DNA-dependent protein kinase inhibitors and compositions having a cross-linked ring skeleton, and their applications to genome editing.

Abstract

This disclosure relates to formula (I) The present invention relates to DNA-PK inhibitors having TIFF2026530608000310.tif54160, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof, methods for producing the same, compositions thereof, and methods for using compounds of formula (I) in combination with DNA cleavage factors.

Description

[Technical Field]

[0001] [Related applications] This application claims priority to U.S. Provisional Application No. 63 / 578,851 filed on 25 August 2023 and U.S. Provisional Application No. 63 / 647,467 filed on 14 May 2024, both of which are incorporated herein by reference.

[0002] [Technical field] This disclosure generally relates to compounds, compositions, methods, and kits for improving genome editing efficiency by administering DNA protein kinase (DNA-PK) inhibitors having general formula (I) and genome editing systems to eukaryotic cells. More specifically, this disclosure relates to compositions comprising a DNA-PK inhibitor of general formula (I), methods for inserting a target polynucleotide into the genome of a eukaryotic cell, and kits for inserting a target gene into the genome of a eukaryotic cell. These methods and kits can improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells (particularly CRISPR recombinant CAR-T cells).

[0003] [Referenced by sequence listings] This application includes a sequence listing submitted in XML format via EFS-WEB, which is incorporated by reference in its entirety. The XML file is named "055920-611P01US_SeqList_ST26.xml", created on August 24, 2023, and has a size of 75KB. [Background technology]

[0004] Developing cost-effective and reliable methods for precisely targeting and modifying the genomes of living cells has been a long-standing goal. Genome editing offers the potential to remove genes causing specific diseases (i.e., gene "knockout"), or to correct gene deletions or enhance biological processes through "knock-in" by providing methods for gene manipulation or insertion. Genome editing can be applied to the treatment of numerous diseases, including genetic disorders, hematological disorders, and cancer, as well as immunotherapy. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-related (Cas) systems are immune mechanisms present in prokaryotes (Ishino et al., Journal of Bacteriology 169:5429-5433 (1987)), and immunity against viruses and plasmid nucleic acids can be obtained by sequence-specific targeting (Soret et al., Nature Reviews Microbiology 6:181-186 (2008)). Since the discovery of the CRISPR system, several groups have conducted extensive research on its potential applications in the field of genetic engineering, including gene editing (Jinek et al., Science 337(6096):816-821 (2012); Cong et al, Science 339(6121):819-823 (2013) and Mali et al., Science 339(6121):823-826 (2013)). The CRISPR-Cas9 gene editing system has been effectively used in a variety of biological species and cell lines.

[0005] Cas9 endonuclease induces double-strand DNA breaks at target sequences located upstream of protospacer adjacent motifs (PAMs). Subsequently, the target sequence can be removed, or a desired sequence can be inserted into the target sequence using the cell's endogenous repair pathways. These endogenous DNA repair pathways include non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and homologous recombination repair (HDR).

[0006] The NHEJ, MMEJ, and HDR pathways all repair double-strand DNA breaks, but such repairs can result in insertions or deletions at the break site. The NHEJ pathway does not require a template for DNA break repair. While NHEJ repair is prone to errors, the presence of a complementary overhang reduces errors. The NHEJ and MMEJ pathways are mechanistically distinct DNA repair pathways, each involving different groups of DNA repair enzymes. Unlike the NHEJ pathway, which can sometimes repair accurately and sometimes incorrectly, the MMEJ pathway is always error-prone, resulting in both deletions and insertions at the repair site. Deletions associated with the MMEJ pathway are due to microhomology (2-10 base pairs) present on both sides of the double-strand break. In contrast, the HDR pathway requires a homologous template to direct repair, but generally performs repairs faithfully and is less prone to errors. Therefore, repair of double-strand DNA breaks via the HDR pathway is preferable to repair via the NHEJ or MMEJ pathways. However, in many cell types, the HDR pathway is restricted by the activity of the NHEJ pathway, which operates at all stages of the cell cycle, and the HDR pathway is mainly active during the S / G2 phase of the cell cycle (Mao et al., Cell Cycle, 7:2902-2906 (2008)).

[0007] The ability to precisely modify the genome of any cell has improved with the recent discovery and introduction of CRISPR / Cas9 editing technologies. However, directing and introducing desired changes to specific loci is limited by the fact that the primary cellular repair pathway operating after Cas9-mediated DNA cleavage is the error-prone non-homologous end joining (NHEJ) pathway. Homologous recombination repair (HDR) is less efficient than NHEJ, resulting in reduced editing efficiency in eukaryotic cells. While the incidence of insertions and deletions caused by NHEJ can reach up to 70% in some reports, HDR efficiency remains low, at less than 1%. Therefore, there is a need to improve genome editing efficiency, particularly HDR efficiency.

[0008] Studies have shown that decreased NHEJ activity in vivo leads to increased HDR activity, and this phenomenon can be utilized to improve the efficiency of CRISPR / Cas9 precision genome editing via the HDR pathway (Pierce et al. Genes Dev., 15, 3237-3242 (2001); Ma et al. RNA Biol., 13, 605-612 (2016); Maruyama, et al. Nat. Biotechnol., 33, 538-542 (2015); Robert et al. Genome Med., 7, 93 (2015)).

[0009] DNA-dependent protein kinases (DNA-PKs) are serine / threonine kinases located in the nucleus and have been shown to be essential for DNA double-strand break repair mechanisms. In mammals, the primary pathway in DNA double-strand break repair is the non-homologous end joining (NHEJ) pathway, which functions at any stage of the cell cycle, removing unjoinable ends and joining broken ends. There is a need for potent and selective DNA-PK inhibitors (DNA-PKi) that improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells such as CRISPR CAR-T cells by transiently inhibiting the NHEJ pathway and promoting DNA repair via the desired HDR pathway. [Overview of the project]

[0010] A first aspect of this disclosure is formula (I): [ka] [In the formula, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group comprising at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises 1 or more R 4 It may be replaced as appropriate; R 1is aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se, wherein said aryl or heteroaryl is one or more R 5 may be optionally substituted with; R 2 is H, halogen, -(CH2) n -CN, -OH, -(CH2) n -O-C1-C4 alkyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, or C(O)NH2; R 3 is independently selected from the group consisting of H, F, C2-C4 alkenyl, C2-C4 alkynyl, CN, OH, CH2OH, NH2, CH2NH2, and C1-C4 alkyl; each R 4 is each independently selected from the group consisting of halogen, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, CD3, CD2CD3, and C1-C6 haloalkyl; or two R 4 bonded to the same atom, together with the carbon atom to which they are bonded, form a C3-C6 cycloalkyl; each R 5 is each independently selected from halogen, NH2, C(O)NH2, OH, -CN, C(O)NHR 7 , C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, and said alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl may be optionally substituted with one or more R 6 may be optionally substituted with; each R 6 is each independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4 alkyl, and C1-C6 alkoxy; each R 7Each is independently selected from H and C1-C4 alkyl groups; n are, independently, integers between 0 and 4; r is an integer between 0 and 2; s is an integer between 0 and 2; and t is an integer between 1 and 2; however, A is a 5-membered heteroring containing NC(O)-N in the ring, and R 1 However, R is greater than or equal to 1. 5 Replaced as appropriate [ka] If so, substructure [ka] teeth, [ka] isn't it] This relates to compounds, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.

[0011] Another aspect of this disclosure is formula (I): [ka] [In the formula, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group contains 1 to 3 R 4 It may be replaced as appropriate; R 1 This is a heteroaryl compound comprising aryl or at least one heteroatom selected from the group consisting of N, O, S, and Se, where the aryl or heteroaryl compound comprises 1 to 4 R 5 It may be replaced as appropriate; R 2 H stands for halogen, -(CH2) n-CN, -OH, -(CH2) n -O-C1-C4 alkyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, or C(O)NH2; R 3 These are independently selected from the group consisting of H, F, C2-C4 alkenyls, C2-C4 alkynyls, CN, OH, CH2OH, NH2, CH2NH2, and C1-C4 alkyls; Each R 4 Each of these is independently selected from the group consisting of halogens, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, and CD3, CD2CD3, C1-C6 haloalkyl; or Two R atoms bonded to the same atom 4 However, they combine with the carbon atoms they bond to to form a C3-C6 cycloalkyl group; Each R 5 These are, independently, halogen, NH2, OH, -CN, C(O)NH2, and C(O)NHR. 7 Selected from the group consisting of C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, where the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl has 1 to 3 R 6 It may be replaced as appropriate; Each R 6 Each of these is independently selected from the group consisting of halogens, OH, oxo, NH2, CHO, C1-C4 alkyl, and C1-C6 alkoxy; Each R 7 Each is independently selected from H and C1-C4 alkyl groups; n are, independently, integers between 0 and 4; r is an integer between 0 and 2; s is an integer between 0 and 2; and t is an integer between 1 and 2; however, A is a 5-membered heteroring containing NC(O)-N in the ring, and R 1 However, 1 to 4 R 5 Replaced as appropriate [ka] If so, substructure [ka] teeth, [ka] isn't it] This relates to compounds, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.

[0012] Another aspect of the present disclosure relates to a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include excipients, diluents, or surfactants.

[0013] Another aspect of the present disclosure relates to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleavage factor, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0014] Another aspect of the present disclosure relates to a method for editing a target genome in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0015] Another aspect of the present disclosure relates to a method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0016] Another aspect of the present disclosure relates to a method for inhibiting or suppressing the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0017] Another aspect of the present disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0018] Another aspect of this disclosure relates to the use of the compound of formula (I), and its pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions for use in the manufacture of pharmacotherapy pharmaceuticals.

[0019] Another aspect of this disclosure relates to the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition in the treatment of cells.

[0020] In some embodiments, the Disclosure provides a method for producing the compounds of the Disclosure.

[0021] In some embodiments, this disclosure provides a method for producing a compound, comprising one or more steps described herein.

[0022] Other features and advantages of this disclosure will become apparent from the detailed description and claims below. [Brief explanation of the drawing]

[0023] [Figure 1] Figure 1 shows the effect of DNA-PK inhibitor compounds on cell viability 5 days after electroporation. Live cells are shown as a percentage of the total cell number. [Figure 2] Figure 2 shows the effect of DNA-PK inhibitors on T cell proliferation 5 days after electroporation. The total number of viable cells (x10e6) is shown. [Figure 3] Figure 3 shows the effect of DNA-PK inhibitors on CAR insertion into the TRAC gene locus 5 days after electroporation. The percentage of CAR+ T cells is shown as a percentage of the total viable cell count. [Figure 4] Figure 4 shows the effect of DNA-PK inhibitors on CAR insertion into the TRAC gene locus 5 days after electroporation. KI efficiency is shown as the percentage change compared to the untreated control condition (calculated by dividing the percentage of CAR+ in the DNA-PKi-treated group by the percentage of CAR+ in the untreated group, subtracting 1, and multiplying by 100). [Figure 5] Figure 5 shows the effect of DNA-PK inhibitors on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100). [Figure 6] Figure 6 shows the effect of DNA-PK inhibitors (compound 1 and compound 78) on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100). [Modes for carrying out the invention]

[0024] [Definition] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure pertains. In this specification, singular nouns are considered plural unless otherwise specified in the context. In the examples or tests of this disclosure, similar or equivalent methods and substances may be used, but suitable methods and substances are listed below. All publications, patent applications, patents, and other documents referenced herein are incorporated by reference. References made herein do not constitute prior art relating to the claimed disclosure. In case of any conflict, including definitions, the provisions of this specification shall prevail. Furthermore, the substances, methods, and examples are illustrative and not intended to be limiting. In case of any conflict between the chemical structure and the name of a compound disclosed herein, the chemical structure shall prevail.

[0025] In this disclosure, the articles "a" and "an" are used to refer to one or more (i.e., at least one) grammatical objects of the articles. For example, "an element" means one or more elements.

[0026] In this disclosure, the term "and / or" is used to mean either "and" or "or" unless otherwise specified.

[0027] The term "may be substituted as appropriate" means that a particular chemical group (e.g., an alkyl group) may (but is not required) be bonded to other substituents (e.g., heteroatoms). For example, a optionally substituted alkyl group may be a fully saturated alkyl chain (i.e., a pure hydrocarbon). Alternatively, an optionally substituted alkyl group may have substituents other than hydrogen. For example, it may be bonded at any position on the chain to a halogen atom, a hydroxyl group, or any other substituent described herein. Thus, the term "may be substituted as appropriate" means that a particular chemical group may, but is not required to, contain other functional groups. Suitable substituents used for any substitution of the listed groups include, but are not limited to, halogens, oxo, -OH, -CN, -COOH, -CH2CN, -O-(C1-C6)alkyl, (C1-C6)alkyl, (C1-C6)alkoxy, (C1-C6)haloalkyl, (C1-C6)haloalkoxy, -O-(C2-C6)alkenyl, -O-(C2-C6)alkynyl, (C2-C6)alkenyl, (C2-C6)alkynyl, -OH, -OP(O) Examples include (OH)2, -OC(O)(C1-C6)alkyl, -C(O)(C1-C6)alkyl, -OC(O)O(C1-C6)alkyl, -NH2, -NH((C1-C6)alkyl), -N((C1-C6)alkyl)2, -NHC(O)(C1-C6)alkyl, -C(O)NH(C1-C6)alkyl, -S(O)2(C1-C6)alkyl, -S(O)NH(C1-C6)alkyl, and S(O)N((C1-C6)alkyl)2. The substituents themselves may also be substituted as appropriate. As used herein, "may be substituted as appropriate" refers to substitution or non-substitution in the sense described later.

[0028] As used herein, the term “substitution” means that one or more hydrogen atoms on a specified atom are substituted by a group selected from the group shown, provided that the substitution does not exceed the normal valence of the specified atom and that the substitution results in a stable compound. When the substituent is oxo or keto (i.e., =O), two hydrogen atoms on the atom are substituted. Keto substituents are not present in aromatic moieties. As used herein, a ring double bond is a double bond formed between two adjacent ring atoms (e.g., C=C, C=N, or N=N). “Stable compound” and “stable structure” refer to a compound that can be isolated from a reference material (RM) with useful purity and is stable enough to be formulated as an effective therapeutic agent. For example, a cycloalkyl-substituted aryl group may include cases where the cycloalkyl is bonded to one atom of the aryl group, or where it is condensed with the aryl group and shares two or more common atoms.

[0029] As used herein, the term "unsubstituted" means that the specified group has no substituents.

[0030] As used herein, “alkyl” refers to linear and branched aliphatic groups having 1 to 30 carbon atoms, which may be substituted as appropriate. “C1, C2, C3, C4, C5 or C6 alkyl” or “C1-C6 alkyl” includes linear saturated aliphatic hydrocarbon groups of C1, C2, C3, C4, C5 or C6 and branched saturated aliphatic hydrocarbon groups of C3, C4, C5 or C6. For example, C1-C6 alkyl includes alkyl groups of C1, C2, C3, C4, C5 and C6. Examples of alkyls include moieties containing 1 to 6 carbon atoms, such as, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, the linear or branched alkyl group has six or fewer carbon atoms (e.g., C1-C6 for linear groups, C3-C6 for branched groups), and in other embodiments, the linear or branched alkyl group has four or fewer carbon atoms. As used herein, the term "heteroalkyl" means an alkyl group having one or more heteroatoms.

[0031] As used herein, the term "alkyl which may be optionally substituted" means an unsubstituted alkyl or an alkyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.

[0032] "Alkoxy" refers to a straight-chain or branched-chain saturated hydrocarbon containing 1 to 30 carbon atoms, with an "O" (i.e., -O(alkyl)) group at the end of the chain. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pentoxy groups.

[0033] As used herein, the term "alkenyl" refers to an unsaturated or partially unsaturated aliphatic group that is similar to the alkyls described above in terms of chain length and substitutability, but contains at least one double bond. For example, the term "alkenyl" includes linear alkenyl groups (e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl) and branched alkenyl groups. In some embodiments, a linear or branched alkenyl group has six or fewer carbon atoms in its main chain (e.g., a linear group has C 2-6The branching chain is C 3-6 ). The term “C 2-6 The term "C" contains an alkenyl group having 2 to 6 carbon atoms. 3-6 This includes alkenyl groups having 3 to 6 carbon atoms.

[0034] As used herein, the term "optionally substituted alkenyl" means an unsubstituted alkenyl, or an alkenyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.

[0035] As used herein, the term "alkynyl" refers to an unsaturated aliphatic group that is similar to the alkyl group described above in terms of chain length and substitutability, but contains at least one triple bond. For example, "alkynyl" includes linear alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octinyl, noninyl, desynyl) and branched alkynyl groups. In some embodiments, a linear or branched alkynyl group has six or fewer carbon atoms in its main chain (e.g., a linear group has C 2-6 The branching chain is C 3-6 ). The term “C2-6 The term "C" contains an alkynyl group having 2 to 6 carbon atoms. 3-6 This includes an alkynyl group having 3 to 6 carbon atoms.

[0036] As used herein, the term "optionally substituted alkynyl" refers to an unsubstituted alkynyl or an alkynyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.

[0037] Other optionally substituted portions (e.g., optionally substituted cycloalkyl, heterocycloalkyl, aryl, or heteroaryl) include both unsubstituted portions and portions substituted with one or more predetermined substituents. For example, substituted heterocycloalkyls include those substituted with one or more alkyl groups, such as 2,2,6,6-tetramethylpiperidinyl and 2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridinyl.

[0038] As used herein, the term "cycloalkyl" refers to a saturated or partially unsaturated hydrocarbon monocyclic or polycyclic system having 3 to 30 carbon atoms (e.g., a fused ring, a bridging ring, or a spiro ring) (e.g., C 3-12 , C 3-10 , C 3-8 , or C 3-6 Examples of cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,2,3,4-tetrahydronaphthalenyl, and adamantyl. In the case of polycyclic cycloalkyls, it is sufficient that at least one of the rings constituting the cycloalkyl is non-aromatic.

[0039] As used herein, the term "heterocycloalkyl" refers to a saturated or partially unsaturated 3- to 8-membered monocyclic or dicyclic ring, a 7- to 12-membered dicyclic ring (fused, bridging, or spirocyclic ring), or an 11- to 14-membered tricyclic ring (fused, bridging, or spirocyclic ring) containing one or more heteroatoms (e.g., O, N, S, P, or Se). Unless otherwise specified, the heteroatoms are independently selected from the group consisting of nitrogen, oxygen, and sulfur, and may be, for example, 1, 1-2, 1-3, 1-4, 1-5, 1-6, or 1, 2, 3, 4, 5, or 6.Examples of heterocycloalkyl groups include, but are not limited to, piperidinyl, piperazinyl, pyrrolidinyl, dioxanil, tetrahydrofuranil, isoindolinyl, indolinyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, triazolidinyl, oxyranil, azetidinyl, oxetanil, thietanil, 1,2,3,6-tetrahydropyridinyl, tetrahydropyranil, dihydropyranil, pyranil, morpholinil, tetrahydrothiopyranil, and 1,4-diazepanyl L, 1,4-oxazepanyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 2,5-diazabicyclo[2.2.1]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, 2,6-diazaspiro[3.3]heptanyl, 1,4-dioxa-8-azaspiro[4.5]decanyl, 1,4-dioxaspiro[4.5]decanyl, 1-oxaspiro[4.5]decanyl, 1-azaspiro[4.5]decanyl, 3'H-spiro[cyclohexane-1,1'-isobenzofuran]yl, 7'H -Spiro[cyclohexane-1,5'-flo[3,4-b]pyridine]-yl, 3'H-Spiro[cyclohexane-1,1'-flo[3,4-c]pyridine]-yl, 3-azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.1.0]hexane-3-yl, 1,4,5,6-tetrahydropyrrolo[3,4-c]pyrazolyl, 3,4,5,6,7,8-hexahydropyrido[4,3-d]pyrimidinyl, 4,5,6,7-tetrahydro-1H-pyrazolo[3,4-c]pyridinyl, 5,6,7,8- Examples include tetrahydropyrido[4,3-d]pyrimidinyl, 2-azaspiro[3.3]heptanyl, 2-methyl-2-azaspiro[3.3]heptanyl, 2-azaspiro[3.5]nonanyl, 2-methyl-2-azaspiro[3.5]nonanyl, 2-azaspiro[4.5]decanyl, 2-methyl-2-azaspiro[4.5]decanyl, 2-oxazaspiro[3.4]octanyl, 2-oxazaspiro[3.4]octan-6-yl, and 5,6-dihydro-4H-cyclopenta[b]thiophenyl. In the case of polycyclic heterocycloalkyls, it is sufficient that at least one of the rings constituting the heterocycloalkyl is non-aromatic (e.g., 1,3-dihydrobenzo[c]isoxazole-3-yl).

[0040] As used herein, the term "heterocycloalkyl which may be appropriately substituted" means an unsubstituted heterocycloalkyl in which one or more hydrogen atoms on one or more carbons or heteroatoms are substituted by a predetermined substituent. Examples of such substituents include alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.

[0041] Unless otherwise defined, the term "aryl" refers to a cyclic aromatic hydrocarbon group having 1 to 3 aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl, or naphthyl. When there are two aromatic rings (e.g., bicyclic), the aromatic rings of the aryl group may be bonded at a single point (e.g., biphenyl) or fused (e.g., naphthyl). The aryl group may be appropriately substituted with one or more substituents (e.g., 1 to 5 substituents) at any bond position. Examples of substituents include, but are not limited to, -H, -halogens, and -O-(C). 1-6 ) alkyl, (C 1-6 )alkyl, -O-(C 2-6 ) Alkenyl, -O-(C 2-6 ) Alkinyl, (C 2-6 ) Alkenil, (C 2-6)Alkinyl, -OH, -OP(O)(OH)2, -OC(O)(C 1-6 )alkyl, -C(O)(C 1-6 )alkyl, -OC(O)O(C 1-6 )Alkyl, NH2, NH((C 1-6 )alkyl), N((C 1-6 )alkyl)2,-S(O)2-(C 1-6 )alkyl, -S(O)NH(C 1-6 )alkyl, and -S(O)N((C 1-6 )alkyl)2 is an example. The substituent itself may be substituted as appropriate. Furthermore, if it contains two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated ring fused with a completely unsaturated aromatic ring. Examples of the ring of the aryl group include, but are not limited to, phenyl, biphenyl, naphthyl, anthracenyl, phenalenyl, phenantrenyl, indanyl, indenyl, tetrahydronaphthalenyl, tetrahydrobenzoanurenyl, 10,11-dihydro-5H-dibenzo[a,d][7]anurenyl, etc. Furthermore, if it contains two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated heterocycle fused with a completely unsaturated aromatic ring. Examples of the aryl ring include, but are not limited to, benzo[d][1,3]dioxol-5-yl, 2,3-dihydrobenzo[b][1,4]dioxin-6-yl, benzo[d]isoxazole-3(2H)-on-6-yl, benzo[d]xazole-2(3H)-on-6-yl, and benzo[d]xazole-2(3H)-on-5-yl.

[0042] Unless otherwise defined, “heteroaryl” means a monovalent monocyclic or polycyclic aromatic group having 5 to 24 ring atoms, wherein the ring contains one or more ring heteroatoms selected from N, O, S, P, Se, or B, and the remaining ring atoms are C. Furthermore, as defined herein, heteroaryl also means a bicyclic heteroaromatic group in which the heteroatoms are selected from N, O, S, P, Se, or B. As defined herein, heteroaryl also means a tricyclic heteroaromatic group containing one or more ring heteroatoms selected from N, O, S, P, Se, or B. The aromatic group may be independently and appropriately substituted by one or more substituents as described herein. For example, but not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indolyl, thiophen-2-yl, quinolinyl, benzopyranil, isothiazolyl, thiazolyl, thiadiazole, indazole, benzimidazolyl, thieno[3,2-b]thio Fen, triazolyl, triazinyl, imidazo[1,2-b]pyrazolyl, flo[2,3-c]pyridinyl, imidazo[1,2-a]pyridinyl, indazolyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-c]pyridinyl, thieno[2,3-b]pyridinyl Lidinyl, benzothiazolyl, indolyl, indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuranyl, benzofuran, chromanil, thiochromanil, tetrahydroquinolinyl, dihydrobenzothiazine, quinolinyl, isoquinolinyl, 1,6-naphthilidinyl, benzo[de]isoquinolinyl, pyrido[4,3-b][1,6]naphthilidinyl, thieno[2,3-b]pyradinyl, quinazolinyl, tetrazolo[1,5-a]pyridinyl, [1,2,4]triazolo[4,3-a]pyridinyl, isoindolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[3,4-b]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[5,4-b]pyridinyl, pyrrolo[1,2-a]pyridinyl, tetrahydro Pyrrolo[1,2-a]pyrimidinyl, 3,4-Dihydro-2H-1λ2-pyrrolo[2,1-b]pyrimidine, dibenzo[b,d]thiophene, pyridine-2-one, flo[3,2-c]pyridinyl, flo[2,3-c]pyridinyl, 1H-pyrido[3,4-b][1,4]thiadinyl, benzoxazolyl, benzoisoxazolyl, flo[2,3-b]pyridinyl, benzothiophenyl, 1,5-naphthilidinyl, flo[3,2-b]pyridine, [1,2,4]triazolo[1,5-a]pyridinyl, benzo[1,2,3]triazolyl, imidazo[1,2-a]pyrimidinyl, [1 Examples include [2,4]triazolo[4,3-b]pyridazinyl, benzo[c][1,2,5]thiadiazolyl, benzo[c][1,2,5]oxadiazole, 1,3-dihydro-2H-benzo[d]imidazole-2-one, 3,4-dihydro-2H-pyrazolo[1,5-b][1,2]oxazinyl, 4,5,6,7-tetrahydropyrazolo[1,5-a]pyridinyl, thiazolo[5,4-d]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, thieno[2,3-b]pyrrolyl, 3H-indolyl, and their derivatives. Furthermore, if the heteroaryl ring contains two or more fused rings, the heteroaryl group as defined herein may consist of one or more saturated or partially unsaturated rings fused with a completely unsaturated aromatic ring (for example, a five-membered heteroaromatic ring containing 1 to 3 heteroatoms selected from N, O, S, P, Se, or B, or a six-membered heteroaromatic ring containing 1 to 3 nitrogen atoms, where the saturated or partially unsaturated ring contains 0 to 4 heteroatoms selected from N, O, S, P, Se, or B, and may be appropriately substituted with one or more oxos). In heteroaryl rings containing two or more fused rings, the saturated or partially unsaturated rings may further be fused with saturated or partially unsaturated rings as described herein. Examples of these heteroaryl groups include indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, 3,4-dihydro-11H-isoquinolinyl, 2,3-dihydrobenzofuranyl, benzofuranonyl, indolinyl, oxyindolyl, indolyl, 1,6-dihydro-7H-pyrazolo[3,4-c]pyridine-7-onyl, 7,Examples include 8-dihydro-6H-pyrido[3,2-b]pyrrolidinyl, 8H-pyrido[3,2-b]pyrrolidinyl, 1,5,6,7-tetrahydrocyclopenta[b]pyrazolo[4,3-e]pyridinyl, 7,8-dihydro-6H-pyrido[3,2-b]pyrroridine, pyrazolo[1,5-a]pyrimidine-7(4H)-onyl, 3,4-dihydropyrazino[1,2-a]indole-1(2H)-onyl, or benzo[c][1,2]oxabolol-1(3H)-olyl.

[0043] A cycloalkyl, heterocycloalkyl, aryl, or heteroaryl ring has the above substituents at one or more positions on the ring (e.g., on the carbon atoms or heteroatoms such as N that make up the ring) (e.g., alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkoxy, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, alkylaminocarbonyl, aralkylaminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl, amino The groups may be substituted with nocarbonyl, alkylthiocarbonyl, phosphate, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups. The aryl and heteroaryl groups may be condensed or crosslinked with non-aromatic alicyclic or heterocyclic rings to form polycyclic rings (e.g., tetralin, methylenedioxyphenyl (e.g., benzo[d][1,3]dioxol-5-yl)).

[0044] If the bond to the substituent is shown to cross a bond connecting two atoms in the ring, the substituent may be bonded to any atom in the ring. For example, the following structure [ka] In this case, substituent R 5 This can be substituted for any hydrogen atom bonded to an atom in the ring (including hydrogen atoms bonded to the ring atom indicated by B). When a substituent is listed without indicating which atom it is bonded to for the remainder of a compound of a particular formula, the substituent may be bonded to any atom in that formula. For example, the following structure [ka] for, [ka] This includes [specific compounds]. Combinations of substituents and / or variables are permitted only if the combination results in a stable compound.

