Mesodermal vascular bud cell composition

Abstract

There is a significant clinical need for improved therapeutic approaches to manage DMD and related muscular dystrophy disorders. [Solution] A mesodermal angioblast composition is disclosed, wherein the mesodermal angioblasts (MABs) are engineered to express a truncated agrin protein.

Description

[Technical Field]

[0001] The present invention generally relates to ex vivo gene therapy, and more particularly to compositions comprising genetically modified mesodermal angioblasts, methods for producing the same, and their use in the treatment of muscular dystrophy disorders, including Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). [Background technology]

[0002] Muscular dystrophy (MD) is a genetic disorder that affects skeletal muscle and often cardiac muscle. MD varies greatly in age of onset, severity, and the muscle groups predominantly affected. There is no effective treatment for any of the conditions, and steroids are the only treatment that can slow disease progression, although they come with severe side effects.

[0003] Duchenne muscular dystrophy (DMD) is one of the most common and severe forms of muscular dystrophy, affecting approximately 1 in 4,000 newborns. Duchenne muscular dystrophy is characterized by progressive atrophy of skeletal and cardiac muscle, leading to variable but progressive muscle weakness that limits the patient's ability to exercise and affecting cardiac and respiratory function later in life.

[0004] DMD is caused by various mutations in the dystrophin gene located on the X chromosome. In 90% of cases, the mutation results in a change in the mRNA leading frame, which prevents dystrophin protein production. Deletions within the frame result in a shorter but partially functional dystrophin, which is associated with milder Becker muscular dystrophy (BMD).

[0005] Proteins that associate with dystrophin and dystrophin-associated glycoprotein complexes (e.g., sarcoglycans) play a crucial role in the interaction with the basement membrane of muscle cells, providing elastic resistance to the stimuli sheath during contraction. In the absence of dystrophin and associated proteins, the membrane is more readily damaged, leading to calcium influx. This influx can be readily measured by dyes such as Fura2, which fluoresce upon binding to calcium ions. Depending on the duration of the influx, it may manifest as a spike or a more sustained increase in fluorescence. If left unregulated, calcium influx leads to hypercontracture, proteolysis, and fiber denaturation.

[0006] Following muscle fiber degeneration, regeneration occurs, albeit to a low degree, through satellite cells, resident myofibrillary stem cells / progenitor cells, and stromal cells such as pericytes. In humans, adult myofibrillaries limit their self-regeneration capacity, and in DMD, the continuous regeneration cycle eventually leads to depletion of the cell population. Muscle degeneration is accompanied by chronic inflammation that continuously generates a dense accumulation of connective tissue and adipose tissue that replaces the muscle fibers, and at this stage, no therapy becomes effective.

[0007] Dystrophin was cloned more than 30 years ago, but there is still no treatment for DMD. Many therapeutic approaches have been introduced into clinical practice, but none have yet achieved meaningful and lasting clinical efficacy. [Overview of the project] [Problems that the invention aims to solve]

[0008] Therefore, there is a significant clinical need for improved therapeutic approaches to treat DMD and related muscular dystrophy disorders. [Means for solving the problem]

[0009] The inventors found that mesodermal angioblasts (MABs) expressing truncated agrin protein block calcium spikes in vivo in a mouse model of muscular dystrophy. [Brief explanation of the drawing]

[0010] [Figure 1] This figure shows exon skipping mediated by cells induced by the lentiviral vector U7#51T2AGFP. A. RT-PCR analysis of transcripts from WT muscle (1), or DMD TIM cells (2), or DMD-GFP cells (3), or DMD-U7 cells (4). Note that the band corresponding to the shorter transcript (skipping exons 48-51) is detectable only in 4. GAPDH and MyHC are loading controls. B. Sequencing of cDNA from band C in Figure 1A(4), showing the predicted sequence of exons 47-52. C. FACS analysis of DMD TIM cells transduced with a vector expressing either GFP (T2AGFP) or U7 snRNA (U7#51T2AGFP). FACS analysis of a mixture of transduced and untransduced cells (1:10 or 1:30). D. Dual IF with antibodies against dystrophin (red) and GFP (green) in differentiated DMD-U7 cells co-cultured with 10 or 30-fold excess DMD TIM cells. Note the expression of dystrophin in substantially all myotubes at a 1:10 dilution and in most myotubes at a 1:30 dilution. DAPI stains the nuclei blue. E. qRT-PCR to analyze the expression of dystrophin and GFP in differentiated DMD-U7 cells co-cultured with 10 or 30-fold excess DMD TIM cells. Note the predicted stepwise decrease in GFP (green bars) expression at 1:10 and 1:30 dilutions. In contrast, dystrophin expression (blue bars) is significantly above the predicted value. MyHC (red bars) expression is also reported as an internal control (*P<0.05; **P<0.01). [Figure 2]This figure shows the intracellular diffusion of snRNA and dystrophin protein expression. A. Double in-situ hybridization of differentiated DMD-U7 cells with a 30-fold excess of DMD TIM cells. GFP mRNA appears in green and is localized around a few (transduced) nuclei (green arrows), while U7 snRNA (red dots) diffuses across the cytoplasm of multinucleated myotubes (red arrows). B. WB analysis of protein extracts from differentiated TIM cell cultures. The samples, from left to right, are: 1: WT TIM cells; 2: WT TIM cells co-cultured with a 10x excess of DMD TIM cells; 3: WT TIM cells co-cultured with a 30x excess of DMD TIM cells; 4: DMD TIM cells; 5: DMD TIM cells transduced with U7#51T2AGFP; 6: DMD TIM cells transduced with U7#51T2AGFP, co-cultured with a 10x excess of DMD TIM cells; 7: DMD TIM cells transduced with U7#51T2AGFP, co-cultured with a 30x excess of DMD TIM cells. Top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, with WT TIM cells: blue bars; DMD TIM cells transduced with U7#51T2AGFP: green bars. WB analysis of protein extracts from differentiated cultures of C. hMAB. Samples, from left to right, are: 1: DMD hMAB; 2: DMD-U7 cells; 3: DMD-U7 cells co-cultured with 10x excess DMD hMAB; 4: WT TIM cells co-cultured with 10x excess DMD hMAB; 5: WT hMAB cells. Top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, with WT TIM cells: blue bars; DMDU7 cells: green bars. WB analysis of protein extracts from differentiated cultures of Fb converted by D. DMD MyoD.The samples, from left to right, are: 1: Fb converted by DMD MyoD; 2: DMD-U7 cells; 3: DMD-U7 cells co-cultured with Fb converted by a 10x excess of DMD Myod; 4: DMD-U7 cells co-cultured with Fb converted by a 30x excess of DMD Myod; 5: WT TIM cells; 6: WT TIM cells co-cultured with Fb converted by a 10x excess of DMD Myod; 7: WT TIM cells co-cultured with Fb converted by a 30x excess of DMD Myod; top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, with WT TIM cells: blue bars; DMD-U7 cells: green bars. [Figure 3]This figure shows dystrophin protein expression induced by the lentiviral vector U7#51T2AGFP in vivo. A. WB analysis of protein extracts from TA of NSG-mdx-Δ51 or NSG WT mice. Samples, from left to right, are: 1: NSG WT muscle; 2: NSG-mdx-Δ51 muscle transplanted with 5 × 10⁵ DMD-U7 cells; 3: NSG-mdx-Δ51 muscle transplanted with 5 × 10⁵ WT TIM cells; 4: NSG-mdx-Δ51 muscle without transplantation. Top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, with WT TIM cells: blue bars; DMDU7 cells: green bars; NSG WT muscle: white bars. B. WB analysis of protein extracts from TA of NSG-mdx-Δ51 or NSG WT mice. The samples, from left to right, are: 1: NSG WT muscle; 2: NSG-mdx-Δ51 muscle with 5 × 10⁵ U7 hMAB transplanted; 3: NSG-mdx-Δ51 muscle with 5 × 10⁵ WT hMAB transplanted; 4: NSG-mdx-Δ51 muscle without transplantation. Top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, with WT hMAB: blue bars; U7 hMAB: green bars; NSG WT muscle: white bars. Cross-section of TA of C. NSG-mdx-Δ51 mouse, double IF with antibodies against dystrophin (green) and anti-human lamin AC (red). The top lane is TA with 5 × 10⁵ WT TIM cells transplanted. The bottom lane is TA with 5 × 10⁵ DMD-U7 cells transplanted. Lower magnification of dystrophin staining is shown in the lower panel. DAPI stains the nuclei blue. Quantification of dystrophin-positive fibers is shown in the inset (**P<0.01). D. Double IF with antibody alpha-SG (green) and nNOS (red) on cross-sections of TA of NSG-mdx-Δ51 mice transplanted with 5 × 10⁵ DMD-U7 cells. The upper lane is TA transplanted with 5 × 10⁵ WT TIM cells. The lower lane is TA transplanted with 5 × 10⁵ DMD-U7 cells. DAPI stains the nuclei blue. [Figure 4] This figure shows the intracellular diffusion of snRNA in vivo and the improvement of motility after transplantation. A. Double in situ hybridization of TA in a cross-section of NSG-mdx-Δ51 mice transplanted with 5 × 10⁵ DMD-U7 cells. LAM A / C appears in green and is shown in human transplanted cells, while U7 snRNA (red dots) diffuses throughout the cytoplasm of multinucleated myotubules. B. WB analysis of protein extracts from TA of NSG-mdx-Δ51: Samples are, from left to right: 1: NSG-mdx-Δ51 muscle transplanted with 5 × 10⁵ DMD-U7 cells; 2: NSG-mdx-Δ51 muscle transplanted with 2.5 × 10⁵ DMD-U7 cells; 3: NSG-mdx-Δ51 muscle transplanted with 1.25 × 10⁵ DMD-U7 cells; 4: NSG-mdx-Δ51 muscle transplanted with 0.625 × 10⁵ DMD-U7 cells; 5: NSG-mdx-Δ51 muscle without transplantation. Top lane: anti-dystrophin antibody; middle lane: anti-LAM A / C antibody; bottom lane: anti-GAPDH antibody. Densitometric scanning is shown on the right, LAM A / C: blue bars; Dys: green bars. C. Analysis of motility assay. The mice, from left to right, are NSG WT (white bar); NSGmdx-Δ51 (black bar); NSGmdx-Δ51 transplanted with 5 × 10⁵ DMD-U7 cells; and NSGmdx-Δ51 transplanted with 5 × 10⁵ WT TIM cells (*P<0.05). [Figure 5] This figure shows the map and snRNA sequence (SEQ ID NO: 2) of the lentiviral vector U7#51T2AGFP. On the left, the scheme of U7#51T2AGFP derived from pCDH.EFK.MCH.T2A.GFP is shown, and on the right, the red U7 snRNA sequence has the antisense sequence underlined (SEQ ID NO: 1). [Figure 6]This figure shows exon skipping mediated by cells induced by the lentiviral vector U7#51T2AGFP. A. Double IF with antibodies against dystrophin (red) and GFP (green) in differentiated DMD-U7 cells co-cultured with 10 or 30-fold excess DMD TIM cells. Note the expression of dystrophin in substantially all myotubes at a 1:10 dilution and in most myotubes at a 1:30 dilution. DAPI stains the nuclei blue. B. Double IF with antibodies against dystrophin (red) and GFP (green) in differentiated DMD-GFP cells co-cultured with 10 or 30-fold excess DMD TIM cells. No dystrophin expression. DAPI stains the nuclei blue. C. Analysis of DMD TIM cells transduced with a vector expressing either GFP (T2AGFP) or U7 snRNA (U7#51T2AGFP). Analysis of a mixture of transduced and untransduced cells (1:10 or 1:30). [Figure 7] This figure shows the phenotypic characterization of NSG-mdx-Δ51 mice before and after a motility assay. A. Phenotypic characterization of NSG-mdx-Δ51 mice by immunohistochemical staining of the diaphragm; heart; and TA. Top lane: hematoxylin and eosin; bottom lane: Masson's trichrome. B. Hematoxylin and eosin staining of TA in NSG-mdx-Δ51 mice after 4 consecutive days of spontaneous exercise. Samples, from left to right: 1: NSG WT muscle; 2: NSG-mdx-Δ51 muscle; 3: NSG-mdx-Δ51 muscle transplanted with 5 × 10⁵ DMD-U7 cells; 4: NSG-mdx-Δ51 muscle transplanted with 5 × 10⁵ TIM WT cells. [Figure 8]This figure shows the transplantation of DMD-U7 cells into a Matrigel plug subcutaneously on the back of mdx / SCID mice. A. Infusion (IF) of differentiated DMD-U7 cells co-cultured with a 10-fold excess of DMD TIM cells in a Matrigel plug implanted subcutaneously on the dorsal side of mdx / SCID mice, using an antibody against dystrophin (red). B. WB analysis of protein extracts from a Matrigel plug implanted subcutaneously on the dorsal side of mdx / SCID mice. Samples, from left to right, are: DMD: DMD TIM cells; 1: DMD U7 cells; 1:10: DMD U7 cells co-cultured with a 10-fold excess of DMD TIM cells. Top lane: anti-dystrophin antibody; middle lane: anti-MyHC antibody; bottom lane: anti-GAPDH antibody. [Figure 9] This figure shows fluorescence intensity (FI) analysis of live cell calcium levels in differentiated myotubes. Myotubes were loaded with Flou-4AM calcium dye (excited at 388 nm). Images were acquired from live time-lapse video of myotubes at 37°C and 5% CO2: each graph represents a 5-second time frame from each video. (A, B, C) Untreated, non-innervated myotubes. (E, F, G) Myotubes treated with 10 μM nimodipine (NIM), a calcium channel blocker. (H, I, G) Myotubes treated with nimodipine after addition of caffeine C) to induce calcium release from SR. (K, L, M) Myotubes treated with 10 μM nitrendipine (NIT), a calcium channel blocker. (D) shows the effect of agryn on DMD myotubes. [Figure 10] This figure shows fluorescence intensity (FI) analysis of calcium imaging of living cells of innervated myotubes. (A, B, C) FI analysis of myotubes co-cultured with mouse embryonic myosin molecules. (D) 3D co-culture of myotubes (stained green with anti-myosin heavy chain antibody) and motor neurons stained red with anti-neuronal filament antibody (upper panel) and rhodamine-labeled bungarotoxin (BTX) (lower panel), showing neuromuscular junction formation. [Figure 11]This figure shows RT-qPCR results illustrating the relative expression levels of various calcium regulatory genes in immortalized human myotubes. The relative expression levels of mRNA (Log) for each gene were normalized to the reference gene (GAPDH), and then to the expression of the same gene in healthy cells (shown as 1). In each experiment, MyHC(I) expression was evaluated to eliminate the effect of possible differentiation fluctuations on gene expression. Values ​​are mean ± SEM, P<0.05. Two-sided P values ​​were calculated between columns. n=3. (J) Western blot analysis of CaV1.1 expression in healthy, DMD, and DMD-U7 myotubes. (K) Immunofluorescence analysis of CaV1.1 and dystrophin in the tibialis anterior muscle of mdx-NGS mice transplanted with healthy human myogonia. [Figure 12] This figure shows RT-qPCR results illustrating the relative expression levels of various calcium regulatory genes in myotubes treated with agrin. Experimental conditions were as described in Figure 3. Values ​​are mean ± SEM, P<0.05. Two-sided P values ​​were calculated between columns. n=3. (HI) Western blot analysis of CaV1.1(H) and alpha-dystroglycan (dystroglyan)(DG) in DMD myotubes treated with agrin. [Figure 13] This figure shows a schematic diagram of calcium leakage due to the absence of dystrophin in early differentiated myotubes and its elimination by agrin. [Figure 14] This figure shows immunohistochemical staining of myotubes analyzed by fluorescence microscopy. Cells were plated on a collagen I-coated plate and then allowed to differentiate for 10 days. They were then fixed and stained with anti-MyHC antibody (MyHC-green) to assess differentiation, as well as the levels of anti-dystrophin (DYS-red) antibody against expressed dystrophin and DAPI for nucleus staining. Scale bar: 50 μM. [Figure 15]This figure shows TEM analysis of early differentiated myotubes. (A, B, C) Differentiation and sarcomere formation in healthy, DMD, and DMD-U7 myotubes. (D, E, F) Levels of differentiation and sarcomere maturation in healthy, DMD, and DMD-U7 myotubes co-cultured with mouse embryonic MN. Scale bar: 0.5~2 μM. [Figure 16] This figure shows fluorescence intensity (FI) analysis of live calcium imaging of human MAB-derived myotubes. Early differentiated MAB-derived myotubes, which are not innervated, were loaded with Flou-4AM calcium dye (excited at 388 nm). Images were acquired from live time-lapse videos of the myotubes at 37°C and 5% CO2: each graph represents a 5-second time frame from each video. (A) IF analysis of healthy myotubes. (B) IF analysis of DMD myotubes. (C) IF analysis of DMD-U7 myotubes. [Figure 17A] This figure shows the action of agrin (a complete molecule) in blocking Ca++ spikes (A) and its action on CaV1.1 expression (B). [Figure 17B] This figure shows the action of agrin (a complete molecule) in blocking Ca++ spikes (A) and its action on CaV1.1 expression (B). [Figure 17C] (C) shows immunohistochemical staining of dystrophy muscle fibers for dystrophin and / or CaV1.1. When transplanted into dystrophy muscle in vivo, fibers expressing dystrophin also express CaV1.1. [Figure 17D] (D) shows the domain structure of the agrin molecule, with the domain at the C-terminus highlighted. Two truncated agrin proteins are shown: C95 A4B8 (top) and C95 A0B0 (bottom). The C95 A0B0 agrin fragment can eliminate Ca++ efflux, but the C95 A4B8 fragment cannot. [Figure 17E](D) shows the domain structure of the agrin molecule, with the domain at the C-terminus highlighted. Two truncated agrin proteins are shown: C95 A4B8 (top) and C95 A0B0 (bottom). The C95 A0B0 agrin fragment can eliminate Ca++ efflux, but the C95 A4B8 fragment cannot. [Figure 18] This figure shows a map of vectors (SEQ ID NO: 3) suitable for expressing truncated mouse agrin protein. [Figure 19] Figure 18 shows DMD myobiocytes transduced with a lenti vector expressing miniagrin, as schematically shown. (A) shows cells expressing the m-Cherry transduction marker, and (B) shows the same cells loaded with Fura-2, showing a transient Ca++ reaction in some cells. (C) shows that Ca++ spikes in human DMD cells disappear after transduction with a lenti vector expressing miniagrin (see, for example, Figure 9). [Figure 20] This figure shows, using immunofluorescence, that CaV1.1 (red) is expressed in healthy muscle cells (WT, panel A) but not in DMD muscle cells (panel B). CaV1.1 expression in DMD muscle cells is restored by transduction using trans-skipped LV expressing U7 snRNA (panel C) or LV expressing miniagrin, as schematically shown in Figure 18 (panel D). [Modes for carrying out the invention]

