DNA-dependent protein kinase inhibitors and compositions having a pyrazolopyridine skeleton, and their applications to genome editing.
Patent Information
- Application Number
- JP2026512260
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-25
- Filing Date
- 2024-08-22
- Publication Date
- 2026-09-09
Smart Images

Figure 2026530609000001_ABST
Abstract
Description
[Technical Field]
[0001] [Related applications] This application claims priority to U.S. Provisional Application No. 63 / 578,860, filed on 25 August 2023, which is incorporated herein by reference in its entirety.
[0002] [Technical field] This disclosure generally relates to compounds, compositions, methods, and kits for improving genome editing efficiency by administering DNA protein kinase (DNA-PK) inhibitors having general formula (I) and genome editing systems to eukaryotic cells. More specifically, this disclosure relates to compositions comprising a DNA-PK inhibitor of general formula (I), methods for inserting a target polynucleotide into the genome of a eukaryotic cell, and kits for inserting a target gene into the genome of a eukaryotic cell. These methods and kits can improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells (particularly CRISPR recombinant CAR-T cells).
[0003] [Referenced by sequence listings] This application includes a sequence listing submitted in XML format via EFS-WEB, which is incorporated by reference in its entirety. The XML file is named "055920-612P01US_SeqList_ST26.xml", created on August 24, 2023, and has a size of 75KB. [Background technology]
[0004] Developing cost-effective and reliable methods for precisely targeting and modifying the genomes of living cells has been a long-standing goal. Genome editing offers the potential to remove genes causing specific diseases (i.e., gene "knockout"), or to correct gene deletions or enhance biological processes through "knock-in" by providing methods for gene manipulation or insertion. Genome editing can be applied to the treatment of numerous diseases, including genetic disorders, hematological disorders, and cancer, as well as immunotherapy. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-related (Cas) systems are immune mechanisms present in prokaryotes (Ishino et al., Journal of Bacteriology 169:5429-5433 (1987)), and immunity against viruses and plasmid nucleic acids can be obtained by sequence-specific targeting (Soret et al., Nature Reviews Microbiology 6:181-186 (2008)). Since the discovery of the CRISPR system, several groups have conducted extensive research on its potential applications in the field of genetic engineering, including gene editing (Jinek et al., Science 337(6096):816-821 (2012); Cong et al, Science 339(6121):819-823 (2013) and Mali et al., Science 339(6121):823-826 (2013)). The CRISPR-Cas9 gene editing system has been effectively used in a variety of biological species and cell lines.
[0005] Cas9 endonuclease induces double-strand DNA breaks at target sequences located upstream of protospacer adjacent motifs (PAMs). Subsequently, the target sequence can be removed, or a desired sequence can be inserted into the target sequence using the cell's endogenous repair pathways. These endogenous DNA repair pathways include non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and homologous recombination repair (HDR).
[0006] The NHEJ, MMEJ, and HDR pathways all repair double-strand DNA breaks, but such repairs can result in insertions or deletions at the break site. The NHEJ pathway does not require a template for DNA break repair. While NHEJ repair is prone to errors, the presence of a complementary overhang reduces errors. The NHEJ and MMEJ pathways are mechanistically distinct DNA repair pathways, each involving different groups of DNA repair enzymes. Unlike the NHEJ pathway, which can sometimes repair accurately and sometimes incorrectly, the MMEJ pathway is always error-prone, resulting in both deletions and insertions at the repair site. Deletions associated with the MMEJ pathway are due to microhomology (2-10 base pairs) present on both sides of the double-strand break. In contrast, the HDR pathway requires a homologous template to direct repair, but generally performs repairs faithfully and is less prone to errors. Therefore, repair of double-strand DNA breaks via the HDR pathway is preferable to repair via the NHEJ or MMEJ pathways. However, in many cell types, the HDR pathway is restricted by the activity of the NHEJ pathway, which operates at all stages of the cell cycle, and the HDR pathway is mainly active during the S / G2 phase of the cell cycle (Mao et al., Cell Cycle, 7:2902-2906 (2008)).
[0007] The ability to precisely modify the genome of any cell has improved with the recent discovery and introduction of CRISPR / Cas9 editing technologies. However, directing and introducing desired changes to specific loci is limited by the fact that the primary cellular repair pathway operating after Cas9-mediated DNA cleavage is the error-prone non-homologous end joining (NHEJ) pathway. Homologous recombination repair (HDR) is less efficient than NHEJ, resulting in reduced editing efficiency in eukaryotic cells. While the incidence of insertions and deletions caused by NHEJ can reach up to 70% in some reports, HDR efficiency remains low, at less than 1%. Therefore, there is a need to improve genome editing efficiency, particularly HDR efficiency.
[0008] Studies have shown that decreased NHEJ activity in vivo leads to increased HDR activity, and this phenomenon can be utilized to improve the efficiency of CRISPR / Cas9 precision genome editing via the HDR pathway (Pierce et al. Genes Dev., 15, 3237-3242 (2001); Ma et al. RNA Biol., 13, 605-612 (2016); Maruyama, et al. Nat. Biotechnol., 33, 538-542 (2015); Robert et al. Genome Med., 7, 93 (2015)).
[0009] DNA-dependent protein kinases (DNA-PKs) are serine / threonine kinases located in the nucleus and have been shown to be essential for DNA double-strand break repair mechanisms. In mammals, the primary pathway in DNA double-strand break repair is the non-homologous end joining (NHEJ) pathway, which functions at any stage of the cell cycle, removing unjoinable ends and joining broken ends. There is a need for potent and selective DNA-PK inhibitors (DNA-PKi) that improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells such as CRISPR CAR-T cells by transiently inhibiting the NHEJ pathway and promoting DNA repair via the desired HDR pathway. [Overview of the project]
[0010] A first aspect of this disclosure is formula (I): [ka] [In the formula, A is R greater than or equal to 1. 3 It is a 6- to 8-membered cycloalkyl group, which may be appropriately substituted with; X 1 is N or CR 4 and; X 2 is O, S, CH-OH, NH, or N(C1-C4 alkyl); R 1 is H, or a 6- to 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is optionally substituted with one or more R 5 as appropriate; R 2 is H, -COO(C1-C4 alkyl), -C(O)O-(aryl or heteroaryl) or heteroaryl (containing at least one heteroatom selected from the group consisting of N, O and S), wherein said aryl or heteroaryl is optionally substituted with one or more R 6 as appropriate; each R 3 is each independently selected from halogen, C1-C4 alkyl, or C1-C4 alkoxy; R 4 is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO(C1-C4 alkyl), and CHO; each R 5 is each independently selected from halogen or C1-C4 alkyl; and each R 6 is each independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2; or two R 6 groups bonded to adjacent atoms on a heteroaryl ring form a 5-membered or 6-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S] , and pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, and tautomers thereof.
[0011] Another aspect of the present disclosure relates to a compound of formula (I):
Chemical Formula
[0012] Another aspect of the present disclosure relates to a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include excipients, diluents, or surfactants.
[0013] Another aspect of the present disclosure relates to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleavage factor, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0014] Another aspect of the present disclosure relates to a method for editing a target genome in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0015] Another aspect of the present disclosure relates to a method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0016] Another aspect of the present disclosure relates to a method for inhibiting or suppressing the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0017] Another aspect of the present disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0018] Another aspect of this disclosure relates to the use of the compound of formula (I), and its pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions for use in the manufacture of pharmacotherapy pharmaceuticals.
[0019] Another aspect of this disclosure relates to the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition in the treatment of cells.
[0020] In some embodiments, the Disclosure provides a method for producing the compounds of the Disclosure.
[0021] In some embodiments, this disclosure provides a method for producing a compound, comprising one or more steps described herein.
[0022] Other features and advantages of this disclosure will become apparent from the detailed description and claims below. [Brief explanation of the drawing]
[0023] [Figure 1]Figure 1 shows the effect of DNA-PK inhibitor compound 18 from Example 18 on cell viability 5 days after electroporation. Live cells are shown as a percentage of the total number of cells. [Figure 2] Figure 2 shows the effect of DNA-PK inhibitor compound 18 from Example 18 on T cell proliferation 5 days after electroporation. The total number of viable cells (x10e6) is shown. [Figure 3] Figure 3 shows the effect of DNA-PK inhibitor compound 18 from Example 18 on CAR insertion into the TRAC gene locus 5 days after electroporation. The percentage of CAR+ T cells is shown as a percentage of the total number of viable cells. [Figure 4] Figure 4 shows the effect of DNA-PK inhibitor compound 18 of Example 18 on CAR insertion into the TRAC gene locus 5 days after electroporation. KI efficiency is shown as the percentage change compared to the untreated control condition (calculated by dividing the percentage of CAR+ in the DNA-PKi treated group by the percentage of CAR+ in the untreated group, subtracting 1, and multiplying by 100). [Figure 5] Figure 5 shows the effect of DNA-PK inhibitor compound 18 of Example 18 on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100). [Modes for carrying out the invention]
[0024] (definition) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure pertains. In this specification, singular nouns are considered plural unless otherwise specified in the context. In the examples or tests of this disclosure, similar or equivalent methods and substances may be used, but suitable methods and substances are listed below. All publications, patent applications, patents, and other documents referenced herein are incorporated by reference. References made herein do not constitute prior art relating to the claimed disclosure. In case of any conflict, including definitions, the provisions of this specification shall prevail. Furthermore, the substances, methods, and examples are illustrative and not intended to be limiting. In the event of any conflict between the chemical structure and the name of a compound disclosed herein, the chemical structure shall prevail.
[0025] In this disclosure, the articles "a" and "an" are used to refer to one or more (i.e., at least one) grammatical objects of the articles. For example, "an element" means one or more elements.
[0026] In this disclosure, the term "and / or" is used to mean either "and" or "or" unless otherwise specified.
[0027] The term "may be substituted as appropriate" means that a particular chemical group (e.g., an alkyl group) may (but is not required) be bonded to other substituents (e.g., heteroatoms). For example, a optionally substituted alkyl group may be a fully saturated alkyl chain (i.e., a pure hydrocarbon). Alternatively, an optionally substituted alkyl group may have substituents other than hydrogen. For example, it may be bonded at any position on the chain to a halogen atom, a hydroxyl group, or any other substituent described herein. Thus, the term "may be substituted as appropriate" means that a particular chemical group may, but is not required to, contain other functional groups. Suitable substituents used for any substitution of the listed groups include, but are not limited to, halogens, oxo, -OH, -CN, -COOH, -CH2CN, -O-(C1-C6)alkyl, (C1-C6)alkyl, (C1-C6)alkoxy, (C1-C6)haloalkyl, (C1-C6)haloalkoxy, -O-(C2-C6)alkenyl, -O-(C2-C6)alkynyl, (C2-C6)alkenyl, (C2-C6)alkynyl, -OH, -OP(O) Examples include (OH)2, -OC(O)(C1-C6)alkyl, -C(O)(C1-C6)alkyl, -OC(O)O(C1-C6)alkyl, -NH2, -NH((C1-C6)alkyl), -N((C1-C6)alkyl)2, -NHC(O)(C1-C6)alkyl, -C(O)NH(C1-C6)alkyl, -S(O)2(C1-C6)alkyl, -S(O)NH(C1-C6)alkyl, and S(O)N((C1-C6)alkyl)2. The substituents themselves may also be substituted as appropriate. As used herein, "may be substituted as appropriate" refers to substitution or non-substitution in the sense described later.
[0028] As used herein, the term “substitution” means that one or more hydrogen atoms on a specified atom are substituted by a group selected from the group shown, provided that the substitution does not exceed the normal valence of the specified atom and that the substitution results in a stable compound. When the substituent is oxo or keto (i.e., =O), two hydrogen atoms on the atom are substituted. Keto substituents are not present in aromatic moieties. As used herein, a ring double bond is a double bond formed between two adjacent ring atoms (e.g., C=C, C=N, or N=N). “Stable compound” and “stable structure” refer to a compound that can be isolated from a reference material (RM) with useful purity and is stable enough to be formulated as an effective therapeutic agent. For example, a cycloalkyl-substituted aryl group may include cases where the cycloalkyl is bonded to one atom of the aryl group, or where it is condensed with the aryl group and shares two or more common atoms.
[0029] As used herein, the term "unsubstituted" means that the specified group has no substituents.
[0030] As used herein, “alkyl” refers to linear and branched aliphatic groups having 1 to 30 carbon atoms, which may be substituted as appropriate. “C1, C2, C3, C4, C5 or C6 alkyl” or “C1-C6 alkyl” includes linear saturated aliphatic hydrocarbon groups of C1, C2, C3, C4, C5 or C6 and branched saturated aliphatic hydrocarbon groups of C3, C4, C5 or C6. For example, C1-C6 alkyl includes alkyl groups of C1, C2, C3, C4, C5 and C6. Examples of alkyls include moieties containing 1 to 6 carbon atoms, such as, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, the linear or branched alkyl has six or fewer carbon atoms (e.g., C1-C6 for linear chains, C3-C6 for branched chains), and in other embodiments, the linear or branched alkyl has four or fewer carbon atoms. As used herein, the term "heteroalkyl" means an alkyl having one or more heteroatoms. As used herein, the term "optionally substituted alkyl" means an unsubstituted alkyl or an alkyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent.The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.
[0031] "Alkoxy" refers to a straight-chain or branched-chain saturated hydrocarbon containing 1 to 12 carbon atoms, with an "O" (i.e., -O(alkyl)) group at the end of the chain. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pentoxy groups.
[0032] As used herein, the term "alkenyl" refers to an unsaturated or partially unsaturated aliphatic group that is similar to the alkyls described above in terms of chain length and substitutability, but contains at least one double bond. For example, the term "alkenyl" includes linear alkenyl groups (e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl) and branched alkenyl groups. In some embodiments, a linear or branched alkenyl group has six or fewer carbon atoms in its main chain (e.g., a linear group has C 2-6 The branching chain is C 3-6 ). The term “C 2-6 The term "C" contains an alkenyl group having 2 to 6 carbon atoms. 3-6This includes alkenyl groups having 3 to 6 carbon atoms.
[0033] As used herein, the term "optionally substituted alkenyl" means an unsubstituted alkenyl, or an alkenyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.
[0034] As used herein, the term "alkynyl" refers to an unsaturated aliphatic group that is similar to the alkyl group described above in terms of chain length and substitutability, but contains at least one triple bond. For example, "alkynyl" includes linear alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octinyl, noninyl, desynyl) and branched alkynyl groups. In some embodiments, a linear or branched alkynyl group has six or fewer carbon atoms in its main chain (e.g., a linear group has C 2-6 The branching chain is C 3-6 ). The term “C 2-6 The term "C" contains an alkynyl group having 2 to 6 carbon atoms. 3-6This includes an alkynyl group having 3 to 6 carbon atoms.
[0035] As used herein, the term "optionally substituted alkynyl" refers to an unsubstituted alkynyl or an alkynyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.
[0036] Other optionally substituted portions (e.g., optionally substituted cycloalkyl, heterocycloalkyl, aryl, or heteroaryl) include both unsubstituted portions and portions substituted with one or more predetermined substituents. For example, substituted heterocycloalkyls include those substituted with one or more alkyl groups, such as 2,2,6,6-tetramethylpiperidinyl and 2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridinyl.
[0037] As used herein, the term "cycloalkyl" refers to a saturated or partially unsaturated hydrocarbon monocyclic or polycyclic system having 3 to 30 carbon atoms (e.g., a fused ring, a bridging ring, or a spiro ring) (e.g., C3-12 , C 3-10 , or C 3-8 Examples of cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,2,3,4-tetrahydronaphthalenyl, and adamantyl. In the case of polycyclic cycloalkyls, it is sufficient that at least one of the rings constituting the cycloalkyl is non-aromatic.
[0038] As used herein, the term "heterocycloalkyl" refers to a saturated or partially unsaturated 3- to 8-membered monocyclic or dicyclic ring, a 7- to 12-membered dicyclic ring (fused, bridging, or spirocyclic ring), or an 11- to 14-membered tricyclic ring (fused, bridging, or spirocyclic ring) containing one or more heteroatoms (e.g., O, N, S, P, or Se). Unless otherwise specified, the heteroatoms are independently selected from the group consisting of nitrogen, oxygen, and sulfur, and may be, for example, 1, 1-2, 1-3, 1-4, 1-5, 1-6, or 1, 2, 3, 4, 5, or 6.Examples of heterocycloalkyl groups include, but are not limited to, piperidinyl, piperazinyl, pyrrolidinyl, dioxanil, tetrahydrofuranil, isoindolinyl, indolinyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, triazolidinyl, oxyranil, azetidinyl, oxetanil, thietanil, 1,2,3,6-tetrahydropyridinyl, tetrahydropyranil, dihydropyranil, pyranil, morpholinil, tetrahydrothiopyranil, and 1,4-diazepanyl L, 1,4-oxazepanyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 2,5-diazabicyclo[2.2.1]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, 2,6-diazaspiro[3.3]heptanyl, 1,4-dioxa-8-azaspiro[4.5]decanyl, 1,4-dioxaspiro[4.5]decanyl, 1-oxaspiro[4.5]decanyl, 1-azaspiro[4.5]decanyl, 3'H-spiro[cyclohexane-1,1'-isobenzofuran]yl, 7'H -Spiro[cyclohexane-1,5'-flo[3,4-b]pyridine]-yl, 3'H-Spiro[cyclohexane-1,1'-flo[3,4-c]pyridine]-yl, 3-azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.1.0]hexane-3-yl, 1,4,5,6-tetrahydropyrrolo[3,4-c]pyrazolyl, 3,4,5,6,7,8-hexahydropyrido[4,3-d]pyrimidinyl, 4,5,6,7-tetrahydro-1H-pyrazolo[3,4-c]pyridinyl, 5,6,7,8- Examples include tetrahydropyrido[4,3-d]pyrimidinyl, 2-azaspiro[3.3]heptanyl, 2-methyl-2-azaspiro[3.3]heptanyl, 2-azaspiro[3.5]nonanyl, 2-methyl-2-azaspiro[3.5]nonanyl, 2-azaspiro[4.5]decanyl, 2-methyl-2-azaspiro[4.5]decanyl, 2-oxazaspiro[3.4]octanyl, 2-oxazaspiro[3.4]octan-6-yl, and 5,6-dihydro-4H-cyclopenta[b]thiophenyl. In the case of polycyclic heterocycloalkyls, it is sufficient that at least one of the rings constituting the heterocycloalkyl is non-aromatic (e.g., 1,3-dihydrobenzo[c]isoxazole-3-yl).
