Plant cultivation methods, uses, and products

JP2026530204APending Publication Date: 2026-09-04EPIPLANTA BIOTECH LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026513748
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-08-31
Filing Date
2024-06-28
Publication Date
2026-09-04

Smart Images

  • Figure 2026530204000001_ABST
    Figure 2026530204000001_ABST
Patent Text Reader

Abstract

This invention provides a method for cultivating plants, its use, and its products. The plant cultivation method involves introducing an inducer into an initial plant and then cultivating the plant to obtain a target plant that does not contain the inducer and has optimized traits compared to the initial plant. The inducer can induce demethylation of 6-methylated bases in plant RNA. The plant cultivation method can be used to obtain a plant that has optimized traits and does not contain the initially introduced inducer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant cultivation, and specifically to a plant cultivation method, use, obtained target plant, and product. Background Art

[0002] Methods of artificial intervention in plant cultivation typically include various approaches such as genetic engineering, cell engineering, and microbial engineering, among others. The aforementioned methods are generally used to obtain new plant varieties. Herein, new plant varieties include whole plants, plant organs (such as flowers, fruits, seeds, roots, stems, leaves, etc.), plant tissues, plant cells, and other parts that can be derived from plants.

[0003] Newly obtained plant varieties are typically expected to exhibit more optimized traits, including, inter alia, optimized growth, increased yield, optimized biomass, enhanced structure, or optimized cell division. Among these optimized traits, increased yield can be achieved by various phenotypic factors, for example, larger seed size or weight per seed / thousand seed weight, increased number of tillers in the root system, and other factors that affect the increase in plant yield, particularly the yield of the desired part of the plant.

[0004] The aforementioned expectations are currently typically achieved by specific modification methods, such as modifying plant DNA or histones to alter the traits of the plant. Before the present invention, there have been approaches related to demethylation of plant RNA to achieve the objective of optimizing plant traits. Summary of the Invention Problem to be Solved by the Invention

[0005] The aforementioned approaches can indeed be used to obtain plants exhibiting optimized traits, particularly increased yield. However, plants obtained through these approaches still contain the initially introduced inducer, and plants containing the inducer and exhibiting optimized traits are still used as reference standards in the selection criteria applied during plant selection. Nevertheless, the applicant's research has shown that plants with optimized traits can be obtained even in the absence of the inducer. Furthermore, the degree of trait optimization achieved is no less than that of plants containing such an inducer.

[0006] Therefore, the present invention provides a plant cultivation method that can obtain plants exhibiting optimized traits without the use of introduced induction media. The specific technical solutions provided are as follows: [Means for solving the problem]

[0007] A plant cultivation method characterized by introducing an induction medium into an initial plant and cultivating it to obtain a target plant that does not contain the induction medium and exhibits optimized traits compared to the initial plant, wherein the induction medium can induce demethylation of 6-methylated bases in plant RNA.

[0008] By arbitrary selection, the target plant has optimized at least one trait compared to the initial plant, with a degree of optimization of Y.

[0009] Optionally, an induction medium is temporarily introduced into the initial plant to directly obtain a target plant that does not contain the induction medium and possesses optimized traits compared to the initial plant.

[0010] Optionally, the induction medium is temporarily introduced into the protoplast of the initial plant.

[0011] An induction medium is used to obtain an intermediate plant by optionally introducing an induction medium into the initial plant, and then using the intermediate plant for offspring cultivation to obtain a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.

[0012] Optionally, intermediate plants may contain induction media.

[0013] By arbitrary selection, the target plant has optimized at least one trait compared to the initial plant, with a degree of optimization of Y.

[0014] By arbitrary selection, the intermediate plant has optimized at least one trait compared to the initial plant, with a degree of optimization of X.

[0015] Optionally, Y is the rate of increase compared to the initial plant at the same time, and is Y≧0.20;Y≧0.50;Y≧1.00, preferably Y≧2.00, preferably Y≧3.00, and preferably Y≧4.00.

[0016] Optionally, trait optimization includes increasing yield.

[0017] Optionally, trait optimization includes increasing the yield of plant organs.

[0018] Optionally, trait optimization may include at least one increase in the volume, number, weight, or tillering number of plant organs.

[0019] Optionally, the induction medium can induce the demethylation of 6-methyladenine in plant RNA.

[0020] The induction medium is introduced in excess of the initial plant at the discretion of the researchers.

[0021] Optionally, the induction medium is a nucleic acid molecule and / or polypeptide, or its homolog, functional variant, or complex.

[0022] Optionally, when the inducing medium is a nucleic acid molecule, a homolog thereof, a functional variant thereof, or a complex thereof, the target plant does not contain the inducing medium, nor does it contain a polypeptide obtained from expression of the inducing medium; and when the inducing medium is a polypeptide, a homolog thereof, a functional variant thereof, or a complex thereof, the target plant does not contain the inducing medium.

[0023] Optionally, the inducing medium is selected from RNA m6A demethylase and a nucleic acid encoding the same.

[0024] Optionally, the inducing medium is selected from at least one of an FTO nucleic acid molecule and / or an FTO polypeptide, or a homolog, a functional variant, or a complex thereof.

[0025] Optionally, the FTO in the inducing medium is derived from vertebrates, invertebrates, algae, orthologs thereof, or paralogs thereof.

[0026] Optionally, the inducing medium corresponds to the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 15 in the sequence listing.

[0027] Optionally, the initial plant is selected from at least one of food crops, feed crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops; preferably selected from at least one of rapeseed plants, tomatoes, lettuce, and beets; or preferably selected from at least one of rice, corn, soybean plants, potatoes, wheat, millet, sugarcane, sorghum, and cassava; or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, camelina, nutsedge, cannabis, and poplar.

[0028] Optionally, the initial plant part to be introduced comprises at least one of plant organs, plant tissues, and plant cells.

[0029] The initial plant tissue to be subjected to the treatment is selected at the discretion of the user.

[0030] Optionally, the induction medium is introduced into at least one of the nucleus and cytoplasm of the early plant.

[0031] Optionally, the introduction method includes introducing a vector containing an induction medium into an initial plant.

[0032] Optionally, the offspring cultivation method includes at least one of the following: natural genetic screening removal, hybrid genetic screening removal, and active removal.

[0033] The present invention also provides the use of the aforementioned plant cultivation method for the production of plants having optimized traits and free from induction media.

[0034] Furthermore, the present invention provides a target plant obtained by the above-described plant cultivation method, which includes at least one of a whole living plant, a plant organ, a plant tissue, or a plant cell.

[0035] The present invention also provides products derived from target plants subjected to inactivation. [Brief explanation of the drawing]

[0036] [Figure 1] The demethylation of N6-methyladenine is schematically shown. [Figure 2] The electrophoretic profiles of PCR products from plant samples are shown. [Figure 3] This is an example of Embodiment 2, showing that the pCAMBIA1307 vector, which contains the FTO gene and the hygromycin resistance gene (hygromycin), was introduced into Agrobacterium tumefaciens LBA4404. [Figure 4] This is a comparative diagram of the entire plant and rice grains between the initial plant (Nipp) and the intermediate plant (FTO), using rice as Embodiment 2. [Figure 5] Embodiment 2 uses rice and provides a comparative example of the entire plant and rice between the initial plant (Nipp) and the target plant (Progeny FTO). [Figure 6] This is a comparative diagram of the root systems of the initial plant (Nipp), intermediate plant (FTO), and target plant (Progeny FTO) using rice as Embodiment 2. [Modes for carrying out the invention]

[0037] To enable those skilled in the art to better understand the technical solutions of the present invention, the following provides a further detailed description of the invention in conjunction with specific embodiments.

[0038] Research in this invention has revealed that certain enzymes can promote the methylation of RNA bases during plant growth and development. For example, the methyltransferase protein MTA can catalyze the N6-methylation of adenine bases in RNA, where "6-" refers to the sixth N in the adenine base linked to the RNA sequence, either in the forward or reverse direction. After methylation, RNA can promote plant growth and development through subsequent processes such as expression, or through products derived therefrom. Experimental evidence has shown that the removal of such methyltransferases adversely affects plant growth and development; for example, plants may not be able to produce viable seeds, or the seeds may not germinate properly. However, it has been further found that partial demethylation from methylated RNA enhances the ability of RNA or its products to promote plant growth and development, thereby promoting trait optimization. Such demethylation can be achieved using appropriate induction media.

[0039] Conventionally, in order to obtain plants with optimized traits, plants that retain an induction medium are typically selected to maintain the optimized traits. However, the applicants of this invention have unexpectedly found that plants subjected to RNA demethylation via a suitable induction medium can retain their optimized traits even in the absence of the induction medium. Furthermore, these optimized traits can, in some cases, be stably inherited.