[0011] Accordingly, according to a first aspect of the present invention, a mesodermal angioblast (MAB) composition is provided, wherein the MAB is engineered to express a truncated agrin protein.

[0012] In addition, the inventors found that the expression of nuclear small RNA (snRNA) in MAB induces exon skipping in the premRNA transcript of dystrophin. Importantly, the inventors surprisingly found that this strategy, when used in combination, provides a synergistic therapeutic effect that results in abundant dystrophin production within a therapeutically effective range.

[0013] Therefore, in some embodiments, the MAB is engineered to express additional snRNAs capable of inducing exon skipping in the premRNA transcript of dystrophin. Therefore, in these embodiments, the MAB is, (i) truncated agrinprotein; and (ii) Nuclear small RNAs (snRNAs) capable of inducing exon skipping in the premRNA transcript of dystrophin. It is being manipulated to express [a certain characteristic].

[0014] Mesodermal hemangioblasts MABs are progenitor cells that are early identified in the dorsal aorta of developing fetuses. They are also present in postnatal skeletal muscle as a vascular-associated cell population. MABs possess properties similar to, and may be representative of, adult pericyte derivatives in vitro. When arising from fetal tissue, MABs can differentiate into numerous mesodermal lineages, including skeletal muscle, cardiac muscle, bone, and cartilage. Human skeletal muscle derived from MABs is defined by the expression of the pericyte markers NG2 proteoglycan and alkaline phosphatase (ALP), as well as the absence of endothelial markers. This allowed for prospective isolation from newly dissociated ALP+ cells. Its differentiation potential is limited to skeletal muscle and smooth muscle in vitro and in vivo.

[0015] Advantageously, MABs can be genetically engineered in vitro, and after intra-arterial injection, they efficiently engraft in skeletal muscle. Such cells have been shown to promote regeneration in both mouse and dog DMD models. Analysis of muscles grafted with MABs demonstrated that these cells also contribute, albeit to a limited extent, to the pool of satellite cells, which is one of the key aspects ensuring long-term muscle homeostasis. In addition, in vitro studies have demonstrated that human MABs can also act as immunomodulatory cells via the inhibition of T cell proliferation mediated by indoleamine 2,3-dioxygenase (IDO) and prostaglandin E-2 (PGE).

[0016] In some embodiments, MABs for use in the present invention can be identified by the expression of NG2 proteoglycan and alkaline phosphatase (ALP), and the absence of expression of endothelial markers such as CD31, CD34, and / or CD45.

[0017] In some embodiments, MABs can be identified by expression of the following markers: CD31 - , CD34 - , CD45 - , CD62L - , CD106 - , CD117 - , CD133 - , CD146 + , CD49b + , CD13 + , and CD44 + .

[0018] In some embodiments, MABs can be identified by further expression of at least one of the following: VCAM-1 (vascular cell adhesion molecule), CD36, CD44, b7, b5, b1, b2 integrins, alpha integrins (including a1, a5 and a6 in some cases), LFA-1 (leukocyte factor antigen), IL-1R (interleukin-1 receptor), SDF-R (stromal-derived factor receptor), and / or cadherin.

[0019] MAB types Previous studies using in vitro expanded MAB cells have shown that these cells differentiate primarily into skeletal and smooth muscle, and most importantly, can cross blood vessel walls and become distributed throughout the body to treat diffuse forms of muscular dystrophy such as DMD. Unfortunately, despite the systemic infusion of a massive number of cells (over one billion in total), the level of engraftment has been found to be low (<1%), and the efficacy in restoring muscle function is moderate, even though some donor-derived dystrophin is detectable as a result of this approach.

[0020] In some embodiments, MAB can differentiate into skeletal muscle in vitro under suitable culture conditions in the absence of an inducer.

[0021] Detailed protocols for the isolation and culture of mesodermal angioblasts have been reported. In short, the method for isolating MABs from pre-obtained donor tissue samples involves mechanically chopping the tissue, followed by growing the resulting fragments without proteolytic enzymes until cells proliferate from the fragments. The proliferated cells are then cultured in DMEM (or Megacell or MyoCult) containing suitable supplements. TN They are cultured in mammalian cell growth media such as -SF.

[0022] In some embodiments, the donor from which the MAB is derived may be a diseased subject, for example, a subject with or suspected of having muscular dystrophy or other myopathy ultimately characterized by abnormal calcium homeostasis as defined herein.

[0023] In some embodiments, the donor from which the MAB is derived may be a subject with muscular dystrophy. The muscular dystrophy may be characterized by abnormal calcium homeostasis.

[0024] In some embodiments, the donor from which the MAB is derived may be a healthy subject.

[0025] In some embodiments, the process of obtaining MAB from a donor does not constitute part of the disclosed method.

[0026] MAB can be modified (genetically altered) to express exogenous sequences that encode truncated agrin proteins and, optionally, snRNAs that can induce exon skipping in the premRNA transcript of dystrophin.

[0027] Agrin Muscle contraction is caused by nerve impulses traveling along the axon as depolarization waves, which trigger the release of a chemical message (acetylcholine) at the synapse. The connection between nerves and muscles occurs via a highly complex synaptic structure called the neuromuscular junction (NMJ).

[0028] Agrin is a key component of NMJs and consists of a core protein of approximately 220 kDa with two glycosaminoglycan side chains that carry heparan sulfate and / or chondroitin sulfate. These increase the molecular weight of agrin to over 400 kDa. Agrin binds to several proteins on the surface of muscle fibers, such as dystroglycans on the membrane and laminin in the basement membrane, and these interactions help stabilize NMJs. Agrin-deficient mice die at birth because they are unable to form NMJs. However, the role of agrin in NMJs in the pathology of muscular dystrophy has not been extensively investigated, as there is no known involvement of this structure in most muscular dystrophys.

[0029] Surprisingly, the inventors have for the first time discovered that the addition of agrin protein to DMD muscle fiber cultures eliminates cytoplasmic calcium spikes.

[0030] As shown in Figure 17D, agryn is a multi-domain protein. Nine follistatin-like module (FS) domains; Two laminin-EGF-like (LE) domains; Two serine / threonine-rich (S / T) domains; One sperm protein, enterokinase, and agrin (SEA) domain; Four epidermal growth factor-like (EG1-4) domains; and Three laminin globular (LG1-3) domains Includes.

[0031] References to "natural agrin," "natural agrin protein," or "natural agrin sequence" refer to any of the agrin isoforms, and therefore may refer to human agrin isoform 1 sequence with database accession number NP_001292204, human agrin isoform 2 sequence with database accession number NP_940978, or human agrin isoform 3 sequence with database accession number NP_001351656.

[0032] To our surprise, the inventors have found that, in the disclosed approach, the truncated agrin protein can be used more advantageously than natural agrin. Agrin is a large molecule, and truncated agrin has been found to offer significantly greater action due to its increased ability to freely diffuse (into or outward) across muscle fibers.

[0033] "Truncate agrinproteins" refer to portions or derivatives of native agrinproteins that are smaller in size than the native protein, for example, containing fewer amino acids and therefore having a lower molecular weight.

[0034] The truncated agrin proteins as defined herein preferably include, if expressed, an additional secretory signal peptide, for example, at the N-terminus. An example of a suitable signal peptide is a peptide consisting of residues 1-29 of the human agrin isoform 1 sequence having database accession number NP_001292204.

[0035] Truncate agrinproteins may contain, or consist of, a single portion of a native agrinprotein, or a combination of multiple portions of a native agrinprotein. Thus, in some examples, truncate agrinproteins may contain, or consist of, one specific domain of a native agrinprotein, or a combination of multiple domains that may exist continuously or discontinuously in a native agrinprotein, but fewer than the total number found in a native agrinprotein.

[0036] Therefore, in some embodiments, the truncated agrin protein may have a length of less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, or less than 20% of the length of the natural agrin protein, for example, based on the number of amino acid residues. Preferably, the truncated agrin protein may have a length of less than 40%, less than 30%, and more preferably less than 25% of the length of the natural agrin protein.

[0037] In some embodiments, the truncated agrin protein may have a length greater than 3%, preferably greater than 5%, of the length of the native agrin protein, for example, based on the number of amino acid residues.

[0038] In some embodiments, the truncated agrin protein may have a length of 4-40%, preferably 6-30% or 7-25%, and most preferably 10-20%, of the length of the native agrin protein, for example, based on the number of amino acid residues.

[0039] In some embodiments, the truncated agrinprotein may be a truncated agrinprotein that includes a portion of the native agrinprotein. Such a portion may have a length of, for example, 4-40%, preferably 6-30% or 7-25%, and most preferably 10-20%, of the length of the native agrinprotein, based on the number of amino acid residues.

[0040] In some embodiments, the truncated agrin protein may contain or consist of one or more domains derived from domains present in the natural agrin protein. Each of the one or more domains of the truncated agrin protein derived from domains present in the natural agrin protein may have at least 90%, 95%, or 99% sequence identity with the corresponding domain present in the natural agrin protein.

[0041] In some embodiments, the truncated agrin protein may contain, or consist of, one or more domains derived from or present in the native agrin protein. Thus, in some embodiments, the truncated agrin protein may contain, or consist of, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 domains derived from or present in the native agrin protein.

[0042] In some embodiments, the truncated agrin protein may contain, or consist of, 15 or fewer, 12 or fewer, 10 or fewer, or 8 or fewer domains derived from or present in the native agrin protein. Preferably, the truncated agrin protein may contain, or consist of, 7 or fewer domains derived from or present in the native agrin protein, for example, 5, 4, 3, 2, or 1 domain.

[0043] In some embodiments, the truncated agrin protein may contain, or consist of, at least one, two, or three domains derived from or present in the native agrin protein. Preferably, the truncated agrin protein may contain, or consist of at least four domains derived from or present in the native agrin protein.

[0044] In some embodiments, the truncated agrin protein may contain, or consist of, 1 to 12 domains derived from or present in the native agrin protein, preferably 2 to 10, 3 to 9, or 4 to 8 domains derived from or present in the native agrin protein. Most preferably, the truncated agrin protein may contain, or consist of 5, 6, or 7 domains derived from or present in the native agrin protein.

[0045] Therefore, in some embodiments, the truncated agrinprotein may be a truncated agrinprotein having a length of 5 to 40% of the length of the native agrinprotein based on the number of amino acid residues, and the truncated agrinprotein may contain or consist of up to seven domains derived from or present in the native agrinprotein.

[0046] In some embodiments, the truncated agrin protein may contain or consist of one or more domains that are sequentially present in the natural agrin protein.

[0047] In some embodiments, the truncated agrin protein may contain or consist of one or more domains present in the C-terminal region of the native agrin protein.

[0048] In some embodiments, the truncated agrin protein may contain, or consist of, one or more domains that are sequentially present in the C-terminal region of the native agrin protein.

[0049] In some embodiments, the truncated agrinprotein may be a truncated agrinprotein having a length of 5 to 40% of the length of the native agrinprotein based on the number of amino acid residues, and the truncated agrinprotein may contain or consist of up to seven domains derived from or present in the native agrinprotein, the domains being contiguous in the native agrinprotein.

[0050] In some embodiments, the truncated agrin protein may contain, or consist of, multiple domains that are discontinuously present in the native agrin protein.

[0051] In some embodiments, the truncated agrin protein may contain or consist of multiple domains, some or all of which may be arranged in the same order as they are present in the native agrin protein.

[0052] In some embodiments, the order of domains in the truncated protein may differ from the order of domains in the native agrin protein.

