Methods and devices for processing fine particles

JP2026530141APending Publication Date: 2026-09-04BLINK AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026503079
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-07-21
Filing Date
2024-07-22
Publication Date
2026-09-04

Smart Images

  • Figure 2026530141000001
    Figure 2026530141000001
  • Figure 2026530141000002
    Figure 2026530141000002
  • Figure 2026530141000003
    Figure 2026530141000003
Patent Text Reader

Abstract

The present invention relates to a method for processing microparticles and a chamber for processing microparticles. Furthermore, the present invention relates to a device for carrying out a method for processing microparticles. Furthermore, the present invention relates to a chamber for culturing and detecting microparticles and a process for housing microparticles in a tightly packed arrangement configuration. Finally, the present invention also relates to a liquid handling and processing tool for establishing a fluid connection to and from a chamber and / or for realizing a liquid flow to and from a chamber.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Field of Invention The present invention relates to a method for processing microparticles and a chamber for processing microparticles. Furthermore, the present invention relates to a device for carrying out a method for processing microparticles. Furthermore, the present invention relates to a chamber for culturing and detecting microparticles and a process for housing microparticles in a tightly packed arrangement configuration. Finally, the present invention also relates to a liquid handling and processing tool for establishing a fluid connection to and from a chamber and / or for realizing a liquid flow to and from a chamber. [Background technology]

[0002] Background of the Invention Microparticles, such as beads, are increasingly used in a wide range of assays. They are particularly used in microfabricated flow cytometry, enzyme immunoassays, and nucleic acid amplification reactions. Microparticles are also used as reaction compartments themselves, with each microparticle functioning as a reaction space where chemical reactions, such as amplification reactions, occur (see, e.g., WO2018 / 122162 A1). Such microparticles (sometimes called "nanoreactor beads") typically undergo a series of process steps including packing, washing, binding, exposure, execution of the desired reaction, and detection. Execution of any of these methods, steps, and assays depends on efficient methodologies for handling microparticles rapidly and reliably (allowing them to be reproducibly exposed to appropriate reagents, buffers, and reaction conditions, and subsequently, potentially, transferred to various reaction compartments).

[0003] However, there remains a need in this art for efficient methodologies and apparatus for processing microparticles. There is also a need in this art for methodologies and apparatus for culturing and detecting microparticles. Furthermore, there is a need for methodologies for housing microparticles in tightly packed configurations. In particular, the processing of so-called "nanoreactor beads" requires sophisticated process control that is not provided by currently known technological solutions. Especially, there is a need to enable contactless sample-to-response workflows by performing microparticle-based biological assays using self-sufficient, integrated cartridges.

[0004] This invention addresses these needs and enables rapid, reliable, reproducible, and efficient handling of particulate matter in a wide range of environments. [Overview of the project]

[0005] In a first embodiment, the present invention relates to a method for processing magnetic microparticles, in particular, for exposing magnetic microparticles to a liquid and / or for generating a dispersion system of magnetic microparticles in a liquid, wherein the method is: a) The process includes providing a first liquid, a plurality of magnetic particles, and a chamber having a capacity for receiving the liquid and the plurality of magnetic particles in any order; the chamber further has a freely movable permanent magnet disposed within the capacity; b) The step of introducing the first liquid and the plurality of magnetic particles into the volume of the chamber in any order, and enabling the plurality of magnetic particles to be immersed in the first liquid, distributed within the first liquid, attracted to the freely movable permanent magnet, and preferably adhering to the freely movable permanent magnet; c) comprising the step of generating a user-definable magnetic field, preferably a user-definable electromagnetic field, outside the chamber, wherein the generated user-definable magnetic field, preferably the user-definable electromagnetic field, exerts a magnetic force on the permanent magnets placed within the capacity, and the permanent magnets are held in a predetermined fixed position within the capacity; d) The step of changing the user-definable magnetic field, preferably the user-definable electromagnetic field, and thereby the magnetic force produced, wherein the permanent magnet rotates to align with the magnetic field, preferably the electromagnetic field, and a shear force acts on the magnetic particles so that the magnetic particles move within the volume, preferably during such movement, most of the plurality of magnetic particles, preferably all of the plurality of magnetic particles, are detached from the permanent magnet and distributed and dispersed within the first liquid.

[0006] In one embodiment, the user-definable magnetic field is a user-definable electromagnetic field.

[0007] In one embodiment, in step d), changing the user-definable magnetic field, preferably the user-definable electromagnetic field, involves changing at least one of the following items, the item being a change in the user-definable magnetic field, preferably the user-definable electromagnetic field: - position, - Polarity when the magnetic field is a direct current (DC) electromagnetic field, - The frequency when the magnetic field is an alternating current (AC) electromagnetic field, and - strength Preferably, the user-definable magnetic field is a change in position of the electromagnetic field, more preferably a change in position and polarity, and even more preferably a change in position, polarity and frequency.

[0008] In one embodiment, step d) is performed n times, where n is an integer in the range of 1 to 1000, preferably 1 to 500, more preferably 1 to 200, and even more preferably 1 to 100, and most preferably n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 3 Selected from 7, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100.

[0009] In one embodiment, the magnetic field is an electromagnetic field, and the method further: e * ) Complete step d) and: either keep the user-definable electromagnetic field constant or switch the user-definable electromagnetic field off; and, The method includes a step of physically separating the plurality of magnetic particles from the permanent magnet immediately after reaching a certain user-definable electromagnetic field or immediately after switching off the user-definable electromagnetic field, before the plurality of magnetic particles adhere to the permanent magnet, such physical separation occurring by either removing the plurality of magnetic particles from the volume which are immersed in and distributed in the first liquid before the plurality of magnetic particles adhere to the permanent magnet, or removing the permanent magnet from the volume before the plurality of magnetic particles adhere to the permanent magnet; such removal of the plurality of magnetic particles or the permanent magnet leaves the magnetic particles dispersed in the first liquid.

[0010] In one embodiment, the magnetic field is an electromagnetic field, and the method further: e) Complete step d), and: maintain the user-definable electromagnetic field constant for a sufficient amount of time, allowing the plurality of magnetic particles to reattach to the permanent magnet, and holding the permanent magnet in a predetermined fixed position within the capacity. or Switching the user-definable electromagnetic field off for a sufficient amount of time allows the multiple magnetic particles to reattach to the permanent magnet, and allows the permanent magnet to sink to the bottom of the chamber and remain there. The process includes a step of performing one of the following:

[0011] In one embodiment, the method further includes step e): f) The procedure includes the step of removing the first liquid from the volume while the plurality of magnetic particles are attached to the permanent magnet and the permanent magnet is held in a predetermined fixed position within the volume or is located at the bottom of the chamber, thereby separating the first liquid from the plurality of magnetic particles that remain attached to the permanent magnet; g) The step of providing a second liquid different from the first liquid, introducing the second liquid into the volume, and enabling the permanent magnet and the plurality of magnetic particles attached thereto to be immersed in the second liquid.

[0012] In one embodiment, the method further includes steps f) and g): If step e) completes step d) and the user-definable electromagnetic field is kept constant: h) The step of maintaining the permanent magnet in a predetermined fixed position within the capacitance by keeping the user-definable electric field constant; Alternatively, if step e) completes step d) and switches off the user-definable electromagnetic field: h* ) re-generating a user-definable electromagnetic field outside the chamber, wherein the generated user-definable electromagnetic field exerts a magnetic force on the permanent magnet disposed in the volume, and the permanent magnet is held at a predetermined fixed position within the volume.

[0013] In one embodiment, step h) or step h * ), the method further comprises: i) changing said user-definable electromagnetic field and thereby the magnetic force exerted thereby, such that said permanent magnet rotates to align with said electromagnetic field, and a shear force acts on said magnetic fine particles, so that said magnetic fine particles move within said volume; preferably, during said movement, a majority of said plurality of magnetic fine particles, more preferably all of said plurality of magnetic fine particles, become detached from said permanent magnet, distributed and dispersed in said second liquid; preferably, in step i), changing said user-definable electromagnetic field comprises changing the position of said user-definable electromagnetic field, more preferably changing the position and polarity, even more preferably changing the position, polarity and frequency.

[0014] In one embodiment, with step i), the method further comprises: j) terminating step i), and: either maintaining said user-definable electromagnetic field constant again, or switching off said user-definable electromagnetic field again; and again, immediately after reaching a constant user-definable electromagnetic field or immediately after switching off said user-definable electromagnetic field; The method comprises a step of physically separating the plurality of magnetic particles from the permanent magnet before the plurality of magnetic particles adhere to the permanent magnet, such physical separation occurring by either removing the plurality of magnetic particles that are distributed and dispersed in the second liquid from the volume before the plurality of magnetic particles adhere to the permanent magnet, or by removing the permanent magnet from the volume before the plurality of magnetic particles adhere to the permanent magnet; such removal of the plurality of magnetic particles or the permanent magnet leaves the magnetic particles dispersed in the second liquid.

[0015] In one embodiment, the chamber is a tube-like chamber having at least one wall, the capacity for receiving the liquid and a plurality of magnetic particles enclosed by the at least one wall, and the chamber further has an upper end which may optionally be closed by a cap or seal.

[0016] In one embodiment, the tubular chamber further has a longitudinal axis, and the capacity for receiving the liquid and a plurality of magnetic particles extends along the longitudinal axis of the chamber; the chamber further has a lower end configured to be reversibly opened and closed by a valve, the lower end serving as an inlet for the liquid into the capacity, or serving as both an inlet for the liquid into the capacity and an outlet for the liquid from the capacity; the chamber further has an upper region, the upper region being located below and adjacent to the upper end, and formed by the upper part of at least one wall; and the upper region of the chamber having a permanent opening located in the at least one wall.

[0017] In one embodiment, the volume of the chamber has the shape of a frustocone, with the narrower end of the frustocone positioned at the lower end of the chamber and the wider end of the frustocone positioned at the upper end of the chamber.

[0018] In one embodiment, the first liquid is an aqueous liquid having an aqueous phase, and if provided according to step g), then the second liquid is a non-aqueous liquid having a non-aqueous phase, preferably an oil phase.

[0019] In a further embodiment, the present invention relates to a chamber 1 for processing magnetic particles configured for use in a method defined herein, wherein the chamber has a capacity 1.1 for receiving a liquid and a plurality of magnetic particles therein, a longitudinal axis and at least one wall 1.2; the capacity for receiving the liquid and a plurality of magnetic particles therein extends along the longitudinal axis of the chamber and is surrounded by the at least one wall; and the chamber further has an upper end 1.3 and a valve which may optionally be closed by a cap or seal 1.3.1 The chamber further has a lower end 1.4 configured to open and close reversibly; the lower end functions as an inlet for liquid into the volume, or as both an inlet for liquid into the volume and an outlet for liquid from the volume; the chamber further has an upper region 1.3.2, which is located below and adjacent to the upper end and is formed by the upper part 1.2.1 of at least one wall, and the upper region of the chamber has a permanent opening 1.3.3 located in the at least one wall; the chamber further has a freely movable permanent magnet 1.5 located within the volume.

[0020] In one embodiment, the chamber is a tubular chamber and has the shape of a frustocone, with the narrower end 1.4.1 of the frustocone positioned at the lower end of the chamber and the wider end 1.4.2 of the frustocone positioned at the upper end of the chamber.

[0021] In one embodiment, the permanent opening located in the upper region of the chamber is configured to function as an inlet for gas, in particular air, or as an outlet for gas or liquid; the permanent opening is either an opening without a closing mechanism that allows free access of material to and free exit of material from the chamber's volume, or an opening with a filter, such filter preferably configured to block particles larger than 100 μm or to self-seal in contact with liquid.

[0022] In a further embodiment, the present invention relates to a device 2 for performing a method for processing fine particles as defined herein, the device comprising a chamber 1 for processing magnetic fine particles as defined herein, an external magnet 2.1 and an actuator 2.2; the external magnet is positioned near the chamber for processing the magnetic fine particles and exerts a magnetic force on a freely movable permanent magnet positioned within the volume of the chamber, and the freely movable permanent magnet is held in a predetermined fixed position within the volume; the external magnet is an electromagnet or a permanent magnet; and the positioning of the external magnet relative to the chamber is achieved by the actuator.

[0023] In yet further embodiments, the present invention also relates to a chamber 3 for culturing and detecting microparticles, particularly magnetic microparticles, and in particular for performing and detecting chemical / biochemical reactions using the microparticles, such as amplification reactions using the microparticles, wherein the chamber for culturing and detecting the microparticles is a two-part chamber and: - Having a first compartment 3.1 having a first capacity 3.1.1, the first compartment is configured for a process of concentrating the fine particles in a suspension system of the fine particles in a liquid surrounding the fine particles, the process of concentrating in the first capacity utilizing the density difference between the fine particles and the liquid surrounding the fine particles; the first compartment has an inlet opening 3.1.2 and an outlet opening 3.1.3, the inlet opening and the outlet opening respectively allowing the liquid or suspension system to flow into and out of the first capacity; - Having a second compartment 3.2 having a second capacity 3.2.1, the second compartment is configured to contain the concentrated microparticles in a tightly packed arrangement within the second capacity, and the second compartment is configured for thermal cultivation and detection of the microparticles arranged in a tightly packed arrangement; the second compartment has an inlet opening 3.2.2 and an outlet opening 3.2.3, each of which allows a liquid or suspension system to flow into and out of the second capacity, and each of which has a reversibly closing inlet valve 3.2.2.1 and outlet valve 3.2.3.1, each of which allows for the reversible closure of the inlet opening 3.2.2 and the outlet opening 3.2.3, and thus, when both valves are closed, the second capacity 3.2.1 can be sealed; The first compartment 3.1 and the second compartment 3.2 are fluidically connected to each other through the inlet opening 3.2.2 of the second compartment, and when the inlet valve 3.2.2.1 is open, the suspension system of concentrated particulate matter flows from the first volume into the second volume.

[0024] In one embodiment, the first compartment configured for a process of concentrating particulate matter within the first volume is either a riser tube or a dropper tube, the riser tube and the dropper tube each having an upper end 3.1.4 and a lower end 3.1.5, and if the first compartment is a riser tube, the riser tube is fluidly connected to the inlet opening 3.2.2 of the second compartment at the upper end 3.1.4 of the riser tube via the inlet valve 3.2.2.1 of the second compartment and the outlet opening 3.1.3 of the first compartment, and if the first compartment is a dropper tube, the dropper tube is fluidly connected to the inlet opening 3.2.2 of the second compartment at the lower end 3.1.5 of the dropper tube via the inlet valve 3.2.2.1 of the second compartment and the outlet opening 3.1.3 of the first compartment.

[0025] In one embodiment, the second compartment has a frame 3.2.4 surrounding the second volume 3.2.1, the frame having side walls 3.2.4.1, 3.2.4.1', an upper wall 3.2.4.2 and a lower wall 3.2.4.3 located opposite the upper wall, the lower wall preferably parallel to the upper wall; the second volume 3.2.1 is surrounded by the side walls 3.2.4.1, 3.2.4.1', the upper wall 3.2.4.2 and the lower wall 3.2.4.3; and one of the upper wall and the lower wall, preferably the upper wall, is connected to an optical sensor. A transparent wall configured to be collided with; and the other of the upper wall and the lower wall, preferably the lower wall, is a wall having low thermal resistivity and is configured to be in contact with a temperature control device; preferably, the distance between the upper wall and the lower wall is in the range of 10um to 500um, more preferably in the range of 20um to 300um, more preferably in the range of 50um to 250um, more preferably in the range of 50um to 200um, and even more preferably in the range of 100um to 200um.

[0026] In one embodiment, the inlet opening 3.2.2 and the outlet opening 3.2.3 are formed of or have an elastomer material, and the inlet valve 3.2.2.1 and the outlet valve 3.2.3.1 each have a first closing means and a second closing means configured to be independently pressed against or inserted into the inlet opening and the outlet opening, thereby compressing the elastomer material, and thereby reversibly closing the inlet opening and the outlet opening in a pressure-resistant manner, thereby allowing the pressure to rise in the second compartment, preferably the first closing means and the second closing means are independently selected from rods, bars, sticks, strips, pillars, clamps, clips and clasps.

[0027] In one embodiment, the upper and lower walls of the second volume are spaced apart and held in place by at least one spacer pillar 3.2.4.4 located within the second volume and in contact with the upper and lower walls, thereby preventing the upper and lower walls from collapsing; preferably, the upper and lower walls are evenly distributed within the second volume and spaced apart and held in place by two, three, four, five, or more spacer pillars located within the second volume and in contact with the upper and lower walls, thereby preventing the upper and lower walls from collapsing.

[0028] In one embodiment, the outlet opening 3.2.3 of the second capacity is permanently open and connected to a conduit 3.2.5 that functions as a vent; preferably, the conduit has a filter 3.2.5.1 configured to contain particles larger than 100 μm or to self-seal upon contact with a liquid.

[0029] In one embodiment of a processing chamber or a culture and detection chamber as defined herein, the chamber further preferably comprises a plurality of magnetic microparticles 5 dispersed in a liquid, wherein the liquid is an aqueous or non-aqueous phase when the chamber is a chamber for processing magnetic microparticles, and is a non-aqueous phase when the chamber is a chamber for culturing and detecting microparticles.

