ANTI-CD30L antibody and its use
Patent Information
- Application Number
- JP2026515000
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-09-12
- Filing Date
- 2024-09-10
- Publication Date
- 2026-09-09
AI Technical Summary
が優るものでもある。かかる利益には、炎症性疾患の徴候又は症状の改善が含まれる。有効量は、知られている技術を用いて、そして類似した状況の下で得られる結果を観察することによって、当業者によって容易に決定され得る。有効量の本開示の抗CD30L抗体は、単回用量又は複数用量で投与され得る。患者に対する有効量の決定では、限定されないが、患者の大きさ(例えば、体重又はマス)、体表面積、年齢及び全般的な健康;関与する具体的な疾患又は障害;疾患又は障害の程度、又は関与、又は重症度;個々の患者の応答;投与される詳細な化合物;投与様式;投与される製剤のバイオアベイラビリティ特性;選択される用量レジメン;併用薬の使用;及びその他、医師に公知の関連性のある状況を含め、幾つもの要因が主治医によって考慮される。
Smart Images

Figure 2026530664000001 
Figure 2026530664000002 
Figure 2026530664000003
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 537,933, filed September 12, 2023, which is incorporated in its entirety by reference herein.
[0002] Sequence List The sequence listing, identified below, submitted concurrently with this specification, is incorporated by reference as a whole: a 48,423 kilobyte XML file named 10471-WO01-SEC_Sequence_Listing_USPTO_8-26-2024; created August 26, 2024.
[0003] This invention relates to the field of inflammatory disorders. This invention relates to an anti-CD30L antibody and the treatment of patients with the said antibody. [Background technology]
[0004] The differentiation antigen group 30 ligand (also known as CD30L, TNFL8, or tumor necrosis factor ligand superfamily member 8) is a member of the tumor necrosis factor (TNF) superfamily and is encoded by the TNFSF8 gene. The main isoform of CD30L contains a 234-amino acid transmembrane protein with 172 amino acids in its extracellular domain. Consistent with one of the prominent features of the TNF superfamily, CD30L forms a homotrimeric complex and binds to its congener receptor CD30 (TNFRSF8). Upon binding to CD30, CD30L stimulates the activation of several pathways, including mitogen-activated protein kinase (MAPK) and nuclear factor kappa B (NF-κB) signaling. Like other TNF superfamily members, CD30L and CD30 can be cleaved from the cell membrane by proteases such as TNFα-converting enzyme (TACE). CD30L-CD30 association has been shown to stimulate increased detachment of both ligand and receptor. Soluble CD30L (sCD30L) can bind to and stimulate CD30 signaling.
[0005] CD30L expression is limited to the immune system. Its expression is strictly regulated and is mainly observed in activated lymphocytes and monocytes. Genetic and pharmacological mouse models have revealed the role of CD30L-CD30 signaling in regulating the differentiation and effector function of helper T cells and B cells. CD30L signaling has been shown to regulate pan-helper T cell effector cytokines, including Th1, TH2, and Th17. CD30L has also been shown to regulate antibody B cell production across multiple isotype classes. Thus, CD30L-CD30 signaling broadly regulates both type 1 and type 2 / allergic adaptive immune responses.
[0006] Several pieces of evidence suggest that CD30L-CD30 signaling is involved in the manifestations of several inflammatory diseases. Rare loss-of-function gene variants of TNFRSF8(CD30) are associated with protection from severe asthma (Olafsdottir et al., Nature Communications, 2020). sCD30 and sCD30L levels have been reported to be elevated in plasma or serum in indications for several diseases, including asthma, inflammatory bowel disease, and multiple sclerosis, suggesting higher levels of signaling activity in pathways associated with these diseases. Disruption of CD30-CD30L signaling in mice, either through genetic or pharmacological models, has been shown to improve disease severity in mouse models of inflammatory diseases (see, e.g., Kennedy et al., Immunology. 2006 Jun;118(2):143-52). While anti-CD30L antibodies are well known (see, for example, International Publication No. 2013 / 163377 and International Publication No. 20221 / 77963), alternative therapeutic antagonism of CD30-CD30L signaling by, for example, anti-CD30L antibodies with increased affinity and / or potency in human patients may offer broad clinical benefits. [Prior art documents] [Patent Documents]
[0007] [Patent Document 1] International Publication No. 2013 / 163377 Pamphlet [Patent Document 2] International Publication No. 20221 / 77963 brochure [Non-patent literature]
[0008] [Non-Patent Document 1] Olafsdottir et al.,Nature Communications,2020 [Non-Patent Document 2] Kennedy et al.,Immunology.2006 Jun;118(2):143-52 [Overview of the project] [Means for solving the problem]
[0009] This disclosure provides antibodies that bind to CD30L, in part, including HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6. In one embodiment, the antibody comprises HCDR1 consisting of SEQ ID NO: 1, HCDR2 consisting of SEQ ID NO: 2, HCDR3 consisting of SEQ ID NO: 3, LCDR1 consisting of SEQ ID NO: 4, LCDR2 consisting of SEQ ID NO: 5, and LCDR3 consisting of SEQ ID NO: 6.
