Aptamer Dynamic Range Compression and Detection Techniques

JP2026530187APending Publication Date: 2026-09-04ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026513426
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-08-31
Filing Date
2024-08-29
Publication Date
2026-09-04

Smart Images

  • Figure 2026530187000001_ABST
    Figure 2026530187000001_ABST
Patent Text Reader

Abstract

An aptamer detection technique with dynamic range compression is described, which allows for the removal of a portion of the more abundant aptamers in an aptamer-based assay. In embodiments, high-abundance oligonucleotides, when in double-stranded form, may tend to re-anneal to each other under certain hybridization conditions compared to low-abundance oligonucleotides. These re-annealed fragments may be digested or unavailable for amplification. In embodiments, high-abundance oligonucleotides can be differentially captured compared to low-abundance oligonucleotides using complementary regions of different lengths. Low-abundance oligonucleotides may be captured by longer complementary regions, which may provide more robust hybridization at annealing temperatures compared to shorter complementary regions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] (Cross-Reference to Related Application) This application claims priority and the benefit thereof to U.S. Provisional Application 63 / 535,9712 (filed on August 31, 2023), the disclosure of which is incorporated herein by reference in its entirety.

[0002] (Reference to Electronic Sequence Listing) This application contains a Sequence Listing submitted electronically in XML format, which is incorporated herein by reference in its entirety. Said XML copy, created on August 21, 2024, is named "ILUM_0138PCT.xml" and has a size of 27,678 bytes. The Sequence Listing contained in this XML file is a part of the present specification and is incorporated herein by reference in its entirety. Background Art

[0003] The technology of the present disclosure generally relates to aptamer detection and / or identification techniques for dynamic range compression in combination with aptamer-based assays. In particular, the disclosed technology relates to nucleic acid sequencing for direct or indirect aptamer detection in combination with aptamer-based assays.

[0004] The subject matter discussed in this section should not be construed as prior art merely by virtue of its mention in this section. Similarly, any problems mentioned in this section or problems associated with subject matter provided as background should not be construed as having been previously recognized in the prior art. The subject matter of this section merely represents different approaches, and may itself also correspond to embodiments of the claimed technology.

[0005] Protein expression patterns are useful in defining cellular identity and state. While RNA transcripts are often used as a substitute for protein expression, the relationship between protein and mRNA abundance is not one-to-one. Differences exist due to post-transcriptional, translational, and protein degradation regulation. Therefore, direct nucleic acid sequencing of RNA transcripts cannot provide an accurate estimate of protein expression.

[0006] Aptamers are nucleic acids that bind to molecular targets, such as proteins, with high affinity and specificity. Advances in aptamer selection and design include the systematic evolution of ligands by exponential enrichment (SELEX). In SELEX, high-affinity nucleic acids for different target analytes can be isolated from combinatorial libraries, enabling high-throughput characterization of aptamer-target binding and multiplexed assays for analytes in complex biological samples. When an aptamer binds to an analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample. However, because the concentrations of proteins or other analytes can vary highly within and / or between different biological samples, it is difficult to identify a useful detection range in multiplexed aptamer-based assays. [Overview of the project]

[0007] In one embodiment, the disclosure provides a method for detecting aptamers. The method involves contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for each different analyte of the analyte, and the analyte is detected by detecting the aptamers of the analyte-aptamer complex. Detecting aptamers involves generating double-stranded oligonucleotides from the aptamers, each double-stranded oligonucleotide comprising an individual aptamer and a complementary chain, denaturing the double-stranded oligonucleotide under denaturing conditions to generate a denatured chain containing the individual aptamer and complementary chain, contacting the denatured chain with a primer under re-annealing conditions such that several denatured chains re-anneal to each other and a portion of the denatured chain anneals to the primer, generating an amplicon by extending from the primer annealed to the denatured chain using a polymerase, and detecting the aptamers using the amplicon.

[0008] In one embodiment, the present disclosure provides a method for detecting aptamers. The method comprises contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for each different analyte of the analyte, and detecting the analyte by detecting the aptamers of the analyte-aptamer complex. Detecting aptamers comprises generating a double-stranded oligonucleotide from the aptamers, each double-stranded oligonucleotide comprising an individual aptamer and a complementary chain, denaturing the double-stranded oligonucleotide under denaturing conditions to generate a denatured chain containing the individual aptamer and complementary chain, contacting the denatured chain with a nuclease under re-annealing conditions such that some denatured chains re-anneal to each other and some denatured chains do not, digesting the re-annealed chain with the nuclease, extending from the primers annealed to the denatured chain using a polymerase to generate an amplicon, and detecting the aptamers using the amplicon.

[0009] In one embodiment, the present disclosure provides a method for aptamer detection. The method comprises contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for each different analyte of the analyte, and the analyte is detected by detecting the aptamers of the analyte-aptamer complex. Detecting the aptamers comprises contacting the aptamers with one or more capture beads, each of which contains a plurality of single-stranded capture molecules, each individual capture molecule containing a complementary region complementary to a portion of an individual aptamer, with a diversity in the length of the complementary regions among the plurality of single-stranded capture molecules, and the contact is under conditions that allow at least some of the aptamers to hybridize to the plurality of single-stranded capture molecules. Detection also comprises separating one or more beads having the hybridized aptamers and detecting the hybridized aptamers. [Brief explanation of the drawing]

[0010] These and other features, aspects, and advantages of the disclosed embodiments will be better understood by reading the following detailed description with reference to the accompanying drawings, and similar features are represented in similar parts across the drawings. [Figure 1] This is a schematic diagram of an exemplary dynamic range within a sample according to an embodiment. [Figure 2] An exemplary workflow for dynamic range compression is shown according to the embodiment. [Figure 3] This embodiment illustrates an exemplary workflow for dynamic range compression using different probe mixtures based on aptamer abundance. [Figure 4] This is a schematic diagram of the separation of the capture probe and reporter probe according to the embodiment. [Figure 5] This is a schematic diagram of a tripolecular complex for use in conjunction with a dynamic range compression technique, according to an embodiment. [Figure 6]An exemplary arrangement of non-hybridized regions according to the embodiment is shown. [Figure 7] An exemplary reporter probe direct amplification technique is shown according to an embodiment. [Figure 8] This embodiment demonstrates exemplary sequencing from a direct amplification technique. [Figure 9] An exemplary reporter probe step-out amplification technique is shown according to the embodiment. [Figure 10] This embodiment demonstrates exemplary sequencing from a step-out amplification technique. [Figure 11] An exemplary reporter probe ligation amplification technique according to an embodiment is shown. [Figure 12] This embodiment demonstrates exemplary sequence determination from a ligation amplification technique. [Figure 13] An exemplary sprint ligation technique is shown according to an embodiment. [Figure 14] An exemplary extension ligation technique is shown according to the embodiment. [Figure 15] An exemplary extension ligation technique is shown according to the embodiment. [Figure 16] An exemplary split-reporter probe technique according to an embodiment is shown. [Figure 17] An exemplary split-reporter probe technique using a sprint, according to an embodiment, is shown. [Figure 18] This embodiment demonstrates exemplary exonuclease digestion for use in conjunction with the split-reporter probe technique. [Figure 19] This embodiment illustrates exonuclease digestion for use in conjunction with the cyclization-resolved reporter-probe technique. [Figure 20] An exemplary dummy reporter technique using a mixture of amplified and non-amplified regions is shown according to the embodiment. [Figure 21] An exemplary dummy reporter technique using endogenous restriction enzyme sites is shown according to the embodiment. [Figure 22]illustrates an exemplary exonuclease digestion technique according to an embodiment. [Figure 23] illustrates an exemplary bead-based selection technique according to an embodiment. [Figure 24] illustrates an exemplary dynamic range compression workflow using primer competition according to an embodiment. [Figure 25] illustrates an exemplary dynamic range compression workflow using nuclease digestion according to an embodiment. [Figure 26] illustrates an exemplary dynamic range compression split workflow using nuclease digestion according to an embodiment. [Figure 27] illustrates exemplary dynamic range compression capture beads and corresponding variable-length complementary regions according to an embodiment. [Figure 28] illustrates temperature-based binding of aptamers by capture beads according to an embodiment. [Figure 29] illustrates multiplexed capture beads having aptamers captured using complementary regions of different lengths according to an embodiment. [Figure 30] illustrates an exemplary streamlined workflow using index amplification according to an embodiment. [Figure 31] is a plot comparing sequencing read counts from the streamlined workflow of Figure 30 with a ligation preparation workflow. [Figure 32] illustrates an exemplary workflow using reduced washing steps according to an embodiment. [Figure 33] shows sequencing read counts under different washing conditions. [Figure 34] shows compression of sequencing read counts using dummy-biotin for different aptamers. [Figure 35] illustrates exemplary undesired non-specific binding between aptamer binding regions. [Figure 36] shows the involvement of different aptamer binding regions in non-specific binding. [Figure 37]This is a block diagram of a sequencing device configured to acquire sequencing data according to an embodiment. [Modes for carrying out the invention]

[0011] The following considerations are presented to enable those skilled in the art to fabricate and use the disclosed technology and are provided in relation to specific uses and their requirements. Various modifications to the disclosed embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and uses without departing from the spirit and scope of the disclosed technology. Accordingly, the disclosed technology is not intended to be limited to the embodiments shown, but is given the broadest scope consistent with the principles and features disclosed herein.

[0012] Aptamers are short, single-stranded nucleic acid molecules (ssDNA or ssRNA) that can bind with high affinity to their specific target molecules. Therefore, aptamers can be used for multi-omics applications such as proteomic characterization of samples using high-throughput methods. For evaluating proteins in complex samples in high-throughput approaches, a challenge is combining aptamers with low-abundance proteins in a single panel, along with high-abundance proteins. For example, human serum / plasma contains proteins whose concentrations can vary by many orders of magnitude, e.g., over a 10-log range. Certain aptamer detection platforms can compress the dynamic range of the proteins being detected. However, even after compression, the dynamic range can still be relatively large. Figure 1 shows an exemplary 5-log dynamic range within aptamer detection results for a sample, illustrating three different aptamers with positive binding results along a wide dynamic range. To address the complexity of the dynamic range, samples may undergo pretreatment or proteins may be measured over a specific range using a targeted panel. These approaches add additional complexity and opportunities for loss of low-concentration proteins.

[0013] This specification discloses a technique for compressing the dynamic range of aptamers having a positive binding result (e.g., binding to a target molecule in a sample), which may occur before or in conjunction with the aptamer detection step. This technique maintains aptamer binding to low-abundance proteins evaluated together with high-abundance proteins. Furthermore, since low-abundance proteins may correspond to biomarkers that can be used for diagnostic purposes, the disclosed technique prevents noise or false-negative results in aptamer-based assays caused by high-abundance proteins that obscure the results. In addition, reducing the dynamic range can also reduce the amount of total sequencing data required to detect aptamers in a detection assay by reducing the amount of reads wasted on high-abundance aptamer sequences. In certain embodiments, the disclosed technique may provide a streamlined workflow with reduced instrument load through a reduction in the number of steps (e.g., a single hybridization reaction or a reduced number of washing steps). The disclosed technique may include a sample preparation step and / or sample preparation that enables improved aptamer abundance measurement.

[0014] Figure 2 shows an exemplary workflow for dynamic range compression, where the dynamic range of individual aptamers 14a can be compressed by removing some of the aptamers 14a before the detection step. The illustrated workflow demonstrates dynamic range compression in individual aptamers 14a of a single-aptamer type. It should be understood that the illustrated workflow can be extended in parallel to all aptamers in a multiplexed aptamer-based assay. Furthermore, the assay eluent may contain multiple aptamers 14a, depending on the concentration of the target molecule of aptamers 14a in the sample being evaluated. Aptamers 14a are single-stranded nucleic acids having immobilized or substantially immobilized nucleic acid sequences. Therefore, all copies or multiples of individual aptamers 14a may share a conserved sequence. Different aptamers, generally referred to as aptamers 14 (see Figure 3), may have different nucleic acid sequences relative to one another, facilitating different target specificities for each different aptamer 14.

[0015] Using the conserved sequence of aptamer 14a, a probe set 20 can be designed, comprising a first probe 22 that hybridizes to a first region 23 of aptamer 14a (e.g., via a complementary sequence), and a second probe 24 that hybridizes to a second region 25 of aptamer 14a. The first probe 22 is a mixture of at least two different types of probes, both sharing the ability to hybridize to the first region 23. As illustrated, the mixture includes an affinity-tagged probe 28 containing an affinity tag 30, and a dummy probe 32 lacking the affinity tag 30. In embodiments, the affinity-tagged probe 28 and the dummy probe 32 are identical except for the presence or absence of the affinity tag 30. The ratio of affinity-tagged probe 28 to dummy probe 32 can be adjusted based on the abundance of the target of aptamer 14a, as is commonly considered herein.