[0045] In the constituent elements or formula of a compound, if any variable (e.g., R) appears multiple times, each variable is defined independently of the definitions of the other variables. Therefore, for example, if a group is substituted with 0 to 2 Rs, that group may be substituted with up to 2 Rs as needed, and in each appearance, R is selected independently of the definition of R. Furthermore, combinations of substituents and / or variables are permitted only if the combination results in a stable compound.

[0046] As used herein, the terms "hydroxy" or "hydroxyl" include groups having -OH or -O-.

[0047] As used herein, the terms "halo" or "halogen" refer to fluoro, chloro, bromo, and iodine.

[0048] The terms "haloalkyl" or "haloalkoxyl" refer to alkyl or alkoxyl groups substituted with one or more halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, and trichloromethyl, while examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, pentafluoroethoxy, and trichloromethoxy.

[0049] As used herein, the term "cyano" refers to a nitrile group (e.g., -CN).

[0050] As used herein, the term "optionally substituted haloalkyl" means an unsubstituted haloalkyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.

[0051] As used herein, the terms "alkoxy" or "alkoxyl" include substituted and unsubstituted alkyl, alkenyl, and alkynyl groups covalently bonded to an oxygen atom. Examples of alkoxy or alkoxyl groups include, but are not limited to, methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy group may be substituted with, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups. Examples of halogen-substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy, and trichloromethoxy.

[0052] As used herein, the term "solvate" refers to a solvent addition form that contains a stoichiometric or non-stoichiometric amount of solvent. Some compounds tend to incorporate solvent molecules at a constant molar ratio in the crystalline solid state, resulting in the formation of solvates. When the solvent is water, the resulting solvate is a hydrate, and when the solvent is an alcohol, the resulting solvate is an alcohol solvate. A hydrate is formed by the binding of one or more molecules of water to one molecule of a substance, where water maintains its molecular state as H₂O.

[0053] As described herein, isomers that differ in the spatial arrangement of atoms are referred to as "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereomers", and stereoisomers that are non-superimposable mirror images of each other are called "enantiomers" or optical isomers. A mixture containing equal amounts of each enantiomer with opposite chirality is called a "racemic mixture". The compound of formula (I) has one or more asymmetric carbon atoms, and may exist as a racemate, a racemic mixture, or individual enantiomers or diastereomers.

[0054] As used herein, the term "tautomer" refers to one of two or more structural isomers that exist in an equilibrium state, and is readily converted from one isomer to the other. This conversion occurs with the formal migration of a hydrogen atom accompanied by switching of adjacent conjugated double bonds. In solution, tautomers exist as a mixture of a tautomer group. In a solution capable of tautomerization, a chemical equilibrium between tautomers is established. The exact ratio of tautomers depends on several factors including temperature, solvent, and pH. The concept of tautomers that are interconvertible via tautomerization is called tautomerism. In keto-enol tautomerization, the simultaneous migration of electrons and hydrogen atoms occurs.

[0055] It is understood that the compounds of the present disclosure may be presented as different tautomers. It should also be understood that when a compound has tautomers, all tautomers are included within the scope of the present disclosure, and no tautomer is excluded by the nomenclature of the compound. It is understood that a particular tautomer may exhibit higher activity than other tautomers.

[0056] The present disclosure also covers isotope-labeled compounds of Formula I (e.g., labeled with D, 2 H, or 14 C). Substitution with heavier isotopes such as deuterium may provide certain therapeutic advantages due to improved metabolic stability (e.g., increased in vivo half-life or reduced required dosage). Isotope-labeled compounds of Formula I can generally be prepared by following procedures similar to those disclosed in the schemes and / or examples set forth below, using an appropriate isotope-labeled reagent in place of the non-isotope-labeled reagent.

[0057] The present disclosure includes a pharmaceutical composition comprising an effective amount of a disclosed compound and a pharmaceutically acceptable carrier.

[0058] As used herein, the term "pharmaceutically acceptable salt" refers to a derivative of the compound disclosed herein, wherein the parent compound is modified by forming an acid salt or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines, and alkali metal salts or organic salts of acidic residues such as carboxylic acids. pharmaceutically acceptable salts include conventional non-toxic salts of parent compounds formed from non-toxic inorganic or organic acids, or quaternary ammonium salts. For example, such conventional non-toxic salts include, but are not limited to, 2-acetoxybenzoic acid, 2-hydroxyethanesulfonic acid, acetic acid, ascorbic acid, benzenesulfonic acid, benzoic acid, bicarbonate, carbonic acid, citric acid, edetic acid, ethanedisulfonic acid, 1,2-ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, glycolylarsanilic acid, hexylresorcinic acid, hydrabamic acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, hydroxymaleic acid, hydroxynaphthoic acid, isethionic acid, lactic acid, and This includes salts formed from inorganic and organic acids selected from ctobionic acid, lauryl sulfonic acid, maleic acid, malic acid, mandelic acid, methanesulfonic acid, naphthic acid, nitric acid, oxalic acid, pamoic acid, pantothenic acid, phenylacetic acid, phosphoric acid, polygalacturonic acid, propionic acid, salicylic acid, stearic acid, subacetic acid, succinic acid, sulfamic acid, sulfanilic acid, sulfuric acid, tannic acid, tartaric acid, toluenesulfonic acid, and commonly present amino acids (e.g., glycine, alanine, phenylalanine, arginine, etc.).

[0059] In some embodiments, pharmaceutically acceptable salts are sodium salts, potassium salts, calcium salts, magnesium salts, diethylamine salts, choline salts, meglumine salts, benzathine salts, trometamic acid salts, ammonia salts, arginine salts, or lysine salts.

[0060] Other examples of pharmaceutically acceptable salts include hexanoic acid, cyclopentanepropionic acid, pyruvate, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-octa-2-en-1-carboxylic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butyl acetate, and muconic acid. The disclosure also includes salts formed by the substitution of an acidic proton present in the parent compound with a metal ion (e.g., alkali metal ions, alkaline earth metal ions, or aluminum ions) or by coordination with an organic base (e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, etc.). In salt form, the ratio of the compound to the salt cation or anion may be 1:1, or it may be a ratio other than 1:1 (e.g., 3:1, 2:1, 1:2, or 1:3).

[0061] References to pharmaceutically acceptable salts as defined herein are understood to include the solvated form (solvate) or crystalline form (polymorph) of the salt.

[0062] "Patient" or "subject" means a mammal, such as a human, mouse, rat, guinea pig, dog, cat, horse, cattle, pig, or a non-human primate such as a monkey, chimpanzee, baboon, or rhesus macaque.

[0063] When the term "effective amount" is used in reference to a compound, it refers to the amount that is effective for use in cell therapy.

[0064] As used in this disclosure, the term "carrier" includes carriers, excipients, and diluents, and means a substance, composition, or vehicle (e.g., liquid or solid extenders, diluents, excipients, solvents, or encapsulating substances) involved in transporting or delivering a pharmaceutical product from one organ or part of the body to another.

[0065] In this disclosure, the term "disability" is synonymous with "disease," "symptom," or "illness" unless otherwise specified, and is used interchangeably with these terms.

[0066] As used in this disclosure, “administration” means either directly administering the disclosed compound, or a pharmaceutically acceptable salt or composition of the disclosed compound, or administering a compound, or a pharmaceutically acceptable salt or composition of the compound, or a prodrug derivative or analog of the compound, that can form an equivalent amount of the active compound in the body of the subject.

[0067] As used in this disclosure, the term "prodrug" means a compound that can be converted into the disclosed compound in a living organism by metabolism (e.g., hydrolysis).

[0068] This disclosure relates to compounds and compositions that can inhibit DNA-dependent protein kinases (DNA-PKs) in subjects or biological samples.

[0069] In a first aspect of this disclosure, formula (I): [ka] (In the formula, A, R 1 , R 2 , R 3 ,r,s, andt are described herein, except that they are 5-membered heterorings containing NC(O)-N in the ring, and R 1 However, R is greater than or equal to 1. 5 Replaced as appropriate [ka] If so, substructure [ka] teeth, [ka] isn't it) Disclosed are the compound, as well as pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, and tautomers thereof.

[0070] Details of the present disclosure are described below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, exemplary methods and materials are described below. Other features, objects, and advantages of the present disclosure will be apparent from the description and the claims. In the description and claims, unless the context clearly indicates otherwise, the singular form shall include the plural. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. All patents and publications cited herein are incorporated by reference in their entireties.

[0071] In some embodiments, R 1 is aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se, wherein said aryl or heteroaryl is optionally substituted with one or more R 5 ; each R 5 is each independently selected from the group consisting of halogen, NH2, OH, -CN, C(O)NH2, C(O)NHR 7 , C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein said alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R 6 ; each R 7 is each independently selected from H and C1-C4 alkyl. In some embodiments, R 1This is a 5-12 member heteroaryl compound containing a 6-10 member aryl compound or at least one heteroatom selected from the group consisting of N, O, S, and Se, where the aryl compound or heteroaryl compound contains one or more R 5 It may be replaced as appropriate. In some embodiments, R 1 This is a 5-12 member heteroaryl compound containing 1-4 heteroatoms selected from the group consisting of 6-10 member aryls or N, O, S, and Se, where the aryl or heteroaryl contains 1 or more R 5 It may be replaced as appropriate. In some embodiments, R 1 This is a 5-12 member heteroaryl compound containing 1-4 heteroatoms selected from the group consisting of 6-10 member aryls or N, O, S, and Se, where the aryl or heteroaryl is 1-4 R 5 It may be replaced as appropriate. In some embodiments, R 1 This is a 5-12 member heteroaryl compound containing 1-3 heteroatoms selected from the group consisting of 6-10 member aryls or N, O, S, and Se, where the aryl or heteroaryl compound contains 1-4 R 5 It may be replaced as appropriate. In some embodiments, R 1 This is a 6-12 member heteroaryl compound containing 1-3 heteroatoms selected from the group consisting of 6-10 member aryls or N, O, S, and Se, where the aryl or heteroaryl compound contains 1-4 R 5 It may be replaced as appropriate.

[0072] In some embodiments, each R 5 These are, independently, halogen, NH2, OH, -CN, C(O)NH2, and C(O)NHR. 7is selected from the group consisting of C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein said alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R 6 as appropriate. In some embodiments, each R 5 is each independently selected from the group consisting of halogen, C1-C4 alkyl, CD3, CD2CD3, C(O)NH2, C(O)NHR 7 , and heteroaryl, wherein said heteroaryl is optionally substituted with one or more R 6 as appropriate; each R 7 is each independently selected from H and C1-C4 alkyl.

[0073] In some embodiments, each R 6 is each independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4 alkyl, CD3, and C1-C6 alkoxy. In some embodiments, each R 6 is C1-C4 alkyl.

[0074] In some embodiments, R 1 is

Chemical Structure

[0075] In some embodiments, R 1 teeth, [ka] The formula is where B is a 5-membered or 6-membered aryl, heterocyclyl, or heteroaryl, where the heterocyclyl or heteroaryl contains at least one heteroatom selected from N, O, S, and Se; and m is an integer from 1 to 4. In some embodiments, B is a 5-membered or 6-membered aryl or a heteroaryl comprising at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 4. In some embodiments, B is 5-membered or 6-membered heterocyclyl or heteroaryl comprising at least one heteroatom selected from the group consisting of N, O, S and Se; and m is an integer from 1 to 4. In some embodiments, B is 5-membered or 6-membered aryl, heterocyclyl or heteroaryl, wherein said heterocyclyl or heteroaryl comprises at least one heteroatom selected from N, O, S and Se; and m is an integer from 1 to 3. In some embodiments, B is 5-membered or 6-membered aryl or heteroaryl comprising at least one heteroatom selected from the group consisting of N, O, S and Se; and m is an integer from 1 to 3. In some embodiments, B is 5-membered or 6-membered heterocyclyl or heteroaryl comprising at least one heteroatom selected from the group consisting of N, O, S and Se; and m is an integer from 1 to 3. In some embodiments, at least one R 5 is CD3 or methyl.

[0076] In some embodiments, R 1 is selected from the group consisting of

化

[0077] In some embodiments, R 1 is

化

[0078] In some embodiments, R 1 teeth, [ka] It is selected from the group consisting of the following.

[0079] In some embodiments, R 1 teeth, [ka] A group consisting of X is selected, where X 1 , X 2 , X 3 , X 4 and X 5 These are N, CH, or C(R) respectively, independently. 5 )

[0080] In some embodiments, R 1 teeth, [ka] That is the case.

[0081] In some embodiments, R 1 teeth, [ka] It is selected from the group consisting of the following.

[0082] In some embodiments, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group comprising at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises 1 or more R 4 It may be replaced as appropriate. In some embodiments, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group comprising at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises 1 to 3 R 4It may be replaced as appropriate.

[0083] In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group comprising at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises 1 or more R 4 It may be replaced as appropriate. In some embodiments, A is a five-membered heteroaryl or heterocycloalkyl group comprising one or two heteroatoms selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate. In some embodiments, A is a five-membered heteroaryl or heterocycloalkyl group comprising one or two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate. In some embodiments, A is a five-membered heteroaryl or heterocycloalkyl group comprising two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be appropriately substituted with. In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group comprising one heteroatom selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate.

[0084] In some embodiments, A is a six-membered heteroaryl or heterocycloalkyl group comprising at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate. In some embodiments, A is a six-membered heteroaryl or heterocycloalkyl group comprising one or two heteroatoms selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate. In some embodiments, A is a six-membered heteroaryl or heterocycloalkyl group comprising one or two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate. In some embodiments, A is a six-membered heteroaryl or heterocycloalkyl group comprising two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be appropriately substituted with. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group comprising one heteroatom selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl group comprises one or more R 4 It may be replaced as appropriate.

[0085] In some embodiments, R 4 These are independently selected from the group consisting of halogens, oxo, thioxo, CD3, CD2CD3, C1-C4 alkyl, C1-C4 alkoxy, and C1-C6 haloalkyl; or two Rs bonded to the same atom 4 However, they combine with the carbon atoms they bond to to form a C3-C6 cycloalkyl group. In some embodiments, each R 4 These are independently selected from the group consisting of halogens, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, CD3, CD2CD3, and C1-C6 haloalkyl; or two Rs bonded to the same atom 4 However, they combine with the carbon atoms they bond to to form a cyclopropyl group. In some embodiments, each R 4is either oxo, thioxo, CD3, CD2CD3, or methyl, or two Rs bonded to the same atom. 4 However, they combine with the carbon atoms they bond to to form a cyclopropyl group. In some embodiments, each R 4 These are oxo, thioxo, CD3, or methyl. In some embodiments, two R atoms bonded to the same atom 4 However, they combine with the carbon atoms they bond to to form a cyclopropyl group.

[0086] In some embodiments, R 2 H stands for halogen, -(CH2) n -CN, -OH, -(CH2) n These are -O-C1-C4 alkyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, or C(O)NH2. In some embodiments, R 2 H is H. In some embodiments, R 2 H stands for halogen, -(CH2) n -CN, -OH, -(CH2) n -O-C1-C4 alkyl, C1-C4 alkoxy, or C1-C4 haloalkyl. In some embodiments, R 2 The group is H, fluoro, -CN, -CH2-CN, -CH2-O-CH3, -OH, methoxy, or CF3. In some embodiments, R 2 is halogen, -(CH2) n -CN, -OH, -(CH2) n -O-C1-C4 alkyl, C1-C4 alkoxy, or C1-C4 haloalkyl. In some embodiments, R 2 These are fluoro, -CN, -CH2-CN, -CH2-O-CH3, -OH, methoxy, or CF3.

[0087] In some embodiments, R3 The group is selected from the group consisting of H, F, C2-C4 alkenyl, C2-C4 alkynyl, CN, OH, CH2OH, NH2, CH2NH2, and C1-C4 alkyl. In some embodiments, R 3 H is H.

[0088] In some embodiments, each n is an independent integer between 0 and 4. In some embodiments, n is 0. In some embodiments, n is 1.

[0089] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-1): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0090] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-2): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0091] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-3): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0092] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-4): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0093] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-5): [ka] (wherein X is O, S, NH, or CH2; and X 1 , X 2 , X 3 , and X 4 However, each is independently N, CH, or C(R 5 It has the structure of ).

[0094] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-6): [ka] (wherein X is O, S, NH, or CH2; B is 1 or more R as appropriate) 5 It has a structure that is a 5-membered or 6-membered aryl or heteroaryl (which may be substituted with a 5-membered or 6-membered aryl or heteroaryl, and m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0095] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ia-7): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0096] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ib-1): [ka] It has the structure (wherein X is O, S, NH, or CH2). However, R 1 R is 1 or greater as appropriate 5 It may be replaced with [ka] If that is the case, then X is not O.

[0097] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ib-2): [ka] It has the structure (wherein X is S, NH, or CH2).

[0098] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ib-3): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0099] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ib-4): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0100] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ic-1): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0101] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ic-2): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0102] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ic-3): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0103] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ic-4): [ka] (wherein X is O, S, NH, or CH2; B is 1 or more R as appropriate) 5 It has a structure that is a 5-membered or 6-membered aryl or heteroaryl (which may be substituted with a 5-membered or 6-membered aryl or heteroaryl, and m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0104] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Id-1): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0105] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Id-2): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0106] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Id-3): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0107] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Id-4): [ka] (wherein X is O, S, NH, or CH2; B is 1 or more R as appropriate) 5 It is a 5-membered or 6-membered aryl or heteroaryl that may be substituted with; and has the structure (where m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0108] In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, is formula (Ie-1): [ka] The formula has the structure (wherein X is O, S, NH, or CH2; and m is an integer from 1 to 3).

[0109] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ie-2): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0110] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ie-3): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0111] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ie-4): [ka] It has the structure (wherein X is O, S, NH, or CH2).

[0112] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ie-5): [ka] (wherein X is O, S, NH, or CH2; B is 1 or more R as appropriate) 5 It has a structure that is a 5-membered or 6-membered aryl or heteroaryl (which may be substituted with a 5-membered or 6-membered aryl or heteroaryl, and m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0113] In some embodiments, a compound of formula (I), or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, is formula (If-1): [ka] It has the structure of [the object].

[0114] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (If-2): [ka] It has the structure of [the object].

[0115] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (If-3): [ka] It has the structure of [the object].

[0116] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (If-4): [ka] (In the formula, B is R of 1 or more as appropriate) 5It has a structure that is a 5-membered or 6-membered aryl or heteroaryl (which may be substituted with a 5-membered or 6-membered aryl or heteroaryl, and m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0117] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ig-1): [ka] It has the structure of [the object].

[0118] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ig-2): [ka] It has the structure of [the object].

[0119] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ig-3): [ka] It has the structure of [the object].

[0120] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ig-4): [ka] It has the structure (where Y is O or S).

[0121] In some embodiments, the compound of formula (I), or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers, is formula (Ig-5): [ka] (In the formula, B is R of 1 or more as appropriate) 5 It is a 5-membered or 6-membered aryl or heteroaryl that may be substituted with; and has the structure (where m is an integer from 0 to 4). In some embodiments, m is an integer from 1 to 3.

[0122] In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt, stereoisomer, or tautomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt or stereoisomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt thereof. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Table 16]

[0123] This disclosure should be understood to include all isomers and mixtures thereof. Where a compound contains a disubstituted cycloalkyl group, the substituents of the cycloalkyl group may be in a cis or trans configuration. Furthermore, all tautomers are included in this disclosure.

[0124] The compounds of this disclosure, and their pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, and prodrugs, may exist as their tautomers (e.g., amides or iminoethers). All such tautomers are included as part of this disclosure.

[0125] Because the compounds disclosed herein may contain chiral or asymmetric centers, they may exist in different stereoisomers. This disclosure encompasses all stereoisomers of the compounds disclosed herein and mixtures thereof (including racemic mixtures). Furthermore, this disclosure includes all geometric and positional isomers. For example, if a compound disclosed herein contains a double bond or a fused ring, both cis and trans forms and mixtures thereof are included within the scope of this disclosure. Each compound disclosed herein includes any enantiomer that fits the general structure of the disclosed compound. The compounds may be in racemic, enantiomerically pure, or any other stereochemical form. The results of the assay may reflect data collected for racemic, enantiomerically pure, or any other stereochemical form.

[0126] A diastereomer mixture can be separated into individual diastereomers based on their physicochemical differences by methods well known to those skilled in the art, such as chromatography and / or fractional crystallization. Enantiomers are obtained by converting the enantiomer mixture into a diastereomer mixture by reaction with a suitable optically active compound (e.g., a chiral alcohol or chiral auxiliary such as Mosher's reagent), separating the diastereomers, and then converting the separated diastereomers back into the corresponding pure enantiomers (e.g., by hydrolysis). Some of the compounds of this disclosure may also be atropisomers (e.g., substituted biaryls), which are considered part of this disclosure. Enantiomers can also be separated using a chiral HPLC column.

[0127] Furthermore, the compounds of this disclosure may exist in different tautomers, and all such forms are included within the scope of this disclosure. For example, all keto-enol tautomers and imine-enamine tautomers of the compounds are also included within this disclosure.

[0128] All stereoisomers (e.g., geometric isomers, optical isomers, etc.) of the compounds of this disclosure (including salts, solvates, esters, and prodrugs of the compounds, as well as salts, solvates, and esters of the prodrugs) are included within the scope of this disclosure. This includes enantiomers, rotational isomers, atropisomers, and diastereomers that may exist due to chiral carbons on various substituents, or even when chiral carbons are absent, as well as positional isomers (e.g., 4-pyridyl and 3-pyridyl). For example, if the compound of formula (I) contains a double bond or a fused ring, both cis and trans forms, as well as mixtures thereof, are also included within the scope of this disclosure. Also included, for example, all keto-enol tautomers and imine-enamine tautomers of the compounds are also included within this disclosure. Each stereoisomer of the compounds of this disclosure may exist, for example, in a form substantially free of other stereoisomers, or may exist, for example, as a racemate, or in a mixture with all other stereoisomers or other selected stereoisomers. The chiral centers of this disclosure may adopt either the S configuration or the R configuration as defined in the 1974 IUPAC Recommendation.

[0129] The terms "salt," "solvate," "ester," and "prodrug" also apply to salts, solvates, esters, and prodrugs in enantiomers, stereoisomers, rotational isomers, tautomers, positional isomers, racemates, or prodrugs of the compounds of the present invention.

[0130] Compounds of formula I may also form salts, which are also included within the scope of this disclosure. Unless otherwise specified, references to compounds of formulas described herein are understood to include references to their salts.

[0131] This disclosure relates to the compounds described herein, and their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers, as well as pharmaceutical compositions comprising one or more of the compounds described herein, or their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers.

[0132] [Methods for synthesizing compounds] The compounds of this disclosure can be prepared by various methods well known to those skilled in the art of organic synthesis. For example, the compounds of this disclosure can be synthesized by the methods described below, as well as by synthetic methods known in the field of synthetic organic chemistry, or variations thereof recognized to those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules, and the transformation and manipulation of functional groups are described in the relevant scientific literature or standard textbooks in the field. While not limited to one or more specific sources, classic literature such as Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th edition, John Wiley & Sons: New York, 2001; Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), incorporated by reference herein, are useful to those skilled in the art and are well-known references in organic synthesis.

[0133] In the reaction steps and synthetic schemes described herein, the order of certain steps (such as the introduction and removal of protecting groups) may be changed. Those skilled in the art will understand that certain groups may need to be protected with protecting groups under certain reaction conditions. Protecting groups may also be used to distinguish similar functional groups within a molecule. A list of protecting groups and methods for introducing and removing them is provided in Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd edition. John Wiley & Sons. New York, 1999.

[0134] It should be understood that the synthesis methods described herein are permissible for a variety of functional groups, and therefore starting materials with various substituents can be used. In these methods, the desired final compound is usually obtained at the end of the overall process or towards the end, but in some cases it may be desirable to further convert the compound into its pharmaceutically acceptable salt.

[0135] In the synthetic schemes described herein, compounds may be illustrated in specific configurations for convenience. Such specific configurations should not be construed as limiting this disclosure to any particular isomer, tautomer, positional isomer, or stereoisomer, nor should they exclude mixtures of isomers, tautomers, positional isomers, or stereoisomers. However, it should be understood that some particular isomer, tautomer, positional isomer, or stereoisomer may exhibit higher activity than other isomers, tautomers, positional isomers, or stereoisomers.

[0136] The methods include, but are not limited to, those described below. The compounds of this disclosure may be synthesized according to the steps outlined in Scheme G1-G3, which include various steps for synthesizing intermediates or compounds. Starting materials are commercially available or prepared by known procedures reported in the literature or by methods illustrated below.

[0137] Scheme G1 for synthesizing compounds of formulas Ia-1, Ia-2, Ia-3, Ia-4, Ia-5, and Ia-6 [ka] In the presence of a base (e.g., DIPEA, Et3N, or K2CO3), amine G1-3 is formed by a nucleophilic substitution reaction between amine G1-2 and G1-1. The bicyclic skeleton G1-5 is formed by hydrolysis of the ester group of G1-3 to acid G1-3 using an aqueous base solution (e.g., LiOH or NaOH), followed by a Curtius rearrangement and intramolecular cyclization using DPPA under heating conditions (e.g., 40-100°C). Alkylated G1-6 is formed from G1-5 and a halide in the presence of a base (e.g., NaOH, NaH, K2CO3, etc.). By performing a Buchwald-Hartwig cross-coupling using a catalyst (e.g., Brett Phos G3), aniline groups (NH2Ar or NH2-heteroaryl) are introduced to the chloropyrimidine skeleton G1-6, and the final product represented by the general formulas Ia-1, Ia-2, Ia-3, Ia-4, Ia-5, and Ia-6 is synthesized (Scheme G1).

[0138] Scheme G2 for synthesizing compounds of formulas Ia-1, Ia-2, Ia-3, Ia-4, Ia-5, and Ia-6 [ka] Under heating conditions, in the presence of HOAc and EtOH, the NO2 group of G2-3 is reduced with either Fe or Zn to form amine G2-4. Cycloforming G2-4 with imidazole and 1,1'-thiocarbonyldiimidazole yields G2-5. In the presence of a base (e.g., NaOH, NaH, K2CO3), G2-5 is alkylated with a halide to form G2-6. Buchwald-Hartwig cross-coupling using a catalyst (e.g., Brett Phos G3) introduces an aniline group (NH2Ar or NH2-heteroaryl) to the chloropyrimidine skeleton G2-6, synthesizing the final products of formulas Ia-1, Ia-2, Ia-3, Ia-4, Ia-5, and Ia-6 (Scheme G2).

[0139] Scheme G3 for synthesizing compounds of formulas If-1, If-2, If-3, and If-4 [ka] G3-3 is obtained by mixing a base (e.g., DIPEA), G3-1, and G3-2 in a suitable solvent (e.g., THF) at a low temperature (e.g., 0°C). Within the scope of the present invention, compounds of formula If-1, If-2, If-3, and If-4 are produced by a CN coupling reaction of G3-3 with various arylamines or heteroarylamines in the presence of a suitable catalyst (e.g., Brettphos Pd G3) and a base (e.g., cesium carbonate) (Scheme G3).

[0140] Scheme G4 for synthesizing the compound of formula 1e-1 [ka] Alternative scheme [ka] In the presence of a base (e.g., Et3N or K2CO3), amine G4-3 is formed by a nucleophilic substitution reaction between amine G4-1 and 2,4-dichloro-5-nitropyrimidine, followed by 2-ethyl haloacetate, or by a nucleophilic substitution reaction between amine G4-1 and 2,4-dichloro-5-nitropyrimidine, followed by 2,4-dichloro-5-nitropyrimidine. Under heating conditions (e.g., 40-100°C) and in the presence of HOAc, the nitro group is reduced to the amine using either Fe or Zn, and a lactam is subsequently formed, thereby forming the bicyclic skeleton G4-4. Alkylated G4-5 is formed from G4-4 and a halide in the presence of a base (e.g., NaOH, NaH, K2CO3, etc.). By performing a Buchwald-Hartwig cross-coupling reaction using a catalyst (e.g., Brett Phos G3), an aniline group (NH2Ar or NH2-heteroaryl) is introduced to the chloropyrimidine skeleton G4-5, synthesizing the final product represented by general formula 1e-1 (Scheme G4).

