiological characteristics of the C3 disease or condition) determined in a sample obtained from the subject can be used as a baseline or control value for the subject. In the therapeutic method of the present invention, after administering a C3 dsRNA agent to a subject once or more times, one or more additional serum samples may be obtained from the subject, and the C3 mRNA level and / or C3 protein level in the subsequent samples may be compared to the subject's control / baseline level and / or ratio, respectively. Such comparisons can be used to assess the onset, progression, or regression of a C3-related disease or condition in the subject. For example, if the C3 mRNA level in a baseline sample obtained from a subject is higher than the C3 mRNA level measured in a sample obtained from the same subject after administration of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention to the same subject, it indicates regression of C3-related disease or condition and demonstrates the efficacy of the administered C3 dsRNA agent of the present invention in treating C3-related disease or condition.

[0203] In some embodiments of the present invention, the values ​​of one or more physiological characteristics of a C3-related disease or disorder determined for a subject can then be used as control values ​​to compare the physiological characteristics of the same subject, thereby enabling the evaluation of changes in the "baseline" physiological characteristics from the subject. Thus, if initial physiological characteristics exist and / or may be determined in a subject, and the methods and compounds of the present invention can be used to reduce the levels of C3 polypeptide and / or C3 polypeptide activity in the subject, the measured values ​​of the initial physiological characteristics can be used as a control for the subject.

[0204] By using the method of the present invention, the C3 dsRNA agent and / or C3 antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat C3 disease or pathology. The efficacy of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of the C3 disease or pathology. In non-limiting examples, the C3 mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to pre-administration levels in a serum sample obtained from the subject at a previous point in time, or compared to uncontacted control levels (e.g., C3 mRNA levels in a control serum sample). The C3 mRNA level and C3 protein level in the subject should be understood to be related to the C3 gene expression level, respectively. Some embodiments of the method of the present invention involve administering an effective amount of the C3 dsRNA and / or C3 antisense agent of the present invention to a subject to inhibit C3 gene expression, thereby reducing C3 mRNA levels, C3 protein levels in the subject, or otherwise positively influencing the physiological characteristics of C3-related diseases or conditions in the subject.

[0205] Some embodiments of the present invention include, for example, determining the presence, absence, and / or alteration of the physiological characteristics of a C3-related disease or condition using methods such as (1) evaluating the physiological characteristics of one or more biological samples obtained from one or more subjects, (2) imaging the subjects (e.g., obtaining liver images), and (3) performing a health examination of the subjects, but not limited to these methods. The determination can be used to evaluate the effectiveness of the therapeutic method of the present invention.

[0206] kit The scope of the present invention also includes reagent kits comprising one or more C3 dsRNA agents and / or C3 antisense polynucleotide agents, as well as instructions for their use in the methods of the present invention. The reagent kits of the present invention may contain one or more C3 dsRNA agents, C3 sense polynucleotides, and C3 antisense polynucleotide agents that can be used to treat C3-related diseases or conditions. Reagent kits containing one or more C3 dsRNA agents, C3 sense polynucleotides, and C3 antisense polynucleotide agents can be manufactured and used in the therapeutic methods of the present invention. The components of the reagent kits of the present invention may be packaged in an aqueous medium or in a lyophilized form. The reagent kits of the present invention may include a carrier, which is partitioned into and tightly confined within a plurality of container devices or a series of container devices such as test tubes, vials, flasks, bottles, syringes, etc. The first container device or series of container devices may contain one or more compounds, for example, C3 dsRNA agents and / or C3 sense or antisense polynucleotide agents. A second container device or a series of container devices may contain a targeting agent, a labeling agent, a delivery agent, etc., which may be included as part of a C3 dsRNA drug and / or C3 antisense polynucleotide administered in embodiments of the therapeutic method of the present invention.

[0207] The reagent kit of the present invention may further include instructions. The instructions are typically in written form and are used to instruct how to perform the treatments included in the reagent kit and to make decisions based on such treatments.

[0208] The following examples are used to illustrate specific examples of the embodiment of the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention is applicable to a variety of compositions and methods.

[0209] Examples Example 1. Phosphoramidite compound 2 [ka] DMTrCl (232 g, 684 mmol, 1.0 equivalent) in pyridine (400 mL) was added to a pyridine (600 mL) solution of isomannitol (100 g, 684 mmol, 1.0 equivalent), which is compound A, and the mixture was stirred at 25°C for 12 hours. LC-MS showed that compound A was completely consumed and a single main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with dichloromethane (500 mL x 2), washed with saline solution (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1~50 / 1, 0.1% Et3N) to obtain compound B (150 g, yield 48.9%), which was a yellow solid.

[0210] 1 H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).

[0211] At 25°C under an N2 atmosphere, 2H-tetrazole (0.45 M, 436 mL, 1.1 equivalents) was added dropwise to a solution of compound B (80.0 g, 178 mmol, 1.0 equivalent) in DCM (800 mL), and then a solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 equivalent) in DCM (200 mL) was added dropwise to the mixture. The reaction mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and a single main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500 mL), extracted with DCM (500 mL × 3), washed with NaHCO3 / saline solution = 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain compound 2 (77g, 119 mmol, yield 66.5%), which was a white solid.