[0016] The workflow includes the step of contacting the aptamer 14a with a probe set 20, for example, a first probe 22 and a second probe 24. Both affinity-tagged probes 28 and dummy probes 32 of the first probe 22 have the same binding ability and specificity to the first region 23 of the aptamer 14a, and contact between the first probe and the aptamer 14a results in binding to both affinity-tagged probes 28 and dummy probes 32. If affinity-tagged probes 28 are scarce in the mixture of first probes 22 (e.g., less than 10%), the majority of the aptamer 14a will bind to the dummy probes 32. Furthermore, all of the second probes 24 can be identical to each other. Thus, two different types of tripolecular complexes are formed for the aptamer 14a. The first type 33 includes the second probe 24 and dummy probes 32. The second type 34 includes the second probe 24 and affinity-tagged probe 28. Here again, since the first probe 22 is provided as a mixture, the relative ratio of the first type 33 and the second type 34 trimolecular complex depends on the ratio of affinity-tagged probe 28 to dummy probe 32 in the first probe 22. The ratio of affinity-tagged probe 28 to dummy probe 32 can be selected for each aptamer in the assay based on its relative abundance to other aptamers, for example, to compress the dynamic range for downstream detection via NGS.

[0017] The workflow also includes a step of separating the first type 33 trimolecular complex from the second type 34 trimolecular complex via a capture entity. For example, only the second type 34 trimolecular complex may be captured using the capture entity shown herein as a capture bead 36 bound to an affinity tag binder 38. However, other configurations are also contemplated, including column-based, flow cell-based, or substrate-based separation using a capture entity bound to an affinity tag 30. Unbound first type 33 can be washed or separated to leave only the second type 34 trimolecular complex and its component molecules, aptamer 14a, affinity-tagged probe 28, and second probe 24. In addition, any unbound or uncaptured probes in probe set 20 are also removed. The workflow also includes detection, as a surrogate measurement of aptamer 14a as generally considered herein, via sequencing of the second probe 24, or oligonucleotides amplified from or otherwise derived from the second probe 24.

[0018] Figure 3 shows an exemplary workflow for dynamic range compression comparing a high-abundance aptamer 14a with a low-abundance aptamer 14b. For example, a high-abundance aptamer 14a may have specific binding affinity to proteins known to be abundant, such as albumin, α-2-macroglobulin, apolipoprotein A1, complement C4, IgG, IgM, apolipoprotein A2, α-1-antitrypsin, plasminogen, or collagen. A low-abundance aptamer 14b may have specific binding affinity to biomarkers, transiently expressed proteins, or proteins expressed only in specific types of cells. These are examples, and it should be understood that the identity of the protein target depends on the composition of the aptamers in the aptamer-based assay. Furthermore, it should be understood that in certain embodiments, high-abundance and low-abundance aptamers may be based on their abundance relative to each other, or on other aptamers in the aptamer-based assay, rather than on absolute abundance or concentration.

[0019] In the illustrated example, the high-abundance aptamer 14a may be expected to be present in the aptamer-based assay eluent at a higher concentration compared to the low-abundance aptamer 14b, for example, based on empirical testing or retrospective analysis. Therefore, to compress the dynamic range in the downstream detection step, different mixtures of the first probe in probe sets 20a and 20b can be used based on the expected abundance. With the high-abundance aptamer 14a, a relatively larger number of aptamer-binding dummy complexes may be removed via binding to the dummy probe 32a. Thus, the dummy probe 32a may be present in a higher proportion in the first probe 22a. To convert less aptamer 14b via dummy binding before the detection step, the dummy probe 32b may be present in a relatively low proportion in the first probe 22b. In one embodiment, the proportion of dummy probe 32b may be 0%. In other words, for a particular aptamer, probe 22 may contain only the tagged probe 28 and not the dummy probe 32. Therefore, the ratio of dummy probe 32 to affinity tagged probe 28 can be adjusted and may differ for different aptamers 14. In high-throughput assays, each individual aptamer 14 may associate with different ratios of dummy probe 32 to affinity tagged probe 28, in the embodiment.

[0020] In embodiments, the ratio of dummy probes 32 to affinity-tagged probes 28 in a mixture of first probes 22 can be greater than 100,000:1, greater than 10,000:1, greater than 1,000:1, greater than 100:1, greater than 20:1, greater than 10:1, greater than 5:1, greater than 2:1, about 1:1, less than 1:2, or less than 1:5. In embodiments, the mixture of first probes 22 includes only dummy probes 32 or affinity-tagged probes 28 and does not include other probe types. In embodiments, dummy probes 32 constitute at least 25%, at least 50%, at least 75%, or at least 90% of the mixture of first probes 22. In embodiments, the mixture of first probes 22 includes only dummy probes 32 or affinity-tagged probes 28 and does not include other probe types. In embodiments, the first probes 22 include only affinity-tagged probes 28 and do not include any dummy probes 32. For example, with proteins present in very low abundances, it may be undesirable to lose any aptamer 14 through removal.

[0021] In a high-throughput assay, each individual aptamer 14 can associate with the affinity-tagged probe 28 of the dummy probe 32 at different ratios, such that each individual aptamer 14 has a unique ratio compared to other aptamers 14 used together in the panel or assay. In an embodiment, a particular group of aptamers 14 that have all associated within an approximate abundance range can have the same ratio to the affinity-tagged probe 28 of the dummy probe 32 compared to one another. In an embodiment, for a high-throughput assay, at least three different ratios of dummy probe 32 to affinity-tagged probe 28 exist for a group of at least 1000 different aptamers 14. In an embodiment, at least 5, 10, 50, 100, or more different ratios of dummy probe 32 to affinity-tagged probe 28 exist for the aptamers 14 in the assay.

[0022] The workflow includes contacting aptamers 14a, 14b with probe sets 20a, 20b, for example, first probes 22a, 22b and second probes 24a, 24b. It should be understood that the first probes 22a, 22b have different binding ability and specificity to different first regions 23a, 23b, and therefore have different nucleic acid sequences. Similarly, the second probes 24a, 24b have different binding ability and specificity to different second regions 25a, 25b, and therefore have different nucleic acid sequences. Contact with probe sets 20a, 20b results in the formation of first type 33a, 33b and second type 34a, 34b trimolecular complexes. Therefore, in the illustrated example, due to the different ratios of the dummy probe 32 to the affinity-tagged probe 28 in the first probes 22a, 22b compared to each other, different ratios of first type 33a, 33b trimolecular complexes and second type 34a, 34b trimolecular complexes are formed between different aptamers 14a, 14b. Since aptamer 14a is more abundant, a larger proportion of first type 33a is formed and can subsequently be removed in a capture step using affinity tags 30 and capture entities, such as capture beads 36 and affinity tag binders 38. The affinity tag 30 can be the same tag for all affinity-tagged probes 28, enabling the capture of all second type 34 trimolecular complexes by the same means.

[0023] In embodiments, even if the high-abundance aptamer 14a is of the first type 33a, where most complex formation is removed by at least 50%, at least 75%, or at least 90%, it should be understood that the high-abundance aptamer 14a may nevertheless be present in greater quantities at detection, simply due to a higher overall starting concentration compared to the low-abundance aptamer 14b. That is, 1% of high-abundance aptamer 14a may be greater than 100% of low-abundance aptamer 14b. However, the disclosed techniques can compress the dynamic range by 1 log, 2 log, or more based on ratio adjustments or other techniques considered herein.

[0024] The disclosed technique includes a workflow in which an affinity-tagged probe 28, used to capture an aptamer 14 in a tripolecular complex, is separated from a second probe 24 to be detected. Figure 4 illustrates the advantages of separating a reporter probe or detection probe, e.g., a second probe 24b, from a capture probe, e.g., an affinity-tagged probe 28b. In one example, aptamer 14b is not detected in a particular sample based on the sample composition. Therefore, aptamer 14b is not present in the workflow. Such an example is during the capture of another tripolecular complex from, for example, aptamer 14a via the affinity-tagged probe 28. Capture beads 36 can pull down the affinity-tagged probe 28b. However, the absence of aptamer 14b to bridge the gap and bind to the second probe 24b means that there is no second probe 24b to be detected. If the detectable portion was present in the affinity-tagged probe 28b, the illustrated example would produce a false positive.

[0025] Figure 5 is a schematic diagram of a tripolecular complex, which may be of type 1 or type 2, depending on the type of the bound first probe 22 (e.g., affinity-tagged probe 28 or dummy probe 32), as generally discussed herein. The first probe 22 hybridizes to the first region 23 of the aptamer 14 via a first complementary region 60, e.g., a first aptamer-binding region. The second probe 24 hybridizes to the second region 25 of the aptamer 14 via a second complementary region 62, e.g., a second aptamer-binding region. The first complementary region 60 and the second complementary region 62 are specific to each individual aptamer 14. It should be understood that the relative positions of the first probe 22 and the second probe 24 on the aptamer 14 are interchangeable, such that the first probe 22 may be in the 5' or 3' position of the second probe 24. The first region 23 and the second region 25 are aptamers 14, which may be spaced apart by, for example, at least 1 to 2 nucleotides. In embodiments, the first region 23 and the second region 25 are spaced apart by 1 to 30 nucleotides. Providing spacing may offer benefits such as normalizing the melting temperatures between probe sets of different aptamers 14 or reducing nonspecific complementarity.

[0026] The first region 23 and the second region 25 may be contiguous or adjacent to each other, for example, separated by 0 nucleotides. The contiguous arrangement of the first probe 22 and the second probe 24 may facilitate a workflow in which the first probe 22 and the second probe 24 are ligated to each other following aptamer binding, for example, directly at their respective ends. In embodiments, the first probe 22 and / or the second probe 24 may include matched overhangs or be blunt-ended, depending on the desired ligation protocol. Ligation of the first probe 22 with the second probe 24 may offer the advantage of reducing melting temperature variations between different sets of probes used in the workflow and may also avoid the need for Tm-enhanced probes. Furthermore, ligation may facilitate higher stringency washing for greater background removal and / or reduced number of washes for a streamlined workflow. In embodiments, the ligation-based approach may also contribute to dynamic range compression. For example, the first probe 22 and / or the second probe 24 may be supplied as a mixture with a dummy probe. In embodiments, the second probe 24 may be provided as a mixture containing both a ligable version containing 5'-phosphate for ligation and a non-ligable version having the same sequence and aptamer-binding ability as the ligable version but lacking the available 5'-phosphate. The ratio of the non-ligable version to the ligable version may be adjusted based on the aptamer abundance. Higher aptamer abundances may be provided with probe mixtures having fewer ligable versions in the mixture compared to lower aptamer abundances. After ligation with the available binding version, the melting temperature and binding of the ligated product are higher. Therefore, higher stringency washing results in retention of the ligated product and loss of the non-phosphorylated but bound non-ligable version.In one embodiment, the ligated probe can be protected and separated from the unligated reporter probe 24 using a 5' affinity reagent such as biotin bound to streptavidin with beads, and the free probe can be digested using an exonuclease, as discussed in Figure 19, while the ligated probe is protected from exonuclease digestion.

[0027] The second probe also extends away from the second complementary region 62 and includes a non-hybridized region 64 that does not hybridize to the aptamer 14. Therefore, the sequence of the non-hybridized region 64 can be selected to avoid substantial complementarity with the sequence of the aptamer 14. The non-hybridized region 64 can be used for detection as a substitute for the aptamer 14. Thus, the non-hybridized region 64 can include a barcode or identification sequence 68 that is unique to each individual aptamer 14. Thus, different aptamers 14 are all different from each other and associated with their respective different identification sequences 68 that uniquely identify them. In embodiments, the uniquely identifying sequence is uniquely identified while taking into account barcode errors (e.g., 1-2 nucleotide sequence errors) during sequencing. Furthermore, the identification sequence 68 can be designed to be different from the aptamer sequence. In embodiments, the identification sequence may be 10-50 nucleotides long.

[0028] To facilitate detection, the non-hybridized region 64 may include a first primer region 70 and a second primer region 72 adjacent to the identification sequence 68, such that amplification of the non-hybridized region 64 using primers 74, 76 to produce an amplified product 80 as generally considered herein amplifies the identification sequence 68, enabling detection of the aptamer 14. In embodiments, amplification is part of the preparation of a sequencing library for sequencing.