[0141] Scheme G5 for synthesizing compounds of formulas Ig-1, Ig-2, Ig-3, Ig-4, and Ig-5 [ka] Alternative scheme [ka] Intermediate G5-2 is obtained by cyclopropanating G5-1 with dibromoethane in the presence of a base (e.g., NaH / DMF). Amine G5-3 is obtained by nucleophilic substitution of amine G1-2 with G5-2 at high temperature (e.g., 100-120°C) in DMA in the presence of a base (e.g., DIPEA, Et3N, or K2CO3). Treatment of G5-3 with a strong base (e.g., NaH) yields the cyclization intermediate G5-4. Oxidation of thioether G5-4 with an oxidizing agent (e.g., Oxone) yields G5-5 having a methanesulfonyl group. In the presence of a base (e.g., LiHMDS / DMF), an aniline group (NH2Ar or NH2-HetAr) is introduced to the pyrimidine skeleton G5-5 having a methanesulfonyl group by substitution reaction, synthesizing the final products having the general formulas Ig, Ig-2, Ig-3, Ig-4, and Ig-5. Alternatively, hydrolysis of ester G5-2 in a basic aqueous solution yields acid G5-6. Amide coupling of G5-6 with amine G1-2 yields amide G5-7, which is then treated with an oxidizing agent (e.g., Oxone) to obtain G5-8, which has a methanesulfonyl group. Substitution reactions in the presence of a base (e.g., LiHMDS / THF) introduce an aniline group (NH2Ar or NH2-HetAr) into the pyrimidine skeleton G5-8, which has a methanesulfonyl group. The final cyclization reaction of G5-9 takes place in the presence of a strong base (e.g., LiHMDS / THF).

[0142] Unless otherwise specified, the examples herein are synthesized according to the general procedures shown in schemes G1 to G5.

[0143] [Compositions containing the compounds of this disclosure] Another aspect of the present disclosure relates to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleavage factor, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the composition further comprises cells. In some embodiments, the composition further comprises donor DNA. In some embodiments, the composition further comprises cells and donor DNA.

[0144] In some embodiments, the cells are eukaryotic cells. In some embodiments, the cells are useful for adoptive immunotherapy (ACT). In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.

[0145] In some embodiments, the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a sequence encoding structural RNA.

[0146] In some embodiments, the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof.

[0147] In some embodiments, the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes double-stranded or single-stranded DNA breaks. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes single-stranded DNA breaks.

[0148] In some embodiments, the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., Cas9 nuclease from S. pyogenes). In some embodiments, the Cas nuclease is a type V Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., Cas12a nuclease from the genus Acidaminococcus).

[0149] In some embodiments, the composition includes modified RNA.

[0150] In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes a dgRNA. In some embodiments, the dual guide RNA consists of crRNA and tracrRNA. In some embodiments, the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes an sgRNA. In some embodiments, the gRNA is a modified gRNA.

[0151] In some embodiments, the DNA cleavage factor is Cas9 or mRNA encoding Cas9, and a modified gRNA in which one or more of the first five nucleotides at the 5' end are modified. In some embodiments, the cleavage factor is Cas12a or mRNA encoding Cas12a, and a modified gRNA containing a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA is one in which one or more of the last five nucleotides at the 3' end are modified.

[0152] In some embodiments, the DNA cleavage factor is a type II Cas nuclease belonging to class 2 or a type V Cas nuclease belonging to class 2, and a guide RNA nucleic acid, where the molar ratio of the guide RNA to the Cas nuclease is approximately 4:1 to 1:4.

[0153] In some embodiments, the composition further comprises a vector. In some embodiments, the vector encodes donor DNA. In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a nonviral vector. In some embodiments, the vector is a nonviral vector comprising donor DNA having a linear, closed-end, circular, single-stranded, or double-stranded form.

[0154] In some embodiments, the composition further comprises an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase theta (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors, selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiosin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).

[0155] In some embodiments, the concentration of DNA-PKI in the composition is approximately 10 μM or less. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.25 μM to approximately 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.25 μM to approximately 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 0.25 μM.

[0156] [Method of use of the disclosed compound] Another aspect of the present disclosure relates to a method for targeted genome editing in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0157] Another aspect of the present disclosure relates to a method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the double-strand DNA breaks are blunt-end breaks. In some embodiments, the double-strand DNA breaks include paired single-strand breaks (e.g., those resulting from a combination of nickasenucleases).

[0158] Another aspect of the present disclosure relates to a method for inhibiting or suppressing the repair of DNA breaks via the non-homologous end-joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the method further involves contacting cells with a microhomology-mediated end-joining (MMEJ) pathway inhibitor. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase theta (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), Novobiosin (Dana-Farber Cancer Institute, Inc.), Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).

[0159] Another aspect of the present disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0160] In some embodiments of the method disclosed herein, the method is characterized by culturing cells in a cell medium that does not contain DNA-PKI, and then adding DNA-PKI to the cell medium.

[0161] In some embodiments of the methods of this disclosure, the method is characterized by contacting cells with a DNA cleavage factor, and then contacting the cells with DNA-PKI. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within approximately 6 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within approximately 3 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within 2 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor for approximately 15 to 45 minutes, and then contacting the cells with DNA-PKI. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor for approximately 30 minutes, and then contacting the cells with DNA-PKI.

[0162] In some embodiments, the method is characterized by simultaneously contacting cells with a DNA cleavage factor and DNA-PKI.

[0163] In some embodiments of the method disclosed herein, the method is characterized by culturing cells in a cell medium containing DNA-PKI.

[0164] In some embodiments, the method is characterized by contacting the cells with DNA-PKI, followed by contacting the cells with a DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor within approximately 3 hours of contacting the cells with DNA-PKI.

[0165] In some embodiments, contact between cells and DNA cleavage factors involves electroporation of cells to allow the DNA cleavage factors to enter the cells. In some embodiments, contact between cells and DNA cleavage factors involves delivery of DNA cleavage factors to cells by other means (e.g., via microinjection, lipid nanoparticles, liposomes, exosomes, or gold nanoparticles). In some embodiments, the method is characterized by simultaneously contacting the cells with the DNA cleavage factors and donor DNA.

[0166] In some embodiments of the methods of this disclosure, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for at least about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours.

[0167] In some embodiments of the methods of this disclosure, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 10 μM or less. In some embodiments, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 0.1 μM to approximately 10 μM. In some embodiments, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 0.25 μM to approximately 5 μM.

[0168] In some embodiments of the methods of this disclosure, the cells are eukaryotic cells. In some embodiments, the cells are useful in adoptive immunotherapy (ACT). In some embodiments, the cells are used in autologous cell therapy. In some embodiments, the cells are used in allogeneic cell therapy. In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.

[0169] In some embodiments of the methods of this disclosure, the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof.

[0170] In some embodiments of the methods of this disclosure, the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes double-stranded or single-stranded DNA breaks. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes single-stranded DNA breaks.

[0171] In some embodiments of the methods of this disclosure, the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., a Cas9 nuclease from S. pyogenes). In some embodiments, the Cas nuclease is a type V Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Cas12a nuclease from the genus Acidaminococcus).

[0172] In some embodiments of the method disclosed herein, the method is further characterized by bringing cells into contact with modified RNA.

[0173] In some embodiments of the methods of this disclosure, the method is further characterized by contacting cells with a guide RNA component. In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes a dgRNA. In some embodiments, the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes an sgRNA. In some embodiments, the gRNA is a modified gRNA.

[0174] In some embodiments of the methods of this disclosure, the DNA cleavage factor is Cas9 or a Cas9-encoding mRNA and a modified gRNA in which one or more of the first five nucleotides at the 5' end are modified. In some embodiments, the cleavage factor is Cas12a or a Cas12a-encoding mRNA and a modified gRNA containing a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA is one in which one or more of the last five nucleotides at the 3' end are modified.

[0175] In some embodiments of the method of this disclosure, the DNA cleavage factor is a type II Cas nuclease belonging to class 2 or a type V Cas nuclease belonging to class 2, and a guide RNA nucleic acid, wherein the molar ratio of the guide RNA to the Cas nuclease is approximately 4:1 to 1:4.

[0176] In some embodiments of the method of this disclosure, the DNA cleavage factor interacts with a target sequence within the TRAC gene of a T cell.

[0177] In some embodiments of the method disclosed herein, the method is characterized by contacting cells with at least two different DNA cleavage factors that target different gene loci.

[0178] In some embodiments, the method is characterized by contacting cells with a vector encoding a DNA cleavage factor. In some embodiments, the vector encodes a DNA cleavage factor and donor DNA. In some embodiments, the method is characterized by contacting cells with a vector encoding a DNA cleavage factor and a second vector encoding donor DNA.

[0179] In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a nonviral vector. In some embodiments, the vector is a nonviral vector comprising donor DNA having a linear, closed-end, circular, single-stranded, or double-stranded form.

[0180] In some embodiments of the methods of this disclosure, the DNA cleavage factor interacts with a target sequence in the cell's genome to produce a double-strand DNA break (DSB).

[0181] In some embodiments of the methods of the present disclosure, the method further involves contacting cells with donor DNA. In some embodiments, the method involves contacting cells with a vector containing donor DNA. In some embodiments, the vector encodes donor DNA. In some embodiments, the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a sequence encoding structural RNA. In some embodiments, the donor DNA includes a template having a foreign nucleic acid encoding a protein. In some embodiments, the protein is selected from cytokines, immunosuppressants, antibodies, receptors, and enzymes. In some embodiments, the protein is a receptor. In some embodiments, the receptor is selected from immune receptors, T cell receptors (TCRs), and chimeric antigen receptors. In some embodiments, the foreign nucleic acid encodes a chain of the TCR (e.g., TCRα, β, δ, or γ chains, or any combination thereof). In some embodiments, the foreign nucleic acid encodes the TCRα chain and / or TCRβ chain. In some embodiments, the template includes a first homology arm and a second homology arm complementary to sequences located upstream and downstream of the cleavage site, respectively.

[0182] In some embodiments of the methods of this disclosure, gene knockout occurs. In some embodiments of the methods of this disclosure, gene repair occurs. In some embodiments of the methods of this disclosure, gene insertion occurs.

[0183] In some embodiments, the method further involves contacting the cells with a microhomology-mediated end-joining (MMEJ) pathway inhibitor. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase theta (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors, selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiosin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).

[0184] Another aspect of this disclosure relates to a compound of formula (I) and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof for use in the manufacture of pharmacotherapy pharmaceuticals.

[0185] Another aspect of this disclosure relates to the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition in the treatment of cells.

[0186] In one embodiment, the subject is a mammal.

[0187] In one embodiment, the mammal in question is a human.

[0188] The disclosed compound may be administered by any method of administration of the therapeutic agent. These methods include systemic or topical administration (e.g., oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal, or topical administration).

[0189] Depending on the method of administration, the compositions disclosed herein may be in solid, semi-solid, or liquid dosage forms (e.g., injections, tablets, suppositories, pills, sustained-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, etc.), and may be in single-dose form, conforming to conventional pharmaceutical practice. Similarly, these may be administered intravenously (both bolus and infusion), intraperitoneally, subcutaneously, or intramuscularly, all of which may be carried out using forms well known to those skilled in the pharmaceutical art.

[0190] Examples of pharmaceutical compositions include tablets and gelatin capsules comprising the compounds of the Disclosure and pharmaceutically acceptable carriers, the carriers being, for example, a) diluents (purified water, triglycerides (e.g., hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof), corn oil, olive oil, sunflower oil, safflower oil, fish oil (e.g., EPA or DHA, or their esters or triglycerides, or mixtures thereof), omega-3 fatty acids or their derivatives, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and / or glycine, etc.); b) lubricants (silica, talc, stearic acid, its magnesium or calcium salt, sodium oleate, sodium stearate, magnesium stearate, etc.); c) binders (such as magnesium aluminum silicate, sodium benzoate, sodium acetate, sodium chloride and / or polyethylene glycol); in the case of tablets, as needed, c) binders (such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, magnesium carbonate, natural sugars (e.g., glucose or β-lactose), corn sweeteners, natural or synthetic thickeners (e.g., gum arabic, tragacanth or sodium alginate), waxes and / or polyvinylpyrrolidone); d) disintegrants (such as starch, agar, methylcellulose, bentonite, xanthan gum, alginic acid or its sodium salt, or effervescent mixtures); e) absorbents, colorants, flavorings, and sweeteners; f) emulsifiers or dispersants (Tween 80, Labrasol, HPMC, DOSS, Caproyl 909, Labrafac, Labrafil, Peceol, Transcutol, Capmul MCM, Capmul PG-12, Captex 355, Gelucire, Vitamin E TGPS, etc.), or other acceptable emulsifiers; and / or g) substances that promote the absorption of the compound (cyclodextrin, hydroxypropyl cyclodextrin, PEG400, PEG200, etc.).

[0191] Liquid compositions for injection, in particular, can be prepared by means of dissolution, dispersion, etc. For example, an isotonic solution or suspension for injection can be formed by dissolving or mixing the disclosed compounds in a pharmaceutically acceptable solvent (e.g., water, physiological saline, dextrose aqueous solution, glycerol, ethanol, etc.). The disclosed compounds can be solubilized using proteins (e.g., albumin, chylomicron particles, or serum proteins).

[0192] The disclosed compounds may be formulated as suppositories that can be prepared from a fatty emulsion or suspension using polyalkylene glycol (e.g., propylene glycol) as a carrier.

[0193] The compounds disclosed herein may also be administered by liposome delivery systems such as small monolayer vesicles, large monolayer vesicles, and multilayer vesicles. Liposomes can be formed from a variety of phospholipids (including cholesterol, stearylamine, or phosphatidylcholine). In some embodiments, as described in U.S. Patent No. 5,262,564 (which is incorporated herein by reference in its entirety), a membrane of lipid components is hydrated with an aqueous solution of the drug to form a lipid layer that encapsulates the drug.

[0194] The disclosed compounds may be delivered using monoclonal antibodies as a specific carrier to which the disclosed compounds are bound. The disclosed compounds can also be bound to soluble polymers as targetable drug carriers. Examples of such polymers include polyvinylpyrrolidone, pyran copolymers, polyhydroxypropyl methacrylamide-phenol, polyhydroxyethyl asparagineamide-phenol, or polyethylene oxide polylysine substituted with palmitoyl residues. Furthermore, the disclosed compounds can be bound to types of biodegradable polymers useful for controlled drug release (e.g., polylactic acid, poly-ε-caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and crosslinkable or amphiphilic block copolymer hydrogels). In some embodiments, the disclosed compounds are not covalently bound to a polymer (e.g., polycarboxylic acid polymers or polyacrylates).

[0195] Parenteral injection preparations are generally administered by subcutaneous, intramuscular, or intravenous injection and infusion. Injectable preparations can be prepared in conventional forms (solutions or suspensions, or solid forms suitable for dissolving in liquid before injection).

[0196] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of formula (I) and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further include excipients, diluents, or surfactants. In some embodiments, the pharmaceutical composition may further include another pharmaceutically active agent.

[0197] In one embodiment, the pharmaceutically acceptable carrier further includes excipients, diluents, surfactants, or any combination thereof.

[0198] In one embodiment, the pharmaceutical composition further includes at least one other therapeutic agent.

[0199] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof for use in cell therapy.

[0200] Each composition may be manufactured according to a conventional mixing, granulation, or coating method, and the pharmaceutical composition may contain about 0.1% to about 99%, about 5% to about 90%, or about 1% to about 20% of the disclosed compound by weight or volume.

[0201] In one embodiment, the composition contains about 1 mg to about 2000 mg of the compound.

[0202] In one embodiment, the composition is administered to the subject twice a day, once a day, once every other day, or once a week.

[0203] [Examples] This disclosure is further illustrated by the following examples and synthesis schemes, which should not be construed as limiting the scope or spirit of this disclosure to the specific procedures described herein. These examples are provided to illustrate specific embodiments and are not intended to limit the scope of this disclosure. Furthermore, it should be understood that various other embodiments, modifications, and equivalents that can be conceived by those skilled in the art may be adopted without departing from the spirit of this disclosure and / or the scope of the appended claims.

[0204] The compounds disclosed herein can be prepared using known chemical reactions and procedures; however, general preparation methods are described below for the reader's reference when synthesizing the compounds. Specific details are provided in the experimental section illustrating the examples.

[0205] All variable groups in these methods are as described in the general description unless otherwise specifically defined below.

[0206] It should be understood that the compounds of the present disclosure having any of the claimed functional groups are not necessarily prepared by any of the methods listed below. Within the scope of each method, any substituents that can function as protecting groups or other non-reaction-participating groups may be present on the reagent or intermediate. These groups are introduced and / or removed in the course of the synthetic scheme to obtain the compounds of the present disclosure using methods well known to those skilled in the art.

[0207] [Abbreviation] Table 2 lists the abbreviations used in this specification and their meanings. [Table 17]

[0208] Analysis method [NMR] The following conditions were used to obtain the proton nuclear magnetic resonance (NMR) spectrum. NMR spectra were measured at either 400 MHz or 500 MHz using a Bruker instrument. DMSO-d6 or CDCl3 were used as the solvent and internal standard. The obtained raw NMR data were analyzed using ADC Labs ACD Spectrus version 2015-01 or MestReNova software. Chemical shifts are expressed in parts per million (ppm) on the downfield side, relative to the internal standard tetramethylsilane (TMS) or the TMS position estimated from the deuterated NMR solvent. Apparent multiplicity is expressed as singlet = s, doublet = d, triplet = t, quartet = q, or multiplet = m. Broad peaks are denoted as br. Integral values ​​are approximate. Note that integral intensity, peak shape, chemical shift, and coupling constants may depend on solvent, concentration, temperature, pH, and other factors. Furthermore, peaks that overlap with or are replaced by water or solvent peaks in the NMR spectrum may not yield reliable integral intensity. In some cases, when obtaining NMR spectra using water peak suppression methods, overlapping peaks may not be observed, or their shape and / or integral values ​​may change.

[0209] [Liquid chromatography] The following preparative and / or analytical (LC / MS) liquid chromatography methods were used.

[0210] Method A: Column: XBridge C18, 2.1 mm x 50 mm; Particle size: 1.7 μm; Mobile phase A: ACN / H2O (5:95, containing 10 mM AA); Mobile phase B: ACN / H2O (95:5, containing 10 mM AA); Temperature: 50°C; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI positive)

[0211] Method B: Column: XBridge C18, 2.1 mm x 50 mm; Particle size: 1.7 μm; Mobile phase A: ACN / H2O (5:95, containing 0.05% TFA); Mobile phase B: ACN / H2O (95:5, containing 0.05% TFA); Temperature: 50°C; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI positive)

[0212] UHPLC Method C: Column: Waters Acquity BEH C18, 2.1 x 50 mm; Particle size: 1.7 μm; Mobile phase A: Acetonitrile:Water (95:5, containing 0.05% TFA); Mobile phase B: Acetonitrile:Water (95:5, containing 0.05% TFA); Temperature: 50°C; Gradient: Elute over 3.00 min from 0%B to 100%B, then elute over 0.50 min at 100%B; Flow rate: 1.0 mL / min; Detection: MS and UV (254 nm)

[0213] UPLCMS Method D: Column: Aquity BEH C18, 50 x 3.0 mm; Particle size: 1.7 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Mobile phase B: ACN: buffer (98:2); Flow rate: 0.7 mL / min; Time (min) / Gradient (%B): 0 / 20, 1.5 / 98, 2 / 98; Detection: MS and UV (254 nm)

[0214] UHPLC Method E: Column: Waters Acquity BEH C18 2.1x50mm; Particle size: 1.7μm; Mobile phase A: Acetonitrile:Water (95:5, containing 0.05% TFA); Mobile phase B: Acetonitrile:Water (95:5, containing 0.05% TFA); Temperature: 50℃; Gradient: Elute over 1.5 minutes from 0%B to 100%B, then elute over 0.50 minutes at 100%B; Flow rate: 1.0mL / min; Detection: MS and UV (254nm)

[0215] LC-MS method F: Column: Kinetex XB-C18 (75x3mm, 2.6μm); Mobile phase A: 0.1% TFA aqueous solution; Mobile phase B: ACN (containing 0.1% TFA); Flow rate: 1.0 mL / min; Time / gradient: Elute over 2.5 minutes from 5%B to 95%B, then elute over 95%B for 2 minutes.

[0216] LC-MS Method G: Column: Kinetex XB-C18 (75x3mm, 2.6μm); 5mM ammonium formate (pH 3.3): ACN (98:2); Mobile phase B: ACN: buffer (98:2); Flow rate: 1.0 mL / min; Time / gradient: Elute over 4.0 minutes from 0%B to 100%B, then elute over 0.6 minutes at 100%B (1.5 mL / min)

[0217] Analytical HPLC method A: Column: Kinetex Biphenyl (100x4.6) mm, 2.6 μm, mobile phase A: 0.05% TFA in water: ACN; mobile phase B: ACN (containing 0.05% TFA): water; flow rate: 1.0 mL / min; time / gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100(1.5mL / min), 12.5 / 100(1.5mL / min), 13 / 10, 15 / 10

[0218] Analytical HPLC method B: Column: Kinetex EVO C18 (100x4.6) mm, 2.6 μm; Mobile phase A: 0.05% TFA aqueous solution: ACN (95:5); Mobile phase B: ACN: 0.05% TFA aqueous solution (95:5); Flow rate: 1.0 mL / min; Time (min) / Gradient (%B): 0 / 10, 1 / 30, 9 / 80, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10

[0219] Preparation of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purin-8-one (intermediate 1) and 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purin-8-one (intermediate 2) as shown in Scheme 1. Scheme 1: [ka]

[0220] Step 1: Synthesis of 2-chloro-4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)pyrimidine-5-carboxylate ethyl(1-3) Potassium carbonate (1.037 g, 7.50 mmol) was added to ethyl 2,4-dichloropyrimidine-5-carboxylate (0.663 g, 3.00 mmol) and 4-aminobicyclo[2.2.1]heptan-1-ol (0.491 g, 3.00 mmol) / acetonitrile (18 mL), and the mixture was stirred at room temperature for 16 hours. The precipitate was collected by filtration, washed with HCl (10 mL), and the filtrate was removed under reduced pressure to obtain products 1-3 (0.935 g, 3.00 mmol, 100% yield). MS: m / z: C 14 H 18 ClN3O3 (theoretical value) [M+H] + 312; (Observed value) 312

[0221] Step 2: Synthesis of 2-chloro-4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)pyrimidine-5-carboxylic acid (1-4) A solution of LiOH (144 mg, 6.00 mmol) / water (9.0 mL) was added to a stirred solution of 2-chloro-4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)pyrimidine-5-carboxylate ethyl (935 mg, 3.00 mmol) / THF (9.0 mL), and the mixture was stirred at 22°C for 3 hours. The organic layer was removed under reduced pressure, and the reaction mixture was acidified with 2 M hydrochloric acid. The precipitate was collected by filtration, washed with water (8 mL), and vacuum-dried to obtain the title compound 1-4 (851 mg, 3.00 mmol, 100% yield) as a white solid. MS: m / z: C 12 H 14 ClN3O3 (theoretical value) [M+H] + 284; (Observed value) 284

[0222] Step 3: Synthesis of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,9-dihydro-8H-purin-8-one(1-5) Triethylamine (0.418 mL, 3.00 mmol) was added to 2-chloro-4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)aminopyrimidine-5-carboxylic acid (850 mg, 3.00 mmol) and diphenyl phosphate azide (DPPA, 825 mg, 3.00 mmol) / DMA (5.0 mL). The mixture was stirred at 22°C for 1 hour, then at 120°C for 16 hours. The reaction mixture was poured onto ice (25 mL), the precipitate was collected by filtration, washed with water (10 mL), and vacuum-dried to obtain the title compound 1-5 (841 mg, 3.00 mmol, 100% yield) as a white solid. MS: m / z: C 12 H 13 ClN4O2 (theoretical value) [M+H] + 281; (Observed value) 281

[0223] Step 4: Synthesis of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purin-8-one (intermediate 1) and 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purin-8-one (intermediate 2) A solution of NaOH (599 mg, 15.00 mmol) / water (1.0 mL) was added to a stirred solution of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,9-dihydro-8H-purine-8-one (841 mg, 3.00 mmol) and MeI (0.937 mL, 15.00 mmol) / THF (6.0 mL), and the mixture was stirred at 22°C for 16 hours. The organic layer was removed under reduced pressure, and the reaction mixture was diluted with water. The precipitate was collected by filtration, washed with water (30 mL), and vacuum-dried to obtain the crude compound. The obtained crude product was purified by column chromatography (0%~30% Â / heptane) to obtain intermediate 1 (370 mg, 1.32 mmol, 41.9% yield) and intermediate 2 (90 mg, 0.29 mmol, 9.7% yield), both as white solids. Intermediate 1: MS: m / z: C 13 H 15 ClN4O2 (theoretical value) [M+H] + 295; (Observed value) 295 Intermediate 2: MS: m / z: C 14 H 17 ClN4O2 (theoretical value) [M+H] + 309; (Observed value) 309

[0224] Preparation of 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) [ka] The title compound was obtained as a white solid (47.15% total yield) in step 1 using 3-fluorobicyclo[1.1.1]pentane-1-amine·HCl according to the method for producing intermediate 1. MS: m / z: C 11 H 10 ClFN4O (Theoretical value) [M+H] + 269; (Observed value) 269

[0225] Preparation of 3-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentane-1-carbonitrile (intermediate 4) [ka] The title compound was obtained as a white solid (total yield 2.3%) by using 3-aminobicyclo[1.1.1]pentane-1-carbonitride in step 1 according to the method for producing intermediate 1. MS: m / z: C 12 H 10 ClFN5O (Theoretical value) [M+H] + 276; (Observed value) 276

[0226] Preparation of 2-chloro-7-methyl-9-(3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)-7,9-dihydro-8H-purine-8-one (intermediate 5) [ka] The title compound was obtained as a white solid (total yield 9.4%) in step 1 using 3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-amine·HCl according to the method for producing intermediate 1. MS: m / z: C 12 H 10 ClF3N4O (Theoretical value) [M+H] + 319; (Observed value) 319

[0227] Preparation of 2-chloro-9-(3-(methoxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 6) [ka] The title compound was obtained as a white solid (52.0% total yield) in step 1 using 3-(methoxymethyl)bicyclo[1.1.1]pentan-1-amine·HCl according to the method for producing intermediate 1. MS: m / z: C 13 H 15 ClN4O2 (theoretical value) [M+H] + 295; (Observed value) 295

[0228] Preparation of 2-(3-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-yl)acetonitrile (intermediate 7) [ka] The title compound was obtained as a white solid (47.0% total yield) in step 1 using 2-(3-aminobicyclo[1.1.1]pentan-1-yl)acetonitrile according to the method for producing intermediate 1. MS: m / z: C 13 H 12 ClN5O (theoretical value) [M+H] + 290; (Observed value) 290

[0229] Preparation of 2-chloro-9-(3-(hydroxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 8) [ka] The title compound was obtained as a white solid (total yield 5.1%) in step 1 using (3-aminobicyclo[1.1.1]pentan-1-yl)methanol·HCl according to the method for producing intermediate 1. MS: m / z: C 13 H 12 ClN5O (theoretical value) [M+H] + 281; (Observed value) 281

[0230] Preparation of 4-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[2.2.2]octane-1-carbonitrile (intermediate 9) [ka] The title compound was obtained as a white solid (37.8% total yield) in step 1 using 4-aminobicyclo[2.2.2]octane-1-carbonitrile according to the method for producing intermediate 1. MS: m / z: C 15 H 16 ClN5O (theoretical value) [M+H] + 318; (Observed value) 318

[0231] Preparation of 2-chloro-9-(4-methoxybicyclo[2.2.2]octan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 10) [ka] The title compound was obtained as a white solid (62.4% total yield) in step 1 using 4-methoxybicyclo[2.2.2]octane-1-amine·HCl according to the method for producing intermediate 1. MS: m / z: C 15 H 19 ClN4O2 (theoretical value) [M+H] + 323; (Observed value) 323

[0232] Preparation of 2-chloro-9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 11) [ka] The title compound was obtained as a white solid (53.9% total yield) in step 1 using 4-aminobicyclo[2.2.2]octan-1-ol·HCl according to the method for producing intermediate 1. MS: m / z: C 14 H 17 ClN4O2 (theoretical value) [M+H] + 309; (Observed value) 309

[0233] Preparation of 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) [ka] The title compound was obtained as a white solid (27.0% total yield) in step 1 using 4-aminobicyclo[2.1.1]hexane-1-ol·HCl according to the method for producing intermediate 2. MS: m / z: C 13 H 15 ClN4O2 (theoretical value) [M+H] + 295; (Observed value) 295

[0234] Preparation of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 13) as shown in Scheme 2 Scheme 2: [ka]