[0212] 1 H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

[0213] Phosphoramidite compound 1 [ka] In an N2 atmosphere at 0-5°C, compound B (500 mg, 1.11 mmol, 1.0 equivalent) was dissolved in DCM (5.0 mL) to which compound D (607 mg, 3.34 mmol, 3.0 equivalent) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equivalent) were added, and the mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and several new peaks appeared on LC-MS, with approximately 70.9% of the desired compound detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold (0-5°C) saturated NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL × 2), and the combined organic layer was washed with ice-cold (0-5°C) saturated NaHCO3 / saline solution = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and vacuum concentrated to obtain the residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to obtain compound 1 (280 mg, 471 μmol, yield 42.3%), which was a white solid.

[0214] 1 H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (br d, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).

[0215] Other phosphoramidites can be produced by the methods described herein and / or by the prior art (e.g., US426,220 and WO02 / 36743).

[0216] Example 2. Production of a solid support containing the phosphoramidite monomer of the present invention [ka] [ka] This represents the carrier portion of the highly porous aminomethyl polyethylene resin. Under the protection of nitrogen gas, 19.50 kg of dichloromethane was added to a 50 L glass reaction vessel, and stirring was started. The temperature was controlled to 20-30°C. 1.47 kg of DMTrimann, 1.50 kg of triethylamine, 0.164 kg of 4-dimethylaminopyridine, and 1.34 kg of succinic anhydride were added to the glass reaction vessel. The mixture was kept warm at 20-30°C for 18 hours, sampled, and the reaction was stopped. 22.50 kg of saturated sodium bicarbonate solution was added to the reaction system and stirred for 10-20 minutes until the layers separated. The organic phase was separated, the aqueous phase was extracted twice with dichloromethane, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and vacuum concentrated to obtain 1.83 kg of a gray to grayish-white solid residue.

[0217] N,N-dimethylformamide (23.50 kg) was added to a 100 L glass vessel, stirred, and the temperature was controlled to 20-30°C. Under the protection of nitrogen gas, the products from the previous step, O-benzotriazoletetramethyluronium hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass vessel via a solid addition funnel, stirred for 10-30 minutes, and then discharged into a 50 L zinc drum for use. Large-porous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., lot number HA2X1209, load amount 0.48 mmol / g) was added to the above 100 L solid-phase synthesis reactor via a solid-feed funnel, the temperature was controlled to 20-30°C, N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc drum in the previous step were added to the solid-phase synthesis reactor, the reaction was allowed to proceed while maintaining the temperature, and the solid load was monitored until it reached ≥250 umol / g, with ultraviolet light being used for load detection. The mixture was filtered under nitrogen gas pressure, the filtered cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), and the filtered cake was left in the vessel. CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were placed in an 80 L glass vessel and stirred for 3 to 8 minutes before use. This procedure was repeated three times, the vessel was covered, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis reaction vessel. After bubbling with nitrogen gas for 10 to 30 minutes, the mixture was pressure filtered. This procedure was repeated four times, the filtered cake in the solid-phase synthesis reaction vessel was purged with nitrogen gas for 2 to 4 hours, and then transferred to a 50 L pressure filter tank. Drying was continued while controlling the temperature to 15-30°C, and after drying, a product weighing 3.516 kg and being a yellow to white solid was obtained.

[0218] The isomannitol residue is added to the 5' or 3' end of the oligonucleotide chain by a method well known to those skilled in the art, such as reverse debasing (invab), and then further added to the target group.

[0219] Example 3. Synthesis of C3 RNAi agent The double-stranded C3 RNAi agents listed in Tables 2-3 above were synthesized according to the following general procedure.

[0220] siRNA sense and antisense chain sequences were synthesized in an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain extension was achieved by a four-step cycle consisting of deprotection, condensation, capping, and oxidation or sulfidation steps for the addition of each nucleotide. Synthesis was performed on a solid support made from pore-controlled glass (CPG, 1000A). Monomer phosphoramidites may be purchased from commercial sources or may be the phosphoramidite compounds in Example 1. The phosphoramidite compounds described herein can be attached to the 3'-terminus as monomer phosphoramidites and further attached to the CPG solid support. When attached to the 5'-terminus, the phosphoramidite compounds can be used in the final coupling reaction and, if necessary, further bound to a target ligand.