[0029] Since the non-hybridized region 64 is single-stranded, the first primer region 70 can represent the primer binding site, which is the reverse complement of the first primer 74, while the second primer region 72 can correspond to the sequence of the second primer 76 that binds to the amplified strand generated from the first primer 74.

[0030] Figures 6 to 15 show different embodiments of amplification techniques, ligation techniques, and / or sequencing techniques, as well as corresponding arrangements of non-hybridized regions 64 that can be used to input the generated amplification product 80 for sequencing library preparation, or, in embodiments, to fit it into a sequencing library that can be sequenced to generate sequence data of the amplification product. Thus, the disclosed embodiments may, in embodiments, offer the advantage of incorporating one or more sequencing library preparation steps into the detection of the aptamer 14. Furthermore, the disclosed embodiments may allow certain steps of sequencing library preparation to be omitted or combined, thus increasing detection efficiency. In embodiments, the disclosed embodiments also relate to sequencing techniques that enable the generation of sequence data from sequence reads of the amplification product 80.

[0031] Figure 6 is a schematic diagram of different configurations of a non-hybridized region 64 containing a universal or conserved sequence that can be used in conjunction with Illumina® sequencing reactions. These are illustrative examples, and it should be understood that any of the disclosed configurations may be used in conjunction with the disclosed techniques. The non-hybridized region 64 may include minimal sequences of only primer regions 70, 72 adjacent to the identification sequence to introduce adapter sequences, such as sequences for primers 1 and 2 used in Illumina® sequencing preparations A14, B15, or examples of their complements, during amplification. In other embodiments, a universal capture primer sequence and / or sample index sequence can be incorporated into oligonucleotides generated from the reporter probe 24 via amplification and / or ligation and extension, etc. Specific configurations including an index may incorporate custom primers or bridge primers during sequencing to correspond to different indices. Other embodiments may include custom options, for example, for sequencing a library using a single read from surface P5, or for adding dark sequencing by a synthetic cycle in which a common sequence resides in the adapter region.

[0032] Adapter arrays A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below: A14-ME:5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'(Sequence ID 1) B15-ME:5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'(Sequence ID 2) ME':5'-phos-CTGTCTCTTATACACATCT-3'(Sequence ID 3) A14:5'-TCGTCGGCAGCGTC-3'(Sequence ID 4) B15:5'-GTCTCGTGGGCTCGG-3'(Sequence ID 5) ME:AGATGTGTATAAGAGACAG (Sequence ID 6)

[0033] The primer region or primer-binding region may include a region having the sequence of a Universal Illumina® capture primer or a region that specifically hybridizes with a Universal Illumina® capture primer. A Universal Illumina® capture primer includes, for example, P5 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 7) or P7 (5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 8)), or a fragment thereof. A region that specifically hybridizes with a Universal Illumina® capture primer may include, for example, the reverse complementary sequence of an Illumina® capture primer P5 ("anti-P5": 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 9) or P7 ("anti-P7": 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 10)), or a fragment thereof.

[0034] The preserved primer region may additionally or alternatively include a region having the sequence of an Illumina® sequencing primer or a fragment thereof, or a region that specifically hybridizes with an Illumina® sequencing primer or a fragment thereof. Examples of Illumina® sequencing primers include SBS3 (5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 11)) or SBS8 (5'-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3' (SEQ ID NO: 12)). Examples of regions that specifically hybridize with an Illumina® sequencing primer or a fragment thereof include Illumina® sequencing primer SBS3 ("Anti-SBS3": 5'-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3' (SEQ ID NO: 13)) or SBS8 ("Anti-SBS8": The sequence may include the reverse complement sequence of 5'-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3' (SEQ ID NO: 14), or a fragment thereof. Incorporation of the sequencing primer sequence into the reporter probe may be direct or via subsequent amplification, ligation, or other sequencing library preparation steps.

[0035] In embodiments, the disclosed amplification products 80 may include amplification products that are different from each other based on different identification sequences 68 but have conserved primer regions or universal primer regions 70, 72. In this means, a reporter probe 24 having a variable identification sequence 68 can be amplified using a single set of primers. Herein, a library preparation kit is provided that includes primers 74, 76 capable of generating amplification products 80 from the reporter probe 24 to produce a sequencing library. The sequences of the primers 74, 76 are based on sequencing of a first primer-binding region 70 and a second primer-binding region 72. However, it should be understood that these arrangements are illustrative and the primer regions 70, 72 for primer binding may be selected to be compatible with other library preparations.

[0036] In the embodiment, sequencing may be performed using Illumina® NGS primers. The following primers are shown as examples. Lead 1 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3' (Sequence ID 15) Lead 2 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG' (Sequence ID 16) Pairing terminal lead 1 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 17) Paired terminal lead 2 5'CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (Sequence ID 18) Index 1 Read 5'CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG(Sequence ID 19) Index 2 read 5'AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC(Sequence ID 20)

[0037] It should be understood that index read primers can be designed to contain a specific index sequence that associates with a particular sample in an aptamer-based assay. Therefore, an index primer may have a nucleotide region, indicated as i5 or i7, whose sequence changes between different samples in a multiplexed reaction. Other samples in the run can be prepared using primers containing their respective indices. Thus, a specific sequence read can be obtained using a universal primer, while other sequence reads can be obtained using primers or mixtures of primers that are specific to the index of one or more samples in the multiplexed reaction.

[0038] In the embodiment, a unique molecular identifier (UMI) may be incorporated into the reporter probe 24, for example, via ligation. The UMI is a short sequence used to uniquely tag each molecule in the sample library, providing error correction and reducing sequencing bias.

[0039] Figure 7 shows an exemplary configuration of the reporter probe 24 for direct amplification via primers 74, 76 (see Figure 5). In Option 1, the reporter probe 24 includes both a second complementary region 62 that binds to the aptamer and a non-hybridized region 64. The non-hybridized region 64 includes a first primer region 70 having ME and A14 sequences and a second primer region 72 having a complement of the B15 sequence, producing an amplification product that can be used with Illumina® sequencing primers. Thus, their inclusion allows standard Illumina® sequencing or NGS techniques to be performed. The first primer region 70 and the second primer region 72 are adjacent to the identification sequence 68. In Option 2, the second primer region 72 includes the ME' sequence. In Option 3, the ME and ME' sequences are excluded. Options 1, 2, and 3 provide different length options for the reporter probe 24, as well as different length options for the amplification product. In certain embodiments, smaller reporter probes 24 may be less expensive to manufacture and purify, as in option 3. However, the exclusion of ME and ME' sequences may involve non-standard sequencing techniques, as considered with respect to Figure 8.

[0040] An example of a sequencing technique based on the amplification product 80 of the reporter probe shown in Figure 7 is shown in Figure 8. The reporter probe 24 is directly amplified using appropriate primers 75, 76 so that the amplification product 80 contains a desired adapter sequence including P5, P7, i5, and i7 that conforms to the Illumina® NGS technique. Therefore, the prepared sequencing library, for example, the amplification product 80 in the illustrated example, is longer than the reporter probe 24. Furthermore, the amplification product 80 may have a second complementary region 62 removed or excluded. In certain embodiments, the amplification product 80 provided herein may be single or dual index. Each individual sample subjected to an aptamer-based assay may be uniquely associated with a specific index(s) not used for other samples in a multiplexing reaction. Sequencing reactions based on the amplification product 80 from Option 1 can use standard sequencing primers, and sequence data can be generated using Read 1 primer to produce sequence reads containing the identification sequence 68 and index information. In certain cases, additional index information can be obtained from complementary strand index reads using i5 or other index primers. Similarly, sequence data from the Option 2 amplification product 80 can generate a discriminant sequence read and a first index read. In Option 2, a second index read may also be generated. Index reads are generally shorter cycle reads. In the illustrated embodiments (e.g., Figures 8, 10, and 12), the i5 and R1 primers are A14-ME and A14'-ME', respectively. The i7 read primer is ME-B15.

[0041] The absence of an ME sequence, as in Option 3, may involve non-standard sequencing. In the illustrated example, index information and identification sequences can be obtained from a single sequence read using a p5 primer, for example. However, certain cycles are performed as dark cycles, e.g., chemistry only, where images are not captured and / or analyzed. Thus, certain sequencing embodiments may be used in conjunction with specific operating instructions for the sequencing device, as discussed with respect to Figure 37.

[0042] Figure 9 shows an example of step-out PCR in which multiple amplifications and primers can be used to add an adapter or other sequences. Option 1 shows a first round of amplification to add a 3' adapter, while the 5' adapter is completed via a second PCR round. Option 2 shows the reverse direction. Option 3 shows a two-step PCR on both the 5' and 3' adapter sequences. The reporter probe 24 contains specific sequences within primer regions 70, 72, which are contained together with the adapter sequences. Step-out PCR can be performed in an index PCR or another reaction. Figure 10 shows a sequencing workflow for sequencing a library prepared from the amplification product 80 from step-out PCR. Sequencing reactions based on the amplification product 80 from Option 1 and Option 2 can use standard sequencing primers, and sequence data can be generated using Read 1 primer to produce a sequence read containing the identification sequence 68. Additional index information can be obtained from complementary strand index readouts using i5 or other index primers. A second index read may also be performed to obtain second index information. In Option 3, the index can be obtained from the first and second index reads, and a custom primer is used to generate a sequence read containing the identification sequence 68. The custom primer sequence readout may include dark cycles to skip non-standard regions of the amplification product 80.

[0043] Figure 11 shows an example of ligation to PCR, where a double-stranded terminal adapter is ligated to a complementary template at the 3' end of probe 24. In the disclosed example, the length of the reporter probe 24 may be adjusted based on the desired downstream detection modality and reporter synthesis efficiency. For example, shorter reporter probes 24 may generally be less expensive and purer. However, shorter reporter probes 24 may also contain fewer endogenous adapters for sequencing that requires a non-standard sequencing approach (e.g., single readout using dark cycles). Option 1 shows a relatively short reporter probe 24 that includes a first primer region 70 but does not include a second primer region 72. Instead, the reporter probe 24 has a short 3-nucleotide tail 84 that can ligate a partially double-stranded adapter 86. Option 2 shows a similar configuration but has a longer first primer region 70. The resulting amplification product can then incorporate additional sequences (e.g., indices p5, p7) via direct amplification or step-out amplification techniques, as discussed in Figures 7 and 9. However, as shown in Figure 12, sequencing from the relatively short amplification product 80 of Option 1 may involve custom sequencing primers or standard primers (i5, i7), but requires the incorporation of three dark cycles to accommodate the tail 84. Option 2 presents an alternative configuration in which standard sequencing primers can be used to generate sequence data using read 1 primers to produce sequence reads containing the identification sequence 68. Additional index information can be obtained from either or both of the i5 or i7 primers, or from other combinations of index primers.

[0044] Adapters for sequencing or other assays may be added in subsequent ligation and / or PCR steps. Relatively long reporters may contain endogenous adapters, but may be more expensive, have lower purity, and / or be too long, resulting in lower synthesis feasibility due to lower yield. Therefore, in certain embodiments, adapter incorporation via a direct or indirect ligation step may be used to modify a relatively short reporter probe 24 that is involved in aptamer binding but does not contain adapter sequences (e.g., index sequences, primer-binding sequences, functional sequences). The disclosed adapter ligation techniques may be used in conjunction with the dynamic range compression workflows provided herein, for example, using dummy probes or reporters. Furthermore, in certain embodiments, the disclosed adapter ligation techniques, such as those considered herein, may be PCR-free workflows that avoid thermocycling. In embodiments, PCR-free workflows offer the advantages of reduced potential amplicon contamination and the elimination of the need for separate areas before and after PCR work.

[0045] Figure 13 shows an exemplary PCR-free workflow using a sprint ligation technique that adds one or more adapters via ligation and extension. The captured reporter probe 24 has a free 3' end, but its 5' end contains a binding region 62. In other examples, this region 62 is not retained in the amplified product using primers that do not cover region 62. However, in the illustrated example, the reporter probe 24 has an endogenous cleavage site 90, e.g., a uracil cleavage site. Here, the reporter probe 24 is captured as part of a tripolecular complex. The tripolecular complex may be generated as commonly considered herein, and the uncaptured reporter probe 24 may associate with different types of tripolecular complexes that were not captured based on the absence of an affinity tag to facilitate binding with the capture beads 36.