[0030] In yet another embodiment, the present invention also relates to a liquid handling and processing tool 4 for establishing a fluid connection to or from a chamber and / or for realizing a flow of liquid to or from a chamber, wherein the liquid handling and processing tool is: - Having a housing 4.1, the housing includes a central space 4.1.1 and a number of chambers 4.1.2, 4.1.2', 4.1.2'' arranged around the central space 4.1.1 for holding reagents or for receiving liquids; - A fluid displacement chamber 4.2 having an upper end 4.2.1 and a lower end 4.2.2, the fluid displacement chamber surrounding a volume 4.2.3 for receiving, handling, and moving a liquid, the volume 4.2.3 for receiving and handling a liquid having an upper part 4.2.3.1 and an adjacent lower part 4.2.3.2, the upper part 4.2.3.1 being cylindrical, and the adjacent lower part 4.2.3.2 being conical or frustoconical, the cone or frustoconical being positioned upside down within the fluid displacement chamber 4.2, the narrower portion 4.2.3.2.1 of the cone or frustoconical being positioned at the lower end 4.2.2 of the fluid displacement chamber, and the wider portion 4.2.3.2.2 of the cone or frustoconical being transitioning into the upper part 4.2.3.1 of the volume; The fluid displacement chamber 4.2 further has a movable piston 4.2.4 positioned in the upper part 4.2.3.1 of the volume 4.2.3 and fitted tightly therein, wherein the piston is movable within the upper part 4.2.3.1 of the volume but not within the adjacent lower part 4.2.3.2 of the volume, or not within the adjacent lower part 4.2.3 of the volume; The fluid displacement chamber 4.2 is located in the central space 4.1.1 of the housing 4.1, and the plurality of chambers 4.1.2, 4.1.2', 4.1.2'' are arranged around the fluid displacement chamber 4.2; - The chamber has a valve 4.3, which is located at the lower end 4.2.2 of the fluid displacement chamber 4.2 and allows for the establishment of a single fluid connection from the fluid displacement chamber 4.2 to a selected chamber from among the plurality of chambers 4.1.2, 4.1.2', 4.1.2''.

[0031] In one embodiment, - The housing 4.1 further has at least one interface 4.1.3 ("processing interface") for fluidly connecting a separate chamber 1 for processing microparticles as defined herein to the housing 4.1; and / or the housing 4.1 further has at least one interface 4.1.4 ("culture interface") for fluidly connecting a separate chamber 3 for culturing and detecting microparticles as defined herein to the housing 4.1; - The valve (4.3) located at the lower end 4.2.2 of the fluid displacement chamber 4.2 allows for the establishment of a single fluid connection from the fluid displacement chamber 4.2 to either the at least one interface 4.1.3 for fluidly connecting a selected chamber from a plurality of chambers 4.1.2, 4.1.2', 4.1.2'' or a separate chamber 1 for processing the microparticles as defined herein, or the at least one interface 4.1.4 for fluidly connecting a separate chamber 3 for culturing and detecting the microparticles as defined herein.

[0032] In one embodiment, the valve (4.3) located at the lower end 4.2.2 of the fluid displacement chamber 4.2 is configured to establish a series of single fluid connections, i.e., one single fluid connection at a given time, in which one single fluid connection is established in succession, and the one single fluid connection is from the fluid displacement chamber 4.2 to a selected chamber from the plurality of chambers 4.1.2, 4.1.2', 4.1.2'' or to one of the interfaces 4.1.3, 4.1.4, and preferably the valve (4.3) is a rotary valve.

[0033] In one embodiment, the liquid handling and processing tool further comprises a chamber 1 for processing fine particles as defined herein, the chamber 1 for processing the fine particles being fluidly connected to the processing interface 4.1.3.

[0034] In one embodiment, the liquid handling and processing tool further comprises a chamber 3 for culturing and detecting particulate matter as defined herein, the chamber 3 for culturing and detecting particulate matter being fluidly connected to the culture interface 4.1.4.

[0035] In one embodiment, the liquid handling and processing tool further comprises a chamber 1 for processing fine particles as defined herein, the chamber 1 for processing fine particles being fluidically connected to the processing interface 4.1.3; and further comprises a chamber 3 for culturing and detecting fine particles as defined herein, the chamber 3 for culturing and detecting fine particles being fluidically connected to the culturing interface 4.1.4.

[0036] In one embodiment, the liquid handling and processing tool further comprises a plurality of magnetic microparticles 5; preferably, the magnetic microparticles are placed in either a chamber 1 for processing the microparticles or a chamber 3 for culturing and detecting the microparticles.

[0037] In one embodiment, the liquid handling and processing tool further comprises an aqueous phase and a separate non-aqueous phase.

[0038] In yet another embodiment, the present invention also relates to a process for housing microparticles in a tightly packed arrangement configuration within the volume of a chamber 3 for culturing and detecting microparticles, wherein the process is: a) The process includes the steps of providing a chamber 3 for culturing and detecting microparticles as defined herein, and a plurality of microparticles 5 dispersed in a liquid, in any order; preferably, the liquid is a non-aqueous liquid, and more preferably, has an oil phase; b) The process includes the step of introducing the plurality of fine particles 5 dispersed in the liquid into the first compartment 3.1 of the chamber 3 for culturing and detecting the fine particles, and concentrating the fine particles in the first volume 3.1.1 of the first compartment 3.1 by utilizing the density difference between the fine particles and the liquid surrounding the fine particles; c) The procedure includes the step of housing the plurality of particles 5 in a tightly packed arrangement in the second volume 3.2.1 of the second compartment 3.2 of the chamber 3 for culturing and detecting the fine particles, the step of discharging the concentrated fine particles from the first volume 3.1.1 of the first compartment 3.1 and introducing them into the second volume 3.2.1 of the second compartment 3.2 through the inlet opening 3.2.2; and discharging the plurality of fine particles from the first compartment 3.1 This is accomplished by continuously discharging the plurality of particles from the first volume 3.1.1 into the second volume 3.2.1, closing the outlet opening 3.2.3 when a first portion of the plurality of particles reaches the second volume 3.2.1 or the outlet opening 3.2.3, thereby increasing the pressure in the second compartment 3.2, and closing the inlet opening 3.2.2 when all of the plurality of particles have been introduced into the second compartment 3.2.

[0039] In one embodiment, for step b), the density of each of the fine particles is selected to be different from the density of the liquid in which the fine particles are dispersed, and step b) is accompanied by allowing the fine particles to accumulate at the upper end 3.1.4 of the first volume 3.1 if the density of each of the fine particles is less than the density of the liquid in which the fine particles are dispersed; or step b) is accompanied by allowing the fine particles to accumulate at the lower end 3.1.5 of the first volume 3.1 if the density of each of the fine particles is greater than the density of the liquid in which the fine particles are dispersed.

[0040] In one embodiment, the densely packed arrangement in step c) is a single layer of fine particles, and the fine particles are tightly packed within the single layer.

[0041] In one embodiment, the chamber 3 for culturing and detecting the microparticles is a chamber as defined herein and has a frame 3.2.4 surrounding the second volume 3.2.1, the frame 3.2.4 having side walls 3.2.4.1, 3.2.4.1', an upper wall 3.2.4.2 and a lower wall 3.2.4.3 located opposite to the upper wall 3.2.4.2, the lower wall and the upper wall being parallel to each other; the second volume 3.2.1 is surrounded by the side walls 3.2.4.1, 3.2.4.1', the upper wall 3.2.4.2 and the lower wall 3.2.4.3; one of the upper wall 3.2.4.2 and the lower wall 3.2.4.3 is a transparent wall configured to be collated by an optical sensor; and the other of the upper wall and the lower wall is a wall having low thermal resistivity and configured to be in contact by a temperature control device; The number of particles dispersed in the liquid is selected so as not to exceed the maximum number of particles that can be arranged in a single layer between the upper wall 3.2.4.2 and the lower wall 3.2.4.3 in the second compartment 3.2, and the single layer has as close packing as possible; or the number of particles dispersed in the liquid is selected so as to cover an area equal to or smaller than the area provided by the upper wall 3.2.4.2 or the lower wall 3.2.4.3 when the particles are arranged in a single layer between the upper wall 3.2.4.2 and the lower wall 3.2.4.3 in the second compartment 3.2 with as close packing as possible.

[0042] Preferred aspects and embodiments of the invention In a first embodiment, the present invention relates to a method for processing fine particles, in particular to a method in which magnetic fine particles are exposed to a liquid and / or a dispersion system of magnetic fine particles is generated. Such a method is: a) The process comprises the steps of providing a first liquid, a plurality of magnetic particles, and a chamber having a capacity for receiving the liquid and the plurality of magnetic particles in any order; the chamber further has a freely movable permanent magnet disposed within the capacity; b) The step of introducing the first liquid and the plurality of magnetic particles into the volume of the chamber in any order, and enabling the plurality of magnetic particles to be immersed in the first liquid, distributed within the first liquid, attracted to the freely movable permanent magnet, and preferably adhering to the freely movable permanent magnet; c) comprising the step of generating a user-definable magnetic field, preferably a user-definable electromagnetic field, outside the chamber, wherein the generated user-definable magnetic field, preferably the user-definable electromagnetic field, exerts a magnetic force on the permanent magnets placed within the capacity, and the permanent magnets are held in a predetermined fixed position within the capacity; d) The step of changing the user-definable magnetic field, preferably the user-definable electromagnetic field, and thereby the magnetic force produced, wherein the permanent magnet rotates to align with the magnetic field, preferably the electromagnetic field, and a shear force acts on the magnetic particles so that the magnetic particles move within the volume, preferably during such movement, most of the plurality of magnetic particles, preferably all of the plurality of magnetic particles, are detached from the permanent magnet and distributed and dispersed within the first liquid.

[0043] As a result of performing steps a) to d) of the method, the fine particles are exposed to and intermittently mixed with the liquid, thereby creating a dispersion of the fine particles in the liquid. The chamber provided in a) has a freely movable permanent magnet located within the volume of the chamber. It should be noted that although the permanent magnet is freely movable within the volume of the chamber, in a preferred embodiment it is typically permanently located within the volume of the chamber and is an integral part thereof. Preferably it is not removed from the chamber at all.

[0044] In a preferred embodiment, when the first liquid and a plurality of magnetic particles are introduced into the volume of the chamber during step b), such magnetic particles are immersed in and distributed within the first liquid, and they are also attracted to the freely movable permanent magnets positioned within the volume of the chamber. Because the particles are magnetized, they will typically also subsequently and eventually adhere to the freely movable permanent magnets. As a result of the free movement of the permanent magnets within the chamber, any magnetic field generated outside the chamber may exert a magnetic force on the permanent magnets and thus move, align, and / or hold the permanent magnets in a predetermined fixed position within the volume of the chamber (step c). Subsequently, if a user-definable magnetic field, preferably a user-definable electromagnetic field outside the chamber, is changed during step d) for example with respect to its position, intensity, polarity, or frequency, the magnetic force exerted by the magnetic field will also change, and as a result the permanent magnet will move, shift, and / or rotate to adapt to and realign with such change in the magnetic field. As a result of such movement, shift, or rotation, there will be shear forces acting on the magnetic particles, and as a result the magnetic particles will move within the volume of the chamber. If such magnetic particles were previously attached to the permanent magnet, some or all of these previously attached magnetic particles will be detached from the permanent magnet and distributed and dispersed in the first liquid. The result of this step will therefore be a dispersion of magnetic particles in the first liquid.

[0045] In one preferred embodiment, the external user-definable magnetic field generated outside the chamber in step c) and modified in step d) is a user-definable electromagnetic field.

[0046] In one embodiment, in step d), changing the user-definable magnetic field, preferably an electromagnetic field, involves changing at least one of the following items, the item being: - position, - Polarity (when the magnetic field is a direct current (DC) electromagnetic field), - Frequency (the magnetic field is an alternating current (AC) electromagnetic field), and, - strength Such a change is preferably a change in the position of such a field, more preferably a change in position and polarity, and even more preferably a change in position, polarity and frequency.

[0047] In one embodiment, step d) is performed n times, resulting in n changes in the user-definable magnetic field. This leads to repeated shear forces acting on the magnetic particles, causing them to move within the chamber's volume for an extended period. Typically, n is an integer in the range of 1 to 1000, preferably 1 to 500, more preferably 1 to 200, and even more preferably 1 to 100.

[0048] In one embodiment, the magnetic field is an electromagnetic field, and this method further: e *) Complete step d), and: perform either maintaining the user-definable electromagnetic field constant or switching the user-definable electromagnetic field off; and immediately after reaching a constant user-definable electromagnetic field or immediately after switching the user-definable electromagnetic field off, physically separate the plurality of magnetic particles from the permanent magnet before the plurality of magnetic particles adhere to the permanent magnet (again). In this embodiment, physical separation is achieved by removing the plurality of magnetic particles immersed in and distributed in the first liquid from the volume, for example by aspirating the liquid containing the particles from the chamber (e.g., pipetting, suction, or other means of creating negative pressure over such liquid containing the particles). Alternatively, such liquid may also be removed from there by draining the liquid from the volume (e.g., by a pump or other means of creating positive pressure over the liquid). Alternatively, though less preferred, such physical separation of the plurality of magnetic particles from the permanent magnet may also occur by removing the permanent magnet from the volume. This is less preferred because, typically, the freely movable permanent magnet is intended to be permanently placed within the chamber, while the liquid containing the plurality of magnetic particles may be easily removed from such chamber and further processed elsewhere, for example, in another chamber located near the (current) processing chamber. The dispersion system of magnetic particles in the first liquid may then be used elsewhere and further processed or subjected to other actions.

[0049] In addition to steps a) to d), step e * An embodiment of the method for processing the aforementioned magnetic particles, which also have ), is an embodiment of the method that brings a dispersion of magnetic particles in a first liquid, which can then be used for other purposes or further processed. Step e * ) is a harvesting step that brings a dispersion system of magnetic nanoparticles into the first liquid.

[0050] Alternatively, a method having steps a) to d) further has step e) (step e * The user-definable electromagnetic field may have, rather than, that the user-definable electromagnetic field is kept constant for a sufficient amount of time, allowing the plurality of magnetic particles to reattach to the permanent magnet and the permanent magnet to be held in a predetermined fixed position within the capacity; or the user-definable electromagnetic field is switched off for a sufficient amount of time, allowing the plurality of magnetic particles to reattach to the permanent magnet and the permanent magnet to sink to and be located at the bottom of the chamber. The user-definable electromagnetic field may have, but step e * Embodiments of this method that do not have the above-mentioned multiple magnetic particles result in the multiple magnetic particles reattaching to the permanent magnet within the chamber. Depending on whether a user-definable electromagnetic field is kept constant or switched off, the permanent magnet may be positioned at different locations within the volume of the chamber. For example, a constant electromagnetic field may hold the permanent magnet at any predetermined fixed position within the volume. However, if the electromagnetic field is switched off, the permanent magnet will then sink to the bottom of the chamber and be located there. Typically, the chamber has an upper end which may be closed by a cap or seal and a lower end configured to be reversibly opened and closed by a valve, the lower end serving as an inlet for liquid into the volume, or serving as an inlet for liquid into the volume of the chamber and an outlet for liquid from the volume of the chamber. The bottom of the chamber where the permanent magnet will sink when the electromagnetic field is switched off is located at the lower end of the chamber.

[0051] In an embodiment of the method having step e), the first liquid can then be separated from the volume of the chamber. In such an embodiment, the method further: f) removing said first liquid from said volume while said plurality of magnetic fine particles are attached to said permanent magnet and said permanent magnet is held at a predetermined fixed position within said volume or is present at the bottom of said chamber, thereby separating said first liquid from said plurality of magnetic fine particles remaining attached to said permanent magnet; g) providing a second liquid different from said first liquid, and introducing said second liquid into said volume of said chamber, thereby allowing said permanent magnet and said plurality of magnetic fine particles attached thereto to be exposed to and / or immersed in said second liquid. In such an embodiment, said method further comprises: if step e) ends step d) and said user-definable electromagnetic field is maintained constant: h) continuing to hold said permanent magnet at the predetermined fixed position within said volume by maintaining said user-definable electromagnetic field constant; or, if step e) ends step d) and said user-definable electromagnetic field is switched off: h * ) re-generating a user-definable electromagnetic field outside of said chamber, wherein said generated user-definable electromagnetic field exerts a magnetic force on said permanent magnet disposed within said volume, such that said permanent magnet is held at a predetermined fixed position within said volume.

[0052] In still further, more specific embodiments, said method further comprises: i) The step may include changing the user-definable electromagnetic field and thus the resulting magnetic force, such that the permanent magnet rotates to align with the electromagnetic field, and a shear force acts on the magnetic particles so that the magnetic particles move within the volume, preferably during such movement, most of the plurality of magnetic particles, more preferably all of the plurality of magnetic particles, are separated from the permanent magnet and distributed and dispersed within the second liquid; preferably, in step i), changing the user-definable electromagnetic field involves a change in the position, more preferably in the position and polarity, more preferably in the position, polarity and frequency of the user-definable electromagnetic field.

[0053] In one embodiment of the method having step i), step i) is preferably performed m times, where m is an integer in the range of 1 to 1000, preferably 1 to 500, more preferably 1 to 200, and even more preferably 1 to 100, and most preferably m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 3 Selected from 3, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100.

[0054] To reiterate, such a user-definable change in the electromagnetic field would result in a change in the magnetic force exerted on the magnetic particles, causing a shear force to act on them, which in turn would cause them to move within the volume, during which time most of the plurality of magnetic particles, more preferably all of them, would be detached from the permanent magnet and distributed and dispersed within the second liquid.

[0055] An embodiment of the method for processing fine particles having step i) may further have another step, which is: j) Complete step i), and: again, either maintain the user-definable electromagnetic field constant, or switch the user-definable electromagnetic field off again; and, Again, immediately after reaching a certain user-definable electromagnetic field or immediately after switching off the aforementioned user-definable electromagnetic field; The step is to physically separate the plurality of magnetic particles from the permanent magnet before the plurality of magnetic particles adhere to the permanent magnet, such physical separation occurring by either removing the plurality of magnetic particles that are distributed and dispersed in the second liquid from the volume before the plurality of magnetic particles adhere to the permanent magnet, or by removing the permanent magnet from the volume before the plurality of magnetic particles adhere to the permanent magnet; such removal of the plurality of magnetic particles or the permanent magnet leaves the magnetic particles dispersed in the second liquid.

[0056] This particular embodiment involves another step of harvesting the dispersion of magnetic particles in a liquid (in this case, the second liquid). Removing the magnetic particles from the volume of the chamber may be done by any suitable means that allows the dispersion of magnetic particles in the second liquid to be removed from the volume. For example, this may be suction such as pipetting, aspiration, or other means for applying negative pressure to the liquid, or alternatively, it may be done by draining the dispersion (i.e., the second liquid and the magnetic particles dispersed therein) from the volume of the chamber. Such draining may be done by a pump or other means for applying positive pressure to the dispersion in the chamber.