[0235] Step 1: Synthesis of 4-((2-chloro-5-nitropyrimidine-4-yl)amino)bicyclo[2.2.1]heptan-1-ol(2-3) Potassium carbonate (1.04 g, 7.50 mmol) was added to 2,4-dichloro-5-nitropyrimidine (582 mg, 3.00 mmol) and 4-aminobicyclo[2.2.1]heptan-1-ol (491 mg, 3.00 mmol) / acetonitrile (18.0 mL), and the mixture was stirred at 22°C for 16 hours. The precipitate was collected by filtration, washed with ethyl acetate (10 mL), and the filtrate was removed under reduced pressure. The resulting crude product was purified by column chromatography (0%~80% ethyl acetate / heptane) to obtain the title compound (170 mg, 0.60 mmol, 19.9% ​​yield) as a pale yellow solid. MS: m / z: C 11 H 13 ClN4O3 (theoretical value) [M+H] + 285; (Observed value) 285

[0236] Step 2: Synthesis of 4-((5-amino-2-chloropyrimidine-4-yl)amino)bicyclo[2.2.1]heptan-1-ol(2-4) To a vial containing 4-((2-chloro-5-nitropyrimidine-4-yl)amino)bicyclo[2.2.1]heptan-1-ol (0.60 mmol, 170 mg), iron (167 mg, 2.99 mmol), EtOH (0.5 mL), H2O (0.5 mL), and AcOH (0.5 mL) were added. The mixture was heated to 70°C and stirred at the same temperature for 1 hour. The resulting suspension was filtered, and the filter cake was washed with DCM / MeOH. The filtrate was concentrated and purified by column chromatography (50%-100% siRNA / heptane) to obtain the product (152 mg, 0.60 mmol, 100% yield) as a solid. MS: m / z: C 11 H 15 ClN4O (theoretical value) [M+H] + 255; (Observed value) 255

[0237] Step 3: Synthesis of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,9-dihydro-8H-purine-8-thion(2-5) To a solution of 4-((5-amino-2-chloropyrimidine-4-yl)amino)bicyclo[2.2.1]heptan-1-ol (152 mg, 0.60 mmol) / CH2Cl2 (3.0 mL), imidazole (81 mg, 1.19 mmol) and 1,1'-thiocarbonyldiimidazole (319 mg, 1.79 mmol) were added, and the solution was stirred at 22°C for 1 hour. The resulting mixture was acidified to pH=5 with 1 M HCl, and a solid precipitated. The precipitate was collected and vacuum-dried to obtain the product (177 mg, 0.59 mmol, 98.3% yield) as a white solid. MS: m / z: C 12 H 13 ClN4OS (Theoretical value) [M+H] + 297; (Observed value) 297

[0238] Step 4: Synthesis of 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 13) A solution of NaOH (71.6 mg, 1.79 mmol) / water (1.5 mL) was added to a stirred solution of 2-chloro-9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7,9-dihydro-8H-purine-8-thione (177 mg, 0.59 mmol) and MeI (0.112 mL, 1.79 mmol) / THF (3.0 mL), and the mixture was stirred at 22°C for 16 hours. The organic layer was removed under reduced pressure, and the reaction mixture was diluted with water. The precipitate was collected by filtration, washed with water (3.0 mL), and vacuum-dried to obtain the title compound (116 mg, 0.37 mmol, 62.6% yield) as a white solid. MS: m / z: C 13 H 15 ClN4OS (Theoretical value) [M+H] + 311; (Observed value) 311

[0239] Preparation of 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 14) [ka] The title compound was obtained as a white solid (total yield 15.1%) by using 3-fluorobicyclo[1.1.1]pentane-1-amine·HCl in step 1, according to the method for producing intermediate 13. MS: m / z: C 11 H 10 ClFN4S (Theoretical value) [M+H] + 285; (Observed value) 285

[0240] Preparation of 9-((1s,4s)-bicyclo[2.2.2]octan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 15) [ka] The title compound was obtained as a white solid (38.4% total yield) in step 1 using (1s,4s)-bicyclo[2.2.2]octane-2-amine·HCl according to the method for producing intermediate 1. MS: m / z: C 14 H 17 ClN4O (theoretical value) [M+H] + 293; (Observed value) 293

[0241] Preparation of 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 16) [ka] The title compound was obtained as a white solid (total yield 23.9%) by using (1S,2S,4R)-bicyclo[2.2.1]heptan-2-amine in step 1, according to the method for producing intermediate 1. MS: m / z: C 13 H 15 ClN4O (theoretical value) [M+H] + 279; (Observed value) 279

[0242] Preparation of 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 17) as shown in Scheme 3 Scheme 3: [ka] Under a nitrogen atmosphere, a mixture of DIPEA (0.21 mL, 1.20 mmol), bicyclo[1.1.1]pentan-1-ylhydrazine·2HCl (0.056 g, 0.33 mmol), and 1-(2,4-dichloropyrimidine-5-yl)ethanone (0.057 g, 0.30 mmol) in THF (3.00 mL) was stirred at 0°C for 3 hours. The resulting mixture was concentrated under reduced pressure, and the resulting residue was purified with MPLC (hexane / siRNA = 1:1) to obtain the product (18.7 mg, 0.08 mmol, 26.7% yield) as a white solid. MS: m / z: C 11 H 11 ClN4 (theoretical value) [M+H] + 235; (Observed value) 235

[0243] Preparation of 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 18) as shown in Scheme 4 Scheme 4: [ka]

[0244] Step 1. (4-Hydroxybicyclo[2.2.1]heptan-1-yl)glycine ethyl [ka] To a stirred solution of 4-aminobicyclo[2.2.1]heptan-1-ol hydrochloride (1.0 g, 6.11 mmol) / acetonitrile (20 mL), DIPEA (2.67 mL, 15.28 mmol) and ethyl bromoethyl (1.021 g, 6.11 mmol) were added at room temperature, and the mixture was stirred at 25°C for 16 hours. The reaction was monitored by GC-MS, and the reaction mixture was diluted with water (100 mL). The resulting crude product was extracted with ethyl acetate (2 x 100 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the product: (4-hydroxybicyclo[2.2.1]heptan-1-yl)glycineethyl (1.1 g, 2.73 mmol, 44.7% yield). GC-MS m / z (M, M+H) + ; 215.2, 216.2; Rt=6.019 minutes Column: Kinetex XB-C18 (75x30) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Flow rate: 1.0 mL / min

[0245] Step 2. N-(2-chloro-5-nitropyrimidine-4-yl)-N-(4-hydroxybicyclo[2.2.1]heptan-1-yl)glycine ethyl: [ka] To a stirred solution of (4-hydroxybicyclo[2.2.1]heptan-1-yl)glycine ethyl (550 mg, 2.58 mmol) / acetonitrile (4 mL), DIPEA (1.126 mL, 6.45 mmol) and 2,4-dichloro-5-nitropyrimidine (500 mg, 2.58 mmol) were added at 0-25°C, and the mixture was stirred at 25°C for 1 hour. The reaction was monitored by TLC and LC-MS, and the reaction mixture was diluted with water (100 mL). The resulting crude product was extracted with ethyl acetate (2 x 100 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by reverse-phase column chromatography (0.1% ammonium acetate: ACN) to obtain N-(2-chloro-5-nitropyrimidine-4-yl)-N-(4-hydroxybicyclo[2.2.1]heptan-1-yl)glycine ethyl (700 mg, 1.718 mmol, 66.6% yield) as a brown viscous substance. Column: Kinetex XB-C18 (75x30) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Flow rate: 1.0 mL / min

[0246] Step 3. 2-Chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,8-dihydropteridine-6(5H)-one: [ka] To a stirred solution of N-(2-chloro-5-nitropyrimidine-4-yl)-N-(4-hydroxybicyclo[2.2.1]heptan-1-yl)glycine ethyl (700 mg, 1.888 mmol) / acetic acid (10 mL), iron (316 mg, 5.66 mmol) was added at 25 °C, and the mixture was stirred at 70 °C for 2 hours. The reaction was monitored by TLC and LC-MS, and the reaction mixture was concentrated under reduced pressure and diluted with water (70 mL). The mixture was neutralized with 10% NaHCO3 solution (pH ~8) and filtered by Celite. The resulting crude product was extracted with ethyl acetate (2 x 80 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by reverse-phase column chromatography (0.1% ammonium acetate: ACN) to obtain 2-chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,8-dihydropteridine-6(5H)-one (280 mg, 0.893 mmol, 47.3% yield) as an off-white solid. LCMS m / z(M, M+H) + : 295.2, 296.2; Rt: 1.66~1.69 Column: Kinetex XB-C18 (75x30) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Flow rate: 1.0 mL / min

[0247] Step 4. 2-Chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-7,8-dihydropteridine-6(5H)-one (intermediate 18): [ka] To a stirred solution of 2-chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7,8-dihydropteridine-6(5H)-one (150 mg, 0.509 mmol) / N,N-dimethylformamide (3 mL), potassium carbonate (211 mg, 1.527 mmol) and MeI (0.064 mL, 1.018 mmol) were added at 0°C, and the mixture was stirred at 0–25°C for 16 hours. The reaction was monitored by LC-MS. The reaction mixture was diluted with water (30 mL), the resulting crude product was extracted with ethyl acetate (2 x 50 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by reverse-phase column chromatography (0.1% ammonium acetate: ACN) to obtain 2-chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-7,8-dihydropteridine-6(5H)-one (60 mg, 0.190 mmol, 37.4% yield) as an off-white solid. LCMS m / z (M, M+H) + : 309.2, 310.2; Rt:0.842~0.88 minutes Column: Kinetex XB-C18 (75x30) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Flow rate: 1.0 mL / min

[0248] Example 1: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 1) [ka] Scheme 5: [ka] 1,4-Dioxane (0.5 mL) was added to a vial containing 2-chloro-9-(1,1-dimethylsiloran-3-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (15 mg, 0.05 mmol), 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine (7.4 mg, 0.05 mmol), Brettphos Pd G3 (9.1 mg, 0.01 mmol), and cesium carbonate (33 mg, 0.10 mmol). This suspension was purged with N2 for 10 minutes and vigorously stirred at 100°C for 16 hours. The mixture was cooled to 22°C, filtered by Celite, and washed with 10% MeOH / DCM. The filtrate was removed and the solvent was removed under reduced pressure. The resulting residue was purified by reverse-phase chromatography (0.05% NH4OAc / H2O and ACN) to obtain the title compound (14.5 mg, 72.5% yield) as a white solid. MS: m / z: C 20 H 22 N8O2 (theoretical value) [M+H] + 407; (Observed value) 407; 1 H NMR (500MHz, DMSO-d6) δ 9.10(s, 1H), 8.54(s, 1H), 8.37(s, 1H), 8.06(s, 1H), 7.70(s, 1H), 5.05-5.01(m, 1H), 3.40-3.34(m, 3H), 2.39(s, 5H), 2.31(s, 2H), 1.99-1.91(m, 2H), 1.70(br t, J=8.7Hz, 2H), 1.58-1.51(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ Fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: (Observed value) [M + H] + 407, retention time: 1.16 minutes, purity: 100% LCMS2 (containing TFA): (Observed value) [M+H] + 407, retention time: 1.03 minutes, purity: 97.2%

[0249] Compound 1 can also be prepared by the following synthesis protocol. Scheme 6 [ka]

[0250] Step 1'. 4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid(6-2): [ka] In a 20 mL glass vial, ethyl 4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid (450 mg, 1.391 mmol) was added, followed by THF (6 mL) and water (6 mL), and then lithium hydroxide monohydrate (234 mg, 5.57 mmol). The mixture was stirred at 25°C for 3 hours, and the reaction mixture was concentrated under reduced pressure to remove organic volatile substances and acidified with 1.5 N HCl. No precipitate formed. The reaction mixture was further concentrated under reduced pressure (until the volume of the aqueous layer was halved) to obtain a white precipitate. This white solid was filtered through a Buchner funnel and vacuum-dried to obtain 4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid (380 mg, 1.055 mmol, 76% yield) as a white solid. UPLC-MS: 296.0 [M+H] +

[0251] Step 2'. 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2-(methylthio)-7,9-dihydro-8H-purine-8-one(6-3): [ka] In an 8 mL glass vial, 4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid (380 mg, 1.287 mmol) was added, followed by 1,4-dioxane (15 mL) and DMA (1.2 mL). Then, triethylamine (0.197 mL, 1.415 mmol) and subsequently diphenyl phosphate azide (389 mg, 1.415 mmol) were added, and the mixture was stirred at 25°C for 1 hour. The reaction mixture was stirred at 100°C for more than 16 hours until it turned brown, and the reaction mixture was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (60-120 mesh silica gel, 0-10% MeOH / DCM) to obtain 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2-(methylthio)-7,9-dihydro-8H-purin-8-one (250 mg, 0.803 mmol, 62.4% yield). LCMS: m / z 293.2 [M+H] +

[0252] Step 3'. 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-(methylthio)-7,9-dihydro-8H-purine-8-one(6-4): [ka] 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2-(methylthio)-7,9-dihydro-8H-purine-8-one (125 mg, 0.428 mmol) was placed in a 20 mL glass vial, and THF (3 mL) and water (1 mL) were added. Sodium hydroxide (68.4 mg, 1.710 mmol) was then added, followed by iodomethane (0.053 mL, 0.855 mmol), and the mixture was stirred at 25°C for at least 5 hours. After 5 hours, UPLCMS and TLC were examined and it was shown that SM had not been consumed. The mixture was stirred at 25°C for at least 11 hours to obtain a heterogeneous reaction mixture. The reaction mixture was concentrated under reduced pressure, and the crude product was purified using silica gel (60-120 mesh, elution solvent: 0-10% MeOH / DCM) to obtain 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-(methylthio)-7,9-dihydro-8H-purine-8-one (124 mg, 76% yield). LC-MS: m / z 307 [M+H] + , RT=1.32 minutes

[0253] Step 4'. 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-(methylsulfonyl)-7,9-dihydro-8H-purine-8-one(6-5): [ka] 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-(methylthio)-7,9-dihydro-8H-purine-8-one (100 mg, 0.326 mmol) was placed in a glass vial (20 mL), and THF (3 mL) and water (3 mL) were added. This mixture was cooled to 0°C, oxone monosulfate compound (602 mg, 0.979 mmol) was added, and the mixture was stirred at 25°C for 6 hours. The reaction was monitored by UPLC-MS and TLC, and the mixture was filtered through a Buchner funnel. The resulting solid was washed with 5% MeOH / DCM, the filtrates were combined and concentrated under reduced pressure, and purified by reverse-phase column chromatography. After concentration, the target compound (90 mg, 81% yield) was obtained from the pure fraction. LC-MS: m / z 339 [M+H] +

[0254] Step 5'. 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 1): [ka] 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-(methylsulfonyl)-7,9-dihydro-8H-purine-8-one (35 mg, 0.103 mmol) was placed in an 8 mL glass vial, and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine (22.99 mg, 0.155 mmol) and DMF (0.5 mL) were added. A THF solution of lithium bis(trimethylsilyl)amide (0.517 mL, 0.517 mmol) was added to this mixture, and the mixture was stirred at 25°C for 2 hours. After workup, the obtained crude product was purified by preparative HPLC (dilution with THF:ACN:water = 50:30:20, column: X Select C18 (150x19) mm, 5 μm, temperature: ambient temperature, mobile phase A: 5 mM ammonium formate, mobile phase B: ACN, flow rate: 15 mL / min, time (min) / gradient: 0 / 10, 12 / 50) to obtain the target product as a white solid (21.2 mg, 50.1%). LCMS: m / z: 407.3 (M+H) + ; LCMS (purity) = 99.38%, RT: 1.453 min; HPLC (purity) = 99.29%, RT: 5.85 min (HPLC method B; 1 H NMR (400MHz, DMSO-d6): δ 9.10(s, 1H), 8.53(s, 1H), 8.37(s, 1H), 8.06(s, 1H), 7.71(s, 1H), 5.01(s, 1H), 3.27(s, 3H), 2.39-2.42(m, 5H), 2.32-2.34(m, 2H), 1.92-1.99(m, 2H), 1.67-1.74(m, 2H), 1.53-1.58(m, 2H)

[0255] Example 2: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 2) [ka] The title compound was prepared according to Example 1 using 6-methylbenzo[d][1,3]dioxol-5-amine and obtained as a white solid in total yield of 68.0%. MS: m / z: C 21 H 23 N5O4[M+H] + (Theoretical value) 410; (Observed value) 410; 1 H NMR (500MHz, DMSO-d6) δ 8.14(s, 1H), 7.95(s, 1H), 7.01(s, 1H), 6.78(s, 1H), 5.95(s, 2H), 5.05-5.01(m, 1H), 3.43-3.20(m, 3H), 2.39(br s, 2H), 2.30(s, 2H), 2.11(s, 3H), 1.97-1.88(m, 2H), 1.74-1.66(m, 2H), 1.59-1.52(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ Fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 410, retention time 1.46 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 410, retention time 1.17 minutes, purity: 100%

[0256] Example 3: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 3) [ka] The title compound was prepared according to Example 1 using 6-methylbenzo[c][1,2,5]thiadiazole-5-amine and obtained as a white solid in total yield of 51.5%. MS: m / z: C 21 H 23 N5O4[M+H] + (Theoretical value) 424; (Observed value) 424; 1 H NMR (500MHz, DMSO-d6) δ 8.57(s, 1H), 8.40(s, 1H), 8.20(s, 1H), 7.89(s, 1H), 5.10-5.06(m, 1H), 3.34-3.15(m, 3H), 2.54(s, 3H), 2.50-2.46(m, 2H), 2.38(s, 2H), 2.05-1.98(m, 2H), 1.75(br t, J=8.3Hz, 2H), 1.63-1.56(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220 nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 424, retention time 1.48 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 424, retention time 1.19 minutes, purity: 100%

[0257] Example 4: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methylquinoxaline-6-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 4) [ka] The title compound was prepared according to Example 1 using 7-methylquinoxaline-6-amine and obtained as a white solid in a total yield of 69.2%. MS: m / z: C 22 H23 N7O2[M+H] + (Theoretical value) 418; (Observed value) 418; 1 H NMR (500MHz, DMSO-d6) δ 8.79 (d, J=1.7Hz, 1H), 8.72 (d, J=1.7Hz, 1H), 8.60(s, 1H), 8.53(s, 1H), 8.19(s, 1H), 7.90(s, 1H), 5.02(s, 1H), 3.43-3.33(m, 3H), 2.57(s, 3H), 2.48(br d, J=0.9Hz, 2H), 2.36(s, 2H), 2.00(br t, J=10.9Hz, 2H), 1.74(br t, J=9.2Hz, 2H), 1.62-1.53(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220 nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 418, retention time 1.22 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 418, Retention time 1.00 min, Purity: 100%

[0258] Example 5: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 5) [ka] The title compound was prepared according to Example 1 using 7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-amine·HCl and obtained as a white solid in total yield of 59.2%. MS: m / z: C 21 H 23 N5O4[M+H] + (Theoretical value) 424; (Observed value) 424;1 H NMR (500MHz, DMSO-d6) δ 8.08(s, 1H), 7.95(s, 1H), 6.99(s, 1H), 6.67(s, 1H), 5.04-5.01(m, 1H), 4.19(s, 4H), 3.32-3.14(m, 3H), 2.41(br s, 2H), 2.31(s, 2H), 2.08(s, 3H), 1.96-1.89(m, 2H), 1.75-1.67(m, 2H), 1.55(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 424, retention time 1.36 minutes, purity: 98.8% LCMS2 (contains TFA): [M+H] + (Observed value) 424, retention time 1.07 minutes, purity: 98.9%

[0259] Example 6: 9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 6) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 2) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 53.8%. MS: m / z: C 21 H 23 N5O4[M+H] + (Theoretical value) 421; (Observed value) 421; 1H NMR (500MHz, DMSO-d6) δ 9.03(s, 1H), 8.54(s, 1H), 8.31(s, 1H), 8.03(s, 1H), 7.65(s, 1H), 3.37-3.20(m, 3H), 3.06(s, 3H), 2.40-2.32(m, 6H), 2.28(s, 2H), 1.95-1.87(m, 2H), 1.78-1.71(m, 1H), 1.49(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 421, retention time 1.36 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 421, retention time 1.11 minutes, purity: 100%

[0260] Example 7: 9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 7) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 2) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as the 2TFA salt in a total yield of 43.6%. MS: m / z: C 22 H 25 N5O4[M+H] + (Theoretical value) 424; (Observed value) 424; 1H NMR (500MHz, DMSO-d6) δ 7.99(s, 1H), 7.22(s, 1H), 7.12(s, 1H), 7.01(d, J=5.6Hz, 2H), 6.84(s, 1H), 5.97(s, 2H), 3.25(s, 3H), 3.21(s, 3H), 2.41(br s, 2H), 2.33(s, 2H), 2.12(s, 3H), 1.99-1.91(m, 2H), 1.81(br s, 2H), 1.61-1.52(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 424, retention time 1.75 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 424, retention time 1.41 minutes, purity: 100%

[0261] Example 8: 9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 8) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 2) and 6-methylbenzo[c][1,2,5]thiadiazole-5-amine, and obtained as a white solid in total yield of 81.8%. MS: m / z: C 21 H 23 N7O2S [M+H] + (Theoretical value) 438; (Observed value) 438; 1H NMR (500MHz, DMSO-d6) δ 8.54(s, 1H), 8.46(s, 1H), 8.24-8.19(m, 1H), 7.90(s, 1H), 3.40-3.25(m, 3H), 3.19(s, 3H), 2.54(s, 5H), 2.46(s, 2H), 2.08-1.99(m, 2H), 1.87(br t, J=13.0Hz, 2H), 1.65-1.55(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 438, Retention time 1.85 minutes, Purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 438, retention time 1.39 minutes, purity: 100%

[0262] Example 9: 9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methylquinoxaline-6-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 9) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 2) and 7-methylquinoxaline-6-amine, and obtained as a white solid in total yield of 73.8%. MS: m / z: C 23 H 25 N7O2[M+H] + (Theoretical value) 432; (Observed value) 432; 1H NMR (500MHz, DMSO-d6) δ 8.78(d, J=1.9Hz, 1H), 8.72(d, J=1.9Hz, 1H), 8.59-8.56(m, 2H), 8.21(s, 1H), 7.90(s, 1H), 3.39(s, 3H), 3.16(s, 3H), 2.57(s, 3H), 2.45(s, 4H), 2.06-1.98(m, 2H), 1.90-1.82(m, 2H), 1.57(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 432, retention time 1.49 minutes, purity: 98.8% LCMS2 (contains TFA): [M+H] + (Observed value) 432, retention time 1.31 minutes, purity: 100%

[0263] Example 10: 9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 10) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 2) and 7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-amine·HCl, and obtained as a white solid in total yield of 66.7%. MS: m / z: C 23 H 27 N5O4[M+H] + (Theoretical value) 438; (Observed value) 438; 1H NMR (500MHz, DMSO-d6) δ 8.13(s, 1H), 7.98(s, 1H), 7.00(s, 1H), 6.67(s, 1H), 4.18(s, 4H), 3.24(s, 3H), 3.22(s, 3H), 2.43(br s, 2H), 2.39-2.33(m, 2H), 2.09(s, 3H), 1.99-1.90(m, 2H), 1.82(br t, J=11.6Hz, 2H), 1.55(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 438, retention time 1.66 minutes, purity: 98.1% LCMS2 (contains TFA): [M+H] + (Observed value) 438, retention time 1.33 minutes, purity: 96.5%

[0264] Example 11: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methylquinoline-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 11) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 7-methylquinoline-6-amine, and obtained as a white solid in total yield of 30.1%. MS: m / z: C 21 H 19 FN6O [M+H] + (Theoretical value) 391; (Observed value) 391; 1H NMR (500MHz, DMSO-d6) δ 8.74(d, J=3.8Hz, 1H), 8.64(s, 1H), 8.28(s, 1H), 8.21-8.18(m, 2H), 7.86(s, 1H), 7.44(dd, J=8.2, 4.2Hz, 1H), 3.18(s, 1H), 3.43-3.15(m, 2H), 2.72(d, J=1.7Hz, 6H), 2.50(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 391, retention time 1.69 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 391, retention time 1.25 minutes, purity: 100%

[0265] Example 12: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 12) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 61.2%. MS: m / z: C 18 H 17 FN8O [M+H] + (Theoretical value) 381; (Observed value) 381; 1H NMR (500MHz, DMSO-d6) δ 9.15(s, 1H), 8.69(s, 1H), 8.38(s, 1H), 8.14(s, 1H), 7.72(s, 1H), 3.38-3.17(m, 3H), 2.69(d, J=2.0Hz, 6H), 2.40(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 381, retention time 1.43 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 381, retention time 1.25 minutes, purity: 100%

[0266] Example 13: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 13) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a TFA salt in a total yield of 79.4%. MS: m / z: C 19 H 18 FN5O3[M+H] + (Theoretical value) 384; (Observed value) 384; 1 H NMR (500MHz, DMSO-d6) δ 8.03(s, 1H), 7.24-6.97(m, 3H), 6.81(s, 1H), 5.97(s, 2H), 3.28-3.17(m, 3H), 2.67(d, J=2.1Hz, 6H), 2.12(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 384, retention time 1.82 minutes, purity: 99.3% LCMS2 (contains TFA): [M+H] + (Observed value) 384, retention time 1.49 minutes, purity: 99.2%

[0267] Example 14: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 14) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 6-methylbenzo[c][1,2,5]thiadiazole-5-amine, and obtained as a white solid in total yield of 82.3%. MS: m / z: C 18 H 16 FN7OS [M+H] + (Theoretical value) 398; (Observed value) 398; 1 H NMR (500MHz, DMSO-d6) δ 8.62(s, 1H), 8.55(s, 1H), 8.27(s, 1H), 7.91(s, 1H), 3.33(s, 3H), 2.78(d, J=2.1Hz, 6H), 2.55(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 398, retention time 1.89 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 398, retention time 1.63 minutes, purity: 100%

[0268] Example 15: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methylquinoxaline-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 15) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 7-methylquinoxaline-6-amine, and obtained as a white solid in total yield of 84.1%. MS: m / z: C 20 H 18 FN7O [M+H] + (Theoretical value) 392; (Observed value) 392; 1 H NMR (500MHz, DMSO-d6) δ 8.82(s, 1H), 8.74(d, J=1.7Hz, 1H), 8.71(s, 1H), 8.66(s, 1H), 8.26(s, 1H), 7.92(s, 1H), 3.33(s, 3H), 2.79-2.73(m, 6H), 2.58(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 392, retention time 1.54 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 392, retention time 1.31 minutes, purity: 100%

[0269] Example 16: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 16) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) and 7-methyl-2,3-dihydrobenzo[b][1,4]dioxin-6-amine·HCl, and obtained as a white solid in total yield of 74.7%. MS: m / z: C 20 H 20 FN5O3[M+H] + (Theoretical value) 398; (Observed value) 398; 1 H NMR (500MHz, DMSO-d6) δ 8.51-8.05(m, 1H), 8.03-8.01(m, 1H), 7.02(s, 1H), 6.69(s, 1H), 4.20(s, 4H), 3.26(s, 3H), 2.68(d, J=1.3Hz, 6H), 2.09(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 398, retention time 1.73 minutes, purity: 93.7% LCMS2 (contains TFA): [M+H] + (Observed value) 398, retention time 1.37 minutes, purity: 100%

[0270] Example 17: 3-(7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentane-1-carbonitrile (compound 17) [ka] The title compound was prepared according to Example 1 using 3-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-carbonitrile (intermediate 4) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 40.7%. MS: m / z: C 20 H 18 FN6O3[M+H] + (Theoretical value) 391; (Observed value) 391; 1 H NMR (500MHz, DMSO-d6) δ 8.30(s, 1H), 8.02(s, 1H), 7.02(s, 1H), 6.80(s, 1H), 5.97(s, 2H), 3.35-3.15(m, 3H), 2.82(s, 6H), 2.12(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 391, retention time 1.63 minutes, purity: 98.9% LCMS2 (contains TFA): [M+H] + (Observed value) 391, retention time 1.29 minutes, purity: 96.4%

[0271] Example 18: 7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-9-(3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)-7,9-dihydro-8H-purine-8-one (compound 18) [ka] The title compound was prepared according to Example 1 using 2-chloro-7-methyl-9-(3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)-7,9-dihydro-8H-purine-8-one (intermediate 5) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 38.9%. MS: m / z: C 19 H 17 F3N8O [M+H] + (Theoretical value) 431; (Observed value) 431; 1 H NMR (500MHz, DMSO-d6) δ 9.15(s, 1H), 8.68(s, 1H), 8.37(s, 1H), 8.14(s, 1H), 7.72(s, 1H), 3.28(s, 3H), 2.62(s, 6H), 2.40(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 431, retention time 1.58 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 431, retention time 1.35 minutes, purity: 100%