[0046] Upon capture, uncaptured components are removed, and the non-hybridized region 64 is cleaved, exposing the 5' end. The cleavage can be mediated by cleavage of the U base by uracil-DNA glycosylase. After cleavage, 5' adapter 94 ligation can be facilitated by a 5' sprint 97 that forms a partially double-stranded ligation region upon hybridization, and 3' adapter 96 ligation can be facilitated by a 3' sprint 98 that forms a partially double-stranded ligation region at the 3' end. The dotted arrows shown represent polymerase elongation from B15' that copies the index using template i7 for adding the index complement to the reporter via elongation. Elongation may include elongation that completely copies p7' without the entire ligation by elongating from the B15' end, or it may include p7' to enable elongation-ligation. The polymerase may be non-stranded substitution and lack 5-3' exonuclease activity. In the embodiment, an Illumina extension ligation mix is ​​used. After ligation and denaturation of sprints 97, 98, the remaining oligonucleotides can be amplified for detection as commonly considered herein.

[0047] Figure 14 shows an exemplary ligation-extension workflow for adding one or more adapters via ligation and extension. The workflow includes the formation of a tripolecular complex as generally considered herein, which involves binding of both a capture probe 28 via a first complementary region 60 and a reporter probe 24 via a second complementary region 62 to corresponding regions of the aptamer 14. The reporter probe 24 includes a non-hybridized region 64 that does not hybridize to the aptamer 14 and has an identification sequence 68 that uniquely identifies the aptamer 14. The workflow also includes the step of separating the tripolecular complex from the dummy-containing tripolecular complex (see Figure 1) and / or the free aptamer 14 or the free reporter probe 24 using a capture entity such as an affinity tag binder that binds to an affinity tag 30 present on the capture probe 28.

[0048] Once captured, the reporter probe 24 and aptamer 14 can be eluted from the captured entity and the capture probe 28. In this workflow, the reporter probe 24 has a first region 100 corresponding to a portion of the 5' adapter sequence and a second region 102 corresponding to a portion of the 3' adapter sequence. The complete 5' and 3' adapter sequences, if present, may represent terminal adapter sequences, respectively, enabling the oligonucleotide to be used as part of a sequencing library for NGS sequencing, which in embodiments can be used to sequence the identification sequence 68 as part of aptamer detection. In the illustrated workflow, rather than having the complete 5' and 3' adapter sequences, the reporter probe has only a portion of these sequences and is relatively short. For example, the total length of the reporter probe may be about 70 nucleotides in one example. In embodiments, the reporter probe 24 may be 50–80 nucleotides. The complete 5' and 3' sequences are incorporated into the terminals via extension ligation as shown.

[0049] As shown in the figure, oligonucleotide 110 having a first region complement 111 and oligonucleotide 120 having a second region complement 122 hybridize to the reporter probe 24. Oligonucleotide 110 includes an adapter region 124 that does not hybridize to the reporter probe 24, for example, an adapter region 124 that is not complementary to the complementary region 62. Oligonucleotide 112 includes an adapter region 130 and an affinity tag 30 that do not hybridize to the reporter probe 24. This hybridization may occur after elution of the aptamer from the aptamer beads. Oligonucleotide 112 may be extended in the 3' direction using the identification sequence 68 as a template and ligated to oligonucleotide 110. In addition, the reporter probe 24 may be extended in the 3' direction using the adapter region 130 as a template. Therefore, the extended reporter probe 24 and the extended ligate oligonucleotides 110 and 112 form a partial double-stranded structure that does not hybridize to the complementary region 62. In this way, the complementary region 62 can be removed from the downstream product without a cleavage step, in contrast to the workflow in Figure 10.

[0050] The retained elongated ligate oligonucleotide 132 can undergo further elongation after a washing step (e.g., heat washing, NaOH, or other denaturing agent), using the hybridized oligonucleotide 136 as a template. Oligonucleotide 136 hybridizes to an adapter region 124 via a complementary region 140. Oligonucleotide 136 also includes a 5' adapter region 142. In embodiments, the elongated hybridized oligonucleotide 136 can be ligated to a hybridized p7' oligo (not shown) that can be elongated and hybridized to the retained elongated ligate oligonucleotide 132. The workflow may include a 3' elongation of the retained elongated ligate oligonucleotide 132 using the 5' adapter region 142 as a template, and a 3' elongation of the hybridized oligonucleotide 136 using the elongated ligate oligonucleotide 132 as a template.

[0051] Oligonucleotides 110 and 112 used for extension or extension ligation can be universal oligonucleotides that hybridize to any captured (e.g., aptamer-bound) reporter probe 24 via the universal region provided in the reporter probe 24. Oligonucleotide 136 hybridizes to the universal adapter region 124. Therefore, the extension ligation oligonucleotide reagent can be used across the entire panel for aptamer detection.

[0052] An optional second capture step can separate the elongated oligonucleotide 136 from the elongated oligonucleotide 132. Both oligonucleotides 132 and 136 contain complete 5' and 3' adapters or their complements for NGS sequencing. The start reporter probe 24 is shorter (e.g., about 70 nucleotides in one example), but the product generated by the elongation ligation workflow is longer. In embodiments, oligonucleotides 132 and 136 may be at least 25%, at least 50%, or at least 100% longer than the start reporter probe 24. The exemplary workflow may, in embodiments, be carried out with or without a subsequent amplification step.

[0053] Figure 15 shows another example of the cleavage-free extension ligation technique. As shown in Figure 14, the workflow involves the formation of a tripolecular complex having binding to the corresponding regions of the aptamer 14, both of which are captured via a first complementary region 60 and a reporter probe 24 via a second complementary region 62. The reporter probe 24 includes a non-hybridized region 64 that does not hybridize to the aptamer 14 and has an identification sequence 68 that uniquely identifies the aptamer 14. The workflow also includes the step of separating the tripolecular complex from the dummy-containing tripolecular complex (see Figure 1) and / or the free aptamer 14 or the free reporter probe 24 using a capture entity such as an affinity tag binder that binds to an affinity tag 30 present on the capture probe 28.

[0054] Once captured, the reporter probe 24 and aptamer 14 can be eluted from the capture entity and the capture probe 28. Multiple oligonucleotide hybridizations form a complex that enables extension ligation of the complete adapter sequence. The reporter probe 24 includes a first region 100 corresponding to a portion of the 5' adapter sequence and a second region 102 corresponding to a portion of the 3' adapter sequence. As shown, oligonucleotide 150 having a first region complement 112 and oligonucleotide 152 having a second region complement 153 both hybridize to the reporter probe 24. In addition, oligonucleotide 150 includes an adapter region 155 that does not hybridize to the reporter probe 24, for example, is not complementary to the complementary region 62, and has an internal affinity tag 30. Oligonucleotide 152 includes an adapter region 156 that does not hybridize to the reporter probe 24 and functions as an extension template. Oligonucleotide 158 hybridizes to adapter region 155, and oligonucleotide 160 hybridizes to oligonucleotide 150 via region 162. Oligonucleotide 158 acts as a split for the ligation of oligonucleotide 150 and oligonucleotide 160. In the complex, oligonucleotides 152, 150, and 160 can be ligated via extension to form oligonucleotide 166.

[0055] Oligonucleotide 166 can be captured via affinity tag 30 and used as a template for the extension of hybridized oligonucleotide 158. For example, multiple extension using T4 polynucleotide kinase allows for the addition of complete 5' and 3' adapters. As considered with respect to Figure 11, extension ligation allows the use of a shorter reporter probe 24 to produce a product that is longer than the starting reporter probe 24, e.g., at least 25%, at least 50%, or at least 100% longer. In addition, the oligonucleotide used for extension can be a universal oligonucleotide that hybridizes to any captured (e.g., aptamer-bound) reporter probe 24 via the universal region present in the reporter probe 24 and can be used across panels for aptamer detection at different aptamers and their associated different identification sequences 68. The illustrated workflow can be carried out with or without subsequent amplification steps and with or without additional capture steps in embodiments. In embodiments, extension can be carried out from A14 without initial phosphate blocking.

[0056] Figure 16 shows an example workflow using a split reporter probe that forms a tripolecular complex with aptamer 14. In contrast to a workflow where the entire identification sequence 68 is provided to a single probe 24, the illustrated example includes a first reporter probe 170 and a second reporter probe 172, where the identification sequence 68 is split between these probes. Using shorter reporter probes is more economical, and subsequent ligation produces a longer product, which has library cleanup benefits. Having a split identification sequence distributed between two probes allows for evaluation of successful hybridization of both probes. This is an advantage because, in other techniques, the second probe is not part of the readout, and mishybridizations are not apparent in the resulting readout.

[0057] The first reporter probe 170 has a first identification sequence 176, and the second reporter probe 172 has a second identification sequence 178. Similarly, the aptamer binding region is also divided between the probes. The first reporter probe 170 has a first aptamer binding region 182 and a first primer region 183 located between the first aptamer binding region 182 and the first identification sequence 176. The second reporter probe 172 has a second aptamer binding region 184 and a second primer region 185 located between the second aptamer binding region 185 and the second identification sequence 178. The primer region is shown as a cleaved or partial adapter sequence (A14' and B15). It should be understood that additional adapter sequences may also be included in the split probe or introduced by amplification and / or ligation as generally considered herein.

[0058] The binding of the first reporter probe 170 and the second reporter probe 172 to the aptamer 14 results in a tripolecular complex in which one of the first or second reporter probes 170 may have an affinity tag 30, as shown, for example, in the first reporter probe 170. Identification sequences and primer sites are located in the non-hybridized portions of the reporter probes 170 and 172. Dynamic range compression can be achieved for split probes by using a mixture containing a dummy probe (e.g., a dummy first probe 170 or a dummy second probe 172) that does not have an affinity tag 30 for a particular aptamer 14. As discussed herein, the selected ratio of dummy affinity tag-bearing probes can be adjusted based on the aptamer abundance.

[0059] The identification sequence 68 can be assembled, for example, by ligating the ends of the first reporter probe 170 and the second reporter probe 172 using single-strand ligation, e.g., CircLigase. The 5' phosphate and adjacent 3' OH of probes 170 and 172 are ligated together so that the first identification sequence 176 and the second identification sequence 178 are contiguous. The ligated strands can be separated using affinity tags 30. Any dummy reporter probe 170 and the unligated second reporter probe 172 are not retained. The unligated reporter probe 170 is also captured, but the amplification step using the first primer site 183 and the second primer site 185 ensures that only ligated pairs produce amplified products. To eliminate false positives from nonspecific or undesirable binding, the technique may require matched pairs for identification sequences 176 and 178. In other words, both identification sequences 176 and 178 can identify aptamer 14, and the technique may require positive sequence matching when both identification sequences 176 and 178 are evaluated using sequencing data obtained from a sequencing device before verifying the detection of aptamer 14.

[0060] Figure 17 shows an embodiment of the technique of Figure 16, in which a single-stranded sprint oligonucleotide 190 is provided to improve the ligation efficiency of reporter probes 170, 172. The sprint oligonucleotide 190 hybridizes to at least a portion of the first identification sequence 176 and the second identification sequence 178 to create a double-stranded region. If the reporter probes 170, 172 also bind to the aptamer 14, they are also partially double-stranded along the aptamer binding regions 182, 184.

[0061] Figure 18 shows embodiments of the techniques of Figure 16 and / or Figure 17. In particular, the use of sprint oligonucleotide 190 can facilitate the ligation of reporter probes 170, 172 even without aptamer binding. Exonuclease digestion of free reporter probes 170, 172 can improve the background generated from the ligation of reporter probes 170, 172 in the absence of aptamer binding. Exonucleases RecJF and Exo I are shown as examples. Providing a mixture of 5'-to-3' and 3'-to-5' exonucleases can facilitate digestion sufficient to eliminate or significantly reduce amplification products generated from aptamer-free ligation. Figure 19 shows a workflow in which aptamer-bound reporter probes 170, 172 can be completely cyclized and protected from exonuclease digestion shown in Figure 15. In particular, exonuclease digestion targets reporter probes 170 and 172, which are not bound to aptamer 14 but ligate with each other, for example, in the presence of sprint oligonucleotide 190.

[0062] In certain embodiments, the reporter probe and the resulting ligation product, extension product, or amplification product, as discussed herein, for example in Figures 16-19, may be used without a capture step.