[0057] In any of the embodiments of the method for processing, the chamber is preferably a tube-like chamber having at least one wall, the capacity for receiving the liquid and the plurality of magnetic particles surrounded by the at least one wall, and the chamber further has an upper end which may optionally be closed by a cap or seal.

[0058] In a preferred embodiment of such a tubular chamber, the cross-section of the chamber is circular, elliptical, or otherwise rounded.

[0059] In a more preferred embodiment of the tube-like chamber, it has a longitudinal axis, the capacity for receiving the liquid and a plurality of magnetic particles extends along the longitudinal axis of the chamber, the chamber further has a lower end configured to be reversibly opened and closed by a valve, the lower end serving as an inlet for the liquid into the capacity, or serving as both an inlet for the liquid into the capacity and an outlet for the liquid from the capacity; the chamber further has an upper region, the upper region being located below and adjacent to the upper end and formed by the upper part of at least one wall, and the upper region of the chamber having a permanent opening located in the at least one wall. At the lower end of the chamber is the bottom of the chamber, which is the bottom where the permanent magnet will be submerged, and the permanent magnet may be present there if an external user-definable electromagnetic field is switched off.

[0060] In any of the embodiments of the method for processing, the volume of the chamber preferably has the shape of a frustocone, the frustocone having a narrow end and a wide end, the chamber having a lower end and an upper end, the lower end being configured to be reversibly opened and closed by a valve, the lower end serving as an inlet for liquid into the volume or serving as both an inlet for liquid into the volume and an outlet for liquid from the volume, the chamber further having an upper end which may optionally be closed by a cap or seal, the narrow end of the frustocone being located at the lower end of the chamber, and the wide end of the frustocone being located at the upper end of the chamber.

[0061] In a preferred embodiment of the method according to the present invention, the first liquid is an aqueous liquid having an aqueous phase, and the second liquid, if provided in step g), is a non-aqueous liquid having a non-aqueous phase, preferably an oil phase.

[0062] A method for processing magnetic microparticles according to the present invention enables the easy preparation of a dispersion system of magnetic microparticles in a liquid and the exposure of magnetic microparticles to such a liquid. It further enables and facilitates the preparation of magnetic microparticles and the sequential exposure of magnetic microparticles to a series of different liquids, during which the magnetic microparticles may be dispersed sequentially in the different liquids. For example, if the first liquid is an aqueous liquid having an aqueous phase, the resulting dispersion system of magnetic microparticles therein will be an aqueous dispersion. Similarly, if the second liquid is a non-aqueous liquid having a non-aqueous phase such as an oil phase, the resulting dispersion system will be a non-aqueous dispersion.

[0063] As used herein, the term “microparticles” is intended to refer to particles whose average dimensions are in the micrometer range. In one embodiment, microparticles according to the present invention have an average size or average dimension or average diameter of approximately 1 μm to 200 μm, preferably 5 μm to 150 μm, and more preferably 10 μm to 100 μm. In one embodiment, microparticles according to the present invention are spherical, elliptical, or ellipsoidal, preferably spherical, and the above dimensions refer to the average diameter of such spherical, elliptical, or ellipsoidal microparticles. In one embodiment, the microparticles have the shape of (spherical) droplets. In another embodiment, microparticles according to the present invention are spherical or quasi-spherical, i.e., have the shape of a sphere (or something similar), and such spheres have an average diameter of the above dimensions.

[0064] In principle, any microparticles may be treatable by the method for treating microparticles according to the present invention. In a preferred embodiment, the microparticles treated in the method according to the present invention are sometimes referred to herein as “beads” or “nanoractor beads.” This is mainly because such beads may have a suitable void capacity for receiving reagents to carry out a particular chemical or biochemical reaction. Since such microparticles are sometimes referred to as “beads” or “nanoractor beads,” the chamber for treating microparticles according to the present invention is sometimes referred to as a “bead processing chamber,” “bead processing chamber,” or “BPC.”

[0065] The only prerequisite for microparticles (or beads or nanoreactor beads) to be processable according to the present invention is that such microparticles (or beads or nanoreactor beads) must be magnetic. Such magnetic properties may be achieved, for example, by the fact that the microparticles contain even smaller magnetic particles that are small enough to be incorporated into the microparticles.

[0066] Suitable fine particles used in a method for processing according to the present invention are disclosed, for example, in International Patent Application No. PCT / EP2022 / 080978, filed by the present applicant on November 7, 2022, or in International Patent Application No. PCT / EP2020 / 086171, also filed by the present applicant on December 15, 2020.

[0067] When used herein in relation to particles, the term “magnetic” is intended to mean “magnetic particles” that exhibit magnetic behavior and can be incorporated into each of the microparticles processed by the method according to the present invention. The dimensions of such “magnetic particles” depend largely on the dimensions of each of the “microparticles” into which they are incorporated. For example, if the microparticles processed according to the method according to the present invention have an average size or dimension or diameter of approximately 1 μm to 200 μm, or 5 μm to 150 μm, or 10 μm to 100 μm, then the corresponding magnetic particles incorporated into the microparticles must be smaller than such microparticles. In one embodiment, as used herein, the “magnetic particles” have a size and average diameter or average longitudinal spread in one direction that is preferably in the range of 50 nm to 10 μm, preferably 100 nm to 5 μm, more preferably 1 μm to 5 μm, and even more preferably 1 μm to 3 μm. In the present invention, when magnetic particles are used to impart magnetic properties to fine particles to be processed, such “magnetic particles” are, in one embodiment, ferromagnetic particles. In another embodiment, such magnetic particles are paramagnetic particles. In yet another embodiment, such magnetic particles are ferrimagnetic particles. In yet another embodiment, such magnetic particles are superparamagnetic particles. In a preferred embodiment, the magnetic particles incorporated into the fine particles are ferromagnetic or paramagnetic particles. As used herein, the term “magnetic particles” means to exclude diamagnetic particles. In one embodiment, as used herein, the magnetic particles have a size and average diameter or average longitudinal spread in one direction, preferably in the range of 50 nm to 10 μm, more preferably 100 nm to 5 μm, more preferably 1 μm to 5 μm, and even more preferably 1 μm to 3 μm.

[0068] The term “dispersion of particulate matter” refers to a mixture of particulate matter in a liquid phase. This term is sometimes used herein as synonymous with “suspension of particulate matter.” As used herein, “suspension of particulate matter” refers to a dispersion in which small solid or semi-solid particles (i.e., particulate matter) are distributed in a liquid phase. As used herein, “dispersion” is generally intended to refer to a heterogeneous mixture in which two distinct phases can be identified.

[0069] In another aspect, the present invention also relates to a chamber for processing magnetic microparticles, the chamber being configured for use in a method for processing microparticles according to the present invention as described herein. According to the present invention, the chamber for processing magnetic microparticles has a capacity for receiving a liquid and a plurality of magnetic microparticles therein, a longitudinal axis, and at least one wall. The capacity for receiving the liquid and the plurality of magnetic microparticles therein extends along the longitudinal axis of the chamber and is surrounded by the at least one wall. Furthermore, the chamber has a cap or seal that closes, or a lower end configured to be reversibly opened and closed by a closable upper end and a valve. The lower end of the chamber functions as an inlet for the liquid into the capacity of the chamber, or as an inlet for the liquid into the capacity of the chamber and an outlet for the liquid from the capacity. Furthermore, the chamber for processing has an upper region, the upper region being located below and adjacent to the upper end and formed by the upper part of the at least one wall, and the upper region of the chamber has a permanent opening located in the at least one wall. In addition, according to the present invention, a chamber for processing magnetic particles further comprises a freely movable permanent magnet disposed within the volume of the chamber. Although such a permanent magnet is freely movable, it is typically permanently disposed within the volume and not removed therefrom. Thus, the freely movable permanent magnet disposed within the volume of the chamber is an integral part of the chamber.

[0070] In a preferred embodiment, the chamber is a tubular chamber and has the shape of a frustocone. Such a frustocone has a narrow end and a wider end on the opposite side. The narrow end of the frustocone is located at the lower end of the chamber, and the wider end of the frustocone is located at the upper end of the chamber.

[0071] In this specification, when used in the context of this frustum of a cone, the terms “narrow end” and “wide end” or “narrow end” and “wide end” are intended to indicate that the two ends differ in their width or cross-section, with the narrower (or narrower) end having a smaller width or cross-section than the wider (or wider) end.

[0072] A permanent opening located in the upper region of the chamber is configured to function as an inlet for gas, particularly air, or as an outlet for gas or liquid. The permanent opening is either an opening without a closing mechanism, allowing free access of material to and from the chamber's volume, or an opening with a filter. Such a filter is preferably configured to block particles larger than 100 μm or to self-seal in contact with liquid.

[0073] In this specification, the term “functioning as a gas inlet” as used in the context of an opening (e.g., a permanent opening) preferably means describing a scenario in which such an opening is an inlet for a gas (e.g., air) when in use, and which allows for the inflow of a gas (e.g., air) into a chamber in which such an opening is located or in which such an opening is located.

[0074] In this specification, the term "functioning as an outlet for gas or liquid" in the context of an opening (e.g., a permanent opening) preferably means describing a scenario in which such an opening is an outlet for gas or liquid when in use and allows for the outflow of gas or liquid from a chamber in which such an opening is located or in which it is located.

[0075] It should be noted that while the chambers for processing microparticles as defined herein are intended to be used in combination with microparticles (i.e., in methods for processing microparticles, also defined herein), they do not necessarily contain microparticles and may be used for purposes other than processing microparticles. For example, the chambers for processing microparticles as defined herein may also be used for processing biological samples, particularly for dissolving biological samples. In such cases, the chambers for processing microparticles as defined herein have ceramic particles intended to facilitate the process of mechanical dissolution of the biological sample. Structurally, the chambers for processing microparticles used for the purpose of processing (e.g., dissolution) such biological samples are as defined herein, except that they contain ceramic particles.

[0076] As used herein, the terms “ceramic particles,” “ceramic microparticles,” or “ceramic beads” are interchangeable and refer to solid particles used to mechanically destroy, dissolve, and homogenize biological samples. Such beads may be made from ceramics, silicon carbide, glass, zirconium silicate, zirconium oxide, stainless steel, garnet, and other materials. When used in a chamber for processing, they are typically moved violently within the chamber, leading to the destruction of the biological sample also placed in the chamber. An example of such ceramic particles is zirconium oxide particles. Typically, such ceramic particles are not magnetized, but they may be moved within a chamber being processed according to the present invention, and this movement, due to the movement of freely movable permanent magnets placed within it, leads to violent and disorderly mixing and movement of any liquid and any particles (including such ceramic particles) placed in the chamber. Effectively, this enables a grinding process, which, when performed in the presence of a biological sample (e.g., blood), leads to the grinding, destruction, and / or dissolution of solid or membrane components (such as biological cells) within such biological sample. According to embodiments of the present invention, ceramic particles are typically used alone in any particular chamber of a cartridge (i.e., in the absence of other fine particles or components whose structural integrity should be preserved), but ceramic particles may and may still be used together with a suitable liquid medium such as a dissolution buffer or other (soluble or soluble) components. Typically, ceramic particles are not used in the presence of other particles, such as magnetic particles, whose structural integrity should be preserved, as described herein, because there is always a risk that these other particles (e.g., magnetic particles) will be destroyed by the rough and vigorous movement of the ceramic particles.

[0077] As used herein, “biological sample” is intended to mean any sample obtained from the body of an organism, which may or may not have been further processed to make, for example, an analyte of interest accessible or suitable for further analysis. Such a sample may be a liquid sample, such as body fluids or components thereof, or a biological tissue or components thereof. Preferably, such a “sample” is selected from liquids such as blood, plasma, serum, urine, sweat, tears, sputum, lymph, semen, ascites, amniotic fluid, bile, breast milk, synovial fluid, peritoneal fluid, pericardial fluid, cerebrospinal fluid, mucus, and chyle, or from “solids” such as tissue, tissue portion, biological cells, cell cultures, or swabs, smears, or wipes containing biological cells and / or body fluids.

[0078] A chamber for performing a processing method according to the embodiments described herein is suitable for performing a method for processing particulate matter according to the present invention. For example, it may also be part of a liquid handling and processing tool (=cartridge) described herein. However, as such, the processing chamber is a standalone entity that can be used alone. In a typical embodiment of such a processing chamber, it should be used in combination with an external magnet located nearby. Such an external magnet does not constitute part of the processing chamber. The combination of the processing chamber and the external magnet according to the present invention is a distinct entity, and such a combination of the processing chamber and the external magnet constitutes another aspect of the present invention. Such a particular aspect is also referred herein to as a device for performing a method for processing particulate matter according to the present invention.

[0079] Accordingly, in a further embodiment, the present invention relates to a device for carrying out a method for processing fine particles according to the present invention, the device having a chamber for processing magnetic fine particles as described herein and, in particular, as described in the embodiments described above. Furthermore, the device has an external magnet and an actuator. In such a device, the external magnet is positioned near the chamber for processing magnetic fine particles and exerts a magnetic force on the freely movable permanent magnet positioned within the volume of the chamber, and the freely movable permanent magnet is held in a predetermined fixed position within the volume. The external magnet may be an electromagnet or a permanent magnet. Positioning of the external magnet relative to the chamber is achieved by the actuator. Furthermore, if the external magnet is an electromagnet, the device further has an electrical circuit and means for changing the position, polarity, frequency and / or intensity of the electromagnetic field. In one embodiment, the external magnet is an electromagnet and has a C-shaped core with a coil wound in its center. The C-shaped core may be shaped like a pair of bull horns (right horn and left horn) with their ends facing each other. In one embodiment, the C-shaped core is preferably positioned near a chamber for processing the magnetic particles, such that the chamber is located between the left and right corners of the C-shaped core. The C-shaped core is more preferably rotated about the longitudinal axis of the coil wound around the center of the core. This rotational motion is converted into selective positioning of a freely movable permanent magnet located within the volume of the chamber.

[0080] In this specification, when used in the context of the external magnet, the term "located near the chamber for processing magnetic particles" is intended to indicate a scenario in which the external magnet is preferably located at a distance from the chamber for processing the magnetic particles, and this distance is in the range of 1 mm to 50 cm, and any suitable sub-range within that (e.g., 1 mm to 40 cm, 1 mm to 30 cm, 1 mm to 20 cm, 1 mm to 10 cm, 1 mm to 9 cm, 1 mm to 8 cm, 1 mm to 7 cm, 1 mm to 6 cm, 1 mm to 5 cm, 1 mm to 4 cm, The range is selected from 1mm-3cm, 1mm-2cm, 1mm-1cm, 1mm-9mm, 1mm-8mm, 1mm-7mm, 1mm-6mm, 1mm-5mm, 1mm-4mm, 1mm-3mm, 1mm-2mm, 5mm-10cm, 5mm-9cm, 5mm-8cm, 5mm-7cm, 5mm-6cm, 5mm-5cm, 5mm-4cm, 5mm-3cm, 5mm-2cm, 5mm-1cm, 5mm-9mm, 5mm-8mm, 5mm-7mm, or 5mm-6mm and any other suitable subrange within any of the aforementioned ranges. For an external magnet to be considered to be located "near" the chamber for processing magnetic particles, the distance from the chamber for processing is such that the external magnet can exert or is selected to exert a magnetic force on a freely moving permanent magnet located within the chamber's volume at such a distance. As a result of such magnetic force being exerted by the external magnet on the freely movable permanent magnet, the freely movable permanent magnet may be held, or will be held, in a predetermined position within the chamber (for example, within the volume of the chamber).

[0081] In accordance with the present invention, a chamber for processing magnetic microparticles as described herein, together with an external magnet positioned nearby, may constitute part of a further entity sometimes referred herein as a “cartridge,” “bead cartridge,” or “liquid handling and processing tool for establishing a fluid connection to and from the chamber and / or enabling a flow of liquid to and from the chamber,” or more simply, “liquid handling and processing tool.” Such “cartridge” or “liquid handling and processing tool” is also described herein.

[0082] In a further embodiment, the present invention also relates to a chamber for culturing and detecting microparticles, particularly magnetic microparticles. Such a chamber may begin functioning after a dispersion system of microparticles has been prepared using a chamber and method for processing microparticles according to the present invention.

[0083] For example, according to this embodiment, the present invention relates to a chamber for carrying out and detecting chemical / biochemical reactions using the fine particles. For example, such chemical / biochemical reactions may be amplification reactions using the fine particles.

[0084] In accordance with the present invention, the chamber for culturing and detecting microparticles is a two-part chamber, and: - Having a first compartment having a first volume, the first compartment is configured for a process of concentrating the fine particles in a suspension system of the fine particles in a liquid surrounding the fine particles, the process of concentrating in the first volume utilizing the density difference between the fine particles and the liquid surrounding the fine particles; the first compartment has an inlet opening and an outlet opening, the inlet opening and the outlet opening respectively allowing the liquid or suspension system to flow into and out of the first volume; - Having a second compartment having a second capacity, the second compartment is configured to contain the concentrated microparticles in a tightly packed arrangement within the second capacity, and the second compartment is configured for thermal culture and detection of the microparticles arranged in a tightly packed arrangement; the second compartment has an inlet opening and an outlet opening, the inlet opening and the outlet opening each allowing a liquid or suspension system to flow into and out of the second capacity, the inlet opening and the outlet opening each having a reversibly closing inlet valve and outlet valve, the inlet valve and the outlet valve each allowing the reversibly closing of the inlet opening and the outlet opening, and thus allowing the second capacity to be sealed when both valves are closed; The first and second compartments are fluidly connected to each other through the inlet opening, and when the inlet valve is open, a suspension system of concentrated particulate matter flows from the first volume into the second volume.

[0085] In this specification, when used in the context of connecting two compartments, the term “fluidically connected” is intended to refer to a connection that allows for the flow of fluid between two entities, such as two compartments, without any leakage (thus connecting the two entities). The term “fluidically connected” may also be used synonymously with “connected in a leak-free manner.”