[0221] Phosphoramidites containing GalNAc ligand clusters (GLS-5* and GLPA15* phosphoramidites are non-limiting examples) are disclosed in WO2023 / 045995A1 (the whole of which is incorporated herein). siRNAs used for in vitro screening (Table 2) were synthesized on a scale of 2 μmol, while siRNAs used for in vivo testing (Table 3) were synthesized on a scale of 5 μmol or more. When the GalNAc ligand (GLO-n phosphoramidites are disclosed as non-limiting examples in WO2023 / 045995A1 (the whole of which is incorporated herein)) was attached to the 3' end of the sense strand, a CPG solid support attached to the GalNAc ligand was used. When a GalNAc ligand (as a non-limiting example, GLS-5* or GLS-15* is attached to the 5' end of the sense chain, and GLS-5* and GLS-15* phosphoramidites having a GalNAc ligand cluster are disclosed in WO2023 / 045995A1 (which is incorporated herein in whole)) is attached to the 5' end of the sense chain, the final coupling reaction was carried out using a GalNAc phosphoramidite. 3% trichloroacetic acid (TCA) in dichloromethane was used to deprotect the 4,4'-dimethoxytrityl protecting group (DMT). 5-ethylthio-1H-tetrazolyl was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN were used for oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomers bound to the solid support were cleaved, and the protecting groups were removed by treatment with a 1:1 volume of 40 wt% aqueous methylamine solution and a 28% ammonium hydroxide solution. The crude mixture was concentrated to synthesize siRNA for use in vitro screening. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the single-stranded product as a sodium salt, which could be used for annealing without further purification. To synthesize siRNA for use in vivo testing, the single-stranded product was further purified by ion-pair reverse-phase HPLC (IP-RP-HPLC).The single-stranded oligonucleotide product purified from IP-RP-HPLC was converted to a sodium salt by dissolving it in 1.0 M NaOAc, and precipitated by adding ice-cold EtOH. Equimolar amounts of complementary sense and antisense oligonucleotides were annealed in water to form a double-stranded siRNA product, which was freeze-dried to obtain a fluffy white solid.

[0222] In several studies, methods for attaching a GalNAc-containing target group (also referred to herein as a GalNAc delivery compound) to the 5' end of a sense strand involved using a GalNAc phosphoramidite (GLS-5* or GLS-15* phosphoramidite) in the final coupling step of solid-phase synthesis, for example, using the same synthetic process used for extending oligonucleotide chains to add a nucleotide to the 5' end of a sense strand.

[0223] In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves using a GLO-n-containing solid support (CPG). In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves attaching the GalNAc target group to the CPG solid support via ester bonding, and obtaining the GalNAc target group attached to the 3' end of the sense chain by using the CPG with the obtained GalNAc target group attached during the synthesis of the sense chain.

[0224] imann residues can be added to the 5' or 3' end of an oligonucleotide chain and / or further added to a GalNAc target group by methods well known to those skilled in the art, such as reverse debasing (invab).

[0225] Example 4. In vitro screening of C3 double-stranded siRNA. Huh7 cells were digested with trypsin to adjust to the appropriate density and then inoculated into 96-well plates. Simultaneously with inoculation, the cells were transfected with test siRNA or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommended procedure. The siRNA was tested three times at two concentrations (0.6 nM and 0.08 nM). After culturing the siRNA-transfected cell samples for 24 hours, QPCR was performed to analyze the expression of target genes at the mRNA level. The results are shown in Table 5.

[0226] [Table 7]

[0227] Example 5. In vivo study of C3 double-stranded siRNA. On day 1, female C57BL / 6J mice (4 mice per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding human C3 and luciferase genes. On day 8, the mice were subcutaneously injected with 3 mg / kg of C3 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 15 and 22. Plasma samples were isolated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human C3 expression levels correlate with luciferase expression levels, the percentage of remaining C3 was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and this was standardized by the change in luciferase activity in control treatment samples over the same period. The results are summarized in Tables 6 and 7.

[0228] [Table 8]

[0229] [Table 9]

[0230] Example 6. In vivo study of C3 double-stranded siRNA. On day 1, female C57BL / 6J mice (4 mice per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding human C3 and luciferase genes. On day 8, the mice received a single subcutaneous injection of 6 mg / kg of C3 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 15 and 22. Plasma samples were isolated, and luciferase activity was measured according to the manufacturer's recommended procedure. Since human C3 expression levels correlate with luciferase expression levels, the percentage of remaining C3 was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and standardized by the change in luciferase activity in control-treated samples over the same period. The results are summarized in Table 8.

[0231] [Table 10]

[0232] Example 7.C3 In vivo study of double-stranded siRNA On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human C3 and luciferase genes. On day 8, the mice were administered a single subcutaneous injection of 6 mg / kg of C3 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on day 15. Plasma samples were isolated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human C3 expression levels correlate with luciferase expression levels, the percentage of remaining C3 was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and this was standardized by the change in luciferase activity in control-treated samples over the same period. The results are summarized in Table 9.

[0233] [Table 11]

[0234] Example 8. In vivo study of C3 siRNA double strands in an NHP PD model. Male cynomolgus monkeys (5-6 years old, weighing 5-7 kg, 3 monkeys per group) were used in the experiment. On day 0, each monkey was subcutaneously injected with the test substance dissolved in sterile saline at a dose of 5 mg / kg. After fasting overnight, blood samples were collected on days -14 (pre-administration), -7 (pre-administration), day 0 (pre-administration), day 7, day 14, day 21, and day 28. Serum C3 protein concentration was measured using the ELISA method (Abcam). Figure 1 shows the percentage of C3 inhibition in the group treated with the test siRNA double-stranded drug (standardized by the mean C3 protein level in the serum sample before siRNA administration).