[0063] Figure 20 shows an example of the dummy reporter probe technique. In Figure 20, the tripolecular complex 200 is captured using a capture probe 28 via interaction between a bead 36 and an affinity tag 30. The tripolecular structure includes an associated reporter probe 24 containing an aptamer-binding region 62 and an active or amplified non-hybridized region 64 in which a recognition sequence 68 is adjacent to primer regions 70, 72. Here, instead of (or in addition to) using the capture probe 28 mixed with the dummy probe 32, the reporter probe 24 may also contain a mixture of an active probe 202 and a dummy probe 210. Thus, other tripolecular structures can be formed that associate with inactive dummy reporters 210. These inactive dummy reporters 210 contain an aptamer-binding region 62 to facilitate binding to the aptamer 14. However, the non-amplified non-hybridized region 64 of these inactive dummy reporters 210 is not amplified. Examples of the configuration of the inactive dummy reporter 210 may include the absence of one or both of the primer regions 70 and 72, or the absence of the identification sequence 68. In another example, the non-amplifying non-hybridized region 64 may include an extension blocker such as a debase extension blocker, a spacer, or uracil. In another variation, a non-phosphorylated probe may be added to adjust the dynamic range by providing a mixture containing both a version with 5' phosphate and a version with the same sequence and aptamer binding ability but without the available 5' phosphate. The ratio of the versions may be adjusted based on the aptamer abundance.

[0064] The mixing ratio or relative ratio of the active reporter 202 to the inactive dummy reporter 210 may be as generally considered with respect to the capture probe mixture.

[0065] Figure 21 shows a reporter probe (e.g., probe 24) having a mixture of endogenous restriction endonuclease (RE) sites located together with a non-hybridized region 64. For example, in low-abundance aptamers 14, group 222 of probe 24 may all be the same, and may not have an RE site within the non-hybridized region 64, but instead have a "null" region of nucleotides that does not correspond to an RE site. In medium-abundance aptamers 14, group 224 of probe 24 may have a mixture of 50% probes having an RE site within the non-hybridized region 64 and 50% probes that do not have an RE site, but instead have a null region of nucleotides that does not correspond to an RE site. In high-abundance aptamers 14, group 226 of probes 24 may consist of a mixture of 75% probes having an RE site within the non-hybridized region 64 and 25% probes lacking an RE site, instead having a null region of nucleotides that does not correspond to an RE site. It should be understood that these percentages are illustrative.

[0066] The presence of the RE site facilitates cleavage using the appropriate RE. The RE site can be conserved across all aptamers 14 such that only a single RE treatment is required to cleave the non-hybridized region 64. The cleavage site can be specific to ss DNA cleavage. In such embodiments, cleavage may occur after capture by the capture probe 28 and before amplification. In other embodiments, cleavage may occur after amplification using double-stranded RE. In such cases, the RE site is retained during amplification. Thus, the cleaved probe 24 is not available for downstream sequencing and, therefore, dynamic range compression is achieved by not being sequenced after amplification. In embodiments, the null region may differ from the RE site by only a single nucleotide substitution to minimize amplification bias between a dummy (with RE site) probe and an active (null site, no RE site) probe.

[0067] Figure 22 shows alternative examples that may be used in conjunction with single-probe workflows and / or dual-probe workflows to eliminate the capture and / or washing steps. That is, rather than a triplophone complex in which both the capture probe 28 and the reporter probe 24 are used, the illustrated embodiment may be carried out using only the reporter probe 24, as generally considered. The free reporter probe 24 may be removed or digested with an exonuclease. The bound reporter probe, which is part of the double-stranded complex with the aptamer 14, is protected. However, in certain embodiments, the disclosed exonuclease digestion may be carried out in conjunction with other disclosed embodiments, such as using a dual-probe workflow using a dummy capture probe 32 and / or a dummy reporter probe 24, as generally considered herein. The illustrated embodiment shows exonuclease digestion of the 3' to 5' of the free reporter, and the 3' end of the reporter probe 24 is involved in aptamer binding and is therefore protected from exonuclease digestion of the 3' to 5'. The disclosed embodiments may be used additionally or alternatively in conjunction with an exonuclease having 5' to 3' exonuclease activity. In such embodiments, the reporter probe 24 may be designed so that its 5' end hybridizes to the aptamer 14 in order to protect the 5' end from digestion compared to a non-hybridized reporter probe 24. In certain embodiments, exonuclease digestion may enable a workflow with reduced washes and / or improved sensitivity.

[0068] Figure 23 illustrates a bead-based capture embodiment that uses group-specific capture sequences and corresponding different sets of capture beads to compress the dynamic range of the input library 250 in the captured reporter probe 24, or in the amplified or ligated extension oligonucleotide product generated from the captured reporter probe 24. In one embodiment, the input library 250 represents a population of oligonucleotides 252 having certain universal or common sequences shared among the input libraries 250 (e.g., adapter sequences 254, 256), certain identification sequences 68 that are unique to only some members of the input library 250 that bind to a particular aptamer 14, and group-specific capture sequences that are also different among different groups (e.g., group capture sequences 260, 262, 264). The different groups are shown as a high-abundance group 270, a medium-abundance group 272, and a low-abundance group 274, but more or fewer groups are also intended. Using the estimated abundance of aptamer 14 in a specific aptamer-based assay, aptamer 14 can be divided into groups based on its relative abundance. Once divided, reporter probes 24 designed to bind to aptamer 14 within each group (e.g., groups 270, 272, 274) can each include a common group capture sequence related to the abundance of the group. Any product generated using the reporter probe 24 will contain the appropriate group capture sequence. Furthermore, in certain embodiments, if oligonucleotide 252 is a product generated using the reporter probe 24, oligonucleotide 252 may exclude aptamer-binding regions (e.g., a second complementary region 62, see Figure 5) that may be present in the reporter probe 24 but are not amplified or included in the input library 250.

[0069] All oligonucleotides 252 of the relatively high-abundance group 270 may contain the same group capture sequence 260 that associates with the high-abundance group 270. If oligonucleotide 252 is double-stranded, it should be understood that all oligonucleotides 252 of the relatively high-abundance group 270 may contain either the same group capture sequence 260 or the reverse complement of the group capture sequence 260. Similarly, if oligonucleotide 252 is double-stranded, all oligonucleotides 252 of all three groups may contain either the universal adapter sequences 256, 258, or their reverse complements. As shown, a mixture of different identification sequences 68 may exist within each group, such that group 270 contains different identification sequences 68a, 68b, 68c corresponding to different aptamers 14a, 14b, 14c designated as high-abundance. Similarly, group 272 contains different identification sequences 68d, 68e, 68f corresponding to different aptamers 14d, 14e, 14f designated as medium-abundance. The low-abundance group 274 may also include a mixture of different identification sequences 68. In this embodiment, a particular identification sequence 68 is assigned to only one group such that the identification sequence 68a exists only within the high-abundance group 270 and associates only with the group-capturing sequence 260.

[0070] An aptamer-based assay is performed to generate an input library 250 from a reporter probe 24 bound to an aptamer 14 having a positive binding event for the components of the sample, as generally considered herein. The input library 250 is then brought into contact with different beads 280 from a bead pool 290. The bead pool 290 can contain different bead groups 300, 302, and 304, each having different complementary regions 310, 312, and 314 complementary to bead capture sequences 260, 262, and 264, respectively. Thus, oligonucleotides 252 of the high-abundance group 270 containing the bead capture sequence 260 are captured by hybridization with a single-stranded complementary region 310 that is present only in the first bead group 300. Oligonucleotides 252 of the medium-abundance group 272, which include bead-capture sequence 262, are captured by the complement region 312, which is present only in the second bead group 302, and oligonucleotides 252 of the low-abundance group 274, which include bead-capture sequence 264, are captured by the complement region 314, which is present only in the second bead group 304. As mentioned, if the oligonucleotide is double-stranded, only one strand may contain the relevant bead-capture sequence. Thus, capture may occur after denaturing the oligonucleotide 252 to enable binding to the single-stranded complement region. Once bound, the beads 280 containing the captured oligonucleotide 252 can be detected as discussed herein. In embodiments, the beads 280 can be designed to capture roughly the same amount of oligonucleotide per bead 280, so that each bead group captures approximately the same amount. However, in certain embodiments, the capture rate per bead 280 or the number of beads per group in a particular bead group can be adjusted to further control the concentration of captured oligonucleotide 252 associated with a particular aptamer 14.

[0071] Different group capture sequences can be incorporated into each reporter probe 24 to enable bead-based capture via hybridization with complementary regions immobilized on beads 280. In contrast, if a single common bead capture sequence is used for the entire input library 250, high-abundance groups 270 tend to be captured in a larger proportion of available beads 280 based on the relatively larger proportion of oligonucleotides 252 of high-abundance group 270 in the library 250. By using separate sets of beads 280, dynamic range compression between low and high abundances can be achieved. Three separate abundance groups with corresponding bead groups are exemplified, but it should be understood that more or fewer groups are intended. In addition, the number of different aptamers 14 and associated identification sequences 68 assigned to each individual group capture sequence can be selected to be 1, 2, 3, 10, 100, 500, or more. In embodiments, the number of identification sequences 68 assigned to each group may differ. For example, the high-abundance group 270 may contain fewer distinct identification sequences compared to the medium-abundance group 272 or the low-abundance group 274. In addition, the illustrated embodiments may be used alone or in combination with other dynamic range compression techniques (e.g., dummy probes) as considered herein, which may be used to adjust the relative abundance of oligonucleotides 252 in the input library 250. Furthermore, the workflow is considered in the context of beads, and the capture technique may be used using a surface such as a flow cell or other substrate.

[0072] Figures 24–27 illustrate an example of dynamic range compression utilizing differential re-annealing for high-abundance aptamers compared to low-abundance aptamers when they are part of a double-stranded fragment. In the illustrated embodiments, the aptamer or reporter probe is provided as part of a double-stranded oligonucleotide 328 or a double-stranded fragment 329 having the sequence of interest. The double-stranded oligonucleotide 328 may include oligonucleotide 330 having a high-abundance sequence (e.g., the sequence of interest 329) and oligonucleotide 332 having a low-abundance sequence. That is, the double-stranded oligonucleotide 328 may represent a pool of double-stranded oligonucleotides 328 having different sequences of interest 329 that can reflect aptamer capture by analytes present in the sample. A particular high-abundance of the sequence of interest 329 is present at a higher count than a lower-abundance of the sequence of interest 329. In embodiments, the high-abundance of the sequence of interest 329 is present at a ratio of at least 10:1 to the lower-abundance of the sequence of interest 329.

[0073] Depending on the technique used to generate the double-stranded oligonucleotide 328 from the aptamer 14, the relative abundance may directly or indirectly reflect the abundance of the analyte in the sample being tested, as described herein. For example, the double-stranded oligonucleotide 328 may be generated by primer extension from a primer complementary to a portion of the aptamer 14. The double-stranded oligonucleotide 328 may also be generated, either additionally or alternatively, by primer extension from a primer complementary to a portion of the reporter probe 24, which is then bound to the aptamer 14. Thus, in embodiments, the sequence of interest 329 may include at least a portion of the sequence of the aptamer 14 or at least a portion of the identification sequence 64, enabling analyte detection. In embodiments, the double-stranded oligonucleotide 328 is generated as part of a library preparation workflow (see Figure 30).

[0074] In one embodiment, the double-stranded oligonucleotide 328 may include universal adapters 334, 336 adjacent to the target sequence 329 and its complement. Therefore, for a pool of double-stranded oligonucleotides 328 having different target sequences 329, all adapters 334, 336 may have the same sequence. In this way, amplification can be performed using universal primers, and the primers 338 may be a set of primers having the same sequence (e.g., the same forward sequence and the same reverse sequence) to amplify a pool of double-stranded oligonucleotides 328 having different target sequences 329. In another embodiment, custom primers are provided for each target sequence 329.

[0075] To compress the dynamic range, the double-stranded oligonucleotide 328 is amplified using primer 338. Rather than providing an excess of primer 338, the primer concentration is diluted or throttled to a lower level than under conventional amplification reaction conditions. Thus, the concentration of primer 338 is insufficient to prevent amplicon re-annealing in subsequent cycles, and high-abundance sequences are more likely to overpower primer 338 than low-abundance sequences during annealing, and therefore less likely to be amplified. Primer 338 may be replenished at low concentrations for continuous cycling. In embodiments, the amplification reaction may be split at different primer concentrations to avoid exponential accumulation of bias. Furthermore, the number of cycles may be adjusted to maintain dynamic range compression.