[0040] The research of this invention has shown that by introducing a specific inducer that can promote RNA demethylation into plants, the traits of the plants themselves can be optimized, and plants with optimized traits can be obtained without the inducer, particularly leading to an increase in plant yield.

[0041] Such inductive media for RNA demethylation primarily target RNA that already has methylated bases. These inductive media are mainly associated with demethylases such as FTO. The chemical mechanism of induction is shown in Figure 1, taking the demethylation process of 6-methyladenine as an example. While the specific RNA sequences demethylated by such inductive media are not yet clear, studies have revealed that such inductive media can indeed demethylate RNA using methylated bases, thereby yielding plants with optimized traits. More advantageously, plants with optimized traits can also be obtained without such inductive media.

[0042] Embodiments of the present invention provide a method for plant cultivation, comprising introducing an inducing medium into an initial plant and obtaining a target plant that does not contain the inducing medium and has optimized traits compared to the initial plant, wherein the inducing medium can induce demethylation of 6-methylated bases in plant RNA.

[0043] As used herein, the term “plant” particularly refers to the whole plant or any of its active parts, including the whole plant, its ancestors and offspring, and plant organs such as seeds, branches, stems, leaves, roots, flowers, and fruits. The term “plant” also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores, and can extend to the harvestable parts of the plant of the present invention, for example, but not limited to the plant body and its offspring, or other available active parts of the plant. The “plant” as described in the present invention is not limited to specific species, including, for example, herbaceous plants, woody plants, algae, ferns, and all plants belonging to the superfamilies of the Kingdom Plantae, preferably monocots or dicots.

[0044] The "plants" necessary for cultivation in this invention can be selected from a variety of plants, including those selected from the following usage classifications, as described above: food crops (rice, corn, soybeans, etc.), fodder crops (alfalfa, etc.), fiber crops (cotton, hemp, etc.), oil crops (sesame, peanuts, etc.), sugar crops, spice crops, seasoning crops, medicinal crops (ginseng, Ganoderma, Fritillaria, etc.), dye crops, ornamental crops, fruit crops, vegetable crops, etc.; or preferably selected from any specific plant chosen from at least one of rapeseed (Brassica napus L.), tomato (Lycopersicon esculentum Mill.), lettuce (Lactuca sativa Lvarramosa Hort.), and beet (Beta vulgaris L.); or preferably selected from rice (Oryza sativa L.), corn (Zea mays L.), soybean (Glycine max (Linn.), potato (Solanum tuberosum), and wheat (Triticum). A selection of at least one of the following: aestivum L.), millet (Setaria italica vargermanica (Mill.) Schred.), sugarcane (Saccharum officinarum), moenka (Sorghum bicolor (L.) Moench), cassava (Manihot esculenta Crantz); or preferably a selection of at least one of the following: tobacco (Nicotiana tabacum L.), alfalfa (Medicago Sativa Linn), rubber grass (Taraxacum kok-saghyz Rodin), cotton (Gossypium spp.), flax (Linum usitatissimum L.), sunflower (Helianthus annuus L.), camelina (Camelina sativa) (L.), nut edge (Cyperus esculentus L.), cannabis (Cannabis sativa L.), poplar (Populus L.).

[0045] As used herein, the term “initial plant” refers to a plant that has not been processed using the methods described in the present invention, and its species and structure may specifically include any of the aforementioned plants. The source of the “initial plant” may be either a wild or artificially cultivated plant.

[0046] As used herein, the term “target plant” refers to a plant that is expected to be processed and obtained by the method of the present invention, and its type and structure may include any of the aforementioned plants.

[0047] The term "products derived from ~treated ~plants" in this specification specifically refers to products derived from the "plants" after inactivation treatment, which are inert and not limited to various fields such as industrial, pharmaceutical, and edible uses, nor are they limited to specific component products such as dried granules, powders, oils, fats, fatty acids, starches, or proteins, nor are they limited to specific product forms such as solids, liquids, gases, or mixtures.

[0048] As defined herein, the term "yield increase" refers to an increase in the weight of a particular harvestable part of the plant compared to its initial state. For example, in the case of rice, an increase in the weight of rice grains is considered a yield increase, and in the case of potatoes, an increase in the weight of tubers is considered a yield increase.

[0049] The term “increase in biomass” as defined herein refers to the weight added to the entire plant, excluding the yield increase described above. For example, in the case of rice, the increase in the weight of the remaining part of the plant, excluding the rice grains, constitutes an increase in biomass.

[0050] The yield and biomass used herein are measured based on the dry weight of plants over the same period.

[0051] The method of the present invention provides plants that exhibit an increased growth rate. Accordingly, the present invention provides a method for increasing the growth rate of plants, comprising introducing an inducer that can promote RNA demethylation into a plant to obtain a target plant that does not contain the inducer.

[0052] Accordingly, the present invention provides a method for increasing plant yield, comprising introducing an induction medium into an initial plant and obtaining a target plant that does not contain the induction medium and exhibits increased yield compared to the initial plant, wherein the induction medium can induce RNA demethylation in the plant.

[0053] Plant traits can be regulated and optimized by introducing an inducer for RNA demethylation. Optionally, plant traits can also be regulated and optimized by using homologs, functional mutants / complexes of the inducer.

[0054] The term “inducing medium” as defined herein refers to a medium capable of inducing RNA demethylation in plants. “Inducing” means catalyzing or participating in any reaction, preferably exhibiting catalytic activity. Such mediums can be demethylases, such as FTO, among others. Furthermore, “RNA” includes one or more types of RNA in plants, such as ribosomal RNA (rRNA), messenger RNA (mRNA), and transfer RNA (tRNA), and “demethylation” refers to the removal of methyl from already methylated RNA, which can occur at one or more sites on the RNA, e.g., demethylation of an already methylated base in the RNA, e.g., demethylation at its 1-methylated base or demethylation at its 6-methylated base. Here, 1 and 6 define the methylation site, which can be counted clockwise or counterclockwise relative to the 6th position, for example, with the N-start position of the bases linking the RNA as position 1. Here, “base” can be a common base in nucleic acid molecules, such as adenine (A), cytosine (C), and guanine (G).

[0055] The source of the “induction medium” may be any one or more sources such as animals or microorganisms, and more preferably the induction medium may be derived from vertebrates or algae, preferably humans or green algae. The “source” as defined herein may be obtained directly or indirectly from vertebrates or algae, or from orthologs or paralogs of vertebrates or algae, preferably from orthologs or paralogs of humans or green algae.

[0056] The term "paralogus" refers to a type of gene duplication within a genome that results in a paralogus gene.

[0057] The term "orthologous" refers to homologous genes in different organisms that have arisen as a result of speciation.

[0058] In this specification, the term "homology" refers to a homologous sequence having equivalent function to the sequence of the described inducer, and the term "functional variant / complex" refers to a variant / complex of an inducer having equivalent function obtained by mutation, conjugation, or other means.

[0059] In this specification, the term "introduction" encompasses one or more embodiments, such as the method of introduction, the components to be introduced, and the amount to be introduced.

[0060] Inducement media can be introduced via various pathways. For example, plants can be infected using a vector containing the induction media, the induction media can be inserted into the plant's DNA, or the vector containing the induction media can be delivered to plant cells. The target site for introduction is not particularly limited and may include, for example, the cell nucleus or cytoplasm. In addition, introduction may be temporary or long-term, and may be at low or excessive levels depending on the plant's traits and the properties of the induction media.

[0061] In this specification, the term "without induction medium" refers to the obtained target plant that does not contain, at least, the introduced induction medium.

[0062] For example, if the inducer is a nucleic acid molecule, its homolog, or a functional variant thereof, the target plant does not contain the inducer or the polypeptide expressed therefrom.

[0063] If the induction medium is a polypeptide, its homolog, or a functional variant thereof, the target plant does not contain the induction medium.

[0064] More specifically, the present invention provides a method for cultivating plants, comprising the following steps:

[0065] An induction medium is introduced into an initial plant to obtain an intermediate plant, and its offspring are obtained to generate a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.

[0066] The present invention provides for obtaining a target plant having directly or indirectly optimized traits compared to an initial plant, without the use of an induction medium. Direct acquisition may, for example, be the transient introduction of an induction medium into an initial plant, particularly the transient introduction into the protoplast cells of the initial plant. Indirect acquisition involves obtaining a second plant (target plant) via an intermediate plant, which is a first plant obtained after the introduction of the induction medium, and then cultivating its offspring. In either case, plant RNA demethylation is affected. The difference lies in whether or not an intermediate plant is involved. Similarly, the terms “intermediate plant” and “target plant” as used herein are structurally or taxonomically equivalent to the aforementioned plants.

[0067] The “inducing medium selected from RNA m6A demethylase and the nucleic acid encoding it” as described herein refers to nucleic acids obtained via the amino acid sequence of the RNA m6A demethylase of the present invention, which include various nucleic acids capable of encoding amino acid sequences obtained by conventional reverse engineering in the art, or nucleic acids obtained directly from a source of RNA m6A demethylase.