[0086] As used herein in the context of microparticles, the term “densely packed arrangement” is intended to mean a scenario in which such microparticles are treated or considered as spherical particles of equal or substantially equal dimensions (or are preferably spherical particles of equal or substantially equal dimensions), and in this scenario, such microparticles are then arranged in a packed arrangement, preferably a close-packed arrangement. As used herein, a close-packed arrangement of spherical particles refers to a dense arrangement in which as large a proportion of the space as possible is occupied by particles (spherical, quasi-spherical, or other rounded shapes). In one embodiment, in such a dense or close-packed arrangement, the microparticles are arranged in a single layer, and preferably in such a single layer, the packing of microspheres in such layer or single layer is selected from random packing, ordered packing, and close-packing (in particular hexagonal close-packing). In a preferred embodiment, the packing of microspheres in a layer or single layer is close-packing, and more preferably hexagonal close-packing.

[0087] In one embodiment of a chamber for culturing and detection, the first compartment is configured for a process of concentrating microparticles within the first volume and is either a riser tube or a dropper tube, the riser tube and the dropper tube each having an upper end and a lower end, and if the first compartment is a riser tube, the riser tube is fluidly connected at the upper end of the riser tube to the inlet opening of the second compartment via the inlet valve of the second compartment and the outlet opening of the first compartment; and if the first compartment is a dropper tube, the dropper tube is fluidly connected at the lower end of the dropper tube to the inlet opening of the second compartment via the inlet valve of the second compartment and the outlet opening of the first compartment.

[0088] Furthermore, in one embodiment of a chamber for culturing and detecting microparticles, the second compartment has a frame surrounding the second volume, the frame having side walls, an upper wall and a lower wall located opposite the upper wall, the lower wall preferably parallel to the upper wall; the second volume is surrounded by the side walls, the upper wall and the lower wall; one of the upper wall and the lower wall, preferably the upper wall, is a transparent wall configured to be collated by an optical sensor. Furthermore, the other of the upper wall and the lower wall, preferably the lower wall, is a wall having low thermal resistivity and is configured to be in contact with a temperature control device. In a preferred embodiment of such a chamber, the distance between the upper wall and the lower wall is in the range of 10 μm to 500 μm, more preferably in the range of 20 μm to 300 μm, more preferably in the range of 50 μm to 250 μm, more preferably in the range of 50 μm to 200 μm, and even more preferably in the range of 100 μm to 200 μm.

[0089] It should be noted that the aforementioned optical sensors and temperature control devices do not constitute part of the chamber for culturing and detecting the microparticles.

[0090] As used herein, the term “optical sensor” is intended to refer to a device that converts electromagnetic radiation or changes thereof into electronic signals. Typically, the electromagnetic radiation may be in the wavelength range from infrared to ultraviolet. Such an “optical sensor” may have an optical detector and, additionally, a light source configured to be used as an excitation light source that can be used to illuminate a sample. When the term “configured to be matched by an optical sensor” is used in the context of a transparent wall, it is intended to refer to the transparent wall being configured to be illuminated by electromagnetic radiation from an excitation light source that constitutes part of the optical sensor. The transparent wall is transparent to a wide range of wavelengths from infrared to ultraviolet wavelengths and, therefore, when the sample is excited by excitation light from the excitation light source, will also be transparent to any such radiation that may be emitted from such sample placed beneath the transparent wall. Such emitted light or emission will then be detected by a detector that constitutes part of the optical sensor.

[0091] In embodiments of the culture and detection chamber surrounding the frame described above, it should also be noted that one of the upper and lower walls is a transparent wall configured to be matched by an optical sensor, while the other of the upper and lower walls does not need to be transparent but is a wall with low thermal resistivity and is configured to be in contact with a temperature control device. Whether the upper or lower wall is transparent or has low thermal resistivity depends on the instrument in which the culture and detection chamber is used. The aforementioned minimum requirements regarding the quality of each wall (i.e., one wall being transparent and the other having low thermal resistivity) always apply to all embodiments of the culture and detection chamber with a frame, but it should be noted that in some embodiments both walls may be transparent.

[0092] In one embodiment of a chamber for culturing and detecting microparticles, the inlet and outlet openings are formed of or have an elastomer material, and the inlet valve and outlet valve each have a first and second closing means configured to be independently pressed against the inlet and outlet openings, respectively, and thereby compress the elastomer material, and thereby reversibly close the inlet and outlet openings in a pressure-resistant manner, allowing for a pressure increase in the second compartment, preferably the first and second closing means are independently selected from rods, bars, sticks, strips, pillars, clamps, clips, and clasps. For example, the second volume of the second compartment may be filled with a dispersion of microparticles to such an extent that a pressure increase occurs in the second compartment, for example by the action of a pump, and such pressure increase may then be maintained by closing the inlet and outlet openings in a pressure-resistant manner.

[0093] In this specification, when used in the context of the walls of the frame of the chamber, the terms “upper” and “lower” are intended to refer to the relative positions of the walls to each other, namely, the “upper” wall is positioned above the “lower” wall, while the “lower” wall is positioned below the “upper” wall.

[0094] The term "wall with low thermal resistivity" is intended to refer to a wall that functions as an efficient heat conductor. Preferably, such a "wall with low thermal resistivity" has a thermal conductivity of 10 W·m. -1 ·K -1 The above, and more preferably 100 W·m -1 ·K -1 The above is true, and more preferably 150 W·m -1 ·K -1 The above applies, and more preferably 200 W·m -1 ·K -1 That is all, and even more preferably 250 W·m-1 ·K -1 That is all, and even more preferably 300W·m -1 ·K -1 It has a thermal conductivity of the above. The "wall with low thermal resistivity" allows for rapid and efficient heat transfer across it (i.e., from and to temperature control devices, and from chamber to chamber).

[0095] In a more preferred embodiment, which may be combined with any of the aforementioned embodiments of the chamber for culturing and detection, the upper and lower walls of the second volume are held apart by at least one spacer pillar positioned within the second volume and in contact with the upper and lower walls, thereby preventing the collapse of the upper and lower walls. Preferably, the upper and lower walls are evenly distributed within the second volume and held apart by two, three, four, five, or more spacer pillars positioned within the second volume and in contact with the upper and lower walls, thereby preventing the collapse of the upper and lower walls.

[0096] In a still more preferred embodiment, which may be combined with any of the embodiments described above, the outlet opening of the second capacity is permanently open and connected to a conduit that functions as a vent. Preferably, the conduit has a filter configured to contain particles larger than 100 μm and / or configured to self-seal upon contact with a liquid.

[0097] According to one preferred embodiment of a chamber for culturing and detecting microparticles or a chamber for processing magnetic microparticles according to the present invention, the chamber may further preferably have a plurality of magnetic microparticles dispersed in a liquid. Such liquid may be an aqueous phase or a non-aqueous phase when the chamber is a chamber for processing magnetic microparticles. Alternatively, when the chamber is a chamber for culturing and detecting microparticles, the liquid may be a non-aqueous phase that isolates the microparticles from each other.

[0098] A further aspect of the present invention relates to a process for housing microparticles in a tightly packed arrangement configuration within the volume of a chamber for culturing and detecting microparticles as defined herein. According to this aspect, the process is: a) The present invention provides, in any order, a chamber for culturing and detecting the fine particles according to the present invention as defined herein, and a plurality of fine particles dispersed in a liquid, preferably the liquid being a non-aqueous liquid, and more preferably having an oil phase; b) The method comprises introducing the plurality of microparticles dispersed in the liquid into the first compartment of a chamber for culturing and detecting the microparticles, and concentrating the microparticles in the first volume of the first compartment by utilizing the density difference between the microparticles and the liquid surrounding them; c) The plurality of particles are contained in a tightly packed arrangement in the second volume of the second compartment of a chamber for culturing and detecting the fine particles, which is accomplished by discharging the concentrated fine particles from the first volume of the first compartment and introducing them into the second volume of the second compartment through the inlet opening; closing the outlet opening when a first portion of the plurality of fine particles reaches the second volume or the outlet opening, thereby increasing or raising the pressure in the second compartment, and closing the inlet opening when all of the plurality of fine particles have been introduced into the second compartment.

[0099] In one embodiment of this process, for step b), the density of each of the fine particles is selected to be different from the density of the liquid in which the fine particles are dispersed, and step b) is accompanied by allowing the fine particles to accumulate at the upper end of the first volume if the density of each of the fine particles is less than the density of the liquid in which the fine particles are dispersed. Alternatively, in such an embodiment, step b) is accompanied by allowing the fine particles to accumulate at the lower end of the first volume if the density of each of the fine particles is greater than the density of the liquid in which the fine particles are dispersed.

[0100] As used herein, the term "density" in the context of fine particles refers to the density of each individual fine particle in a dispersion, liquid, or sample, and not to the density of multiple fine particles. Only when the density of each of the fine particles is selected to be different from the density of the liquid in which the fine particles are dispersed, will it be possible to concentrate the fine particles in the first volume of the first compartment by utilizing the density difference between the fine particles in one and the liquid surrounding them in the other.

[0101] In a preferred embodiment, the close-packed arrangement in step c) of the process for housing fine particles in a close-packed arrangement is a single layer of fine particles, and the fine particles are close-packed within the single layer.

[0102] In one embodiment, the chamber for culturing and detecting the microparticles is a chamber as defined herein and has a frame surrounding the second volume, the frame having side walls, an upper wall and a lower wall located opposite the upper wall, the upper walls being parallel to each other; the second volume is surrounded by the side walls, the upper wall and the lower wall; one of the upper wall and the lower wall is a transparent wall configured to be collated by an optical sensor; and the other of the upper wall and the lower wall has low thermal resistivity. It is a wall and is configured to be in contact with a temperature control device; the number of particles dispersed in the liquid is selected so as not to exceed the maximum number of particles that can be arranged in a single layer between the upper wall and the lower wall in the second compartment, and the single layer has as close packing as possible; or the number of particles dispersed in the liquid is selected so as to cover an area equal to or smaller than the area provided by the upper wall or the lower wall when the particles are arranged in a single layer between the upper wall and the lower wall in the second compartment with as close packing as possible. In this context, however, if the chamber for cultivation and detection is used as part of a liquid handling and processing tool (= as part of a cartridge), the total number of particles processed in such liquid handling and processing tool and dispersed in the liquid may exceed, and may be greater than, the number of particles that (ultimately) come to be arranged in a single layer between the upper wall and the lower wall of the frame of the chamber.

[0103] As used herein, the terms “process” and “method” are intended to be used synonymously and refer to the procedures or activities performed.

[0104] In yet further embodiments, the present invention relates to a liquid handling and processing tool for establishing a fluid connection to and from a chamber and / or facilitating a flow of liquid into and from a chamber. Such a liquid handling and processing tool is sometimes referred to herein as a “cartridge” or “bead cartridge” and may have additional chambers, for example, a chamber for processing magnetic microparticles as described herein and / or a chamber for culturing and detecting microparticles as described herein and / or a pump for moving liquids, suspensions, or dispersions between different chambers constituting part of the liquid handling and processing tool and / or a storage chamber for reagents, aqueous liquids, non-aqueous liquids, or waste.

[0105] Liquid handling and processing tools according to the present invention include: - Having a housing, the housing includes a central space and a number of chambers for holding reagents or receiving liquids, the chambers being arranged around the central space; - A fluid displacement chamber having an upper and lower end, the fluid displacement chamber surrounding a volume for receiving, handling and moving a liquid, the volume for receiving and handling the liquid having an upper and an adjacent lower part, the upper being cylindrical, and the adjacent lower being cone or frustum, the cone or frustum being positioned upside down within the fluid displacement chamber, the narrower portion of the cone or frustum being positioned at the lower end of the fluid displacement chamber, and the wider portion of the cone or frustum being positioned towards the upper part of the volume; The fluid displacement chamber further has a movable piston positioned in the upper part of the volume and fitted tightly therein, the piston being sized to be movable within the upper part of the volume but not within the adjacent lower part of the volume, or not within the adjacent lower part of the volume; The fluid displacement chamber is located in the central space of the housing, and the plurality of chambers are arranged around the fluid displacement chamber; - The device has a valve, which is located at the lower end of the fluid displacement chamber and allows for the establishment of a single fluid connection from the fluid displacement chamber to a selected chamber among the plurality of chambers.

[0106] In this specification, when used in the context of this cone or frustum of a cone, the terms “narrower part” and “wider part” or “narrower part” and “wider part” are intended to indicate that the two parts differ in their width or cross-section, with each narrower (or narrower) part having a smaller width or cross-section than the wider (or wider) part.

[0107] Such liquid handling and processing tools may be connected to a device for applying pressure to the fluid displacement chamber, allowing the movable piston, located at the top of the fluid displacement chamber's capacity, to move up and down. Such a pump may be actuated by a pump actuator and may be used to apply positive pressure to move the liquid in one direction or negative pressure to move the liquid in the opposite direction. Based on the direction of the pressure (positive or negative), the liquid may be discharged from one chamber into another, or drawn in from one chamber into another.

[0108] In one embodiment, the housing of the liquid handling and processing tool further has at least one interface ("processing interface") for fluidly connecting a separate chamber for processing the microparticles described herein to the housing; and / or the housing further has at least one interface for fluidly connecting a separate chamber for culturing and detecting the microparticles as defined herein to the housing. In this embodiment, the valve located at the lower end of the fluid displacement chamber allows for the establishment of a single fluid connection from the fluid displacement chamber to either the at least one interface for fluidly connecting a selected chamber from a plurality of chambers or the separate chamber for processing the microparticles described herein, or the at least one interface for fluidly connecting the separate chamber for culturing and detecting the microparticles described herein.

[0109] In a preferred embodiment, the valve located at the lower end of the fluid displacement chamber is configured to establish a series of single fluid connections, i.e., one single fluid connection at a given time, in which one single fluid connection is established in succession, and the single fluid connection is from the fluid displacement chamber to a selected chamber among a plurality of chambers or one of the interfaces, and more preferably the valve is a rotary valve.

[0110] In a more preferred embodiment, the liquid handling and processing tool further comprises a chamber for processing fine particles according to the present invention as defined herein, the chamber for processing the fine particles being fluidly connected to the processing interface.

[0111] In another preferred embodiment, the liquid handling and processing tool further comprises a chamber for culturing and detecting particulate matter as defined herein, the chamber for culturing and detecting particulate matter being fluidly connected to the culture interface.

[0112] In yet another preferred embodiment, the liquid handling and processing tool further comprises both a chamber for processing microparticles as defined herein and a chamber for culturing and detecting microparticles as defined herein, wherein the chamber for processing the microparticles is fluidically connected to the processing interface; and the chamber for culturing and detecting the microparticles is fluidically connected to the culturing interface.

[0113] In yet another, even more preferred embodiment, the liquid handling and processing tool further comprises a plurality of magnetic microparticles; preferably, the magnetic microparticles are placed in either a chamber for processing the microparticles or a chamber for culturing and detecting the microparticles, or possibly both.

[0114] In one embodiment of a liquid handling and processing tool, such a tool further comprises an aqueous phase and a separate non-aqueous phase. These phases are typically arranged in different chambers.

[0115] As used herein, “chamber for processing magnetic particles” is sometimes also referred to as “processing chamber” or “bead processing chamber.” Such a chamber for processing magnetic particles is a standalone chamber and can be used alone, or it may constitute part of a liquid handling and processing tool for establishing a fluid connection to or from the chamber and / or for enabling a liquid flow to or from the chamber, as defined herein. Such “liquid handling and processing tool” is sometimes also referred to herein as “cartridge” or “bead cartridge.”

[0116] Similarly, as used herein, “chamber for culturing and detecting microparticles” is sometimes also referred to as “culture chamber,” “detection chamber,” “amplification chamber,” or “PCR chamber.” The chamber for culturing and detecting microparticles may be a standalone chamber or may be part of a liquid handling and processing tool (or “cartridge”).

[0117] Typically, in embodiments of the present invention, a liquid handling and processing tool for establishing a fluid connection to and from a chamber and / or for realizing a flow of liquid to and from a chamber is a tool for the safe operation and execution of various bioanalytical assays. A liquid handling and processing tool according to the present invention can and is suitable for performing the analysis of biological samples for various diagnostic and monitoring purposes. For that purpose, a liquid handling and processing tool according to the present invention may have various components, and for example, it may have an integrated pump component or module provided for moving liquid between different other components or modules. The pump may be actuated by a pump actuator. Furthermore, the liquid handling and processing tool may have a valve component, such as a rotary valve. Such a valve component provides a controlled liquid phase between different chambers and the pump component of the liquid handling and processing tool. Again, here as well, the different valves work in conjunction with a valve actuator. Furthermore, a liquid handling and processing tool according to the present invention may have a culture and detection chamber (= “Chamber for culturing and detecting microparticles”) designed to concentrate microparticles and arrange them in a single-layer configuration. Furthermore, such culture and detection chambers are designed for temperature culture and fluorescence detection / matching of microparticles within them. The chambers for culturing and detecting these microparticles also include valves that provide a closure operation. Liquid handling and processing tools according to the present invention may also have one or more storage chambers for various liquids, such as buffers, as well as for liquids that are immiscible with aqueous solutions, such as non-aqueous liquids (e.g., oils). Similarly, one or more storage chambers for reagents may be present within the liquid handling and processing tool, where the reagents are provided in a dry state or resuspended in aqueous buffer. Furthermore, according to the present invention, liquid handling and processing tools may include one or more chambers (= "bead processing chambers") for processing magnetic microparticles.As described herein, a chamber for processing such magnetic microparticles allows for the efficient and reproducible preparation of dispersion systems of microparticles in aqueous or non-aqueous liquids, or the exchange of liquids in such dispersion systems. Overall, in a typical embodiment, the liquid handling and processing tool will contain all the reagents necessary to perform each test and provide compartments and / or chambers for performing dedicated processing and detection steps. In certain embodiments, the liquid handling and processing tool is also disposable. The processes performed using the liquid handling and processing tool are self-sufficient in that the sample or reagent never comes into contact with the instrument used to process the cartridge. For illustrative purposes, the liquid handling and processing tool according to the present invention should be used in a device providing temperature control and optical detection means.