[0039] As used herein, the term "heterocycloalkyl which may be appropriately substituted" means an unsubstituted heterocycloalkyl in which one or more hydrogen atoms on one or more carbons or heteroatoms are substituted by a predetermined substituent. Examples of such substituents include alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.
[0040] Unless otherwise defined, the term "aryl" refers to a cyclic aromatic hydrocarbon group having 1 to 3 aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl, or naphthyl. When there are two aromatic rings (e.g., bicyclic), the aromatic rings of the aryl group may be bonded at a single point (e.g., biphenyl) or fused (e.g., naphthyl). The aryl group may be appropriately substituted with one or more substituents (e.g., 1 to 5 substituents) at any bond position. Examples of substituents include, but are not limited to, -H, -halogens, and -O-(C). 1-6 ) alkyl, (C 1-6 )alkyl, -O-(C 2-6 ) Alkenyl, -O-(C 2-6 ) Alkinyl, (C 2-6 ) Alkenil, (C 2-6)Alkinyl, -OH, -OP(O)(OH)2, -OC(O)(C 1-6 )alkyl, -C(O)(C 1-6 )alkyl, -OC(O)O(C 1-6 )Alkyl, NH2, NH((C 1-6 )alkyl), N((C 1-6 )alkyl)2,-S(O)2-(C 1-6 )alkyl, -S(O)NH(C 1-6 )alkyl, and -S(O)N((C 1-6 )alkyl)2 is an example. The substituent itself may be substituted as appropriate. Furthermore, if it contains two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated ring fused with a completely unsaturated aromatic ring. Examples of the ring of the aryl group include, but are not limited to, phenyl, biphenyl, naphthyl, anthracenyl, phenalenyl, phenantrenyl, indanyl, indenyl, tetrahydronaphthalenyl, tetrahydrobenzoanurenyl, 10,11-dihydro-5H-dibenzo[a,d][7]anurenyl, etc. Furthermore, if it contains two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated heterocycle fused with a completely unsaturated aromatic ring. Examples of the aryl ring include, but are not limited to, benzo[d][1,3]dioxol-5-yl, 2,3-dihydrobenzo[b][1,4]dioxin-6-yl, benzo[d]isoxazole-3(2H)-on-6-yl, benzo[d]xazole-2(3H)-on-6-yl, and benzo[d]xazole-2(3H)-on-5-yl. Unless otherwise defined, “heteroaryl” means a monovalent monocyclic or polycyclic aromatic group having 5 to 24 ring atoms, wherein the ring contains one or more ring heteroatoms selected from N, O, S, P, Se, or B, and the remaining ring atoms are C. Furthermore, as defined herein, heteroaryl also means a bicyclic heteroaromatic group in which the heteroatoms are selected from N, O, S, P, Se, or B. As defined herein, heteroaryl also means a tricyclic heteroaromatic group containing one or more ring heteroatoms selected from N, O, S, P, Se, or B. The aromatic group may be independently and appropriately substituted by one or more substituents as described herein. For example, but not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indolyl, thiophen-2-yl, quinolinyl, benzopyranil, isothiazolyl, thiazolyl, thiadiazole, indazole, benzimidazolyl, thieno[3,2-b]thio Fen, triazolyl, triazinyl, imidazo[1,2-b]pyrazolyl, flo[2,3-c]pyridinyl, imidazo[1,2-a]pyridinyl, indazolyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-c]pyridinyl, thieno[2,3-b]pyridinyl Lidinyl, benzothiazolyl, indolyl, indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuranyl, benzofuran, chromanil, thiochromanil, tetrahydroquinolinyl, dihydrobenzothiazine, quinolinyl, isoquinolinyl, 1,6-naphthilidinyl, benzo[de]isoquinolinyl, pyrido[4,3-b][1,6]naphthilidinyl, thieno[2,3-b]pyradinyl, quinazolinyl, tetrazolo[1,5-a]pyridinyl, [1,2,4]triazolo[4,3-a]pyridinyl, isoindolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[3,4-b]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[5,4-b]pyridinyl, pyrrolo[1,2-a]pyridinyl, tetrahydro Pyrrolo[1,2-a]pyrimidinyl, 3,4-Dihydro-2H-1λ2-pyrrolo[2,1-b]pyrimidine, dibenzo[b,d]thiophene, pyridine-2-one, flo[3,2-c]pyridinyl, flo[2,3-c]pyridinyl, 1H-pyrido[3,4-b][1,4]thiadinyl, benzoxazolyl, benzoisoxazolyl, flo[2,3-b]pyridinyl, benzothiophenyl, 1,5-naphthilidinyl, flo[3,2-b]pyridine, [1,2,4]triazolo[1,5-a]pyridinyl, benzo[1,2,3]triazolyl, imidazo[1,2-a]pyrimidinyl, [1 Examples include [2,4]triazolo[4,3-b]pyridazinyl, benzo[c][1,2,5]thiadiazolyl, benzo[c][1,2,5]oxadiazole, 1,3-dihydro-2H-benzo[d]imidazole-2-one, 3,4-dihydro-2H-pyrazolo[1,5-b][1,2]oxazinyl, 4,5,6,7-tetrahydropyrazolo[1,5-a]pyridinyl, thiazolo[5,4-d]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, thieno[2,3-b]pyrrolyl, 3H-indolyl, and their derivatives. Furthermore, if the heteroaryl ring contains two or more fused rings, the heteroaryl group as defined herein may consist of one or more saturated or partially unsaturated rings fused with a completely unsaturated aromatic ring (for example, a five-membered heteroaromatic ring containing 1 to 3 heteroatoms selected from N, O, S, P, Se, or B, or a six-membered heteroaromatic ring containing 1 to 3 nitrogen atoms, where the saturated or partially unsaturated ring contains 0 to 4 heteroatoms selected from N, O, S, P, Se, or B, and may be appropriately substituted with one or more oxos). In heteroaryl rings containing two or more fused rings, the saturated or partially unsaturated rings may further be fused with saturated or partially unsaturated rings as described herein. Examples of these heteroaryl groups include indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, 3,4-dihydro-11H-isoquinolinyl, 2,3-dihydrobenzofuranyl, benzofuranonyl, indolinyl, oxyindolyl, indolyl, 1,6-dihydro-7H-pyrazolo[3,4-c]pyridine-7-onyl, 7,Examples include 8-dihydro-6H-pyrido[3,2-b]pyrrolidinyl, 8H-pyrido[3,2-b]pyrrolidinyl, 1,5,6,7-tetrahydrocyclopenta[b]pyrazolo[4,3-e]pyridinyl, 7,8-dihydro-6H-pyrido[3,2-b]pyrroridine, pyrazolo[1,5-a]pyrimidine-7(4H)-onyl, 3,4-dihydropyrazino[1,2-a]indole-1(2H)-onyl, or benzo[c][1,2]oxabolol-1(3H)-olyl. A cycloalkyl, heterocycloalkyl, aryl, or heteroaryl ring has the above substituents at one or more positions on the ring (e.g., on the carbon atoms or heteroatoms such as N that make up the ring) (e.g., alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkoxy, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, alkylaminocarbonyl, aralkylaminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl, amino They may be substituted with nocarbonyl, alkylthiocarbonyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic group. The aryl and heteroaryl groups may be condensed or crosslinked with non-aromatic alicyclic or heterocyclic rings to form polycyclic rings (e.g., tetralin, methylenedioxyphenyl (e.g., benzo[d][1,3]dioxol-5-yl)).
[0041] If the bond to the substituent is shown to cross a bond connecting two atoms in the ring, the substituent may be bonded to any atom in the ring. For example, the following structure [ka] In this case, substituent R 5 This can be substituted for any hydrogen atom bonded to an atom in the ring (including hydrogen atoms bonded to the ring atom indicated by B). When a substituent is listed without indicating which atom it is bonded to for the remainder of a compound of a particular formula, the substituent may be bonded to any atom in that formula. For example, the following structure [ka] for, [ka] This includes [specific compounds]. Combinations of substituents and / or variables are permitted only if the combination results in a stable compound.
[0042] In the constituent elements or formula of a compound, if any variable (e.g., R) appears multiple times, each variable is defined independently of the definitions of the other variables. Therefore, for example, if a group is substituted with 0 to 2 Rs, that group may be substituted with up to 2 Rs as needed, and in each appearance, R is selected independently of the definition of R. Furthermore, combinations of substituents and / or variables are permitted only if the combination results in a stable compound.
[0043] As used herein, the terms "hydroxy" or "hydroxyl" include groups having -OH or -O-.
[0044] As used herein, the terms "halo" or "halogen" refer to fluoro, chloro, bromo, and iodine.
[0045] The terms "haloalkyl" or "haloalkoxyl" refer to alkyl or alkoxyl groups substituted with one or more halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, and trichloromethyl, while examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, pentafluoroethoxy, and trichloromethoxy.
[0046] As used herein, the term "cyano" refers to a nitrile group (e.g., -CN).
[0047] As used herein, the term "optionally substituted haloalkyl" means an unsubstituted haloalkyl in which one or more hydrogen atoms on one or more carbon atoms of the hydrocarbon skeleton are substituted by a predetermined substituent. The substituents include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups.
[0048] As used herein, the terms "alkoxy" or "alkoxyl" include substituted and unsubstituted alkyl, alkenyl, and alkynyl groups covalently bonded to an oxygen atom. Examples of alkoxy or alkoxyl groups include, but are not limited to, methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy group may be substituted with, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate group, phosphonate, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfate group, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclyl, alkylaryl, or aromatic or heteroaromatic groups. Examples of halogen-substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy, and trichloromethoxy.
[0049] As used herein, the term "solvate" refers to a solvation form containing a stoichiometric or non-stoichiometric amount of solvent. Some compounds tend to incorporate solvent molecules in a certain molar ratio in their crystalline solid state, resulting in the formation of solvates. When the solvent is water, the solvate formed is a hydrate; when the solvent is alcohol, the solvate formed is an alcohol solvate. Hydrates are formed when one or more water molecules combine with one molecule of another substance, in which case the water retains its molecular state as H2O.
[0050] As used herein, the term "isomer" refers to a compound that has the same molecular formula but differs in the order or spatial arrangement of its atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are mirror images of each other but cannot be superimposed are called "enantiomers" or optical isomers. A mixture containing equal amounts of each enantiomer having opposite chiralities is called a "racemic mixture." The compound of formula (I) has one or more chiral carbon atoms and may exist as a racemate, a racemic mixture, or as individual enantiomers or diastereomers.
[0051] As used herein, the term "tautomer" refers to one of two or more structural isomers that exist in equilibrium and can be readily converted from one isomer to the other. This conversion involves a formal transfer of hydrogen atoms, accompanied by the switching of adjacent conjugated double bonds. Tautomers exist in solution as a mixture of tautomers. In solutions where tautomerization is possible, a chemical equilibrium is established between tautomers. The exact ratio of tautomers varies depending on several factors, including temperature, solvent, and pH. The concept of tautomers that can be interconverted by tautomerization is called tautomerism. In keto-enol tautomerism, simultaneous transfer of electrons and hydrogen atoms occurs.
[0052] It should be understood that the compounds disclosed herein may be shown as different tautomers. Furthermore, if a compound has tautomers, all tautomers are included within the scope of this disclosure, and no tautomers are excluded by the naming of the compound. It should be understood that certain tautomers may exhibit higher activity than others.
[0053] This disclosure relates to isotope-labeled compounds of formula I (e.g., 2 H and 14 This also includes compounds labeled with 1C. Substitution with heavier isotopes, such as deuterium, may offer certain therapeutic benefits by improving metabolic stability (e.g., increased d, extending the in vivo half-life or reducing the required dose). Isotope-labeled compounds of formula I can generally be prepared by using a suitable isotope-labeling reagent instead of a non-isotopically labeled reagent, following a procedure similar to that disclosed in the scheme and / or examples shown below.
[0054] This disclosure includes pharmaceutical compositions comprising an effective amount of the disclosed compound and a pharmaceutically acceptable carrier.
[0055] As used herein, the term "pharmaceutically acceptable salt" refers to a derivative of the compound disclosed herein, wherein the parent compound is modified by forming an acid salt or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines, and alkali metal salts or organic salts of acidic residues such as carboxylic acids. pharmaceutically acceptable salts include conventional non-toxic salts of parent compounds formed from non-toxic inorganic or organic acids, or quaternary ammonium salts. For example, such conventional non-toxic salts include, but are not limited to, 2-acetoxybenzoic acid, 2-hydroxyethanesulfonic acid, acetic acid, ascorbic acid, benzenesulfonic acid, benzoic acid, bicarbonate, carbonic acid, citric acid, EDTA, ethanedisulfonic acid, 1,2-ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, glycolylarsanilic acid, hexylresorcinic acid, hydrabamic acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, hydroxymaleic acid, hydroxynaphthoic acid, isethionic acid, lactic acid, and This includes salts formed from inorganic and organic acids selected from ctobionic acid, lauryl sulfonic acid, maleic acid, malic acid, mandelic acid, methanesulfonic acid, naphthic acid, nitric acid, oxalic acid, pamoic acid, pantothenic acid, phenylacetic acid, phosphoric acid, polygalacturonic acid, propionic acid, salicylic acid, stearic acid, subacetic acid, succinic acid, sulfamic acid, sulfanilic acid, sulfuric acid, tannic acid, tartaric acid, toluenesulfonic acid, and commonly present amino acids (e.g., glycine, alanine, phenylalanine, arginine, etc.).
[0056] In some embodiments, pharmaceutically acceptable salts are sodium salts, potassium salts, calcium salts, magnesium salts, diethylamine salts, choline salts, meglumine salts, benzathine salts, trometamic acid salts, ammonia salts, arginine salts, or lysine salts.
[0057] Other examples of pharmaceutically acceptable salts include hexanoic acid, cyclopentanepropionic acid, pyruvate, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-octa-2-en-1-carboxylic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butyl acetate, and muconic acid. The disclosure also includes salts formed by the substitution of an acidic proton present in the parent compound with a metal ion (e.g., alkali metal ions, alkaline earth metal ions, or aluminum ions) or by coordination with an organic base (e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, etc.). In salt form, the ratio of the compound to the salt cation or anion may be 1:1, or it may be a ratio other than 1:1 (e.g., 3:1, 2:1, 1:2, or 1:3).
[0058] References to pharmaceutically acceptable salts as defined herein are understood to include the solvated form (solvate) or crystalline form (polymorph) of the salt.
[0059] "Patient" or "subject" means a mammal, such as a human, mouse, rat, guinea pig, dog, cat, horse, cattle, pig, or a non-human primate such as a monkey, chimpanzee, baboon, or rhesus macaque.
[0060] When the term "effective amount" is used in reference to a compound, it refers to the amount that is effective for use in cell therapy.
[0061] As used in this disclosure, the term "carrier" includes carriers, excipients, and diluents, and means a substance, composition, or vehicle (e.g., liquid or solid extenders, diluents, excipients, solvents, or encapsulating substances) involved in transporting or delivering a pharmaceutical product from one organ or part of the body to another.
[0062] In this disclosure, the term "disability" is synonymous with "disease," "symptom," or "illness" unless otherwise specified, and is used interchangeably with these terms.
[0063] As used in this disclosure, “administration” means either directly administering the disclosed compound, or a pharmaceutically acceptable salt or composition of the disclosed compound, or administering a compound, or a pharmaceutically acceptable salt or composition of the compound, or a prodrug derivative or analog of the compound, that can form an equivalent amount of the active compound in the body of the subject.
[0064] As used in this disclosure, the term "prodrug" means a compound that can be converted into the disclosed compound in a living organism by metabolism (e.g., hydrolysis).
[0065] This disclosure relates to compounds and compositions that can inhibit DNA-dependent protein kinases (DNA-PKs) in subjects or biological samples.
[0066] In a first aspect of this disclosure, formula (I): [ka] (In the formula, A, R 1 , R 2 , X 1 , and X 2 Compounds of (as described herein), as well as pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, and tautomers thereof, are disclosed.
[0067] Details of this disclosure are described below. Similar or equivalent methods and materials to those described herein may be used in the practice or testing of this disclosure, but examples of such methods and materials are described below. Other features, purposes, and advantages of this disclosure will become apparent from this specification and the claims. In the specification and claims, singular nouns are to be taken as plural unless otherwise specified in the context. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. All patents and publications referenced herein are incorporated by reference.
[0068] In some embodiments, A is appropriately 1 or more R 3 A 6-8 member cycloalkyl group which may be substituted with each R 3 Each of these is independently selected from halogens, C1-C4 alkyls, or C1-C4 alkoxys. In some embodiments, A is appropriately 1 or more R 3 It is a six-membered cycloalkyl group which may be substituted with [another compound]. In some embodiments, A is appropriately 1 or more R 3 It is a 7-membered cycloalkyl group which may be substituted with [another compound]. In some embodiments, A is appropriately 1 or more R 3 It is an 8-membered cycloalkyl group which may be substituted with [another compound]. In some embodiments, A is a 6- to 8-membered cycloalkyl group. In some seminars, A is one R 3 It is a 6- to 8-membered cycloalkyl group substituted with [a specific compound]. In some examples, A is two R 3 It is a 6- to 8-membered cycloalkyl group substituted with [a specific compound]. In some embodiments, A has three R's 3 It is a 6- to 8-membered cycloalkyl group substituted with [a specific compound]. In some embodiments, A has four R's 3 It is a 6- to 8-membered cycloalkyl group substituted with [a specific compound]. In some embodiments, A is one of five R's 3 It is a 6- to 8-membered cycloalkyl group substituted with [a specific compound].