[0068] In this specification, the term “intermediate plant” may refer to any subsequent generation of the initial plant. “Intermediate plants” may contain induction media.

[0069] As described herein, the “target plant” can be any subsequent generation of the initial plant, and if no intermediate plant is produced, the target plant is grown directly from the initial plant. If an intermediate plant is produced, the target plant is obtained from its offspring by cultivating the intermediate plant.

[0070] The methods of the present invention are not intended to particularly limit the numerical range of trait optimization and can provide qualitative rather than quantitative explanations. In the methods of the present invention, any improvement or beneficial increase in a plant trait is considered trait optimization. Furthermore, the degree of trait optimization, as defined herein as X and Y, can also be defined by specific numerical values, all of which are based on a comparison with the same trait of the initial plant, such as an increase in seed yield X and Y, or an increase in total seed weight X and Y.

[0071] The degree of optimization Y of the target plant's traits is the same as, not exceeding, or can exceed, the degree of optimization X of the intermediate plant's traits. When calculated using an increment factor, Y is the increment factor compared to the initial plant at the same time. Y≧0.20, Y≧0.50, Y≧1.00, preferably Y≧2.00, preferably Y≧3.00, and preferably Y≧4.00. Here, the increment factor can be, for example, a weight increase factor.

[0072] The method of the present invention allows for the selection of nucleic acid molecules and / or polypeptides, their homologs, or functional variants / complexes thereof as the induction medium.

[0073] The term "inducing medium" may also refer to a nucleic acid molecule or polypeptide, a mixture of nucleic acid molecules and polypeptides, a paralog or orthologue homologous to a nucleic acid molecule or polypeptide, or a substance obtained by a corresponding vector, hybrid, or fusion. Specifically, an existing demethylation inducing medium may be one or more sequences listed in the sequence listing. It should be understood that the inducing medium is not limited to sequences listed in the sequence listing.

[0074] "Nucleic acid molecules and / or polypeptides, their homologs or functional variants" may be any natural or synthetic substance.

[0075] The term “hybridization” as defined herein refers to the process by which essentially homologous and complementary nucleotide sequences anneal to one another. Hybridization processes can occur entirely in solution, meaning both complementary nucleic acids are in solution. Hybridization processes can also proceed in such a way that one of the complementary nucleic acids is immobilized on a substrate such as magnetic beads, agarose beads, or any other resin. Furthermore, hybridization processes can proceed so that one of the complementary nucleic acids is immobilized on a solid support such as a nitrocellulose or nylon membrane, or on a support such as silica glass by techniques such as photolithography. To enable hybridization to occur, nucleic acid molecules are typically denatured thermally or chemically to separate double-stranded nucleic acids into two single-stranded nucleic acids and / or to remove hairpins or other secondary structures from single-stranded nucleic acids. The stringency of hybridization is influenced by conditions such as temperature, salt concentration, and the composition of the hybridization buffer.

[0076] Nucleic acid molecules or their variants may originate from any natural or artificial source. Nucleic acids / genes or their variants may originate from microbial sources such as bacteria, yeast, or fungi, or from plant, algae, or animal (including human) sources. They may be altered from their natural forms in terms of composition and / or genomic environment by rigorous artificial manipulation. Nucleic acids are preferably derived from sources such as algae, particularly green algae.

[0077] The term "homolog" encompasses two specific forms of homology, namely orthologous and paralogous sequences, which are associated with evolutionary concepts used to describe genetic relationships.

[0078] Homologous substances may also take the form of protein "insertion mutants" in which one or more amino acid residues are introduced at a predetermined position within a protein. Such insertions may include fusions at the amino-terminus and / or carboxyl-terminus, as well as insertions into a sequence of one or more amino acids. Typically, insertions into an amino acid sequence are smaller than fusions at the amino or carboxyl-terminus, ranging from approximately 1 to 10 residues. Examples of amino-terminus or carboxyl-terminus fusion proteins or peptides include the binding or activation domains of transcription activators used in yeast two-hybrid systems, phage coat proteins, (histidine) 6-tags, glutathione S-transferase tags, protein A, maltose-binding proteins, dihydrofolate reductase, Tag·100 epitopes, c-myc epitopes, FLAG epitopes, lacZ, CMP (calmodulin-binding peptide), HA epitopes, C protein epitopes, and VSV epitopes.

[0079] Functional variants applicable to the methods of the present invention may also include any splice variants of nucleic acid molecules or genes. As used herein, the term “any splice variant” encompasses variants of nucleic acid sequences in which selected introns and / or exons are removed, substituted, or added. Such variants remain unaffected in the biological activity of the protein and can be obtained by selectively retaining a functional fragment of the polypeptide. These splice variants may occur naturally or be artificially produced. Methods for producing such splice variants are well known in the art.

[0080] The following describes the advantages of the plant cultivation method of the present invention, such as increased yield or strengthened root system of novel plants, through specific embodiments.

[0081] [Embodiment 1] A method for inducing the production of target plants by co-culturing an induction medium with protoplasts. 1. Expression and purification of the inducer Experimental group: The induction medium was cloned into the pET28a vector expressed in E. coli to obtain an induction medium containing an N-terminal His6 tag fusion. The cloned plasmid was transformed into competent cells and cultured. When the OD600 reached 0.6-0.8, 0.5 mM IPTG was added for induction, and E. coli was cultured at 16°C for 20 hours, after which the cells were harvested. After sonication for 10 minutes, the cells were centrifuged at 13000 rpm for 30 minutes. The supernatant was used for subsequent purification experiments. First, Ni column affinity purification was performed, then cation exchange column purification, and finally size exclusion chromatography. The collected proteins were concentrated to a high concentration of 10-20 mg / mL, and the purity of the proteins was measured using polyacrylamide gel electrophoresis.

[0082] Control group: Except for the absence of an induction medium, all other steps and parameters were the same as those of the experimental group.

[0083] 2. Preparation of protoplasts Method 1: Sterilize the seeds in a 70% ethanol and 0.4% hypochlorite solution for 15 minutes, wash them three times with distilled water, and sow them on 1 / 2 MS solid medium. Grow the seedlings in a greenhouse at 25°C with 16 hours of light and 8 hours of dark. To isolate protoplasts, the leaves, stems, and sheaths of 14-day-old seedlings are cultured in an enzyme solution (1.0% cellulase R10, 0.5% macerozyme R10, 0.45 M mannitol, 20 mM MES [pH 5.7], CPW solution) in the dark at 25°C with shaking (40 rpm) for 12 hours, then diluted with an equal volume of W5 solution. After filtration, collect the protoplasts at the bottom of the tube by centrifugation at 100 g for 5 minutes. The protoplasts are resuspended in CPW21S solution (CPW solution containing 21% [w / v] sucrose, pH 5.8), and then centrifuged at 80 g for 7 minutes to collect the protoplasts at the bottom of the tube. The protoplasts are resuspended in W5 solution and centrifuged at 70 g for 5 minutes to collect the protoplasts at the bottom of the tube. Finally, the protoplasts are resuspended in W5 solution and counted using a hemocytometer under a microscope. The protoplasts are then subjected to a 1 × 10⁶ concentration in MMG solution (0.4 M mannitol, 15 mM MgCl₂, 4 mM MES [pH 5.7]). 6 Dilute to a concentration of / ml. Suitable for plants such as Arabidopsis thaliana and rice.

[0084] Method 2: Take plant leaves grown in B5 medium for 3 weeks and digest them in an enzyme solution (1% cellulose R10, 0.25% macerozyme R10, 0.5M mannitol, 8mM CaCl2, 5mM MES [pH 5.7], 0.1% BSA) in the dark at 25°C for 5 hours. Resuspend the protoplasts twice in an equal volume of W5 solution. To obtain complete protoplasts, place the protoplasts on an equal volume 21% sucrose gradient in W5 solution, centrifuge at 50g for 5 minutes, collect the complete protoplasts, and resuspend them in W5 solution. Stabilize the prepared protoplast solution at 4°C for at least 1 hour before transfection via PEG. Suitable for plants such as tobacco.

[0085] 3. Protoplast Transfection Before transfection, 1-5 x 10 5 The protoplasts were suspended in 200 μL of MMG solution, gently mixed with 5–20 μL of protein solution (10–60 μg of inducer protein) (divided into control and experimental groups) and 210 μL of freshly prepared PEG solution (40% [w / v] PEG4000, 0.2 M mannitol, and 0.1 M CaCl2), and incubated in the dark at 25°C for 10 minutes. After incubation, W5 solution (2 mM MES [pH 5.7], 154 mM NaCl, 125 mM CaCl2, 5 mM KCl) was slowly added, and the resulting solution was thoroughly mixed by inverting the tube. The protoplasts were collected by centrifugation at 100 g for 3 minutes and gently resuspended in 1 ml of WI solution (0.5 M mannitol, 20 mM KCl, 4 mM MES [pH 5.7]). Finally, transfer the protoplasts to a multiwell plate and incubate them in the dark at 25°C for 24-48 hours.