[0235] Example 9.C3 In vivo study of double-stranded siRNA On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human C3 and luciferase genes. On day 8, the mice received a single subcutaneous injection of 1, 3, or 6 mg / kg of C3 siRNA or PBS. Blood samples were collected on day 8 (before siRNA administration), day 15, and day 22. Plasma samples were isolated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human C3 expression levels correlate with luciferase expression levels, the percentage of remaining C3 was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and this was standardized by the change in luciferase activity in control-treated samples over the same period. The results are summarized in Table 10.

[0236] [Table 12]

[0237] Example 10. In vivo study of C3 siRNA double strands in an NHP PD model. Male cynomolgus monkeys (5-6 years old, weighing 5-7 kg, 3 monkeys per group) were used in the experiment. On day 0, each monkey was subcutaneously injected with the test substance dissolved in sterile saline at a dose of 5 mg / kg. After fasting overnight, blood samples were collected on days -7 (pre-administration), day 0 (pre-administration), day 7, day 14, day 21, and day 28. Serum C3 protein concentration was measured using the ELISA method (Abcam). Figure 2 shows the percentage of C3 inhibition in the group administered the test siRNA double-stranded drug (standardized by the mean C3 protein level in the serum sample before siRNA administration).

[0238] Example 11. In vivo study of C3 siRNA double strands in an NHP PD model. Male cynomolgus monkeys (5-6 years old, weighing 5-7 kg, 3 monkeys per group) were recruited for the experiment. On day 1, each monkey was subcutaneously injected with the test substance prepared in sterile saline at a dose of 6 mg / kg. After an overnight fast, liver biopsy samples were collected on day -7 (before administration), day 29, and day 57. C3 mRNA levels were measured by qPCR. Figure 3 shows the percentage of C3 mRNA inhibition in the group treated with the test siRNA double-stranded drug (standardized by the mean C3 level in the liver biopsy sample taken on day -7 before siRNA administration).

[0239] Example 12. Phosphoramidite 15 (Enantiomer phosphoramidite-15-1 and enantiomer phosphoramidite-15-2) [ka] At 0°C, benzoyl chloride (126 g, 893 mmol, 104 mL) was added to a solution of pyridine (735 g, 9.29 mol, 750 mL) containing uracil (50.0 g, 446 mmol) and acetonitrile (1.50 L). The reaction mixture was stirred at 20-25°C for 12.0 hours, and TLC showed that the compound uracil had been completely consumed. The reaction mixture was concentrated under vacuum to obtain the residue. The residue was diluted with cold water (1.0 L) and extracted with ethyl acetate (1.0 L x 3). The combined organic layers were washed with saline solution (500 mL) and dried over anhydrous sodium sulfate. The resulting residue was purified by column chromatography (SiO2, ethyl acetate / petroleum ether = 1 / 10-1 / 1) to obtain Phos-15-1A (63 g, yield 65.3%), a white solid.

[0240] 1 H NMR: EC4783-420-P1N (400 MHz, DMSO- d6) δ ppm 7.96 (dd, J =8.4, 1.2 Hz, 2 H), 7.76-7.81 (m, 1 H), 7.67 (dd, J =7.6, 5.6 Hz, 1 H), 7.58-7.64 (m, 2 H), 5.75 (dd, J =7.6, 1.2 Hz, 1 H).

[0241] A solution of Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol) in tetrahydrofuran (80 mL) was mixed with triphenylphosphine (11.5 g, 43.9 mmol) and diethyl azodicarboxylate (7.64 g, 43.9 mmol, 7.98 mL), and the mixture was stirred at 20-25°C for 16 hours. LC-MS showed that compound Phos-15-1A was completely consumed. The reaction mixture was concentrated under reduced pressure to remove the tetrahydrofuran. The residue was diluted with cold water (80 mL) and extracted with ethyl acetate (80 mL x 3). The combined organic layers were washed with saline (80 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM = 0 / 10 to 1 / 10) to obtain the compound Phos-15-1B (14 g, crude product), which is a white solid.

[0242] Under the protection of nitrogen gas, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperbenzoic acid (2.27 g, 11.1 mmol, 85% purity) in dichloromethane (70 mL) was heated at 0-5°C. After 16 hours of reaction, TLC showed that compound Phos-15-1B had been completely consumed and a new spot with relatively low polarity was detected. The pH of the reaction mixture was gradually adjusted to 7-8 with saturated NaHSO3 and NaHCO3 solution (1:1), then extracted with ethyl acetate (70 mL x 3), washed the combined organic phase with saline solution (700 mL), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was eluted by silica gel column chromatography (100-200 mesh silica gel) and ethyl acetate:petroleum ether (1:30-1:1) to obtain compound Phos-15-1C (1.2 g, crude product), which was a white solid.

[0243] To a solution of compound Phos-15-SM3 (4.0 g, 14.4 mmol) in tetrahydrofuran (24.0 mL), KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) were added, and the resulting mixture was stirred at 70°C for 4.0 hours. LC-MS showed that the starting material Phos-15-SM3 was completely consumed and that a main peak with the molecular weight of the desired target molecule was detected. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration through a short silica gel pad, and the mixture was rinsed with ethyl acetate. The filtrate was concentrated under vacuum to obtain compound Phos-15-1D (3.50 g, 98.5% yield), a brown oily substance. Compound Phos-15-1D was used in the next step without further purification.