[0053] In some embodiments, the truncated agrin protein may contain or consist of multiple domains that are sequentially present in the natural agrin protein, with one or more of the domains being overlapping.

[0054] Therefore, in some embodiments, the truncated agrinprotein may be a truncated agrinprotein having a length of 5 to 40% of the length of the native agrinprotein based on the number of amino acid residues, and the truncated agrinprotein may contain or consist of up to seven domains derived from or present in the native agrinprotein, the domains being present consecutively in the native agrinprotein and arranged in the same order as they are present in the native agrinprotein.

[0055] Several splice variants of naturally occurring agrin exist, the most abundant of which is a secreted protein containing an N-terminal agrin (NtA) domain (see Figure 17D). Agrin is produced in the cell body of neurons, transported along the axon, and released from the axon terminals of motor neurons into the synaptic cleft of the NMJ.

[0056] When added to cultured muscle cells, Agrin induces the aggregation of acetylcholine receptors (AChRs) and several additional elements that are concentrated at the neuromuscular junction (NMJ) in vivo.

[0057] Some truncated agrin proteins have been found to retain this AChR aggregation activity. These truncated agrin proteins are identified based on the size and position of the fragment. For example, we found that a 95 kDa C-terminal fragment of agrin was particularly advantageous for expression in MAB and for use in the disclosed approach. This fragment is referred to as the "C95" agrin fragment and corresponds to the LG1-3 agrin domain and the EG1-4 agrin domain (see Figure 17D).

[0058] Therefore, in some embodiments, the truncated agrin protein may be a truncated agrin protein having a length of less than about 40% of the length of the native agrin protein based on the number of amino acid residues, and the truncated agrin protein may contain or consist of up to seven domains derived from or present in the native agrin protein, the domains of which include or consist of the LG1-3 agrin domain and EG1-4 agrin domain of the native agrin protein. Preferably, the domains are arranged in the sequence in which they are present in the native agrin protein.

[0059] In some embodiments, the truncated agrin protein may have at least 90% sequence identity with the C95 agrin fragment.

[0060] Therefore, in some embodiments, the truncated agrin protein may consist of or contain a C95 agrin fragment.

[0061] The C95 agrin protein may consist of residues 1329-2068 of a human agrin isoform 1 sequence, or it may have an amino acid sequence containing these residues.

[0062] In some embodiments, the truncated agrin protein may further include a C95 agrin fragment comprising 1 to 5 additional agrin domains, for example, an additional 4, 3, 2, or 1 agrin domain.

[0063] In some embodiments, the C95 agrin protein may have an amino acid sequence consisting of residues 1329-2068 and may further contain up to about 100 additional amino acids. For example, in some embodiments, the C95 agrin protein may have up to 50, 40, 30, 20, or 10 additional amino acids at the N-terminus of the amino acid sequence consisting of residues 1329-2068 of human agrin isoform 1. In addition, or alternatively, in some embodiments, the C95 agrin protein may have up to 50, 40, 30, 20, or 10 additional amino acids at the C-terminus of the amino acid sequence consisting of residues 1329-2068 of human agrin isoform 1.

[0064] Two sites within the C-terminal region of agryn have been modified by alternative mRNA splicing: - The insert "A" (called "y" in rats) in the LG2 domain (as shown in Figure 17D) has been found to have the sequence Lys-Ser-Arg-Lys, which is identically conserved across numerous vertebrate species. The presence or absence of this KSRK insert is indicated by the suffix "A4" or "A0," respectively. - The insert at site "B" in the LG3 domain (called z in rats) (as shown in Figure 17D) is not very conserved and contains 8, 11, or 19 amino acids. The presence or absence of the insert at site B is indicated, as necessary, by the suffix "B0", "B8", "B11", or "B19".

[0065] The sequences of these inserts affect the AChR aggregation activity of agrin: recombinant rat, chick, and ray agrin A4B8 induces AChR aggregation at picomolar concentrations, while soluble agrin A0B0 activity is undetectable. This is true for native agrin and various truncated forms. For example, the C95 A4B8 agrin fragment has been found to induce AChR aggregation, but the C95 A0B0 fragment has not. Similarly, the "C45" A4B8 agrin fragment (consisting of LG2-3 and EG3-4 domains) and the "C21" B8 agrin fragment (a 21 kDa fragment containing only the B8 and LG3 domains) have been found to induce AChR aggregation.

[0066] Agrin, which binds to α-dystroglycan, a non-integrin receptor and superficial membrane protein of the dystrophin-glycoprotein complex, is not required for agrin-induced AChR aggregation, and the AChR aggregation activity of agrin isoforms does not correlate with their affinity for α-dystroglycan. Agrin A0B0 isoforms, which bind to heparin and are inactive in AChR aggregation, bind to α-dystroglycan with high affinity. In contrast, agrin A4B8 isoforms, which bind to heparin and are active in AChR aggregation, bind to α-dystroglycan with at least one-tenth the affinity of agrin A0B0 isoforms.

[0067] The inventors have found that when the agrin A0B0 isoform is expressed in MAB, Ca ++ We found that the flux could be eliminated, and therefore, it is remarkably advantageous for use in the disclosed approach.

[0068] Therefore, in some embodiments, the truncated agrin protein can bind to α-dystroglycan.

[0069] In some embodiments, the truncated agrin protein can bind to α-dystroglycan with high affinity. Methods for determining the binding affinity between the truncated agrin protein and α-dystroglycan are expected to be known to those skilled in the art. In some embodiments, high affinity binding to α-dystroglycan means that the truncated agrin protein can bind to α-dystroglycan with a binding affinity greater than 50% of the binding affinity of the native agrin protein under equivalent conditions.

[0070] In some embodiments, the truncated agrin protein is unable to induce AChR aggregation. Methods for determining AChR aggregation are expected to be known to those skilled in the art. In some embodiments, induction of AChR aggregation means that the truncated agrin protein induces AChR aggregation at a level less than 50% of the level induced by the native agrin protein under equivalent conditions.

[0071] In some embodiments, the truncated agrin protein is unable to induce AChR phosphorylation. Methods for determining AChR phosphorylation are expected to be known to those skilled in the art. In some embodiments, induction of AChR phosphorylation means that the truncated agrin protein induces AChR phosphorylation at a level less than 50% of the level of AChR phosphorylation induced by the native agrin protein under equivalent conditions.

[0072] In some embodiments, the truncated agrin protein is the A0B0 agrin isoform.

[0073] In some embodiments, the truncated agrin protein comprises or consists of the C-terminal portion of a native agrin protein having a molecular weight of less than 120 kDa. In some embodiments, the truncated agrin protein is an A0B0 agrin isoform comprising or consisting of the C-terminal portion of a native agrin protein having a molecular weight of less than 120 kDa.

[0074] In some embodiments, the truncated agrin protein comprises or consists of the C-terminal portion of a native agrin protein having a molecular weight of less than 100 kDa. In some embodiments, the truncated agrin protein is an A0B0 agrin isoform comprising or consisting of the C-terminal portion of a native agrin protein having a molecular weight of less than 100 kDa.

[0075] Therefore, in some embodiments, the truncated agrinprotein may be a truncated agrinprotein having a length of less than about 40% of the length of the native agrinprotein based on the number of amino acid residues, and the truncated agrinprotein contains or consists of the LG1-3 agrin domain and EG1-4 agrin domain of the native agrinprotein, and the truncated agrinprotein is the A0B0 isoform. Preferably, the domains are arranged in the sequence in which they are present in the native agrinprotein.

[0076] In some embodiments, the truncated agrin protein comprises or consists of the C-terminal portion of a native agrin protein having a molecular weight greater than 20 kDa. In some embodiments, the truncated agrin protein is an A0B0 agrin isoform comprising or consisting of the C-terminal portion of a native agrin protein having a molecular weight greater than 20 kDa.

[0077] In some embodiments, the truncated agrin protein comprises or consists of the C-terminal portion of a native agrin protein having a molecular weight of 21 to 95 kDa. In some embodiments, the truncated agrin protein is an A0B0 agrin isoform comprising or consisting of the C-terminal portion of a native agrin protein having a molecular weight of 21 to 95 kDa.

[0078] In some embodiments, the truncated agrin protein comprises or consists of a C95 A0Bo agrin fragment.

[0079] In some embodiments, the truncated agrin protein may consist of or contain a truncated agrin protein called "miniagrin" (MAG).

[0080] MAG is derived from muscle agrin isoforms and can bind to α-dystroglycans with high affinity. MAG has a domain structure consisting of an NtA domain, one FS module (FS), and a C95 agrin fragment.

[0081] MAG has been found to be particularly advantageous for use in the disclosed approach due to its ease of expression in MABs and, furthermore, due to its important residual cellular function.

[0082] Advantageously, the inventors also found that MAG can diffuse highly along muscle fibers.

[0083] In some embodiments, the truncated agrin protein contains or consists of MAG.

[0084] In some embodiments, the truncated agrin protein comprises or consists of the MAG A0Bo truncated agrin protein.

[0085] The truncated agrin protein may be modified, for example, to provide improved in vivo stability. Therefore, in some embodiments, the agrin protein may contain one or more mutations that provide improved stability, such as protease resistance. For example, in some embodiments, the agrin protein may contain a mutation that removes a protease cleavage site. Therefore, in some embodiments, the agrin protein may not contain a protease cleavage site.

[0086] However, the inventors have found that protease resistance does not offer any advantages with respect to the therapeutic use of the disclosed MAB composition. Therefore, the truncated agrin protein advantageously does not require the inclusion of any site-specific mutations. Accordingly, in preferred embodiments, the agrin protein does not contain site-specific mutations, such as those for removing protease cleavage sites.

[0087] While there are at least three possible heparan sulfate (HS) attachment sites within the primary structure of natural agrin, it is thought that only two of these actually carry HS chains when the protein is expressed in vivo. The inventors have found that when agrin molecules completely lacking HS chains are added to DMD muscle fiber cultures, they eliminate cytoplasmic calcium spikes.

[0088] Therefore, in some embodiments, the truncated agrin protein may contain at most one HS chain, or more preferably, no HS chains. It has been found that truncated agrin proteins with a reduced number of HS chains or no HS chains have advantageously improved diffusion properties.

[0089] In fact, any functional truncated agrin protein can be expressed in the disclosed MAB. Therefore, in some embodiments, the truncated agrin protein is a functional truncated agrin protein.

[0090] Various tests can be used to determine whether a truncated agrin protein is a functional truncated agrin protein for the purposes of the disclosure of this invention.

[0091] The term "functional truncated agrin" generally refers to truncated agrin proteins that possess biological activity, and more specifically, truncated agrin proteins that possess sufficient biological activity to reduce the progressive deterioration of muscle tissue characteristic of muscular dystrophy in other contexts. For example, the inventors have found that agrin proteins are CaV We have found that it is possible to significantly alter the levels of calcium homeostasis-related proteins such as 1.1, thereby reducing one or more signs or symptoms associated with muscular dystrophy, such as muscular dystrophy characterized by abnormal calcium homeostasis.

[0092] For example, a suitable test may involve determining the ability of a truncated agrin protein to reduce or eliminate cytoplasmic calcium spikes in DMD muscle fiber cultures when used at any concentration within the micromolar range. Suitable methods for testing this property are expected to be known to those skilled in the art and are disclosed herein. Any truncated agrin protein capable of eliminating cytoplasmic calcium spikes when expressed in DMD muscle fiber cultures is considered a functional truncated agrin protein for the purposes of the disclosure of this invention. In this context, “eliminate” means reducing the intracellular calcium level to less than 10% of the maximum level measured using a calcium indicator such as fura2 in a calcium imaging assay. Similarly, any truncated agrin protein capable of reducing cytoplasmic calcium spikes when expressed in DMD muscle fiber cultures is considered a functional truncated agrin protein for the purposes of the disclosure of this invention. In this context, "reduce" refers to reducing intracellular calcium levels to less than 50%, 40%, 30%, or 20% of the maximum level measured using a calcium indicator such as fura2 in a calcium imaging assay.

[0093] In some embodiments, when expressed in cultures of DMD muscle fibers, truncated agrin protein can reduce or eliminate cytoplasmic calcium spikes. Methods for detecting cytoplasmic calcium spikes in DMD muscle fiber cultures are expected to be known to those skilled in the art. In some embodiments, reducing or eliminating cytoplasmic calcium spikes when expressed in cultures of DMD muscle fibers means that, in the presence of truncated agrin protein, the level of cytoplasmic calcium spikes in DMD muscle cultures is less than 50% of the level detected in the absence of truncated agrin protein expression.

[0094] Additional or alternative tests may include determining the ability of a truncated agrin protein to increase, restore, or substantially restore the expression level of one or more specific proteins known to reduce or eliminate expression in DMD muscle fibers or in vitro models of such fibers, when used at any concentration within the micromolar range. Suitable proteins include, for example, Ca V 1.1, Ca such as CACNA1S, SCN4A, RyR1, and / or TRPC1 ++Examples include proteins involved in homeostasis. Preferred methods for determining levels of expression, such as determining whether one or more proteins exhibit reduced or absent expression in DMD muscle fibers, and whether the level of expression is increased, restored, or substantially restored by the truncated agrin protein, are expected to be known to those skilled in the art and are disclosed herein. Any truncated agrin protein capable of restoring the level of expression of one or more proteins is considered a functional truncated agrin protein for the purposes of the disclosure of this invention. In this context, “restoring” means increasing the level of expression of one or more proteins to more than 90% of the level of expression in healthy cultured muscle fibers. Similarly, any truncated agrin protein capable of increasing or substantially restoring the level of expression of one or more proteins is considered a functional truncated agrin protein for the purposes of the disclosure of this invention. In this context, "substantially restore" means increasing the expression level of one or more proteins to more than 50%, 60%, 70%, or 80% of the expression level in healthy cultured muscle fibers.

[0095] Ca V 1.1 Modifications in protein expression refer to an increase or decrease in the level of detectable protein in a biological sample (e.g., a sample from a subject at risk of or with muscular dystrophy) compared to a control (e.g., a sample from a subject without muscular dystrophy), or compared to a known reference value that indicates the level of protein in the absence of the disease. "Modification" of expression includes an increase in expression (upward regulation) or a decrease in expression (downward regulation).

[0096] In some embodiments, the truncated agrin protein is Ca V It is possible to induce and / or increase the expression of calcium homeostasis-related proteins such as 1.1. Ca VMethods for determining the expression levels of calcium homeostasis-related proteins such as 1.1, and thereby determining whether protein expression is induced or increased, are expected to be known to those skilled in the art. In some embodiments, Ca V Increasing the expression of calcium homeostasis-related proteins such as 1.1 means that, when expressed in DMD muscle fiber culture, truncated agrin protein induces the expression of the target protein at a level 50% higher than the level of expression of the corresponding protein in the absence of truncated agrin protein expression.

[0097] Examples of vectors that can be used to express truncated agrin proteins in MAB are shown in Figure 18.

[0098] Nuclear small RNA To date, oligonucleotide-based exon skipping therapies have failed to achieve efficacy in Phase III clinical trials, likely because these large molecules cannot diffuse through certain barriers such as collagen-rich fibrous tissue and muscle basement membranes. In contrast, cell therapy, although technically more demanding, guarantees longer-lasting, more permanent effects because muscle fibers persist in principle for life, which is expected to avoid lifelong drug administration.