[0086] 4. Protoplast regeneration The transfected protoplasts were resuspended in 0.5 × B5 supplement medium (0.5 × B5 medium, 375 mg / L CaCl2·2H2O, 18.35 mg / L NaFe-EDTA, 270 mg / L sodium succinate, 103 g / L sucrose, 0.2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.3 mg / L 6-benzylaminopurine (BAP), 0.1 g / L MES), and an equal volume of 2.4% agarose solution was added to suspend the protoplasts in 2.5 × 10⁻¹⁶ solution. 5Dilute the protoplast to 1 / ml. Spread the agarose-embedded protoplast in a 6-well plate, cover with 2 ml of 0.5 × B5 liquid medium, and incubate in the dark at 25°C. After 7 days, replace with 2 ml of fresh 0.5 × B5 liquid medium. Transfer the 6-well plate to light conditions (16 hours light [30 μmol-2 s-1] and 8 hours dark) and incubate at 25°C. After 3 weeks of incubation, transfer the microcallus, which has grown to several millimeters in diameter, to MS regeneration medium containing 30 g / L sucrose, 0.6% plant agar, 0.1 mg / L α-naphthaleneacetic acid (NAA), and 0.5 mg / L BAP. After approximately 4 weeks on the regeneration medium, induction of new bud tissue is observed.

[0087] 5. Root regeneration, transplantation, and management from plant bud tissue The newly developed bud tissue is cut and transferred to a rooting medium to form complete seedlings. The surviving plants are then transplanted to a greenhouse for conventional fertilization and watering. Seeds from the transformed seedlings are harvested.

[0088] 6. Obtain genetically optimized plants that do not contain induction media. The collected transformed seedlings are free of the induction medium and can be identified by PCR detection of genomic DNA. These induction medium-free plants are planted in the field, and their yields are evaluated through at least two field experiments. Plants with increased yields are selected to ultimately obtain target plants free of the induction medium.

[0089] The following data are calculated based on target plants from experimental and control groups during their maturation stages. The measured data are used to calculate the percentage increase in yield of various plants relative to the yield of the control group plants, represented by Y. Yield is calculated based on the harvested products or root systems of different plants, including but not limited to roots, stems, leaves, flowers, fruits, and seeds.

[0090] In the present invention, the yield of the control group plants refers to the yield of the initial plants without the introduction of the induction medium, where Y represents the percentage data of the increase or enhancement of various traits based on the initial plants, in units of %. The above data is in terms of dry weight, and specifically, is obtained by inactivating in an oven at 105°C for 20 minutes, then drying in an oven at 80°C for 20 hours and weighing. In Embodiment 1, the induction medium used is a polypeptide having a specific sequence that may be the same as Sequence IDs 1-4 in the sequence listing herein, or a nucleic acid molecule encoding it, or a homologous sequence with equivalent function, or a mutant / complex with equivalent function. The induction medium may be derived from vertebrates, invertebrates, or algae.

[0091] The following data are based on a single variable (i.e., introduction of the induction medium sequence - experimental group, or non-introduction of the induction medium sequence - control group), while other factors influencing plant yield and root growth, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, and cultivation time cycles, are artificially standardized and identical, and all substances or components used can be obtained through commercial purchase.

[0092] [Table 1]

[0093] Table 1 above indicates that the human FTO polypeptide sequence of Sequence ID No. 1 in the sequence listing, or the DNA encoding the polypeptide sequence, or a homologous sequence with equivalent function, or a variant / complex thereof with equivalent function, can be used for expression.

[0094] [Table 2]

[0095] Table 2 above shows that the porcine FTO polypeptide sequence of Sequence ID No. 2 in the sequence listing, or DNA for expressing the polypeptide sequence, a functionally equivalent homologous sequence, or a functionally equivalent mutant / complex can be used.

[0096] [Table 3]

[0097] Table 3 above shows that the bovine FTO polypeptide sequence of Sequence ID No. 3 in the sequence listing, or DNA for expressing the polypeptide sequence, a functionally equivalent homologous sequence, or a functionally equivalent mutant / complex can be used.

[0098] [Table 4]

[0099] Table 4 above shows that the green algae FTO polypeptide sequence of Sequence ID No. 4 in the sequence listing, or DNA for expressing the polypeptide sequence, its homologous sequence with equivalent function, or its mutant / zygote with equivalent function can be used.

[0100] [Embodiment 2] A method for obtaining intermediate plants through Agrobacterium-borne infection of callus tissue, and a method for selecting target plants in the offspring.

[0101] 1. Induction of callus tissue using plant seeds as test material. 1) Sterilization: Take the seeds from a mature plant, remove the hulls by hand, and select plump, clean seeds free of sterilization spots. Place the seeds in a 100 ml sterile beaker, add 70% alcohol and sterilize for 2 minutes, discard the alcohol, add a 20% sodium hypochlorite (NaClO) solution and soak for 30 minutes, discard the sodium hypochlorite solution, rinse the seeds 4-5 times with sterile distilled water, and finally soak in sterile distilled water for 30 minutes.

[0102] 2) Induction culture (aseptic technique required): After sterilizing the seeds, place them on sterile filter paper to absorb surface moisture, then transfer 12-14 seeds per dish to NB medium containing 2.0 mg / L 2,4-D (pH 5.8). To ensure a sufficient induction rate, it is best to maintain the seed germination direction parallel to or slightly downward relative to the medium during inoculation, avoiding upward or vertically downward orientation. After the procedure, seal the petri dishes with a sealing film and incubate in a light incubator at 30°C and approximately 50% humidity. Perform dark induction culture for 20-30 days until clear, loosened callus tissue appears, followed by subculturing or pre-culture transformation.

[0103] 3) Subculturing (aseptic technique required): Open a petri dish on a pristine workbench and, using tweezers, select callus tissue that has naturally broken apart, grown vigorously, has a firm texture, is pale yellow, and has a particle size of approximately 3 mm. Place these tissues in NB medium containing 2.0 mg / L of 2,4-D and 0.5 mg / L of 6-BA (pH 5.8). Place 10 callus tissues in each dish and culture in the dark at 30°C. If the callus tissue becomes severely softened, it is recommended to move it to light for subculturing. The subculturing period is approximately 10-15 days (depending on the growth of the callus tissue, the next subculturing time should be determined), and a total of two subculturings should be performed. Note: If a large amount of water adheres to the lid during the culture process in the petri dish, it is improper and may lead to poor culture. This is because the bottom of the petri dish is heated, while the temperature of the lid is lower than medium temperature, causing water vapor to condense on the lid of the petri dish.

[0104] 2. Culturing Agrobacterium Experimental group: A vector containing the induction medium and the hygromycin resistance gene hygromycin was transferred to a parasitic bacterium. For example, the pCAMBIA1307 vector containing the induction medium and the hygromycin resistance gene hygromycin was transferred to Agrobacterium LBA4404 and inoculated into YEP solid medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0105] Control group: A vector containing the hygromycin resistance gene was introduced into the parasitic bacteria. For example, the pCAMBIA1307 vector containing the hygromycin resistance gene was introduced into Agrobacterium LBA4404 and inoculated into YEP solid medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0106] After culturing the control and experimental groups at 28°C for 2 days, Agrobacterium monoclonal colonies were selected and colony PCR was performed to confirm whether the induction medium had been transferred to Agrobacterium. Positive monoclonal colonies were selected and cultured in 4 ml of YEP medium (containing 50 mg / L Kan and 20 mg / L Rif) at 28°C, shaking at 220 rpm for 20–36 hours until the bacterial suspension reached an OD600 of 0.8–1.0.

[0107] 3. Infection and co-culture 1) The prepared Agrobacterium suspensions (separate control and experimental groups) were centrifuged at 4°C at 4000 rpm for 10 minutes, and the supernatant was removed. A suspension was prepared using AAM medium containing 100 umol / L acetosyringone, and the final concentration of the bacterial suspension was adjusted to an OD600 of approximately 0.2.

[0108] 2) Collect rice callus that has grown to a certain size and place it in an Agrobacterium suspension for 20-30 minutes for infection.

[0109] 3) Remove the callus and place it on sterile filter paper for 20-30 minutes to drain the fluid, preventing excessive growth of Agrobacterium during co-culture and avoiding excessive damage to the callus.

[0110] 4) Place the callus tissue in NB medium containing 2.0 mg / L of 2,4-D and 100 umol / L of acetosyringone (pH 5.2), and incubate in the dark at 25°C for 48-72 hours. Note: Co-cultures require follow-up and observation. If Agrobacterium is detected, it indicates an over-infection and may lead to bacterial growth during subsequent screening.