[0244] 1 H NMR: EC11950-13-P1B (400 MHz, DMSO- d6) δ ppm 3.96-4.07 (m, 4H) 3.27 (d, J =14.0 Hz, 2H) 2.40 (s, 3H) 1.22 (t, J =7.2 Hz, 6H).

[0245] To a solution of compound Phos-15-1C (1.20 g, 4.02 mmol) in ethanol (15.0 mL), potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) were added, and the mixture was stirred at 20-25°C for 3.0 hours. TLC showed that compound Phos-15-1C was completely consumed and new spots with relatively high polarity were detected. The mixture obtained from the reaction was filtered, diluted with water (20 mL), extracted with dichloromethane (20 mL x 3), washed with saline solution, dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (SiO2, MeOH / DCM = 1 / 100 to 10 / 100) to obtain compound Phos-15-1E, a brown oily substance (1.00 g, yield 65.7%, a 1:1 mixture of enantiomer compound-1E-1 and compound-1E-2).

[0246] 1 H NMR: EC10615-82-P1N1 (400 MHz, DMSO- d6) δ ppm 11.23 (br s, 1 H), 7.69 (d, J =8.0 Hz, 1 H), 5.58 (dd, J =8.0, 1.6 Hz, 1 H), 4.93 (q, J =8.8 Hz, 1 H), 3.96-4.17 (m, 5 H), 3.08-3.17 (m, 1 H), 3.03 (dd, J = 14.0, 2.0 Hz, 2 H), 2.38-2.47 (m, 1 H), 2.04-2.07 (m, 1 H), 1.82-1.90 (m, 1 H), 1.56-1.59 (m, 1 H), 1.25 (t, J =6.8 Hz, 6 H).

[0247] The compound Phos-15-1E was reconstituted to yield the enantiomers Phos-15-1E-1 and Phos-15-1E-2 by chiral reconstitution. The reconstitution conditions were a DAIELCHIRALPAK AD 40mm column, 140 mL / min, and ethanol:carbon dioxide = 35:75. To understand this, if it is necessary to obtain the enantiomer phosphoramidite-15-1 or enantiomer phosphoramidite-15-2, it can be obtained simply by reacting the corresponding enantiomer Phos-15-1E-1 or Phos-15-1E-2 with a phosphorus reagent as a starting material.

[0248] At room temperature under nitrogen gas protection, a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and diisopropylamine tetrazolate salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL) was added to a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (reagent P, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL), and the mixture was then stirred at 40°C for 1.0 hour. LC-MS showed that compound Phos-15-1E was completely consumed, several new peaks appeared on the LC-MS, and approximately 80% of the desired compound was detected. The resulting reaction mixture was cooled to -20°C, poured into ice-cold (0-5°C) saturated sodium bicarbonate aqueous solution (10 mL), extracted with dichloromethane (10 mL x 2), washed with ice-cold (0-5°C) saturated sodium bicarbonate aqueous solution / saline solution (5 mL / 5 mL), dried over anhydrous sodium sulfate, and vacuum concentrated to obtain a residue (~2.0 mL). The residue was purified by column chromatography (basic Al2O3, MeOH / DCM = 1 / 80~1 / 40, 0.1% Et3N) to obtain phosphoramidite-15 (350 mg, 0.6 mmol, yield 57.2%, a 1:1 mixture of enantiomer phosphoramidite-15-1 and enantiomer phosphoramidite-15-2) as a colorless oil.

[0249] Following the same synthesis method as described above, enantiomerized phosphoramidite-15-1 or enantiomerized phosphoramidite-15-2 was obtained using the corresponding Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification as the starting material.

[0250] δ ppm 11.23 (br s, 1 H), 7.70 (d, J =8.0 Hz, 1 H), 5.55-5.60 (m, 1 H), 4.89 (q, J =8.4 Hz, 1H), 4.29-4.42 (m, 1H), 3.99-4.09 (m, 4H), 3.65-3.84 (m, 2H), 3.53-3.62 (m, 2H), 3.35-3.41 (m, 1H), 3.02 (dd, J =14.0, 8.0 Hz, 2H), 2.76-2.79 (m, 2H), 2.40-2.49 (m, 1H), 2.15-2.25 (m, 1H), 1.95-2.07 (m, 1H), 1.65-1.75 (m, 1H), 1.23-1.26 (m, 6H) 1.12-1.21 (m, 12H).

[0251] The compound phosphoramidite 15 (a 1:1 mixture of phosphoramidite 15-1 and phosphoramidite 15-2 as used herein) can be attached to the 5' end as a monomer phosphoramidite, in which case the phosphoramidite compound can be used in the final coupling reaction, for example, by forming a phos-15* nucleotide at the 5' end of an antisense sequence.

[0252] equivalent While several embodiments of the present invention have been described and explained herein, those skilled in the art will readily conceive of various other means and / or structures to perform the function and / or result and / or obtain one or more of the advantages described herein, and each of these variations and / or modifications will be considered to be within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and arrangements described herein are illustrative and that actual parameters, dimensions, materials and / or arrangements will depend on the specific application taught by the present invention. Those skilled in the art will recognize many equivalents of the specific embodiments of the present invention described herein or can determine them simply by using conventional experimentation. Accordingly, it should be understood that the above embodiments are shown merely illustratively and that within the scope of the appended claims and their equivalents, the present invention can be carried out in ways different from those specifically described and claimed. The present invention relates to each of the individual features, systems, articles, materials and / or methods described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods (provided that these features, systems, articles, materials, and / or methods are not inconsistent with each other) is also included within the scope of the present invention.