[0099] However, the inventors have developed a novel strategy that combines the advantages of exon skipping with the advantages of cell-based therapy, thereby synergistically reducing the drawbacks of each of the two distinct approaches.

[0100] Cell-mediated exon skipping utilizes the multinucleated nature of muscle fibers, where it has been found that a single cell, upon fusing with a regenerating muscle fiber, will enter adjacent commensal dystrophy nuclei and produce high levels of snRNA expected to cross-correct. This approach can amplify dystrophin production by an order of magnitude and therefore significantly increase therapeutic effects. Thus, this cell-mediated exon skipping approach utilizes the multinucleated nature of muscle fibers to achieve cross-correction of commensal dystrophy nuclei by snRNA.

[0101] The inventors observed that co-culturing genetically corrected human myogonia and their dystrophic counterparts in a ratio of either 1:10 or 1:30 resulted in dystrophin production several times higher than that predicted by simple dilution, reaching levels considered therapeutic. This is attributed to the diffusion of RNA, such as U7 snRNA, into adjacent commensal dystrophic nuclei.

[0102] The inventors have surprisingly found that this cell-mediated exon skipping approach can be advantageously used in combination with the delivery of truncated agrin proteins using MAB compositions. Surprisingly, the resulting engineered MABs were found to delay muscle fiber cell death to a level of action that may have been predicted based on the results observed when either approach was used alone.

[0103] In use, both the truncated agrin protein and snRNA were found to favorably diffuse along the muscle fiber (externally and internally, respectively), thereby providing therapeutic intervention at all relevant locations throughout the muscle fiber, both internally (snRNA) and externally (truncate agrin protein).

[0104] Therefore, in some embodiments, the composition may include an MAB engineered to express a truncated agrin protein, and an snRNA capable of inducing exon skipping in the premRNA transcript of dystrophin.

[0105] Methods for determining exon skipping activity are expected to be known to those skilled in the art. For example, exon skipping activity can be measured by analyzing total RNA isolated by reverse transcriptase polymerase chain reaction (RT-PCR) using dystrophin-specific primers adjacent to the targeted exon.

[0106] Any snRNA capable of inducing exon skipping in the premRNA transcript of dystrophin, and capable of increasing, restoring, or substantially restoring dystrophin levels in muscle fibers, can be used.

[0107] Therefore, in some embodiments, the MAB may be engineered to express snRNAs that increase the level of dystrophin in muscle fibers. Preferred methods for determining the level of dystrophin in muscle fibers are expected to be known to those skilled in the art.

[0108] In some embodiments, the snRNA may be a modified uridine-rich 7(U7) snRNA.

[0109] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin premRNA transcript, thereby inducing skipping of one or more dystrophin exons.

[0110] In some embodiments, the snRNA includes a sequence of bases that specifically hybridize to a region of the dystrophin premRNA transcript, thereby inducing skipping of one or more dystrophin exons 50-55 of the dystrophin gene.

[0111] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin premRNA transcript, thereby inducing skipping of dystrophin exon 51. In some embodiments, the snRNA sequence may consist of or contain the RNA sequence of SEQ ID NO: 1 CCUCUGUGAUUUUAUAACUUGAUUCAAGGAAGAUGGCAUUUCU[Sequence ID 1].

[0112] In some embodiments, the snRNA sequence may consist of or include the RNA sequence of Sequence ID No. 1, which further comprises up to two nucleotide substitutions, preferably up to one nucleotide substitution.

[0113] In some embodiments, the snRNA sequence may consist of or include the RNA sequence of Sequence ID No. 1, which further includes up to two nucleotide additions, preferably up to one nucleotide addition.

[0114] In some embodiments, the snRNA sequence may consist of or include the RNA sequence of Sequence ID No. 1, which further comprises up to two nucleotide deletions, preferably up to one nucleotide deletion.

[0115] In some embodiments, the snRNA sequence may consist of the RNA sequence of SEQ ID NO: 1.

[0116] An example of a lentiviral vector that can be used to express the snRNA sequence of Sequence ID No. 1 in MAB is shown in Figure 5.

[0117] In some embodiments, MAB cells are engineered to express both truncated agrin protein and small nuclear RNAs capable of inducing exon skipping in the human dystrophin gene. The advantage of this approach is that substantially all MAB cells in the composition deliver both therapeutic agents for diffusion across muscle fibers.

[0118] In some embodiments, a single lenti vector may be used in the MAB to express both a truncated agrin protein and a small nuclear RNA capable of inducing exon skipping in the human dystrophin gene.

[0119] In some embodiments, a separate lenti vector may be used in the MAB to express a small nuclear RNA capable of inducing exon skipping in truncated agrin protein and the human dystrophin gene.

[0120] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 2-7 of the dystrophin gene.

[0121] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 11-18 of the dystrophin gene.

[0122] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 43-48 of the dystrophin gene.

[0123] In some embodiments, the snRNA contains a sequence of bases that specifically hybridize to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 45-53 of the dystrophin gene.

[0124] In some embodiments, the MAB may be engineered to express multiple different snRNAs. Thus, in some embodiments, the MAB may be engineered to express a truncated agrin protein and multiple different snRNAs. In some embodiments, each of the different snRNAs may be capable of inducing skipping of a different dystrophin. In some embodiments, each of the different snRNAs may be capable of inducing skipping of the same dystrophin exon.

[0125] Using five different vectors, each designed for multiple exon skipping targeting the most common mutations in the dystrophin gene, approximately 60% of the DMD patient population can be treated, as shown in Table I.

[0126] [Table 1]

[0127] Therefore, in some embodiments, the MAB may be engineered to express multiple different snRNs. At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 45–53 of the dystrophin gene; At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 2-7 of the dystrophin gene; At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 11–18 of the dystrophin gene; At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 43–48 of the dystrophin gene; At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 45–53 of the dystrophin gene; At least one snRNA contains a sequence of bases that specifically hybridizes to a region of the dystrophin gene transcript, thereby inducing skipping of one or more exons 50–55 of the dystrophin gene.

[0128] Manufacturing method A second aspect of the present invention provides a method for producing the MAB composition of the first aspect, which includes transduction of the MAB with a vector to express a truncated agrin protein.

[0129] In some embodiments, the method may include transducing MAB with a first vector for expressing a truncated agrin protein, and transducing with a second vector for expressing a nuclear small RNA (snRNA) capable of inducing exon skipping in the premRNA transcript of dystrophin.

[0130] In some embodiments, the method may involve transduction into a MAB with a single vector to express both a truncated agrin protein and a nuclear small RNA (snRNA) capable of inducing exon skipping in the premRNA transcript of dystrophin.

[0131] In some embodiments, the first and / or second vector may include a viral vector.

[0132] In some embodiments, the first and / or second vector may include a retroviral vector.

[0133] In some embodiments, the first and / or second vector may include a lentiviral vector.

[0134] In some embodiments, the viral vector may be modified to delete any non-essential sequence.

[0135] In some embodiments, the MAB may be expanded in vitro and transduced with a “trans-skip” lentiviral vector. The “trans-skip” lentiviral vector is produced using a widely used HIV-1-based transient packaging system, which encodes minimal packaging functionality and lacks all HIV accessory genes except for REV, which is separately expressed by the packaging construct. This system incorporates a superior biosafety mechanism, and the self-inactivating lentiviral vector does not encode viral genes.

[0136] The "trans-skip" lentiviral vector is replication-deficient because it codes for no viral genes and is packaged only in the presence of the smallest viral protein in trans form under transient transfection conditions. The backbone is a gutted vector with minimal viral genetic material, carrying only the smallest essential cis-acting sequence and no viral genes. In addition to the removal of the U3 region from the 5'LTR, the U3 region from the 3'LTR is also deleted. After transduction in target cells, the 3'LTR is spontaneously copied to the 5' end, thereby effectively inactivating the newly generated 5'LTR lacking the U3 region. This self-inactivation ensures that recruitment is impossible after transduction, even under conditions where the presence of pseudo-HIV helper packaging function in target cells is highly unlikely. The 5' to 3' configuration of the vector is as follows: • A chimeric 5'LTR that replaces the HIV U3 region and contains an RSV enhancer / promoter that replaces the transcription dependency to Tat. Vector packaging signals. • Rev response element (RRE). • HIV central polyprint lactate (cppt) and termination sequence (cts). EF1α, i.e., a human-specific, universal, and efficient promoter for driving transgene expression. • The target U7 nuclear small RNA, for example, a U7 snRNA engineered to skip exon 51 (#51) of the dystrophin gene. • WPRE: Woodchuck hepatitis virus regulatory element. SV40 / Ori: Simian virus 40 replication origin. • pB322 / Ori: Plasmid BR322 replication origin. The 3'LTR has a large deletion in the U3 region, removing a 400-nucleotide sequence containing all the major determinants involved in regulating HIV-1 LTR promoter activity, such as the TATA box. In the absence of this sequence, the template used to generate both copies of the LTR in the incorporated provirus is lost, and therefore, vector inactivation occurs as a result.

[0137] In some embodiments, MAB is obtained, for example, from a donor, and the method includes expanding and growing the MAB in vitro and transducing it into cells with a lentiviral vector.

[0138] In some embodiments, a MAB may be obtained, for example, pre-obtained from a donor, and may be expanded in vitro and transduced with a “trans-skip” lentiviral vector encoding a small nuclear RNA that has been engineered to skip exon 51 of the dystrophin gene.

[0139] In some embodiments, the MAB may include autologous human mesodermal angioblasts (hMABs) that have been expanded in vitro and transduced with a lentiviral vector.

[0140] In some embodiments, the MAB may include autologous human mesodermal angioblasts (hMABs) transduced with a “trans-skip” lentiviral vector that is expanded in vitro and encoded with a small nuclear RNA that has been engineered to skip exon 51 of the dystrophin gene.

[0141] The MAB may be an autologous MAB that has been stably transduced to express a small nuclear RNA in order to correct the primary transcript of dystrophin by inducing exon skipping, for example, exon 51.

[0142] Therefore, the MAB may be an autologous MAB modified with a "trans-skip" lentiviral vector gene.

[0143] In some embodiments, MAB can be obtained from a muscle biopsy of the extensor digitorum brevis (EBD) muscle of a DMD patient. In some embodiments, the method for producing MAB may include one or more of the following steps: 1. Obtain EBD muscle samples from DMD patients, or use EBD muscle samples obtained in advance from DMD patients; 2. Identification of suitable finely chopped muscle fragments by microscopy, for example; 3. Plating of the fragments onto a culture dish coated with collagen I; 4. Recovery of MAB (from proliferated cells); 5. Transduction of MAB; and 6. Expansion, propagation, and characterization of MAB.

[0144] The following provides a detailed example of a preferred method for producing transduced MABs.

[0145] The muscle biopsy is washed, dissected under an inverted microscope, and any unwanted connective tissue and adipose tissue is removed. The cleaned muscle is finely chopped into small fragments and transferred to a collagen-coated culture dish, where it is cultured overnight in the minimum volume of medium necessary to cover the surface of the dish. This facilitates the adhesion of the fragment(s) to the culture dish. The following day, additional medium is gently added, and the fragments are cultured for up to 15 days, with periodic monitoring of potential cell growth.

[0146] Once the proliferating cells appear and cover a medium to large area of ​​the culture dish (usually 5-15 days), the cells are collected by a mild proteolytic treatment. The collected MABs are cultured in a specific culture medium favorable to their growth (e.g., Myocult-SF from STEMCELL Technologies).

[0147] Once the MAB reaches the subconfluence stage (e.g., 2 / 3 confluence), the MAB is transduced with a transskip lenti vector. Transduced cells are analyzed for transduction efficiency, measured as mean vector copy number / cell. For example, a QPCR assay can be used with a primer / probe set capable of recognizing GAPDH (housekeeping) and WPRE (DNA sequence delivered from the viral vector).

[0148] Transduction is considered acceptable, for example, if VCN is ≥ 1.

[0149] The transduced MABs are then cultured in a suitable medium, such as Myocult-SF from STEMCELL Technologies. In Myocult-SF, the cells proliferate actively with an average population doubling time of 1 day and can be secondary cultured for at least 40 passages before reaching senescence.

[0150] MAB is prepared using, for example, GMP-grade frozen medium without DMSO (e.g., Cryo-SFM), with a maximum of 1 × 10⁶ units per 1 ml. 7 ~≦5×10 7 The individual cells may be stored at low temperatures. The vials are first placed in a GMP-controlled -80°C freezer for no more than 24 hours, and then in a GMP-controlled vapor phase liquid nitrogen storage facility.

[0151] If transduction is deemed acceptable (i.e., VCN ≥ 1), cells are characterized using standard protocols for, for example, cell number and viability, proliferation rate, phenotype of cell surface markers, tumorigenesis, viral integration, and / or karyotype. Cells can also be tested for potency, for example, by analyzing dystrophin production in vitro (as a percentage of the level expressed in healthy muscle cells). Differentiation in vitro, and therefore dystrophin production, may underestimate in vivo activity. For example, mouse MABs may not differentiate in vitro but may differentiate in vivo. Similarly, human MABs from different donors may show little differentiation potential in vitro but show better differentiation potential in vivo.

[0152] "Non-target" cells, i.e., other cell types present in the composition, can be checked by FACS analysis (>90% of cells express mesenchymal markers such as CD44 and CD13).

[0153] In some embodiments, the cell preparation may contain varying ratios of satellite cells (CD56+). However, this is not harmful, as these cells also contribute to muscle formation and provide therapeutic benefits.

[0154] In preferred embodiments, the cell preparation is free of endothelial cells or hematopoietic cells (CD31, CD34, CD45 < 5%). In preferred embodiments, the culture medium is selected from an initial heterogeneous cell population (MAB). Inflammatory cells present in the initial biopsy (lymphocytes or macrophages) will not survive under the culture conditions used.

[0155] In some embodiments, each dose of the composition may contain 1 million to 100 million cells, for example, 5 million to 50 million cells, or 10 million to 30 million cells.

[0156] In some embodiments, the viral titer of MAB in the composition is 10 × 10 6 ~10×10 8For example, approximately 10 x 10 7 That's fine.

[0157] In some embodiments, the number of vector copies of MAB in the composition may be 1 to 5.

[0158] In some embodiments, the viral vector may be configured to enter cells directly.

[0159] In some embodiments, a delivery system, such as a liposome-based delivery system, can be used to transfect the target MAB.

[0160] Conditions that can be treated or used therapeutically According to a third aspect of the present invention, an MAB composition produced by the method of the first aspect or the method of the second aspect is provided for use as a pharmaceutical.

[0161] According to a fourth aspect of the present invention, an MAB composition produced by the method of the first aspect or the method of the second aspect is provided for use in treating muscular dystrophy disorders.

[0162] In some embodiments, the muscular dystrophy disorder may be DMD or BMD. Therefore, the composition may be intended for use in treating DMD or BMD.

[0163] In some embodiments, muscular dystrophy may be characterized by abnormal calcium homeostasis.

[0164] In some embodiments, the MAB composition may be used to reduce or prevent calcium spikes in muscle fibers.

[0165] Therefore, in some embodiments, the MAB composition may be used for treating DMD or BMD by reducing or preventing calcium spikes in muscle fibers.