[0111] 4. Screening for callus resistance Remove the callus tissue, wash it 5-6 times with sterile water, and shake it continuously throughout the process. Next, place the callus tissue on sterile filter paper and air dry it. Distribute it evenly onto NB medium containing 50 mg / L hygromycin (pH 5.8) for the first round of selection screening. Incubate in the dark at 28°C, and if growth of fungi or Agrobacterium is observed, immediately transfer the infected callus tissue to a new selection plate.

[0112] After approximately 30 days of screening, if new callus tissue has grown, transfer it to fresh NB medium containing 50 mg / L hygromycin (pH 5.8) and screen it for a further 7-10 days. If significant growth is observed, it is considered positive callus tissue; however, if no growth occurs, or if browning or death is not observed, it may still be a false positive.

[0113] 5. Induction, differentiation, and rooting of positive callus The actively growing yellow callus granules obtained in the second selection (to ensure that the callus tissue used for differentiation is free of defects) are placed on NB medium (pH 5.8) containing 2.0 mg / L 6-BA, 0.5 mg / L kinetin, and 50 mg / L hygromycin. A small amount of callus tissue is used for each clone, with 2-3 positive clones per bottle, and a small amount of callus tissue placed for each clone. The callus tissue used should be of high quality, regardless of the quantity. After culturing in the dark at 27°C for 10 days, light-induced differentiation is performed for 10-20 days until green leaves appear, and then rooting is allowed to proceed. The light intensity should be 4000 lux, 14 h / d.

[0114] Each healthy seedling differentiated from the clone is placed in 1 / 2N6 medium (pH 5.8) containing 0.5 mg / L naphthaleneacetic acid and 50 mg / L hygromycin, and rooting is induced using 2-3 seedlings per plant. The plants are cultured at 27-30°C with 4000 lux and 14 h / d of light. After 7-10 days, the sealed film is opened and an appropriate amount of sterile water is added. Transplanting takes place after 2-3 days. Note: Callus should not be subcultured during the differentiation process. The time from differentiation of the intermediate plant to transplantation is approximately 3 months.

[0115] 6. Acclimatization and transplantation of intermediate plants Select seedlings of intermediate plants with well-differentiated roots, stems, and leaves (if they grow to the top of the test tube, open the cover promptly), open the sealing film, add an appropriate amount of distilled water or sterile water (to prevent bacteria from growing in the culture medium), acclimate for about 3 days to 1 week, wash off the agar, transplant into soil pots in a greenhouse, grow them, and test them to obtain intermediate plants.

[0116] 7. Verification of intermediate plant trials 1) PCR test: Design the induction medium primers as follows: FTO-F: ATGAAGCGCACCCCGACTG, FTO-R: GGGTTTTGCTTCCAGAAGCTGA. The PCR reaction program is 5 minutes at 95°C, 15 seconds at 95°C, 15 seconds at 58°C, 30 seconds at 72°C, 35 cycles, extension at 72°C for 30 seconds, 10 minutes at 72°C, and storage at 4°C. After the reaction is complete, analyze the PCR product by 1% agarose gel electrophoresis.

[0117] 2) Rapid selection method for intermediate plants under hygromycin treatment: Fresh green leaves approximately 1 cm long were cut and collected from the seedlings to be tested (incisions made at both ends), and placed flat on a detection medium (0.7 agar, 1 ml / L 6-BA, 50 mg / L hygromycin) at 28°C, with a light / dark cycle of 16 h / 8 h for 48 hours. Leaves that remained fresh and green indicated positive plants, while negative seedlings showed patchy necrosis on the leaves.

[0118] 8. Evaluation of the effects of induction media in intermediate plants The following data are obtained based on intermediate plants of the experimental and control groups during the maturation stage. The measured data refer to the aforementioned content, which is used to calculate the percentage increase in yield X of the different plants compared to the yield of the control plants. Yield is calculated based on the harvested products or roots of the different plants, including but not limited to roots, stems, leaves, flowers, fruits, and seeds.

[0119] In this invention, the yield of the control group plants refers to the yield of initial plants without the introduction of the induction medium, and Y represents the percentage increase or enhancement of various traits based on the initial plants. The aforementioned data are in terms of dry weight, and specifically, are obtained by oven-drying the initial plants at 105°C for 20 minutes, then oven-drying them at 80°C for 20 hours, and finally weighing them.

[0120] The following data is based on a single variable (i.e., introduction of the induction medium sequence - experimental group, or non-introduction of the induction medium sequence - control group), while other factors influencing plant yield and root growth, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, and cultivation time cycles, are artificially standardized and identical, and all substances or components used can be obtained through commercial purchase.

[0121] 9. Obtaining genetically improved target plants without induction media. 1) Obtained from intermediate plants. In plants that heterozygously overexpress the inducer, when cells undergo meiosis to form gametes, the inducer segregates along with homologous chromosomes and enters one of the gametes. After self-fertilization, the inducer is independently inherited by offspring via gametes, resulting in gene segregation, which produces offspring that do not contain the inducer and offspring that overexpress it. By PCR detection of genomic DNA, plants that do not contain the inducer and hygromycin genes in their genome can be selected and obtained. These plants that do not contain the inducer and hygromycin genes are cultivated, and the optimized traits are evaluated through at least two experiments to select target plants with the optimized traits. Finally, target plants with optimized traits that do not contain the inducer and hygromycin genes in their genome are obtained.

[0122] 2) Obtained from hybridization and isolation of intermediate plants and wild types. Crop crossbreeding involves a fertilization process in which the pistil of one variety receives pollen from another variety, resulting in hybrid seeds. For example, rice is a self-pollinating crop that has both male and female reproductive organs on the same flower. It is achieved by removing the male reproductive organs from the T3 generation of a pure line strain that overexpresses the inducer, followed by artificial pollination with wild-type rice pollen, to obtain hybrid seeds. The hybrid seeds are intermediate plants that have heterozygous overexpression of the inducer. Self-pollination results in gene segregation, yielding offspring that do not contain the inducer type and offspring that do. Screening can be performed using PCR detection of genomic DNA to select rice that does not contain the inducer and hygromycin genes. These plants that do not contain the inducer and hygromycin genes are cultivated and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are selected, and finally, target plants with optimized traits that do not contain the inducer and hygromycin genes in their genome are obtained.

[0123] 3) Acquisition through natural loss during the generational succession process of intermediate plants. During crop and seed reproduction, meiosis occurs to form germ cells, and fertilization is completed through the combination of sperm (pollen) and egg to form a zygote, which develops into a seed. This process increases species diversity and promotes the evolution of species genotypes. During the continuous reproduction of seed plants, introduced exogenous genes may be naturally lost. When exogenous genes are lost, target plants with optimized traits that do not contain the inducer are obtained. In the continuous inheritance process of inducer-overexpressing strains, the loss of exogenous genes in the genome has been found by PCR detection of genomic DNA of successive generations, meaning that the inducer and hygromycin genes cannot be detected. Based on existing experience, the loss of exogenous genes can be observed in the T2 generation. These plants, which do not contain the inducer and hygromycin genes, will be cultured and their optimized traits will be evaluated through at least two experiments, and the optimized traits will be evaluated through at least two experiments to select target plants with optimized traits. Ultimately, target plants with optimized traits are obtained, which do not contain induction media or hygromycin genes in their genomes.

[0124] Note: PCR detection method for genomic DNA: Gene primers are designed as follows: FTO-F:AGGAAGTTCATTTCATTTGGAGAGGAC, FTO-R:GGGTTTTGCTTCCAGAAGCTGA. The PCR reaction program is 35 cycles of 5 minutes at 95°C, 15 seconds at 95°C, 120 seconds at 60°C, and 30 seconds at 72°C, followed by 10 minutes of extension at 72°C and storage at 4°C. After the reaction is complete, the PCR product is analyzed by 1% agarose gel electrophoresis.

[0125] Design the hygromycin gene primers as follows: Hyg-F:CTTCTACACAGCCATCGGTC, Hyg-R:ACAATCCCACTATCCTTCGC. The PCR reaction program consists of 35 cycles of 5 minutes at 95°C, 15 seconds at 95°C, 120 seconds at 55°C, and 30 seconds at 72°C, followed by 10 minutes of extension at 72°C and storage at 4°C. After the reaction is complete, analyze the PCR product by 1% agarose gel electrophoresis.