[0069] In some embodiments, A is [ka] A group consisting of the following is selected, where p is 0, 1, 2, or 3. In some embodiments, p is 0. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 0 or 1. In some embodiments, p is 0, 1, or 2.
[0070] In some embodiments, X 1 is N or CR 4 And here R 4 The group is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO(C1-C4 alkyl), and CHO. In some embodiments, X 1 It is N. In some embodiments, X 1 CR 4 That is the case.
[0071] In some embodiments, X 2 The group is O, S, CH-OH, NH, or N(C1-C4 alkyl). In some embodiments, X 2 It is O. In some embodiments, X 2 S is. In some embodiments, X 2 It is CH-OH. In some embodiments, X 2 It is NH. In some embodiments, X 2 is N(C1-C4 alkyl).
[0072] In some embodiments, R 1 is H, or a 6- to 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is optionally substituted with one or more R 5 as appropriate, and each R 5 is each independently selected from the group consisting of halogen and C1-C4 alkyl. In some embodiments, R 1 is H. In some embodiments, R 1 is a 6- to 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is optionally substituted with one or more R 5 as appropriate.
[0073] In some embodiments, R 1 is a 6-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O. In some embodiments, R 1 is a 7-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O. In some embodiments, R 1 is an 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O. In some embodiments, R 1 is a 6-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is optionally substituted with one or more R 5may be optionally substituted with. In some embodiments, R 1 is a 7-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is one or more R 5 may be optionally substituted with. In some embodiments, R 1 is an 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is one or more R 5 may be optionally substituted with. In some embodiments, R 1 is a 6-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is one or more R 5 is substituted with. In some embodiments, R 1 is a 7-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is one or more R 5 is substituted with. In some embodiments, R 1 is an 8-membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of N and O, wherein said heterocycloalkyl or heteroaryl group is one or more R 5 is substituted with.
[0074] In some embodiments, R 1 is
化
[0075] In some embodiments, R 2 is H, -COO(C1-C4 alkyl), -C(O)O-(aryl or heteroaryl), or heteroaryl (containing at least one heteroatom selected from the group consisting of N, O, and S), where the aryl or heteroaryl is one or more R 6 It may be replaced as appropriate. In some embodiments, R 2 H is H. In some embodiments, R 2 These are -COO(C1-C4 alkyl) or -C(O)O-(aryl or heteroaryl). In some embodiments, R 2 is -COO(C1-C4 alkyl) or -C(O)O-(aryl or heteroaryl), where the aryl or heteroaryl is 1 or more R 6 It may be replaced as appropriate. In some embodiments, R 2 is -COO(C1-C4 alkyl) or -C(O)O-(aryl or heteroaryl), where the aryl or heteroaryl is 1 or more R 6 It will be replaced by this. In some embodiments, R 2 This is a heteroaryl compound containing at least one heteroatom selected from the group consisting of N, O, and S. In some embodiments, R 2This is a heteroaryl compound comprising at least one heteroatom selected from the group consisting of N, O, and S, where the heteroaryl compound comprises one or more R 6 It may be replaced as appropriate. In some embodiments, R 2 This is a heteroaryl compound comprising at least one heteroatom selected from the group consisting of N, O, and S, where the heteroaryl compound comprises one or more R 6 It will be replaced by this.
[0076] In some embodiments, R 2 teeth, [ka] And here each X 3 , X 4 , X 5 , and X 6 These are independently N and C(R 6 ) selected from, and at least one X 3 , X 4 , X 5 , and X 6 is C(R 6 )
[0077] In some embodiments, R 2 teeth, [ka] And here each X 3 , X 4 , X 5 , and X 6 These are independently N, NH, O, S, and C(R 6 ) will be selected from. In some embodiments, at most one X 3 , X 4 , X 5 , and X 6 However, it is either O or S. In some embodiments, at most one X 3 , X 4 , X 5 , and X 6However, the answer is O. In some embodiments, at most one X 3 , X 4 , X 5 , and X 6 However, it is S.
[0078] In some embodiments, R 2 teeth, [ka] A group consisting of the following is selected, where m is 0, 1, 2, or 3. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 0 or 1. In some embodiments, m is 0, 1, or 2.
[0079] In some embodiments, each R 3 Each of these is independently selected from halogens, C1-C4 alkyls, or C1-C4 alkoxys. In some embodiments, each R 3 Each of these is independently selected from halogens, C1-C3 alkyls, or C1-C3 alkoxys. In some embodiments, each R 3 Each of these is independently selected from halogens, C1-C2 alkyls, or C1-C2 alkoxys. In some embodiments, each R 3 Each of these is independently selected from halogens, C1 alkyls, or C1 alkoxys. In some embodiments, each R 3 Each of these is independently selected from C1-C4 alkyl or C1-C4 alkoxy. In some embodiments, each R 3Each of these is independently selected from halogens or C1-C4 alkoxys. In some embodiments, each R 3 Each of these is independently selected from halogens or C1-C4 alkyl groups. In some embodiments, each R 3 Each of these is independently selected from halogens. In some embodiments, each R 3 Each of these is independently selected from C1-C4 alkyl groups. In some embodiments, each R 3 Each of these is independently selected from C1-C4 alkoxys.
[0080] In some embodiments, R 4 The group is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO(C1-C4 alkyl), and CHO. In some embodiments, R 4 It is -CN. In some embodiments, R 4 It is a halogen. In some embodiments, R 4 It is a C1-C4 alkyl group. In some embodiments, R 4 It is a C1-C4 alkoxy. In some embodiments, R 4 It is CO(C1-C4 alkyl). In some embodiments, R 4 He is the CHO. In some embodiments, R 4 This is selected from the group consisting of halogens, C1-C4 alkyls, C1-C4 alkoxys, CO(C1-C4 alkyl), and CHO. In some embodiments, R 4 The group is selected from the group consisting of -CN, C1-C4 alkyl, C1-C4 alkoxy, CO(C1-C4 alkyl), and CHO. In some embodiments, R 4The group is selected from the group consisting of -CN, halogens, C1-C4 alkoxys, CO(C1-C4 alkyl), and CHO. In some embodiments, R 4 The group is selected from the group consisting of -CN, halogen, C1-C4 alkyl, CO(C1-C4 alkyl), and CHO. In some embodiments, R 4 The group is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, and CHO. In some embodiments, R 4 The group is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, and CO(C1-C4 alkyl).
[0081] In some embodiments, each R 5 Each of these is independently selected from the group consisting of halogens and C1-C4 alkyl groups. In some embodiments, each R 5 Each of these is independently selected from the group consisting of halogens and C1-C3 alkyl groups. In some embodiments, each R 5 Each of these is independently selected from the group consisting of halogens and C1-C2 alkyl groups. In some embodiments, each R 5 Each of these is independently selected from the group consisting of halogens and C1 alkyl groups. In some embodiments, each R 5 Each of these is a halogen, independently of the others. In some embodiments, each R 5 Each of these is independently a C1-C4 alkyl group.
[0082] In some embodiments, each R 6Each of these is independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2; or two R atoms bonded to adjacent atoms of a heteroaryl ring. 6 The group forms a 5- or 6-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S. In some embodiments, each R 6 Each of these is independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2. In some embodiments, each R 6 Each of these is independently selected from halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2. In some embodiments, each R 6 Each of these is independently selected from hydrogen, halogen, or -CN. In some embodiments, each R 6 Each of these is independently selected from C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, or C1-C4 haloalkoxy. In some embodiments, each R 6 Each of these is independently selected from CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2. In some embodiments, two R atoms bonded to adjacent atoms of a heteroaryl ring 6 The group forms a 5- or 6-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S. In some embodiments, two R atoms bonded to adjacent atoms of a heteroaryl ring 6 The group forms a five-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S. In some embodiments, two R atoms bonded to adjacent atoms of a heteroaryl ring 6 The group forms a six-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S.
[0083] In some embodiments, the compound of formula (I) is formula (Ia-1): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0084] In some embodiments, the compound of formula (I) is formula (Ia-2): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0085] In some embodiments, the compound of formula (I) is formula (Ia-3): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0086] In some embodiments, the compound of formula (I) is formula (Ia-4): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0087] In some embodiments, the compound of formula (I) is formula (Ib-1): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0088] In some embodiments, the compound of formula (I) is formula (Ib-2): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0089] In some embodiments, the compound of formula (I) is formula (Ib-3): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0090] In some embodiments, the compound of formula (I) is formula (Ib-4): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0091] In some embodiments, the compound of formula (I) is formula (Ib-5): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0092] In some embodiments, the compound of formula (I) is formula (Ib-6): [ka] The compound, or its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0093] In some embodiments, the compound of formula I is selected from the compounds shown in Table 1, or from their pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0094] In some embodiments, the compound of formula I is selected from the compounds shown in Table 2, or from their pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.
[0095] In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt, stereoisomer, or tautomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt or stereoisomer thereof. In some of the embodiments described above, the compound of formula I is the compound itself, or a pharmaceutically acceptable salt thereof. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] Table 8 Table 9 Table 10 Table 11 Table 12 Table 13 Table 14
change
[0096] Table 26 Table 27 Table 28 Table 29 Table 30 Table 31 Table 32 Table 33
[0097] It is to be understood that the present disclosure includes all isomers and mixtures thereof. Where a compound contains a double bond, the substituent may be in the E or Z configuration. Where a compound contains a disubstituted cycloalkyl, the substituent on the cycloalkyl may be in the cis or trans configuration. Furthermore, all tautomers are intended to be included in the present disclosure.
[0098] The compounds of the present disclosure, and pharmaceutically acceptable salts, hydrates, solvates, stereoisomers and prodrugs thereof, may exist as their tautomers (e.g., amides or imino ethers). All such tautomers are encompassed as part of the present disclosure.
[0099] Because the compounds disclosed herein may contain chiral or asymmetric centers, they may exist in different stereoisomers. This disclosure encompasses all stereoisomers of the compounds disclosed herein and mixtures thereof (including racemic mixtures). Furthermore, this disclosure includes all geometric and positional isomers. For example, if a compound disclosed herein contains a double bond or a fused ring, both cis and trans forms and mixtures thereof are included within the scope of this disclosure. Each compound disclosed herein includes any enantiomer that fits the general structure of the disclosed compound. The compounds may be in racemic, enantiomerically pure, or any other stereochemical form. The results of the assay may reflect data collected for racemic, enantiomerically pure, or any other stereochemical form.
[0100] A diastereomer mixture can be separated into individual diastereomers based on their physicochemical differences by methods well known to those skilled in the art, such as chromatography and / or fractional crystallization. Enantiomers are obtained by converting the enantiomer mixture into a diastereomer mixture by reaction with a suitable optically active compound (e.g., a chiral alcohol or chiral auxiliary such as Mosher's reagent), separating the diastereomers, and then converting the separated diastereomers back into the corresponding pure enantiomers (e.g., by hydrolysis). Some of the compounds of this disclosure may also be atropisomers (e.g., substituted biaryls), which are considered part of this disclosure. Enantiomers can also be separated using a chiral HPLC column.
[0101] Furthermore, the compounds of this disclosure may exist in different tautomers, and all such forms are included within the scope of this disclosure. For example, all keto-enol tautomers and imine-enamine tautomers of the compounds are also included within this disclosure.
[0102] All stereoisomers (e.g., geometric isomers, optical isomers, etc.) of the compounds of this disclosure (including salts, solvates, esters, and prodrugs of the compounds, as well as salts, solvates, and esters of the prodrugs) are included within the scope of this disclosure. This includes enantiomers, rotational isomers, atropisomers, and diastereomers that may exist due to chiral carbons on various substituents, or even when chiral carbons are absent, as well as positional isomers (e.g., 4-pyridyl and 3-pyridyl). For example, if the compound of formula (I) contains a double bond or a fused ring, both cis and trans forms, as well as mixtures thereof, are also included within the scope of this disclosure. Also included, for example, all keto-enol tautomers and imine-enamine tautomers of the compounds are also included within this disclosure. Each stereoisomer of the compounds of this disclosure may exist, for example, in a form substantially free of other stereoisomers, or may exist, for example, as a racemate, or in a mixture with all other stereoisomers or other selected stereoisomers. The chiral centers of this disclosure may adopt either the S configuration or the R configuration as defined in the 1974 IUPAC Recommendation.
[0103] The terms "salt," "solvate," "ester," and "prodrug" also apply to salts, solvates, esters, and prodrugs in enantiomers, stereoisomers, rotational isomers, tautomers, positional isomers, racemates, or prodrugs of the compounds of the present invention.
[0104] Compounds of formula I may also form salts, which are also included within the scope of this disclosure. Unless otherwise specified, references to compounds of formulas described herein are understood to include references to their salts.
[0105] This disclosure relates to the compounds described herein, and their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers, as well as pharmaceutical compositions comprising one or more of the compounds described herein, or their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers.
[0106] [Methods for synthesizing compounds] The compounds of this disclosure can be prepared by various methods well known to those skilled in the art of organic synthesis. For example, the compounds of this disclosure can be synthesized by the methods described below, as well as by synthetic methods known in the field of synthetic organic chemistry, or variations thereof recognized to those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules, and the transformation and manipulation of functional groups are described in the relevant scientific literature or standard textbooks in the field. While not limited to one or more specific sources, classic literature such as Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th edition, John Wiley & Sons: New York, 2001; Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), incorporated by reference herein, are useful to those skilled in the art and are well-known references in organic synthesis.
[0107] In the reaction steps and synthetic schemes described herein, the order of certain steps (such as the introduction and removal of protecting groups) may be changed. Those skilled in the art will understand that certain groups may need to be protected with protecting groups under certain reaction conditions. Protecting groups may also be used to distinguish similar functional groups within a molecule. A list of protecting groups and methods for introducing and removing them is provided in Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd edition. John Wiley & Sons. New York, 1999.
[0108] It should be understood that the synthesis methods described herein are permissible for a variety of functional groups, and therefore starting materials with various substituents can be used. In these methods, the desired final compound is usually obtained at the end of the overall process or towards the end, but in some cases it may be desirable to further convert the compound into its pharmaceutically acceptable salt.
[0109] In the synthetic schemes described herein, compounds may be illustrated in specific configurations for convenience. Such specific configurations should not be construed as limiting this disclosure to any particular isomer, tautomer, positional isomer, or stereoisomer, nor should they exclude mixtures of isomers, tautomers, positional isomers, or stereoisomers. However, it should be understood that some particular isomer, tautomer, positional isomer, or stereoisomer may exhibit higher activity than other isomers, tautomers, positional isomers, or stereoisomers.
[0110] The methods include, but are not limited to, those described below. The compounds of this disclosure may be synthesized according to the steps outlined in General Schemes 1 to 3, which include various steps for synthesizing intermediates or compounds. Starting materials are commercially available or prepared by known procedures reported in the literature or by methods illustrated below.
[0111] General Scheme 1
Chemical
Chemical
[0112] As shown in General Scheme 2, the heteroaryl ether having general formula (I) is synthesized using a reaction similar to the series of reactions described in General Scheme 1.
[0113] General Scheme 2
Chemical
[0114] Alternatively, as shown in general scheme 3, the bromofluoro dicyclic skeleton G15 can be used instead of the bromophenol dicyclic skeleton G3, and the reaction can be carried out with the corresponding alcohols (e.g., G14 and G17).
[0115] General Scheme 3 [ka] [ka]
[0116] [Compositions containing the compounds of this disclosure] Another aspect of the present disclosure relates to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleavage factor, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the composition further comprises cells. In some embodiments, the composition further comprises donor DNA. In some embodiments, the composition further comprises cells and donor DNA.
[0117] In some embodiments, the cells are eukaryotic cells. In some embodiments, the cells are useful for adoptive immunotherapy (ACT). In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.
[0118] In some embodiments, the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a sequence encoding structural RNA.
[0119] In some embodiments, the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof.
[0120] In some embodiments, the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes double-stranded or single-stranded DNA breaks. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes single-stranded DNA breaks.
[0121] In some embodiments, the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., Cas9 nuclease from S. pyogenes). In some embodiments, the Cas nuclease is a type V Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., Cas12a nuclease from the genus Acidaminococcus).
[0122] In some embodiments, the composition includes modified RNA.
[0123] In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes a dgRNA. In some embodiments, the dual guide RNA consists of crRNA and tracrRNA. In some embodiments, the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes an sgRNA. In some embodiments, the gRNA is a modified gRNA.
[0124] In some embodiments, the DNA cleavage factor is Cas9 or mRNA encoding Cas9, and a modified gRNA in which one or more of the first five nucleotides at the 5' end are modified. In some embodiments, the cleavage factor is Cas12a or mRNA encoding Cas12a, and a modified gRNA containing a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA is one in which one or more of the last five nucleotides at the 3' end are modified.
[0125] In some embodiments, the DNA cleavage factor is a type II Cas nuclease belonging to class 2 or a type V Cas nuclease belonging to class 2, and a guide RNA nucleic acid, where the molar ratio of the guide RNA to the Cas nuclease is approximately 4:1 to 1:4.
[0126] In some embodiments, the composition further comprises a vector. In some embodiments, the vector encodes donor DNA. In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a nonviral vector. In some embodiments, the vector is a nonviral vector comprising donor DNA having a linear, closed-end, circular, single-stranded, or double-stranded form.
[0127] In some embodiments, the composition further comprises an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase theta (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors, selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiosin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).
[0128] In some embodiments, the concentration of DNA-PKI in the composition is approximately 10 μM or less. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.25 μM to approximately 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.25 μM to approximately 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is approximately 0.1 μM to approximately 0.25 μM.
[0129] [Method of use of the disclosed compound] Another aspect of the present disclosure relates to a method for targeted genome editing in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0130] Another aspect of the present disclosure relates to a method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the double-strand DNA breaks are blunt-end breaks. In some embodiments, the double-strand DNA breaks include paired single-strand breaks (e.g., those resulting from a combination of nickasenucleases).