[0272] Example 19: 7-Methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-9-(3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)-7,9-dihydro-8H-purine-8-one (compound 19) [ka] The title compound was prepared according to Example 1 using 2-chloro-7-methyl-9-(3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)-7,9-dihydro-8H-purine-8-one (intermediate 5) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as the 2TFA salt in a total yield of 42.3%. MS: m / z: C 20 H 18 F3N5O3[M+H] + (Theoretical value) 434; (Observed value) 434; 1 H NMR (500MHz, DMSO-d6) δ 8.03(s, 1H), 7.23-6.99(m, 4H), 6.82(s, 1H), 5.96(s, 2H), 3.26(s, 3H), 2.60(s, 6H), 2.12(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 434, Retention time 2.01 minutes, Purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 434, retention time 1.64 minutes, purity: 99.2%

[0273] Example 20: 9-(3-(methoxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 20) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-(methoxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 6) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 58.2%. MS: m / z: C 20 H 22 N8O2[M+H] + (Theoretical value) 407; (Observed value) 407; 1 H NMR (500MHz, DMSO-d6) δ 9.15(s, 1H), 8.60(s, 1H), 8.37(s, 1H), 8.10(s, 1H), 7.71(s, 1H), 3.46(s, 2H), 3.31-3.21(m, 3H), 2.57-2.52(m, 3H), 2.40(s, 3H), 2.27(s, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 407, retention time 1.29 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 407, retention time 1.16 minutes, purity: 100%

[0274] Example 21: 9-(3-(methoxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 21) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-(methoxymethyl)bicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 6) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 54.5%. MS: m / z: C 20 H 22 N8O2[M+H] + (Theoretical value) 410; (Observed value) 410; 1 H NMR (500MHz, DMSO-d6) δ 8.25(br s, 1H), 7.99(s, 1H), 7.05(s, 1H), 6.79(s, 1H), 5.95(s, 2H), 3.47(s, 3H), 3.28(s, 2H), 3.24(s, 3H), 2.25(s, 6H), 2.12(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 410, retention time 1.69 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 410, retention time 1.37 minutes, purity: 99.3%

[0275] Example 22: 2-(3-(7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-yl)acetonitrile (compound 22) [ka] The title compound was prepared according to Example 1 using 2-(3-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-yl)acetonitrile (intermediate 7) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 60.0%. MS: m / z: C 20 H 19 N9O [M+H] + (Theoretical value) 402; (Observed value) 402; 1 H NMR (500MHz, DMSO-d6) δ 9.11(s, 1H), 8.63(s, 1H), 8.37(s, 1H), 8.10(s, 1H), 7.70(s, 1H), 3.27(s, 2H), 2.98(s, 3H), 2.40(s, 3H), 2.35(s, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 402, retention time 1.26 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 402, retention time 1.12 minutes, purity: 99.3%

[0276] Example 23: 2-(3-(7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-yl)acetonitrile (compound 23) [ka] The title compound was prepared according to Example 1 using 2-(3-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[1.1.1]pentan-1-yl)acetonitrile (intermediate 7) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 59.5%. MS: m / z: C 21 H 20 N6O3[M+H] + (Theoretical value) 405; (Observed value) 405; 1 H NMR (500MHz, DMSO-d6) δ 8.27(s, 1H), 7.99(s, 1H), 7.02(s, 1H), 6.78(s, 1H), 5.95(s, 2H), 3.24(s, 2H), 2.98(s, 3H), 2.33(s, 6H), 2.12(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 405, retention time 1.61 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 405, retention time 1.30 minutes, purity: 100%

[0277] Example 24: 4-(7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[2.2.2]octane-1-carbonitrile (compound 24) [ka] The title compound was prepared according to Example 1 using 4-(2-chloro-7-methyl-8-oxo-7,8-dihydro-9H-purine-9-yl)bicyclo[2.2.2]octane-1-carbonitrile (intermediate 9) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 78.5%. MS: m / z: C 22 H 23 N9O [M+H] + (Theoretical value) 433; (Observed value) 433; 1 H NMR (500MHz, DMSO-d6) δ 7.98(s, 1H), 7.24-6.98(m, 2H), 6.85(s, 1H), 5.99(s, 2H), 3.23(s, 3H), 2.46-2.38(m, 6H), 2.11(s, 3H), 2.04-1.99(m, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 433, retention time 1.74 minutes, purity: 99.3% LCMS2 (contains TFA): [M+H] + (Observed value) 433, retention time 1.34 minutes, purity: 98.5%

[0278] Example 25: 9-(4-methoxybicyclo[2.2.2]octan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 25) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.2]octan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 10) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 79.2%. MS: m / z: C 22 H 26 N8O2[M+H] + (Theoretical value) 435; (Observed value) 435; 1 H NMR (500MHz, DMSO-d6) δ 9.14(s, 1H), 8.57(s, 1H), 8.38(s, 1H), 8.08(s, 1H), 7.71(s, 1H), 3.06(s, 3H), 2.48(br d, J=8.3Hz, 6H), 2.40(s, 3H), 1.72-1.65(m, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 435, retention time 1.31 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 435, retention time 1.06 minutes, purity: 100%

[0279] Example 26: 9-(4-methoxybicyclo[2.2.2]octan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 26) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.2.2]octan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 10) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 93.9%. MS: m / z: C 23 H 27 N5O4[M+H] + (Theoretical value) 438; (Observed value) 438; 1 H NMR (500MHz, DMSO-d6) δ 7.97(s, 1H), 7.27-6.97(m, 2H), 6.86(s, 1H), 5.99(s, 2H), 3.23(s, 3H), 3.07(s, 3H), 2.48-2.43(m, 6H), 2.12(s, 3H), 1.72-1.67(m, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 438, retention time 1.73 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 438, retention time 1.34 minutes, purity: 100%

[0280] Example 27: 9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 27) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 11) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 77.2%. MS: m / z: C 22 H 25 N5O4[M+H] + (Theoretical value) 424; (Observed value) 424; 1 H NMR (500MHz, DMSO-d6) δ 7.95(s, 1H), 7.03(s, 1H), 6.80(s, 1H), 5.96(s, 2H), 3.21(s, 2H), 2.47-2.42(m, 6H), 2.12(s, 3H), 1.66-1.61(m, 6H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 424, Retention time 1.40 minutes, Purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 424, retention time 1.05 minutes, purity: 100%

[0281] Example 28: 9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (Compound 28) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 29.6%. MS: m / z: C 21 H 23 N5O4[M+H] + (Theoretical value) 410; (Observed value) 410; 1 H NMR (500MHz, DMSO-d6) δ 7.99(s, 1H), 7.0-7.0(m, 1H), 6.83(s, 1H), 5.97(s, 2H), 3.3-3.3(m, 2H), 2.1-2.2(m, 7H), 1.9-2.0(m, 2H), 1.7-1.8(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 410, retention time 1.63 minutes, purity: 98.3% LCMS2 (contains TFA): [M+H] + (Observed value) 410, retention time 1.30 minutes, purity: 96.8%

[0282] Example 29: 9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 29) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 31.8%. MS: m / z: C 20 H 22 N8O2[M+H] + (Theoretical value) 407; (Observed value) 407; 1 H NMR (500MHz, DMSO-d6) δ 9.16(s, 1H), 8.59(s, 1H), 8.36(s, 1H), 8.11(s, 1H), 7.70(s, 1H), 3.4-3.28(s, 2H), 3.23(m, 1H), 2.40(s, 3H), 2.13(br s, 4H), 2.01-1.98(m, 2H), 1.74-1.71(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 407, retention time 1.21 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 407, retention time 1.03 minutes, purity: 100%

[0283] Example 30: 9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 30) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) and 6-methylbenzo[c][1,2,5]thiadiazole-5-amine, and obtained as a white solid in total yield of 33.6%. MS: m / z: C 20 H 21 N7O2S [M+H] + (Theoretical value) 424; (Observed value) 424; 1 H NMR (500MHz, DMSO-d6) δ 8.63(s, 1H), 8.49(s, 1H), 8.24(s, 1H), 7.90(s, 1H), 3.43(s, 3H), 3.33(s, 2H), 2.27-2.19(m, 4H), 2.08-2.02(m, 2H), 1.78(br dd, J=5.1, 7.1Hz, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 424, retention time 1.79 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 424, retention time 1.79 minutes, purity: 100%

[0284] Example 31: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-thion (compound 31) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 13) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 60.6%. MS: m / z: C 20 H 22 N8OS [M+H] + (Theoretical value) 423; (Observed value) 423; 1 H NMR (500MHz, DMSO-d6) δ 9.13(s, 1H), 8.76(s, 1H), 8.60-8.58(m, 1H), 8.38(s, 1H), 7.72(s, 1H), 5.19-5.15(m, 1H), 2.68(s, 3H), 2.58(br s, 2H), 2.46-2.42(m, 2H), 2.40(s, 3H), 1.98-1.90(m, 2H), 1.76(br s, 2H), 1.60(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 423, retention time 1.26 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 423, retention time 1.08 minutes, purity: 100%

[0285] Example 32: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-thion (compound 32) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 13) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 74.8%. MS: m / z: C 21 H 23 N5O3S [M+H] + (Theoretical value) 426; (Observed value) 426; 1 H NMR (500MHz, DMSO-d6) δ 8.51(s, 1H), 7.05(s, 1H), 7.25-6.98(m, 1H), 6.82(s, 1H), 5.97(s, 2H), 2.67(s, 3H), 2.60-2.53(m, 2H), 2.42(s, 2H), 2.13(s, 3H), 1.92(br s, 2H), 1.76(br s, 2H), 1.61(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 426, retention time 1.58 minutes, purity: 98.3% LCMS2 (contains TFA): [M+H] + (Observed value) 426, retention time 1.23 minutes, purity: 99.2%

[0286] Example 33: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-2-((7-methylquinoxaline-6-yl)amino)-7,9-dihydro-8H-purine-8-thion (compound 33) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 13) and 7-methylquinoxaline-6-amine, and obtained as a white solid in total yield of 71.4%. MS: m / z: C 22 H 23 N7OS [M+H] + (Theoretical value) 434; (Observed value) 434; 1 H NMR (500MHz, DMSO-d6) δ 8.83-8.77(m, 2H), 8.74(d, J=1.7Hz, 1H), 8.71(s, 1H), 8.64(s, 1H), 7.92(s, 1H), 2.70(s, 5H), 2.58(s, 3H), 2.55(s, 1H), 2.49(br s, 2H), 2.04-1.96(m, 2H), 1.84-1.76(m, 2H), 1.67-1.60(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 434, retention time 1.49 minutes, purity: 100% LCMS2 (contains TFA): [M+H] + (Observed value) 434, retention time 1.26 minutes, purity: 99.4%

[0287] Example 34: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-thion (compound 34) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 14) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 77.0%. MS: m / z: C 18 H 17 FN8S [M+H] + (Theoretical value) 397; (Observed value) 397; 1 H NMR (500MHz, DMSO-d6) δ 9.23(s, 1H), 8.96(s, 1H), 8.66(s, 1H), 8.43(s, 1H), 7.75(s, 1H), 2.84(d, J=1.9Hz, 6H), 2.71(s, 3H), 2.42(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 397, retention time 1.56 minutes, purity: 98.3% LCMS2 (contains TFA): [M+H] + (Observed value) 397, retention time 1.36 minutes, purity: 100%

[0288] Example 35: 9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-thion (compound 35) [ka] The title compound was prepared according to Example 1 using 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-thion (intermediate 14) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 71.7%. MS: m / z: C 19 H 18 FN5O2S [M+H] + (Theoretical value) 400; (Observed value) 400; 1 H NMR (500MHz, DMSO-d6) δ 8.54(s, 2H), 7.11(s, 1H), 6.81(s, 1H), 5.97(s, 2H), 2.81(d, J=1.9Hz, 6H), 2.69(s, 3H), 2.14(s, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 400, retention time 1.99 minutes, purity: 98.6% LCMS2 (contains TFA): [M+H] + (Observed value) 400, retention time 1.61 minutes, purity: 97.4%

[0289] Example 36: 2-((5-fluoro-2-methyl-4-(oxazol-5-yl)phenyl)amino)-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (compound 36) [ka] Scheme 7: [ka]

[0290] Step 1: Synthesis of 5-fluoro-2-methyl-4-(oxazol-5-yl)aniline Dioxane (1.0 mL) and water (0.2 mL) were added to two drum vials containing oxazole-5-boronic acid pinacol ester (5 mg, 0.18 mmol), 4-bromo-5-fluoro-2-methylaniline (31 mg, 0.15 mmol), [1,1'-bis(di-tert-butylphosphino)ferrocene]dichloropalladium(II) (9.8 mg, 0.015 mmol), and tripotassium phosphate (64 mg, 0.30 mmol). The mixture was stirred overnight at 100°C. The resulting suspension was concentrated to dryness, dissolved in EA, and filtered to obtain the target compound (29 mg, 0.015 mmol, 100% yield) as a dark oil.

[0291] Step 2: Synthesis of 2-((5-fluoro-2-methyl-4-(oxazol-5-yl)phenyl)amino)-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one The title compound was prepared according to Example 1 using 2-chloro-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 1) and 5-fluoro-2-methyl-4-(oxazol-5-yl)aniline, and obtained as a white solid in total yield of 28.9%. MS: m / z: C 23 H 23 FN6O3[M+H] + (Theoretical value) 451; (Observed value) 451; 1 H NMR (500MHz, DMSO-d6) δ 8.48-8.39(m, 2H), 8.15-8.10(m, 1H), 7.95(d, J=14.5Hz, 1H), 7.61-7.55(m, 1H), 7.41(d, J=3.2Hz, 1H), 3.28(s, 3H), 3.17(s, 1H), 2.45(br d, J=1.3Hz, 2H), 2.36(s, 2H), 2.32(s, 3H), 2.03-1.93(m, 2H), 1.79-1.69(m, 2H), 1.64-1.54(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 451, retention time 1.52 minutes, purity: 91.2% LCMS2 (contains TFA): [M+H] + (Observed value) 451, retention time 1.24 minutes, purity: 98.1%

[0292] Example 37: 2-((5-fluoro-2-methyl-4-(1-methyl-1H-pyrazole-4-yl)phenyl)amino)-9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (compound 37) [ka] The title compound was prepared according to Example 36 using 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole in Step 1, and obtained as a white solid in total yield of 54.8%. MS: m / z: C 24 H 26 FN7O2[M+H] + (Theoretical value) 464; (Observed value) 464; 1 H NMR (500MHz, DMSO-d6) δ 8.27(s, 1H), 8.09-8.05(m, 1H), 8.05-8.02(m, 1H), 7.82(s, 1H), 7.71(d, J=13.8Hz, 1H), 7.49(br d, J=9.0Hz, 1H), 3.90-3.86(m, 3H), 3.41-3.21(m, 3H), 2.44(br s, 2H), 2.35(s, 2H), 2.26(s, 3H), 2.01-1.93(m, 2H), 1.73(br s, 2H), 1.57(br s, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 464, retention time 1.46 minutes, purity: 98.1% LCMS2 (contains TFA): [M+H] + (Observed value) 464, retention time 1.19 minutes, purity: 97.3%

[0293] Example 38: 2-((5-fluoro-2-methyl-4-(1-methyl-1H-pyrazole-4-yl)phenyl)amino)-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (compound 38) [ka] The title compound was prepared according to Example 36 using 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole in step 1 and 2-chloro-9-(3-fluorobicyclo[1.1.1]pentan-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 3) in step 2, and was obtained as a white solid in total yield of 58.9%. MS: m / z: C 22 H 21 F2N7O [M+H] + (Theoretical value) 438; (Observed value) 438; 1 H NMR (500MHz, DMSO-d6) δ 8.49(s, 1H), 8.17-8.11(m, 1H), 8.06(br s, 1H), 7.84(s, 1H), 7.73(br d, J=14.0Hz, 1H), 7.52(d, J=8.7Hz, 1H), 3.91-3.85(m, 3H), 3.43-3.26(m, 3H), 2.75-2.70(m, 6H), 2.29-2.24(m, 3H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 438, retention time 1.77 minutes, purity: 95.8% LCMS2 (contains TFA): [M+H] + (Observed value) 438, retention time 1.48 minutes, purity: 100%

[0294] Example 39: 2-((5-fluoro-2-methyl-4-(1-methyl-1H-pyrazole-4-yl)phenyl)amino)-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (compound 39) [ka] The title compound was prepared according to Example 36 using 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole in step 1 and 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) in step 2, and was obtained as a white solid in total yield of 48.1%. MS: m / z: C 24 H 26 FN7O [M+H] + (Theoretical value) 464; (Observed value) 464; 1H NMR (500MHz, DMSO-d6) δ 8.46(s, 1H), 8.12(s, 1H), 8.05(s, 1H), 7.83(s, 1H), 7.74(d, J=14.0Hz, 1H), 7.51(d, J=8.5Hz, 1H), 3.91-3.87(m, 3H), 3.42(br s, 1H), 3.31-3.24(m, 5H), 3.17(s, 1H), 2.37(s, 1H), 2.27(s, 3H), 2.18(s, 4H), 2.01(br dd, J=6.2, 7.3Hz, 2H), 1.75(br dd, J=5.4, 6.7Hz, 2H), 1.25-1.12(m, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 464, retention time 1.68 minutes, purity: 91.5% LCMS2 (contains TFA): [M+H] + (Observed value) 464, retention time 1.35 minutes, purity: 96.4%

[0295] Example 40: 2-Fluoro-4-((9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-8-oxo-8,9-dihydro-7H-purine-2-yl)amino)-5-methylbenzamide (Compound 40) [ka] Scheme 8: [ka]

[0296] Step 1: Synthesis of 4-amino-2-fluoro-5-methylbenzamide 4-amino-2-fluoro-5-methylbenzonitrile (150 mg, 0.999 mmol) was stirred in DMSO (0.7 mL) and cooled in an ice bath. H2O2 (0.153 mL, 4.99 mmol) was added, and the mixture was stirred at 60°C for 1.5 hours, after which H2O (3 mL) was added. The mixture was filtered, and the resulting solid was washed with water and recovered. The product (115 mg, 0.68 mmol, 68.4% yield) was dried under reduced pressure to obtain a white solid.

[0297] Step 2: Synthesis of 2-fluoro-4-((9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-8-oxo-8,9-dihydro-7H-purine-2-yl)amino)-5-methylbenzamide The title compound was prepared according to Example 1 using 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) and 4-amino-2-fluoro-5-methylbenzamide, and obtained as a white solid in total yield of 21.2%. MS: m / z: C 21 H 23 FN6O3[M+H] + (Theoretical value) 427; (Observed value) 427; 1 H NMR (500MHz, DMSO-d6) δ 8.54-8.40(m, 1H), 8.25-8.11(m, 1H), 7.94(d, J=14.5Hz, 1H), 7.55(br d, J=8.8Hz, 1H), 7.48-7.36(m, 2H), 3.34-3.30(m, 1H), 3.30-3.26(m, 2H), 2.29(s, 3H), 2.22(br s, 4H), 2.02(br d, J=6.7Hz, 2H), 1.77(br d, J=5.2Hz, 2H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] +(Observed value) 427, retention time 1.36 minutes, purity: 913.4% LCMS2 (contains TFA): [M+H] + (Observed value) 427, retention time 1.19 minutes, purity: 93.3%

[0298] Example 41: 2-((5-fluoro-2-methyl-4-(oxazol-5-yl)phenyl)amino)-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (compound 41) [ka] The title compound was prepared according to Example 36 using 2-chloro-9-(4-methoxybicyclo[2.1.1]hexane-1-yl)-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 12) in step 2, and obtained as a white solid in total yield of 24.2%. MS: m / z: C 23 H 23 FN6O3[M+H] + (Theoretical value) 451; (Observed value) 451; 1 H NMR (500MHz, DMSO-d6) δ 8.54(s, 1H), 8.47(s, 1H), 8.18(s, 1H), 8.00(d, J=13.9Hz, 1H), 7.58(d, J=8.5Hz, 1H), 7.43(d, J=3.2Hz, 1H), 3.32-3.24(m, 4H), 2.33(s, 3H), 2.20(br s, 4H), 2.09-1.99(m, 2H), 1.80-1.73(m, 2H), 1.13(d, J=13.9Hz, 1H) Purification conditions: Column: XBridge C18, 19mm x 200mm, particle size: 5μm; flow rate: 20mL / min; column temperature: 25℃ The fractions were identified and recovered using UV (220nm) and MS (ESI positive). LCMS method A: [M+H] + (Observed value) 451, retention time 1.76 minutes, purity: 95.4% LCMS2 (contains TFA): [M+H] + (Observed value) 451, retention time 1.51 minutes, purity: 96.5%

[0299] Example 42: 9-((1s,4s)-bicyclo[2.2.2]octan-2-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 42) [ka] The title compound was prepared according to Example 1 using 9-((1s,4s)-bicyclo[2.2.2]octan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 15) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 52.9%. MS: m / z: C 21 H 24 N6O [M+H] + (Theoretical value) 405; (Observed value) 405; 1 H NMR (500MHz, DMSO-d6) δ 9.03(s, 1H), 8.62(s, 1H), 8.37(s, 1H), 8.11(s, 1H), 7.71(s, 1H), 4.48-4.43(m, 1H), 3.39-3.36(m, 3H), 2.75(br d, J=19.3Hz, 1H), 2.36(s, 3H), 1.83(br s, 1H), 1.81-1.73(m, 1H), 1.64(br s, 1H), 1.57(br s, 1H), 1.53-1.42(m, 4H), 1.33(br s, 1H), 1.23(br t, J=11.9Hz, 1H), 1.08(br s, 1H)

[0300] Example 43: 9-((1s,4s)-bicyclo[2.2.2]octan-2-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 43) [ka] The title compound was prepared according to Example 1 using 9-((1s,4s)-bicyclo[2.2.2]octan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 15) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 59.8%. MS: m / z: C 22 H 25 N5O3[M+H] + (Theoretical value) 408; (Observed value) 408; 1 H NMR (500MHz, DMSO-d6) δ 8.23(s, 1H), 8.01(s, 1H), 6.93(s, 1H), 6.78(s, 1H), 5.93(d, J=2.7Hz, 2H), 4.46-4.40(m, 1H), 3.47-3.30(m, 3H), 2.84-2.78(m, 1H), 2.10(s, 3H), 1.93-1.84(m, 1H), 1.75(br t, J=12.4Hz, 1H), 1.64(br s, 1H), 1.60-1.49(m, 6H), 1.26(br s, 2H)

[0301] Example 44: 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-7-methyl-2-((7-methylquinoline-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 44) [ka] The title compound was prepared according to Example 1 using 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 16) and 7-methylquinoline-6-amine, and obtained as a white solid in total yield of 72.3%. MS: m / z: C 23 H 24 N6O [M+H] + (Theoretical value) 401; (Observed value) 401; 1H NMR (500MHz, DMSO-d6) δ 8.95(br d, J=3.5Hz, 1H), 8.61(br d, J=10.1Hz, 1H), 8.47(br s, 1H), 8.19(s, 1H), 7.98(s, 1H), 7.77(br s, 1H), 7.29-6.96(m, 4H), 4.27-4.21(m, 1H), 3.33(s, 3H), 2.58(s, 3H), 2.41(br s, 2H), 2.25-2.17(m, 2H), 1.72-1.64(m, 1H), 1.55-1.42(m, 2H), 1.25(br d, J=10.2Hz, 1H), 1.22-1.14(m, 1H), 1.02(br d, J=8.9Hz, 1H)

[0302] Example 45: 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 45) [ka] The title compound was prepared according to Example 1 using 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 16) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 70.6%. MS: m / z: C 20 H 22 N8O [M+H] + (Theoretical value) 401; (Observed value) 401; 1H NMR (500MHz, DMSO-d6) δ 8.88(s, 1H), 8.18(d, J=1.5Hz, 1H), 7.87(s, 1H), 7.50(s, 1H), 7.05-6.72(m, 1H), 3.94(br s, 1H), 3.06(s, 3H), 2.21-2.12(m, 4H), 2.09(br s, 1H), 1.99(br s, 1H), 1.87(br s, 1H), 1.39(br t, J=10.5Hz, 1H), 1.22(br t, J=10.9Hz, 2H), 1.03-0.95(m, 1H), 0.92(br d, J=8.9Hz, 1H), 0.73(br d, J=10.2Hz, 1H)

[0303] Example 46: 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-7-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 46) [ka] The title compound was prepared according to Example 1 using 9-((1S,2S,4R)-bicyclo[2.2.1]heptan-2-yl)-2-chloro-7-methyl-7,9-dihydro-8H-purine-8-one (intermediate 16) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 73.6%. MS: m / z: C 21 H 23 N5O3[M+H] + (Theoretical value) 394; (Observed value) 394; 1H NMR (500MHz, DMSO-d6) δ 8.01(s, 1H), 7.30-7.01(m, 1H), 7.01-6.99(m, 1H), 6.84(s, 1H), 5.98(d, J=1.6Hz, 2H), 4.15(br d, J=5.6Hz, 1H), 3.64-2.87(m, 3H), 2.41(br s, 1H), 2.33(br s, 1H), 2.28(br s, 1H), 2.17-2.09(m, 4H), 1.66-1.60(m, 1H), 1.49(br s, 2H), 1.26-1.20(m, 1H), 1.16(br d, J=11.0Hz, 1H), 1.07-1.02(m, 1H)

[0304] Example 47: 1-(bicyclo[1.1.1]pentan-1-yl)-3-methyl-N-(7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)-1H-pyrazolo[3,4-d]pyrimidine-6-amine (compound 47) [ka] The title compound was prepared according to Example 1 using 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 17) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine, and obtained as a white solid in total yield of 87.0%. MS: m / z: C 18 H 18 N8[M+H] + (Theoretical value) 347; (Observed value) 347; 1 H NMR (500MHz, DMSO-d6) δ 9.36(s, 1H), 9.19(s, 1H), 8.97(s, 1H), 8.41(s, 1H), 7.74(s, 1H), 2.63(s, 1H), 2.44(s, 6H), 2.32(s, 6H)

[0305] Example 48: 1-(bicyclo[1.1.1]pentan-1-yl)-3-methyl-N-(6-methylbenzo[d][1,3]dioxol-5-yl)-1H-pyrazolo[3,4-d]pyrimidine-6-amine (compound 48) [ka] The title compound was prepared according to Example 1 using 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 17) and 6-methylbenzo[d][1,3]dioxol-5-amine, and obtained as a white solid in total yield of 42.9%. MS: m / z: C 19 H 19 N5O2[M+H] + (Theoretical value) 350; (Observed value) 350; 1 H NMR (500MHz, DMSO-d6) δ 8.84(s, 1H), 8.79(s, 1H), 7.21(s, 1H), 6.81(s, 1H), 5.98(s, 2H), 2.61(s, 1H), 2.40(s, 3H), 2.28(s, 6H), 2.15(s, 3H)

[0306] Example 49: N-(1-(bicyclo[1.1.1]pentan-1-yl)-3-methyl-1H-pyrazolo[3,4-d]pyrimidine-6-yl)-7-methylquinoxaline-6-amine (Compound 49) [ka] The title compound was prepared according to Example 1 using 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 17) and 7-methylquinoxaline-6-amine, and obtained as a white solid in total yield of 71.3%. MS: m / z: C 20 H 19 N7[M+H] + (Theoretical value) 358; (Observed value) 358; 1H NMR (500MHz, DMSO-d6) δ 9.12(s, 1H), 9.05(s, 1H), 8.90(s, 1H), 8.85(s, 1H), 8.78(s, 1H), 7.95(s, 1H), 2.68(s, 1H), 2.61(s, 3H), 2.48(s, 3H), 2.41(s, 6H)

[0307] Example 50: N-(1-(bicyclo[1.1.1]pentan-1-yl)-3-methyl-1H-pyrazolo[3,4-d]pyrimidine-6-yl)-6-methylbenzo[c][1,2,5]thiadiazole-5-amine (compound 50) [ka] The title compound was prepared according to Example 1 using 1-(bicyclo[1.1.1]pentan-1-yl)-6-chloro-3-methyl-1H-pyrazolo[3,4-d]pyrimidine (intermediate 17) and 6-methylbenzo[c][1,2,5]thiadiazole-5-amine, and obtained as a white solid in total yield of 52.1%. MS: m / z: C 18 H 17 N7S [M+H] + (Theoretical value) 364; (Observed value) 364; 1 H NMR (500MHz, DMSO-d6) δ 9.06(s, 1H), 9.04-8.98(m, 1H), 8.86(s, 1H), 7.94(s, 1H), 2.70(s, 1H), 2.58(s, 3H), 2.48(s, 3H), 2.42(s, 6H)

[0308] Example 51: 8-{4-hydroxybicyclo[2.2.1]heptan-1-yl}-5-methyl-2-({7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl}amino)-5,6,7,8-tetrahydropteridine-6-one (compound 51) [ka] To a stirred solution of 2-chloro-8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-7,8-dihydropteridine-6(5H)-one (intermediate 18, 40 mg, 0.130 mmol) / dioxane (5 mL), Cs2CO3 (127 mg, 0.389 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine (26.9 mg, 0.181 mmol) were added at ambient temperature. The mixture was degassed for 5 minutes, and 1,1'-bis(dicyclohexylphosphino)ferrocene (14.99 mg, 0.026 mmol) and Pd2(dba)3 (23.73 mg, 0.026 mmol) were added, degassed for 5 minutes, and the mixture was heated at 100°C for 2 hours under microwave conditions. The reaction was monitored by TLC and LC-MS. The reaction mixture was diluted with water (50 mL), and the resulting crude product was extracted with ethyl acetate (2 x 50 mL). The organic layers were washed together with saline solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was purified by reverse-phase HPLC to obtain the title compound (26 mg, 46.9%). Column: Kinetex XB-C18 (75x30) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Flow rate: 1.0 mL / min; 1 H NMR (400MHz, DMSO-d6): δ 8.92(s, 1H), 8.39(s, 1H), 8.35(s, 1H), 7.72(s, 1H), 7.70(s, 1H), 4.84(s, 1H), 4.05(s, 2H), 3.17(s, 3H), 2.32(s, 3H), 2.16-2.20(m, 2H), 1.72(s, 2H), 1.48-1.60(m, 4H), 1.14-1.18(m, 2H) HPLC (purity) = 98.32%; Column: X-select CSH C18 (150 x 4.6 mm), 3.5 μm; Mobile phase A: 10 mM ammonium acetate aqueous solution; Mobile phase B: CAN; Flow rate: 1.0 mL / min; Time / gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10; RT: 6.063 min; LCMS m / z: 421.2 [M+H] + , RT=1.26 minutes Column: Kinetec Biphenyl (100x4.6mm), 2.6μm; Mobile phase A: 0.1% TFA / H2O; Mobile phase B: 0.1% TFA / AC; Flow rate: 1.0 mL / min; Time / Gradient (%B): 0 / 10, 7 / 60, 7.1 / 100, 8 / 100, 8.1 / 10, 10 / 10

[0309] Examples 52 to 56 were obtained using the same procedure as in Example 51.