[0118] As used herein, a chamber for culturing and detecting microparticles allows for the concentration of microparticles within a first compartment having a first volume. The first compartment is configured for a process of concentrating the microparticles within a first volume in a suspension system of microparticles in a liquid surrounding them. The process of concentrating the microparticles within the first volume utilizes the density difference between the microparticles and the liquid surrounding them. For example, such liquid may be a non-aqueous and water-immiscible liquid selected to have a density different from that of each magnetic microparticle. In a preferred embodiment, the density of the non-aqueous liquid phase is selected such that it is greater than the density of each magnetic microparticle. Thus, the lower density of each microparticle will result in the buoyancy of the microparticles in the non-aqueous and water-immiscible liquid phase. Examples of suitable non-aqueous and water-immiscible liquid phases include oils, in particular mineral oils, fluorocarbon (FC) oils, perfluorocarbon (PFC) oils, perfluoropolyether (PFPE) oils, and hydrofluoroether (HFE) oils. A suitable example of a hydrofluoroether oil is Novec 7500®, commercially available from 3M Deutschland GmbH (Neuss, Germany). In some embodiments, the non-aqueous and water-immiscible liquid phase may be additives such as emulsifiers, surfactants and / or stabilizers, and may be complemented by them.

[0119] In embodiments of a method for processing magnetic microparticles, it should be noted that the generation of a user-definable magnetic field in step c) can occur in a variety of different ways. For example, one possibility for generating such a user-definable magnetic field is to provide an external magnet, such as a permanent magnet or electromagnet, that does not constitute part of the chamber for processing the microparticles, and to place it near the chamber for processing the microparticles, such that the magnet exerts a magnetic force on a freely movable permanent magnet located within the chamber's volume. Another possibility for generating a user-definable magnetic field in step c) is to switch on an electromagnet that has already been placed near the chamber. Again, such an electromagnet does not constitute part of the chamber, but is external to it and located near the chamber, such that the external electromagnet exerts a magnetic force on a freely movable permanent magnet located within the chamber's volume, and the freely movable permanent magnet may or may be held in a predetermined fixed position within the chamber's volume.

[0120] In a preferred embodiment of a method for processing magnetic particles, a freely movable permanent magnet positioned within the volume of the chamber is assumed to be an integral part of the chamber. This means that such a freely movable permanent magnet may move within the chamber due to changes in magnetic force exerted by an external magnet, but will not move out of the chamber at any point in the process (e.g., will not be removed from it). This is true in step e *This relates to the physical separation of magnetic particles from the permanent magnet in (a) or (j), and such physical separation is more preferably achieved by removing the distributed and dispersed magnetic particles from the chamber's volume in a liquid (either the first or second liquid). Although theoretically possible, it is undesirable for such physical separation to occur by removing the permanent magnet from the volume and chamber and leaving the distributed and dispersed liquid (either the first or second liquid) in the chamber. Therefore, the removal of the distributed and dispersed magnetic particles from the volume in a liquid (either the first or second liquid) is preferably achieved by removing / transferring each liquid in which the particles are distributed and dispersed from the volume to another location. The removal of such liquid (including the distributed and dispersed particles in it) may be achieved, for example, by pumping or otherwise transferring such liquid out of the chamber. For example, if a chamber for processing magnetic microparticles is part of a liquid handling and processing tool described herein in accordance with the present invention, the removal of the liquid from such chamber for processing the microparticles occurs by the action of a fluid displacement chamber (which constitutes part of the liquid handling and processing tool and has a movable piston located therein, the movable piston being movable within the fluid displacement chamber by interaction with a plunger or tappet of a pump such as a syringe). Effectively, such fluid displacement chamber itself may thus function as a pump, thereby causing the transfer of the liquid.

[0121] In principle, any transfer of liquid from or into a chamber may be carried out by a pump, syringe, or any other means to exert positive or negative pressure on such liquid, insofar as such means is fluidically connected to each chamber (from or into which the fluid is to be moved). Transfer may be carried out by any suitable transfer process such as pumping, pipetting, suction, discharge, aspiration, or extrusion.

[0122] In a preferred embodiment of a chamber for processing magnetic particles according to the present invention, such a chamber has a capacity for receiving a liquid and, optionally, for receiving a plurality of magnetic particles therein during use; it has a longitudinal axis and at least one wall, and the capacity for receiving the liquid and the plurality of magnetic particles therein extends along the longitudinal axis of the chamber and is surrounded by the at least one wall. In embodiments in which the chamber has only one wall surrounding the capacity, such a chamber typically has a rounded (or elliptical) or circular cross-section. The capacity for receiving the liquid is then surrounded on its sides by one wall and at the top and bottom of the chamber by an upper and lower end, respectively. However, in other embodiments, there may be more than one (i.e., several) walls surrounding the capacity, in which case the cross-section of the chamber may be somewhat angular, for example, triangular, rectangular, square, pentagonal, hexagonal, heptagonal, octagonal, nonagonal, decagonal, etc. The capacity for receiving the liquid is then surrounded on its sides by the aforementioned walls and at the top and bottom of the chamber by the upper and lower ends, respectively.

[0123] In a preferred embodiment, the chamber for processing magnetic particles is a tubular chamber. In this specification, as used in this context, the term “tubular” is intended to refer to a chamber having a tubular shape. For example, it may have a cylindrical shape, or it may have a conical shape with different cross-sectional widths at different ends. However, in a preferred embodiment, it has a chamber volume for processing magnetic particles having a frustoconical shape, the frustoconical having a narrower end and a wider end opposite to the narrower end, the lower end being configured to be reversibly opened and closed by a valve (e.g., a valve constituting part of a liquid handling and processing tool into which the chamber is incorporated). The lower end of the chamber functions as an inlet for liquid into the chamber volume, or as an inlet for liquid into the chamber volume and an outlet for liquid from the volume. Furthermore, the chamber further has an upper end which may optionally be closed by a cap or seal. In embodiments where the chamber volume has a frustoconical shape, the narrower end of the frustoconical is located at the lower end of the chamber, and the wider end of the frustoconical is located at the upper end of the chamber.

[0124] It should also be noted that, in the context of a culture and detection chamber as defined herein, transparent walls described as "configured to be collated by an optical sensor" are sometimes referred to. In this context, it should be noted that such optical sensors are not part of the culture and detection chamber as defined herein, but are provided by a separate instrument that enables optical collation of the culture and detection chamber. Similarly, still in the context of a culture and detection chamber as defined herein, walls having low thermal resistivity and described as "configured to be contacted by a temperature control device" are sometimes referred to. In this context, again, it should be noted that such temperature control devices are not part of the culture and detection chamber as defined herein, but are provided by a separate instrument that enables heating and cooling of the culture and detection chamber.

[0125] In the context of a chamber for culture and detection as defined herein, the term “riser tube” is sometimes referred to. In this context, such term is intended to refer to a tube, pipe, or conduit that functions as a first compartment of the chamber for culture and detection and allows a liquid or suspension system to be transported or transferred from a lower level to a second compartment of the chamber for culture and detection, the second compartment being located at a higher level (compared to the first compartment) and fluidly connected to the riser tube (=first compartment).

[0126] Similarly, the term “downstream conduit” is sometimes mentioned. When used in this context, such term is intended to refer to a tube, pipe, or conduit that functions as a first compartment of the aforementioned culture and detection chamber and allows the transport or transfer of a liquid or suspension system from a higher level to a second compartment of the culture and detection chamber, which is located at a lower level (compared to the first compartment) and connected to the downstream conduit (=first compartment).

[0127] In accordance with embodiments of the present invention, liquid handling and processing tools are also provided for establishing a fluid connection to and from a chamber and / or for realizing a liquid flow to and from a chamber. Such liquid handling and processing tools are sometimes referred to herein as “cartridges” or “bead cartridges.” The liquid handling and processing tools for establishing a fluid connection to and from a chamber and / or for realizing a liquid flow to and from a chamber, according to the present invention, are self-sufficient, integrated cartridges that enable the execution of multi-step workflows involving magnetic microparticles such as nanoreactor beads. By appropriately providing multiple chambers (including a storage chamber, one or more chambers for processing microparticles as defined herein, and at least one chamber for culturing and detecting microparticles, also as defined herein) within such cartridges, and by pre-filling each chamber with the reagents and / or microparticles necessary to carry out the intended reaction, complex multi-step protocols and workflows can be executed without interference once the workflow has started and without the risk of introducing external sources of contamination. This is because all necessary reagents are already part of the cartridge and no longer need to be added during the workflow. The user's role is to first load the sample, and then, once the cartridge is introduced into the appropriate apparatus, allowing for heating and cooling, interaction with means to operate the cartridge's fluid displacement chamber, and optical alignment of the chamber for incubation and detection, follow the desired protocol. The execution of the desired protocol may be controlled by a computer and appropriate operating software. Therefore, the liquid handling and processing tools defined herein are entirely self-sufficient and require no non-automated user interaction that may introduce contaminants, other than the initial introduction of the sample into the liquid handling and processing tools.

[0128] This, therefore, enables the execution of a completely contactless "sample-to-result" workflow. [Brief explanation of the drawing]

[0129] Refer to the drawings below.

[0130] [Figure 1]Figure 1 shows an embodiment of a chamber for processing magnetic particles (= “bead processing chamber”) and its arrangement with respect to an external magnet. It should be noted that such an external magnet does not constitute part of the processing chamber according to the present invention, for example, it does not constitute part of the processing chamber described in any of claims 15 to 17, but such an external magnet constitutes part of a device for performing a method for processing magnetic microparticles according to the present invention, and in particular it constitutes part of the device described in claim 18. In the left portion of the figure, a perspective view is shown of a tubular bead processing chamber having an interface with a valve at the bottom and an open top that can be closed by a cap or seal. Such a processing chamber may have a cylindrical or conical shape. In a preferred embodiment, it is the internal volume of the cylindrical or conical chamber, i.e., the volume for receiving liquid and a plurality of microparticles. When the top of the processing chamber is open, microparticles and samples can be added. Also on the left side of the figure, a freely movable permanent magnet and an electromagnet in the form of a C-shaped core (with a coil wound around its center) are shown, positioned in a chamber. The electromagnet is located near the chamber for processing the magnetic particles and exerts a magnetic force on the freely movable permanent magnet located within the chamber's volume, and the freely movable permanent magnet is held in a predetermined fixed position within the volume. On the right side of Figure 1, a side view of the same chamber is shown, illustrating the rotational motion of the electromagnet about the coil axis with curved arrows indicating two possible positions of the C-shaped core of the electromagnet. The movement of the coil and the C-shaped core is translated into selective positioning of the permanent magnet located inside the chamber for processing. On the right side, a permanent opening located in the upper region of the chamber is also shown.Such permanent openings may function as overflow and / or vents, and allow for a single-direction flow, particularly when the chamber is incorporated into a liquid handling and processing tool ("cartridge"), and when it is necessary to match particulate matter ("beads") with such liquids within a particular liquid handling process, without allowing any different liquids, or traces of such liquids, to leave the chamber for processing and move towards any compartment or functional element such as valves, pumps, etc., that could come into contact with reagents or samples other than particulate matter in the chamber for a given processing. This is to avoid any sources of contamination within the cartridge. [Figure 2A] Figure 2A shows an example of a possible configuration of an embodiment of a chamber for processing magnetic microparticles when integrated within an embodiment of a liquid handling and processing tool (= “cartridge”). More specifically, Figure 2A shows three chambers for processing such magnetic microparticles integrated and arranged within a liquid handling and processing tool (= “cartridge”). The housing of the shown cartridge is partially dissected to reveal the configuration of the processing chambers within the tool. On the opposite side of the cartridge, a chamber for culturing and detecting microparticles, more specifically its second compartment protruding from the cartridge, is also shown. [Figure 2B] Figure 2B shows an example of a partially dissected cartridge, illustrating a cross-section of a fluid displacement chamber (including a movable piston positioned at the top of the fluid displacement chamber's volume). A cross-section of a processing chamber (including a cap or seal or stopper closing the upper end of the chamber) is also shown. Furthermore, a chamber for culturing and detecting partially dissected microparticles, including a first compartment and a second compartment, is also shown. [Figure 2C] Figure 2C shows a top view of the same cartridge embodiment, illustrating the positioning of the external magnet relative to the three processing chambers. [Figure 2D]Figure 2D shows a side view of the same cartridge embodiment, and again, it shows one possible positioning of the external magnet relative to the cartridge. [Figure 3] Figure 3 shows a transmission image of a plurality of magnetic nanoparticles (5) (= "magnetic nanoreactor beads") suspended in fluorocarbon (FC) oil (PicoSurf) by performing a method for processing fine particles according to the present invention using a processing chamber (= "processing chamber") described herein, and using the interaction of a freely movable permanent magnet placed inside the processing chamber and an external magnet that exerts a magnetic force on the internally placed permanent magnet. The magnetic nanoreactor beads are easily recognized as rounded "clumps". Even smaller droplets, also visible in the image, are microemulsion droplets formed from excess liquid that was not absorbed by the magnetic nanoreactor beads. [Figure 4A] Figure 4A shows different diagrams of an embodiment of a chamber for culturing and detecting microparticles, with the left side showing a perspective view of a fully assembled chamber for culturing and detecting microparticles. Such a chamber has a first compartment and a second compartment. The first compartment is configured for the process of concentrating microparticles within a first volume of the first compartment. In this particular example, such a first compartment is configured as a riser tube. The second compartment, having a second volume, is configured to contain the concentrated microparticles. The right side of Figure 4A shows an exploded view of an embodiment of the chamber for culturing and detecting microparticles. This part of the figure also shows a frame surrounding the second volume, having side walls, a top wall, and a bottom wall located opposite the top wall, in this case being a transparent wall. The bottom wall is a wall having low thermal resistivity. Reversibly closing inlet and outlet valves, as well as a conduit connected to the outlet opening / valve of the second volume, are also shown, the conduit terminating at a vent, with an anti-aerosol filter located below the vent opening. [Figure 4B]Figure 4B shows a top view of a second compartment of a chamber for culturing and detecting microparticles, and in particular shows its second volume, the inlet and outlet openings of the second compartment (including reversibly closing valves for each of them), the frame of the second compartment, and several spacer pillars arranged within and evenly distributed within the second volume (to prevent the upper and lower walls of the second compartment from collapsing by contact with it). [Figure 5] Figure 5 shows an embodiment of a liquid handling and processing tool (= “cartridge”) including a chamber for culturing and detection. Figure 5A is a top view, and Figure 5B is a cross-sectional view taken through the tool along line AA in Figure 5A. [Figure 6] Figure 6 shows an assembled diagram (Figure 6A) and an exploded view (Figure 6B) of an embodiment of a liquid handling and processing tool according to the present invention, which includes three processing chambers and one culture and detection chamber. [Figure 7]Figure 7 shows a block diagram of an example of a liquid handling and processing tool (= “cartridge”). In this figure, the exemplary cartridge has six main functional modules: 1. An integrated pump module provided for moving liquid between different modules or chambers. The pump module works in conjunction with a pump actuator on the instrument. 2. A valve block or rotary valve provides a controlled liquid interface between different chambers and the pump module, and the valve works in conjunction with a valve actuator. 3. A culture and detection chamber designed for concentrating beads and arranging them in a single-layer configuration, and for temperature culture and fluorescence detection of the beads. The chamber is equipped with a valve that provides a closure operation. 4. One or more storage chambers for liquids that are immiscible with aqueous solutions. 5. One or more storage chambers for reagents provided in a dry state or resuspended in aqueous buffer. 6. One or more bead processing chambers containing permanent magnets and working in conjunction with external magnets used to apply an electromagnetic field that is electrostatic and alternating current to the chambers. (In this context, “module” is intended to refer to an entity that performs a specific, designated function or task within a liquid handling and processing tool. In a simple scenario, such a “module” should be identified with a single chamber (e.g., a chamber that stores a specific reagent or liquid, or functions as a storage chamber, sink, waste processing unit, reservoir, or overflow). In another case, such a “module” may be a series of chambers that function together to perform a specific, designated task. In yet another scenario, such a “module” may have entities other than chambers, such as pistons, actuators, pumps, or conduits, either alone or together with one or more chambers.) [Figure 8]Figure 8 shows two photographic images of an embodiment of a chamber for processing microparticles at two different stages of a method for processing microparticles ("before mixing" (left) and "after mixing" (right)). Shown on the left ("before mixing") is the chamber, which has a freely movable permanent magnet placed within its volume and microparticles ("beads") attached to it. The permanent magnet is placed in and immersed in a fluorocarbon oil (FC oil) phase on which an aqueous phase containing a PCR master mix containing reagents necessary to perform a polymerase chain reaction (PCR) is placed. A visible interface is also present, which lies between the oil phase and the aqueous phase. In the left photograph, a permanent external magnetic field is applied to the chamber, so that the permanent magnet is appropriately oriented and fixedly held in a predetermined position within the chamber. The beads are similar to the aqueous fluid on the oil and have a lower density than the oil itself, yet remain attached to the freely movable but fixed permanent magnet. Since the microparticles ("beads") are attached to a permanent magnet that is freely movable but stationary, they do not rise to the interface but remain attached to the freely movable magnet. During the process, starting from the left panel / photograph, the beads and aqueous liquid are suspended in the fluorocarbon oil by moving the permanent magnet using a magnetic field generated outside the chamber (step c of the method for processing microparticles), this magnetic field is alternately changed (step d of the method for processing microparticles), so that the permanent magnet rotates and / or moves to align with the (changed) magnetic field, resulting in disordered mixing and shear forces acting on the magnetic microparticles, so that the magnetic microparticles move within the volume of the chamber, as a result of the magnetic microparticles being detached from the permanent magnet and forming a suspension system of microparticles in the oil phase. Due to the rough and vigorous movement of the magnet, the aqueous phase that was previously placed on top of the oil phase is also emulsified and a microemulsion of droplets is formed together with the bead suspension system in the oil. In the right side of Figure 8 ("After Mixing"), the figure shows the state immediately after such disordered mixing in the chamber.The cloudy appearance of the emulsion indicates a highly dispersed aqueous droplet emulsion and suspension system of magnetic beads (shown by grayish-brown), with particulate matter and microemulsions having a lower density than the non-aqueous phase (FC oil) and therefore eventually rising. The image was taken when the external magnetic field was switched off and the permanent magnets in the chamber were allowed to fall. [Figure 9] Figure 9 shows a photograph of an embodiment of a chamber for culturing and detection, located within an embodiment of a liquid handling and processing tool ("cartridge"). More specifically, as shown in the figure, a first compartment of the chamber for culturing and detection is shown holding a suspension system of concentrated microparticles ("beads") within the first compartment. Below the layer of concentrated microparticles is shown a "microemulsion" (water in oil emulsion, referred to in the figure as "microemulsion in FC oil," where the oil phase contains very few emulsified aqueous droplets) of an aqueous solution in oil, such as a PCR master mix (reagents required for PCR) (the aqueous droplets have lower buoyancy due to their lower droplet volume). Due to their buoyancy and the density difference between the microparticles and the oil, the microparticles rise to the upper end of the first compartment. As a result, the microparticles begin to concentrate and accumulate at the upper end of the first compartment of the chamber for culturing and detection. [Figure 10]Figure 10 shows an image (composite from several individual fluorescence images) of an embodiment of a second compartment of the culture and detection chamber, where microparticles are arranged in a tightly packed configuration according to a process for containing the microparticles described herein in a tightly packed configuration within the volume of the chamber for culturing and detecting the microparticles. Because the second compartment of the chamber has a transparent wall configured to be collated by an optical sensor, individual microparticles can be "seen" through the transparent wall. Squares on the left and right sides of the chamber are also shown in the left and right centers of the photograph. These squares, indicated as DF-1 and DF-2 in the figure, are used as detection windows for the automated chamber filling process. Their positions are near the inlet and outlet openings, respectively. [Figure 11] Figure 11 shows two photographs of the second compartment of a chamber for culturing and detecting microparticles filled with microparticles after polymerase chain reaction (PCR) has been performed. In the image on the left, all microparticles are labeled and detectable using appropriate filters for microparticle recognition. In the image on the right, the same second compartment is shown, but with different filters that allow for the identification of whether the microparticles are positive (=PCR amplified) or negative (=PCR did not amplified). [Figure 12A]Figure 12A shows a top view of an embodiment of a liquid handling and processing tool in which a sample is processed, involving mechanical dissolution of the sample in one processing chamber (position 4, abbreviated and labeled "Pos4" in the figure), chemical dissolution in two other chambers ("Pos2" and "Pos13"), and subsequent steps (such as bonding, washing, and amplification) are performed in a different processing chamber ("Pos6"). The processing chamber in "Pos6" would contain lyophilized magnetic nanoparticles ("lyophilized nanoreactor beads"), such as those disclosed in PCT / EP2022 / 080978 or International Patent Application No. PCT / EP2020 / 086171, filed by the present applicant on November 7, 2022. Mechanical lysis of the sample is achieved by ceramic particles in “Pos4”, such as zirconium particles, which can be moved within the chamber for processing by a permanent magnet in the chamber, driven by applying an alternating external magnetic field which will move and mix the liquid and any particles placed therein within the permanent magnet in the chamber. As a result of such movement and mixing, the biological sample will be lysed. Figure 12A also shows a chamber for culture and detection (“Pos11”) and a sample chamber for sample input (“Pos5”). Other chambers for liquid handling and processing tools are filled with binding buffer, fluorocarbon oil, washing buffer, proteinase K and guanidinium hydrochloride, and PCR reagents (referred to as “PCR pellets” or “PCR master mix pellets”, containing dNTPs, Mg salts, buffers, Taq polymerase, and optionally dried reagents for PCR such as primers and probes). Alternatively, suitable primers and / or probes may also be provided as part of lyophilized magnetic microparticles. [Figure 12B]Figure 12B shows a flowchart of the assumed process for the cartridge layout in Figure 12A. The sample is loaded at Pos-5 and subsequently lysed (mechanically at Pos-4, and chemically at Pos-2 and -13). The lysate is then transferred to Pos-6, an example of a chamber for processing according to the present invention, and containing lyophilized magnetic microparticles ("beads"), where nucleic acid binding to the microparticles ("beads") occurs. Still within Pos-6, the beads are loaded with the reagents necessary for PCR, suspended in oil, and harvested. The beads, along with the oil, are then transferred to Pos-11, an example of a chamber for culturing and detecting microparticles according to the present invention. Here, the beads are concentrated in a first compartment (referred to as the "rising chamber" in the figure) and then placed in a second compartment (referred to as the "culture chamber" in the figure). Still within Pos-11, nucleic acid amplification and detection of positive and negative beads subsequently occur. [Figure 13A] Figure 13A shows a top view of an embodiment of a liquid handling and processing tool ("cartridge") intended for use on a single patient, in which different body fluids / samples are examined. The samples are urine, blood, and swabs, which are stored in and processed in different storage chambers. Dissolution of each sample is performed by chemical means in the presence of magnetic microparticles ("nanoractors" or "nanoractor beads"). [Figure 13B]Figure 13B shows a flowchart of the assumed process for the cartridge layout in Figure 13A. Three different samples (whole blood, swab, and urine) are each loaded separately into chambers Pos-4, Pos-5, and Pos-6 for processing, and then chemically dissolved in the same chambers with magnetic microparticles ("nanoreactor beads") already present in the chamber. Due to the presence of nanoreactor beads, the dissolution of each sample is performed by chemical means rather than mechanical means. Mechanical dissolution would be too harsh for the beads and could lead to their destruction. Since the dissolution is already in the same chamber as each nanoreactor bead, nucleic acid binding to the microparticles ("beads") may and will occur in the same chamber. Subsequently, still in the same chambers, the beads are washed, then loaded with the reagents necessary for PCR, suspended in oil, and harvested. The beads of all three samples, along with the oil, are then transferred to Pos-11, an example of a chamber for culturing and detecting microparticles according to the present invention. Here, the beads are concentrated in the first compartment (referred to as the “elevation chamber” in the diagram) and then placed in the second compartment (referred to as the “culture chamber” in the diagram). Still within Pos-11, nucleic acid amplification and detection of the positive and negative beads then occur as a result. Since the beads will be coded in a sample-specific manner (see Figure 13A, codes 1-3), they can be easily identified from the point of each sample to which they belong. [Figure 14A] Figure 14A shows a top view of another layout of another embodiment of the liquid handling and processing tool, in which three samples (e.g., from three different patients) are processed in different chambers for different processing, and furthermore, dissolution and further processing of each sample are carried out within each processing chamber. Dissolution is performed by chemical dissolution in the presence of a magnetic nanoreactor. [Figure 14B]Figure 14B shows a flowchart of the assumed process for the cartridge layout in Figure 14A. Three different samples (from three different individuals) are each loaded separately into chambers Pos-4, Pos-5, and Pos-6 for processing, and then chemically dissolved in the same chambers with magnetic microparticles ("nanoreactor beads") already present in the chambers. Due to the presence of nanoreactor beads, the dissolution of each sample is performed by chemical means rather than mechanical means. Mechanical dissolution would be too harsh for the beads and could lead to their destruction. Since the dissolution is already in the same chamber as each nanoreactor bead, nucleic acid binding to the microparticles ("beads") may and will occur in the same chamber. Subsequently, still in the same respective chambers, the beads are washed, then loaded with the reagents necessary for PCR, suspended in oil, and harvested. The beads from all three samples, along with the oil, are then transferred to Pos-11, an example of a chamber for culturing and detecting microparticles according to the present invention. Here, the beads are concentrated in the first compartment (referred to as the “elevation chamber” in the diagram) and then placed in the second compartment (referred to as the “culture chamber” in the diagram). Still within Pos-11, nucleic acid amplification and detection of the positive and negative beads then occur as a result. The beads are coded in a sample-specific manner (see Figure 14A, codes 1-3), so they can be easily identified from the point of each sample to which they belong. [Figure 15]Figure 15 shows the results of mechanical lysis of Candida crusey cells using an embodiment of a chamber for processing microparticles with zirconium oxide microparticles. A predetermined number of zirconium oxide microparticles are introduced into the chamber for processing the microparticles together with lysis buffer and Candida crusey cells. This is carried out as described in Example 2, and the results are compared with a benchmark kit from Qiagen Germany (commercially available under the name "DNeasy Blood & Tissue sample preparation kit"). A control example in which lysis was not performed is also shown. The numbers above the bars indicate the absolute copy number of DNA determined for each lysed sample. The process used in accordance with the embodiment of the present invention in the processing chamber is significantly more efficient in terms of copy number when compared with the Qiagen benchmark reference.