[0131] Another aspect of the present disclosure relates to a method for inhibiting or suppressing the repair of DNA breaks via the non-homologous end-joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the method further involves contacting cells with a microhomology-mediated end-joining (MMEJ) pathway inhibitor. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase theta (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), Novobiosin (Dana-Farber Cancer Institute, Inc.), Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).
[0132] Another aspect of the present disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
[0133] In some embodiments of the method disclosed herein, the method is characterized by culturing cells in a cell medium that does not contain DNA-PKI, and then adding DNA-PKI to the cell medium.
[0134] In some embodiments of the methods of this disclosure, the method is characterized by contacting cells with a DNA cleavage factor, and then contacting the cells with DNA-PKI. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within approximately 6 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within approximately 3 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with DNA-PKI within 2 hours after contacting the cells with the DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor for approximately 15 to 45 minutes, and then contacting the cells with DNA-PKI. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor for approximately 30 minutes, and then contacting the cells with DNA-PKI.
[0135] In some embodiments, the method is characterized by simultaneously contacting cells with a DNA cleavage factor and DNA-PKI.
[0136] In some embodiments of the method disclosed herein, the method is characterized by culturing cells in a cell medium containing DNA-PKI.
[0137] In some embodiments, the method is characterized by contacting the cells with DNA-PKI, followed by contacting the cells with a DNA cleavage factor. In some embodiments, the method is characterized by contacting the cells with the DNA cleavage factor within approximately 3 hours of contacting the cells with DNA-PKI.
[0138] In some embodiments, contact between cells and DNA cleavage factors involves electroporation of cells to allow the DNA cleavage factors to enter the cells. In some embodiments, contact between cells and DNA cleavage factors involves delivery of DNA cleavage factors to cells by other means (e.g., via microinjection, lipid nanoparticles, liposomes, exosomes, or gold nanoparticles). In some embodiments, the method is characterized by simultaneously contacting the cells with the DNA cleavage factors and donor DNA.
[0139] In some embodiments of the methods of this disclosure, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for at least about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours. In some embodiments, the method is characterized by exposing cells to a DNA cleavage factor and DNA-PKI for about 24 hours.
[0140] In some embodiments of the methods of this disclosure, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 10 μM or less. In some embodiments, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 0.1 μM to approximately 10 μM. In some embodiments, the method is characterized by contacting cells with DNA-PKI in a cell medium, where the concentration of DNA-PKI in the cell medium is approximately 0.25 μM to approximately 5 μM.
[0141] In some embodiments of the methods of this disclosure, the cells are eukaryotic cells. In some embodiments, the cells are useful in adoptive immunotherapy (ACT). In some embodiments, the cells are used in autologous cell therapy. In some embodiments, the cells are used in allogeneic cell therapy. In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.
[0142] In some embodiments of the methods of this disclosure, the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof.
[0143] In some embodiments of the methods of this disclosure, the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes double-stranded or single-stranded DNA breaks. In some embodiments, the CRISPR / Cas nuclease component includes or encodes a CRISPR / Cas nuclease that causes single-stranded DNA breaks.
[0144] In some embodiments of the methods of this disclosure, the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component includes a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., a Cas9 nuclease from S. pyogenes). In some embodiments, the Cas nuclease is a type V Cas nuclease belonging to class 2. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Cas12a nuclease from the genus Acidaminococcus).
[0145] In some embodiments of the method disclosed herein, the method is further characterized by bringing cells into contact with modified RNA.
[0146] In some embodiments of the methods of this disclosure, the method is further characterized by contacting cells with a guide RNA component. In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes a dgRNA. In some embodiments, the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes an sgRNA. In some embodiments, the gRNA is a modified gRNA.
[0147] In some embodiments of the methods of this disclosure, the DNA cleavage factor is Cas9 or a Cas9-encoding mRNA and a modified gRNA in which one or more of the first five nucleotides at the 5' end are modified. In some embodiments, the cleavage factor is Cas12a or a Cas12a-encoding mRNA and a modified gRNA containing a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA is one in which one or more of the last five nucleotides at the 3' end are modified.
[0148] In some embodiments of the method of this disclosure, the DNA cleavage factor is a Cas nuclease belonging to class 2 or class 5, and a guide RNA nucleic acid, wherein the molar ratio of the guide RNA to the Cas nuclease is approximately 4:1 to 1:4.
[0149] In some embodiments of the method of this disclosure, the DNA cleavage factor interacts with a target sequence within the TRAC gene of a T cell.
[0150] In some embodiments of the method disclosed herein, the method is characterized by contacting cells with at least two different DNA cleavage factors that target different gene loci.
[0151] In some embodiments, the method is characterized by contacting cells with a vector encoding a DNA cleavage factor. In some embodiments, the vector encodes a DNA cleavage factor and donor DNA. In some embodiments, the method is characterized by contacting cells with a vector encoding a DNA cleavage factor and a second vector encoding donor DNA.
[0152] In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a nonviral vector. In some embodiments, the vector is a nonviral vector comprising donor DNA having a linear, closed-end, circular, single-stranded, or double-stranded form.
[0153] In some embodiments of the methods of this disclosure, the DNA cleavage factor interacts with a target sequence in the cell's genome to produce a double-strand DNA break (DSB).
[0154] In some embodiments of the methods of the present disclosure, the method further involves contacting cells with donor DNA. In some embodiments, the method involves contacting cells with a vector containing donor DNA. In some embodiments, the vector encodes donor DNA. In some embodiments, the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a sequence encoding structural RNA. In some embodiments, the donor DNA includes a template having a foreign nucleic acid encoding a protein. In some embodiments, the protein is selected from cytokines, immunosuppressants, antibodies, receptors, and enzymes. In some embodiments, the protein is a receptor. In some embodiments, the receptor is selected from immune receptors, T cell receptors (TCRs), and chimeric antigen receptors. In some embodiments, the foreign nucleic acid encodes a chain of the TCR (e.g., TCRα, β, δ, or γ chains, or any combination thereof). In some embodiments, the foreign nucleic acid encodes the TCRα chain and / or TCRβ chain. In some embodiments, the template includes a first homology arm and a second homology arm complementary to sequences located upstream and downstream of the cleavage site, respectively.
[0155] In some embodiments of the methods of this disclosure, gene knockout occurs. In some embodiments of the methods of this disclosure, gene repair occurs. In some embodiments of the methods of this disclosure, gene insertion occurs.
[0156] In some embodiments, the method is further characterized by contacting the cells with a microhomology-mediated end-joining (MMEJ) pathway inhibitor. In some embodiments, the MMEJ pathway inhibitor is DNA polymerase theta (Polθ or POLQ). In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from the group consisting of PolQ inhibitors, which are selected from compounds listed in J. Med. Chem 2023, 66, 6498 by Pismataro, MC et al. and its references (e.g., ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiosin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof).
[0157] Another aspect of this disclosure relates to a compound of formula (I) and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof for use in the manufacture of pharmacotherapy pharmaceuticals.
[0158] Another aspect of this disclosure relates to the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition in the treatment of cells.
[0159] In one embodiment, the subject is a mammal.
[0160] In one embodiment, the mammal in question is a human.
[0161] The disclosed compound may be administered by any method of administration of the therapeutic agent. These methods include systemic or topical administration (e.g., oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal, or topical administration).
[0162] Depending on the method of administration, the compositions disclosed herein may be in solid, semi-solid, or liquid dosage forms (e.g., injections, tablets, suppositories, pills, sustained-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, etc.), and may be in single-dose form, conforming to conventional pharmaceutical practice. Similarly, these may be administered intravenously (both bolus and infusion), intraperitoneally, subcutaneously, or intramuscularly, all of which may be carried out using forms well known to those skilled in the pharmaceutical art.
[0163] Examples of pharmaceutical compositions include tablets and gelatin capsules comprising the compounds of the Disclosure and pharmaceutically acceptable carriers, the carriers being, for example, a) diluents (purified water, triglycerides (e.g., hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof), corn oil, olive oil, sunflower oil, safflower oil, fish oil (e.g., EPA or DHA, or their esters or triglycerides, or mixtures thereof), omega-3 fatty acids or their derivatives, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and / or glycine, etc.); b) lubricants (silica, talc, stearic acid, its magnesium or calcium salt, sodium oleate, sodium stearate, magnesium stearate, etc.); c) binders (such as magnesium aluminum silicate, sodium benzoate, sodium acetate, sodium chloride and / or polyethylene glycol); in the case of tablets, as needed, c) binders (such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, magnesium carbonate, natural sugars (e.g., glucose or β-lactose), corn sweeteners, natural or synthetic thickeners (e.g., gum arabic, tragacanth or sodium alginate), waxes and / or polyvinylpyrrolidone); d) disintegrants (such as starch, agar, methylcellulose, bentonite, xanthan gum, alginic acid or its sodium salt, or effervescent mixtures); e) absorbents, colorants, flavorings, and sweeteners; f) emulsifiers or dispersants (Tween 80, Labrasol, HPMC, DOSS, Caproyl 909, Labrafac, Labrafil, Peceol, Transcutol, Capmul MCM, Capmul PG-12, Captex 355, Gelucire, Vitamin E TGPS, etc.), or other acceptable emulsifiers; and / or g) substances that promote the absorption of the compound (cyclodextrin, hydroxypropyl cyclodextrin, PEG400, PEG200, etc.).
[0164] Liquid compositions for injection, in particular, can be prepared by means of dissolution, dispersion, etc. For example, an isotonic solution or suspension for injection can be formed by dissolving or mixing the disclosed compounds in a pharmaceutically acceptable solvent (e.g., water, physiological saline, dextrose aqueous solution, glycerol, ethanol, etc.). The disclosed compounds can be solubilized using proteins (e.g., albumin, chylomicron particles, or serum proteins).
[0165] The disclosed compounds may be formulated as suppositories that can be prepared from a fatty emulsion or suspension using polyalkylene glycol (e.g., propylene glycol) as a carrier.
[0166] The compounds disclosed herein may also be administered by liposome delivery systems such as small monolayer vesicles, large monolayer vesicles, and multilayer vesicles. Liposomes can be formed from a variety of phospholipids (including cholesterol, stearylamine, or phosphatidylcholine). In some embodiments, as described in U.S. Patent No. 5,262,564 (which is incorporated herein by reference in its entirety), a membrane of lipid components is hydrated with an aqueous solution of the drug to form a lipid layer that encapsulates the drug.
[0167] The disclosed compounds may be delivered using monoclonal antibodies as a specific carrier to which the disclosed compounds are bound. The disclosed compounds can also be bound to soluble polymers as targetable drug carriers. Examples of such polymers include polyvinylpyrrolidone, pyran copolymers, polyhydroxypropyl methacrylamide-phenol, polyhydroxyethyl asparagineamide-phenol, or polyethylene oxide polylysine substituted with palmitoyl residues. Furthermore, the disclosed compounds can be bound to types of biodegradable polymers useful for controlled drug release (e.g., polylactic acid, poly-ε-caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and crosslinkable or amphiphilic block copolymer hydrogels). In some embodiments, the disclosed compounds are not covalently bound to a polymer (e.g., polycarboxylic acid polymers or polyacrylates).
[0168] Parenteral injection preparations are generally administered by subcutaneous, intramuscular, or intravenous injection and infusion. Injectable preparations can be prepared in conventional forms (solutions or suspensions, or solid forms suitable for dissolving in liquid before injection).
[0169] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of formula (I) and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further include excipients, diluents, or surfactants. In some embodiments, the pharmaceutical composition may further include another pharmaceutically active agent.
[0170] In one embodiment, the pharmaceutically acceptable carrier further includes excipients, diluents, surfactants, or any combination thereof.
[0171] In one embodiment, the pharmaceutical composition further includes at least one other therapeutic agent.
[0172] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof for use in cell therapy.
[0173] Each composition may be manufactured according to a conventional mixing, granulation, or coating method, and the pharmaceutical composition may contain about 0.1% to about 99%, about 5% to about 90%, or about 1% to about 20% of the disclosed compound by weight or volume.
[0174] In one embodiment, the composition contains about 1 mg to about 2000 mg of the compound.
[0175] In one embodiment, the composition is administered to the subject twice a day, once a day, once every other day, or once a week.
[0176] [Examples] This disclosure is further illustrated by the following examples and synthesis schemes, which should not be construed as limiting the scope or spirit of this disclosure to the specific procedures described herein. These examples are provided to illustrate specific embodiments and are not intended to limit the scope of this disclosure. Furthermore, it should be understood that various other embodiments, modifications, and equivalents that can be conceived by those skilled in the art may be adopted without departing from the spirit of this disclosure and / or the scope of the appended claims.
[0177] The compounds disclosed herein can be prepared using known chemical reactions and procedures; however, general preparation methods are described below for the reader's reference when synthesizing the compounds. Specific details are provided in the experimental section illustrating the examples.
[0178] All variable groups in these methods are as described in the general description unless otherwise specifically defined below.
[0179] It should be understood that the compounds of the present disclosure having any of the claimed functional groups are not necessarily prepared by any of the methods listed below. Within the scope of each method, any substituents that can function as protecting groups or other non-reaction-participating groups may be present on the reagent or intermediate. These groups are introduced and / or removed in the course of the synthetic scheme to obtain the compounds of the present disclosure using methods well known to those skilled in the art.
[0180] The following are examples and abbreviations used in this specification. [Table 34]
[0181] Analysis method [NMR] The following conditions were used to obtain the proton nuclear magnetic resonance (NMR) spectrum. NMR spectra were measured at either 400 MHz or 500 MHz using a Bruker instrument. DMSO-d6 or CDCl3 were used as the solvent and internal standard. The obtained raw NMR data were analyzed using ADC Labs ACD Spectrus version 2015-01 or MestReNova software. Chemical shifts are expressed in parts per million (ppm) on the downfield side, relative to the internal standard tetramethylsilane (TMS) or the TMS position estimated from the deuterated NMR solvent. Apparent multiplicity is expressed as singlet = s, doublet = d, triplet = t, quartet = q, or multiplet = m. Broad peaks are denoted as br. Integral values are approximate. Note that integral intensity, peak shape, chemical shift, and coupling constants may depend on solvent, concentration, temperature, pH, and other factors. Furthermore, peaks that overlap with or are replaced by water or solvent peaks in the NMR spectrum may not yield reliable integral intensity. In some cases, when obtaining NMR spectra using water peak suppression methods, overlapping peaks may not be observed, or their shape and / or integral values may change.
[0182] [Liquid chromatography] The following preparative and / or analytical (LC / MS) liquid chromatography methods were used.