[0310] Example 52: 8-{4-hydroxybicyclo[2.2.1]heptan-1-yl}-5-methyl-2-[(6-methyl-2H-1,3-benzodioxol-5-yl)amino]-5,6,7,8-tetrahydropteridine-6-one (Compound 52) [ka] LCMS: m / z 424.2 [M+H] +,RT=2.51min (Conditions: Column: XSELECT CSH C18 (50x4.6mm) 3.5μm, Mobile phase A: 10mm AA / H2O; Mobile phase B: CAN; Flow rate: 1mL / min; Time (min) / Gradient (%B): 0 / 5, 2.5 / 95, 2.51 / 95, 4.5 / 95); HPLC purity: 99.06%, RT: 4.33min (Conditions: Column: Kinetex Biphenyl (100x4.6)mm, 2.6μm, Mobile phase: A: 0.05% TFA aqueous solution: ACN (95:5); Mobile phase B: ACN: 0.05% TFA aqueous solution (95:5); Flow rate: 1.0mL / min; Time (min) / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100(1.5mL / min), 12.5 / 100(1.5mL / min), 13 / 10, 15 / 10); 1 H NMR (400MHz, DMSO-d6): δ 8.15(s, 1H), 7.98(s, 1H), 7.62(s, 1H), 6.80(d, J=9.20Hz, 2H), 5.94(s, 2H), 4.01(s, 2H), 3.15(s, 3H), 2.24-2.27(m, 2H), 2.06(s, 3H), 1.73(s, 2H), 1.57-1.58(m, 4H), 1.36-1.38(m, 2H)

[0311] Example 53: 8-{4-hydroxybicyclo[2.2.1]heptan-1-yl}-5-methyl-2-[(7-methylquinoline-6-yl)amino]-5,6,7,8-tetrahydropteridine-6-one (compound 53) [ka] LCMS: m / z 431.1 [M+H] +,RT=3.94min (Conditions: Column: Kinetec Biphenyl (100x4.6mm), 2.6μm; Mobile phase A: 0.1% TFA water; Mobile phase B: 0.1% TFA / CAN; Flow rate: 1.0mL / min; Time (min) / Gradient (%B): 0 / 10, 7 / 60, 7.1 / 100, 8 / 100, 8.1 / 10, 10 / 10); HPLC purity: 86.2%, RT: 7.84min (Conditions: Column: X-select CSH C18 (150x4.6)mm, 3.5μm, Mobile phase A: 10mM ammonium acetate water; Mobile phase B: CAN; Flow rate: 1.0mL / min; Time (min) / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100(1.5mL / min), 12.5 / 100(1.5mL / min), 13 / 10, 15 / 10); 1 H NMR (400MHz, DMSO-d6): δ 8.75-8.77(m, 1H), 8.3(s, 1H), 8.17(d, J=7.60Hz, 1H), 8.04(s, 1H), 7.86(s, 1H), 7.74(s, 1H), 7.41-7.44(m, 1H), 4.70-4.90(m, 1H), 4.07(s, 2H), 3.19(s, 3H), 2.45(s, 3H), 2.31-2.34(m, 2H), 1.74(s, 2H), 1.53-1.62(m, 4H), 1.13-1.5(m, 2H)

[0312] Example 54: 8-{3-fluorobicyclo[1.1.1]pentan-1-yl}-5-methyl-2-({7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl}amino)-5,6,7,8-tetrahydropteridine-6-one (compound 54) [ka] LCMS: m / z 395.0 [M+H] +,RT=1.09 min (Conditions: Column: Kinetex XB-C18 (75x3.0) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2); Mobile phase B: ACN: buffer (98:2); Flow rate: 1.0 mL / min; Time (min) / gradient (%B): 0 / 20, 4 / 100, 4.1 / 100 (1.5 mL / min), 4.6 / 100 (1.5 mL / min), 4.7 / 20, 5 / 20); HPLC purity: 98.3%, RT: 4.15 min (Conditions: Column: Kinetex Biphenyl (100x4.6) mm, 2.6 μm; Mobile phase A: 0.05% TFA aqueous solution: acetonitrile (95:5), Mobile phase B: 0.05% TFA aqueous solution:acetonitrile; flow rate: 1.0 mL / min; time (min) / gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10; 1 H NMR (400MHz, DMSO-d6): δ 8.97(s, 1H), 8.48(s, 1H), 8.39(s, 1H), 7.8(s, 1H), 7.74(s, 1H), 4.05(s, 2H), 3.19(s, 3H), 2.34-2.35(m, 9H)

[0313] Example 55: 8-{4-hydroxybicyclo[2.2.1]heptan-1-yl}-5-methyl-2-[(6-methyl-2,1,3-benzothiadiazole-5-yl)amino]-5,6,7,8-tetrahydropteridine-6-one (compound 55)

[0314] TIFF2026530608000167.tif3951LCMS: m / z 438.0 [M+H] +,RT=0.92min (Conditions: Column: Kinetex XB-C18 (75x3.0) mm, 2.6 μm, Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2), Mobile phase B: ACN: buffer (98:2); Flow rate: 1.0 mL / min; Time (min) / Gradient (%B): 0 / 20, 4 / 100, 4.1 / 100 (1.5 mL / min), 4.6 / 100 (1.5 mL / min), 4.7 / 20, 5 / 20); HPLC purity: 93.9%, RT: 4.26min (Conditions: Column: Kinetex Biphenyl (100x4.6) mm, 2.6 μm; Mobile phase A: 0.05% TFA aqueous solution: acetonitrile (95:5), Mobile phase B: 0.05% TFA aqueous solution:acetonitrile (5:95); flow rate: 1.0 mL / min; time (min) / gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10; 1 ¹H NMR (400MHz, DMSO-d6): δ 8.39(s, 1H), 8.21(s, 1H), 7.90(s, 1H), 7.81(s, 1H), 4.89(s, 1H), 4.12(s, 2H), 3.21(s, 3H), 1.81(s, 2H), 1.62-1.69(m, 4H), 1.30-1.40(m, 2H) (One CH3 peak and one -CH2 peak overlap with the 2.5 ppm solvent peak.)

[0315] Example 56: 8-{3-fluorobicyclo[1.1.1]pentan-1-yl}-5-methyl-2-[(6-methyl-2H-1,3-benzodioxol-5-yl)amino]-5,6,7,8-tetrahydropteridine-6-one (compound 56) [ka] LCMS: m / z 398.0 [M+H] +,RT=1.77min (Conditions: Kinetex XB-C18 (75x3.0) mm, 2.6 μm; Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2), Mobile phase B: ACN: buffer (98:2); Flow rate: 1.0 mL / min; Time / gradient (%B): 0 / 20, 4 / 100, 4.1 / 100 (1.5 mL / min), 4.6 / 100 (1.5 mL / min), 4.7 / 20, 5 / 20); HPLC purity: 98.0%, RT: 6.81min (Conditions: Column: Kinetex Biphenyl (100x4.6) mm, 2.6 μm; Mobile phase A: 0.05% TFA aqueous solution: acetonitrile (95:5), Mobile phase B: 0.05% TFA aqueous solution: acetonitrile; Flow rate: 1.0 mL / min; Time (min) / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10; 1 H NMR (400MHz, DMSO-d6): δ 8.17(d, J=8.80Hz, 1H), 7.72(s, 1H), 6.83(d, J=10.00Hz, 2H), 5.95(s, 1H), 4.01(s, 2H), 3.18(s, 3H), 2.35(d, J=2.00Hz, 6H), 2.09(s, 3H)

[0316] The following examples were prepared in the same manner as in Example 51, using appropriate reagents, precursors, and starting materials.

[0317] Example 57: 8-(3-fluorobicyclo[1.1.1]pentan-1-yl)-5-methyl-2-((7-methylquinoline-6-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 57) [ka] LC-MS: m / z: 405.2 [M+H] + ; RT=1.20 min (LCMS method G); HPLC purity: 95.39%, RT=7.41 min (HPLC method A); 1H NMR (400MHz, DMSO-d6): δ 8.74-8.76(m, 1H), 8.47(s, 1H), 8.19(d, J=8.40Hz, 1H), 8.04(s, 1H), 7.87(s, 1H), 7.84(s, 1H), 7.40 7.43(m, 1H), 4.05(s, 2H), 3.21(s, 3H), 2.46(s, 3H), 2.37(d, J=2.40Hz, 6H)

[0318] Example 58: 8-(3-fluorobicyclo[1.1.1]pentan-1-yl)-5-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 58) [ka] LC-MS: m / z: 412.0 [M+H] + ; RT=2.32 min (LCMS method G); HPLC purity: 96.73%, RT=4.79 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.84(s, 1H), 7.82(s, 2H), 6.84(s, 1H), 4.13(s, 2H), 3.37(s, 3H), 2.63(d, J=2.00Hz, 6H), 2.56(d, J=0.80Hz, 3H)

[0319] Example 59: 8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((7-methylquinoxaline-6-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 59) [ka] LC-MS: m / z: 432.0 [M+H] + ; RT=1.48 min (LCMS method F); HPLC purity: 93.64%, RT=7.54 min (HPLC method A); 1¹H NMR (400MHz, DMSO-d6): δ 8.80 (d, J=2.00Hz, 1H), 8.74 (d, J=2Hz, 1H), 8.42 (s, 1H), 8.33 (s, 1H), 7.90 (s, 1H), 7.80 (s, 1H), 4.86 (s, 1H), 4.11 (s, 2H), 3.21 (s, 3H), 2.67 (s, 3H), 1.79 (s, 2H), 1.59-1.66 (m, 4H), 1.30-1.40 (m, 2H) (Two protons overlap with the 2.5 ppm solvent peak.)

[0320] Example 60: 8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((6-methylbenzo[c][1,2,5]oxadiazole-5-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 60) [ka] LC-MS: m / z: 422.0 [M+H] + , RT=1.532 min (LCMS method G); HPLC purity: 98.44%, RT=3.28 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.34(s, 1H), 8.2(s, 1H), 7.86(s, 2H), 4.95(s, 1H), 4.16(s, 2H), 3.22(s, 3H), 2.57 2.62(m, 2H), 2.49(s, 3H), 1.87(s, 2H), 1.66-1.78(m, 4H), 1.46-1.51(m, 2H)

[0321] Example 61: 8-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((7-methylsinnoline-6-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 61) [ka] LC-MS: m / z: 432.2 [M+H] +, RT=2.76 min (LCMS method G); HPLC purity: 93.24%, RT=2.81 min (HPLC method A); 1 ¹H NMR (400MHz, DMSO-d6): δ 9.16 (d, J=6.00Hz, 1H), 8.32-8.37 (m, 2H), 8.25 (s, 1H), 7.91 (d, J=6.00Hz, 1H), 7.83 (s, 1H), 5.00 (s, 1H), 4.14 (s, 2H), 3.22 (s, 3H), 2.54-2.58 (m, 4H), 1.83 (s, 2H), 1.60-1.71 (m, 4H), 1.34-1.38 (m, 2H) (One proton overlaps with the 2.5 ppm solvent peak.)

[0322] Example 62: 8-(4-methoxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 62) [ka] LC-MS: m / z: 435.2 [M+H] + , RT=2.29 min (LCMS method G); HPLC purity: 95.85%, RT=5.82 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.91(s, 1H), 8.38(s, 2H), 7.72(s, 2H), 4.05(s, 2H), 3.21(s, 3H), 3.03(s, 3H), 2.32(s, 3H), 2.14-2.18(m, 2H), 1.82(s, 2H), 1.60-1.63(m, 4H), 1.16-1.24(m, 2H)

[0323] Example 63: 8-(4-methoxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 63) [ka] LC-MS: m / z: 438.2 [M+H] + , RT=1.48 min (LCMS method G); HPLC purity: 95.31%, RT=6.19 min (HPLC method A); 1 H NMR (400MHz, DMSO-d6): δ 8.03(s, 1H), 7.65(s, 1H), 6.81(d, J=4.80Hz, 2H), 5.95(s, 2H), 4.02(s, 2H), 3.15(d, J=7.20Hz, 6H), 2.20-2.24(m, 2H), 2.07(s, 3H), 1.86(s, 2H), 1.67-1.68(m, 4H), 1.36-1.40(m, 2H)

[0324] Example 64: 8-(4-methoxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 64) [ka] LC-MS: m / z: 452.7 [M+H] + , RT=1.96 min (LCMS method F); HPLC purity: 96.76%, RT=5.92 min (HPLC method A); 1 ¹H NMR (400 MHz, DMSO-d6): δ 8.37 (s, 1H), 8.28 (s, 1H), 7.91 (s, 1H), 7.83 (s, 1H), 4.13 (s, 2H), 3.22 (s, 3H), 3.08 (s, 3H), 1.93 (s, 2H), 1.73-1.76 (m, 4H), 1.37-1.41 (m, 2H) (Three CH3 protons and two CH2 protons overlap with the solvent peak.)

[0325] Example 65: 8-(4-methoxybicyclo[2.2.1]heptan-1-yl)-5-methyl-2-((7-methylquinoline-6-yl)amino)-7,8-dihydropteridine-6(5H)-one (Compound 65) [ka] LC-MS: m / z: 445.8 [M+H] + RT=1.45 min (LCMS method F); HPLC purity: 95.01%, RT=8.44 min (Conditions: Column: X-Bridge C8 (150 x 4.6) mm, 3.5 μm; Mobile phase A: 10 mm ammonium acetate aqueous solution, Mobile phase B: ACN; Flow rate: 1.0 mL / min, Time (min) / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10); 1 H NMR (400MHz, DMSO-d6): δ 8.76(d, J=2.80Hz, 1H), 8.36(s, 1H), 8.19(d, J=7.20Hz, 1H), 8.02(s, 1H), 7.86(s, 1H), 7.76(s, 1H), 7.41-7.44(m, 1H), 4.07(s, 2H), 3.20(s, 3H), 3.00(s, 3H), 2.45(s, 3H), 2.20-2.40(m, 2H), 0.00(s, 2H), 1.61-1.66(m, 4H)

[0326] Example 66. 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 66) [ka] Scheme 9: Manufacturing of Example 66 [ka]

[0327] Step 1: 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate ethyl(9-2) To a stirred solution of NaH (1.75 g, 73.0 mmol) / DMF (70 mL), ethyl 2-(4-chloro-2-(methylthio)pyrimidine-5-yl)(7.20 g, 29.2 mmol) was added. Then, 1,2-dibromoethane (8.22 g, 43.8 mmol) was added at 0°C, and the mixture was stirred at 25°C for 16 hours. The reaction was quenched with water (30 mL) at 0°C and extracted with ethyl acetate (2 x 80 mL). The organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the crude product. This was purified by silica gel column chromatography (elution: 30-40% siRNA / petroleum ether) to obtain ethyl 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate (3.5 g, 12.32 mmol, 42.2% yield) as a brownish viscous substance. LCMS: m / z: 273.2 [M+H] + RT=2.65 min (LCMS method F)

[0328] Step 2: 1-(4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate ethyl(9-4) To a stirred mixture of 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate ethyl (500 mg, 1.833 mmol) / N,N-dimethylacetamide (10 mL), 4-aminobicyclo[2.2.1]heptan-1-ol hydrochloride (450 mg, 2.75 mmol) and sodium bicarbonate (308 mg, 3.67 mmol) were added, and the mixture was stirred at 130°C for at least 16 hours. The resulting reaction mixture was diluted with water (50 mL) and extracted with ethyl phosphate (2 x 100 mL). The organic layers were dried over sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. The obtained crude compound was purified by reverse-phase chromatography [dilution solvent: THF:water:ACN (50:20:30), column: RediSep 40gm C18, 20-40μ, mobile phase A: 5mM ammonium formate aqueous solution; mobile phase B: acetonitrile; elution solvent (%): 35% acetonitrile / 5mM ammonium formate aqueous solution; flow rate: 40 mL / min] to obtain 1-(4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate ethyl (220 mg, 0.381 mmol, 20.80% yield) as an off-white solid. LCMS: m / z: 364.6 [M+H] + , RT=0.36 min (LCMS method F)

[0329] Step 3: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one(9-5) A stirred solution of 1-(4-((4-hydroxybicyclo[2.2.1]heptan-1-yl)amino)-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylate ethyl (60 mg, 0.165 mmol) / THF (3 mL) was cooled to 0°C, and then NaH (19.81 mg, 0.495 mmol) was added at 0°C. This mixture was stirred at 60°C for 1 hour, then cooled to 0°C, quenched with water (50 mL), and extracted with ethyl acetate (2 x 80 mL). The organic layers were washed together with brine, filtered, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the crude compound (70 mg, a mixture of the salt of compound 3 and the target compound 4). The obtained crude product was dissolved in DMF (5 mL), and HATU (94 mg, 0.248 mmol) and DIPEA (0.072 mL, 0.413 mmol) were added, and the mixture was stirred at 25°C for at least 16 hours. The resulting reaction mixture was diluted with water (50 mL) and extracted with HCl (2 x 100 mL). The organic layers were combined, dried over sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. The obtained crude compound was purified by reverse-phase LCMS [dilution solvent: THF:water:ACN (50:20:30); column: RediSep 40gm C18, 20-40μ, mobile phase A: 5mM ammonium formate aqueous solution; mobile phase B: acetonitrile; elution solvent (%): 35% acetonitrile / 5mM ammonium formate aqueous solution, flow rate: 40 mL / min] to obtain 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (60 mg, 0.157 mmol, 95% yield). LCMS: m / z: 318.2 [M+H] + , RT=1.70 min (LCMS method G)

[0330] Step 4: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylsulfonyl)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one(9-6) A stirred solution of 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (60 mg, 0.189 mmol) / THF (3 mL) and H2O (3 mL) was cooled to 0°C, then oxone (291 mg, 0.473 mmol) was added at 0°C, and the mixture was stirred at 25°C for 16 hours. The reaction mixture was quenched with aqueous sodium sulfite solution (3 mL) and diluted with water (50 mL). The mixture was extracted with ethyl acetate (2 x 60 mL), the fraction of the organic layer was washed with saline solution, dried over sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. The obtained crude compound was purified by reversed-phase column chromatography [dilution solvent: THF:water:ACN (50:20:30); column: RediSep 40gm C18, 20-40μm; mobile phase A: 5mM ammonium formate aqueous solution; mobile phase B: acetonitrile; instrument name: Teledyne Isco-Combi flash; elution solvent (%): 30% acetonitrile / 5mM ammonium formate aqueous solution; flow rate: 30 mL / min] to obtain 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylsulfonyl)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (60 mg, 0.137 mmol, 72.7% yield) as an off-white solid. LCMS: m / z: 350.0 [M+H] + , RT=0.74 min (UHPLC method D)

[0331] Step 5: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 66) 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-(methylsulfonyl)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (30 mg, 0.086 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine (16.54 mg, 0.112 mmol) / THF (4 mL) were stirred together, then LHMDS (0.343 mL, 0.343 mmol) was added, and the mixture was stirred at 25°C for 1 hour. The reaction mixture was diluted with water (80 mL) and extracted with ethyl acetate (2 x 90 mL). The organic layers were washed together with saline solution, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained crude compound was purified by preparative HPLC (conditions: dilution solvent: water:THF:ACN (30:30:40), column: X-Bridge C18 (150x19) mm, 5 μm, temperature: ambient temperature, mobile phase A: 5 mM ammonium formate, mobile phase B: acetonitrile, flow rate: 15 mL / min, time / gradient: 0 / 30, 7 / 70). The pure fraction was recovered and freeze-dried to obtain 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (4.5 mg, 10.50 μmol, 12.23% yield) as an off-white solid. LCMS: m / z 418.0 [M+H] + , RT=1.32 min (LCMS method G); HPLC (purity) = 97.43%, RT=5.22 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 9.02(s, 1H), 8.81(s, 1H), 8.39(s, 1H), 7.85(s, 1H), 7.72(s, 1H), 4.94(s, 1H), 2.33-2.49(m, 5H), 2.26(s, 2H), 1.75-1.82(m, 2H), 1.58-1.63(m, 4H), 1.45-1.47(m, 4H)

[0332] The following examples were prepared in the same manner as in Example 66, using appropriate reagents, precursors, and starting materials.

[0333] Example 67: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((7-methylquinoxaline-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 67) [ka] LC-MS: m / z: 429.3 [M+H] + ; RT=1.70 min (LCMS method F); HPLC purity: 93.03%, RT=3.54 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.81-8.83(m, 2H), 8.76(d, J=1.82Hz, 1H), 8.50(s, 1H), 7.98(s, 1H), 7.93(s, 1H), 2.55-2.62(m, 6H), 2.31(s, 2H), 1.84-1.90(m, 2H), 1.65-1.71(m, 4H), 1.47-1.52(m, 4H)

[0334] Example 68: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 68) [ka] LC-MS: m / z: 421.1 [M+H] + ; RT=1.86 min (LCMS method F); HPLC purity: 99.38%, RT=5.01 min (HPLC method A); 1H NMR (400MHz, DMSO-d6): δ 8.46(s, 1H), 7.76(s, 1H), 6.93(s, 1H), 6.79(s, 1H), 5.96(s, 2H), 4.95(s, 1H), 2.42-2.45(m, 2H), 2.25-2.30(m, 2H), 2.11(s, 3H), 1.78-1.84(m, 2H), 1.62-1.69(m, 2H), 1.54-1.57(m, 2H), 1.48-1.51(m, 2H), 1.10-1.30(m, 2H)

[0335] Example 69: 7'-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-2'-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 69) [ka] LC-MS: m / z: 435.0 [M+H] + ; RT=1.90 min (LCMS method F); HPLC purity: 94.30%, RT=4.87 min (HPLC method B); 1 ¹H NMR (400MHz, DMSO-d6): δ 8.71(s, 1H), 8.454(s, 1H), 7.99(s, 1H), 7.93(s, 1H), 4.96(s, 1H), 2.53(s, 3H), 2.30-2.32(m, 2H), 1.86-1.92(m, 2H), 1.66-1.71(m, 4H), 1.50-1.52(m, 4H) (One CH2 group (two protons) overlaps with the solvent peak.)

[0336] Example 70: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 70) [ka] Scheme 10 [ka]

[0337] Step 1: 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylic acid 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylic acid ethyl (2.0 g, 7.33 mmol) / THF (20 mL) and H2O (20 mL) were stirred together, to which LiOH (0.878 g, 36.7 mmol) was added at room temperature and the mixture was stirred at room temperature for 6 hours. The reaction was monitored by LC-MS. The reaction mixture was diluted with water (50 mL) and acidified with 1.5 N HCl solution (pH ~6). The resulting crude product was extracted with ethyl acetate (2 x 100 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. This reaction mixture was purified by reverse-phase column chromatography (0.1 ammonium formate / acetonitrile) to obtain 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylic acid (1.55 g, 5.89 mmol, 80% yield) as an off-white solid. LCMS m / z 245.0 [MH] + , RT=1.00 min (UHPLC method D)

[0338] Step 2: 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide To a stirred solution of 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)cyclopropane-1-carboxylic acid (1500 mg, 6.13 mmol) / DMF (15 mL), DIPEA (3.21 mL, 18.39 mmol) and 3-fluorobicyclo[1.1.1]pentan-1-amine·HCl (1265 mg, 9.20 mmol), followed by N,N,N',N'-tetramethylchloroformamidinium hexafluorophosphate (3440 mg, 12.26 mmol) were added at room temperature, and the mixture was stirred at 0–25°C for 6 hours. The reaction was monitored by LC-MS. The reaction mixture was diluted with water (70 mL), and the resulting crude product was extracted with ethyl acetate (2 x 110 mL). The organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. This reaction mixture was purified using a reverse-phase column (0.1 ammonium formate / acetonitrile) to obtain 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (700 mg, 2.022 mmol, 33.0% yield) as an off-white solid. LCMS m / z 329.2 [MH] + ; RT=2.82 min (LCMS method G)

[0339] Step 3: 1-(4-chloro-2-(methylsulfonyl)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide 1-(4-chloro-2-(methylthio)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (140 mg, 0.427 mmol) / THF (9 mL) and H2O (9 mL) were stirred together, to which Oxon (788 mg, 1.281 mmol) was added at 0°C and the mixture was heated at 0-25°C for 16 hours. The reaction was monitored by LC-MS, and the reaction mixture was diluted with sodium pyrosulfite (8 mL) and water (60 mL). The resulting crude product was extracted with ethyl acetate (2 x 80 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by reverse-phase column chromatography (0.1% ammonium acetate: ACN) to obtain 1-(4-chloro-2-(methylsulfonyl)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (140 mg, 0.370 mmol, 87% yield) as an off-white solid. LCMS m / z 360.0 [M+H] + ; RT=2.23~2.45 min (LCMS method G)

[0340] Step 4: 1-(4-chloro-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)pyrimidine-5-yl)-N-(3-fluorobicyclo[1,1,1]pentan-1-yl)cyclopropane-1-carboxamide To a stirred solution of 1-(4-chloro-2-(methylsulfonyl)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (100 mg, 0.278 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-amine (41.2 mg, 0.278 mmol) / THF (6 mL), LHMDS (1.112 mL, 1.112 mmol) was added at 0°C and the mixture was heated at 0-25°C for 1 hour. The reaction mixture was diluted with water (20 mL), the resulting crude product was extracted with ethyl acetate (2 x 50 mL), the organic layers were washed together with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by trituration with ELISA:petroleum ether (5:95) to obtain 1-(4-chloro-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (100 mg, 0.140 mmol, 50.5% yield) as a brown viscous substance. LC-MS: m / z: 428.2 [M+H] + , RT=1.06 min (UHPLC method D)

[0341] Step 5: 7'-(3-fluorobicyclo[1,1.1]pentan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one To a stirred solution of 1-(4-chloro-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)pyrimidine-5-yl)-N-(3-fluorobicyclo[1.1.1]pentan-1-yl)cyclopropane-1-carboxamide (100 mg, 0.234 mmol) / THF (6 mL), LHMDS (0.935 mL, 0.935 mmol) was added at 0°C and the mixture was heated at 0-25°C for 1 hour. The reaction mixture was diluted with water (20 mL), and the crude product was extracted with ethyl acetate (2 x 50 mL). The organic layers were washed together with saline solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by reverse-phase preparative column chromatography (0.1 ammonium formate / ACN) to obtain 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (28 mg, 0.071 mmol, 30.4% yield) as an off-white solid. LC-MS: m / z: 392.0 [M+H] + ; RT=1.89 min (LCMS method F); HPLC purity: 99.39%, RT=6.05 min (HPLC method A); 1 H NMR (400MHz, DMSO-d6): δ 9.07(s, 1H), 8.52(s, 1H), 8.40(s, 1H), 7.94(s, 1H), 7.74(s, 1H), 2.62(d, J=2.40Hz, 6H), 2.38(s, 3H), 1.66-1.69(m, 2H), 1.50-1.53(m, 2H)

[0342] The following examples were prepared in the same manner as in Example 66, using appropriate reagents, precursors, and starting materials.