[0131] Furthermore, refer to the following examples, which are given not to limit the present invention, but to illustrate it. [Modes for carrying out the invention]

[0132] Examples [Examples]

[0133] Embodiment of a chamber for processing The processing chamber has a capacity of approximately 0.6 ml. It is equipped with an overflow opening and accommodates both beads and permanent magnets. The chamber is also designed to prevent the magnets from clogging or tilting under any circumstances. A schematic representation of such a chamber is shown in Figure 1 as a standalone representation, and in Figure 2, such a chamber is shown incorporated into a liquid handling and processing tool (= “cartridge”). The external electromagnet is made up of two components: a C-shaped core (10 layers of electrical sheets with a thickness of 0.5 mm) and a coil (1014 turns of enameled copper wire with a diameter of 0.4 mm). The coil is pulse-driven with a voltage of ±32V and a current of 2A. Furthermore, the entire electromagnet can rotate around the coil's axis via a stepper motor. By adjusting the rotation angle and applying the corresponding voltage to the coil, the position of the permanent magnet within the bead processing chamber can be adjusted. The combination of an external electromagnet, an integrated permanent magnet, and magnetic microparticles enables three basic functions: 1. Dispersing magnetic nanoparticles in a liquid This involves changing the voltage polarity with appropriate pause times (e.g., 3ms +32V, 150ms 0V, 3ms -32V, 150ms 0V; repeat X times for gentle mixing, or 4ms +32V, 2ms 0V, 4ms -32V, 2ms 0V; repeat X times for emulsification). 2. Collecting suspended magnetic particles from a liquid (oil or aqueous solution) onto a permanent magnet: The magnet is slowly moved through the liquid, the applied voltage remains positive or zero (1ms +32V, 5ms 0V; repeated X times), and the particles gradually accumulate on the magnet. 3. Harvesting magnetic nanoparticles from the chamber The permanent magnet is quickly moved out of the liquid but remains in the chamber, and while the liquid is being drawn in by appropriate means (e.g., a pump that creates negative pressure) (1 ms +32V, 5 ms 0V; repeated X times), no magnetic particles can adhere to the magnet. The combination of permanent magnets and external electromagnets in a bead processing chamber for generating a magnetic field offers several advantages. First, the external magnetic field can be constructed and changed very quickly. Second, the excitation frequencies of the electromagnets and the natural rotation frequencies of the permanent magnets are different, allowing for the disordered motion of the permanent magnets to be achieved, resulting in rapid and uniform mixing or intermixing of the different components contained within the chamber. Simultaneously, the position of the permanent magnets can be easily adjusted based on the level at which the chamber is filled, ensuring that the magnets move only within the liquid. This can be used to prevent bubble formation. [Examples]

[0134] Embodiment of a chamber for processing for use in mechanical dissolution The following describes a mechanical dissolution protocol in which a biological sample is dissolved in a chamber for processing microparticles using ceramic microparticles (=beads). Using such ceramic microparticles, bead milling is substantially achieved. To hold ceramic or other microparticles, a processing chamber ("bead processing chamber (BPC)") was modified with a sieve (mesh size 100 μm) at the inlet-outlet opening at the bottom of the BPC. 200 mg of 0.1 mm diameter zirconium oxide beads (Omni International, USA) were loaded into the BPC. A 1 × 1.5 mm disc-shaped permanent magnet (Webcraft GmbH, Germany) was placed inside the sample processing chamber. Candida crusey was used as a model organism for yeast cells to analyze the efficiency of mechanical lysis. C. crusey cells were pre-counted and, after washing, suspended in 600 μL of PBS buffer. The cell suspension system was added to a chamber for processing with zirconium oxide beads and a permanent magnet. To break up the beads, a magnetic field with alternating pole orientations (3ms each, followed by a 5ms pause) was applied for 180 seconds, and the ceramic beads were agitated by the movement of a permanent magnet within the BPC. During mixing, the magnetic coil unit was moved back and forth along the entire length of the chamber. After bead beating, the supernatant was collected from the BPC, and 2 μL of the supernatant was directly pipetteed into 18 μL of PCR master mix containing a 0.4 mM forward primer (GCATCGATGAAGAACGCAGC) (SEQ ID NO:1), a 0.4 mM reverse primer (GACGCTCAAACAGGCATGC) (SEQ ID NO:2), and a 0.2 mM probe (ATTO647N-CGTGAATCATCGAGTCTTTGAACGC-BHQ2) (SEQ ID NO:3) for the detection of multicopy 18s rRNA genes from different Candida species. For reference, we isolated Candida crusey DNA using Qiagen DNeasy Blood & Tissue sample preparation (Qiagen, Germany), which includes a supplementary protocol for the purification of total DNA from yeast. Yeast cells were resuspended in 600 μL of sorbitol buffer and further processed according to the manufacturer's instructions. Extracted DNA was eluted with 2 × 200 μL of H2O, and 200 μL of H2O was added before transferring 2 μL of diluted eluate to the 18 μL PCR mix described above. PCR was performed on a standard qPCR cycler (Thermofisher QuantStudio 3) under the following cycling conditions (95°C, 5 min; 95°C, 15 sec and 61°C, 30 sec for 45 cycles). Furthermore, to determine the amount of free C. crusey-DNA in the sample, an undissolved control was performed. This was done by directly applying 2 μL of spore suspension to the PCR master mix without any prior treatment. The results of the comparative analysis of the three samples are summarized in Figure 16. The numbers above the bars indicate the absolute copy number determined for each method. The copy number was calculated based on a PCR calibration curve generated in advance using pre-quantified purified C. crusey DNA. [Examples]

[0135] Embodiments of a process involving liquid handling and processing tools (= "cartridges"). The cartridge in this embodiment is designed to perform two different bead assays separately in two processing chambers (= "bead processing chambers" or "BPCs"). Both chambers contain magnets (d=4mm; h=1mm). The bead slurry is pipetted onto these magnets, and all chambers are closed with lids. Biological samples are placed in sample chambers located between the BPCs. All reagents used in each assay are placed in storage chambers. The sample chambers and all reagent chambers are closed after being filled. The cartridge is secured in appropriate equipment that enables optical matching, as well as mechanical interlocking for heating and cooling, and operation of valves and integrated pumps. The assay workflow, which consists of the following steps, is initiated by the operating software. A. Sample preparation on beads in BPC before the PCR master mix is ​​added. First, the elastomer piston contained in the cartridge pump is made contact. The rod of the pump actuator moves into the pump body of the cartridge and attaches to the piston at a predetermined position. Bead Conditioning The binding buffer is drawn from the binding buffer chamber into the pump. Then, a predetermined volume of binding buffer is added to each processing chamber. The beads are cultured with the binding buffer, which is gently agitated by a magnet in the processing chamber. Sample dissolution The lysis buffer is drawn from each storage chamber into the pump and then transferred into the sample chamber. During the incubation period for lysis, the sample can be mixed by moving the liquid between the sample chamber and the pump. (Alternatively, an already lysis-completed sample can be applied to the sample chamber.) join The dissolution is drawn into a pump and applied to two processing chambers containing beads. Any residue present in the pump is discarded into a waste chamber, reducing any potential carryover. Culturing under strong magnetic mixing in the processing chambers allows the analyte to bind to the beads. The beads are then collected by an internal magnet, and the liquid is removed from the processing chambers into the pump and then moved to the waste treatment area. Optional "overflow" step Immediately after dissolution, the dissolution buffer can also be removed by a special "overflow" washing step. For this purpose, the dissolution is pushed upward with excess washing buffer and poured into the waste space through an opening at the top of the processing chamber (1.3.3). Such a step may be useful for efficiently removing foam from the dissolution buffer and ensuring accurate liquid dosing thereafter. After a short mixing and subsequent collection of beads on an internal magnet, the processing chamber is emptied again through an opening at the bottom of the chamber, which connects it to a rotary valve. Approximately 50 μl of aqueous residue remains in the chamber to prevent the beads from drying out. Cleaning A predetermined volume of washing buffer is pumped from each storage chamber into the processing chamber. The magnet is agitated several times with short but strong movements to detach the beads from the magnet and ensure optimal liquid exchange around the beads. Subsequently, the beads are collected on the magnet in the washing buffer by the slow up-and-down movement of the magnet, and the washing buffer is drawn out of the chamber and moved to the waste treatment area. The beads remain on the magnet in the processing chamber. Multiple washing steps may be performed, and different washing buffers may be used. A minimum aqueous residual volume of approximately 50 μl remains on the beads to prevent them from drying out. Addition of PCR reagent (master mix) From each storage chamber, the PCR master mix is ​​transferred onto the beads in the processing chamber. During incubation, periodic, gentle stirring is performed using a magnet. The collection step (slow up-and-down movement of the magnet) binds the beads from the suspension to the internal magnet. The master mix liquid is discarded into the waste treatment section. Displacement of the aqueous phase using (optional) oil To remove excess master mix from the beads, fluorocarbon oil containing an emulsifier (Pico-Surf) is drawn from each storage chamber (oil chamber) into the processing chamber. While the beads remain attached to the internal magnets, the fluorocarbon oil completely displaces the master mix and pushes it into the waste processing section through an opening at the top of the processing chamber. The oil is then removed through a bottom opening and discarded into the waste processing section. B. Phase transition Preparation of a bead suspension system Fluorocarbon oil is added to the beads in the processing chamber from each chamber. The disordered and intense movement of the magnets in the processing chamber produces a stable bead-oil suspension system from the beads and fluorocarbon oil. Harvesting: Transferring the beads into the pump. The beads are briefly mixed by a magnetic mixer and then moved from the processing chamber into the pump volume. After the suspension system is transferred from the pump volume, the beads are able to rise to the top of the liquid by buoyancy. In this way, the beads are transferred into the pump volume until all the beads are removed from the processing chamber and only the oil and some microemulsion remain. Optionally, after separate processing of different samples in separate bead processing chambers (BPCs), the emulsified individual samples may be combined in the pump here. Transfer to the lifting chamber and reactor The beads are then pumped from the pump into the first compartment of the culture and detection chamber ("culture chamber"). After the entire volume has been transferred from the pump to the first compartment, a short pause is applied to allow the beads to rise to the top of the liquid in the compartment (see Figure 10). Subsequently, fluorocarbon oil is drawn into the central syringe of the cartridge and pushed into the riser tube, transporting the beads upward to the feed ramp of the second compartment of the culture chamber. C. Loading the detection chamber and PCR / detection Automatically fill the culture chamber. The complete filling of the second compartment of the culture chamber with beads is automatically detected. For this purpose, detection windows are defined at the reactor inlet (DF-1) and reactor outlet (DF-2) (see Figure 10), where the first image is taken before the compartment is filled (see reference image). First, the suspension system is pumped in small volumes (5 μl, 0.1 ml / min, waiting time 0-12 seconds). As soon as beads are detected at DF-1, a large volume step (20 μl, 0.1 ml / min, waiting time 0-12 seconds) is performed. At this stage, the compartment is not yet filled (approximately 80%). Subsequently, another 5 μl filling loop is performed. As soon as beads are visible at DF-2, the valve at the reactor outlet is closed. The rapid sequence of liquid addition steps and the predetermined delay time prevent reactor chamber overflow (loss of beads in the outflow channel). PCR and detection After adjusting the exposure and autofocus settings, mosaic images of the chamber are taken with the necessary fluorescence filters for each probe and label used with the beads before and after PCR. Thermocycling parameters for PCR are also adjusted as needed. The beads can be detected, and positive and negative beads can be distinguished using appropriate optical filters (see Figure 11). [Examples]