[0183] Method A: Column: XBridge C18, 2.1 mm x 50 mm; Particle size: 1.7 μm; Mobile phase A: ACN / H2O (5:95, containing 10 mM AA); Mobile phase B: ACN / H2O (95:5, containing 10 mM AA); Temperature: 50°C; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI positive)
[0184] Method B: Column: XBridge C18, 2.1 mm x 50 mm; Particle size: 1.7 μm; Mobile phase A: ACN / H2O (5:95, containing 0.05% TFA); Mobile phase B: ACN / H2O (95:5, containing 0.05% TFA); Temperature: 50°C; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI positive)
[0185] UHPLC Method D: Column: Waters Acquity BEH C18, 2.1 x 50 mm; Particle size: 1.7 μm; Mobile phase A: Acetonitrile:Water (95:5, containing 0.05% TFA); Mobile phase B: Acetonitrile:Water (95:5, containing 0.05% TFA); Temperature: 50°C; Gradient: Elute over 3.00 min from 0%B to 100%B, then elute over 0.50 min at 100%B; Flow rate: 1.0 mL / min; Detection: MS and UV (254 nm)
[0186] UHPLC Method E: Column: Waters Acquity BEH C18 2.1x50mm; Particle size: 1.7μm; Mobile phase A: Acetonitrile:Water (95:5, containing 0.05% TFA); Mobile phase B: Acetonitrile:Water (95:5, containing 0.05% TFA); Temperature: 50℃; Gradient: Elute over 1.5 minutes from 0%B to 100%B, then elute over 0.50 minutes at 100%B; Flow rate: 1.0mL / min; Detection: MS and UV (254nm)
[0187] Column 6 Method: Column: Waters Acquity BEH C18 2.1x50mm; Particle size: 1.7μm; Mobile phase A: Acetonitrile:Water (containing 0.05% TFA) = 95:5; Mobile phase B: Acetonitrile:Water (containing 0.05% TFA) = 95:5; Temperature: 50℃; Gradient: Elute from 0%B to 100%B for 1.00 min, then elute at 100%B for 0.50 min; Flow rate: 1.0 mL / min; Detection: MS and UV (254 nm)
[0188] [Analytical LC / MS method] Method 1: Column: HALC 90A C18, 3.0 x 30 mm; Particle size: 2.0 μm; Mobile phase A: Water (containing 0.1% formic acid); Mobile phase B: Acetonitrile (containing 0.1% formic acid); Temperature: 40°C; Gradient: Elute over 1.0 min from 5% B to 95% B, then elute over 0.40 min at 95% B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0189] Method 2: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm; Particle size: 3.0 μm; Mobile phase A: 5 mM ammonium bicarbonate aqueous solution; Mobile phase B: Acetonitrile; Temperature: 40°C; Gradient: Elute over 1.0 min at 10% B to 95% B, then elute over 0.40 min at 95% B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0190] Method 3: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm; Particle size: 3.0 μm; Mobile phase A: 5 mM ammonium bicarbonate aqueous solution; Mobile phase B: Acetonitrile; Temperature: 40°C; Gradient: Elute from 10%B to 60%B for 1.7 minutes, then from 60%B to 95%B for 0.6 minutes, followed by elution at 95%B for 0.50 minutes; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0191] Method 4: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm; Particle size: 3.0 μm; Mobile phase A: 5 mM ammonium bicarbonate aqueous solution; Mobile phase B: Acetonitrile; Temperature: 40°C; Gradient: Elute over 1.7 minutes from 30%B to 70%B, then over 0.6 minutes from 70%B to 95%B, followed by elution over 0.50 minutes at 95%B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0192] Method 5: Column: HALC 90A C18, 3.0 x 30 mm; Particle size: 2.0 μm; Mobile phase A: Water (containing 0.1% formic acid); Mobile phase B: Acetonitrile (containing 0.1% formic acid); Temperature: 40°C; Gradient: Elute over 1.7 minutes from 20%B to 60%B, then over 0.6 minutes from 60%B to 100%B, followed by elution over 0.50 minutes at 100%B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0193] Method 6: Column: HALC 90A C18, 3.0 x 30 mm; Particle size: 2.0 μm; Mobile phase A: Water (containing 0.1% formic acid); Mobile phase B: Acetonitrile (containing 0.1% formic acid); Temperature: 40°C; Gradient: Elute over 1.2 minutes from 5% B to 100% B, then elute over 0.60 minutes at 100% B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0194] Method 7: Column: HALC 90A C18, 3.0 x 33 mm; Particle size: 2.0 μm; Mobile phase A: Water (containing 0.05% TFA); Mobile phase B: Acetonitrile (containing 0.05% TFA); Temperature: 40°C; Gradient: Elute from 5% B to 100% B for 1.1 minutes, then elute with 100% B for 0.30 minutes; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0195] Method 8: Column: HALC 90A C18, 3.0 x 30 mm; Particle size: 2.0 μm; Mobile phase A: Water (containing 0.05% TFA); Mobile phase B: Acetonitrile (containing 0.05% TFA); Temperature: 40°C; Gradient: Elute over 1.2 minutes from 5% B to 100% B, then elute over 0.60 minutes at 100% B; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm)
[0196] Example 1. 6-(morpholine-4-yl)-4-{[(1s,4s)-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 1) [ka]
[0197] Step 1. Synthesis of tert-butyl(cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate [ka] Trans-4-((tert-butoxycarbonyl)amino)cyclohexyl methanesulfonate (1048 mg, 3.57 mmol) and 6-bromo-4-hydroxypyrazolo[1,5-a]pyridine-3-carbonitrile (850 mg, 3.57 mmol) were stirred in 15 mL of dioxane at room temperature. Cs2CO3 (2443 mg, 7.50 mmol) was added, the container was sealed, and the mixture was heated at 105°C for 20 hours. The reaction was confirmed by LC-MS to have a conversion rate of 50%, so trans-4-((tert-butoxycarbonyl)amino)cyclohexyl methanesulfonate (1048 mg, 3.57 mmol) was added, and the mixture was stirred at 105°C for 24 hours. After cooling, the reaction mixture was filtered through Celite and washed with ethyl acetate. The filtrate was concentrated, the resulting residue was purified with ISCO (hex / ethyl), and after vacuum drying, tert-butyl(cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (900 mg, 57.9% yield) was obtained as a grayish-white foam. 1 H NMR (400MHz, chloroform-d) δ 8.33(d, J=1.2Hz, 1H), 8.15(s, 1H), 6.77(s, 1H), 4.78-4.59(m, 2H), 3.67-3.41(m, 1H), 3.02(s, 1H), 2.22-2.09(m, 2H), 1.91-1.72(m, 4H), 1.45(s, 9H), 1.38-1.19(m, 2H); Analysis LCMS ESI m / z 336.7 [M-COOtBu] + , RT=2.14 min (UHPLC method D)
[0198] Step 2. Synthesis of tert-butyl(cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate [ka] A mixture of tert-butyl(cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (130 mg, 0.299 mmol), morpholine (39.0 mg, 0.448 mmol), BINAP (37.2 mg, 0.060 mmol), Pd2(dba)3 (27.3 mg, 0.030 mmol), and Cs2CO3 (243 mg, 0.747 mmol) / toluene (2 mL) was purged with nitrogen for 10 minutes, sealed, and stirred at 100°C for 24 hours. The reaction mixture was cooled, filtered through Celite, and washed with ethyl acetate. The filtrates were combined and concentrated, and the resulting residue was purified with ISCO (hexane / ethylacetate) to obtain tert-butyl(cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (70 mg, 0.159 mmol, 53.1% yield) as a light brown film. LCMS ESI m / z 464.0 [M+Na] + ; RT=1.24 min (UHPLC method E)
[0199] Step 3. Synthesis of 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carbonitrile [ka] tert-butyl(cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (70 mg, 0.159 mmol) was stirred at room temperature for 30 minutes in a mixed solvent of DCM (2 mL) and TFA (1 mL). The mixture was concentrated, azeotropically dissolved with DCM (3x), and vacuum-dried to obtain 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carbonitrile (62 mg, 0.136 mmol, 86% yield) as the TFA salt. This was used directly in the next step. 1¹H NMR (500MHz, DMSO-d6) δ 8.43(s, 1H), 7.93(s, 1H), 7.85 (br s, 3H), 7.22(s, 1H), 7.05-7.01(m, 1H), 7.07-6.95(m, 1H), 4.90 (br s, 1H), 3.82-3.73(m, 4H, overlapping with H2O peak), 3.43-3.37(m, 1H), 3.15-3.10(m, 4H), 2.15-2.07(m, 2H), 1.82-1.70(m, 6H); LCMS ESI m / z 342.0 [M+H] + ; RT=0.85 min (UHPLC method E)
[0200] Step 4. Synthesis of 6-(morpholine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile [ka] 2-chloro-4-methylpyrimidine (16.94 mg, 0.132 mmol) and 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carbonitrile (30 mg, 0.088 mmol) were added to 1,4-dioxane (1 mL), the solution was bubbling with nitrogen for 5 minutes, Rockphos G3 (8 mg) followed by sodium tert-butoxide (25.3 mg, 0.264 mmol), and the mixture was bubbling with nitrogen for 3 minutes. The mixture was then sealed and heated at 70°C for 3 hours. LC-MS showed a target product:starting material ratio of 2:1. The reaction was further stirred at room temperature for 72 hours, the resulting reaction mixture was concentrated, the residue was dissolved in MeOH and filtered for purification. 1¹H NMR (500MHz, DMSO-d6) δ 8.43 (s, 1H), 8.24-8.20 (m, 1H), 7.93 (s, 1H), 7.08 (s, 1H), 6.62 (br d, J=4.1Hz, 1H), 4.96 (br s, 1H), 3.90 (s, 1H), 3.76 (m, 3H, overlapping with H2O), 3.18-3.10 (m, 4H), 2.33 (br s, 3H), 2.10-2.02 (m, 2H), 1.85-1.71 (m, 7H); Analysis LCMS ESI m / z 434.2 [M+H] + ; RT=1.66 min, 99.4% (Method A); 434.1 [M+H] + , RT=1.34 min, 100% (Method B)
[0201] Examples 2 to 6 below were manufactured using the same procedure as in Example 1, but in step 4, instead of heating at 70°C for 3 hours, they were heated at 100°C for 16 to 24 hours.
[0202] Example 2. N-methyl-2-{[cis-4-{[3-cyano-6-(morpholine-4-yl)pyrazolo[1,5-a]pyridine-4-yl]oxy}cyclohexyl]amino}pyrimidine-4-carboxamide (Compound 2) [ka]
[0203] Example 3. 6-(morpholine-4-yl)-4-{[cis-4-[(6-methoxypyridazine-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 3) [ka]
[0204] Example 4. 6-(morpholine-4-yl)-4-{[cis-4-[(5-methoxypyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 4) [ka]
[0205] Example 5. 6-(morpholine-4-yl)-4-{[cis-4-[(2-methylpyrimidine-4-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 5) [ka]
[0206] Example 6. 6-(morpholine-4-yl)-4-{[cis-4-[(6-methylpyridazine-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 6) [ka]
[0207] Example 7. 6-(morpholine-4-yl)-4-{[cis-4-[(pyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 7) [ka] 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carbonitrile (6 mg, 0.018 mmol) and 2-chloropyrimidine (6.04 mg, 0.053 mmol) were stirred in 2-propanol (0.3 mL), DIEA (0.015 mL, 0.088 mmol) was added, and the mixture was stirred at 100-105°C for 16 hours. The reaction mixture was cooled and concentrated, dissolved in MeOH, filtered, and purified by reverse-phase HPLC to obtain the title compound (2 mg, 25.7%).
[0208] Example 8. tert-butyl N-[cis-4-{[3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridine-4-yl]oxy}cyclohexyl]carbamate (compound 8) [ka] tert-butyl(cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (300 mg, 0.689 mmol) and 2-(3,6-dihydro-2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (232 mg, 1.103 mmol) were dissolved in 1,4-dioxane (3 mL), and the solution was bubbling with nitrogen. Na2CO3 (1.034 mL, 2.067 mmol), followed by Pd(dppf)Cl2 (60 mg), was added, and the mixture was bubbling with nitrogen for 3 minutes. The vial was sealed and stirred at 100-105°C for 2 hours. After cooling to room temperature, the resulting reaction mixture was filtered and washed with ethyl acetate. The filtrate was concentrated and purified by silica gel chromatography (hexane / Â) to obtain tert-butyl(cis-4-((3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate (280 mg, 0.638 mmol, 93% yield).
[0209] Example 9. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-aminocyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 9) [ka] 200 mg, 0.456 mmol of tert-butyl(cis-4-((3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridine-4-yl)oxy)cyclohexyl)carbamate was stirred at room temperature for 30 minutes in a mixed solution of DCM (2 mL) and TFA (1 mL). The resulting mixture was concentrated, azeotropically removed with DCM (3x), and vacuum-dried to obtain 4-((cis-4-aminocyclohexyl)oxy)-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridine-3-carbonitrile (150 mg, 97% yield) as the TFA salt. This was used directly in the next step.
[0210] Example 10. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(pyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 10) [ka] Example 10 was prepared using the same procedure as in Example 2 (7.4 mg, 45.0% yield).
[0211] Examples 11-16 were manufactured starting from Example 9 and following the same procedure as Example 1.
[0212] Example 11. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(2-methylpyrimidine-4-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 11) [ka]
[0213] Example 12. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(6-methylpyridazine-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 12) [ka]
[0214] Example 13. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(5-methoxypyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 13) [ka]
[0215] Example 14. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(6-methoxypyridazine-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 14) [ka] Example 15. N-methyl-2-{[cis-4-{[3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridine-4-yl]oxy}cyclohexyl]amino}pyrimidine-4-carboxamide (Compound 15) [ka] Example 16. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 16) [ka]
[0216] Example 17. 6-(pyridine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 17) [ka]
[0217] Step 1. 6-Bromo-4-((cis-4-((4-methylpyrimidine-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile [ka] Following the same procedure as in Step 1 of Example 1, the reaction of trans-4-((4-methylpyrimidine-2-yl)amino)cyclohexyl methanesulfonate (240 mg, 0.840 mmol), 6-bromo-4-hydroxypyrazolo[1,5-a]pyridine-3-carbonitrile (200 mg, 0.840 mmol), and Cs2CO3 (575 mg, 1.764 mmol) / dioxane (4 mL) was vacuum-dried to obtain the title compound (230 mg, 0.538 mmol, 64.1% yield) as a colorless film. 1 H NMR (400MHz, chloroform-d) δ 8.31(d, J=0.9Hz, 1H), 8.14-8.07(m, 2H), 6.74(s, 1H), 6.34(d, J=5.0Hz, 1H), 5.21(br d, J=8.5Hz, 1H), 4.74(br LCMS ESI m / z 426.8, 428.8 [M+H] + ; RT=1.45 min (UHPLC method D)
[0218] Step 2. 6-(pyridine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile The title compound was obtained using the same procedure as in Example 8 (9 mg, 90% yield).
[0219] Example 18. 6-{8-oxa-3-azabicyclo[3.2.1]octan-3-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 18) [ka] Nitrogen was bubbling for 5 minutes in a solution of 6-bromo-4-((cis-4-((4-methylpyrimidine-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (30 mg, 0.070 mmol) and 8-oxa-3-azabicyclo[3.2.1]octane (23.83 mg, 0.211 mmol) / 1,4-dioxane (1 mL), followed by Ruphos (10 mg), then Ruphos-G3 (16 mg), and then Cs2CO3 (160 mg, 0.491 mmol). The reaction mixture was bubbling with nitrogen for 1 minute, sealed, and stirred at 100°C for 3 hours. This was concentrated, dissolved in MeOH, filtered, and purified by reverse-phase HPLC to obtain the title compound (13.3 mg, 40.6% yield).
[0220] Examples 19 and 20 were obtained by following the procedure of Example 18.
[0221] Example 19. 6-(2-methylmorpholine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 19) [ka]
[0222] Example 20. 6-[(2R)-2-methylmorpholine-4-yl]-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 20) [ka]
[0223] Example 21. 6-{3-oxabicyclo[4.1.0]heptan-6-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 21) [ka] 2-(3-oxabicyclo[4.1.0]heptan-6-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (8.39 mg, 0.037 mmol) and 6-bromo-4-(((1s,4s)-4-((4-methylpyrimidine-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (16 mg, 0.037 mmol) were dissolved in 1,4-dioxane (1 mL) and H2O (0.1 mL), and the solution was bubbled with nitrogen. [1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium (5.48 mg, 7.49 μmol), followed by tripotassium phosphate (39.7 mg, 0.187 mmol), were added, the mixture was bubbling with nitrogen for 3 minutes, the vial was sealed and stirred at 80-85°C for 2 hours, then stirred at 100°C for 30 minutes. After cooling to room temperature, the resulting reaction mixture was concentrated, dissolved in MeOH, filtered, and purified to obtain the title compound (1 mg, 6% yield).
[0224] Example 22. 6-{3-oxabicyclo[4.1.0]heptan-6-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 22) [ka]
[0225] Step 1. Synthesis of 4-(8-fluoro-[1,2,4]triazolo[1,5-a]pyridine-6-yl)morpholine [ka] Cesium carbonate (977 mg, 3.0 mmol) was added to 6-bromo-8-fluoro-[1,2,4]triazolo[1,5-a]pyridine (216 mg, 1.0 mmol) and morpholine (0.13 mL, 1.5 mmol) / 1,4-dioxane (4 mL). Brettphos precat G3 (84 mg, 0.1 mmol) was added, and the suspension was vigorously stirred at 100°C for 16 hours. The mixture was cooled to room temperature, filtered, and the resulting solid was washed with 10% MeOH / DCM. The crude product was purified by MPLC to obtain the desired product as a yellow solid (115 mg, 51.7% yield). 1 LCMS ESI m / z 223.1 [M+H] + RT=0.85 min (Column method 6)
[0226] Step 2. Synthesis of tert-butyl(cis-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridine-8-yl)oxy)cyclohexyl)carbamate [ka] A mixture of 4-(8-fluoro-[1,2,4]triazolo[1,5-a]pyridine-6-yl)morpholine (56 mg, 0.25 mmol) and tert-butyl(cis-4-hydroxycyclohexyl)carbamate (56 mg, 0.275 mmol) / THF (2.0 mL) was mixed with NaHMDS (THF solution, 0.55 mL, 0.55 mmol) at 0°C. This suspension was heated to 22°C and stirred at the same temperature for 1 hour. The reaction was quenched with water and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined and concentrated, purified by MPLC, and the desired product was obtained as an oil. LCMS ESI m / z 418.5 [M+H] + RT=1.55 min (Column method 6)
[0227] Step 3. Synthesis of cis-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridine-8-yl)oxy)cyclohexane-1-amine To a solution of tert-butyl((1s,4s)-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridine-8-yl)oxy)cyclohexyl)carbamate (104 mg, 0.25 mmol) / DCM (1 mL), TFA (0.5 mL) was added and the mixture was stirred at room temperature for 1 hour. This mixture was concentrated, and the product was obtained as an oil. This was used directly in the next step. LCMS ESI m / z 318.3 [M+H] + RT=0.87 min (Column method 6)
[0228] Step 4. Following the same procedure as in Step 4 of Example 1, the sample was purified by reverse-phase HPLC to obtain Example 22 (3.6 mg, yield %).
[0229] Examples 23 and 24 were manufactured following the same procedure as in Example 22.
[0230] Example 23. 6-{3-oxabicyclo[4.1.0]heptan-6-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 23) [ka]
[0231] Example 24. 6-{3-oxabicyclo[4.1.0]heptan-6-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 24) [ka]
[0232] [Table 35] [Table 36] [Table 37] [Table 38]
[0233] Example 25. 6-(morpholine-4-yl)-4-{[cis-4-(pyrimidine-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 25) [ka] General reaction scheme for synthesizing Example 25 [ka]
[0234] Step 1. Preparation of trans-4-((tert-butyldimethylsilyl)oxy)cyclohexane-1-ol [ka] To a solution of trans-1,4-cyclohexanediol (2 g, 17.22 mmol) / DCM (40 mL), imidazole (3.52 g, 51.65 mmol) and tert-butylchlorodimethylsilane (2.85 g, 18.94 mmol) were added at 0°C. The mixture was allowed to return to room temperature and stirred for 22 hours. The reaction was monitored by TLC. The resulting mixture was quenched with water (40 mL), and the product was extracted with DCM (3 x 40 mL). The organic layers were washed together with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (elution solvent: PE / siRNA(4 / 1)) to obtain trans-4-((tert-butyldimethylsilyl)oxy)cyclohexane-1-ol (1.42 g, 35.8% yield) as an off-white solid.