[0076] The workflow includes a denaturation step carried out at a temperature high enough to separate the strands of double-stranded oligonucleotide 328 (e.g., 94–98°C for 1–3 minutes). Since primer concentrations are limited, high-abundance oligonucleotides 330 are more readily re-annealed, while low primer concentrations may be sufficient for amplification of low-abundance oligonucleotides 332. As illustrated, many separated strands 330a and 330b re-anneal when the temperature decreases from the denaturation temperature to the annealing temperature (e.g., when the temperature decreases from the denaturation temperature to a temperature about 5°C lower than the primer's melting temperature (Tm), or to 45–60°C), promoting primer binding to the template. Extension from the annealed primer can be carried out at a temperature suitable for the polymerase, e.g., 65–75°C. The annealing temperature is selected to allow primer annealing, although the energy of re-annealing the separated strands may be more preferable. Therefore, when primer availability is limited, high-abundance strands 330a and 330b tend to re-anneal. However, lower abundance chains 332a and 332b may be occupied by primer binding and therefore unavailable for re-annealing. In embodiments, at least 50%, at least 60%, at least 80%, or at least 90% of the high abundance chains 330a and 330b are re-annealed. In embodiments, at least 50%, at least 60%, at least 80%, or at least 90% of the low abundance chains 332a and 332b bind to primer 338.

[0077] After one or more amplification cycles, the product contains re-annealed oligonucleotide 340 and amplicon 341. The re-annealed oligonucleotide 340 of high-abundance oligonucleotide 330 represents a barrier to exponential growth. That is, these re-annealed oligonucleotides 340 are not available for primer binding and amplification, and therefore function to maintain oligonucleotide 330 with high-abundance sequences at a lower amplification rate over successive amplification cycles. Some growth occurs, and some amplicon 341 is generated from the high-abundance oligonucleotide 330, but the growth rate is lower than the standard exponential growth curve for PCR. In contrast, the lower-abundance oligonucleotide 332 has a higher amplification rate and either does not undergo re-annealing or undergoes less re-annealing. Therefore, the product slopes more toward amplicon 341, and the growth rate more closely approximates the standard exponential growth curve for PCR. Over time, depending on the primer concentration and the number of cycles, the exponential growth rate of low-abundance oligonucleotide 332 compared to the slower growth rate of high-abundance oligonucleotide 330 causes a compression of the dynamic range between these two groups. The detection or characterization of products 340, 341 is carried out as generally discussed herein and may be correlated with the relevant analytes.

[0078] In the embodiments, the primer concentration is less than 1 μM or less than 0.1 μM, and the template oligonucleotide is present in an amount of at least 0.1 ng as a group. However, it should be understood that other ratios are intended to achieve a restrictive or non-excessive primer concentration for higher abundances of oligonucleotide 330 while maintaining a primer concentration sufficient to amplify lower abundances of oligonucleotide 332. In the embodiments, the primer concentration is selected to be above the reference or experimental mean concentration for lower abundances of oligonucleotide 332, while being below the reference or experimental mean concentration for higher abundances of oligonucleotide 330. In the embodiments, the primer concentration is selected so that the primer exceeds the lower abundance of oligonucleotide 332 in a reference sample having a predetermined composition and whose amplification has been demonstrated.

[0079] Figure 25 shows a dynamic range compression workflow incorporating a double-stranded nuclease. In the illustrated workflow, differential re-annealing of high-abundance oligonucleotides is utilized to provide a target for double-stranded nuclease removal of the re-annealed strands. After the denaturation step and return to the annealing temperature, for example, in the presence of primer 338, the reaction equilibrium is favorable to the double-stranded fragments for high-abundance oligonucleotide 330, where strands 330a and 330b are re-annealed, leaving only some single-stranded 330a and 330b. In contrast, for lower-abundance oligonucleotide 332, the reaction equilibrium is favorable to the separated strands 332 and 332b. The separated strands 330a, 330b, 332a, and 332b are protected from double-stranded nuclease digestion and are therefore available for primer extension at the extension temperature to generate amplicon 343 in the presence of polymerase. Because high-abundance oligonucleotide 330 is more likely to form double-stranded fragments for digestion, it experiences nuclease-mediated removal at a higher rate. Therefore, the protection of lower-abundance oligonucleotide 332 from digestion compared to the higher digestion rate of high-abundance oligonucleotide 330 causes a compression of the dynamic range between these two groups. Detection or characterization of product 343 is carried out as generally discussed herein and may be correlated with the relevant analytes.

[0080] In this embodiment, the nuclease is a thermally stable double-chain nuclease.

[0081] Figure 26 shows an alternative workflow in which a sample containing double-stranded oligonucleotide 328 is split into two or more parts. In one part shown at the top of the workflow, dynamic range compression is performed, while the other part shown at the bottom of the workflow is processed without dynamic range compression. Detection can also be split between parts. Since product 344 from dynamic range compression can be compressed or concentrated for lower abundances of oligonucleotide 332, detection using product 344 can cover the target sequence 329 associated with lower abundances of oligonucleotide 332. These sequences 329 may be known or previously characterized in embodiments. Product 346 in the lower workflow is not compressed. Therefore, detection of the target sequence 329 may be applied to or limited to those associated with high abundance oligonucleotide 330. Detection or characterization of products 344, 346 may be performed as generally discussed herein and correlated with the relevant analytes.

[0082] Dynamic range compression in the upper region can be performed as discussed with respect to Figures 24-25. For example, as illustrated, after amplification in the first step, a double-stranded nuclease digests the dsDNA at a high annealing temperature. Sequences with high abundance have a favorable equilibrium with the dsDNA and are therefore digested more than sequences with low abundance. Further amplification or low-temperature annealing is then performed to produce the compression product 344.

[0083] Figures 27–29 illustrate a bead-based dynamic range compression technique, where capture beads 400, e.g., magnetic beads, are bound to the capture molecule 402 with different capture intensities, each varying based on the capture domain length. In this way, single-stranded aptamers 14 and / or reporter probes 24 can be captured for characterization as part of a detection workflow. Capture molecules with longer capture domains (e.g., those containing more nucleotides) have greater binding intensities to their target molecules. Figure 27 shows the capture beads 400 and different aptamers 14, along with the designation of the complementary region 404 of the aptamer 14 used for capture by the capture domain of the capture molecule 402. The complementary region 404 is complementary to the terminal region of the capture molecule 402.

[0084] Different lengths of the complementary region 404 result in different hybridization or annealing intensities. For example, longer complementary regions 404a generally bind more strongly than shorter complementary regions 404b, although this is also a function of the specific sequence. Binding by shorter complementary regions 404b is less likely, while binding by longer complementary regions 404a is stronger. The choice of reaction temperature results in a compression of the dynamic range between different aptamers 14. Thus, dynamic range compression can be achieved by varying the length of the complementary region 404 and the corresponding complementary portion of the capture molecule 402 (and therefore, the double-strand stability). Complementary regions 404 with lengths ranging from 6 to 16 nucleotides (nt) correspond to predicted double-strand free energy values ​​of approximately -10 to -30 kcal / mol, respectively. Figure 28 shows the temperature-dependent shift in bonding for different complementary regions 404, where the longer complementary region 404a is more stable at higher temperatures compared to the shorter complementary region 404.

[0085] Figure 29 shows multiplexed capture beads 400 carrying different capture molecules 402, each having different binding specificities to different aptamers 14a and 14b and their different complementary regions 404a and 404b. However, it should be understood that the reaction can be implemented using a pool of beads 400 specific to each of the different aptamers 14.

[0086] The use of the capture beads 400 enables the separation of target detection molecules, such as aptamers 14 or reporter probes 24, and downstream processing in the detection workflow.

[0087] Figure 30 shows an exemplary streamlined workflow using direct index amplification according to an embodiment. In the exemplary workflow, a separate ligation preparation workflow step can be eliminated by using an amplification reaction, e.g., step-out amplification or direct amplification. On the left side of the workflow, the captured reporter probe 24 can undergo the amplification reaction and then be fed into sequence library preparation, where a branched adapter is ligated to the end of the amplified reporter probe. However, amplification for incorporating the sequencing adapter sequence can be used to produce the same final product but without the intervening ligation step. Thus, a direct amplification workflow without a ligation step or without adapter ligation can save library preparation time. Figure 31 is a plot comparing the sequencing read count from the streamlined workflow of Figure 30 with that of the ligation preparation workflow, showing similar sequence read counts and similar efficiency in library preparation.

[0088] Figure 32 shows an exemplary workflow with a washing step according to an embodiment. In the first step of the workflow, the aptamer 14 is brought into contact with the capture probe 28 and the reporter probe 24. The reaction may include a mixture of dummy and non-dummy probes of the capture probe 28 as disclosed herein. For example, a hybridization reaction that allows hybridization of the aptamer with the reporter probe may be, for example, an overnight hybridization. However, other time ranges are also intended (e.g., 30 minutes, 1 hour, 2 hours, 5 hours). If the aptamer 14, which is part of an aptamer-based assay, is present in the sample, an aptamer complex is formed comprising the aptamer 14, the capture probe 28, and the reporter probe 24. The probe and aptamer complex are separated from unbound elements in the reaction mixture via affinity tag capture, which is shown as bead capture. The capture beads include an affinity tag binder so that the capture beads can capture at least one capture probe 28 having an affinity tag. As discussed herein, beads can also capture empty probes or uncomplexed probes that are not hybridized to any aptamer. However, uncomplexed captured probes 28 that are not complexed with the reporter probe 24 via an aptamer do not produce any amplification products in downstream processes.

[0089] Once captured by the beads, a washing step is performed to separate the beads from the unbound elements, which may include reporter probe 24 that is not complexed with any aptamer, and dummy complexes that may contain reporter probe 24 complexed with a dummy probe that does not have an affinity tag. After separation, the sample proceeds to a sequence library preparation step, indicated as ligation to a PCR reaction. However, other preparation workflows such as direct amplification, step-out PCR, or other amplification and / or ligation preparations as discussed herein are also contemplated. The final product of the workflow contains oligonucleotide fragments, which can then be sequenced as part of a sequencing reaction to generate sequence data.

[0090] In some embodiments, the workflow may include only a single wash step after bead capture and before amplification and / or ligation. In other embodiments, two, three, or more wash steps are intended. Figure 33 shows different wash conditions for washing in the bead capture step, as well as sequencing read counts for comparing 3, 6, and 12 washes. Reducing the number of washes from 12 to 6 improves reproducibility and reduces assay time and consumable usage. Further reducing the washes from 6 to 3 increases the signal further, but also increases the background without any input (0 input fM).

[0091] Figure 34 shows the compression of sequencing read counts using dummy-biotin for different aptamers. The left panel shows the experimental setup using aptamer and probe complex formation. Two different types of complexes can be formed for individual aptamers: a first complex containing an affinity tag and a second complex without an affinity tag. The ratio of these types of complexes to a given aptamer depends on the ratio of the dummy probe to the capture probe. Figure 34 shows that the sequence read count is reduced through the use of the dummy probe in the workflow of Figure 30, removing a portion of the aptamer population that would have otherwise generated sequence reads. Figure 34 shows a two-order-of-magnitude (100×) reduction in the read count, i.e., a compression to 1% across a panel of 96 aptamers.

[0092] Figure 35 shows an example of undesirable nonspecific binding between aptamer binding regions. The upper part of Figure 35 shows the desired complex structure after the hybridization reaction, where the complex contains aptamer 14, reporter probe 24, and capture probe 28. The lower part of Figure 35 shows the undesirable structure formation in which reporter probe 24 directly complexes with capture probe 28 via the aptamer binding region of reporter probe 24 and / or the aptamer binding region of capture probe 28. In this case, the complex is formed without aptamer crosslinking. If the undesirable reporter probe 24 is pulled down during bead capture and subsequent amplification and sequencing, background due to nonspecific binding occurs. Figure 36 shows the involvement of different aptamer binding regions in nonspecific binding. Nonspecific aptamer binding region interactions were shown to be a major contributing factor to background. Nonspecific binding can be low-level base pairing between adapter sequences.