[0126] The specific implementation method is as follows: I. Plant DNA extraction method Kit name: DNAquick Plant System (Rapid Plant Genomic DNA Extraction System) Brand: TIANGEN 1. Handling of materials: Take 100 mg of fresh plant tissue and place it in a 2 ml test tube containing steel beads, or place 10 mg in a well of a 96-well plate (if using a 96-well plate, halve the extract solution). Store in a -80°C freezer for at least 30 minutes. Shake in a grinder for 1 minute, add 400 μl of buffer FP1 and 6 μl of RNase A (10 mg / ml), vortex for 1 minute, and stand at room temperature for 10 minutes. Note: Due to the great diversity of plant materials, the optimal amount of experimental material should be determined based on differences in material or different tissues of the same material. 2. Add 130 µl of buffer solution FP2, mix thoroughly, and vortex for 1 minute. 3. Centrifuge at 12,000 rpm (~13,400 x g) for 5 minutes, then transfer the supernatant to a new centrifuge tube. 4. Optional step: Centrifuge the supernatant again at 12,000 rpm (~13,400 x g) for 5 minutes, then transfer the supernatant to a new centrifuge tube. Note: The purpose of this step is to remove precipitated impurities from the supernatant, thereby increasing the purity of the extracted genomic DNA. 5.0.7 times the volume of isopropanol is added to the supernatant and mixed thoroughly until aggregated genomic DNA appears. (For example, add 350 ul of isopropanol to 500 ul of supernatant), centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, discard the supernatant, and retain the precipitate. Add 600 µl of 6.70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and discard the supernatant. 7. Repeat step 6. 8. Open the lid, turn the container upside down, and let it air dry completely at room temperature for 5-10 minutes to remove any residual ethanol. Note: Ethanol residue may affect subsequent enzymatic reactions (enzyme digestion, PCR, etc.). 9. Add 200 µl of elution buffer TE, dissolve the DNA in a 65°C water bath for 10-60 minutes, invert and mix several times to aid dissolution, and finally obtain the DNA solution.

[0127] II. PCR reaction 1. Reagents Specific primer: FTO primer PCR Enzyme Mixture: New Blue Dye High Fidelity Taq Enzyme Mixture, Brand: Juhe Mei Primers: FTO Primer, Forward Primer FTO-F, Reverse Primer FTO-R 2. Setting up the reaction system Add each component sequentially to a 0.2 ml centrifuge tube or PCR plate well. Reagent final concentration Forward primer 0.5 ul Reverse primer 0.5ul plant DNA 3ul PCR enzyme mixture 10ul ddH2O 6ul 3. After amplification is complete at the set time and temperature shown below, identification is performed by electrophoresis. After pre-denaturation at 95°C for 3 minutes, proceed to the cycle amplification stage: cycle 30-35 times at 95°C for 30 seconds, then at 58°C for 30 seconds, then at 72°C for 20 seconds, and maintain at 72°C for 5 minutes.

[0128] III. Agarose Nucleic Acid Electrophoresis 1. Wash the apparatus used for electrophoresis with distilled water and set up the comb. 2. Prepare a 1.5% agarose gel of the appropriate concentration. Accurately weigh 1.5 g of agarose, place it in an Erlenmeyer flask, and add approximately 100 ml of electrophoresis buffer (TAE). 3. After heating and melting in a microwave oven, let it cool for a while, then add 10 μl of dye (10000X), mix well, and pour into an electrophoresis tank. 4. Allow to solidify at room temperature for approximately 40 minutes. Carefully remove the comb, place the gel in the electrophoresis tank, and prepare for sample loading. 5. Add enough electrophoresis buffer to the electrophoresis tank to cover the surface of the gel, and ensure that there are no air bubbles in the sample wells. 6. Prepare the sample before loading (using 8 tube strips), add 5 μl of the sample and the marker, and slowly inject the mixed sample into the loading well using a pipette, ensuring there is no cross-infection between the wells. 7. Connect the power supply according to the positive and negative terminals (red +, black -), and perform electrophoresis at a voltage of 40-60V for 30-40 minutes. The end of electrophoresis can be determined based on the position of the bromophenol blue. 8. After electrophoresis is complete, turn off the power, perform gel imaging observation, and measure the fragment size by comparing it with the marker.

[0129] IV. Test results: As shown in the electrophoresis diagram in Figure 2, the presence of a band indicates the presence of the FTO gene, while the absence of a band indicates that the sample does not contain the FTO gene.

[0130] 10. Evaluation of target plant traits The following data are obtained based on the target plants of the experimental and control groups at the maturation stage. The measured data are expressed as Y, representing the percentage increase in yield of each plant relative to the yield of the control group plants, based on the above. Yields are calculated based on the harvested products or root systems of different plants, such as roots, stems, leaves, flowers, fruits, and seeds.

[0131] In this invention, the yield of the control group plants refers to the yield of initial plants without the introduction of the induction medium, and Y represents the percentage increase or enhancement of various traits based on the initial plants. The aforementioned data are in terms of dry weight, and specifically, are obtained by oven-drying the initial plants at 105°C for 20 minutes, then oven-drying them at 80°C for 20 hours, and finally weighing them.

[0132] The following data is based on a single variable (i.e., introduction of the induction medium sequence - experimental group, or non-introduction of the induction medium sequence - control group), while other factors influencing plant yield and root growth, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, and cultivation time cycles, are artificially standardized and identical, and all substances or components used can be obtained through commercial purchase.

[0133] Embodiment 2 employs a nucleic acid molecule or polypeptide as the induction medium. The specific sequence may be the same sequence as those listed in Sequence IDs 1-8 or 12-15 of the sequence listing, or it may be a homologous sequence with equivalent function, or a variant / complex with equivalent function. The induction medium may be derived from vertebrates or algae.

[0134] The solution used in Embodiment 2 can be specifically exemplified as follows. 1. Composition of YEP liquid medium for Agrobacterium growth (per liter): Solid medium with 10 g / L yeast extract + 10 g / L peptone + 5 g / L NaCl, pH 7.2, and 15 g / L agar added. 2. Agrobacterium resuspension solution AAM culture medium: 50 ml of 20×AA macronutrients, 10 ml of 100×FeEDTA, 10 ml of 100×B5 macronutrients, 10 ml of 100×B5 vitamins, 100 ml of 10×AA amino acids, 1 ml of 100 mM acetosyringone, 68.5 g of sucrose, 36 g of glucose, 0.5 g of hydrolyzed casein. The volume is adjusted to 1000 ml, the pH is adjusted to 5.2, and the solution is sterilized by passing it through a 0.22 mm cellulose acetate membrane. 3.20×AA Main elements: 59g KCl, 3g CaCl2·2H2O, 10g MgSO4·7H2O, and 3g NaH2PO4·H2O, distilled water, final volume 1L, store at 4℃. 4.10×AA amino acids: Dilute 8.76g of Gin, 2.66g of Asp, 1.74g of Arg, and 75mg of Gly in 1L of distilled water, sterilize by passing through a 0.22mm cellulose acetate membrane, and store at 4°C. 5.100×B5 Vitamin: 10g inositol, 1g thiamine hydrochloride, 100mg pyridoxine hydrochloride, and 100mg niacin distilled water, final volume 1L, store at 4℃. 6.100×B5 Main elements: 1,320 mg MnSO4·4H2O, 200 mg ZnSO4·7H2O, 2.5 mg CuSO4·5H2O, 25 mg Na2MoO4·2H2O, 2.5 mg CoCl2·6H2O, 300 mg H3BO3, and 75 mg KI. Dilute to 1 L with distilled water and store at 4°C. 7. NB medium: N6 medium macronutrients and micronutrients, B5 medium organic elements, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 30 g / L sucrose, 8 g / L agar.

[0135] [Embodiment 3] A method for obtaining intermediate plants through Agrobacterium-borne infection of shoot apical tissue, and a method for selecting target plants in the offspring.

[0136] 1. Mature plant embryos are used as experimental material to induce callus tissue. Soak mature seeds in clean water, changing the water every 1-2 hours. After 2 days, the seeds will begin to divide, and when the white embryo is exposed, they will germinate and root at 37°C. When the embryo has grown to 1.5-2.0 cm, use a scalpel to remove the embryo and cotyledon sheath from the shoot apex and stem whorl, exposing the shoot apical meristem.

[0137] 2. Cultivation of Agrobacterium (same as step 2 of Embodiment 2)

[0138] 3. Infection and co-culture Place the treated plants in an AAM resuspension (see step 3 of Embodiment 2), add 200 l / L of the surfactant Silwet L-77, vacuum at 1.5 kPa for 8 minutes, discard the resuspension, and place on clean, moist perlite. Cultivate in the dark at 28°C for 3 days.