[0235] Step 2. Preparation of 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine [ka] To a solution of trans-4-[tert-butyl(dimethyl)silyl]oxycyclohexanol (500 mg, 2.17 mmol) in dry DMF (10 mL), NaH (183 mg, 4.56 mmol, 60%, dispersed in mineral oil) was added at 0°C and the mixture was stirred for 30 minutes. To this mixture, 2-chloropyrimidine (323 mg, 2.82 mmol) was added at 0°C and the mixture was stirred for 24 hours after returning to room temperature. The reaction was monitored by LC-MS. After the reaction was complete, the mixture was quenched with cold water (30 mL) and the product was extracted with RINKAN (3 x 30 mL). The organic layers were washed together in brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by reverse-phase flash chromatography (conditions: column: C18 silica gel; mobile phase A: water (0.05% TFA), mobile phase B: ACN; flow rate: 50 mL / min; gradient: elution of 90%B to 95%B in 2 minutes; wavelength: 254 / 220 nm). The fractions were combined and concentrated under reduced pressure to obtain 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine (440 mg, 51.2% yield) as a colorless oil. Analytical LC / MS (Method 1): Observed mass: 309.15; RT=1.104 min
[0236] Step 3. Production of trans-4-(pyrimidine-2-yloxy)cyclohexane-1-ol [ka] 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine (420 mg, 1.36 mmol) / THF (5 mL) and methanol (1 mL) were mixed with Et3N·3HF (570 mg, 3.54 mmol) and stirred at room temperature for 24 hours. The reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was cooled to 0°C in an ice bath and ammonium water (382 mg, 28% w / w, 3.27 mmol) was added, followed by water (30 mL). The product was extracted with RINKAN (3 x 30 mL), the organic layers were washed together with brine, and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (eluent: 65% PE / RINKAN) to obtain trans-4-pyrimidine-2-yloxycyclohexanol (240 mg, 90% yield) as a colorless oil. Analytical LC / MS: Purity (Method 2): 99.2%; Observed mass: 195.20; RT=0.460 min
[0237] Step 4. Production of trans-4-(pyrimidine-2-yloxy)cyclohexyl methanesulfonate [ka] To a solution of trans-4-pyrimidine-2-yloxycyclohexanol (210 mg, 1.08 mmol) / DCM (2.5 mL), Et3N (328 mg, 3.24 mmol) and MsCl (0.1 mL, 1.35 mmol) in DCM (0.5 mL) were added dropwise at 0°C and the mixture was stirred at room temperature for 1 hour. The reaction was monitored by LC-MS. After the reaction was complete, saturated sodium bicarbonate aqueous solution (15 mL) was added to quench the mixture. The product was extracted with dichloromethane (3 x 30 mL), and the organic layers were dried together over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (elution solvent: PE / siRNA (1 / 1)) to obtain trans-4-(pyrimidine-2-yloxy)cyclohexyl methanesulfonic acid (245 mg, 80.2% yield) as a white solid. 1H NMR(400MHz, CDCl3) δ 8.53(d, J=4.8Hz, 2H), 6.95(t, J=4.8Hz, 1H), 5.24-5.12(m, 1H), 4.95-4.84(m, 1H), 3.06(s, 3H), 2.29-2.11(m, 4H), 1.94-1.79(m, 4H); Analytical LC / MS (Method 2): Purity: 96.4%; Observed mass: 272.95; RT=0.727 min
[0238] Step 5. Preparation of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile [ka] To a solution of trans-4-(pyrimidine-2-yloxy)cyclohexyl methanesulfonate (225 mg, 0.83 mmol) / 1,4-dioxane (1.5 mL) and DMF (1.5 mL), Cs2CO3 (539 mg, 1.65 mmol) and 6-bromo-4-hydroxy-pyrazolo[1,5-a]pyridine-3-carbonitrile (256 mg, 1.07 mmol) were added, and the mixture was stirred at 100°C for 5 hours. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the mixture was diluted with water (40 mL), and the aqueous layer was extracted with ELISA (3 x 40 mL). The organic layers were washed together with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (elution solvent: PE / siRNA(1 / 1)) to obtain 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (210 mg, 48.4% yield) as a yellow solid. Analytical LC / MS (Method 1): Observed mass: 414.20 / 416.20; RT=0.793 min
[0239] Step 6. Preparation of 6-Molfolino-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile [ka] To a solution of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (80 mg, 0.19 mmol) / 1,4-dioxane (2 mL), morpholine (34 mg, 0.39 mmol), Cs2CO3 (188 mg, 0.58 mmol), Ruphos Pd G3 (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. The solution was degassed three times with nitrogen and stirred at 90°C for 4 hours under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was diluted with water (20 mL) and extracted with RINKAN (3 x 20 mL). The organic layers were washed together with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The obtained residue was purified by preparative TLC (100% EA) to obtain the crude product. The obtained crude product was further purified by preparative HPLC (conditions: column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: NH4HCO3 water (10 mmol / L), mobile phase B: ACN; flow rate: 60 mL / min; gradient: elution of 27%B to 57%B over 7 minutes; wavelength: 254 nm / 220 nm; elution time 1 (min): 6.8). The pure fractions were combined and concentrated under reduced pressure to remove the organic solvent. The aqueous solution of the residue was freeze-dried to obtain the title compound (29.4 mg, 36% yield) as a white solid. 1 H NMR (400MHz, DMSO-d6) δ 8.60(d, J=4.8Hz, 2H), 8.43(s, 1H), 7.92(s, 1H), 7.10(t, J=4.8Hz, 2H), 5.17-5.03(m, 1H), 4.99-4.89(m, Analytical LC / MS (Method 3): Purity: 99.6%; Observed mass: 421.30; RT=1.573 min
[0240] Example 26. 6-{6-oxa-3-azabicyclo[3.1.1]heptan-3-yl}-4-{[cis-4-(pyrimidine-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 26) [ka] To a solution of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (80 mg, 0.19 mmol) / 1,4-dioxane (10 mL), 6-oxa-3-azabicyclo[3.1.1]heptane, 4-methylbenzenesulfonic acid (157 mg, 0.58 mmol), Cs2CO3 (315 mg, 0.97 mmol), Ruphos Pd G3 (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. The solution was degassed three times with nitrogen and stirred overnight at 90°C under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was diluted with water (40 mL) and the product was extracted with ELISA (3 x 40 mL). The organic layers were washed together with saline solution and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to obtain the crude product. The crude product was further purified by preparative HPLC (conditions: column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: NH4HCO3 water (10 mmol / L), mobile phase B: ACN; flow rate: 60 mL / min; gradient: elution of 26%B to 56%B over 7 minutes; wavelength: 254 nm / 220 nm; elution time 1 (min): 6.1). The pure fractions were combined and concentrated under reduced pressure to remove the organic solvent. The aqueous solution of the residue was freeze-dried to obtain the title compound (15.6 mg, 18.6% yield) as an off-white solid. 1H NMR (400MHz, DMSO-d6) δ 8.60(d, J=4.8Hz, 2H), 8.37(s, 1H), 7.82(s, 1H), 7.11(t, J=4.8Hz, 1H), 6.90(s, 1H), 5.18-5.05(m, 1H), 5.02-4.89(m, 1H), 4.72(d, J=6.0Hz, 2H), 3.64(d, J=11.2Hz, 2H), 3.44(d, J=11.2Hz, 2H), 3.20-3.08(m, 1H), 2.14-2.04(m, 2H), 2.04-1.81(m, 7H); Analytical LC / MS (Method 3): Purity: 99.8%; Observed mass: 433.35; RT=1.520 min
[0241] Example 27. 6-{8-oxa-3-azabicyclo[3.2.1]octan-3-yl}-4-{[cis-4-(pyrimidine-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 27) [ka] To a solution of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (80 mg, 0.19 mmol) / 1,4-dioxane (4 mL), 8-oxa-3-azabicyclo[3.2.1]octane hydrochloride (64 mg, 0.43 mmol), Cs2CO3 (252 mg, 0.77 mmol), Ruphos Pd G3 (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. This solution was degassed three times with nitrogen and stirred overnight at 90°C under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was diluted with water (40 mL) and extracted with RINKAN (3 x 40 mL). The organic layers were washed together with saline solution and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by preparative TLC (dichloromethane / MeOH = 18 / 1) to obtain the crude product. The crude product was further purified by preparative HPLC (conditions: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: NH4HCO3 water (10 mmol / L), mobile phase B: ACN; flow rate: 60 mL / min; gradient: elution of 31%B to 61%B over 10 minutes; wavelength: 254 nm / 220 nm; elution time 1 (min): 7.9). The pure fractions were combined and concentrated under reduced pressure to remove the organic solvent. The aqueous solution of the residue was freeze-dried to obtain the title compound (9.5 mg, 11.0% yield) as a white solid. 1 H NMR (400MHz, DMSO-d6) δ 8.60(d, J=4.8Hz, 2H), 8.40(s, 1H), 7.81(s, 1H), 7.11(t, J=4.8Hz, 1H), 7.05(s, 1H), 5.17-5.04(m, 1H), 4.99-4.89(m, 1H), 4.43(s, 2H), 3.43(d, J=10.8Hz, 2H), 2.83(d, J=11.2Hz, 2H), 2.12-1.77(m, 12H); Analytical LC / MS (Method 4): Purity: 99.9%; Observed mass: 447.25; RT=1.160 minutes
[0242] Example 28. 6-(2-methylmorpholine-4-yl)-4-{[cis-4-(pyrimidine-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 28) [ka] To a solution of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (80 mg, 0.19 mmol) / 1,4-dioxane (2 mL), 2-methylmorpholine (39 mg, 0.39 mmol), Cs2CO3 (189 mg, 0.58 mmol), Ruphos Pd G3 (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. This solution was degassed three times with nitrogen and stirred at 90°C for 5 hours under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was diluted with water (20 mL), and the product was extracted with RINKAN (3 x 20 mL). The organic layers were washed together with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to obtain the crude product. The obtained crude product was further purified by preparative HPLC (conditions: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH4HCO3), mobile phase B: ACN; flow rate: 60 mL / min; gradient: elution of 31%B to 61%B over 10 minutes; wavelength: 254 nm / 220 nm; elution time 1 (min): 7.95). The pure fractions were combined and concentrated under reduced pressure to remove the organic solvent. The aqueous solution of the residue was freeze-dried to obtain the title compound (18.8 mg, 22.4% yield) as a white solid. 1H NMR (400MHz, DMSO-d6) δ 8.60(d, J=4.8Hz, 2H), 8.43(s, 1H), 7.92(s, 1H), 7.11(t, J=4.8Hz, 2H), 5.17-5.05(m, 1H), 4.99-4.90(m, 1H), 3.97-3.87(m, 1H), 3.75-3.57(m, 3H), 3.51(d, J=11.6Hz, 1H), 2.74-2.61(m, 1H), 2.35(t, J=11.2Hz, 1H), 2.12-1.78(m, 8H), 1.16(d, J=6.2Hz, 3H); Analytical LC / MS (Method 4): Purity: 99.8%; Observed mass: 435.35; RT=1.173 min
[0243] Example 29. 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-(pyrimidine-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 29) [ka] To a solution of 6-bromo-4-((cis-4-(pyrimidine-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carbonitrile (60 mg, 0.14 mmol) / 1,4-dioxane (1 mL) and water (0.2 mL), 2-(3,6-dihydro-2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (40 mg, 0.19 mmol), Na2CO3 (15 mg, 0.14 mmol), and Pd(dppf)Cl2·CH2Cl2 (12 mg, 0.01 mmol) were added. This solution was degassed three times with nitrogen and stirred at 90°C for 4 hours under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LC-MS. After the reaction was complete, the resulting mixture was diluted with water (20 mL), and the product was extracted with Depositphotos (3 x 20 mL). The organic layers were washed together with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to obtain the crude product. The obtained crude product was further purified by preparative HPLC (conditions: column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: NH₄HCO₃ water (10 mmol / L), mobile phase B: ACN; flow rate: 60 mL / min; gradient: elution of 31%B~61%B over 10 minutes; wavelength: 254 nm / 220 nm; elution time 1 (min): 8.5). The pure fractions were combined and concentrated under reduced pressure to remove the organic solvent. The aqueous solution of the residue was freeze-dried to obtain the title compound (33.6 mg, 55.4% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ 8.60(d, J=4.8Hz, 2H), 8.57(s, 1H), 8.48(s, 1H), 7.28(s, 1H), 7.11(t, J=4.8Hz, 1H), 6.57(s, 1H), 5.19-5.07(m, 1H), 5.06-4.97(m, 1H), 4.28(d, J=2.4Hz, 2H), 3.84(t, J=5.6Hz, 2H), 2.57-2.51(m, 2H), 2.17-1.74(m, 8H); Analytical LC / MS (Method 4): Purity: 99.7%; Observed mass: 418.30; RT=1.147 minutes
[0244] Examples 30-33 were manufactured according to the same procedure as in Examples 25-29.
[0245] Example 30. 6-(2-methylmorpholine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 30) TIFF2026530609000110.tif5040
[0246] Example 31. 6-{8-oxa-3-azabicyclo[3.2.1]octan-3-yl}-4-{[cis-4-[(4-methylpyrimidine-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (Compound 31) TIFF2026530609000111.tif5040
[0247] Example 32.6 6-(morpholine-4-yl)-4-{[cis-4-[(4-methylpyrimidine-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 32) [ka]
[0248] Example 33. 6-(morpholine-4-yl)-4-{[cis-4-[(5-methoxypyrimidine-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carbonitrile (compound 33) [ka]
[0249] [Table 39]
[0250] Biological examples [DNA-PK biochemical assay using Reaction Biology's HotSpot kinase assay protocol] Basic reaction buffer: 20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.01% Brij35, 0.02 mg / mL BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO (cofactors required for each kinase reaction were added separately). Reaction procedure: 1. Prepare the substrate using the newly prepared reaction buffer. 2. Add any necessary cofactors to the substrate solution. 3. Add the kinase to the substrate solution and mix gently. 4. Using acoustic technology (Echo550, nL scale), the compound / 100% DMSO was added to the kinase reaction mixture and incubated at room temperature for 20 minutes. 5. Add 33P-ATP to the above mixture and start the reaction. 6. Incubate at room temperature for 2 hours. 7. Detection of kinase activity by P81 filter binding method
[0251] Various compounds were evaluated using DNA-PK biochemical assays. [Table 40] [Table 41] [Table 42]
[0252] [T-cell cytotoxicity assay: CD3 Glo proliferation assay] Frozen CD3 T cell vials were lysed in assay medium (RPMI 1640, 5% HI FBS, 1x L / G, 1x NEAA, 1x sodium pyruvate, 1x P / S (Gibco, Waltham MA)), and the number of viable cells was counted using a cell counter Moxi V (Orflo, Ketchum ID). The lysed T cells were collected by centrifugation at 1600 rpm for 10 minutes at room temperature, and the T cell pellet was resuspended in assay medium (10 mL) in a conical tube (50 mL) and incubated in a 37°C incubator for 1 hour. The T cell suspension was removed from the 37°C incubator and diluted to 5e5 cells / mL. The T cells were then subjected to the method described in WO 2018 / 197949 (Poltorak et al., Scientific Reports). The cells were stimulated at 37°C for 24 hours with an anti-CD3 / anti-CD28 stimulating reagent (4 μg per 1 million T cells) prepared using an oligomeric streptavidin mutation reagent manufactured in (see also 2020). The following day, the compounds were subjected to 10 sequential 3-fold dilutions in 100% DMSO, with a maximum concentration of 3 mM. After all compounds were diluted in Echo-compatible 384-well plates (Beckman, Indianapolis IN), 200 nL of the dilutions were dispensed using an ECHO 650 acoustic dispenser (Beckman, Indianapolis IN) into 384-well tissue culture-treated plates (Catalog #353988, Corning, Tewksbury). The cells were transferred to MA. To neutralize the activation of T cells by the anti-CD3 / anti-CD28 stimulating reagent, 50 mM D-biotin was added to cultured T cells activated with the anti-CD3 / anti-CD28 stimulating reagent in a 1:50 ratio, and incubated at 37°C for 10 minutes. 40 μL of neutralized cultured T cells or assay medium control was dispensed per well into an assay plate (Corning) pre-dispensed with 200 nL of DMSO solution of the compound, using a Multidrop dispenser (ThermoFisher, Waltham MA). After incubating the plate for 3 days, 10 μL of CellTiter-Glo reagent (Promega, Madison WI) was added per well, and incubated at room temperature for 10 minutes.Next, measurements were taken using an Envision plate reader (Perkin-Elmer, Waltham MA). The concentration at which the CellTiter-Glo signal decreased by 50% compared to wells containing DMSO alone (CC) was measured. 50 The value was calculated using the four-dimensional parameterized logistic equation.
[0253] [T cell culture medium and lysis] CD4 + and CD8 + T cells were isolated from healthy donor T cells, and CD4 and CD8 T cells were mixed in a 1:1 ratio in serum-free T cell medium (TCM) containing recombinant cytokines (100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15).
[0254] [Activation of T cells] To stimulate T cells, an anti-CD3 / anti-CD28 stimulating reagent was prepared using an oligomeric streptavidin mutant reagent manufactured by the method described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). This oligomeric streptavidin mutant reagent has an average hydrodynamic radius of 90-120 nm and contains an average of 2000-2800 tetramers of the streptavidin mutant (Strep-Tactin® m2, SEQ ID NO: 6). The oligomeric streptavidin mutation reagent was prepared at room temperature by mixing the following components: (i) an anti-CD3 Fab fragment with a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) ligated to the carboxyl terminus of the heavy chain, and (ii) an anti-CD28 Fab fragment with a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) ligated to the carboxyl terminus of the heavy chain. The peptide-tagged Fab fragments were prepared by recombination (see International Patent Application Publication Nos. WO 2013 / 011011 and WO 2013 / 124474). The anti-CD3 Fab fragment was prepared using the hybridoma cell line OKT3 (ATCC® CRL-8001).TM The anti-CD28 Fab fragment is derived from a CD3-conjugated monoclonal antibody produced by (see also U.S. Patent No. 4,361,549) and contains the heavy chain variable region (SEQ ID NO: 31) and light chain variable region (SEQ ID NO: 32) of the anti-CD3 antibody OKT3, as described in Arakawa et al., J. Biochem. 120, 657-662 (1996). The anti-CD28 Fab fragment is derived from the antibody CD28.3 (registered as a synthetic single-chain Fv construct under GenBank accession number AF451974.1; see also Vanhove et al., BLOOD, 15 July 2003, Vol. 102, No. 2, pp 564-570) and contains the heavy chain variable region (SEQ ID NO: 33) and light chain variable region (SEQ ID NO: 34) of the anti-CD28 antibody CD28.3. To prepare the anti-CD3 / anti-CD28 stimulating reagent, 0.3 mg of oligomeric streptavidin mutagenesis reagent, 0.5 μg of peptide-tagged anti-CD3Fab fragment, and 0.5 μg of peptide-tagged anti-CD28Fab fragment were used.