[0343] Example 71: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((7-methylquinoline-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 71) [ka] LC-MS: m / z: 402.0 [M+H] + ; RT=1.87 min (LCMS method F); HPLC purity: 97.72%, RT=4.15 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.95(s, 1H), 8.78(dd, J=1.7, 4.2Hz, 1H), 8.23(d, J=8.4Hz, 1H), 8.16(s, 1H), 7.99(s, 1H), 7.89(s, 1H), 7.45(dd, J=4.3, 8.3Hz, 1H), 2.64(d, J=2.4Hz, 6H), 1.71-1.68(m, 2H), 1.54-1.51(m, 2H)

[0344] Example 72: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((7-methylquinoxaline-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 72) [ka] LC-MS: m / z: 403.2 [M+H] + ; RT=2.81 min (LCMS method G); HPLC purity: 99.35%, RT=6.05 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.95(s, 1H), 8.82(d, J=1.6Hz, 1H), 8.77(d, J=2.00Hz, 1H), 8.52(s, 1H), 8.06(s, 1H), 7.94(d, J=0.80Hz, 1H), 2.71(d, J=2.40Hz, 4H), 2.57(s, 3H), 1.72-1.74(m, 2H), 1.55-1.57(m, 2H)

[0345] Example 73: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((6-methylbenzo[c][1,2,5]thiadiazole-5-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 73) [ka] LC-MS: m / z: 409.0 [M+H] + RT=3.29 min (Conditions: Column: Kinetex XB-C18 (75x3) mm, 2.6 μm, Mobile phase A: 5 mM ammonium formate (pH 3.3): ACN (98:2), Mobile phase B: ACN: buffer (98:2), Flow rate: 1.0 mL / min, Time / gradient (%B): 0 / 40, 3.5 / 100, 3.51 / 100 (1.5 mL / min), 4.5 / 100 (1.5 mL / min), 4.7 / 40, 5 / 40); HPLC purity: 99.10%, RT=7.91 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.84(s, 1H), 8.48(s, 1H), 8.07(s, 1H), 7.94(s, 1H), 2.73(d, J=2.00Hz, 6H), 2.54(d, J=0.80Hz, 3H), 1.73-1.76(m, 2H), 1.56-1.58(m, 2H)

[0346] Example 74: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((4-methyl-6-(oxazol-5-yl)pyridine-3-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 74) [ka] LC-MS: m / z: 419.0 [M+H] + ; RT=2.46 min (LCMS method G); HPLC purity: 99.39%, RT=4.76 min (HPLC method B); 1H NMR (400MHz, DMSO-d6): δ 8.84(s, 1H), 8.48(s, 1H), 8.07(s, 1H), 7.94(s, 1H), 2.73(d, J=2.00Hz, 6H), 2.54(d, J=0.80Hz, 3H), 1.73-1.76(m, 2H), 1.56-1.58(m, 2H)

[0347] Example 75: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((4-methyl-6-(1-methyl-1H-pyrazole-4-yl)pyridine-3-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 75) [ka] LC-MS: m / z: 432.0 [M+H] + ; RT=2.14 min (LCMS method G); HPLC purity: 98.67%, RT=4.60 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.89(s, 1H), 8.48(s, 1H), 8.22(s, 1H), 7.95(d, J=0.80Hz, 1H), 7.89(s, 1H), 7.56(s, 1H), 3.89(s, 3H), 2.63(d, J=2.00Hz, 6H), 2.25(s, 3H), 1.65-1.68(m, 2H), 1.49-1.52(m, 2H)

[0348] Example 76: 7'-(3-fluorobicyclo[1.1.1]pentan-1-yl)-2'-((6-methylbenzo[d][1,3]dioxol-5-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one (compound 76) [ka] LC-MS: m / z: 395.0 [M+H] +; RT=3.02 min (LCMS method G); HPLC purity: 98.77%, RT=5.76 min (HPLC method B); 1 H NMR (400MHz, DMSO-d6): δ 8.59(s, 1H), 7.84(s, 1H), 6.96(s, 1H), 6.82(s, 1H), 5.97(s, 2H), 2.63(d, J=2.00Hz, 6H), 2.12(s, 3H), 1.62-1.65(m, 2H), 1.47-1.50(m, 2H)

[0349] Example 77: 9-(4-hydroxybicyclo[2.2.1]heptan-1-yl)-7-(methyl-d3)-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 77) [ka] Example 77 was prepared using the same synthesis procedure as Example 1, but with CD3I instead of CH3I in the alkylation step. LC-MS: m / z: 410.1 [M+H] + ; HPLC purity: 100%, RT=1.08 min (LCMS method A); 1 H NMR (400MHz, DMSO-d6): δ 9.10(s, 1H), 8.52(s, 1H), 8.37(s, 1H), 7.70(s, 1H), 5.06(s, 1H), 2.39(m, 5H), 2.31(s, 2H), 1.99-1.89(m, 2H), 1.70(br, t, J=8.6Hz, 2H), 1.61-1.49(m, 2H)

[0350] Example 78: 9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 78) [ka] (9-(4-hydroxybicyclo[2.2.2]octan-1-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridine-6-yl)amino)-7,9-dihydro-8H-purine-8-one (compound 78) has already been disclosed in PCT publication number WO2022017368A1.

[0351] [Biological Examples and Bioactivity] Various compounds of this disclosure, including compound 78 (see structure above), were evaluated as controls for DNA-PK inhibitors using DNA-PK biochemical assays and one or more kinase counter screening assays listed below (e.g., ATM, PI3Kα, PI3Kβ, and PI3Kδ biochemical assays).

[0352] [DNA-PK biochemical assay using Reaction Biology's HotSpot kinase assay protocol] Reagents: Basic reaction buffer; 20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.01% Brij35, 0.02 mg / mL BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO (cofactors required for each kinase reaction were added separately). Reaction procedure: 1. Prepare the substrate using the newly prepared reaction buffer. 2. Add any necessary cofactors to the substrate solution. 3. Add the kinase to the substrate solution and mix gently. 4. Using acoustic technology (Echo550, nL scale), the compound / 100% DMSO was added to the kinase reaction mixture and incubated at room temperature for 20 minutes. 5. Add 33P-ATP to the above mixture and start the reaction. 6. Incubate at room temperature for 2 hours. 7. Detection of kinase activity by P81 filter binding method

[0353] [Biochemical assay of ataxia telangiectasia mutant protein (ATM) using Reaction Biology's HTRF kinase assay protocol] Assay format: This assay detects kinase activity using an antibody-based HTRF assay. Using GST-tagged p53 protein as a substrate, a specific phosphorylation site is bound to a Eu-labeled antibody upon phosphorylation, and this is detected as an HTRF signal against anti-GST-d2. Reagents: Reaction buffer; 50 mM Hepes (pH 7.5), 150 mM NaCl, 10 mM MnCl2, 1% glycerol, 0.01% Brij35, 1 mM DTT, 1% DMSO Substrate: Human p53 (aa2-393, manufactured by RBC, expressed in E. coli, N-terminal GST tag added, MW=70.42kDa) Detection: Anti-p53-pS15-Eu cryptotate mAb (CisBio cat# 61P08KAZ), anti-GST-d2 mAb Reaction procedure: 1. Add a 2-fold diluted enzyme solution to each well of the reaction plate, except for the control well labeled "No E". Add buffer solution to the "No E" well instead. 2. Using acoustic technology (Echo550, nL scale), the compound / 100% DMSO was added to the kinase reaction mixture and incubated at room temperature for 30 minutes. 3. Add the 2-fold diluted substrate and ATP mixture to the reaction mixture and start the reaction. 4. Incubate at room temperature for 2 hours. HTRF detection: 1. Add the 2x diluted stop / detection mixture and incubate in the dark for 2 hours to overnight. 2. HTRF measurement using EnVision (excitation wavelength / fluorescence wavelength 1 / fluorescence wavelength 2 = 320 / 615 / 665 nm)

[0354] [Biochemical assay of phosphoinositide 3-kinase α (PI3Kα) using Reaction Biology's ADP-Glo ​​assay platform] Step 1 (Lipid Kinase): Assay using the ADP-Glo ​​format lipid kinase currently offered by Reaction Biology Corporation (RBC). Step 2 (Explanation of Assay Principle): The kinase reaction consumes ATP and produces ADP as a byproduct. The amount of ADP produced is quantified by ADP-Glo ​​luminescence detection. This assay consists of three steps. First, a kinase reaction is performed using a lipid substrate in the presence of ATP. Next, ADP-Glo TM The reaction is stopped using a reagent, and any remaining ATP is consumed. Finally, ADP is converted to ATP and measured using the luciferase / luciferin reaction. Step 3 (Assassination Procedure): 1. Prepare the kinase solution using the newly prepared reaction buffer. 2. Add the substrate to the kinase solution, mix gently, and then dispense into the wells for the assay (dispense a kinase solution without substrate into the wells for measuring background). 3. Using acoustic technology (Echo550, nL scale), the compound / 100% DMSO was added to the kinase reaction mixture and incubated at room temperature for 20 minutes. 4. Add ATP to the above mixture and start the reaction. 5. Incubate at 30°C for 60 minutes. 6. Stop the reaction with ADP-Glo ​​reagent and incubate for 40 minutes. 7. Add the detection mixture and incubate for 30 minutes. 8. Measuring luminescence Step 4 (Data Analysis): The emission signal was converted to the amount of ADP generated in μM units based on the ADP calibration curve. Calibration curve and IC 50 To calculate the values, nonlinear regression was performed using GraphPad Prism software.

[0355] [Biochemical assay of phosphoinositide 3-kinase α (PI3Kα)] A solution containing 0.2 nM anti-HIS terbium (Cisbio, 64CUSTAZU), a designed probe (3.7 nM), and 1.0 nM His-PIK3CA / PIK3R1 (p110α / p85α) was prepared in FRET buffer (20 mM HEPES, 10 mM MgC12, 0.015% Brij-35, 4 mM DTT, 0.05 mg / mL BSA). The detection antibody / enzyme / probe solution was dispensed into the wells of a plate (a low-binding black polystyrene 1536 plate (Corning, 3724) containing 10 nL of an appropriate concentration of the target compound dissolved in DMSO) using Formulatrix Tempest (2 μL per well). The plate was incubated at room temperature for 1 hour. FRET was measured using an EnVision plate reader (excitation wavelength: 340 nm, fluorescence wavelength: 520 nm / 495 nm). Total signal (0% inhibition) was calculated from wells containing only 10 nL of DMSO, and blank signal (100% inhibition) was calculated from wells containing 10 nL of 15 nM staurosporine and an internal control.

[0356] [Biochemical assay of phosphoinositide 3-kinase δ (PI3Kδ)] A solution containing 0.2 nM anti-HIS terbium (Cisbio, 64CUSTAZU), a designed probe (40 nM), and 1.0 nM His-PIK3CD / PIK3R1 (p110δ / p85α) was prepared in FRET buffer (20 mM HEPES, 10 mM MgC12, 0.015% Brij-35, 4 mM DTT, 0.05 mg / mL BSA). The detection antibody / enzyme / probe solution was dispensed into the wells of a plate (a low-binding black polystyrene 1536 plate (Corning, 3724) containing 10 nL of the target compound solution at an appropriate concentration dissolved in DMSO) using Formulatrix Tempest (2 μL per well). The plate was incubated at room temperature for 1 hour. FRET was measured using an EnVision plate reader (excitation wavelength: 340 nm, fluorescence wavelength: 520 nm / 495 nm). Total signal (0% inhibition) was calculated from wells containing only 10 nL of DMSO, and blank signal (100% inhibition) was calculated from wells containing 10 nL of 15 nM staurosporine and an internal control.

[0357] [Bioactivity Data] [Table 18] [Table 19] [Table 20] [Table 21]

[0358] [T-cell cytotoxicity assay: CD3 Glo proliferation assay] Frozen CD3 T cell vials were lysed in assay medium (RPMI 1640, 5% HI FBS, 1x L / G, 1x NEAA, 1x sodium pyruvate, 1x P / S (Gibco, Waltham MA)), and the number of viable cells was counted using a cell counter Moxi V (Orflo, Ketchum ID). The lysed T cells were collected by centrifugation at 1600 rpm for 10 minutes at room temperature, and the T cell pellet was resuspended in assay medium (10 mL) in a conical tube (50 mL) and incubated in a 37°C incubator for 1 hour. The T cell suspension was removed from the 37°C incubator and diluted to 5e5 cells / mL. The T cells were then subjected to the method described in WO 2018 / 197949 (Poltorak et al., Scientific Reports). The cells were stimulated at 37°C for 24 hours with an anti-CD3 / anti-CD28 stimulating reagent (4 μg per 1 million T cells) prepared using an oligomeric streptavidin mutation reagent manufactured in (see also 2020). The following day, the compounds were subjected to 10 sequential 3-fold dilutions in 100% DMSO, with a maximum concentration of 3 mM. After all compounds were diluted in Echo-compatible 384-well plates (Beckman, Indianapolis IN), 200 nL of the dilutions were dispensed using an ECHO 650 acoustic dispenser (Beckman, Indianapolis IN) into 384-well tissue culture-treated plates (Catalog #353988, Corning, Tewksbury). The cells were transferred to MA. To neutralize the activation of T cells by the anti-CD3 / anti-CD28 stimulating reagent, 50 mM D-biotin was added to cultured T cells activated with the anti-CD3 / anti-CD28 stimulating reagent in a 1:50 ratio, and incubated at 37°C for 10 minutes. 40 μL of neutralized cultured T cells or assay medium control was dispensed per well into an assay plate (Corning) pre-dispensed with 200 nL of DMSO solution of the compound, using a Multidrop dispenser (ThermoFisher, Waltham MA). After incubating the plate for 3 days, 10 μL of CellTiter-Glo reagent (Promega, Madison WI) was added per well, and incubated at room temperature for 10 minutes.Next, measurements were taken using an Envision plate reader (Perkin-Elmer, Waltham MA). The concentration at which the CellTiter-Glo signal decreased by 50% compared to wells containing DMSO alone (CC) was measured. 50 The value was calculated using the four-dimensional parameterized logistic equation.

[0359] [T cell culture medium and lysis] CD4 + and CD8 + T cells were isolated from healthy donor T cells, and CD4 and CD8 T cells were mixed in a 1:1 ratio in serum-free T cell medium (TCM) containing recombinant cytokines (100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15).

[0360] [Activation of T cells] To stimulate T cells, an anti-CD3 / anti-CD28 stimulating reagent was prepared using an oligomeric streptavidin mutant reagent manufactured by the method described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). This oligomeric streptavidin mutant reagent has an average hydrodynamic radius of 90-120 nm and contains an average of 2000-2800 tetramers of the streptavidin mutant (Strep-Tactin® m2, SEQ ID NO: 6). The oligomeric streptavidin mutation reagent was prepared at room temperature by mixing the following components: (i) an anti-CD3 Fab fragment with a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) ligated to the carboxyl terminus of the heavy chain, and (ii) an anti-CD28 Fab fragment with a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) ligated to the carboxyl terminus of the heavy chain. The peptide-tagged Fab fragments were prepared by recombination (see International Patent Application Publication Nos. WO 2013 / 011011 and WO 2013 / 124474). The anti-CD3 Fab fragment was prepared using the hybridoma cell line OKT3 (ATCC® CRL-8001).TM The anti-CD28 Fab fragment is derived from a CD3-conjugated monoclonal antibody produced by (see also U.S. Patent No. 4,361,549) and contains the heavy chain variable region (SEQ ID NO: 31) and light chain variable region (SEQ ID NO: 32) of the anti-CD3 antibody OKT3, as described in Arakawa et al., J. Biochem. 120, 657-662 (1996). The anti-CD28 Fab fragment is derived from the antibody CD28.3 (registered as a synthetic single-chain Fv construct under GenBank accession number AF451974.1; see also Vanhove et al., BLOOD, 15 July 2003, Vol. 102, No. 2, pp 564-570) and contains the heavy chain variable region (SEQ ID NO: 33) and light chain variable region (SEQ ID NO: 34) of the anti-CD28 antibody CD28.3. To prepare the anti-CD3 / anti-CD28 stimulating reagent, 0.3 mg of oligomeric streptavidin mutagenesis reagent, 0.5 μg of peptide-tagged anti-CD3Fab fragment, and 0.5 μg of peptide-tagged anti-CD28Fab fragment were used.

[0361] Approximately 3 x 10⁶ isolated T cells 6 The cells were suspended at a density of cells / mL. Anti-CD3 / anti-CD28 stimulating reagents were added to the cell culture medium supplemented with 100 IU / mL of IL-2, 1500 IU / mL of IL-7, and 19 IU / mL of IL-15. The cells were cultured in a 6-well plate (Corning 351146) and incubated at 37°C for 48 hours.

[0362] [Modification of T cells] After 48 hours of activation, count the number of T cells, 5 x 10 7The cells were resuspended in buffer at a density of cells / mL. To induce gene disruption at the endogenous TCRα constant region (TRAC) locus via CRISPR / Cas9 gene editing, ribonucleoprotein (RNP), composed of Cas9 protein (Aldevron) and a TRAC-targeting single guide RNA (sgRNA) containing the target domain sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO: 28; targeting exon 1 of the endogenous TRAC gene), was added to the resuspended T cells to a final RNP concentration of 2 μM. 100 μL of the T cell / RNP solution was transferred to electroporation cuvettes (Lonza P3 Primary Cell 4D-Nucleofector X Kit L V4XP-3024), and electroporation was performed using a Lonza 4D-Nucleofector X Unit (Lonza) with pulse code DN-100 / P3. Immediately after electroporation, 600 μL of TCM was added to each cuvette, and the cells were left to stand in the cuvettes at 37°C for 15 minutes. The electroporated cells were harvested and transferred to a 96-well flat-bottom plate (Corning 351172) for recovery. For example, anti-BCMA CAR was inserted into the TRAC gene locus (MOI: 5x10) on this plate. 3 The solution contains AAV, which encodes homologous recombination repair templates for viral genome / cell regeneration, a predetermined concentration of DNA-PK inhibitor, 1 mM D-biotin, 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15, with a final volume of 210 μL TCM / well and a final cell density of 5x10⁶ (based on pre-electroporation count). 5 The T cell / well ratio was adjusted. The above anti-BCMA CAR is described in WO2019 / 090003.

[0363] For example, anti-BCMA CAR (encoded by SEQ ID NO: 198, SEQ ID NO: 197) includes a human IgGκ signaling sequence, human anti-BCMA scFv (Table 4), a modified IgG4 hinge CH2-CH3 spacer (encoded by SEQ ID NO: 184; SEQ ID NO: 183, which is sometimes also referred to as "LS"), a human CD28 transmembrane domain (encoded by SEQ ID NO: 186, SEQ ID NO: 185), an intracellular co-signaling sequence derived from human 4-1BB (encoded by SEQ ID NO: 188, SEQ ID NO: 187), and an intracellular signaling domain derived from human CD3ζ (encoded by SEQ ID NO: 190, SEQ ID NO: 189).

[0364] The example human anti-BCMA scFv includes scFv having the following sequence: [Table 22]

[0365] The general structure of the example homologous recombination repair template polynucleotide is as follows: [5' homology arm (SEQ ID NO: 191)]-[promoter (SEQ ID NO: 187)]-[transgene sequence encoding anti-BCMA CAR (SEQ ID NO: 193)]-[3' homology arm (SEQ ID NO: 192)]. The homology arms contain a nucleic acid sequence of approximately 600 bp homologous to the sequence around the target integration site in exon 1 of the human TCRα constant region (TRAC) gene. The complete sequence of the homologous recombination repair template polynucleotide used is shown in SEQ ID NO: 194. Control samples were prepared in the same manner as above, under conditions without treatment with DNA-PK inhibitors (untreated) or without the addition of AAV (TRAC KO only) in the corresponding wells of the recovery plate.

[0366] [T cell proliferation] T4 hours after electroporation, T cells were transferred to 24-well GREX plates (Wilson Wolf 80192M), and TCM containing 100 IU / mL of IL-2, 1500 IU / mL of IL-7, and 19 IU / mL of IL-15 was added to a final volume of 3 mL / well. The cells were cultured in the GREX plates for a total of 5 days after electroporation, with cytokine replenishment every 2-3 days (the final volume on day 5 after electroporation was 4 mL / well). On day 5 after electroporation, cell viability and cell count were measured using AOPI staining (Nexcelom CS2-0106) and a Cellaca MX automated cell counter (Nexcelom Bioscience). CAR knock-in efficiency was measured by flow cytometry as described below.

[0367] [Flow cytometry] After T cell modification and proliferation for 5 days, TRAC knockout and CAR knock-in of cells were analyzed by flow cytometry. In short, 2-5 x 10⁻¹⁰ cells were analyzed. 5Cells / wells were transferred to a 96-well round-bottom plate (Corning 351177) and stained using LIVE / DEAD Fixable near-IR (ThermoFisher L34993) according to the manufacturer's protocol. Subsequently, an antibody cocktail consisting of CD3 antibody (BioLegend, UCHT1), CD4 antibody (BioLegend, OKT4), CD8 antibody (BD Horizon, RPA-T8), and anti-idiotype antibody (an antibody that binds to the extracellular region of the anti-BCMA CAR, see WO2021 / 113776) was added to cell staining buffer (BioLegend D5RE-01386-1) and diluted, and stained at 4°C for 30 minutes. After staining, cells were washed, resuspended in 100 μL of cell staining buffer per well, and analyzed using a FACSymphony A5 flow cytometer (BD Biosciences). A high-throughput plate reader was used to identify 20,000 viable cells per well. Data analysis was performed using FlowJo 10.8.1 (BD Biosciences) and JMP 15.2.0 (SAS Institute Inc.). The total number of CAR+ T cells was calculated by multiplying the percentage of CAR+ cells by the total number of cells. Then, to normalize for the untreated condition, the total number of CAR+ T cells in the DNA-PK inhibitor-treated condition was divided by the average total number of CAR+ T cells in the three untreated wells, subtracted by 1, and then multiplied by 100 to calculate the total number of CAR+ cells as a relative percentage change compared to the untreated control group.

[0368] Figure 1 shows the effect of treating cells derived from two donors with DNA-PK inhibitors (e.g., compounds 12 and 13) at concentrations of 0.25 μM, 1.25 μM, and 2.5 μM on cell viability 5 days after electroporation (shaded bars represent Donor 1, and unshaded bars represent Donor 2). Viable cells are shown as a percentage of the total cell number.

[0369] Figure 2 shows the effect of DNA-PK inhibitor compounds on T cell proliferation 5 days after electroporation. The total number of viable cells (x10e6) is shown.

[0370] Figure 3 shows the effect of DNA-PK inhibitors on CAR insertion into the TRAC gene locus 5 days after electroporation. The percentage of CAR+ T cells is shown as a percentage of the total viable cell count.

[0371] Figure 4 shows the effect of DNA-PK inhibitors on CAR insertion into the TRAC gene locus 5 days after electroporation. KI efficiency is shown as the percentage change compared to the untreated control condition (calculated by dividing the percentage of CAR+ in the DNA-PKi-treated group by the percentage of CAR+ in the untreated group, subtracting 1, and multiplying by 100).

[0372] Figure 5 shows the effect of DNA-PK inhibitors on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100).

[0373] Figure 6 shows the effect of DNA-PK inhibitors (compound 1 and compound 78) on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100).

[0374] [Table 23] [Table 24] [Table 25] [Table 26] [Table 27] [Table 28] [Table 29]

[0375] [Equivalent range] Details of one or more embodiments of this disclosure are described in the embodiments for carrying out the invention described above. Any methods and materials similar or equivalent to those described herein may be used in carrying out or testing this disclosure, but preferred methods and materials are described below. Other features, purposes and advantages of this disclosure will become apparent from this specification and the claims. In the specification and the appended claims, singular nouns are to be considered plural unless the context makes otherwise clear. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. All patents and publications referenced herein are incorporated herein by reference. The embodiments for carrying out the above invention are presented for illustrative purposes only and are not intended to limit this disclosure to any particular embodiment. This disclosure is limited only by the claims appended to this specification.

[0376] [Enumeration of Implementations] Embodiment 1. Equation (I): [ka] [In the formula, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group contains 1 or more R 4 It may be replaced as appropriate; R 1This is a heteroaryl compound comprising aryl or at least one heteroatom selected from the group consisting of N, O, S, and Se, wherein the aryl or heteroaryl is 1 or more R 5 It may be replaced as appropriate; R 2 H stands for halogen, -(CH2) n -CN, -OH, -(CH2) n -O-C1-C4 alkyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, or C(O)NH2; R 3 This is selected from the group consisting of H, F, C2-C4 alkenyl, C2-C4 alkynyl, CN, OH, CH2OH, NH2, CH2NH2, and C1-C4 alkyl; Each R 4 Each of these is independently selected from the group consisting of halogens, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, CD3, CD2CD3, and C1-C6 haloalkyl; or Two R atoms bonded to the same atom 4 However, they combine with the carbon atoms they bond to to form a C3-C6 cycloalkyl group; Each R 5 These are, independently, halogen, NH2, OH, -CN, C(O)NH2, and C(O)NHR. 7 Selected from the group consisting of C1-C4 alkyl, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, where the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is one or more R 6 It may be replaced as appropriate; Each R 6 Each of these is independently selected from the group consisting of halogens, OH, oxo, NH2, CHO, C1-C4 alkyl, and C1-C6 alkoxy; Each R 7Each is independently selected from H and C1-C4 alkyl groups; n are, independently, integers between 0 and 4; r is an integer between 0 and 2; s is an integer between 0 and 2; and t is an integer between 1 and 2; however A is a 5-membered heteroring containing NC(O)-N in the ring, and R 1 However, R is greater than or equal to 1. 5 Replaced as appropriate [ka] If so, substructure [ka] teeth, [ka] isn't it] Compounds thereof, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.

[0377] Embodiment 2. In the formula, R 1 but, [ka] And here B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 0 and 4. The compound described in Embodiment 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0378] Embodiment 3. In the formula, R 1 but, [ka] A group consisting of the following is selected, where, X 1 , X 2 , X 3 , X 4 and X 5 However, each is independently N, CH, or C(R 6 ) and m is an integer between 1 and 3. The compound described in Embodiment 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0379] Embodiment 4. The compound is given by formula (Ia-1): [ka] A compound according to any one of Embodiments 1 to 3, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0380] Embodiment 5. The compound is given by formula (Ia-2): [ka] A compound according to any one of Embodiments 1, 3, or 4, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0381] Embodiment 6. The compound is given by formula (Ia-3): [ka] A compound according to any one of Embodiments 1 to 4, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0382] Embodiment 7. The compound is given by formula (Ia-4): [ka] A compound according to any one of Embodiments 1 to 4, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0383] Embodiment 8. The compound is given by formula (Ia-5): [ka] This is shown, and in the formula, X is O, S, NH, or CH2; and X 1 , X 2 , X 3 , and X 4 However, each is independently N, CH, or C(R 5 ) A compound described in any one of Embodiments 1 to 4, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0384] Embodiment 9. The compound is given by formula (Ia-6): [ka] This is shown, and in the formula, X is O, S, NH, or CH2; B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 0 and 4. A compound described in any one of Embodiments 1 to 4, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0385] Embodiment 10. The compound is given by formula (Ia-7): [ka] A compound according to any one of Embodiments 1 to , represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0386] Embodiment 11. The compound is given by formula (Ib-1): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. However, R 1 R is 1 or greater as appropriate 5 It may be replaced with [ka] If that is the case, then X is not O.