[0139] 4. Selection, transplantation, and management of intermediate plants After culturing in the dark, the plants are transferred to a plant seedbed. At the 3-4 leaf stage, leaves are collected from the transformed plants for PCR detection and identification of the transformed seedlings. Transformed plants: Design gene primers are, for example, FTO-F:ATGAAGCGCACCCCGACTG, FTO-R:GGGTTTTGCTTCCAGAAGCTGA. The PCR reaction program is 35 cycles of 5 minutes at 95°C, 15 seconds at 95°C, 15 seconds at 58°C, 30 seconds at 72°C, extension at 72°C for 10 minutes, and storage at 4°C. After the reaction is complete, the PCR product is analyzed using 1% agarose gel electrophoresis. After 7 days, the surviving plants are transplanted to a transgenic plant demonstration platform greenhouse and regularly fertilized and watered. Seeds are harvested from the transformed seedlings.

[0140] 5. Evaluation of the traits of the intermediate plant (same as step 8 of Embodiment 2)

[0141] 6. Obtaining genetically improved target plants without induction media. The collected transgenic seedlings can undergo genetic segregation, yielding offspring that do not contain the inducer and offspring that overexpress the inducer. Plants that do not contain the inducer and the hygromycin gene can be selected and obtained by PCR detection of genomic DNA (same as in Embodiment 2, step 9). These plants that do not contain the inducer and the hygromycin gene are then cultivated and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are selected, and finally, target plants with optimized traits that do not contain the inducer and the hygromycin gene in their genome are obtained.

[0142] The harvested transgenic seedlings may naturally lose the induction medium. These plants, which do not contain the induction medium and hygromycin gene (determined by PCR detection of genomic DNA in the same manner as in step 9 of Embodiment 2), are planted and evaluated for the optimized trait through at least two experiments. Target plants with the optimized trait are selected, and finally, target plants with the optimized trait that do not contain the induction medium and hygromycin gene in their genome are obtained.

[0143] 7. Evaluation of target plant traits (same as step 10 of Embodiment 2)

[0144] [Embodiment 4] A method for obtaining intermediate plants by Agrobacterium-borne infection and induction of callus formation, and then selecting target plants from the offspring (this method can be applied to any living plant to directly obtain target plants by inducing callus formation).

[0145] 1. Plant cultivation Plants mature their seeds in nutrient-rich soil and mature in a greenhouse environment at 24°C with 16 hours of light and 8 hours of darkness (approximately 63-66 days).

[0146] 2. Culturing Agrobacterium DR (Growth Regulatory Elements) are a type of growth regulatory element that induces the formation of meristematic tissue in plants. Commonly used examples include BBM, ipt, ΔMP, STM, and Wus2.

[0147] Experimental group: Agrobacterium GV3101 was transferred to an induction medium, a vector containing the hygromycin resistance gene hygromycin, and a vector containing DR. After incubation overnight in growth medium (10 mM MES, pH 5.6, 20 μM acetosyringone, 50 mg / L kanamycin, 50 mg / L gentamicin) at 28°C for 12 hours, the bacteria were collected by centrifugation at 5000 rpm for 10 minutes and resuspended in infiltration medium (10 mM MES, 150 μM acetosyringone, 10 mM MgCl2) to achieve an OD600 value of 0.2–0.3. Before inoculation, the Agrobacterium-borne infection solution was incubated at room temperature (approximately 25°C) for 2–4 hours.

[0148] Control group: Vectors containing the hygromycin resistance genes hygromycin and DR were cultured overnight in Agrobacterium GV3101 at 28°C for 12 hours in growth medium (10 mM MES, pH 5.6, 20 μM acetosyringone, 50 mg / L kanamycin, 50 mg / L gentamicin), then centrifuged at 5000 rpm for 10 minutes to collect bacterial cells, which were resuspended in infiltration medium (10 mM MES, 150 μM acetosyringone, 10 mM MgCl2) to achieve an OD600 value of 0.2–0.3. Before inoculation, the Agrobacterium-borne infection solution was incubated at room temperature (approximately 25°C) for 2–4 hours.

[0149] 3. Infection and screening of intermediate plants Remove all visible meristematic tissue from the plants, leaving 2-3 nodes and supporting leaves. Immediately inoculate the wound site with an Agrobacterium-borne infection solution using a syringe and a 31G needle. Observe bud formation at the cut site of the plant 38-48 days after inoculation. Each injection site with newly formed tissue or meristematic tissue is counted as a single event. Genomic PCR identification is performed for the appearance of shoot tissue (see step 7 of Embodiment 2) as an indicator of the presence and expression of the transgene.

[0150] 4. Transplanting and management of intermediate plants After cutting the newly developed shoot tissue and transferring it to a rooting medium to form complete seedlings, the surviving plants are transplanted to a greenhouse for normal fertilization and watering. Seeds are harvested from the transformed seedlings.

[0151] 5. Evaluation of the traits of the intermediate plant (same as step 8 of Embodiment 2)

[0152] 6. Obtaining target plants with optimized traits that do not contain induction media. The transgenic seedlings collected can undergo genetic segregation, resulting in offspring that do not contain the inducer and offspring that overexpress the inducer. Screening is performed by PCR detection of genomic DNA to obtain plants that do not contain the inducer or hygromycin gene in their genome. These plants, which do not contain the inducer or hygromycin gene, are then cultured and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are selected, and finally, target plants with optimized traits that do not contain the inducer or hygromycin gene in their genome are obtained.

[0153] Harvested transgenic seedlings may naturally lose the inducing medium. These plants, lacking the inducing medium and the hygromycin gene, are cultivated and evaluated for their optimized traits through at least two experiments. Target plants with the optimized traits are then selected, and finally, target plants with the optimized traits that do not contain the inducing medium and the hygromycin gene in their genome are obtained.

[0154] 7. Evaluation of target plant traits (same as step 10 of Embodiment 2)

[0155] [Embodiment 5] Method for obtaining target plants by mechanical inoculation via PVX vector 1. Plant cultivation Plants mature their seeds in nutrient-rich soil and mature in a greenhouse environment at 24°C with 16 hours of light and 8 hours of darkness (approximately 63-66 days).

[0156] 2. Culturing Agrobacterium Experimental group: The vector pPZPVX containing the inducing medium was transferred to Agrobacterium C58C1, cultured in Luria broth medium, and the bacterial cells were harvested and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 value of 0.2–0.3. Before inoculation, the Agrobacterium-borne infection solution was incubated at room temperature (approximately 25°C) for 2–4 hours. Control group: The vector pPZPVX, without the induction medium, was transferred to Agrobacterium C58C1, cultured in Luria broth medium, and the bacterial cells were harvested and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 value of 0.2–0.3. Prior to inoculation, the Agrobacterium-borne infection solution was incubated at room temperature (approximately 25°C) for 2–4 hours.

[0157] 3. Infection and screening of intermediate plants Agrobacterium containing a plasmid expressing the inducer is injected into tobacco leaves using a syringe. After 7 days, the inoculated leaves are homogenized in 10 mM NaPi buffer (pH 7.0) (expression of the inducer is confirmed by Western blotting). After homogenization, the mixture is centrifuged at 16,000 g for 3 minutes, and the supernatant is filtered using a 0.45 μm filter. The filtered supernatant is spread on the fourth or fifth true leaf together with carborundum (600 mesh), and PVX is mechanically inoculated by gently rubbing it by hand. After inoculation, the plants are grown at 16°C under a 16-hour light / 8-hour dark cycle, and new shoot formation is observed at the inoculation site after 7-8 days.

[0158] Note: Western blot detection of inducer media expression: Mix post-infection powdered leaf tissue with 1× loading buffer, heat at 95°C for 10 minutes, centrifuge at 15,000 rpm for 10 minutes at room temperature, and collect the supernatant. Load onto 10% SDS-PAGE, transfer to membrane after electrophoresis, block, and detect inducer media expression using inducer media antibody.

[0159] 4. Transplanting and management of intermediate plants After cutting the newly developed shoot tissue and transferring it to a rooting medium to form complete seedlings, the surviving plants are transplanted to a greenhouse for normal fertilization and watering. Seeds are harvested from the transformed seedlings.

[0160] 5. Evaluation of the traits of the intermediate plant (same as step 8 of Embodiment 2)

[0161] 6. Obtaining target plants with optimized traits that do not contain induction media. The collected transgenic seedlings are free of the induction medium and can be identified by PCR testing of genomic DNA. These plants, free of the induction medium, are cultivated and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are selected, and finally, target plants with optimized traits that do not contain the induction medium or hygromycin gene in their genome are obtained.

[0162] 7. Evaluation of target plant traits (same as step 10 of Embodiment 2)

[0163] [Embodiment 6] Method for obtaining target plants using haploid-induced editing (HI-Edit) technology Haploid induction technology (HI) induces haploidy through appropriate modification of centromere histone H3 or knockout of matrilineal cells, followed by chromosome duplication, thereby rapidly obtaining homozygous candidate substances and fixing the genotype of crops, which is important in crop breeding practices. Haploid induction editing technology (HI-Edit) combines haploid induction cultivation with gene editing technology, freeing it from the limitations of existing gene editing systems imposed by species and genotype, and enabling direct improvement of a wide range of plants, including commercial varieties, in a short time. Since the donor chromosomes containing the gene editing elements introduced through haploid induction lines are removed during the crossing process, the resulting hybrids do not contain genetic information derived from the paternal parent, thereby eliminating the need for multiple backcrosses. Optimized diploid lines can be obtained by simply doubling the chromosomes of the target haploid plant, shortening the cultivation cycle. It can improve target crops through distant crosses, has broad applicability, and allows for the acquisition of lines that do not contain introduced genes.