[0166] In some embodiments, the donor from which the MAB is derived may be a diseased subject, such as a muscular dystrophy, for example, a muscular dystrophy characterized by abnormal calcium homeostasis as defined herein, or a subject at risk of having such a muscular dystrophy.

[0167] In some embodiments, the donor from which the MAB is derived may be a subject with muscular dystrophy. In some embodiments, the MAB composition may be suitable for autologous administration for use in the treatment of the subject disease.

[0168] In some embodiments, the MAB composition may be for personal use in the treatment of muscular dystrophy disorders.

[0169] In some embodiments, the donor from which the MAB is derived may be a healthy subject.

[0170] In some embodiments, the process of obtaining MAB from a donor does not constitute part of the disclosed method.

[0171] MAB can be modified (genetically altered) to express exogenous sequences that encode snRNAs capable of inducing exon skipping in the premRNA transcripts of truncated agrinprotein and dystrophin.

[0172] The composition of the first aspect offers several advantages when used as a pharmaceutical, for example, in the treatment of muscular dystrophy.

[0173] For example, the inventors found that agryn delivered to muscle fibers in culture using the disclosed method eliminates cytoplasmic calcium spikes in DMD muscle cells characterized by abnormal calcium homeostasis. Surprisingly, agryn eliminates Ca ++ The sensor is Ca V It was found to restore physiological levels of 1.1. Ca V 1.1 binds to ryanodine receptor 1 (RyR1) and regulates it, thereby disrupting the flow of Ca to the cytoplasm. ++ To prevent release. When delivered using the disclosed MAB, truncated agrin protein has been found to deliver these effects more effectively than native agrin, as a result of its improved ability to diffuse along multinucleated muscle fibers due to its smaller size and the absence of negatively charged heparan sulfate chains compared to native agrin.

[0174] Furthermore, in contrast to other therapeutic approaches, cell therapy using the composition of the first aspect provides a long-lasting, more substantially permanent effect, as the muscle fibers persist throughout life in principle. Thus, this approach offers the advantage of avoiding lifelong drug administration and immunosuppression, as is the case with heterogeneous methods.

[0175] In any case, MAB delivery, particularly MAB delivery in embodiments involving autologous MABs, can be repeated multiple times without causing a specific immune response (which always occurs with AAV therapy).

[0176] In addition, the disclosed approach offers the further advantage that it does not require modifying the truncated agrin protein to increase stability, for example, by mutating it with respect to protease resistance, which may be done in the case of therapeutic approaches involving the delivery of therapeutic protein compositions.

[0177] Cell therapy for muscular dystrophy has had limited success, primarily due to poor engraftment of donor cells in fibrotic muscle, especially in the advanced stages of the disease. To overcome this limitation, we developed cell-mediated exon skipping, which utilizes the multinucleated nature of muscle fibers to achieve cross-correction of commensal dystrophic nuclei by nuclear small RNAs such as U7 snRNA, engineered to induce skipping of one or more exons of the dystrophin gene, e.g., exon 51.

[0178] This approach combines the advantages of cell-based therapy and exon skipping while mitigating their respective drawbacks. The inventors found that co-culturing genetically corrected human myoborigin cells with their dystrophic counterparts resulted in dystrophin production at levels several times higher than previously possible, considered therapeutically significant. This advantageously high level of expression is attributed to the diffusion of U7 snRNA into adjacent commensal dystrophic nuclei. Under the same conditions, wild-type MAB cells (co-culturified with 10- or 30-fold excess DMD cells) only slightly increased dystrophin expression levels. When genetically corrected human myoborigin cells were transplanted into immunodeficient mdx mice with exon 51 mutations, they produced dystrophin at levels significantly higher than WT cells, well within a therapeutic range, resulting in force recovery even with engraftment rates of only 3-5%. This level of dystrophin production promises clinical efficacy with the disclosed cell therapy.

[0179] Abnormal calcium homeostasis is characterized by transient (spikes) or sustained increases in cytoplasmic intracellular calcium concentration, as identified, for example, using calcium indicators such as fura2 in calcium imaging assays. These calcium spikes were previously thought to occur to induce muscle contraction in response to neuronal stimulation under physiological conditions, or due to membrane damage that could cause hypercontraction. However, we have now surprisingly found that spikes in cytoplasmic intracellular calcium concentration occur prior to sarcomere aggregation, innervation, and muscle contraction.

[0180] Homeostasis is a stable state of internal physical and chemical conditions maintained by a biological system. A reference to calcium homeostasis refers to intracellular calcium homeostasis. Intracellular free Ca ++ Concentration ([Ca ++ i) Ca under resting conditions varies greatly under different conditions; however, Ca ++ The intracellular concentration of Ca in the extracellular environment ++ It is considerably lower. However, certain intracellular organelles (Ca ++ Mitochondria and sarcoplasmic reticulum, which are known as stores, contain Ca ++ It accumulates, and Ca at a higher concentration than in the cytoplasm. ++ To maintain. Abnormal or dysregulated calcium homeostasis is often a result of damage to the membrane, such as damage caused by the absence of dystrophin. ++ This is caused by dysfunction of channels, exchangers, calcium ion pumps, calcium ion transport channels, and calcium ion-binding proteins.

[0181] Calcium spikes occur spontaneously in muscle cells under the described conditions, i.e., in the absence of muscle nerve innervation [Ca ++ This refers to transient, repeated fluctuations in the relative concentration of ]i. The spikes are caused by Ca from intracellular calcium stores such as the sarcoplasmic reticulum. ++This occurs as a result of the emission of voltage-dependent Ca ++ Blocking the release from these stores using channel inhibitors such as nimodipine or nitrendipine substantially reduces their amplitude. As the inventors have shown in the examples, calcium spikes do not occur in healthy, untreated, and uninnervated myotubes.

[0182] Furthermore, because calcium spikes are transient, they differ from other types of calcium influx that occur as a result of damage (e.g., loss of integrity) to the sarcoplasmic reticulum and / or plasma membrane.

[0183] Methods for identifying and measuring calcium spikes are expected to be known to those skilled in the art and are described herein. For example, a preferred approach is the microscopic imaging method discussed in the examples, in which the status of intracellular calcium is measured using the green fluorescent calcium indicator Fluo-4 AM.

[0184] Calcium spikes can be observed using living cell calcium indicators. Examples of calcium indicators include, but are not limited to, chemical calcium indicators. Chemical calcium indicators are small molecules that bind to calcium ions via chelation. Typically, Ca ++ The binding of to an indicator molecule causes either an increase in the quantum efficiency of fluorescence or a shift in the emission / excitation wavelength. An example of a chemical calcium indicator is Fura-2. This molecule contains Ca ++ In its free form, it has an excitation spectrum at 380 nm (emitted at 500 nm). The molecule is Ca ++ When it binds to [Ca], the excitation shifts to 340 nm (it has the same emission wavelength at 500 nm). Therefore, [Ca] ++ The increase in ] is Ca ++The bound molecule is excited at 340 nm, and the fluorescence intensity from the free form of the dye is simultaneously reduced at 380 nm. Therefore, monitoring the fluorescence intensity over time using an excitation wavelength of approximately 380 nm is possible. ++ As a result of the change in ] Fura-2 is Ca ++ Free form and Ca ++ This is expected to enable the visualization of calcium spikes that occur when switching between binding forms.

[0185] Dystrophin disorders refer to diseases caused by mutations in the DMD gene, which encodes the dystrophin protein found in muscles (Duchenne and Becker muscular dystrophy). As seen in the examples, the inventors have shown that the absence of dystrophin protein binds to and regulates the calcium sensor element of the dihydropyridine receptor (DHPR) complex, Ca, which is known to bind to and regulate ryanodine receptor 1 (RyR1). V It was shown that this causes a reduction in the expression of 1.1. In the absence of dystrophin, Ca V 1.1 Reduction in expression deregulates DHPR, and therefore disregulated or spontaneous Ca ++ It causes a leak.

[0186] In some embodiments, the muscular dystrophy is either Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD).

[0187] In some embodiments, muscular dystrophy is another type of muscular dystrophy caused by mutations in membrane proteins that result in abnormal (i.e., disregulated) calcium homeostasis. A non-exclusive list of such muscular dystrophy includes numerous limb-girdle muscular dystrophys (e.g., 2A, 2D, 2E2I, 2L) and myotonic dystrophy.

[0188] In some embodiments, a therapeutically effective amount of the composition of the first aspect is used to restore calcium homeostasis and thereby treat one or more signs or symptoms associated with the disorder.

[0189] A therapeutically effective dose refers to an amount effective in reducing, alleviating, eliminating, preventing, or inhibiting at least one symptom of a disorder, and can be determined empirically. In various embodiments of the disclosure of the present invention, a "therapeutically effective dose" is an amount sufficient to achieve a statistically significant enhancement of either tissue or cell regeneration, for example, muscle cell regeneration, or to delay cell death, compared to a control.

[0190] Therefore, in some embodiments, the therapeutically effective dose is sufficient to achieve a statistically significant delay in muscle fiber death compared to the control.

[0191] In some embodiments, the therapeutically effective dose is Ca V This is a sufficient amount to increase the expression of 1.1.

[0192] In some embodiments, the therapeutically effective dose is sufficient to prevent or delay muscle fiber death. Methods for measuring the prevention or delay of muscle fiber death are expected to be known to those skilled in the art. These methods include, for example, measuring the level of creatine kinase (an enzyme released by dying muscle fibers) in serum, and assessing the presence of necrotic fibers by hematoxylin and eosin (H&E) staining.

[0193] The delivery of the composition is not limited to any particular dosage form, but generally, with respect to the delivery of MABs and snRNAs engineered to express agrin proteins for use in treating or alleviating the symptoms of the disclosed disorders, the composition is delivered by any suitable means.

[0194] In some embodiments, pharmaceutical use includes intra-arterial and / or intramuscular administration of the composition of the first aspect.

[0195] Composition for use as a medicine In some embodiments, the composition for use according to the first aspect, or the composition for use according to the third or fourth aspect, may contain pharmaceutically acceptable excipients.

[0196] In some embodiments, the composition may be in the form of a cell suspension containing a liquid.

[0197] In some embodiments, the composition may be in the form of an injectable cell suspension.

[0198] In some embodiments, the composition may also contain one or more excipients suitable for use in cell therapy. Such excipients are expected to be known to those skilled in the art.

[0199] In some embodiments, the composition for administration may include a sodium chloride buffer containing human serum albumin (HSA). For example, in some embodiments, the composition for administration may include a 0.9% w / v sodium chloride injection BP containing 1% HSA.

[0200] Treatment method A fifth aspect of the present invention is provided, a method for treating muscular dystrophy, comprising administering a therapeutically effective amount of the composition of the first aspect, or a composition produced by the method of the second aspect, to a subject in need thereof.

[0201] Muscular dystrophy can be characterized by abnormal calcium homeostasis.

[0202] All features described herein (including all accompanying claims, abstracts, and drawings), and / or all steps of any method or process disclosed herein, may be combined with any of the above aspects, except in any combination where at least some of such features and / or steps are mutually exclusive.

[0203] To better understand the present invention and to further illustrate how its embodiments can be put into practice, the accompanying drawings are provided hereby referenced as an example. [Examples]

[0204] The inventors have found that cells in cultures containing both immortalized DMD myofibrillators and primary DMD MAB cells exhibit transient Ca2+ 25- ++ We found that this indicates the appearance of spikes.

[0205] The inventors of this invention have identified these Ca ++ We found that the spike was eliminated by genetic correction resulting in dystrophin reexpression, and further by co-culturing with mouse embryonic motor neurons. Surprisingly, we also found that this effect can be replaced by agrin alone. Agrin is a sensor that modulates the ryanodine receptor complex. V Stabilize 1.1, Ca ++ Eliminates spikes. These findings are related to Ca in DMD muscle cells. ++ This study aims to elucidate a novel early mechanism of dysregulation. This mechanism offers a novel therapeutic strategy for using truncated agrin in the treatment of muscular dystrophy conditions characterized by abnormal calcium homeostasis, particularly the presence of calcium spikes.

[0206] The inventors used either telomerase-immortalized myofibrillators (TIMs) with a frameshift mutation in exon 51, fibroblasts converted by MyoD (22), or primary human hMABs from DMD patients. The inventors generated a novel mouse model incorporating a skippable mutation in exon 51. Myofibrillators were transduced with a lentiviral vector expressing U7 snRNA capable of inducing exon 51 skipping, which was then diffused along the muscle fibers, permanently correcting the commensal dystrophy nuclei in the same region. The inventors demonstrate that this strategy increases therapeutic effect both in vitro and in newly regenerated muscle fibers of a DMD model by co-culturing genetically corrected DMD and uncorrected cells, resulting in abundant dystrophin production within a therapeutically effective range.

[0207] Materials and methods cell myogenic cells Telomerase-immortalized myofibrillator (TIM) cells used in Examples 1-5 were maintained in a 4:1 ratio of 80% DMEM / RPMI199 (Sigma), 20% FBS, 25 mg / mL Dexam (Gibco), 10 mg / mL Gentamicin (Sigma), 25 mg / mL Fetuin (Gibco), and 1× Insulin-Transferrin Selenium-X (Gibco), supplemented with 5 μg / mL hFGF and 500 μg / mL recombinant hEGF. hMABs were maintained in Megacell DMEM, 5% FBS, 0.2% β-Mercaptoethanol (Gibco), 1% LGlut (Gibco), 1% Pen / Strep (Gibco), and 1% Non-essential Amino Acids (Sigma). MyoD-ER(T) fibroblasts were maintained in DMEM (Sigma), 20% FBS, 1% L-Glut (Gibco), 1% Pen / Strep (Gibco), and 1 mM sodium pyruvate (Gibco). TIM cells were differentiated on collagen (Gibco) coated culture dishes using DMEM (Sigma), 10 mg / mL gentamicin (Sigma), and 1× insulin-transferrin-selenium-X (Gibco), while hMAB and MyoDER(T) fibroblasts were differentiated on collagen coated culture dishes using DMEM (Sigma), 4% HS, 1% L-Glut (Gibco), and 1% Pen / Strep (Gibco). Both culture media were supplemented with 1.25 mM forskolin (Sigma) to enhance myotube fusion.

[0208] The cell models used in Examples 6-10 were human immortalized WT and DMD muscle cells produced at Vincent Mouly Lab (Institute of Myology, Paris). DMD cells are characterized by exon 51-specific mutations. In our laboratory, DMD-U7 cells were generated by transduction of DMD cells with a lentiviral vector expressing nuclear small RNA (U7 snRNA) engineered to skip exon 51. Human immortalized muscle cells were mixed with 20% M199 medium (199; Gibco, USA; 22340-020), 20% fetal bovine serum (FBS; SIGMA, USA; F9665-500ML), 50 μg / mL gentamicin (Gent; SIGMA, USA; G1272-10ML), and 25 μg / mL fetuin (FET; Gibco, USA; PSB1005). 2) Cells were cultured in a mixture of Dulbecco's Modified Eagle Medium (DMEM; SIGMA, USA; D5796-500ML) supplemented with human fibroblast growth factor (hFGF) (50 ng / ml; Gibco, USA; 17105-041), human epidermal growth factor (hEGF) (5 ng / ml; Gibco, USA; 2129284), dexamethasone (0.2 μg / ml; SIGMA, USA; D4902-100MG), and insulin (5 μg / ml; Gibco, USA; 51500-056 10ML). The medium was maintained at 4°C and used in subsequent experiments.