[0136] Layout of liquid handling and processing tools (= "cartridges") for processing samples and performing mechanical and chemical dissolution. The following protocol is performed using liquid handling and processing tools with reagents contained in each chamber, as shown in Figure 12A. The process performed on the cartridge is shown in the flowchart in Figure 12B. The indicated positions ("Pos-X", where X is an integer from 1 to 20) represent the actual space in which the steps are performed. The following is a simplified protocol for processing 1 mL of a cell culture sample transferred to position 5 on the cartridge, as shown in Figure 12A. Before sample processing begins, all dry reagents on the cartridge are resuspended and prepared for use by a series of pump and valve steps. Mechanical sample dissolution - Transfer the entire sample from Pos-5 to the mechanical dissolution chamber [MLC][Pos-4] → Pipette 2 x 500 μl (to avoid contaminating the pump piston with the sample) for 60-180 seconds with strong magnetic mixing [field setting: 3 ms on; 5 ms off] and high-speed servo movement [speed 120; two different positions]. - While the magnets in the MLC are pulsed in parallel (3ms on; 5-10ms off; Pos1 / 2:2050), liquid is drawn from Pos-5 to the pump, keeping the ceramic beads (crushed beads) moving and enabling liquid aspiration from the chamber. - Dissolution / proteinase K treatment and thermal deactivation - The entire liquid is drawn from Pos-5 to the pump and dispensed into Pos-2 and Pos-13 in 500 μL aliquots, respectively. The dried solubilants (proteinase K and guanidinium salt) provided in Pos-2 and Pos-13 are resuspended during the process. - During the filling process, the dissolution chamber is heated to 60°C and then maintained at 60°C for 10 minutes to allow the sample to be treated with proteinase K. - Subsequently, the temperature in the chamber is raised to 95°C for 5 minutes to inactivate the proteinase K enzyme. - Allows heating to stop and the liquid to cool to room temperature. - The total volume of liquid is transferred from Pos-2 and Pos-13 to Pos-10, which contains 500 μL of binding buffer solution. - After the complete transfer of the solubil into the binding buffer chamber (Pos-10), a volume of 500 μl is transferred back and forth several times between the chamber and the pump to mix the different liquids. - Nucleic acid binding to beads - 500 μl of the conjugated mixture is transferred via a pump to the bead processing chamber ("BPC") (Pos-6). - In BPC, the beads are homogeneously distributed by magnets under gentle mixing (1 ms on; 2000 ms off) at different servo positions (Pos: 2050; 1750, 1450) to maximize the collision probability between the bead surface and the free DNA in the binding mixture. This process is carried out at room temperature for 2 minutes and 30 seconds. - Subsequently, the beads are held on the magnet by applying an external electromagnetic field (1 ms on; 5 ms off without changing polarity) to the chamber, the magnet is then held in the lower region (fluid access) of the BPC, and the supernatant (450 μl) is drawn from the chamber to the waste container (Pos-03) via a pump. - This process is repeated two more times, so that the entire binding mixture from Pos-10 is exposed to the beads in Pos-6. Cleaning step - 500 μl is transferred from Pos-12 to Pos-6 via a pump. - The magnet is moved from the bottom to the top and then returned to mix (3ms on; 5ms off), after which the electromagnet is switched on, and the coil movement is repeated until all the beads are collected on the magnet. - After the magnet with the beads returns to the bottom of the BPC, the supernatant (500 μl) is drawn from Pos-6 and discarded to Pos-3. This step can be repeated up to six times. Load the beads with the PCR master mix. - 100 μl of dH2O is moved from Pos-8 to Pos-7, which contains dried PCR reagent ("PCR master mix pellet"), and resuspended. - All the liquid is then moved to Pos-6 via a pump. - A gentle rotation of the permanent magnet (for 1 minute to facilitate fluid exchange and uniform distribution of the PCR master mix across the beads in the chamber) is the result. - 100 μl of supernatant is removed from the chamber via a pump to the waste treatment unit (Pos-3). Suspension system of beads in oil - 240 μl of PicoSurf (fluorocarbon oil with 5% emulsifier) ​​is transferred from Pos-9 to Pos-3 via a pump. - The beads are dispersed in oil for 3 × 12 seconds via powerful servo movement (speed: 120) and a very strong alternating magnetic field (4 on, 2 off). - The magnet is intentionally moved several times between the gas phase and the liquid phase to form an optimal bead suspension system. Subsequently, the protocol follows the steps described in Example 3: "Harvesting: Transferring beads into the pump," "Transferring to the rise chamber and reactor," "Automatically filling the culture chamber," and "PCR and detection." [Examples]

[0137] Layout of liquid handling and processing tools (= "cartridges") for processing different samples (body fluids) from a single patient. The cartridge may be equipped with reagents to accommodate processes for the analysis of different sample types derived from a single patient. Figure 13A shows a possible layout of such a cartridge that may allow for the detection of biomarkers from urine, swab, and whole blood from a single patient. The actual protocol essentially follows the steps already outlined in detail in Examples 3 and 4, but with emphasis on ensuring that different samples are exposed to the correct reagents and that the encoded beads in each BPC do not cross-contaminate. The BPC operates using a permanent opening located in the upper region of the chamber (such operation is sometimes referred to herein as “operation in overflow mode”). Such a permanent opening is shown, for example, in Figure 1, 1.3.3), and allows for fluid exchange to follow a unidirectional flow path, and enables the addition of new fluid / reagent through an inlet at the bottom of the BPC and transfer to a waste treatment section (Pos3) through a permanent overflow opening located in the upper region of the BPC. The steps of dissolution, washing, loading with PCR reagent, and bead suspension in oil are all performed in the respective chambers at Pos-6, Pos-5, and Pos-4. These locations also contain encoded nanoreactor beads and allow for separate sample processing. Beads from different BPCs are then collected in a pump and processed together in the unified workflow outlined in Examples 3 and 4. Sample type-specific data can be distinguished based on the bead code. This process is summarized in the flowchart in Figure 13B. [Examples]

[0138] Layout of liquid handling and processing tools (= "cartridges") for processing different samples (body fluids) from different patients. The cartridge may also be equipped with reagents to accommodate the process for simultaneous analysis of samples from different individuals. Figure 14A shows a possible layout of such a cartridge that allows for the detection of biomarkers from three different samples, where the samples are encoded by the fluorescent code of each nanoreactor bead that the samples will be matched with. The actual protocol essentially follows the steps outlined in Examples 3 and 4, but it is emphasized that cross-contamination between different samples will be prevented by using a liquid handling process that ensures that only liquids that have not come into contact with any of the samples are moved from each storage chamber to each BPC (POS-6, POS-5, POS-4). The BPCs operate using a permanent opening located in the upper region of the chamber (such operation is sometimes referred to herein as “operation in overflow mode”). Such permanent openings are shown, for example, in Figure 1, section 1.3.3), allowing for liquid exchange via a unidirectional flow path and enabling the addition of new liquid / reagent through an inlet at the bottom of the BPC, as well as transfer to the waste treatment section (Pos3) through a permanent overflow opening located in the upper region of the BPC. Otherwise, the steps of dissolution, washing, loading with PCR reagent, and bead suspension in oil are all performed individually for each sample in their respective chambers at Pos-6, Pos-5, and Pos-4. These locations also contain encoded nanoreactor beads and allow for separate sample processing. Bead mixing occurs in the pump section as part of the harvesting process. The mixed beads are then processed as a single sample according to the protocols previously outlined in Examples 3 and 4. Sample type-specific data can be distinguished based on the bead code. This particular process is summarized in the flowchart in Figure 14B. [Explanation of Symbols]

[0139] List of reference numbers 1. Chamber for processing magnetic nanoparticles ("processing chamber") 1.1 Chamber capacity for processing 1.2 At least one wall of the chamber for processing 1.2.1 The upper part of at least one of the walls (constituting the upper region of the chamber for processing) 1.3 Upper end of chamber for processing 1.3.1 Cap or seal to close the upper end of the chamber for processing 1.3.2 The upper region of the processing chamber located below and adjacent to the upper end of the processing chamber. 1.3.3 Permanent openings located in at least one wall in the upper region 1.4 Lower end of chamber for processing 1.4.1 The narrow end of the chamber for processing (when the chamber, preferably the volume of the chamber, has a frustoconical shape) 1.4.2 The wide end of the chamber for processing (when the chamber, preferably the volume of the chamber, has a frustoconical shape) 1.5 A freely movable permanent magnet located within the capacity of the chamber for processing. 2. Device for performing a method for processing magnetic nanoparticles 2.1 External Magnets 2.2 Actuator 3. Chamber for culturing and detecting microparticles ("Culturing and Detection Chamber") 3.1 The first compartment of the chamber for culturing and detection 3.1.1 Capacity of the first compartment ("first capacity") 3.1.2 Entrance opening of the first compartment 3.1.3 Exit opening of the first compartment 3.1.4 Upper end of the first section 3.1.5 Lower end of the first section 3.2 Second compartment of the chamber for culturing and detection 3.2.1 The capacity of the second compartment ("second capacity") 3.2.2 Entrance opening to the second section 3.2.2.1 Reversibly closing inlet valve of the second compartment 3.2.3 Exit opening of the second compartment 3.2.3.1 Reversibly closing outlet valve for the second compartment 3.2.4 Frame of the second section 3.2.4.1, 3.2.4.1' Side walls of the frame of the second section 3.2.4.2 Upper wall of the frame 3.2.4.3 Lower wall of the frame 3.2.4.4 Spacer pillar within the second capacity as described above 3.2.5 Conduit 3.2.5.1 Filters in conduits 4. A liquid handling and processing tool (= "cartridge") for establishing a fluid connection to or from the chamber and / or for realizing the flow of liquid into or from the chamber. 4.1 Housings for liquid handling and processing tools 4.1.1 Central space of the housing 4.1.2, 4.1.2', 4.1.2'' Multiple chambers for holding reagents or receiving liquids 4.1.3 At least one interface (= "processing interface") for fluidly connecting a separate chamber (1) for processing fine particles to the housing (4.1) of the liquid handling and processing tool (4). 4.1.4 At least one interface (= "culture interface") for fluidly connecting a separate chamber (3) for culturing and detecting microparticles to the housing (4.1) of the liquid handling and processing tool (4). 4.2 Fluid Displacement Chamber 4.2.1 Upper end of the fluid displacement chamber 4.2.2 Lower end of the fluid displacement chamber 4.2.3 Capacity of the fluid displacement chamber 4.2.3.1 The upper part of the volume of the fluid displacement chamber 4.2.3.2 The adjacent lower part of the volume of the fluid displacement chamber 4.2.3.2.1 Narrow part of a cone or frustum of a cone 4.2.3.2.2 The broad part of a cone or frustum of a cone 4.2.4 Movable piston of the fluid displacement chamber 4.3 Valve located at the lower end (4.2.2) of the fluid displacement chamber 5. Multiple fine particles, preferably magnetic fine particles.

Claims

1. A method for processing magnetic microparticles, in particular for exposing magnetic microparticles to a liquid and / or for generating a dispersion system of magnetic microparticles in a liquid, the method being: a) The process comprises the steps of providing a first liquid, a plurality of magnetic particles, and a chamber having a capacity for receiving the liquid and the plurality of magnetic particles in any order; the chamber further has a freely movable permanent magnet disposed within the capacity; b) The step of introducing the first liquid and the plurality of magnetic particles into the volume of the chamber in any order, and enabling the plurality of magnetic particles to be immersed in the first liquid, distributed within the first liquid, attracted to the freely movable permanent magnet, and preferably attached to the freely movable permanent magnet; c) comprising the step of generating a user-definable magnetic field, preferably a user-definable electromagnetic field, outside the chamber, wherein the generated user-definable magnetic field, preferably the user-definable electromagnetic field, exerts a magnetic force on the permanent magnets placed within the capacity, and the permanent magnets are held in a predetermined fixed position within the capacity; d) A step of changing the user-definable magnetic field, preferably the user-definable electromagnetic field, and thereby the magnetic force produced, wherein the permanent magnet rotates to align with the magnetic field, preferably the electromagnetic field, and a shear force acts on the magnetic particles so that the magnetic particles move within the volume, preferably during such movement, most of the plurality of magnetic particles, preferably all of the plurality of magnetic particles, are separated from the permanent magnet and distributed and dispersed within the first liquid. The aforementioned method.

2. The method according to claim 1, wherein the user-definable magnetic field is a user-definable electromagnetic field.

3. In step d), changing the user-definable magnetic field, preferably the user-definable electromagnetic field, is accompanied by a change in at least one of the following items, wherein the item is a change in the user-definable magnetic field, preferably the user-definable electromagnetic field: - position, - Polarity when the magnetic field is a direct current (DC) electromagnetic field, - The frequency when the magnetic field is an alternating current (AC) electromagnetic field, and - Strength Preferably, the user-definable magnetic field, preferably a change in the position of the electromagnetic field, more preferably a change in position and polarity, and more preferably a change in position, polarity and frequency. The method according to any one of claims 1 to 2.

4. Step d) is performed n times, where n is an integer in the range of 1 to 1000, preferably 1 to 500, more preferably 1 to 200, and even more preferably 1 to 100, and most preferably n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 4 The method according to any one of claims 1 to 3, selected from 2, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100.

5. The magnetic field is an electromagnetic field, and the method further: e * ) Complete step d) and: either keep the user-definable electromagnetic field constant or switch the user-definable electromagnetic field off; and, The method includes a step of physically separating the plurality of magnetic particles from the permanent magnet immediately after reaching a certain user-definable electromagnetic field or immediately after switching off the user-definable electromagnetic field, before the plurality of magnetic particles adhere to the permanent magnet, wherein such physical separation occurs by either removing the plurality of magnetic particles immersed in and distributed in the first liquid from the volume before the plurality of magnetic particles adhere to the permanent magnet, or by removing the permanent magnet from the volume before the plurality of magnetic particles adhere to the permanent magnet; wherein such removal of the plurality of magnetic particles or the permanent magnet leaves the magnetic particles dispersed in the first liquid. The method according to any one of claims 1 to 4.

6. The magnetic field is an electromagnetic field, and the method further: e) Complete step d), and: maintain the user-definable electromagnetic field constant for a sufficient amount of time, allowing the plurality of magnetic particles to reattach to the permanent magnet, and holding the permanent magnet in a predetermined fixed position within the capacity. or Switching the user-definable electromagnetic field off for a sufficient amount of time allows the multiple magnetic particles to reattach to the permanent magnet, and allows the permanent magnet to sink to the bottom of the chamber and remain there. The step of performing one of the following: The method according to any one of claims 1 to 4.

7. The aforementioned method further: f) The procedure includes the step of removing the first liquid from the volume while the plurality of magnetic particles are attached to the permanent magnet and the permanent magnet is held in a predetermined fixed position within the volume or is located at the bottom of the chamber, thereby separating the first liquid from the plurality of magnetic particles that remain attached to the permanent magnet; g) Providing a second liquid different from the first liquid, introducing the second liquid into the volume, and enabling the permanent magnet and the plurality of magnetic particles attached thereto to be immersed in the second liquid, The method according to claim 6.

8. The aforementioned method further: If step e) completes step d) and the user-definable electromagnetic field is kept constant: h) The step of maintaining the permanent magnet in a predetermined fixed position within the capacity by keeping the user-definable electromagnetic field constant; Alternatively, if step e) completes step d) and switches off the user-definable electromagnetic field: h * ) The method comprises the step of regenerating a user-definable electromagnetic field outside the chamber, wherein the generated user-definable electromagnetic field exerts a magnetic force on the permanent magnets placed within the capacity, and the permanent magnets are held in a predetermined fixed position within the capacity. The method according to claim 7.

9. The aforementioned method further: i) a step of changing the user-definable electromagnetic field and the magnetic force thereby produced, wherein the permanent magnet rotates to align with the electromagnetic field, and a shear force acts on the magnetic particles so that the magnetic particles move within the volume, preferably during such movement, most of the plurality of magnetic particles, more preferably all of the plurality of magnetic particles, are separated from the permanent magnet and distributed and dispersed within the second liquid; preferably, in step i), changing the user-definable electromagnetic field involves a change in the position of the user-definable electromagnetic field, more preferably a change in position and polarity, more preferably a change in position, polarity and frequency. The method according to claim 8.