[0253] All definitions defined and used herein should be understood as definitions in comparative dictionaries, definitions in documents incorporated by citation, and / or the general meaning of the terms defined.

[0254] As used herein and in the claims, the indefinite articles "a" and "an" should be understood as "at least one" unless expressly stated otherwise.

[0255] The phrase "and / or" as used in the specification and claims should be understood as "either one or both" of the elements thus combined, that is, the elements may exist in combination in some cases and separately in other cases. In addition to the elements explicitly marked in the "and / or" section, other elements may exist, whether related to the explicitly marked elements or not, unless otherwise explicitly stated.

[0256] All references, patents and patent applications, and publications cited or referenced herein are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region complementary to a C3 RNA transcript, the complementary region comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences of SEQ ID NOs. 25-28, 31-35, 39-41, or 45-47, and optionally comprising a target ligand, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary to each other. Double-stranded ribonucleic acid (dsRNA) agent.

2. The dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by only 0, 1, 2, or 3 nucleotides from one of the sense sequences of sequence numbers 2-5, 8-12, 16-18, or 22-24. The dsRNA agent according to claim 1.

3. The sense strand and antisense strand include the sequences listed in the form of a double-stranded sequence, and the double-stranded sequence is selected from the following sequences: (a) The sequences are sequence numbers 2 and 25, respectively. (b) The sequences are sequence numbers 3 and 26, respectively. (c) The sequences are sequence numbers 4 and 27, respectively. (d) The sequences are sequence numbers 8 and 31, respectively. (e) The sequences are sequence numbers 9 and 32, respectively. (f) The sequences are sequence numbers 10 and 33, respectively. (g) The sequences are sequence numbers 11 and 34, respectively. (h) The sequences are sequence numbers 12 and 35, respectively. (i) The sequences are sequence numbers 16 and 39, respectively. (j) The sequences are sequence numbers 17 and 40, respectively. (k) The sequences are sequence numbers 18 and 41, respectively. (l) The sequences are sequence numbers 22 and 45, respectively. (m) The sequences are sequence numbers 23 and 46, and (n) The sequences are sequence numbers 24 and 47, respectively. A dsRNA agent according to any one of claims 1 to 2.

4. The antisense strand of dsRNA contains a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from formula (I) by only 0, 1, 2, or 3 nucleotides, wherein the nucleotide sequence of formula (I) is 5'-Z １ UAUUCAUGAGCUUCGUAGZ ２ It is shown as -3'(I), and of which, Z １ is selected from one of C, G, A, or U, or does not exist, Z ２ This is a nucleotide sequence with a length of 0 to 15 nucleotides. A dsRNA agent according to any one of claims 1 to 2.

5. The antisense strand of dsRNA contains a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of formula (III) by only 0, 1, 2, or 3 nucleotides, wherein the nucleotide sequence of formula (III) is 5'-Z ５ UGUUCAUUCUGAUUCCUUZ ６ It is shown as -3'(III), of which Z ５ is selected from one of C, G, A, or U, or does not exist, Z ６ This is a nucleotide sequence with a length of 0 to 15 nucleotides. A dsRNA agent according to any one of claims 1 to 2.

6. The antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18 or 19 consecutive nucleotides that differs from the nucleotide sequence of formula (V) by 0, 1, 2 or 3 nucleotides, wherein the nucleotide sequence of formula (V) is 5'-Z ９ GUAGUAGAAUUUCUCUGUZ １０ -3' (V), wherein Z ９ is selected from one of C, G, A and U, or is absent, and Z １０ is a nucleotide sequence with a length of 0 to 15 nucleotides, A dsRNA agent according to any one of claims 1 to 2.

7. The dsRNA agent comprises at least one modified nucleotide. A dsRNA agent according to any one of claims 1 to 6.

8. All or essentially all nucleotides in the sense strand and / or antisense strand are modified nucleotides. A dsRNA agent according to any one of claims 1 to 7.

9. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to the C3 RNA transcript, each strand having a length of approximately 15 to 30 nucleotides, and the sense strand sequence containing a sequence that may be represented by formula (A). 5′-(N′ Ｌ ) ｎ′ N′ Ｌ N′ Ｌ N′ Ｌ N′ Ｌ N′ Ｆ N′ Ｌ N′ Ｆ N′ Ｌ N′ Ｎ１ N′ Ｎ２ N′ Ｌ N′ Ｌ N′ Ｌ N′ Ｌ N′ Ｌ (N′ Ｌ ) ｍ′ -3′ (A) Among them, each N' Ｆ This indicates a 2'-fluoromodified nucleotide, and each N' Ｎ１ and N' Ｎ２ Each N' independently represents a modified or unmodified nucleotide. Ｌ This independently indicates modified or unmodified nucleotides, but does not indicate 2'-fluoromodified nucleotides, and m' and n' are each independently selected from integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

10. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises one sense strand and one antisense strand, the sense strand being complementary to the antisense strand, the antisense strand containing a region complementary to a portion of the C3 RNA transcript, each strand having a length of approximately 18 to 30 nucleotides, and the antisense strand containing a sequence that may be represented by formula (B). 3′-(N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｍ４ N Ｌ N Ｌ N Ｌ N Ｍ５ N Ｌ N Ｍ６ N Ｌ N Ｌ N Ｆ N Ｌ -5′ (B) Of these, each N Ｆ This indicates a 2'-fluoromodified nucleotide, and each N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ and N Ｍ６ This independently indicates modified or unmodified nucleotides, and each N Ｌ This independently represents modified or unmodified nucleotides, but they are not 2'-fluoromodified nucleotides, and n is an integer selected from 0 to 7. Double-stranded ribonucleic acid (dsRNA) agent.

11. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises one sense strand and one antisense strand, the sense strand and antisense strand form a dsRNA double-stranded body, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the C3 RNA transcript, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA comprises a double-stranded body represented by formula (C). Sense strand: 5'-(N' Ｌ ) ｎ’ N' Ｌ N' Ｌ N' Ｌ N' Ｌ N' Ｆ N' Ｌ N' Ｆ N' Ｌ N' Ｎ１ N' Ｎ２ N' Ｌ N' Ｌ N' Ｌ N' Ｌ N' Ｌ (N' Ｌ ) ｍ’ -3' Antisense strand: 3'-(N Ｌ ) ｎ N Ｍ１ N Ｌ N Ｍ２ N Ｌ N Ｆ N Ｌ N Ｍ３ N Ｍ４ N Ｌ N Ｌ N Ｌ N Ｍ５ N Ｌ N Ｍ６ N Ｌ N Ｌ N Ｆ N Ｌ -5' (C) Of these, the length of each chain is approximately 18 to 30 nucleotides, and each N Ｆ and N' Ｆ This independently shows a 2'-fluoromodified nucleotide, N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ , N' Ｎ１ and N' Ｎ２ Each of these independently represents a modified or unmodified nucleotide, and N' Ｎ１ and N' Ｎ２ It contains only one 2'-fluoromodified nucleotide, N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ and N Ｍ６ It has only three 2'-fluoromodified nucleotides, and each N Ｌ and N' Ｌ The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7. Double-stranded ribonucleic acid (dsRNA) agent.

12. The one or more modified nucleotides are independently selected from 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reversed nucleotide, reversed debasalized nucleotide, isomannitol nucleotide, reversed 2'-Ome nucleotide, reversed 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, cholesterol derivative or terminal nucleotide linked to a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphate amide ester, or nucleotide containing a non-natural base. A dsRNA agent according to any one of claims 1 to 11.

13. The guide strand contains an E-vinylphosphonate nucleotide located at its 5' end. A dsRNA agent according to any one of claims 1 to 12.

14. The dsRNA agent contains at least one phosphorothioate nucleotide interbond, A dsRNA agent according to any one of claims 1 to 13.

15. The sense strand includes at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 14.

16. The antisense chain includes at least one phosphorothioate nucleotide interbond, A dsRNA agent according to any one of claims 1 to 14.

17. The sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 14.

18. The antisense chain contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 14.

19. The dsRNA comprises a double-stranded molecule selected from AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, and AV04980, and the double-stranded molecule optionally contains a target ligand. A dsRNA agent according to any one of claims 1 to 18.

20. The sense strand is complementary or basically complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides. A dsRNA agent according to any one of claims 1 to 19.

21. The length of the complementary region is 19 to 21 nucleotides. A dsRNA agent according to any one of claims 1 to 20.

22. Each of the aforementioned chains has a length of 40 nucleotides or less. A dsRNA agent according to any one of claims 1 to 21.

23. Each chain has a length of 30 nucleotides or less. A dsRNA agent according to any one of claims 1 to 21.

24. Each chain has a length of 25 nucleotides or less. A dsRNA agent according to any one of claims 1 to 21.

25. Each chain has a length of 23 or fewer nucleotides. A dsRNA agent according to any one of claims 1 to 21.

26. The dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. A dsRNA agent according to any one of claims 1 to 25.

27. One or more target groups or binding groups are conjugated to the sense chain. The dsRNA agent according to claim 26.

28. The target group or binding group contains N-acetylgalactosamine (GalNAc). A dsRNA agent according to either claim 26 or 27.

29. The target group includes having the following structure: 【Chemistry 1】 Each n'' is independently selected from 1 or 2. A dsRNA agent according to any one of claims 26 to 28.

30. The target group has the following structure: Table 1-1 Table 1-2 Table 1-3 Table 1-4 A dsRNA agent according to any one of claims 26 to 29.

31. The dsRNA agent comprises a target group conjugated to the 5'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 30.

32. The dsRNA agent comprises a target group conjugated to the 3'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 30.

33. The antisense chain contains one reverse debase residue at its 3'-terminus. A dsRNA agent according to any one of claims 1 to 30.