[0209] Mouse primary nerve cells (MN) Mouse fetal spinal cord was isolated from E12.5 fetuses. The isolation procedure was performed and the cells were processed under sterile conditions using a dissecting microscope (ZEISS A×10.V16). The isolated spinal cord was rapidly shredded into small pieces and digested in HBBS (1×; Gibco, USA; 14175-053) containing a specific concentration of dispase (2.4 U / ml; Gibco, USA; 17105-041) in a shaking water bath at 37°C for 25 minutes. The cell suspension was then centrifuged at 280×g for 10 minutes. The isolated MN was maintained and cultured using a specific culture medium. The culture medium was prepared as follows: DMEM / F-12 medium (1×; Gibco, USA; 21331-020) was supplemented with 2% B-27 (1×; Gibco, USA; A35828-01), 1% L-GLUT (1×; Gibco, USA; 15140-122), 1% penicillin / streptomycin (P / S) (1×; Gibco, USA; 15140-122), and 10 ug / ml mouse neuron growth factor (1×; Gibco, USA; 17105-041). The medium was then maintained at 4°C and used in subsequent experiments.

[0210] 3D culture of human myotubes and mouse embryonic myotubes (MNs) Human muscle cells were prepared in growth medium, seeded onto layers of collagen-coated plates, and incubated overnight at 37°C and 5% CO2. The growth medium was replaced with differentiation medium prepared using high-glucose DMEM medium supplemented with insulin, gentamicin, and trace amounts of serum to enhance cell differentiation into multinucleated myotubes. On day 6 of differentiation, extracted MN was mixed with Matrigel prepared in MN growth medium and added to the myotubes.

[0211] Wrench Vector Using the lentiviral vector U7#51T2AGFP (denoted as T2AGFP) derived from pCDH.EFK.MCH.T2A.GFP, we enabled co-expression of the reporter gene GFP and snRNA under the same promoter, human elongation factor-1 alpha (EF-1a).

[0212] treatment Nimodipine (Sigma, USA, N-149) was prepared by dissolution in DMSO and stored at -20°C. The stock solution (10 mM) was diluted with DMSO to obtain a working concentration of 10 μM. Nitrendipine (Sigma, USA, N-149) was prepared by dissolution in DMSO and stored at -20°C. The stock solution (10 mM) was diluted with DMSO to obtain a working concentration of 10 μM. Caffeine (Sigma, USA, C-0750) was prepared by dissolution in dH₂O and stored at 4°C. The stock solution (100 mM) was diluted with dH₂O to obtain a working concentration of 10 mM. EGF powder (5 ng / ml; Gibco, USA; 2129284) was reconstituted to 50 ng / ml with PBS, and stored as aliquots at -20°C. The stock solution was freshly prepared to obtain a final concentration of 5 ng / ml. FGF powder (5 ng / ml; Gibco, USA; 2129284) was reconstituted to 500 ng / ml with PBS, and stored as aliquots at -20°C. The stock solution was freshly prepared to obtain a final concentration of 50 ng / ml. Human recombinant agrin powder (50 μg; R&D Systems, USA; 6624-AG) was reconstituted to 300 μg / ml with PBS, and stored as aliquots at -20°C.

[0213] Immunofluorescence Staining Immunocytochemistry (ICC) in Examples 1 to 5: Cells were stained using the following primary antibodies: anti-MyHC MF-20 (Development Studies Hybridoma Bank); anti-Dys MANDRA17 (Development Studies Hybridoma Bank); anti-GFP (Abcam). The secondary antibodies used were anti-mouse Alexa Fluor 546 and anti-chicken Alexa Fluor 488 (Abcam). Nuclei were stained with DAPI (Sigma).

[0214] For immunofluorescence staining of injected and uninjected TA muscle, tissue was dissected, frozen in isopentane cooled with liquid nitrogen, and cleaved in a cryostat (LEICA CM 1850, Leica, Germany) to obtain transverse and longitudinal cryostat fragments. Primary antibodies used, in addition to those mentioned above, were anti-dystrophin DMD (Sigma), anti-α-sarcoglycan (Atlas antibodies), anti-nNOS (R&D system), and anti-LAM A / C (Invitrogen). Secondary antibodies used were anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 546 (Abcam). Nuclei were stained with DAPI (Sigma).

[0215] Immunocytochemistry (ICC) in Examples 6-10: Cells were plated onto one of the 24 multiwell plates coated with collagen I (Thermo Fischer Scientific, USA; 142475), differentiated, washed with PBS for 2 × 10 minutes, fixed in 4% paraformaldehyde (PFA) in PBS at 4°C for 20 minutes, then washed with PBS at room temperature (RT) for 3 × 5 minutes, and incubated with 10% fetal bovine serum (FBS) prepared in PBS at room temperature for 30 minutes. The cells were then permeabilized with 1% BSA in 0.2% Triton in PBS at room temperature for 30 minutes, followed by incubation overnight at 4°C with a primary antibody prepared in permeabilization buffer. The next day, the cells were washed with 1% BSA in 0.2% Triton in PBS for 3 × 10 minutes and incubated with a secondary antibody specific to the host species of the primary antibody at 4°C for 1 hour. Images were acquired using a (ZEISS A×10) inverted microscope and processed and analyzed using (Zeiss Zen imaging software).

[0216] Immunohistochemistry (IHC) in Examples 1-5: Hematoxylin and eosin staining were performed according to the instructions provided by Sigma Aldrich (Hematoxylin H9627 and Eosin 230251, Sigma). Masson's trichrome staining was performed according to the instructions provided for the iron staining kit (HT20 Sigma). Sirius red staining was performed according to the instructions provided for the Picro Sirius red staining kit (Ab 150681, Abcam).

[0217] Immunohistochemistry (IHC) in Examples 6-10: For histological studies, the tibialis anterior muscle was dissected and immediately frozen in liquid nitrogen in preparation for tissue fragmentation. The samples were placed in an optimal cutting temperature compound (OCT) (Thermo Fischer Scientific, USA; LAMB / OCT) and frozen in isopentane cooled in liquid nitrogen. Using a Leica cryostat (Leica, USA; CM-1950), 10-micrometer cross-sections were obtained at -18°C. The fragments were collected on gelatin-coated slides and treated with the primary antibody, mouse anti-Ca V The fragments were incubated overnight at 4°C with 1.1 (1:200; Thermo Fischer Scientific, MA3-920) and rabbit anti-dystrophin (1:1000; Merckmillipore, 574777). The following day, the fragments were washed with PBS and then incubated at 4°C for 1 hour with a secondary antibody specific to the host species of the primary antibody. The nuclei were counterstained using Hoechst stain (1:1000; Thermo Fischer Scientific). Images were acquired using a (ZEISS A×10) inverted microscope and processed and analyzed using (Zeiss Zen imaging software).

[0218] antibody In Examples 6-10: The following primary and secondary antibodies were used at the following concentrations: mouse anti-TUJ1 (1:500; Biolegend, MMS-435P), mouse anti-MyHC (1:3; Developmental Studies Hybridoma Bank MF20), α-Bungarotoxin (BTX, Sigma-Aldrich, T0195), mouse anti-Ca V 1.1 (1:200; Thermo Fischer Scientific, MA3-920), goat anti-mouse (1:500; Thermo Fischer Scientific), goat anti-rabbit (1:500; Thermo Fischer Scientific). The nuclei were counterstained using Hoechst stain (1:1000; Thermo Fischer Scientific).

[0219] In Situ An in-situ assay was performed using the ACDbio RNAscope multiplex fluorescent reagent kit according to the provided instructions. The signal was amplified using LAM A / C and U7 snRNA detection, GFP-specific probes specially designed for us by ACDbio.

[0220] Microscopic imaging Ca in living cells ++Imaging: Intracellular calcium status was measured using the green fluorescent calcium indicators Fluo-4 AM (Invitrogen, USA, F14201), Fluo-2, and improved versions of Fluo-3. After medium removal, differentiated myotubes were loaded with 2 μM Fluo-4 AM prepared in DMSO and diluted in fresh differentiation medium. Cells were incubated at 37°C for 1 hour, followed by washing with differentiation medium for 2 × 5 minutes. During imaging, cells were incubated at 37°C, and images were acquired using a (ZEISS A × 10) inverted fluorescence microscope with 488 nm laser line excitation at 4.2 frames / second. Analysis of acquired images was performed using ImageJ software by measuring the fluorescence intensity over several seconds, and values ​​were normalized to zero fluorescence intensity. Calculations and visualizations were performed using GraphPad Prism (8.4.2).

[0221] Transmission electron microscopy (TEM): Healthy DMD and DMD-U7 myoborigin cells were plated overnight at 37°C and 5% CO2 onto ACLAR embedding film coated with collagen I. The growth medium was then replaced with differentiation medium to promote cell fusion and myotube formation. After 10 days, the cells were fixed with a fixative containing 4% PFA, 2.5% GA, and 0.1 mMEPES. Samples were processed at the Bioimaging Core Facility of the University of Manchester.

[0222] RT-PCR and qRT-PCR In Examples 1-5, total RNA was extracted using TRIzol (Invitrogen) according to the manufacturer's instructions. RNA was reverse transcribed using a cDNA preparation kit (Thermos Scientific). For RT-PCR reactions, the following primers were used: hGAPDH, hMyHC, and hDYS. For qRT-PCR reactions, the following primers were used: hGAPDH, hMyHC, GFP, hDYS47 / 52, and hDYS53. The sequences of the primer pairs are outlined in Table 1. For sequencing, cDNA was extracted using the QIAquick gel extraction kit (Qiagen) according to the provided instructions, and sequencing was performed using GeneWiz.

[0223] [Table 2]

[0224] In Examples 6-10: RNA was extracted from differentiated myotubes. After removing the culture medium, the cells were washed twice with 1×PBS at room temperature. Subsequently, 500 μl of TRIzol reagent (Life Technologies, USA, 15596018) was added for cell recovery and homogenization. The subsequent steps are described in the manufacturing protocol. The extracted RNA was resuspended in nuclease-free water (Invitrogen, USA, 10977-035) and immediately cooled on ice. The eluted RNA was then used for further evaluation of volume and purity or stored at -80°C.

[0225] To synthesize cDNA, the process began with genome digestion, treating each sample with a standardized amount of 1 μg of RNA in DNase buffer (B43, Thermo Fisher Scientific, USA), DNase (EN0525, Thermo Fisher Scientific, USA), and nuclease-free water (Invitrogen, USA, 10977-035). The samples were then incubated at 37°C for 30 minutes, followed by the addition of 1 μl of 0.5 M EDTA (R1021, Thermo Fisher Scientific, USA), and incubation at 65°C for 10 minutes. In the subsequent step, retrotranscription was performed by adding the product obtained by digesting random hexamer primers (SO142, Thermo Fisher Scientific, USA) with nuclease-free water (Invitrogen, USA, 10977-035), followed by incubation at 65°C for 5 minutes. 12 μl of the product was added to a PCR reaction tube containing 5× reaction buffer (5×RT) (00557616, Thermo Fisher Scientific, USA), RNase ribolock RNase inhibitor (EO0381, Thermo Fisher Scientific, USA), dNTP mix (R0191, Thermo Fisher Scientific, USA), and RevertAid reverse transcriptase (200V / μl) (EP0442, Thermo Fisher Scientific). The sample was then amplified using a Mastercycler (epgradient S).

[0226] RT-qPCR was performed using the Roche LightCycler 96 system with the FastStart Essential DNA Master Mix (06924204001, Roche, Swiss). Samples were prepared by adding 10 ng of cDNA to the SYBER Green Master Mix and 10 μM forward and reverse primers (Table 2). Absolute quantification of each target was performed using Roche LightCycler software version 1.5, with a standard curve as the reference.

[0227] [Table 3]

[0228] Western blot In Examples 1-5: Cells were lysed in RIPA buffer (10 mM Tris, 100 mM NaCl, 1 mM EDTA, 1% Triton, 10% glycerol, 0.1% SDS, and 1% protease inhibitor). Protein concentrations were determined using Bio-Rad protein assays. Proteins were separated by cast SDS PAGE with a 4–15% gradient and then transferred to a nitrocellulose membrane using a standard protocol. Blots were incubated with the following antibodies: anti-MyHCMF-20 (Development Studies Hybridoma Bank); anti-Dys MANDRA17 (Development Studies Hybridoma Bank); anti-GAPDH (Abcam); and anti-LAM A / C (Invitrogen). Proteins were visualized by enhanced chemiluminescence (thermoscientific) according to the manufacturer's instructions.

[0229] In Examples 6-10: Cells were washed once with cold PBS supplemented with a cocktail protease inhibitor (78446, Thermo Fisher Scientific, USA) and then removed using a cell scraper. The cell suspension was then centrifuged at 5000 rpm and 4°C for 20 minutes. The cell pellet was resuspended in RIPA buffer containing a cocktail protease inhibitor (100 mm Tris, 100 mm NaCl, 1 mm ETDA, 1% Triton, 10% glycerol, 0.1% SDS) and subsequently centrifuged at 5000 rpm for 10 minutes. 30-50 ng of total protein was loaded onto a 4-12% pre-made gel (Novex, NP0322BOX). Both 10× NuPAGE sample reducing agent (Invitrogen, NP0004) and 4× NuPAGE loading buffer (Invitrogen, NP0006) were added to the sample, and the mixture was heated at 95°C for 10 minutes. The gel was run in 1× NuPAGE SDS running buffer (Invitrogen, NP0001) mixed with NuPAGE antioxidant (Invitrogen, NP0005). The protein was transferred onto a nitrocellulose membrane in the presence of 1× transfer buffer (Invitrogen, NP0006-1). To avoid nonspecific protein binding, the membrane was incubated with 5% fat-free dry milk (Marval) prepared in 1× TBST for 1 hour at room temperature. It was then incubated overnight at 4°C with the desired antibody. The following day, the blot was washed twice at 15-minute intervals using 1× TBST. Next, the blots were incubated with a suitable HRP-conjugated secondary antibody (DAKO, P0448) at room temperature for 1 hour.

[0230] In Vivo In Examples 1-5: NGS mice with a skippable mutation in exon 51 (NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(HLA-A / H2-D / B2M)1Dvs / SzJ) were obtained from Jackson Laboratory (USA). 5 × 10⁻¹⁵ saturates were added to the tibialis anterior (TA) and / or gastrocnemius (G) and / or quadriceps (Q) muscles of the mice. 5TIM cells or hMABs were injected intramuscularly; the contralateral muscle was used as a control muscle that did not receive injection. Mice were sacrificed 30 days after injection. Scid mice (C57BL6 / 10ScSn.Cg-PrkdcscidDMDmdx / J) carrying a spliceable mutation in exon 23 were obtained from Jackson Laboratory (USA). Mice were injected subcutaneously in the back with 5×10 mixed in Matrigel (Corning) plugs 5 TIM cells. Use of animals in this study was approved (license PDB0CF0C2); mice were fed ad libitum and had constant access to tap water.