[0255] Approximately 3 x 10⁶ isolated T cells 6 The cells were suspended at a density of cells / mL. Anti-CD3 / anti-CD28 stimulating reagents were added to the cell culture medium supplemented with 100 IU / mL of IL-2, 1500 IU / mL of IL-7, and 19 IU / mL of IL-15. The cells were cultured in a 6-well plate (Corning 351146) and incubated at 37°C for 48 hours.
[0256] [Modification of T cells] After 48 hours of activation, count the number of T cells, 5 x 10 7The cells were resuspended in buffer at a density of cells / mL. To induce gene disruption at the endogenous TCRα constant region (TRAC) locus via CRISPR / Cas9 gene editing, ribonucleoprotein (RNP), composed of Cas9 protein (Aldevron) and a TRAC-targeting single guide RNA (sgRNA) containing the target domain sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO: 28; targeting exon 1 of the endogenous TRAC gene), was added to the resuspended T cells to a final RNP concentration of 2 μM. 100 μL of the T cell / RNP solution was transferred to electroporation cuvettes (Lonza P3 Primary Cell 4D-Nucleofector X Kit L V4XP-3024), and electroporation was performed using a Lonza 4D-Nucleofector X Unit (Lonza) with pulse code DN-100 / P3. Immediately after electroporation, 600 μL of TCM was added to each cuvette, and the cells were left to stand in the cuvettes at 37°C for 15 minutes. The electroporated cells were harvested and transferred to a 96-well flat-bottom plate (Corning 351172) for recovery. For example, anti-BCMA CAR was inserted into the TRAC gene locus (MOI: 5x10) on this plate. 3 The solution contains AAV, which encodes homologous recombination repair templates for viral genome / cell regeneration, a predetermined concentration of DNA-PK inhibitor, 1 mM D-biotin, 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15, with a final volume of 210 μL TCM / well and a final cell density of 5x10⁶ (based on pre-electroporation count). 5 The T cell / well ratio was adjusted. The above anti-BCMA CAR is described in WO2019 / 090003.
[0257] For example, anti-BCMA CAR (encoded by SEQ ID NO: 198, SEQ ID NO: 197) includes a human IgGκ signaling sequence, human anti-BCMA scFv (Table 6), a modified IgG4 hinge CH2-CH3 spacer (encoded by SEQ ID NO: 184; SEQ ID NO: 183, which is sometimes also referred to as "LS"), a human CD28 transmembrane domain (encoded by SEQ ID NO: 186, SEQ ID NO: 185), an intracellular co-signaling sequence derived from human 4-1BB (encoded by SEQ ID NO: 188, SEQ ID NO: 187), and an intracellular signaling domain derived from human CD3ζ (encoded by SEQ ID NO: 190, SEQ ID NO: 189).
[0258] The example human anti-BCMA scFv includes scFv having the following sequence: [Table 43]
[0259] The general structure of the example homologous recombination repair template polynucleotide is as follows: [5' homology arm (SEQ ID NO: 191)]-[promoter (SEQ ID NO: 187)]-[transgene sequence encoding anti-BCMA CAR (SEQ ID NO: 193)]-[3' homology arm (SEQ ID NO: 192)]. The homology arms contain a nucleic acid sequence of approximately 600 bp homologous to the sequence around the target integration site in exon 1 of the human TCRα constant region (TRAC) gene. The complete sequence of the homologous recombination repair template polynucleotide used is shown in SEQ ID NO: 194. Control samples were prepared in the same manner as above, under conditions without treatment with DNA-PK inhibitors (untreated) or without the addition of AAV (TRAC KO only) in the corresponding wells of the recovery plate.
[0260] [T cell proliferation] T4 hours after electroporation, T cells were transferred to 24-well GREX plates (Wilson Wolf 80192M), and TCM containing 100 IU / mL of IL-2, 1500 IU / mL of IL-7, and 19 IU / mL of IL-15 was added to a final volume of 3 mL / well. The cells were cultured in the GREX plates for a total of 5 days after electroporation, with cytokine replenishment every 2-3 days (the final volume on day 5 after electroporation was 4 mL / well). On day 5 after electroporation, cell viability and cell count were measured using AOPI staining (Nexcelom CS2-0106) and a Cellaca MX automated cell counter (Nexcelom Bioscience). CAR knock-in efficiency was measured by flow cytometry as described below.
[0261] [Flow cytometry] After T cell modification and proliferation for 5 days, TRAC knockout and CAR knock-in of cells were analyzed by flow cytometry. In short, 2-5 x 10⁻¹⁰ cells were analyzed. 5Cells / wells were transferred to a 96-well round-bottom plate (Corning 351177) and stained using LIVE / DEAD Fixable near-IR (ThermoFisher L34993) according to the manufacturer's protocol. Subsequently, an antibody cocktail consisting of CD3 antibody (BioLegend, UCHT1), CD4 antibody (BioLegend, OKT4), CD8 antibody (BD Horizon, RPA-T8), and anti-idiotype antibody (an antibody that binds to the extracellular region of the anti-BCMA CAR, see WO2021 / 113776) was added to cell staining buffer (BioLegend D5RE-01386-1) and diluted, and stained at 4°C for 30 minutes. After staining, cells were washed, resuspended in 100 μL of cell staining buffer per well, and analyzed using a FACSymphony A5 flow cytometer (BD Biosciences). A high-throughput plate reader was used to identify 20,000 viable cells per well. Data analysis was performed using FlowJo 10.8.1 (BD Biosciences) and JMP 15.2.0 (SAS Institute Inc.). The total number of CAR+ T cells was calculated by multiplying the percentage of CAR+ cells by the total number of cells. Then, to normalize for the untreated condition, the total number of CAR+ T cells in the DNA-PK inhibitor-treated condition was divided by the average total number of CAR+ T cells in the three untreated wells, subtracted by 1, and then multiplied by 100 to calculate the total number of CAR+ cells as a relative percentage change compared to the untreated control group.
[0262] Figure 1 shows the effect of treating cells derived from two donors with a DNA-PK inhibitor compound (e.g., compound 18 from Example 18) at concentrations of 0.25 mM, 1.25 mM, and 2.5 mM on cell viability 5 days after electroporation (shaded bars represent Donor 1, and unshaded bars represent Donor 2). Viable cells are shown as a percentage of the total cell number.
[0263] Figure 2 shows the effect of DNA-PK inhibitors (e.g., compound 18 in Example 18) on T cell proliferation 5 days after electroporation. The total number of viable cells (x10e6) is shown.
[0264] Figure 3 shows the effect of DNA-PK inhibitors (e.g., compound 18 in Example 18) on CAR insertion into the TRAC gene locus 5 days after electroporation. The percentage of CAR+ T cells is shown as a percentage of the total number of viable cells.
[0265] Figure 4 shows the effect of DNA-PK inhibitors (e.g., compound 18 in Example 18) on CAR insertion into the TRAC gene locus 5 days after electroporation. KI efficiency is shown as the percentage change compared to the untreated control condition (calculated by dividing the percentage of CAR+ in the DNA-PKi-treated group by the percentage of CAR+ in the untreated group, subtracting 1, and multiplying by 100).
[0266] Figure 5 shows the effect of DNA-PK inhibitor compounds (e.g., compound 18 in Example 18) on the total number of CAR+ cells 5 days after electroporation. The relative number of CAR+ cells is shown as the percentage change compared to the untreated control condition (calculated by dividing the number of CAR+ cells under DNA-PKi treatment by the number of cells under the untreated condition, subtracting 1, and multiplying by 100).
[0267] [Table 44] [Table 45] [Table 46] [Table 47] [Table 48] [Table 49] [Table 50] [Table 51]
[0268] [Equivalent range] Details of one or more embodiments of this disclosure are described in the embodiments for carrying out the invention described above. Any methods and materials similar or equivalent to those described herein may be used in carrying out or testing this disclosure, but preferred methods and materials are described below. Other features, purposes and advantages of this disclosure will become apparent from this specification and the claims. In the specification and the appended claims, singular nouns are to be considered plural unless the context makes otherwise clear. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. All patents and publications referenced herein are incorporated herein by reference. The embodiments for carrying out the above invention are presented for illustrative purposes only and are not intended to limit this disclosure to any particular embodiment. This disclosure is limited only by the claims appended to this specification.
[0269] [Enumeration of Implementations] Embodiment 1. Formula I: [ka] [In the formula, A is R of 1 or more as appropriate. 3 A 6- to 8-membered cycloalkyl group which may be substituted with; X 1 is N or CR 4 and; X 2 is O, S, CH-OH, NH, or N(C1-C4 alkyl); R 1 This is a 6-8 member heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of H, or N and O, and this heterocycloalkyl or heteroaryl group contains 1 or more R 5It may be replaced as appropriate; R 2 is H, -COO(C1-C4 alkyl), -C(O)O-(aryl or heteroaryl), or heteroaryl (containing at least one heteroatom selected from the group consisting of N, O, and S), where the aryl or heteroaryl is one or more R 6 It may be replaced as appropriate; Each R 3 Each of these is independently selected from halogens, C1-C4 alkyls, or C1-C4 alkoxys; R 4 This is selected from the group consisting of -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO(C1-C4 alkyl), and CHO; Each R 5 Each is independently selected from halogens or C1-C4 alkyls; and Each R 6 Each of these is independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH(C1-C4 alkyl), COO(C1-C4 alkyl), COO(C3-C8 cycloalkyl), or NH2; or two R atoms bonded to adjacent atoms of a heteroaryl ring. 6 The group forms a 5- or 6-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S. Compounds thereof, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.
[0270] Embodiment 2. In the formula, R 2 but, [ka] And here each X 3 , X 4 , X 5 , and X 6 These are N and C(R) independently of each other. 6 ) selected from, and at least one X3 , X 4 , X 5 , and X 6 is C(R 6 ) The compound described in Embodiment 1.
[0271] Embodiment 3. In the formula, R 2 but, [ka] And here each X 3 , X 4 , X 5 , and X 6 These are, independently, N, NH, O, S, and C(R) 6 ) selected from, at most one X 3 , X 4 , X 5 , and X 6 However, it is either O or S. The compound described in Embodiment 1.
[0272] Embodiment 4. In the equation, A is [ka] Selected from, where p is 0, 1, 2, or 3, The compound described in Embodiment 1.
[0273] Embodiment 5. In the formula, R 1 teeth, [ka] Selected from, where n is 0, 1, 2, or 3, The compound described in Embodiment 1.
[0274] Embodiment 6. In the formula, R 2 but, [ka] Selected from, where m is 0, 1, 2, or 3. The compound described in Embodiment 1.
[0275] Embodiment 7. The compound is given by formula (Ia-1): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0276] Embodiment 8. The compound is given by formula (Ia-2): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0277] Embodiment 9. The compound is given by formula (Ia-3): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0278] Embodiment 10. The compound is given by formula (Ia-4): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0279] Embodiment 11. The compound is given by formula (Ib-1): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0280] Embodiment 12. The compound is given by formula (Ib-2): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0281] Embodiment 13. The compound is given by formula (Ib-3): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0282] Embodiment 14. The compound is given by formula (Ib-4): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0283] Embodiment 15. The compound is given by formula (Ib-5): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0284] Embodiment 16. The compound is given by formula (Ib-6): [ka] A compound according to any one of the embodiments described above, as shown in [reference].
[0285] Embodiment 17. The compound, [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] A compound described in any one of the embodiments described above, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, selected from the group consisting of the above.
[0286] Embodiment 18. The compound, [ka] [ka] [ka] [ka] A compound described in any one of the embodiments described above, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, selected from the group consisting of the above.
[0287] Embodiment 19. The compound is selected from the group consisting of the compounds shown in Table 1, the compound described in Embodiment 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
[0288] Embodiment 20. The compound is selected from the group consisting of the compounds shown in Table 2, the compound described in Embodiment 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
[0289] Embodiment 21. A pharmaceutically acceptable composition comprising a compound described in any one of Embodiments 1 to 20 and a pharmaceutically acceptable carrier.
[0290] Embodiment 22. a) DNA protein kinase inhibitors (DNA-PKI); and b) DNA cutting factor; A composition comprising a DNA-PKI, wherein the DNA-PKI is a compound described in any one of Embodiments 1 to 20.
[0291] Embodiment 23. Furthermore, the composition according to embodiment 22 includes cells.
[0292] Embodiment 24. The composition according to Embodiment 22 or Embodiment 23, further comprising donor DNA.
[0293] Embodiment 25. The composition according to any one of Embodiments 22 to 24, wherein the DNA-PKI concentration in the composition is approximately 10 μM or less.
[0294] Embodiment 26. The composition according to any one of Embodiments 22 to 24, wherein the DNA-PKI concentration in the composition is approximately 0.1 to 10 μM.
[0295] Embodiment 27. The composition according to Embodiment 26, wherein the DNA-PKI concentration in the composition is approximately 0.25 to 5 μM.
[0296] Embodiment 28. The composition according to any one of Embodiments 23 to 27, wherein the above-mentioned cells are eukaryotic cells.
[0297] Embodiment 29. The composition according to any one of Embodiments 23 to 27, wherein the cells are useful for adoptive immunotherapy (ACT).
[0298] Embodiment 30. The composition according to Embodiment 29, wherein the cells in question are stem cells.
[0299] Embodiment 31. The composition according to Embodiment 30, wherein the stem cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs).
[0300] Embodiment 32. The composition according to any one of Embodiments 29 to 31, wherein the cells in question are immune cells.
[0301] Embodiment 33. The composition according to Embodiment 32, wherein the immune cells are white blood cells or lymphocytes.
[0302] Embodiment 34. The composition according to Embodiment 33, wherein the immune cells are lymphocytes.
[0303] Embodiment 35. The composition according to Embodiment 34, wherein the lymphocytes are T cells, B cells, or NK cells.
[0304] Embodiment 36. The composition according to Embodiment 34, wherein the lymphocyte is a T cell.
[0305] Embodiment 37. The composition according to embodiment 36, wherein the T cells are primary T cells.
[0306] Embodiment 38. The composition according to Embodiment 36, wherein the T cells are regulatory T cells.
[0307] Embodiment 39. The composition according to any one of Embodiments 36 to 38, wherein the lymphocytes are activated T cells.
[0308] Embodiment 40. The composition according to any one of Embodiments 36 to 38, wherein the lymphocytes are inactivated T cells.
[0309] Embodiment 41. The composition according to any one of Embodiments 23 to 40, wherein the cells are human cells.
[0310] Embodiment 42. The composition according to any one of Embodiments 22 to 41, wherein the DNA cleavage factor includes a CRISPR / Cas nuclease component and, optionally, a guide RNA component.
[0311] Embodiment 43. The composition according to any one of Embodiments 22 to 42, wherein the DNA cleavage factor includes a CRISPR / Cas nuclease that causes double-stranded DNA breaks or single-stranded DNA breaks.
[0312] Embodiment 44. The composition according to any one of Embodiments 22 to 41, wherein the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof.
[0313] Embodiment 45. The composition according to Embodiment 42, wherein the DNA cleavage factor is a CRISPR / Cas nuclease component and a guide RNA component.
[0314] Embodiment 46. The composition according to Embodiment 45, wherein the CRISPR / Cas nuclease component includes Cas nuclease or mRNA encoding Cas nuclease.
[0315] Embodiment 47. The composition according to Embodiment 45, wherein the CRISPR / Cas nuclease component includes Cas nuclease.
[0316] Embodiment 48. The composition according to Embodiment 46 or Embodiment 47, wherein the Cas nuclease is a type II Cas nuclease belonging to class 2.
[0317] Embodiment 49. The composition according to Embodiment 48, wherein the Cas nuclease is a Cas9 nuclease.
[0318] Embodiment 50. The composition according to Embodiment 49, wherein the Cas nuclease is a Cas9 nuclease derived from S. pyogenes.
[0319] Embodiment 51. The composition according to Embodiment 46 or Embodiment 47, wherein the Cas nuclease is a type V Cas nuclease belonging to class 2.
[0320] Embodiment 52. The composition according to Embodiment 46 or Embodiment 47, wherein the Cas nuclease is Cas12a nuclease.
[0321] Embodiment 53. The composition according to Embodiment 52, wherein the Cas nuclease is a Cas12a nuclease derived from the genus Acidaminococcus.
[0322] Embodiment 54. The composition according to any one of Embodiments 46 to 53, wherein the Cas nuclease causes single-strand DNA breaks.
[0323] Embodiment 55. A composition according to any one of Embodiments 22 to 54, comprising modified RNA.
[0324] Embodiment 56. The composition according to any one of Embodiments 42 to 55, wherein the guide RNA component is a guide RNA nucleic acid.
[0325] Embodiment 57. The composition according to Embodiment 56, wherein the guide RNA nucleic acid is guide RNA (gRNA).
[0326] Embodiment 58. The composition according to Embodiment 56 or Embodiment 57, wherein the guide RNA nucleic acid is a dual guide RNA (dgRNA) consisting of crRNA and tracrRNA, or encodes such dgRNA.
[0327] Embodiment 59. The composition according to Embodiment 56 or Embodiment 57, wherein the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes such sgRNA.
[0328] Embodiment 60. The composition according to any one of Embodiments 57 to 59, wherein the gRNA is a modified gRNA.
[0329] Embodiment 61. The composition according to Embodiment 60, wherein the cleavage factor is Cas9, and the modified gRNA is one in which one or more of the first five nucleotides at the 5' end are modified.