[0093] Figure 37 is a schematic diagram of a sequencing device 500 that may be used in conjunction with the disclosed embodiments for obtaining sequencing data of identification sequences and / or index sequences as generally discussed herein. The sequencing device 500 may be implemented according to any sequencing technique, including those incorporating synthesis sequencing as described in U.S. Patent Applications Nos. 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2005 / 0100900, U.S. Patent No. 7,057,026, International Publication Nos. 05 / 065814, 06 / 064199, and 07 / 010251, the entire disclosure of which is incorporated herein by reference. Alternatively, sequencing by ligation techniques may be used in the sequencing device 500. Such techniques, which use DNA ligases to incorporate oligonucleotides and identify such oligonucleotide incorporation, are described in U.S. Patents 6,969,488, 6,172,218, and 6,306,597, the entirety of which disclosures are incorporated herein by reference. In some embodiments, nanopore sequencing can be utilized, thereby removing a target nucleic acid chain or nucleotide from the target nucleic acid by an exonuclease and passing through the nanopore. As the target nucleic acid or nucleotide passes through the nanopore, each base species can be identified by measuring the variation in the electrical conductance of the pore (U.S. Patent No. 7,001,792, Soni & Meller, Clin. Chem. 53, 1996-2001 (2007), Healy, Nanomed. 2, 459-481 (2007), and Cockroft, et al. J. Am. Chem. Soc. 130, 818-820 (2008), these disclosures are incorporated herein by reference in their entirety). Further embodiments include the detection of protons released upon incorporation of nucleotides into the extension product.For example, sequencing based on the detection of released protons may use commercially available electrodetectors and related technologies from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), or it may use sequencing methods and systems described in U.S. Patent Publication Nos. 2009 / 0026082(A1), 2009 / 0127589(A1), 2010 / 0137143(A1), and 2010 / 0282617(A1) (each of which is incorporated herein by reference in its entirety). Certain embodiments may utilize methods that include real-time monitoring of DNA polymerase activity. Nucleotide incorporation can be detected via fluorescence resonance energy transfer (FRET) interactions between fluorophore-supported polymerases and γ-phosphate-labeled nucleotides, or using zero-mode waveguides as described, for example, in Levene et al. Science 299, 682-686 (2003), Lundquist et al. Opt. Lett. 33, 1026-1028 (2008), and Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008) (these disclosures are incorporated herein by reference in their entirety). Other suitable alternative techniques include, for example, fluorescence in situ sequencing (FISSEQ) and massively parallel signature sequencing (MPSS). In certain embodiments, the sequencing device 500 may be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, CA). In other embodiments, the sequencing device 500 may be configured to operate using a CMOS sensor with nanowells fabricated on a photodiode so that the DNA deposition is aligned one-to-one with each photodiode.

[0094] The sequencing device 500 may be a "one-channel" detection device in which only two of the four nucleotides are labeled and detectable for any given image. For example, thymine may have a permanent fluorescent label, while adenine may use the same fluorescent label in a separable form. Guanine may be permanently dark, and cytosine may be dark initially but can be labeled during the cycle. Thus, each cycle may include a first image and a second image, where the dye is cleaved from any adenine and added to any cytosine such that only thymine and adenine are detectable in the first image, but only thymine and cytosine are detectable in the second image. Any base that is dark through both images is guanine, and any base that is detectable through both images is thymine. A base that is detectable in the first image but not in the second image is adenine, and a base that is not detectable in the first image but is detectable in the second image is cytosine. By combining the information from the first and second images, all four bases can be identified using one channel.

[0095] In the shown embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as described above, these may be implemented as a single device. Furthermore, the associated computer 504 may communicate locally with the sample processing device 502, or networked, or otherwise. In the shown embodiment, a biological sample may be added in the sample processing device 502 to a sample substrate 510, e.g., a flow cell or slide, which is imaged to generate sequencing data. For example, a reagent interacting with the biological sample fluoresces at a specific wavelength in response to an excitation beam generated by the imager 512, thereby returning luminescence for imaging. For example, the fluorescent component may be generated by a fluorescently tagged nucleic acid that hybridizes to a complementary molecule of the component or hybridizes to a fluorescently tagged nucleotide incorporated into an oligonucleotide using polymerase. As will be understood by those skilled in the art, the wavelength at which the dyes of the sample are excited, and the wavelength at which they fluoresce, will depend on the absorption and emission spectra of the particular dye. Such returned radiation may propagate through a directional optical system. This retrobeam can generally be directed towards the detection optics of the imager 512.

[0096] The imager detection optical system may be obtained based on any preferred technique and may be, for example, a charged coupled device (CCD) sensor that generates pixelated image data based on photons that affect location within the device. However, it will be understood that any of a variety of other detectors may also be used, including but not limited to detector arrays configured for time delay integration (TDI) operation, complementary metal oxide semiconductor (CMOS) detectors, avalanche photodiode (APD) detectors, Geiger-mode photon counters, or any other preferred detectors. TDI mode detection can be coupled with line scanning, as described in U.S. Patent No. 7,329,860, incorporated herein by reference. Other useful detectors are described, for example, in the references previously provided herein in the context of various nucleic acid sequencing methodologies.

[0097] The imager 512 may be under processor control, for example, by a processor 514, and the sample receiving device 502 may include an I / O control 516, an internal bus 518, a non-volatile memory 520, RAM 522, and any other memory structure in which the memory can store executable instructions, as well as other suitable hardware components that may be similar to those described with respect to Figure 31. Furthermore, the associated computer 504 may also include a processor 524, an I / O control 526, a communication circuit 527, and a memory architecture including RAM 528 and non-volatile memory 530 in which executable instructions 532 can be stored. The hardware components may be connected by an internal bus that can also be connected to a display 534. In embodiments in which the array determination device 500 is implemented as an all-in-one device, certain redundant hardware elements may be eliminated.

[0098] Processors 514, 524 can be programmed to assign individual sequencing reads to a sample based on one or more relevant index sequences, in accordance with the techniques provided herein. In certain embodiments, based on image data acquired by imager 512, sequencing device 500 may be configured to generate sequencing data including base calls for each base of the sequencing read. Furthermore, based on image data, even for sequential sequencing reads, individual reads may be linked to the same location, and therefore to the same template strand, via the image data. In this way, index sequencing reads can be associated with sequencing reads of insert sequences before being assigned to the original sample. Processors 514, 524 can also be programmed to perform downstream analysis on sequences corresponding to inserts in a particular sample, following the assignment of sequencing reads to the sample.

[0099] In certain embodiments, I / O controls 516, 526 may be configured to accept user input for automatically selecting sequencing parameters based on the reporter probe 24 and associated sequence library preparation techniques. For example, if custom primers or dark cycles are incorporated into the sequencing run, the sequencing device may select from pre-programmed operation commands and / or receive user input to operate the sequencing device according to desired sequencing parameters. In embodiments, the user input may be the selection of a sequence library preparation kit or the reading of a barcode or identifier of a sequence library preparation kit.

[0100] In embodiments of the disclosed technique, aptamer detection may be based on the presence of a unique identifier sequence 68 that identifies each individual aptamer in the sequencing data generated by the sequencing device 500. Thus, in embodiments, the sequencing device 500 may perform an analysis of sequence reads to identify one or more identifier sequences 68 for a panel of aptamers. Based on the identified aptamers, a positive aptamer identification notification or report may be generated. In embodiments, the notification may be provided on a display 534 or communicated to a remote device or cloud server via a communication circuit 527.

[0101] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid having a specific binding affinity to a target molecule. Binding of an aptamer to a target molecule may result in catalytic alteration of the target molecule, reaction with the target molecule in a manner that modifies or alters the target molecule or its functional activity, covalent bonding to the target molecule (as in suicide inhibitors), and facilitating reactions between the target molecule and another molecule. In one embodiment, the target molecule is a non-polynucleotide three-dimensional chemical structure that binds to the aptamer via a mechanism primarily independent of Watson / Crick base pairing or triple helix bonding. In another embodiment, the aptamer is not a nucleic acid with a known physiological function that is bound to the target molecule.

[0102] Aptamers include nucleic acids identified from a candidate mixture of nucleic acids. The specific binding affinity of an aptamer to its target generally refers to aptamer binding to that target with a much higher degree of affinity than binding to other non-target components in the mixture or sample. Different aptamers may have either the same or different numbers of nucleotides. Aptamers may be DNA or RNA, and may be single-stranded, double-stranded, or contain double-stranded regions. The aptamers discussed herein may be used in any diagnostic, imaging, high-throughput screening, or targeted validation technique or procedure, or in assays that may utilize aptamers, oligonucleotides, antibodies, and ligands, but are not limited to such assays.

[0103] The aptamers disclosed herein may be used in aptamer-based assays, such as those disclosed in U.S. Patent Nos. 7,855,054 and 7,964,356, and U.S. Patent Application Publications 2011 / 0136099 and 2012 / 0115752. In one example, a panel of aptamers for different target molecules is provided attached to a solid support. The attachment of the aptamers to the solid support is achieved by bringing a first solid support into contact with the aptamers, allowing a releaseable first tag contained in the aptamer to directly or indirectly associate with a suitable first capture agent attached to the first solid support or a portion thereof. A test sample is then prepared and brought into contact with immobilized aptamers having specific affinity for each of those target molecules that may or may not be present in the sample. If the test sample contains target molecules, an aptamer-target affinity complex is formed in the mixture having the test sample. In addition to the aptamer-target affinity complex, a non-complexed aptamer is also attached to the first solid support. The aptamer-target affinity complex and the non-complexed aptamer associated with the probe on the solid support are then partitioned from the mixture residue, thereby removing the free target and all other non-complexed substances, i.e., components of the mixture that are not associated with the first solid support, from the test sample (sample matrix). This partitioning step is referred to herein as Catch 1 partitioning (see definition below). Following partitioning, the aptamer-target affinity complex, along with any non-complexed aptamer, is released from the first solid support using a method appropriate to the specific releaseable first tag being used.

[0104] In one embodiment, an aptamer-target affinity complex bound to a solid support is treated with a drug that introduces a second tag to the target molecular component of the aptamer-target affinity complex. In one embodiment, the target is a protein or peptide, which is biotinylated by treatment with NHS-PEO4-biotin. The second tag introduced to the target molecule may be the same as or different from the aptamer capture tag. If the second tag is the same as the first tag or aptamer capture tag, the free capture site on the first solid support may be blocked before the commencement of this tagging step. In this exemplary embodiment, the first solid support is washed with free biotin before the commencement of target tagging. A tagging method, in particular for tagging targets such as peptides and proteins, is described in U.S. Patent No. 7,855,054.

[0105] Distribution is completed by releasing the uncomplexed aptamer and the aptamer-target affinity complex from the first solid support. In one embodiment, the first releaseable tag is a photocleavable portion that is cleaved by irradiation with a UV lamp under conditions that cleave ≥90% of the first releaseable tag. In other embodiments, release is achieved by a method suitable for the selected releaseable portion in the first releaseable tag. The aptamer-target affinity complex can be eluted and collected for further use in the assay, or it can be contacted with another solid support to carry out the remaining steps of the assay.

[0106] In one embodiment, a second partition is performed to remove the free aptamer (referred to herein as catch 2 partition, see definition below). As described above, in one embodiment, the second tag used for catch 2 partition may be added to the target while the aptamer-target affinity complex is still in contact with the solid support used for catch 0 capture. In other embodiments, the second tag may be added to the target at a different point in the assay prior to the start of catch 2 partition. The mixture is brought into contact with a solid support, which preferably has a capture element (second) attached to its surface that can bind to the target capture tag (second tag) with high affinity and specificity. In one embodiment, the solid support is a magnetic bead (e.g., DynaBeads MyOne Streptavidin C1) contained in a well of a microtiter plate, and the capture element (second capture element) is streptavidin. The magnetic beads provide a convenient method for separating the partitioned components of the mixture. The aptamer-target affinity complex contained in the mixture is then bound to the solid support via a binding interaction between the target (second) capture tag and a second capture element on the second solid support. The aptamer-target affinity complex is then distributed from the mixture residue by washing the support with a buffering solution containing, for example, an organic solvent including but not limited to glycerol.

[0107] Next, the aptamers are selectively eluted from the aptamer-target complex using a buffer containing chaotropic salts from the group including but not limited to sodium perchlorate, lithium chloride, sodium chloride, and magnesium chloride. Aptamers retained on the Catch2 beads by aptamer / aptamer interactions are not eluted by this treatment.

[0108] In another embodiment, aptamers released from a catch-2 distribution are detected and optionally quantified by detection methods such as those discussed herein, including next-generation sequencing techniques. For example, this may be done via amplification and / or sequencing of a probe that binds to the eluted aptamer. In a particular embodiment, the detection includes detection results that provide relative and / or estimated absolute concentrations of the detected aptamer. The detection results may include notification or output of positive or negative detection results or relative or estimated concentrations for a specific aptamer ID or a specific target of the aptamer.

[0109] In certain embodiments of this disclosure, the probes disclosed in probe set 20 may include one or more conserved regions, such as a first conserved primer region and a second conserved primer region. The conserved regions are conserved among at least some other probes in probe set 20 such that the conserved regions have identical or similar nucleotide sequences when compared among the probes. For example, for a given second probe 24, all probes 24 may have the same first conserved primer region and second conserved primer region. In this means, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any captured probe 24.