[0231] In Examples 6 to 10: pregnant female CD1 mice and NGS-DMD mice (NOD.Cg-Prkdc) carrying a spliceable mutation in exon 51 scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M)1Dvs / SzJ) were obtained from Jackson Laboratory (USA) and housed in the animal facility of the University of Manchester. All experiments and procedures were approved by the University of Manchester Animal Welfare and Ethical Review Body (AWERB). All experiments were performed in accordance with the guidelines of University of Manchester Animal Care, under the regulations of the UK Home Office (ASPA1986) and under project license PDB0C0.

[0232] 8-month-old NGS-DMD mice were injected with wild-type human cells. NGS-DMD mice were prepared, injected in the tibialis anterior muscle, and checked periodically. The number of injected cells was evaluated and optimized in a prior pilot study conducted in our laboratory.

[0233] Motility assay Sixteen male NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(HLA-A / H2-D / B2M)1Dvs / SzJ mice were divided into four groups: four wild-type mice, four DMD-untreated mice, four wild-type DMD mice transplanted with TIM cells, and four DMD mice transplanted with DMD-U7 cells. 0.5 × 10⁶ cells were applied to the TA, Gas, Quad, and both hind limbs of the mice. 6 The drug was administered intramuscularly. Thirty days later, the mice were placed alone in a home cage with a running wheel for five days. The mice were expected to be able to run and move around naturally. Their activity was continuously monitored.

[0234] statistical analysis In Examples 1-5: To ensure statistically significant differences were measured even with different experimental procedures, all in vitro experiments were repeated three times in three-part series. However, for cross-correction experiments, the amount of expressed protein was quantified by densitometric analysis of the Western Blue (WB) and compared with different samples using a t-test performed with GraphPad Prism 9.0 software.

[0235] In vivo experiments were conducted with a group of six animals. This represents the best compromise between the 3R guidelines and the need for reproducible and consistent results. All in vivo data were analyzed using GraphPad Prism 9.0 software. T-tests were used for comparisons and analyses between different animal populations.

[0236] In Examples 6-10: All illustrations and statistical analyses were performed using software (Microsoft) or GraphPad Prism (8.4.2). Data were presented as mean ± standard deviation (SD). Statistical analysis was performed, and differences were considered statistically significant if the p-value < 0.05.

[0237] Example 1 - Exon skipping mediated by cells induced by the lentiviral vector U7#51T2AGFP Working with myobiogenic cell lines isolated from DMD patients that are capable of long-term expansion and proliferation, and to avoid inter-patient variability, the inventors chose to work with immortalized myobiogenic cell lines having a deletion in exons 48-50 (Δ48-50). These cells (referred to as TIM) were immortalized with telomerase and CDK4. These cells can expand and proliferate indefinitely and maintain replication ability and robust muscle differentiation even in late passages. The inventors also used a similarly immortalized WT control line with similarly high differentiation efficacy. The inventors confirmed the results with DMD fibroblasts converted to muscle using adenovectors expressing primary MAB and MyoD from DMD patients. To correct genetic defects via exon skipping, the inventors constructed a third-generation SIN lentiviral vector (LV) expressing U7 nuclear small RNA under transcriptional regulation of the human EF1-α ubiquitous promoter. This is engineered to skip the acceptor and donor splice sites of exon 51, thus resulting in the restoration of the correct reading frame. To facilitate the detection of transduced cells, the vector also expresses GFP after the T2A site. A control vector expressing only GFP was also produced. Figures 1C and 6C reveal, as elucidated by FACS analysis, that at a low MOI (0.8), approximately 80% of cells were transduced by the U7#51T2AGFP LV and more than 90% were transduced by the control GFP LV (Figure 1C). Co-culture of transduced and untransduced cells in 1:10 and 1:30 ratios resulted in a stepwise reduction of fluorescence (Figure 6C).

[0238] Next, the inventors tested the ability of U7#51T2AGFP LV to induce cell-mediated exon skipping, and thus a shorter version of dystrophin. Total RNA was extracted from myotubes differentiated from either LV-corrected or uncorrected DMD, and RT-PCR was performed using the generated cDNA. Human muscle biopsies were used as a positive control to show the size of full-length dystrophin (900 bp). A band of approximately 400 bp was observed in all samples from DMD TIM myotubes. A second dystrophin band of approximately 250 bp (the size of the shorter dystrophin) was seen only in cells transduced with LV and indicated dystrophin mRNA produced by exon skipping via U7#51T2AGFP (Figure 1A). Sequencing of the 250 bp band showed that it corresponds to Δ47–52 (Figure 1B). This result confirms the ability of U7#51T2AGFP to induce exon skipping.

[0239] To test the ability of Δ47-52 dystrophin mRNA to produce protein, immunofluorescence (IF) staining was performed to visualize dystrophin protein in DMD TIM cells and genetically corrected DMD TIM cells (hereinafter referred to as DMD-U7). To test whether U7 snRNA diffuses to adjacent DMD nuclei and thereby corrects dystrophin produced in these nuclei, DMD-U7 cells were co-cultured with DMD TIM cells in 1:10 and 1:30 ratios to simulate 10% and 3% in vitro cell engraftment, respectively (Figure 1C, Figure 6C). Figure 1D shows integrated images of the 1:10 and 1:30 co-cultures, where dystrophin (red) expression extends well beyond the GFP (green) expressing region in the cytoplasm of multinucleated myotubes, as indicated by the arrows. Individual fluorescence channels are shown in Figures 6A-B. These results demonstrate a cross-correction of dystrophin by U7#51T2AGFP, resulting from its diffusion into adjacent dystrophy nuclei.

[0240] Next, the inventors tested whether snRNA diffusion and exon skipping could be induced in adjacent dystrophic nuclei by qRT-PCR on DMD-U7 cells and DMD TIM cells co-cultured in 1:10 and 1:30 ratios (Figure 1E). Quantification of differentiation levels using MyHC expression confirmed the IF analysis, as no significant differences were recorded across all conditions (Figure 1E) (Figure 6A-B). GFP expression was directly compared to dystrophin expression to evaluate the level of dystrophin obtained by cross-correction. GFP expression decreased proportionally to the ratio of transduced cells to untransduced cells. In contrast, the 1:10 and 1:30 co-cultures showed higher dystrophin expression compared to GFP. Dystrophin expression of nearly 40% (a fourfold increase) and 20% (an approximately sevenfold increase) was observed in cells co-cultured at ratios of 1:10 and 1:30, respectively (Figure 1E), confirming the ability of snRNA produced by U7#51T2AGFP to induce cross-correction of adjacent nuclei and thus amplify dystrophin production.

[0241] Example 2 - Intracellular diffusion of snRNA produced by U7#51T2AGFP To demonstrate the potential intracytoplasmic diffusion of U7 snRNA from the original transduced nucleus to adjacent dystrophy nuclei within the same myotube, we performed dual in-situ hybridization with specific mRNA probes. One probe was for U7 snRNA (red), and the other for GFP mRNA (green). In contrast, GFP mRNA was localized in the cytoplasm surrounding a single donor nucleus (green arrow), while the snRNA diffused along most of the available cytoplasm within the same myotube (red arrow), which was observed where no nuclei expressing GFP mRNA were detected (Figure 2A). These results demonstrate the ability of U7#51T2AGFP snRNA to diffuse along myotubes and enter adjacent nuclei that were not genetically corrected.

[0242] Example 3 - In vitro dystrophin protein expression induced by U7 snRNA To quantify the protein expression produced by nuclear cross-correction, the inventors performed a Western blot assay (WB). Proteins were extracted from co-cultures of DMD-U7 and DMD-TIM cells at ratios of 1:10 and 1:30. As a control, WT TIM cells were co-cultured with DMD-TIM cells under the same conditions. The level of differentiation was quantified by analyzing myosin heavy chain (MyHC), which did not show a significant difference in expression between the different samples (Figure 2B). As expected, DMD-TIM cells did not produce any dystrophin protein, whereas dystrophin protein expression was detected in WT TIM cells, and at a lower level in DMD-U7 cells. However, dystrophin expression at a 1:10 dilution was already higher in the co-culture of DMD-TIM and DMD-U7 cells than in the co-culture of DMD-TIM and WT TIM cells. At a 1:30 dilution, dystrophin was still clearly detectable in co-cultures of DMD TIM and DMD-U7 cells, but not in co-cultures with WT TIM cells. Western blotting (densitometry) showed only a 1.2-fold increase in dystrophin expression in DMD TIM cells co-cultured with DMD-U7 cells at 1:10 and 1:30 ratios (50% and 20% WT TIM cells) compared to co-cultures of WT TIM cells and DMD TIM cells at the same ratios, indicating robust dystrophin expression.

[0243] To determine whether cross-correction of snRNA-mediated exon skipping is effective with other types of myobiocytes, we co-cultured DMD-U7 and WT TIM cells with two different types of DMD myobiocytes: mesodermal angioblasts derived from DMD patients (DMDhMAB) or fibroblasts converted by MyoD (DMDMyoDERTFbs). Dystrophin protein expression was detected in all different co-cultured samples (Figure 2C, 2D) with the same trend in all cases. Quantification of protein expression showed increased dystrophin protein expression in DMD-U7 cells compared to WT TIM cells in all co-cultures. This result confirms that this phenomenon is not specific to immortalized cells and that, under all conditions, dystrophin protein production is not necessarily attributable to WT nuclei, but is also produced in adjacent dystrophy nuclei corrected by U7 snRNA produced by genetically corrected nuclei.

[0244] These data demonstrate that snRNA-based strategies enhance dystrophin protein production through cross-correction of adjacent nuclei of dystrophy contained within the same myotube.

[0245] Example 4 - In vivo dystrophin protein expression induced by U7 snRNA Next, the inventors analyzed the efficiency of an in vivo exon skipping strategy in which transplanted human cells fuse with resident dystrophy myofiocytes to form hybrid regenerated muscle fibers. Mouse cells were also corrected because the acceptor and donor splice sites were humanized. In preliminary experiments, the inventors repeated in vitro dilution experiments by co-culturing DMD-U7 and DMD TIM cells in a 1:10 ratio in Matrigel plugs implanted under the dorsal skin of mdx / SCID mice (n=3). 100% DMD-U7 cells were used as a control in similar Matrigel plugs implanted under the dorsal skin of the same mice (Figure 8A). After one month, the inventors harvested plugs containing only multinucleated muscle fibers from two mice. IF analysis showed significant dystrophin expression even in samples diluted to 1:10, while WB analysis showed substantially the same amount of dystrophin protein, detected in both plugs containing only DMD-U7 cells and plugs containing only 1 / 10 DMD-U7 and 9 / 10 DMD-TIM cells (Figure 8B).

[0246] The currently used mdx mice have a mutation in exon 23 and are unsuitable for cell-mediated exon skipping by snRNA engineered to skip exon 51. For this reason, we have generated NSG mice with a skippable exon 51 mutation. These mice (defined for simplicity as NSG-mdx-Δ51) are fully immunodeficient and develop muscular dystrophy like typical mdx mice, with a degenerative peak around 1 month of age and a progressive but relatively mild dystrophy phenotype that worsens after 1 year of age (Figure 7A).

[0247] The inventors have found that the same number (5 × 10) can be used in NSG-mdx-Δ51. 5Either DMD-U7 or WT TIM cells were injected (individual cells). In other animals, the inventors also injected either DMD-U7 hMAB or WT hMAB. To evaluate dystrophin correction at the protein level, the inventors performed WB analysis of injected tibialis anterior muscle (TA) one month after a single intramuscular injection. WB analysis showed recovery of dystrophin expression in skeletal muscle with both TIM cells and hMAB (Figures 3A and 3B). As shown in Figure 3A, TA injected with DMD-U7 cells showed approximately 60% of the protein levels detected in WT muscle, while TA injected with WT TIM showed protein recovery, but at lower levels compared to DMD-U7 cells (approximately 20%), suggesting the ability of snRNA to induce expression even in genetically uncorrected, adjacent nuclei. Similar results were observed in TA injected with DMD-U7 hMAB and WT hMAB (Figure 3B), with approximately 50% and 10% dystrophin expression, respectively. It is estimated that 30% of normal dystrophin levels would provide therapeutic benefit to DMD patients. Infusion of muscle fragments from TA injected with either WT TIM or DMD-U7 cells confirmed the restoration of dystrophin (Figure 3C), α-sarcoglycan (sargoclycan), and nNOS (Figure 3D) expression.

[0248] To test whether the extremely high levels of dystrophin expression were due to the genetic correction of resident nuclei mediated by the intracytoplasmic diffusion of U7 snRNA from the nuclei of the original transduced, injected cells, we performed dual in-situ hybridization using specific mRNA probes, one for snRNA (red) and the other for human LAM A / C (green). The snRNA diffused along most of the available cytoplasm within the same muscle fiber, even to areas where no nuclei expressing LAM A / C mRNA were detected (Figure 4A). These results demonstrate the ability of U7#51T2AGFP snRNA to diffuse along muscle fibers and enter adjacent, genetically uncorrected nuclei, explaining the efficacy of a single cell injection in restoring dystrophin protein expression to up to approximately 60% of WT levels, a result previously only achievable with AAV injection.

[0249] Considering the mechanism discussed above, the inventors demonstrated that lowering the dose of injected cells would not proportionally reduce the amount of dystrophin produced. To test this hypothesis, the inventors injected 5, 2.5, 1.25, and 0.62 × 10¹⁶ cells into the TA of NSG-mdx-Δ51 mice. 5 The inventors injected individual cells. One month later, they performed a WB analysis of the extracted proteins. Figure 4B shows that even at the lowest cell dose (12.5% ​​of the maximum dose), approximately 50% of the maximum dose of protein was detected, normalized by LAM A / C analysis, which detects the number of human cells present.

[0250] Example 5 - Motility Assay The inventors also evaluated whether increased dystrophin production restored mouse motility. NSG WT mice and NSG-mdx-Δ51 mice, some of which were transplanted with either WT TIM, DMD TIM, or DMDU7 cells, had their spontaneous motility monitored in real time for four consecutive days. NSG-mdx-Δ51 mice showed a 50% reduction in motility compared to NSG WT mice (Figure 3C); the same mice transplanted with DMD-U7 cells showed up to 70% recovery of spontaneous motility compared to WT animals, while mice transplanted with WT TIM cells showed only very little recovery (Figure 3C).

[0251] Example 6 - Dystrophin deficiency in early differentiated DMD myotubes Ca 2+ Causes leakage The inventors of the present invention have found that Ca ++ As revealed by the indicator Fura-2, we found that early-differentiated DMD myotubes that were not innervated by nerves showed repeated spikes, while healthy myotubes did not (Figure 9A, 9B). Interestingly, DMD-U7 myotubes showed detectable Ca ++ Since no leakage was observed (Figure 9C), dystrophin expression was determined to be Ca ++ It is shown to be necessary and sufficient to prevent the appearance of spikes. Furthermore, myotubes derived from DMD mesodermal angioblasts also exhibit transient Ca2+ activity not observed in myotubes derived from healthy mesodermal angioblasts or in DMD-derived myotubes or genetically corrected myotubes. ++ The presence of spikes was also found (Figure 16, A-C).