10. The aforementioned method further: j) Complete step i), and: again maintain the user-definable electromagnetic field constant. or Again, perform one of the following actions: switch off the user-definable electromagnetic field; and, Again, immediately after reaching a certain user-definable electromagnetic field or immediately after switching the aforementioned user-definable electromagnetic field off; The process includes a step of physically separating the plurality of magnetic particles from the permanent magnet before the plurality of magnetic particles adhere to the permanent magnet, wherein such physical separation occurs by removing the plurality of magnetic particles that are distributed and dispersed in the second liquid from the volume before the plurality of magnetic particles adhere to the permanent magnet, or by removing the permanent magnet from the volume before the plurality of magnetic particles adhere to the permanent magnet; and such removal of the plurality of magnetic particles or the permanent magnet leaves the magnetic particles dispersed in the second liquid. The method according to claim 9.

11. The method according to any one of the claims, wherein the chamber is a tube-like chamber having at least one wall, and the capacity for receiving the liquid and a plurality of magnetic particles is surrounded by the at least one wall, and the chamber further has an upper end which may optionally be closed by a cap or seal.

12. The method according to claim 11, wherein the tubular chamber further has a longitudinal axis, and a capacity for receiving the liquid and a plurality of magnetic particles extends along the longitudinal axis of the chamber, and the chamber further has a lower end configured to be reversibly opened and closed by a valve, the lower end serving as an inlet for the liquid into the capacity, or serving as both an inlet for the liquid into the capacity and an outlet for the liquid from the capacity; the chamber further has an upper region, the upper region being located below and adjacent to the upper end, and formed by the upper part of at least one wall, and the upper region of the chamber having a permanent opening located in the at least one wall.

13. The method according to any one of the claims, wherein the volume of the chamber has the shape of a frustocone, the narrower end of the frustocone is located at the lower end of the chamber, and the wider end of the frustocone is located at the upper end of the chamber.

14. The method according to any one of the claims, wherein the first liquid is an aqueous liquid having an aqueous phase, and the second liquid, provided according to any one of claims 7 to 13, is a non-aqueous liquid having a non-aqueous phase, preferably an oil phase.

15. A chamber (1) for processing magnetic particles configured for use in any one of claims 1 to 14, wherein the chamber has a capacity (1.1), a longitudinal axis, and at least one wall (1.2) for receiving a liquid and a plurality of magnetic particles therein; the capacity for receiving the liquid and a plurality of magnetic particles therein extends along the longitudinal axis of the chamber and is surrounded by the at least one wall; the chamber further has an upper end (1.3) which may optionally be closed by a cap or seal (1.3.1) and can be reversibly opened by a valve. The chamber has a lower end (1.4) configured to be closed; the lower end functions as an inlet for liquid into the volume, or as both an inlet for liquid into the volume and an outlet for liquid from the volume; the chamber further has an upper region (1.3.2) located below and adjacent to the upper end, and formed by the upper part (1.2.1) of at least one wall, and the upper region of the chamber has a permanent opening (1.3.3) located in the at least one wall; the chamber further has a freely movable permanent magnet (1.5) located within the volume. The aforementioned chamber.

16. The chamber according to claim 15, wherein the chamber is a tube-like chamber and has the shape of a frustocone, the narrower end of the frustocone (1.4.1) is located at the lower end of the chamber, and the wider end of the frustocone (1.4.2) is located at the upper end of the chamber.

17. The chamber according to any one of claims 15 to 16, wherein the permanent opening located in the upper region of the chamber is configured to function as an inlet for gas, in particular air, or as an outlet for gas or liquid; the permanent opening is either an opening without a closing mechanism that allows free access of a substance to the volume of the chamber and free exit of a substance from the volume of the chamber, or an opening with a filter, the filter preferably configured to block particles larger than 100 μm, or to self-seal in contact with a liquid.

18. A device (2) for carrying out the method according to any one of claims 1 to 14, the device comprising a chamber (1) for processing magnetic particles according to any one of claims 15 to 17, an external magnet (2.1), and an actuator (2.2); the external magnet is positioned near the chamber for processing the magnetic particles and exerts a magnetic force on a freely movable permanent magnet positioned within the volume of the chamber, and the freely movable permanent magnet is held in a predetermined fixed position within the volume; the external magnet is an electromagnet or a permanent magnet; and the positioning of the external magnet relative to the chamber is achieved by the actuator.

19. A chamber (3) for culturing and detecting microparticles, particularly magnetic microparticles, and in particular for performing and detecting chemical / biochemical reactions using the microparticles, such as amplification reactions using the microparticles, wherein the chamber for culturing and detecting the microparticles is a two-part chamber, and: - Having a first compartment (3.1) having a first volume (3.1.1), the first compartment is configured for a process of concentrating the fine particles in a suspension system of the fine particles in a liquid surrounding the fine particles, the process of concentrating in the first volume utilizing the density difference between the fine particles and the liquid surrounding the fine particles; the first compartment has an inlet opening (3.1.2) and an outlet opening (3.1.3), the inlet opening and the outlet opening respectively allowing the liquid or suspension system to flow into and out of the first volume; - Having a second compartment (3.2) having a second volume (3.2.1), the second compartment is configured to contain the concentrated microparticles in a tightly packed arrangement within the second volume, and the second compartment is configured for thermal culture and detection of the microparticles arranged in a tightly packed arrangement; the second compartment has an inlet opening (3.2.2) and an outlet opening (3.2.3), the inlet opening and the outlet opening each allowing a liquid or suspension system to flow into and out of the second volume, the inlet opening and the outlet opening each having a reversibly closing inlet valve (3.2.2.1) and an outlet valve (3.2.3.1), the inlet valve and the outlet valve each enabling the reversibly closing of the inlet opening (3.2.2) and the outlet opening (3.2.3), and thus enabling the sealing of the second volume (3.2.1) when both valves are closed; The first compartment (3.1) and the second compartment (3.2) are fluidly connected to each other through the inlet opening (3.2.2) of the second compartment, and when the inlet valve (3.2.2.1) is open, the suspension system of concentrated particulate matter flows from the first volume into the second volume. The aforementioned chamber.

20. The first compartment configured for the process of concentrating fine particles within the first volume is either a riser tube or a drop-down tube, and the riser tube and the drop-down tube each have an upper end (3.1.4) and a lower end (3.1.5), and if the first compartment is a riser tube, the riser tube is connected to the front of the riser tube via the inlet valve (3.2.2.1) of the second compartment and the outlet opening (3.1.3) of the first compartment. The chamber according to claim 19, wherein the upper end (3.1.4) is fluidly connected to the inlet opening (3.2.2) of the second compartment, and if the first compartment is a downpipe, the downpipe is fluidly connected to the inlet opening (3.2.2) of the second compartment at the lower end (3.1.5) of the downpipe via the inlet valve (3.2.2.1) of the second compartment and the outlet opening (3.1.3) of the first compartment.

21. The second compartment has a frame (3.2.4) surrounding the second volume (3.2.1), the frame having side walls (3.2.4.1, 3.2.4.1'), an upper wall (3.2.4.2) and a lower wall (3.2.4.3) located opposite the upper wall, the lower wall preferably parallel to the upper wall; the second volume (3.2.1) is surrounded by the side walls (3.2.4.1, 3.2.4.1'), the upper wall (3.2.4.2) and the lower wall (3.2.4.3); and one of the upper wall and the lower wall, preferably the upper wall, is to be matched by an optical sensor. A chamber according to any one of claims 19 to 20, wherein the transparent wall is configured as follows: and the other of the upper wall and the lower wall, preferably the lower wall, is a wall having low thermal resistivity and is configured to be in contact with a temperature control device; preferably, the distance between the upper wall and the lower wall is in the range of 10 μm to 500 μm, more preferably in the range of 20 μm to 300 μm, more preferably in the range of 50 μm to 250 μm, more preferably in the range of 50 μm to 200 μm, and even more preferably in the range of 100 μm to 200 μm.

22. The chamber according to any one of claims 19 to 21, wherein the inlet opening (3.2.2) and the outlet opening (3.2.3) are formed of or have an elastomer material, and the chamber has a first closing means and a second closing means configured such that the inlet valve (3.2.2.1) and the outlet valve (3.2.3.1) are each independently pressed against the inlet opening and the outlet opening or inserted into the inlet opening and the outlet opening, and thereby compress the elastomer material, and thereby reversibly close the inlet opening and the outlet opening in a pressure-resistant manner, thereby allowing the pressure to rise in the second compartment, preferably the first closing means and the second closing means are independently selected from rods, bars, sticks, strips, pillars, clamps, clips and clasps.

23. The upper wall and the lower wall of the second volume are held apart by at least one spacer pillar (3.2.4.4) located within the second volume and in contact with the upper wall and the lower wall, thereby preventing the upper wall and the lower wall from collapsing; preferably, the upper wall and the lower wall are evenly distributed within the second volume and held apart by two, three, four, five or more spacer pillars located within the second volume and in contact with the upper wall and the lower wall, thereby preventing the upper wall and the lower wall from collapsing, according to any one of claims 19 to 22.

24. The chamber according to any one of claims 19 to 23, wherein the outlet opening (3.2.3) of the second capacity is permanently open and connected to a conduit (3.2.5) that functions as a vent; preferably, the conduit has a filter (3.2.5.1) configured to contain particles larger than 100 μm or to self-seal upon contact with a liquid.

25. A chamber for processing magnetic microparticles according to any one of claims 15 to 17, or a chamber for culturing and detecting microparticles according to any one of claims 19 to 24, wherein the chamber further preferably comprises a plurality of magnetic microparticles (5) dispersed in a liquid, the liquid being an aqueous phase or a non-aqueous phase when the chamber is a chamber for processing magnetic microparticles, and being a non-aqueous phase when the chamber is a chamber for culturing and detecting microparticles.

26. A liquid handling and processing tool (4) for establishing a fluid connection to or from a chamber and / or for realizing a flow of liquid to or from a chamber, wherein the liquid handling and processing tool is: - Having a housing (4.1), the housing includes a central space (4.1.1) and a number of chambers (4.1.2, 4.1.2', 4.1.2'') arranged around the central space (4.1.1) for holding reagents or receiving liquids; - A fluid displacement chamber (4.2) having an upper end (4.2.1) and a lower end (4.2.2), the fluid displacement chamber surrounding a volume (4.2.3) for receiving, handling, and moving a liquid, the volume for receiving and handling the liquid (4.2.3) having an upper part (4.2.3.1) and an adjacent lower part (4.2.3.2), the upper part (4.2.3.1) being cylindrical, and the adjacent lower part (4.2.3.2) being conical or frustoconical, the cone or frustoconical being positioned upside down within the fluid displacement chamber (4.2), the narrow portion of the cone or frustoconical being positioned at the lower end (4.2.2) of the fluid displacement chamber, and the wider portion of the cone or frustoconical being (4.2.3.2.2) transitioning into the upper part (4.2.3.1) of the volume; The fluid displacement chamber (4.2) further has a movable piston (4.2.4) positioned in the upper part (4.2.3.1) of the volume (4.2.3) and fitted tightly therein, wherein the piston is movable within the upper part (4.2.3.1) of the volume but not within the adjacent lower part (4.2.3.2) of the volume, or is sized not to be movable within the adjacent lower part (4.2.3.2) of the volume; The fluid displacement chamber (4.2) is located in the central space (4.1.1) of the housing (4.1), and the plurality of chambers (4.1.2, 4.1.2', 4.1.2'') are arranged around the fluid displacement chamber (4.2); - Having a valve (4.3), the valve is located at the lower end (4.2.2) of the fluid displacement chamber (4.2) and enables the establishment of a single fluid connection from the fluid displacement chamber (4.2) to a selected chamber from among the plurality of chambers (4.1.2, 4.1.2', 4.1.2''), The aforementioned liquid handling and processing tools.

27. - The housing (4.1) further has at least one interface (4.1.3) ("processing interface") for fluidly connecting to the housing (4.1) a separate chamber (1) for processing the microparticles described in any of claims 15 to 17 and 25; and / or the housing (4.1) further has at least one interface (4.1.4) ("culture interface") for fluidly connecting to the housing (4.1) a separate chamber (3) for culturing and detecting the microparticles described in any of claims 19 to 24 and 25; - The valve (4.3) located at the lower end (4.2.2) of the fluid displacement chamber (4.2) enables the establishment of a single fluid connection from the fluid displacement chamber (4.2) to one of the at least one interface for fluidly connecting a selected chamber from the plurality of chambers (4.1.2, 4.1.2', 4.1.2'') or a separate chamber (1) for processing the microparticles as described in any of claims 15 to 17 and 25, or to one of the at least one interface (4.1.4) for fluidly connecting a separate chamber (3) for culturing and detecting the microparticles as described in any of claims 19 to 24 and 25. A liquid handling and processing tool according to claim 26.

28. The liquid handling and processing tool according to claim 27, wherein the valve (4.3) located at the lower end (4.2.2) of the fluid displacement chamber (4.2) is configured to establish a series of single fluid connections, i.e., one single fluid connection at a given time, in which one single fluid connection is established in succession, and the one single fluid connection is from the fluid displacement chamber (4.2) to one of the selected chambers (4.1.2, 4.1.2', 4.1.2'') or one of the interfaces (4.1.3, 4.1.4), and preferably the valve (4.3) is a rotary valve.

29. Furthermore, the liquid handling and processing tool according to any one of claims 27 to 28, comprising a chamber (1) for processing fine particles according to any one of claims 15 to 17, wherein the chamber (1) for processing fine particles is fluidly connected to the processing interface (4.1.3).

30. Furthermore, the liquid handling and processing tool according to any one of claims 27 to 28, comprising a chamber (3) for culturing and detecting the fine particles described in any one of claims 19 to 25, wherein the chamber (3) for culturing and detecting the fine particles is fluidly connected to the culture interface (4.1.4).

31. The liquid handling and processing tool according to any one of claims 27 to 28, further comprising a chamber (1) for processing the fine particles according to any one of claims 15 to 17, wherein the chamber (1) for processing the fine particles is fluidly connected to the processing interface (4.1.3); and further comprising a chamber (3) for culturing and detecting the fine particles according to any one of claims 19 to 24, wherein the chamber (3) for culturing and detecting the fine particles is fluidly connected to the culture interface (4.1.4).

32. The liquid handling and processing tool according to any one of claims 29 to 31, further comprising a plurality of magnetic microparticles (5); preferably, the magnetic microparticles are arranged in either a chamber (1) for processing the microparticles or a chamber (3) for culturing and detecting the microparticles.

33. Furthermore, the liquid handling and processing tool according to any one of claims 26 to 32, further comprising an aqueous phase and a separate non-aqueous phase.

34. A process for housing microparticles in a tightly packed configuration within the volume of a chamber (3) for culturing and detecting microparticles, wherein the process is: a) The process comprises the steps of providing a chamber (3) for culturing and detecting the fine particles according to any one of claims 19 to 24 and 25, and a plurality of fine particles (5) dispersed in a liquid, in any order; preferably, the liquid is a non-aqueous liquid, and more preferably, it has an oil phase; b) The procedure includes the step of introducing the plurality of fine particles (5) dispersed in the liquid into the first compartment (3.1) of a chamber (3) for culturing and detecting the fine particles, and concentrating the fine particles in the first volume (3.1.1) of the first compartment (3.1) by utilizing the density difference between the fine particles and the liquid surrounding the fine particles; c) The method comprises the step of arranging the plurality of microparticles (5) in a tightly packed configuration in the second volume (3.2.1) of the second compartment (3.2) of the chamber (3) for culturing and detecting the microparticles, the step of discharging the concentrated microparticles from the first volume (3.1.1) of the first compartment (3.1) and introducing them into the second volume (3.2.1) of the second compartment (3.2) through the inlet opening (3.2.2); and arranging the plurality of microparticles in the first compartment (3 1) The process is carried out by continuously discharging the particles from the first volume (3.1.1) into the second volume (3.2.1), closing the outlet opening (3.2.3) when a first portion of the particles reaches the second volume (3.2.1) or the outlet opening (3.2.3), thereby increasing the pressure within the second compartment (3.2), and closing the inlet opening (3.2.2) when all of the particles have been introduced into the second compartment (3.2). The aforementioned process.

35. The process according to claim 34, wherein for step b), the density of each of the fine particles is selected to be different from the density of the liquid in which the fine particles are dispersed, and step b) is accompanied by allowing the fine particles to accumulate at the upper end (3.1.4) of the first volume (3.1) if the density of each of the fine particles is less than the density of the liquid in which the fine particles are dispersed; or step b) is accompanied by allowing the fine particles to accumulate at the lower end (3.1.5) of the first volume (3.1).

36. The process according to any one of claims 34 to 35, wherein the densely packed arrangement in step c) is a single layer of fine particles, and the fine particles are closely packed within the single layer.

37. The chamber (3) for culturing and detecting the aforementioned microparticles is the chamber according to any one of claims 21 to 24 and 25, and has a frame (3.2.4) surrounding the second volume (3.2.1), the frame (3.2.4) having side walls (3.2.4.1, 3.2.4.1'), an upper wall (3.2.4.2) and a lower wall (3.2.4.3) located opposite to the upper wall (3.2.4.2), the lower wall and the upper wall being parallel to each other; the second The volume (3.2.1) is surrounded by the side walls (3.2.4.1, 3.2.4.1'), the upper wall (3.2.4.2), and the lower wall (3.2.4.3); one of the upper wall (3.2.4.2) and the lower wall (3.2.4.3) is a transparent wall configured to be matched by an optical sensor; and the other of the upper wall and the lower wall is a wall having low thermal resistivity and configured to be in contact with a temperature control device; The number of particles dispersed in the liquid is selected so as not to exceed the maximum number of particles that can be arranged in a single layer between the upper wall (3.2.4.2) and the lower wall (3.2.4.3) in the second compartment (3.2), and the single layer has as close packing as possible; or the number of particles dispersed in the liquid is selected so as to cover an area equal to or smaller than the area provided by the upper wall (3.2.4.2) or the lower wall (3.2.4.3) when the particles are arranged in a single layer between the upper wall (3.2.4.2) and the lower wall (3.2.4.3) in the second compartment (3.2). The process according to any one of claims 34 to 36.