34. The sense strand contains one or two reverse debase residues or imann residues at its 3' or / and 5' end. A dsRNA agent according to any one of claims 1 to 30.

35. The dsRNA agent has two blunt ends, A dsRNA agent according to any one of claims 1 to 34.

36. At least one strand contains the 3' overhang of at least one nucleotide. A dsRNA agent according to any one of claims 1 to 34.

37. At least one strand contains the 3' overhanging ends of at least two nucleotides. A dsRNA agent according to any one of claims 1 to 34.

38. The dsRNA includes a double-stranded body selected from the group consisting of AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, and AD01447-3. A dsRNA agent according to any one of claims 1 to 37.

39. The C3 RNA transcript is sequence number 1. A dsRNA agent according to any one of claims 1 to 38.

40. A dsRNA agent according to any one of claims 1 to 39, composition.

41. Further comprising a pharmaceutically acceptable carrier, The composition according to claim 49.

42. Further comprising one or more other therapeutic agents, The composition according to claim 41.

43. The composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe, or vial. The composition according to claim 42.

44. The composition is prepared for use in subcutaneous or intravenous (IV) administration. The composition according to any one of claims 40 to 43.

45. A cell comprising a dsRNA agent according to any one of claims 1 to 39, wherein the cell is optionally a mammalian cell and optionally a human cell. cell.

46. A method for inhibiting C3 gene expression in cells, wherein the method is (i) Producing cells comprising an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 39 or a composition according to any one of claims 40 to 44. method.

47. (ii) Further comprising inhibiting C3 gene expression in the cells by maintaining the cells produced in step (i) of claim 46 for a time sufficient to obtain degradation of the mRNA transcript of the C3 gene, The method according to claim 46.

48. The cells are located within the body of the subject, and the dsRNA drug is administered subcutaneously to the subject. The method according to any one of claims 46 to 47.

49. The aforementioned cells are located within the subject's body, and the dsRNA drug is administered to the subject via IV administration. The method according to any one of claims 46 to 47.

50. The further includes evaluating the inhibition of the C3 gene after administering a dsRNA drug to the subject, of which the evaluation method is: (i) To determine one or more physiological characteristics of C3-related disease or symptoms in the subject, (ii) Comparing the determined physiological characteristics with the baseline pre-treatment physiological characteristics of the C3-related disease or condition and / or the control physiological characteristics of the C3-related disease or condition, Of these, the comparison indicates one or more of the presence or absence of inhibition of C3 gene expression in the subject. The method according to claim 48 or 49.

51. The determined physiological characteristics are one or more of the following: the subject's C3 mRNA level, C3 protein level, etc. The method according to claim 50.

52. One or more of the following are reduced: the C3 mRNA level of the subject, the C3 protein level of the subject, The method according to claim 51.

53. A method for inhibiting the expression of the C3 gene in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 39 or a composition according to any one of claims 40 to 44. method.

54. The dsRNA agent is administered subcutaneously to the subject. The method according to claim 53.

55. The dsRNA agent is administered to the subject via IV administration. The method according to claim 53.

56. The further includes evaluating the inhibition of the C3 gene after administration of a dsRNA agent, the evaluation method being: (i) To determine one or more physiological characteristics of the subject's C3-related disease or condition, (ii) Comparing the determined physiological characteristics with the baseline pre-treatment physiological characteristics of the C3-related disease or condition and / or the control physiological characteristics of the C3-related disease or condition, Of these, the comparison indicates one or more of the presence or absence of inhibition of C3 gene expression in the subject. The method according to any one of claims 53 to 55.

57. A method for treating a disease or condition related to the presence of a C3 protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 39 or a composition according to any one of claims 40 to 44 in order to inhibit C3 gene expression. method.

58. The aforementioned diseases or conditions are one or more of the following: C3 glomerulosis (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease with bacterial flora, malarial anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases. The method according to claim 57.

59. Further including administering an alternative treatment plan to the subject, The method according to claim 58.

60. The aforementioned alternative treatment plan includes administering one or more types of C3 antisense polynucleotides to the subject, administering a non-C3 dsRNA therapeutic agent to the subject, and inducing behavioral changes in the subject. The method according to claim 59.

61. Non-C3 dsRNA therapeutic agents include one or more of the following: C5 inhibitors, such as anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimub (REGN3918)); C5 peptide inhibitors (e.g., zircoplan); or C3 peptide inhibitors, such as compstatin. The method according to claim 60.

62. The dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 57 to 61.

63. The dsRNA agent is administered to the subject via IV administration. The method according to any one of claims 57 to 61.

64. Further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject, The method according to any one of claims 57 to 63.

65. The method for determining the effectiveness of treatment on a subject is: (i) To determine one or more physiological characteristics of the subject's C3-related disease or condition, (ii) Comparing the determined physiological characteristics with the baseline pre-treatment physiological characteristics of a C3-related disease or condition, Of these, the comparison indicates one or more of the following: the presence, absence, and level of effectiveness of administering double-stranded ribonucleic acid (dsRNA) agents to the subject. The method according to claim 64.

66. The determined physiological characteristics were the C3 mRNA level and C3 protein level of the subject. The method according to claim 65.

Images