[0330] Embodiment 62. The composition according to Embodiment 60, wherein the cleavage factor is Cas12a and the modified gRNA contains a DNA / RNA hybrid molecule.
[0331] Embodiment 63. The modified gRNA is one in which one or more of the last five nucleotides at the 3' end are modified, as described in Embodiments 60 to 62.
[0332] Embodiment 64. The composition according to any one of Embodiments 22 to 63, wherein the composition comprises a guide RNA nucleic acid and a type II Cas nuclease belonging to class 2 or a type V Cas nuclease belonging to class 2, and the molar ratio of the guide RNA to the Cas nuclease is about 4:1 to 1:4.
[0333] Embodiment 65. The composition according to any one of Embodiments 24 to 64, wherein the donor DNA comprises a template having a protein-coding sequence, a regulatory sequence, or a structural RNA-coding sequence.
[0334] Embodiment 66. The composition according to any one of Embodiments 22 to 65, further comprising a vector.
[0335] Embodiment 67. The composition according to Embodiment 66, wherein the vector encodes donor DNA.
[0336] Embodiment 68. The composition according to Embodiment 66 or Embodiment 67, wherein the vector is a viral vector.
[0337] Embodiment 69. The composition according to Embodiment 66 or Embodiment 67, wherein the vector is a nonviral vector.
[0338] Embodiment 70. The composition according to Embodiment 68, wherein the vector is AAV.
[0339] Embodiment 71. The composition according to Embodiment 23, wherein the cells in question are not cancer cells.
[0340] Embodiment 72. The composition according to any one of Embodiments 22 to 71 further comprises an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway.
[0341] Embodiment 73. A method for targeted genome editing in cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound described in any one of Embodiments 1 to 20.
[0342] Embodiment 74. A method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA cleavage factor and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 20.
[0343] Embodiment 75. A method for inhibiting or suppressing the repair of DNA breaks via the non-homologous end joining (NHEJ) pathway in cells, characterized by contacting cells with a DNA break factor and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 20.
[0344] Embodiment 76. Furthermore, the method according to embodiment 75, characterized by contacting cells with an inhibitor of the microhomology-mediated end-joining (MMEJ) pathway.
[0345] Embodiment 77. A method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein DNA-PKI is a compound described in any one of Embodiments 1 to 20.
[0346] Embodiment 78. The method according to any one of Embodiments 73 to 77, characterized by culturing cells in a cell medium that does not contain DNA-PKI, and then adding DNA-PKI to the cell medium.
[0347] Embodiment 79. The method according to any one of Embodiments 73 to 78, characterized in that the cells are brought into contact with a DNA cleavage factor, and then the cells are brought into contact with DNA-PKI.
[0348] Embodiment 80. The method according to Embodiment 79, characterized in that the cells are brought into contact with DNA-PKI within approximately 6 hours of contacting the cells with a DNA cleavage factor.
[0349] Embodiment 81. The method according to Embodiment 80, characterized in that the cells are brought into contact with DNA-PKI within approximately 3 hours of contacting the cells with a DNA cleavage factor.
[0350] Embodiment 82. The method according to any one of Embodiments 73 to 78, characterized by simultaneously contacting a DNA cleavage factor and DNA-PKI with cells.
[0351] Embodiment 83. The method according to any one of Embodiments 73 to 78, characterized in that the cells are brought into contact with DNA-PKI, and then the cells are brought into contact with a DNA cleavage factor.
[0352] Embodiment 84. The method according to any one of Embodiments 73 to 83, wherein the contact between the cell and the DNA cleavage factor includes electroporation.
[0353] Embodiment 85. The method according to Embodiment 83 or Embodiment 84, characterized in that the cells are brought into contact with a DNA cleavage factor within approximately 3 hours of contacting the cells with DNA-PKI.
[0354] Embodiment 86. The method according to any one of Embodiments 83 to 85, characterized by culturing cells in a cell medium containing DNA-PKI.
[0355] Embodiment 87. The method according to any one of Embodiments 83 to 86, wherein the cells are brought into contact with the DNA cleavage factor and DNA-PKI for at least about 1 day.
[0356] Embodiment 88. The method according to Embodiment 87, wherein the cells are brought into contact with a DNA cleavage factor and DNA-PKI for approximately 1 day to approximately 2 weeks.
[0357] Embodiment 89. The method according to Embodiment 87, wherein the cells are brought into contact with a DNA cleavage factor and DNA-PKI for approximately two weeks.
[0358] Embodiment 90. The method according to any one of Embodiments 73 to 89, wherein cells are brought into contact with DNA-PKI in a cell culture medium, and the concentration of DNA-PKI in the cell culture medium is approximately 10 μM or less.
[0359] Embodiment 91. The method according to any one of Embodiments 73 to 90, wherein cells are brought into contact with DNA-PKI in a cell culture medium, and the concentration of DNA-PKI in the cell culture medium is approximately 0.1 to 10 μM.
[0360] Embodiment 92. The method according to Embodiment 91, wherein the concentration of DNA-PKI in the cell culture medium is approximately 0.25 to 5 μM.
[0361] Embodiment 93. The method according to any one of Embodiments 73 to 92, wherein the above cells are eukaryotic cells.
[0362] Embodiment 94. The method according to any one of Embodiments 73 to 93, wherein the cells are used in adoptive immunotherapy (ACT).
[0363] Embodiment 95. The method according to Embodiment 94, wherein the cells are used in autologous cell therapy.
[0364] Embodiment 96. The method according to Embodiment 94, wherein the cells are used in allogeneic cell therapy.
[0365] Embodiment 97. The method according to any one of Embodiments 73 to 93, wherein the cells in question are stem cells.
[0366] Embodiment 98. The method according to Embodiment 97, wherein the stem cells are hematopoietic stem cells (HSCs).
[0367] Embodiment 99. The method according to Embodiment 97, wherein the cells are induced pluripotent stem cells (iPSCs).
[0368] Embodiment 100. The method according to Embodiment 94 or Embodiment 95, wherein the cells in question are immune cells.
[0369] Embodiment 101. The method according to Embodiment 100, wherein the immune cells are leukocytes or lymphocytes.
[0370] Embodiment 102. The method according to Embodiment 101, wherein the immune cells are lymphocytes.
[0371] Embodiment 103. The method according to Embodiment 102, wherein the lymphocyte is a T cell, a B cell, or an NK cell.
[0372] Embodiment 104. The method according to Embodiment 103, wherein the lymphocyte in question is a T cell.
[0373] Embodiment 105. The method according to Embodiment 104, wherein the T cell is a primary T cell.
[0374] Embodiment 106. The method according to Embodiment 104, wherein the T cell is a regulatory T cell.
[0375] Embodiment 107. The method according to any one of Embodiments 103 to 106, wherein the lymphocyte is an activated T cell.
[0376] Embodiment 108. The method according to any one of Embodiments 103 to 106, wherein the lymphocytes are inactivated T cells.
[0377] Embodiment 109. The method according to any one of Embodiments 73 to 108, wherein the cells in question are human cells.
[0378] Embodiment 110. The method according to any one of Embodiments 73 to 109, wherein the DNA cleavage factor is selected from zinc finger nucleases, TALE nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof.
[0379] Embodiment 111. The method according to Embodiment 110, wherein the DNA cleavage factor is a CRISPR / Cas nuclease component.
[0380] Embodiment 112. The method according to Embodiment 111, wherein the CRISPR / Cas nuclease component includes Cas nuclease or mRNA encoding Cas nuclease.
[0381] Embodiment 113. The method according to Embodiment 112, wherein the CRISPR / Cas nuclease component includes mRNA encoding a Cas nuclease.
[0382] Embodiment 114. The method according to Embodiment 112 or Embodiment 113, wherein the Cas nuclease is a type II Cas nuclease belonging to class 2.
[0383] Embodiment 115. The method according to Embodiment 112 or Embodiment 113, wherein the Cas nuclease is a type V Cas nuclease belonging to class 2.
[0384] Embodiment 116. The method according to Embodiment 114, wherein the Cas nuclease is a Cas9 nuclease.
[0385] Embodiment 117. The method according to Embodiment 116, wherein the Cas nuclease is a Cas9 nuclease derived from S. pyogenes.
[0386] Embodiment 118. The method according to Embodiment 115, wherein the Cas nuclease is Cas12a nuclease.
[0387] Embodiment 119. The method according to any one of Embodiments 73 to 118, further characterized by bringing modified RNA into contact with the cells.
[0388] Embodiment 120. The method according to any one of Embodiments 73 to 119, further characterized by bringing a guide RNA nucleic acid into contact with the cells.
[0389] Embodiment 121. The method according to Embodiment 120, wherein the guide RNA nucleic acid is gRNA.
[0390] Embodiment 122. The method according to Embodiment 120 or Embodiment 121, wherein the guide RNA nucleic acid is a dual guide RNA (dgRNA) or encodes such dgRNA.
[0391] Embodiment 123. The method according to Embodiment 120 or Embodiment 121, wherein the guide RNA nucleic acid is a single guide RNA (sgRNA) or encodes such sgRNA.
[0392] Embodiment 124. The method according to any one of Embodiments 121 to 123, wherein the gRNA is a modified gRNA.
[0393] Embodiment 125. The modified gRNA described above is one in which one or more of the first five nucleotides at the 5' end have been modified, according to the method of Embodiment 124.
[0394] Embodiment 126. The modified gRNA described above is one in which one or more of the last five nucleotides at the 3' end are modified, according to the method of Embodiment 124 or Embodiment 125.
[0395] Embodiment 127. The method according to any one of Embodiments 120 to 126, wherein the DNA cleavage factor is a type II Cas nuclease belonging to class 2 or a type V Cas nuclease mRNA belonging to class 2, and the molar ratio of guide RNA nucleic acid to Cas nuclease is approximately 4:1 to 1:4.
[0396] Embodiment 128. The method according to any one of Embodiments 73 to 127, further characterized by bringing the cells into contact with donor DNA.
[0397] Embodiment 129. The method according to Embodiment 128, characterized by contacting cells with a vector containing donor DNA.
[0398] Embodiment 130. The method according to Embodiment 128 or Embodiment 129, wherein the donor DNA includes a template having a protein-coding sequence, a regulatory sequence, or a structural RNA-coding sequence.
[0399] Embodiment 131. The method according to Embodiment 130, wherein the template sequence is incorporated into the cell genome by homologous recombination repair (HDR).
[0400] Embodiment 132. The method according to any one of Embodiments 73 to 131, further characterized by bringing the vector into contact with the cells.
[0401] Embodiment 133. The method according to Embodiment 132, wherein the vector encodes a DNA cleavage factor.
[0402] Embodiment 134. The method according to Embodiment 132 or Embodiment 133, wherein the vector encodes donor DNA.
[0403] Embodiment 135. The method according to any one of Embodiments 132 to 134, wherein the vector is a viral vector.
[0404] Embodiment 136. The method according to any one of Embodiments 132 to 134, wherein the vector is a nonviral vector.
[0405] Embodiment 137. The method according to embodiment 135, wherein the vector is AAV.
[0406] Embodiment 138. The method according to any one of Embodiments 73 to 137, wherein the DNA cleavage factor interacts with a target sequence in the cell's genome to cause a double-strand DNA break (DSB).
[0407] Embodiment 139. The method according to any one of Embodiments 73 to 138, wherein gene knockout occurs.
[0408] Embodiment 140. The method according to any one of Embodiments 73 to 139, wherein gene repair occurs.
[0409] Embodiment 141. The method according to any one of Embodiments 73 to 140, wherein gene insertion occurs.
[0410] Embodiment 142. The method according to any one of Embodiments 130 to 141, wherein the donor DNA includes a template having an exogenous nucleic acid encoding a protein.
[0411] Embodiment 143. The method according to Embodiment 142, wherein the protein is selected from the group consisting of cytokines, immunosuppressive factors, antibodies, receptors, and enzymes.
[0412] Embodiment 144. The method according to Embodiment 143, wherein the protein is a receptor.
[0413] Embodiment 145. The method according to Embodiment 143 or Embodiment 144, wherein the receptor is selected from the group consisting of immune receptors, T cell receptors (TCRs), and chimeric antigen receptors.
[0414] Embodiment 146. The method according to Embodiment 145, wherein the receptor is an immune receptor.
[0415] Embodiment 147. The method according to Embodiment 145, wherein the receptor is a TCR.
[0416] Embodiment 148. The method according to Embodiment 142, wherein the foreign nucleic acid encodes a TCRα chain and / or a TCRβ chain.
[0417] Embodiment 149. The method according to embodiment 145, wherein the receptor is a chimeric antigen receptor.
[0418] Embodiment 150. The method according to any one of Embodiments 130 to 149, wherein the DNA cleavage factor interacts with a target sequence in the TRAC gene of a T cell.
[0419] Embodiment 151. The method according to Embodiment 150, characterized by contacting cells with at least two different DNA cleavage factors that target different gene loci.
[0420] Embodiment 152. The method according to any one of embodiments 142 to 151, wherein the mold includes a first homology arm and a second homology arm that are complementary to each other in arrangements located upstream and downstream of the cutting portion.
Claims
1. Formula I: 【Chemistry 1】 [In the formula, A is R of 1 or more as appropriate. 3 A 6- to 8-membered cycloalkyl group which may be substituted with; X 1 is N or CR 4 and; X 2 These are O, S, CH-OH, NH, or N(C) 1 -C 4 Alkyl) is; R 1 This is a 6-8 membered heterocycloalkyl or heteroaryl group containing at least one heteroatom selected from the group consisting of H or N and O, where the heterocycloalkyl or heteroaryl group contains 1 or more R 5 It may be replaced as appropriate; R 2 is H, -COO(C 1 -C 4 alkyl), -C(O)O-(aryl or heteroaryl) or heteroaryl (containing at least one heteroatom selected from the group consisting of N, O and S), wherein said aryl or heteroaryl may have one or more R 6 which may be optionally substituted; Each R 3 These are, independently, halogen and C 1 -C 4 Alkyl, and C 1 -C 4 Selected from alkoxy; R 4 -CN, halogen, C 1 -C 4 Alkyl, C 1 -C 4 Alkoxy, CO(C 1 -C 4 Selected from the group consisting of alkyl, and CHO; Each R 5 These are, independently, halogen and C 1 -C 4 Selected from alkyl groups; and Each R 6 These are, independently, hydrogen, halogen, -CN, and C. 1 -C 4 Alkyl, C 1 -C 4 Haloalkyl, C 1 -C 4 Alkoxy, C 1 -C 4 Haloalkoxy, CONH(C) 1 -C 4 Alkyl), COO(C 1 -C 4 Alkyl), COO(C 3 -C 8 Cycloalkyl, and NH 2 Selected from; or two R atoms bonded to adjacent atoms of the heteroaryl ring 6 The group forms a 5- or 6-membered fused ring containing 0 to 3 heteroatoms selected from O, N, and S. Compounds thereof, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.
2. In the formula, R 2 but, 【Chemistry 2】 And here each X 3 , X 4 , X 5 , and X 6 However, N and C(R) are independent of each other. 6 ) selected from, and at least one X 3 , X 4 , X 5 , and X 6 is C(R 6 The compound according to claim 1, which is the compound described in claim 1.
3. In the formula, R 2 but, 【Transformation 3】 And here each X 3 , X 4 , X 5 , and X 6 However, each is independent of N, NH, O, S, and C(R) 6 ) selected from, at most one X 3 , X 4 , X 5 , and X 6 The compound according to claim 1, wherein the compound is O or S.
4. In the equation, A is 【Chemistry 4】 A group consisting of is selected, where p is 0, 1, 2, or 3. The compound according to claim 1.
5. In the formula, R 1 but, 【Transformation 5】 A group consisting of is selected, where n is 0, 1, 2, or 3. The compound according to claim 1.
6. In the formula, R 2 but, 【Transformation 6】 A group consisting of is selected, where m is 0, 1, 2, or 3. The compound according to claim 1.
7. The compound is of formula (Ia-1), (Ia-2), (Ia-3), or (Ia-4): 【Transformation 7】 A compound as described in any one of the preceding claims, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
8. The compound is of formula (Ib-1), (Ib-2), (Ib-3), (Ib-4), (Ib-5), or (Ib-6): 【Transformation 8】 【Chemistry 9】 A compound as described in any one of the preceding claims, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
9. The compound, 【Chemistry 10】 【Chemistry 11】 【Chemistry 12】 【Chemistry 13】 【Chemistry 14】 【Chemistry 15】 【Chemistry 16】 【Chemistry 17】 【Chemistry 18】 【Chemistry 19】 【Chemistry 20】 【Chemistry 21】 【Chemistry 22】 【Chemistry 23】 【Chemistry 24】 A compound according to any one of the preceding claims, selected from the group consisting of the above, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
10. The compound, 【Chemistry 25】 【Chemistry 26】 【Chemistry 27】 【Chemistry 28】 A compound according to any one of the preceding claims, selected from the group consisting of the above, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.
11. a) A composition comprising a DNA protein kinase inhibitor (DNA-PKI) and b) a DNA cleavage factor, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.
12. The composition according to claim 11, further comprising cells.
13. The composition according to claim 11 or 12, further comprising donor DNA.
14. The composition according to any one of claims 11 to 13, wherein the DNA cleavage factor comprises a CRISPR / Cas nuclease component and, optionally, a guide RNA component.
15. The composition according to any one of claims 11 to 14, further comprising a vector.
16. The composition according to any one of claims 11 to 15, further comprising an inhibitor of the microhomology-mediated end-binding (MMEJ) pathway.
17. A method for targeted genome editing of cells, characterized by contacting cells with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.
18. A method for repairing double-strand DNA breaks in the genome of a cell, characterized by contacting the cell with a DNA cleavage factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.
19. A method for inhibiting or suppressing the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, characterized by contacting cells with a DNA break factor and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1 to 10.
20. A method for targeted insertion of donor DNA into the genome of a cell, characterized by contacting the cell with a DNA cleavage factor, donor DNA, and DNA-PKI, wherein the DNA-PKI is a compound described in any one of claims 1 to 10.