[0387] Embodiment 12. The compound is given by formula (Ib-2): [ka] A compound according to any one of Embodiments 1, 3, or 11, represented by the formula, where X is S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0388] Embodiment 13. The compound is given by formula (Ib-3): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3 or 11, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Embodiment 14. The compound is given by formula (Ib-4): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3 or 11, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0389] Embodiment 15. The compound is given by formula (Ic-1): [ka] A compound according to any one of Embodiments 1 to 3, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0390] Embodiment 16. The compound is given by formula (Ic-2): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1, 3, or 15, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0391] Embodiment 17. The compound is given by formula (Ic-3): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1-3 or 15, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0392] Embodiment 18. The compound is given by formula (Ic-4): [ka] This is shown, and in the formula, X is O, S, NH, or CH2; B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 1 and 3. A compound described in any one of Embodiments 1 to 3 or 15, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0393] Embodiment 19. The compound is given by formula (Id-1): [ka] A compound according to any one of Embodiments 1 to 3, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0394] Embodiment 20. The compound is given by formula (Id-2): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1, 3, or 19, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0395] Embodiment 21. The compound is given by formula (Id-3): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3 or 19, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0396] Embodiment 22. The compound is given by formula (Id-4): [ka] This is shown, and in the formula, X is O, S, NH, or CH2; and m is an integer between 1 and 3. A compound according to any one of Embodiments 1 to 3 or 19, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0397] Embodiment 23. The compound is given by formula (Ie-1): [ka] A compound according to any one of Embodiments 1 to 3, represented by the formula, where X is O, S, NH, or CH2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0398] Embodiment 24. The compound is given by formula (Ie-2): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1, 3, or 19, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0399] Embodiment 25. The compound is given by formula (Ie-3): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3 or 23, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0400] Embodiment 26. The compound is given by formula (Ie-4): [ka] A compound as shown in the formula, where X is O, S, NH, or CH2, as described in any one of Embodiments 1 to 3 or 23, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0401] Embodiment 27. The compound is given by formula (Ie-5): [ka] This is shown, and in the formula, X is O, S, NH, or CH2; B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 1 and 3. A compound according to any one of Embodiments 1 to 3 or 23, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0402] Embodiment 28. The compound is given by formula (If-1): [ka] A compound according to any one of Embodiments 1 to 3, as shown, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0403] Embodiment 29. The compound is given by formula (If-2): [ka] A compound as described in any one of Embodiments 1, 3, or 28, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0404] Embodiment 30. The compound is given by formula (If-3): [ka] A compound according to any one of Embodiments 1 to 3 or 28, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0405] Embodiment 31. The compound is given by formula (If-4): [ka] This is shown, and in the formula, B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 1 and 3. A compound according to any one of Embodiments 1 to 3 or 28, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0406] Embodiment 32. The compound is given by formula (Ig-1): [ka] A compound according to any one of Embodiments 1 to 3, as shown, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0407] Embodiment 33. The compound is given by formula (Ig-2): [ka] A compound according to any one of Embodiments 1 to 3, as shown, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0408] Embodiment 34. The compound is given by formula (Ig-3): [ka] A compound according to any one of Embodiments 1 to 3, as shown, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0409] Embodiment 35. The compound is given by formula (Ig-4): [ka] A compound as shown in the formula, where Y is O or S, as described in any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0410] Embodiment 36. The compound is given by formula (Ig-5): [ka] This is shown, and in the formula, B is 1 or more R as appropriate 5 A 5-membered or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer between 0 and 4. A compound described in any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. In some embodiments, m is an integer from 1 to 3.

[0411] Embodiment 37. The compound, [ka] [ka] [ka] [ka] [ka] [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the following.

[0412] Embodiment 38. The compound, [ka] [ka] [ka] [ka] [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0413] Embodiment 39. The compound, [ka] [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0414] Embodiment 40. The compound, [ka] A compound according to claim 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0415] Embodiment 41. The compound, [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0416] Embodiment 42. The compound, [ka] A compound according to claim 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0417] Embodiment 43. The compound, [ka] A compound according to claim 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0418] Embodiment 44. The compound, [ka] A compound according to Embodiment 1 or 3, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof, selected from the group consisting of the above.

[0419] Embodiment 45. The compound, [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0420] Embodiment 46. The compound, [ka] A compound according to Embodiment 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

[0421] Embodiment 47. A pharmaceutically acceptable composition comprising a compound described in any one of Embodiments 1 to 46 and a pharmaceutically acceptable carrier.

[0422] Embodiment 48. a) DNA protein kinase inhibitors (DNA-PKI); and b) DNA cutting factor; A composition comprising a DNA-PKI, wherein the DNA-PKI is a compound described in any one of Embodiments 1 to 46.

[0423] Embodiment 49. The composition according to Embodiment 48, further comprising cells.

[0424] Embodiment 50. The composition according to embodiment 48 or 49, further comprising donor DNA.

[0425] Embodiment 51. The composition according to any one of Embodiments 48 to 50, wherein the DNA-PKI concentration in the composition is approximately 10 μM or less.

[0426] Embodiment 52. The composition according to any one of Embodiments 48 to 50, wherein the DNA-PKI concentration in the composition is approximately 0.1 to 10 μM.

[0427] Embodiment 53. The composition according to Embodiment 52, wherein the DNA-PKI concentration in the composition is approximately 0.25 to 5 μM.

[0428] Embodiment 54. The composition according to any one of embodiments 49 to 53, wherein the above-mentioned cells are eukaryotic cells.

[0429] Embodiment 55. The composition according to any one of embodiments 49 to 53, wherein the cells are useful for adoptive immunotherapy (ACT).

[0430] Embodiment 56. The composition according to Embodiment 55, wherein the cells in question are stem cells.

[0431] Embodiment 57. The composition according to Embodiment 56, wherein the stem cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs).

[0432] Embodiment 58. The composition according to any one of embodiments 55 to 57, wherein the cells in question are immune cells.

[0433] Embodiment 59. The composition according to Embodiment 58, wherein the immune cells are white blood cells or lymphocytes.

[0434] Embodiment 60. The composition according to Embodiment 59, wherein the immune cells are lymphocytes.

[0435] Embodiment 61. The composition according to Embodiment 60, wherein the lymphocytes are T cells, B cells, or NK cells.

[0436] Embodiment 62. The composition according to Embodiment 60, wherein the lymphocyte is a T cell.

[0437] Embodiment 63. The composition according to embodiment 62, wherein the T cells are primary T cells.

[0438] Embodiment 64. The composition according to Embodiment 62, wherein the T cells are regulatory T cells.

[0439] Embodiment 65. The composition according to any one of embodiments 62 to 64, wherein the lymphocytes are activated T cells.

[0440] Embodiment 66. The composition according to any one of embodiments 62 to 64, wherein the lymphocytes are inactivated T cells.

[0441] Embodiment 67. The composition according to any one of embodiments 49 to 66, wherein the cells are human cells.

[0442] Embodiment 68. The composition according to any one of Embodiments 48 to 67, wherein the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component.

[0443] Embodiment 69. The composition according to any one of Embodiments 48 to 68, wherein the DNA cleavage factor includes a CRISPR / Cas nuclease that causes double-stranded DNA breaks or single-stranded DNA breaks.

[0444] Embodiment 70. The composition according to any one of embodiments 48 to 67, wherein the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof.

[0445] Embodiment 71. The composition according to Embodiment 68, wherein the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component.

[0446] Embodiment 72. The composition according to Embodiment 71, wherein the CRISPR / Cas nuclease component includes Cas nuclease or mRNA encoding Cas nuclease.

[0447] Embodiment 73. The composition according to Embodiment 71, wherein the CRISPR / Cas nuclease component includes Cas nuclease.

[0448] Embodiment 74. The composition according to embodiment 72 or 73, wherein the Cas nuclease is a type II Cas nuclease belonging to class 2.

[0449] Embodiment 75. The composition according to Embodiment 74, wherein the Cas nuclease is a Cas9 nuclease.

[0450] Embodiment 76. The composition according to Embodiment 75, wherein the Cas nuclease is a Cas9 nuclease derived from S. pyogenes.

[0451] Embodiment 77. The composition according to embodiment 72 or 73, wherein the Cas nuclease is a type V Cas nuclease belonging to class 2.

[0452] Embodiment 78. The composition according to embodiment 72 or 73, wherein the Cas nuclease is Cas12a nuclease.

[0453] Embodiment 79. The composition according to Embodiment 78, wherein the Cas nuclease is a Cas12a nuclease derived from the genus Acidaminococcus.

[0454] Embodiment 80. The composition according to any one of embodiments 72 to 79, wherein the Cas nuclease causes single-strand DNA breaks.

[0455] Embodiment 81. A composition according to any one of embodiments 48 to 80, comprising modified RNA.

[0456] Embodiment 82. The composition according to any one of embodiments 68 to 81, wherein the guide RNA component is a guide RNA nucleic acid.

[0457] Embodiment 83. The composition according to Embodiment 82, wherein the guide RNA nucleic acid is guide RNA (gRNA).

[0458] Embodiment 84. The composition according to embodiment 82 or 83, wherein the guide RNA nucleic acid is a dual guide RNA (dgRNA) consisting of crRNA and tracrRNA, or encodes such dgRNA.

[0459] Embodiment 85. The composition according to embodiment 82 or 83, wherein the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes such sgRNA.

[0460] Embodiment 86. The composition according to any one of embodiments 83 to 85, wherein the gRNA is a modified gRNA.

[0461] Embodiment 87. The composition according to Embodiment 86, wherein the cleavage factor is Cas9, and the modified gRNA is one in which one or more of the first five nucleotides at the 5' end are modified.

[0462] Embodiment 88. The composition according to Embodiment 86, wherein the cleavage factor is Cas12a and the modified gRNA contains a DNA / RNA hybrid molecule.

[0463] Embodiment 89. The composition according to embodiments 86 to 88, wherein the modified gRNA is one in which one or more of the last five nucleotides of the 3' end are modified.

[0464] Embodiment 90. The composition according to any one of Embodiments 48 to 89, wherein the composition comprises a guide RNA nucleic acid and a type II Cas nuclease belonging to class 2 or a type V Cas nuclease belonging to class 2, and the molar ratio of the guide RNA to the Cas nuclease is about 4:1 to 1:4.

[0465] Embodiment 91. The composition according to any one of embodiments 50 to 90, wherein the donor DNA comprises a template having a protein-coding sequence, a regulatory sequence, or a structural RNA-coding sequence.

[0466] Embodiment 92. The composition according to any one of embodiments 48 to 91, further comprising a vector.

[0467] Embodiment 93. The composition according to Embodiment 92, wherein the vector encodes donor DNA.

[0468] Embodiment 94. The composition according to embodiment 92 or 93, wherein the vector is a viral vector.

[0469] Embodiment 95. The composition according to embodiment 92 or 93, wherein the vector is a nonviral vector.

[0470] Embodiment 96. The composition according to Embodiment 94, wherein the vector is AAV.

[0471] Embodiment 97. The composition according to Embodiment 49, wherein the cells in question are not cancer cells.

[0472] Embodiment 98. The composition according to any one of embodiments 48 to 97, further comprising an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway.

[0473] Embodiment 99. A method for targeted genome editing in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound described in any one of Embodiments 1 to 46.

[0474] Embodiment 100. A method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA cleavage factor and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 46.

[0475] Embodiment 101. A method for inhibiting or suppressing the repair of DNA breaks via the non-homologous end joining (NHEJ) pathway in cells, characterized by contacting cells with a DNA break factor and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 46.

[0476] Embodiment 102. Furthermore, the method according to Embodiment 101, characterized by contacting cells with an inhibitor of the microhomology-mediated end-joining (MMEJ) pathway.

[0477] Embodiment 103. A method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 46.

[0478] Embodiment 104. The method according to any one of embodiments 99 to 103, characterized by culturing cells in a cell medium that does not contain DNA-PKI, and then adding DNA-PKI to the cell medium.

[0479] Embodiment 105. The method according to any one of embodiments 99 to 104, characterized in that the cells are brought into contact with a DNA cleavage factor, and then the cells are brought into contact with DNA-PKI.

[0480] Embodiment 106. The method according to Embodiment 105, characterized in that the cells are brought into contact with DNA-PKI within approximately 6 hours of contacting the cells with a DNA cleavage factor.

[0481] Embodiment 107. The method according to Embodiment 106, characterized in that the cells are brought into contact with DNA-PKI within approximately 3 hours of contacting the cells with a DNA cleavage factor.

[0482] Embodiment 108. The method according to any one of embodiments 99 to 104, characterized by simultaneously contacting a DNA cleavage factor and DNA-PKI with cells.

[0483] Embodiment 109. The method according to any one of embodiments 99 to 104, characterized in that the cells are brought into contact with DNA-PKI, and then the cells are brought into contact with a DNA cleavage factor.

[0484] Embodiment 110. The method according to any one of embodiments 99 to 109, wherein the contact between the cell and the DNA cleavage factor includes electroporation.

[0485] Embodiment 111. The method according to Embodiment 109 or 110, characterized in that the cells are brought into contact with a DNA cleavage factor within approximately 3 hours of contacting the cells with DNA-PKI.

[0486] Embodiment 112. The method according to any one of embodiments 109 to 111, characterized by culturing cells in a cell medium containing DNA-PKI.

[0487] Embodiment 113. The method according to any one of embodiments 109 to 112, wherein the cells are brought into contact with a DNA cleavage factor and DNA-PKI for at least about 1 day.

[0488] Embodiment 114. The method according to Embodiment 113, wherein the cells are brought into contact with a DNA cleavage factor and DNA-PKI for approximately 1 day to approximately 2 weeks.

[0489] Embodiment 115. The method according to Embodiment 113, wherein the cells are brought into contact with a DNA cleavage factor and DNA-PKI for approximately two weeks.

[0490] Embodiment 116. The method according to any one of embodiments 99 to 115, wherein cells are brought into contact with DNA-PKI in a cell culture medium, and the concentration of DNA-PKI in the cell culture medium is approximately 10 μM or less.

[0491] Embodiment 117. The method according to any one of embodiments 99 to 116, wherein cells are brought into contact with DNA-PKI in a cell culture medium, and the concentration of DNA-PKI in the cell culture medium is approximately 0.1 to 10 μM.

[0492] Embodiment 118. The method according to Embodiment 117, wherein the concentration of DNA-PKI in the cell culture medium is approximately 0.1 to 5 μM.

[0493] Embodiment 119. The method according to any one of embodiments 99 to 118, wherein the cells described above are eukaryotic cells.

[0494] Embodiment 120. The method according to any one of embodiments 99 to 119, wherein the cells are used in adoptive immunotherapy (ACT).

[0495] Embodiment 121. The method according to Embodiment 120, wherein the cells are used in autologous cell therapy.

[0496] Embodiment 122. The method according to Embodiment 120, wherein the cells are used in allogeneic cell therapy.

[0497] Embodiment 123. The method according to any one of embodiments 99 to 119, wherein the cells are stem cells.

[0498] Embodiment 124. The method according to Embodiment 123, wherein the stem cells are hematopoietic stem cells (HSCs).

[0499] Embodiment 125. The method according to Embodiment 123, wherein the cells in question are induced pluripotent stem cells (iPSCs).

[0500] Embodiment 126. The method according to embodiment 120 or 121, wherein the cells are immune cells.

[0501] Embodiment 127. The method according to embodiment 126, wherein the immune cells are leukocytes or lymphocytes.

[0502] Embodiment 128. The method according to Embodiment 127, wherein the immune cells are lymphocytes.

[0503] Embodiment 129. The method according to Embodiment 128, wherein the lymphocyte is a T cell, a B cell, or an NK cell.

[0504] Embodiment 130. The method according to Embodiment 129, wherein the lymphocyte in question is a T cell.

[0505] Embodiment 131. The method according to Embodiment 130, wherein the T cell in question is a primary T cell.

[0506] Embodiment 132. The method according to Embodiment 130, wherein the T cell is a regulatory T cell.

[0507] Embodiment 133. The method according to any one of embodiments 129 to 132, wherein the lymphocyte is an activated T cell.

[0508] Embodiment 134. The method according to any one of embodiments 129 to 132, wherein the lymphocytes are inactivated T cells.

[0509] Embodiment 135. The method according to any one of embodiments 99 to 134, wherein the cells are human cells.

[0510] Embodiment 136. The method according to any one of embodiments 99 to 135, wherein the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof.

[0511] Embodiment 137. The method according to Embodiment 136, wherein the DNA cleavage factor is a CRISPR / Cas nuclease component.

[0512] Embodiment 138. The method according to Embodiment 137, wherein the CRISPR / Cas nuclease component includes Cas nuclease or mRNA encoding Cas nuclease.

[0513] Embodiment 139. The method according to Embodiment 138, wherein the CRISPR / Cas nuclease component includes mRNA encoding a Cas nuclease.

[0514] Embodiment 140. The method according to embodiment 138 or 139, wherein the Cas nuclease is a type II Cas nuclease belonging to class 2.

[0515] Embodiment 141. The method according to embodiments 138 to 139, wherein the Cas nuclease is a type V Cas nuclease belonging to class 2.

[0516] Embodiment 142. The method according to Embodiment 140, wherein the Cas nuclease is a Cas9 nuclease.

[0517] Embodiment 143. The method according to Embodiment 142, wherein the Cas nuclease is a Cas9 nuclease derived from S. pyogenes.

[0518] Embodiment 144. The method according to Embodiment 141, wherein the Cas nuclease is Cas12a nuclease.

[0519] Embodiment 145. The method according to any one of embodiments 99 to 144, further characterized by bringing modified RNA into contact with the cells.

[0520] Embodiment 146. The method according to any one of embodiments 99 to 145, further characterized by bringing a guide RNA nucleic acid into contact with the cells.

[0521] Embodiment 147. The method according to Embodiment 146, wherein the guide RNA nucleic acid is gRNA.

[0522] Embodiment 148. The method according to embodiment 146 or 147, wherein the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes such dgRNA.

[0523] Embodiment 149. The method according to embodiment 146 or 147, wherein the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes such sgRNA.

[0524] Embodiment 150. The method according to any one of embodiments 147 to 149, wherein the gRNA is a modified gRNA.

[0525] Embodiment 151. The modified gRNA described above is one in which one or more of the first five nucleotides at the 5' end have been modified, according to the method of Embodiment 150.

[0526] Embodiment 152. The modified gRNA described above is one in which one or more of the last five nucleotides at the 3' end are modified, according to the method of Embodiment 150 or 151.

[0527] Embodiment 153. The method according to any one of Embodiments 146 to 152, wherein the DNA cleavage factor is a type II Cas nuclease belonging to class 2 or a type V Cas nuclease mRNA belonging to class 2, and the molar ratio of guide RNA nucleic acid to Cas nuclease is approximately 4:1 to 1:4.

[0528] Embodiment 154. The method according to any one of embodiments 99 to 153, further characterized by bringing the cells into contact with donor DNA.

[0529] Embodiment 155. The method according to Embodiment 154, characterized by contacting cells with a vector containing donor DNA.

[0530] Embodiment 156. The method according to Embodiment 154 or 155, wherein the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a structural RNA-coding sequence.

[0531] Embodiment 157. The method according to Embodiment 156, wherein the template sequence is incorporated into the cell genome by homologous recombination repair (HDR).

[0532] Embodiment 158. The method according to any one of embodiments 99 to 157, further characterized by bringing the vector into contact with the cells.

[0533] Embodiment 159. The method according to Embodiment 158, wherein the vector encodes a DNA cleavage factor.

[0534] Embodiment 160. The method according to embodiment 158 ​​or 159, wherein the vector encodes donor DNA.

[0535] Embodiment 161. The method according to any one of embodiments 158 to 160, wherein the vector is a viral vector.

[0536] Embodiment 162. The method according to any one of embodiments 158 to 160, wherein the vector is a nonviral vector.

[0537] Embodiment 163. The method according to Embodiment 161, wherein the vector is AAV.

[0538] Embodiment 164. The method according to any one of embodiments 99 to 163, wherein the DNA cleavage factor interacts with a target sequence in the cell's genome to cause a double-strand DNA break (DSB).

[0539] Embodiment 165. The method according to any one of embodiments 99 to 164, wherein gene knockout occurs.

[0540] Embodiment 166. The method according to any one of embodiments 99 to 165, wherein gene repair occurs.

[0541] Embodiment 167. The method according to any one of embodiments 99 to 166, wherein gene insertion occurs.

[0542] Embodiment 168. The method according to any one of embodiments 156 to 167, wherein the donor DNA includes a template having an exogenous nucleic acid encoding a protein.

[0543] Embodiment 169. The method according to Embodiment 168, wherein the protein is selected from the group consisting of cytokines, immunosuppressive factors, antibodies, receptors, and enzymes.

[0544] Embodiment 170. The method according to Embodiment 169, wherein the protein is a receptor.

[0545] Embodiment 171. The method according to embodiment 169 or 170, wherein the receptor is selected from the group consisting of immune receptors, T cell receptors (TCRs), and chimeric antigen receptors.

[0546] Embodiment 172. The method according to Embodiment 171, wherein the receptor is an immune receptor.

[0547] Embodiment 173. The method according to Embodiment 171, wherein the receptor is a TCR.

[0548] Embodiment 174. The method according to Embodiment 168, wherein the foreign nucleic acid encodes a TCRα chain and / or a TCRβ chain.

[0549] Embodiment 175. The method according to embodiment 171, wherein the receptor is a chimeric antigen receptor.

[0550] Embodiment 176. The method according to any one of embodiments 156 to 175, wherein the DNA cleavage factor interacts with a target sequence in the TRAC gene of a T cell.

[0551] Embodiment 177. The method according to Embodiment 176, characterized by contacting cells with at least two different DNA cleavage factors that target different gene loci.

[0552] Embodiment 178. The method according to any one of embodiments 168 to 177, wherein the mold includes a first homology arm and a second homology arm that are complementary to each other in arrangements located upstream and downstream of the cutting portion.

Claims

1. Equation (I): 【Chemistry 1】 [In the formula, A is a 5-membered or 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl group contains 1 or more R 4 It may be replaced as appropriate; R 1 This is a heteroaryl comprising an aryl or at least one heteroatom selected from the group consisting of N, O, S, and Se, wherein the aryl or heteroaryl comprises one or more R 5 It may be replaced as appropriate; R 2 is H, halogen, -(CH 2 ) n -CN, -OH, -(CH 2 ) n -O-C 1 -C 4 alkyl, C 1 -C 4 alkyl, C 1 -C 4 alkoxy, C 1 -C 4 haloalkyl, C 2 -C 4 alkenyl, C 2 -C 4 alkynyl, or C(O)NH 2 ; and R 3 H, F, C 2 -C 4 Alkenil, C 2 -C 4 Alkinyl, CN, OH, CH 2 OH, NH 2 CH 2 NH 2 , and C 1 -C 4 Selected from the group consisting of alkyl groups; Each R 4 These are, independently, halogen, oxo, thioxo, and C. 1 -C 4 Alkyl, C 1 -C 4 Alkoxy, CD 3 CD 2 CD 3 , and C 1 -C 6 Selected from the group consisting of haloalkyls; or Two R atoms bonded to the same atom 4 However, when they bond together with the carbon atoms, C 3 -C 6 Forms a cycloalkyl group; Each R 5 These are, independently, halogen and NH. 2 OH, -CN, C(O)NH 2 C(O)NHR 7 , C 1 -C 4 Alkyl, C 1 -C 4 Alkyl, C 2 -C 4 Alkenil, C 2 -C 4 Alkinil, CD 3 CD 2 CD 3 , C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl, C 3 -C 6 Selected from the group consisting of cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, where the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is 1 or more R 6 It may be replaced as appropriate; Each R 6 These are, independently, halogen, OH, oxo, and NH. 2 , CHO, C 1 -C 4 Alkyl, and C 1 -C 6 Selected from the group consisting of alkoxys; Each R 7 These are H and C, respectively, independently. 1 -C 4 Selected from alkyl groups; Each n is an independent integer between 0 and 4; r is an integer between 0 and 2; s is an integer between 0 and 2; and t is an integer between 1 and 2; however, A is a 5-membered heteroring containing NC(O)-N in the ring, and R 1 However, R is 1 or greater as appropriate. 5 Replaced with 【Chemistry 2】 If so, substructure 【Transformation 3】 teeth, 【Chemistry 4】 isn't it] A compound of [this].

2. The compound is of formula (Ia-1), (Ia-2), (Ia-3), (Ia-4), (Ia-5), (Ia-6), or (Ia-7): 【Transformation 5】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Transformation 6】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Transformation 7】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Transformation 8】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 9】 (In the formula, X is O, S, NH, or CH) 2 and X 1 , X 2 , X 3 , and X 4 Each of these independently comprises N, CH, or C(R 5 ) is) 【Chemistry 10】 (wherein X is O, S, NH, or CH 2 ; B is optionally one or more R 5 5- or 6-membered aryl or heteroaryl which may be substituted with; and m is an integer of 0 to 4), or 【Chemistry 11】 (In the formula, X is O, S, NH, or CH) 2 (is) The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

3. The compound is of formula (Ib-1), (Ib-2), (Ib-3), or (Ib-4): 【Chemistry 12】 (In the formula, X is O, S, NH, or CH) 2 However, R 1 R is 1 or greater as appropriate 5 Replaced with 【Chemistry 13】 If that is the case, X is not O), 【Chemistry 14】 (In the formula, X is S, NH, or CH) 2 (is), 【Chemistry 15】 (In the formula, X is O, S, NH, or CH) 2 (is), or 【Chemistry 16】 (wherein X is O, S, NH, or CH 2 ) The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

4. The compound is of formula (Ic-1), (Ic-2), (Ic-3), or (Ic-4): 【Chemistry 17】 (In the formula, X is O, S, NH, or CH) 2 (is), [Chemistry 18] (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 19】 (In the formula, X is O, S, NH, or CH) 2 (is), or 【Chemistry 20】 (In the formula, X is O, S, NH, or CH) 2 B is, as appropriate, 1 or more R 5 It is a 5-membered or 6-membered aryl or heteroaryl that may be substituted with; and m is an integer between 1 and 3. The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

5. The compound is of formula (Id-1), (Id-2), (Id-3), or (Id-4): 【Chemistry 21】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 22】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 23】 (In the formula, X is O, S, NH, or CH) 2 (is), or 【Chemistry 24】 (In the formula, X is O, S, NH, or CH) 2 (and m is an integer between 1 and 3), The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

6. The compound is of formula (Ie-1), (Ie-2), (Ie-3), (Ie-4), or (Ie-5): 【Chemistry 25】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 26】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 27】 (In the formula, X is O, S, NH, or CH) 2 (is), 【Chemistry 28】 (In the formula, X is O, S, NH, or CH) 2 (is), or 【Chemistry 29】 (In the formula, X is O, S, NH, or CH) 2 B is, as appropriate, 1 or more R 5 It is a 5-membered or 6-membered aryl or heteroaryl that may be substituted with; and m is an integer between 1 and 3. The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

7. The compound is of formula (If-1), (If-2), (If-3), or (If-4): 【Transformation 30】 or 【Chemistry 31】 (In the formula, B is R of 1 or more as appropriate) 5 It is a 5-membered or 6-membered aryl or heteroaryl that may be substituted with; and m is an integer between 1 and 3. The compound according to claim 1, as shown by [representation], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

8. The compound is of the formula (Ig-1), (Ig-2), (Ig-3), (Ig-4), or (Ig-5): 【Chemistry 32】 【Transformation 33】 (wherein Y is O or S), or 【Transformation 34】 (In the formula, B is R of 1 or more as appropriate) 5 It is a five- or six-membered aryl or heteroaryl that may be substituted with; and m is an integer from 0 to 4, and in some embodiments m is an integer from 1 to 3. A compound according to any one of claims 1 to 3, as shown in [the relevant section], or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

9. The compound, 【Chemistry 35】 【Transformation 36】 【Chemistry 37】 【Transformation 38】 【Chemistry 39】 【Chemistry 40】 【Chemistry 41】 【Chemistry 42】 A compound according to claim 1, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof, selected from the group consisting of the above.

10. The compound, 【Chemistry 43】 【Chemistry 44】 【Chemistry 45】 A compound according to claim 1 or 3, selected from the group consisting of the above, or a pharmaceutically acceptable salt, isomer, solvate, prodrug, or tautomer thereof.

11. a) A composition comprising a DNA protein kinase inhibitor (DNA-PKI) and b) a DNA cleavage factor, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.

12. The composition according to claim 11, further comprising cells.

13. The composition according to claim 11 or 12, further comprising donor DNA.

14. The composition according to any one of claims 11 to 13, wherein the DNA cleavage factor comprises a CRISPR / Cas nuclease component and, optionally, a guide RNA component.

15. The composition according to any one of claims 11 to 13, further comprising a vector.

16. The composition according to any one of claims 11 to 15, further comprising an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway.

17. A method for targeted genome editing of cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.

18. A method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.

19. A method for inhibiting or suppressing the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.

20. A method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound described in any one of claims 1 to 10.

Images