[0164] 1. Construct an induction medium vector and introduce it into the non-haploid induction inbred line NP2222 to obtain stable transgenic plants. Immature embryos at 9 days old, isolated from the self-mating line NP2222, were mixed with Agrobacterium strain LBA4404 containing an induction medium vector (experimental group) or Agrobacterium strain LBA4404 containing a vector without an induction medium (control group). Infected embryos were cultured in recovery medium and callus induction medium. Callus was selected on a medium containing mannose, and resistant callus was regenerated into intermediate plants to obtain stable transgenic plants.

[0165] 2. Evaluation of the traits of the intermediate plant (same as step 8 of Embodiment 2)

[0166] 3. Select intermediate plants containing the induction medium, cross them with the natural haploid induction line RWKS, and select individuals containing both the induction medium and the homozygous matl protecton. The naturally occurring haploid-inducing strain RWKS contains the haploid-inducing factor matl allele and the R1 color marker. When RWKS is crossed with a plant line containing the inducing medium, the offspring exhibit phenoseilysis. Hybrid offspring containing the inducing medium, the haploid-inducing matl allele from RWKS, and the R1 color marker are selected and self-pollinated. From the F2 generation, individuals containing the inducing medium and the homozygous matl mutation are selected.

[0167] 4. Screening and acquisition of target plants F2 plants homozygous for mat1 and the inducer are re-crossed with various inbred plant lines, and haploid plants with genotype MATL that do not contain the inducer are selected using RWKS's unique grain-color marker. Target plants are collected by embryo rescue. Harvested modified plants that do not contain the inducer can be identified by PCR detection of genomic DNA. These inducer-free plants are planted, and the optimized traits are evaluated through at least two experiments to select target plants with optimized traits. Finally, target plants with optimized traits that do not contain the inducer or hygromycin gene in their genome are obtained.

[0168] 5. Evaluation of target plant traits (same as step 10 of Embodiment 2)

[0169] Embodiments 2 to 6 described above all involve obtaining a target plant via an intermediate plant and measuring the degree of trait optimization. The table data below is presented using data from Embodiment 2, and the data from the other embodiments differ from the data from Embodiment 2 by ±5% or less. Therefore, further details are not provided here. [Table 5]

[0170] Table 5 above shows that the human FTO polypeptide sequence listed as Sequence ID No. 1 in the sequence listing, or DNA for expressing the polypeptide sequence, its homologous sequence with equivalent function, or its variant / zygote with equivalent function may be used. [Table 6]

[0171] Table 6 above allows the use of the porcine FTO polypeptide sequence listed as Sequence ID No. 2 in the sequence listing, or DNA for expressing the polypeptide sequence, its homologous sequence with equivalent function, or its mutant / zygote with equivalent function.

[0172] [Table 7]

[0173] Table 7 above shows that the bovine FTO polypeptide sequence listed as Sequence ID No. 3 in the sequence listing, or DNA for expressing the polypeptide sequence, its homologous sequence with equivalent function, or its mutant / zygote with equivalent function may be used.

[0174] [Table 8]

[0175] Table 8 above shows that the Chlamydomonas reinhardtii FTO polypeptide sequence listed in Sequence ID No. 4 of the sequence listing, or DNA for expressing the polypeptide sequence, its homologous sequence with equivalent function, or its mutant / zygote with equivalent function can be used.

[0176] [Table 9]

[0177] Table 9 above shows that DNA can be used to express various algal and invertebrate sequences, or sequences SEQ ID NOs. 5-15 in the sequence listing, their homologous sequences with equivalent function, or their variants / complexes with equivalent function.

[0178] The above are merely preferred embodiments of the present invention. The embodiments described above are not intended to limit the present invention. The scope of protection of the present invention shall be defined by the claims. Those skilled in the art can make several improvements and modifications without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A plant cultivation method characterized by introducing an induction medium into an initial plant and cultivating it to obtain a target plant that does not contain the induction medium and exhibits optimized traits compared to the initial plant, A method for cultivating plants, wherein the induction medium can induce demethylation of 6-methylated bases in plant RNA.

2. The plant cultivation method according to claim 1, characterized in that the target plant has at least one trait optimized compared to the initial plant, and the degree of optimization is Y.

3. The plant cultivation method according to claim 1, characterized by temporarily introducing an induction medium into the initial plant and directly obtaining a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.

4. The plant cultivation method according to claim 1, characterized in that the induction medium is temporarily introduced into the protoplast of the initial plant.

5. The plant cultivation method according to claim 1, characterized by introducing an induction medium into the initial plant to obtain an intermediate plant, and using the intermediate plant for offspring cultivation to obtain a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.

6. The plant cultivation method according to claim 5, characterized in that the intermediate plant contains an induction medium.

7. The plant cultivation method according to claim 5, characterized in that the target plant has at least one trait optimized compared to the initial plant, and the degree of optimization is Y.

8. The plant cultivation method according to claim 7, characterized in that the intermediate plant has at least one trait optimized compared to the initial plant, and the degree of optimization is X.

9. The plant cultivation method according to any one of claims 2 or 7, wherein Y is the rate of increase compared to the initial plant at the same time, and Y ≥ 0.20; Y ≥ 0.50; Y ≥ 1.00, preferably Y ≥ 2.00, preferably Y ≥ 3.00, and preferably Y ≥ 4.

00.

10. The plant cultivation method according to claim 1, characterized in that the optimization of the aforementioned traits includes an increase in yield.

11. The plant cultivation method according to claim 1, characterized in that the optimization of the aforementioned traits includes increasing the yield of plant organs.

12. The method for cultivating plants according to claim 1, characterized in that the optimization of the traits includes at least one increase in the volume, number, weight, or tillering number of plant organs.

13. The plant cultivation method according to claim 1, characterized in that the induction medium can induce the demethylation of 6-methyladenine in plant RNA.

14. The plant cultivation method according to claim 1, characterized in that the induction medium is introduced in an excessive amount to the initial plant.

15. The plant cultivation method according to claim 1, characterized in that the induction medium is a nucleic acid molecule and / or polypeptide, its homolog, its functional variant or complex.

16. The method for cultivating plants according to claim 1, characterized in that, when the induction medium is a nucleic acid molecule, its homolog, its functional mutant, or a complex thereof, the target plant does not contain the induction medium, nor does it contain a polypeptide obtained from the expression of the induction medium, and when the induction medium is a polypeptide, its homolog, its functional mutant, or a complex thereof, the target plant does not contain the induction medium.

17. The plant cultivation method according to claim 1, characterized in that the induction medium is selected from RNA m6A demethylase and the nucleic acid encoding it.

18. The plant cultivation method according to claim 1, characterized in that the induction medium is selected from at least one of FTO nucleic acid molecules and / or polypeptides, their homologs, their functional variants, or complexes.

19. The plant cultivation method according to claim 1, characterized in that the FTO in the induction medium is derived from vertebrates, invertebrates, algae, their orthologs, or their paralogs.

20. The plant cultivation method according to claim 1, characterized in that the induction medium is one of those shown in sequence numbers 1 to 15 of the sequence listing.

21. The method for cultivating plants according to claim 1, wherein the initial plant is selected from at least one of food crops, fodder crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops, preferably selected from at least one of rapeseed, tomato, lettuce, and beet, or preferably selected from at least one of rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, and cassava, or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, camelina, nut edible, cannabis, and poplar.

22. The plant cultivation method according to claim 1, characterized in that the initial plant subjected to the introduction process includes at least one of a plant organ, plant tissue, and plant cell.

23. The plant cultivation method according to claim 1, characterized in that the initial plant to be subjected to introduction treatment is selected from meristematic tissue.

24. The plant cultivation method according to claim 1, characterized in that an induction medium is introduced into at least one of the nucleus and cytoplasm of the initial plant.

25. The plant cultivation method according to claim 1, characterized in that the introduction method includes introducing a vector having an induction medium into the initial plant.

26. The plant cultivation method according to claim 1, characterized in that the method for cultivating offspring includes at least one of natural genetic screening removal, hybrid genetic screening removal, and active removal.

27. Use of the plant cultivation method according to claim 1 for the production of plants having optimized traits and free from induction media.

28. A product obtained by subjecting a target plant obtained by the plant cultivation method described in claim 1 to an inactivation treatment.