[0252] Example 7 - Calcium regulatory genes are downregulated in DMD myotubes. Ca ++ To determine whether alterations in homeostasis can be caused by changes in the expression of genes encoding ion channels or sensors, the inventors analyzed relative mRNA expression levels using quantitative PCR analysis. In DMD myotubes, the inventors identified DHPR skeletal muscle L-type alpha 1 subunit (Ca VWe observed a significant reduction in the calcium voltage-gated channel subunit alpha-1S (CACNA1S) and sodium voltage-gated channel alpha-4 (SCN4A) genes encoding 1.1) (Figure 11A-B). In contrast, these genes were expressed to levels comparable to healthy cells in DMD-U7 myotubes (Figure 11A-B). On the other hand, RyR1 and transient receptor potential cation channel subfamily C (TRPC1) were slightly upregulated in DMD cells, and there were no significant changes in DMD-U7 myotubes compared to healthy myotubes (Figure 11C-D). Finally, we found that the beta-I and Δ subunits of AChR were reduced in DMD myotubes.

[0253] L-type voltage-gated calcium channel (VGCC) Ca V 1.1 The isoforms are located in the sarcoplasmic sheath and T-tubules, where they interact to modulate RyR1; it is exclusively expressed and highly regulated in skeletal muscle. Ca V 1.1 is Ca ++ To test whether it contributes to leakage, the inventors used a DMD muscle tube and Ca ++ The cells were treated with specific inhibitors such as nimodipine and nitrendipine to eliminate the spikes (Figure 9F-L). On the other hand, direct stimulation of calcium release from RyR1 did not show significant changes in DMD compared to healthy cells (Figure 9H-J).

[0254] Example 8-Ca ++ Spikes do not induce muscle contraction; this is the action of motor neurons. The inventors of this invention have found that under these culture conditions, Ca ++ We observed that muscle contraction did not occur following the spike, and hypothesized that this was due to the absence of a developed and mature contraction mechanism. To test this, we performed transmission electron microscopy (TEM) on healthy DMD and DMD-U7 myotubes (Figures 15A-C). In all cases, we observed the initial aggregation of thick and thin filaments and the early formation of Z-lines, which we hypothesized was due to the absence of a developed and mature contraction mechanism. ++This explains why, despite the spikes, no spasmodic myotubes were observed. The inventors then hypothesized that co-culturing with motor neurons might promote myotube maturation and the development of contractile activity. Indeed, bungarotoxin stained neuromuscular junction (NMJ) formation (Figure 10D), and TEM showed that sarcomerogenesis was progressing, but the myotubes had not yet reached the point where they could contract. Surprisingly, the inventors found that under conditions where motor neurons were not stimulated, Ca in innervated DMD myotubes was present. ++ The disappearance of spikes was observed. In healthy or DMD-U7 myotubes, Ca ++ No spikes appeared (Figure 10A-C). Ca in the absence of motor neuron stimulation. ++ The fact that the spike disappeared suggests that molecules released at the NMJ level may be involved in the observed effect.

[0255] Example 9 - In DMD myotubes, agryn is Ca ++ Eliminates spikes and restores normal expression of calcium regulatory proteins. Agrin is involved in NMJ formation. Surprisingly, when agrrin is added to DMD myotube cultures at any concentration tested in the μM range, Ca is produced in DMD myotubes. ++ The elimination of the spikes suggests that the action of muscle innervation occurs via the release of agrin (Figure 9D). To understand the mechanism of action of agrin, the inventors proposed that agrin is Ca ++ We investigated whether agrin brings about the expression and / or stability of proteins involved in homeostasis. We found that the expression of CACNA1S and SCN4A in DMD myotubes treated with agrin was restored to normal levels (Figure 12A-B). We also found that both RyR1 and TRPC1 were expressed at normal levels in DMD myotubes treated with agrin (Figure 12C-D). These results suggest that in skeletal muscle, agrin brings about Ca ++ It has been shown that it plays a role in regulating the expression of homeostasis genes, and therefore its Ca ++The action on the spike is described below.

[0256] Example 10 - Both dystrophin and agryn are Ca V 1.1 Essential for expression Western blot analysis showed that Ca V 1.1 expression was significantly reduced in DMD myotubes, but recovered in DMD-U7 myotubes (Figure 11J). These findings are consistent with those observed at the mRNA level, indicating that the absence of dystrophin affects Ca at a very early stage of differentiation V 1.1 structure and expression negatively. Surprisingly, in agrin-treated DMD myotubes, Ca V 1.1 expression was restored (Figure 12H).

[0257] Ca V To confirm the role of dystrophin in regulating 1.1 expression in vivo, we analyzed the tibialis anterior (TA) muscle of NSG-mdx mice that had previously been transplanted with healthy human myoblasts (Figure 14). We found that only dystrophin-expressing muscle fibers have Ca V 1.1 shows strong expression, which is barely detectable in uncorrected muscle fibers in DMD (Figure 11K). These results indicate that Ca V 1.1 expression is associated, either directly or indirectly, with dystrophin expression in mature muscle fibers in addition to early-stage muscle fibers.

[0258] Example 11-C95 A0B0 truncated agrinprotein is Ca ++ Eliminate the leak Figures 17A to 17C show that expression of full-length agrin enables, in vitro and in vivo, Ca ++ to block spikes and Ca V to upregulate 1.1. When transplanted into dystrophic muscle in vivo, dystrophin-expressing fibers also express Ca V 1.1 (Figure 17C).

[0259] The domain structure of the agrin protein is shown in Figure 17D. The domain at the C-terminus of the agrin protein is highlighted to distinguish between the A / y insertion site and the B / z insertion site.

[0260] As shown in Figure 17E, the expression of the C95 A0B0 truncated agrin protein fragment is Ca ++ It was found to eliminate leakage (left panel), but this effect was not observed with the expression of the corresponding C95 A4B8 truncated agrin protein (right panel).

[0261] Example 12 - Miniagrin protein expression is Ca ++ Eliminate the leak As shown in Figure 9, the inventors of the present invention have found that Ca ++ As revealed by the indicator Fura-2, we found that early-differentiated DMD myotubes that were not innervated by nerves showed repeated spikes, while healthy myotubes did not (Figures 9A, 9B).

[0262] The inventors have found that after transduction of DMD myogenic cells using a lenti vector expressing miniagrin, Ca ++ We found that the spikes disappeared (Figure 19). This is consistent with the finding in Example 11 that C95A0B0 miniagrin prevents calcium spikes. DMD myotubes transfected with miniagrin showed detectable Ca ++ No leakage was observed (Figure 19B).

[0263] Ca in cells transduced with an embedded lentiviral vector ++ The absence of spikes suggests that the correction may be permanent, and that miniagrin expression in DMD cells is transient Ca ++ This suggests that spikes can be permanently prevented.

[0264] Example 13 - Miniagrin protein expression or U7snRNA is Ca V 1.1 Induce expression The inventors have found that reduced Ca in DMD myotubesV 1.1 The expression was observed (Figure 11A-B), and as explained in Example 11, the expression of full-length agrin was observed in vitro and in vivo. V We found that it is possible to adjust 1.1 upwards.

[0265] Consistent with these findings, we have discovered that Ca in DMD muscle cells V We also found that the expression of 1.1 could be restored by transduction using a lentivector expressing U7 snRNA (Figure 20C), or by transduction using a lentivector expressing miniagrin (Figure 20D).

[0266] Consideration The inventors have found that in different types of DMD myofibrillators, repeated Ca2+ activity occurs at high frequency. ++ The appearance of spikes was observed but not in their healthy counterparts. The relationship between these spikes and the absence of dystrophin had not been previously investigated or reported. The spikes were observed to occur in the early stages of differentiation when sarcomere formation is incomplete and therefore the cells cannot contract. This allowed the phenomenon to be studied independently of any mechanical action resulting from contraction. Voltage-dependent Ca such as nimodipine or nitrendipine... ++ Since the channel inhibitor eliminated the spike, it is suggested that the DHPR-RyR1 complex is involved in this leakage when dystrophin is absent from the muscle membrane. Indeed, when cell-mediated exon skipping restores dystrophin expression, Ca ++ The spikes have disappeared.

[0267] To promote myotube maturation during culture, we developed a 3D co-culture system using fetal mouse motor neurons that are physically separated from the myotubes by a Matrigel layer, as elucidated by bungarotoxin staining, but are in contact with the myotube surface and project axons that induce the assembly of Ach receptors. Under these conditions, and in the absence of any neuronal stimulation, Ca ++The spike disappeared. Therefore, the inventors of the present invention, Ca ++ We hypothesized that the absence of spikes is due to secretion rather than electrical activity of motor neurons. Therefore, we investigated agrin, which is involved in regulating the assembly of Ach receptors and provides junctions to the basement membrane in congenital muscular dystrophy MDC1A, caused by mutations in laminin 211.

[0268] In an investigation into membrane proteins whose expression is reduced in the absence of dystrophin and which may be restored in DMD-U7 cells, we found that Ca ++ Sensor Ca V 1.1 was dramatically reduced in DMD cells, but after genetic correction, it was observed to be expressed at the same level as healthy cells, though not at a higher level. V 1.1 is the only isoform expressed in skeletal muscle and is part of the DHPR complex, which is linked to Ca via RyR1. ++ Regulates outflow. The inventors have found that exposure of DMD myotubes to agrin is Ca V We found that it dramatically increases the expression of 1.1, but this is Ca ++ It correlates with the disappearance of spikes. Therefore, both dystrophin and agrin, Ca ++ To prevent spikes, Ca ++ The sensor is Ca V 1. Regulates the expression of 1.1.

[0269] Based on the findings of the present invention, the inventors propose the model illustrated in Figure 13. The findings of the present invention show that agryn, like dystrophin, stabilizes dystroglycans on the membrane, which in turn stabilizes Ca in the complex. V 1.1 suggests maintaining directly or indirectly. DHPR and RyR1 release Ca from the internal store. ++ It forms a complex that regulates efflux. In the absence of dystrophin, Ca V 1.1 Reduction in expression deregulates DHPR, and therefore Ca ++ It causes disregard of efflux. Re-expression of dystrophin or addition of aglin causes CaV This leads to the re-expression of 1.1, Ca ++ It eliminates the spikes. Notably, when healthy human myogonia are injected into the muscles of NSG-DMD mice, only the fibers expressing dystrophin express Ca V It expresses 1.1.

[0270] In a study using mesodermal angioblasts as donor cells to fuse with regenerating muscle fibers and produce U7 nuclear small RNA to induce dystrophin exon skipping, the inventors found that U7 snRNA diffuses along the muscle fibers and enters adjacent nuclei, amplifying dystrophin production several times over, thereby providing a therapeutic effect.

[0271] Considering the clear and surprising finding that U7 snRNA delivered by mesodermal angioblast cell therapy can diffuse along muscle fibers, we have identified the use of mesodermal angioblasts as a favorable medium in cell therapy approaches for the delivery of agryn for use in treating muscular dystrophy characterized by the presence of calcium spikes, specifically for reducing or preventing calcium spikes in these conditions. Although agryn is expressed in NMJs, when administered by mesodermal angioblast cell therapy, it diffuses along muscle fibers, Ca V It induces the expression of 1.1, Ca ++ It is expected that the spikes will be eliminated.

[0272] Agrin is a large molecule, and its heparan sulfate chain has a strong negative charge, which may limit its diffusion across muscle fibers. Mini-agrins have been shown to exert this function, and being small and diffusible molecules, functional truncated agrin proteins are more effective than agrin, Ca ++ We provide tools to eliminate leaks.

Claims

1. A mesodermal angioblast composition, wherein the mesodermal angioblasts (MABs) are engineered to express a truncated agrin protein.

2. The donor from whom the aforementioned MAB originates is (a) Subjects with muscular dystrophy; or (b) Healthy subjects The composition according to claim 1.

3. The composition according to claim 2, wherein the muscular dystrophy disorder is a muscular dystrophy disorder characterized by abnormal calcium homeostasis.

4. The composition according to any one of claims 1 to 3, wherein the shortened agrin protein is a shortened agrin protein having a length of 4 to 40% of the length of the natural agrin protein based on the number of amino acid residues.

5. The composition according to any one of claims 1 to 4, wherein the shortened agrin protein is a shortened agrin protein comprising or consisting of 1 to 12 domains derived from domains present in natural agrin proteins.

6. The composition according to claim 5, wherein each of the one or more domains of the shortened agrin protein has at least 90% sequence identity with a corresponding domain present in a natural agrin protein.

7. The composition according to claim 5 or 6, wherein each of the plurality of domains is derived from a domain present in the C-terminal portion of the natural agrin protein.

8. The composition according to any one of claims 1 to 7, wherein the shortened agrin protein is the A0B0 agrin isoform.

9. The aforementioned shortened agrin protein (a) It is possible to bind to α-dystroglycan; (b) Inability to induce aggregation and / or phosphorylation of acetylcholine receptors (AChR); and / or (c) The composition according to any one of claims 1 to 8, which, when expressed in culture of DMD muscle fibers, can reduce or eliminate cytoplasmic calcium spikes.

10. The composition according to any one of claims 1 to 9, wherein the MAB is modified to additionally express nuclear small RNA (snRNA) capable of inducing exon skipping in the premRNA transcript of dystrophin.

11. The composition according to claim 10, wherein the snRNA is a modified uridine-rich 7 (U7) snRNA.

12. The composition according to claim 11, wherein the snRNA sequence consists of or includes the RNA sequence of Sequence ID No.

1.

13. The composition according to any one of claims 10 to 12, wherein the snRNA comprises a sequence of bases that specifically hybridize to the region of the premRNA transcript of dystrophin, thereby inducing skipping of one or more dystrophin exons.

14. The composition according to claim 13, wherein the snRNA induces skipping of dystrophin exon 51.

15. The composition according to any one of claims 10 to 14, wherein the MAB is manipulated to express a plurality of different snRNAs.

16. A composition according to any one of claims 1 to 15 for use as a pharmaceutical.

17. The composition according to claim 16 for use in treating muscular dystrophy disorders.

18. A composition for use according to claim 16 or 17, for personal use.

19. A composition for use according to any one of claims 16 to 18, in the form of an injectable cell suspension.

20. A method for producing the composition according to any one of claims 1 to 19, comprising transduction in vitro into a MAB with a vector for expressing a truncated agrin protein.

21. The method according to claim 20, wherein the vector is configured to express both a truncated agrin protein and a nuclear small RNA (snRNA) capable of inducing exon skipping in the premRNA transcript of dystrophin.

22. The method according to claim 20, further comprising transducing in vitro the MAB with a second vector for expressing a nuclear small RNA (snRNA) capable of inducing exon skipping in the premRNA transcript of dystrophin.

23. The method according to any one of claims 20 to 22, wherein the first and / or second vector comprises a lentiviral vector.

24. The MAB is obtained in advance from a donor, and the method includes expanding and growing the MAB in vitro and transducing cells with a lentiviral vector, and the donor from which the MAB originates is (a) Subjects with muscular dystrophy; or (b) Healthy subjects The method according to any one of claims 20 to 23.

25. A method for treating muscular dystrophy, comprising administering a therapeutically effective amount of the composition according to any one of claims 1 to 15 to a subject in need thereof.

Images