[0110] One or more probes considered herein may include a discriminant sequence that can be used to identify one or more specific aptamers, and which may include one or more nucleotide sequences. The discriminant sequence may be an artificial sequence. The discriminant sequence may include at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the discriminant sequence includes at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the discriminant sequence in the probe is different.

[0111] One or more probes considered herein may include affinity tags. Affinity tags may be useful in various applications, such as bulk isolation of target nucleic acids hybridized to hybridization tags. As used herein, the term “affinity tag” and its grammatical synonyms may refer to components of a multicomponent complex, where components interact specifically with or bind specifically to each other. For example, affinity tags may each include biotin or poly-His that can bind to streptavidin or nickel. Other examples of multicomponent affinity tag complexes are listed, for example, in U.S. Patent Application Publication 2012 / 0208705, U.S. Patent Application Publication 2012 / 0208724, and International Patent Application Publication 2012 / 061832, each of which is incorporated herein by reference in whole.

[0112] The disclosed embodiments provide different primers and probes. The probes and / or primers of the disclosed embodiments are designed to be complementary to a target sequence (either the target sequence of a sample or another probe sequence) so that hybridization of the target sequence with the probe of the present invention occurs. As outlined below, this complementarity does not need to be perfect, and any number of base pair mismatches may exist that interfere with hybridization between the target sequence and the single-stranded nucleic acid of the present invention. However, if the number of mutations is so large that hybridization cannot occur even under the lowest stringent hybridization conditions, the sequence is not a complementary target sequence. Thus, "substantially complementary" as used herein means that the probe is sufficiently complementary to the target sequence to hybridize under normal reaction conditions.

[0113] A variety of hybridization conditions, including high, moderate, and low stringency conditions, can be used in this invention. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5–10°C, lower than the thermal melting point (Tm) of a particular sequence at defined ionic strength and pH. Tm is the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (if the target sequence is present in excess, at Tm, 50% of the probe is occupied at equilibrium) (under defined ionic strength, pH, and nucleic acid concentration). Stringent conditions are characterized by a salt concentration of less than 1.0 M sodium ions at pH 7.0–8.3, typically about 0.01–1.0 M sodium ion concentration (or other salts), and a temperature of at least about 30°C for short probes (e.g., 10–50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).

[0114] In certain embodiments, the probe contact step may be performed under stringency conditions that allow the formation of a hybridization complex only in the presence of the target. Stringency can be controlled by varying process parameters, which are thermodynamic variables including but not limited to temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, and organic solvent concentration. The size of the primer nucleic acids can vary generally between 5 and 500 nucleotides, as understood by those skilled in the art. Primers may be 10–100, 15–50, and 10–35, depending on the application and amplification technique.

[0115] The techniques disclosed relate to dynamic range compression in one or more applications, such as the analysis of eluents in aptamer-based assays. Dynamic range compression may include one or more amplification steps, which may be part of sequencing library preparation, allowing the adapter to be oligonucleotide-fused to a reporter probe for downstream sequencing. The adapter may be attached to a target polynucleotide in any other preferred manner. In some embodiments, the adapter is introduced in a multi-step process, such as a two-step process, which involves ligating a portion of the adapter to a target polynucleotide having a universal primer sequence. The second step includes extension, for example, by PCR amplification, using a primer having a 3' end having a sequence complementary to the attached universal primer sequence and a 5' end containing other sequences of the adapter. As an example, such extension may be performed as described in U.S. Patent No. 8,053,192, which is incorporated herein by reference in its entirety. Additional extension may be performed to provide an additional sequence to the 5' end of the resulting previously extended polynucleotide.

[0116] In some embodiments, the adapter may be ligated to a reporter probe. Any suitable adapter may be attached to a target polynucleotide, such as a reporter probe, via any suitable process, such as those considered herein. The adapter may include library-specific index tag sequences (e.g., i5, i7). The index tag sequences may be attached to target polynucleotides from each library before the sample is immobilized for sequencing. The index tag is not formed by a portion of the target polynucleotide itself, but becomes part of the template for amplification. The index tag may be a synthetic sequence of nucleotides that is added to the target as part of the template preparation step. Thus, a library-specific index tag is a nucleic acid sequence tag attached to each of the target molecules in a particular library, and its presence is used to indicate or identify the library from which the target molecule was isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1 to 10 nucleotides or 4 to 6 nucleotides in length. Four nucleotide index tags offer the possibility of multiplexing 256 samples on the same array, while six nucleotide index tags enable processing of 4,096 samples on the same array. Adapters may contain two or more index tags to increase the multiplexing potential.

[0117] The adapter may include any other suitable sequences in addition to the index tag sequence. For example, the adapter may include a universal elongation primer sequence and a polynucleotide obtained for sequencing, typically located at the 5' or 3' end of the adapter. The universal elongation primer sequence may hybridize to a complementary primer bound to the surface of a solid substrate. The complementary primer includes a free 3' end to which a nucleotide can be added to elongate the sequence using a polymerase or other suitable enzyme as a template, yielding a reverse chain of the library polynucleotide bound to the solid surface. Such elongation may be part of a sequencing run or cluster amplification.

[0118] In some embodiments, the adapter includes one or more universal sequencing primer sequences. The universal sequencing primer sequences can bind to sequencing primers to enable sequencing of an index tag sequence, a target sequence, or both an index tag sequence and a target sequence. In some embodiments, the disclosed reporter probe, e.g., reporter probe 24, may include a “sequencing adapter” or “sequencing adapter site,” i.e., a region containing one or more sites that can hybridize to a primer. In some embodiments, the sequence may include at least a first primer site useful for amplification, sequencing, and the like.

[0119] After adapter integration, the disclosed reporter probe can be sequenced. In one example, sequencing may be performed via Illumina's sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on the attachment of fragmented genomic DNA to a planar, optionally optically transparent surface to which oligonucleotide anchors are bound. The template DNA is repaired at the ends to produce 5' phosphorylated blunt ends, and a single A base is added to the 3' end of the blunt-phosphorylated DNA fragment using the polymerase activity of the Krenow fragment. This addition prepares DNA fragments for ligation to the oligonucleotide adapter, which have a single T base overhang at their 3' end to enhance ligation efficiency. The adapter oligonucleotides are complementary to the flow cell anchor. Under restriction dilution conditions, the adapter-modified single-strand template DNA is added to the flow cell and immobilized by hybridization to the anchor. Attached DNA fragments are extended, and bridges are amplified to create ultra-high-density sequencing flow cells with hundreds of millions of clusters, each containing approximately 1,000 copies of the same template. In one embodiment, randomly fragmented genomic DNA is amplified using PCR before undergoing cluster amplification. Alternatively, unamplified genomic library preparation is used, and randomly fragmented genomic DNA is enriched using cluster amplification only. The template is sequenced using a robust four-color DNA sequencing bisynthesis technique with a reversible terminator having a removable fluorescent dye. High-sensitivity fluorescence detection is achieved using laser excitation and internal total internal reflection optical elements. Sequences are aligned against a conserved correlation between truth tables or aptamer identity and identification sequences using specially developed data analysis pipeline software.

[0120] This written description enables a person skilled in the art to practice the disclosed embodiments, including by using the examples, fabricating and using any device or system, and performing any incorporated methods. The patentable scope is defined by the claims and may include other embodiments that a person skilled in the art could conceive. Such other embodiments are intended to be within the claims if they include structural elements that are no different from the literal wording of the claims, or if they include equivalent structural elements that differ only slightly from the literal wording of the claims.

Claims

1. A method for detecting aptamers, The method involves contacting the analyte of a sample with multiple aptamers under conditions that enable the formation of an analyte-aptamer complex, wherein different aptamers among the multiple aptamers have specific affinity for each of the different analytes among the analytes. The method includes detecting the analyte by detecting the aptamer of the analyte-aptamer complex, wherein the detection of the aptamer is The process involves generating double-stranded oligonucleotides from the aptamers, wherein each double-stranded oligonucleotide comprises an individual aptamer and a complementary strand. The process involves denaturing the double-stranded oligonucleotide under denaturation conditions to generate a denatured chain containing the individual aptamers and the complementary chain, The modified chains are brought into contact with the primer under re-annealing conditions such that some of the modified chains re-anneal to each other and some of the modified chains anneal to the primer. Using polymerase, the denatured chain is extended from the primer to generate an amplicon, A method comprising detecting the aptamer using the amplicon.

2. The method according to claim 1, wherein the primer is provided at a concentration lower than the concentration of the individual aptamers having a high abundance.

3. The method according to claim 1, wherein the primer is provided at a concentration higher than the concentration of individual aptamers having low abundance.

4. The method according to claim 1, further comprising detecting the aptamer using the re-annealed denatured chain.

5. The method according to claim 1, wherein some of the double-stranded oligonucleotides contain different target sequences to one another, the first target sequence containing a high-abundance sequence and the second target sequence containing a low-abundance sequence.

6. The method according to claim 5, wherein the first target sequence comprises a first aptamer sequence, and the second target sequence comprises a second aptamer sequence.

7. The method according to claim 6, wherein the first aptamer sequence is present in the double-stranded oligonucleotide in a ratio of at least 10:1 with respect to the target second sequence.

8. The method according to claim 7, wherein at least a portion of the denatured chain containing the first aptamer sequence re-anneals to the complementary chain and does not bind to the primer.

9. The method according to claim 8, wherein at least 90% of the denatured chain containing the second aptamer sequence is bound to the primer.

10. A method for detecting aptamers, The method involves contacting the analyte of a sample with multiple aptamers under conditions that enable the formation of an analyte-aptamer complex, wherein different aptamers among the multiple aptamers have specific affinity for each of the different analytes among the analytes. The process includes detecting the analyte by detecting the aptamer of the analyte-aptamer complex, wherein detecting the aptamer is The process involves generating double-stranded oligonucleotides from the aptamers, wherein each double-stranded oligonucleotide comprises an individual aptamer and a complementary strand. The process involves denaturing the double-stranded oligonucleotide under denaturation conditions to generate a denatured chain containing the individual aptamers and the complementary chain, The denatured chains are brought into contact with a nuclease under re-annealing conditions such that some denatured chains re-anneal to each other and some denatured chains do not re-anneal. The nuclease digests the re-annealed chain, Using polymerase, the amplicon is generated by extending the annealed primer onto the denatured chain, A method comprising detecting the aptamer using the amplicon.

11. The method according to claim 10, wherein the nuclease is a double-stranded nuclease that does not digest the denatured chain using an annealed primer.

12. The method according to claim 10, wherein some of the double-stranded oligonucleotides contain different target sequences to each other, the first target sequence containing a high-abundance sequence and the second target sequence containing a low-abundance sequence.

13. The method according to claim 12, wherein the first target sequence comprises a first aptamer sequence, and the second target sequence comprises a second aptamer sequence.

14. The method according to claim 13, wherein the first aptamer sequence is present in the double-stranded oligonucleotide in a ratio of at least 10:1 with respect to the target second sequence.

15. The method according to claim 14, wherein at least 90% of the denatured chain containing the second aptamer sequence is bound to the primer.

16. The method according to claim 10, wherein detecting the analyte comprises preserving a portion of the double-stranded oligonucleotide and contacting the double-stranded oligonucleotide with the nuclease.

17. A bead-based aptamer detection method, The method involves contacting the analyte of a sample with multiple aptamers under conditions that enable the formation of an analyte-aptamer complex, wherein different aptamers among the multiple aptamers have specific affinity for each of the different analytes among the analytes. The process includes detecting the analyte by detecting the aptamer of the analyte-aptamer complex, wherein the detection of the aptamer is The aptamer is brought into contact with one or more capture beads, wherein the one or more capture beads are The present invention comprises a plurality of single-stranded trapping molecules, each trapping molecule containing a complementary region complementary to a portion of each individual aptamer, wherein there is a diversity in the length of the complementary regions among the plurality of single-stranded trapping molecules, and the contact is under conditions that allow at least some of the aptamers to hybridize to the plurality of single-stranded trapping molecules. Separating the one or more beads having the hybridized aptamer, A bead-based aptamer detection method comprising detecting the hybridized aptamer.

18. The method according to claim 17, wherein the complementary region is 6 to 16 nucleotides long.

19. The method according to claim 17, wherein each individual capture molecule is associated with a complementary region of a specific length.

20. The method according to claim 17, wherein the shortest complementary region is associated with a high-abundance aptamer.

21. The method according to claim 17, wherein the longest complementary region is associated with a low-abundance aptamer.

22. The method according to claim 17, wherein the one or more beads include magnetic beads.

23. The method according to claim 17, wherein the one or more beads include multiplexed beads having different capture molecules specific to each different aptamer and complementary regions of different lengths.