[0010] In any of the above embodiments, the antibody comprises a heavy chain variable region (HCVR) containing SEQ ID NO: 19, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 19, and a light chain variable region (LCVR) containing SEQ ID NO: 20, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 20. In one embodiment, the variant of SEQ ID NO: 19 comprises substitutions, insertions, or deletions of 6, 5, 4, 3, 2, or 1 or fewer amino acids relative to SEQ ID NO: 19, and the variant of SEQ ID NO: 20 comprises substitutions, insertions, or deletions of 6, 5, 4, 3, 2, or 1 or fewer amino acids relative to SEQ ID NO: 20, where the mutation occurs in the HCVR, LCVR, or the framework region of both HCVR and LCVR. In one embodiment, the antibody comprises an HCVR containing SEQ ID NO: 19 and an LCVR containing SEQ ID NO: 20. In one embodiment, the antibody comprises HCVR, represented by SEQ ID NO: 19, and LCVR, represented by SEQ ID NO: 20.
[0011] In any of the embodiments described above, the antibody comprises a heavy chain (HC) containing SEQ ID NO: 25 and a light chain (LC) containing SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, where each HC contains SEQ ID NO: 25 and each LC contains SEQ ID NO: 26. In another embodiment, the antibody comprises two HCs and two LCs, where each HC consists of SEQ ID NO: 25 and each LC consists of SEQ ID NO: 26.
[0012] This disclosure provides an antibody that binds to CD30L, comprising HCDR1 comprising SEQ ID NO: 7, HCDR2 comprising SEQ ID NO: 8, HCDR3 comprising SEQ ID NO: 9, LCDR1 comprising SEQ ID NO: 10, LCDR2 comprising SEQ ID NO: 11, and LCDR3 comprising SEQ ID NO: 12. In any of the above embodiments, the antibody comprises HCDR1 comprising SEQ ID NO: 7, HCDR2 comprising SEQ ID NO: 8, HCDR3 comprising SEQ ID NO: 9, LCDR1 comprising SEQ ID NO: 10, LCDR2 comprising SEQ ID NO: 11, and LCDR3 comprising SEQ ID NO: 12.
[0013] In any of the above embodiments, the antibody includes HCVR containing SEQ ID NO: 23, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 23, and LCVR containing SEQ ID NO: 24, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 24. In one embodiment, the variant of SEQ ID NO: 23 includes substitutions, insertions, or deletions of 6, 5, 4, 3, 2, or 1 or fewer amino acids to SEQ ID NO: 23, and the variant of SEQ ID NO: 24 includes substitutions, insertions, or deletions of 6, 5, 4, 3, 2, or 1 or fewer amino acids to SEQ ID NO: 24, where the mutation occurs in the framework region of HCVR, LCVR, or both HCVR and LCVR. In one embodiment, the antibody includes HCVR containing SEQ ID NO: 23 and LCVR containing SEQ ID NO: 24. In one embodiment, the antibody includes HCVR consisting of SEQ ID NO: 23 and LCVR consisting of SEQ ID NO: 24.
[0014] In any of the embodiments described above, HC comprises SEQ ID NO: 29 and LC comprises SEQ ID NO: 30. In one embodiment, the antibody comprises two HCs and two LCs, where each HC comprises SEQ ID NO: 29 and each LC comprises SEQ ID NO: 30. In one embodiment, the antibody comprises two HCs and two LCs, where each HC consists of SEQ ID NO: 29 and each LC consists of SEQ ID NO: 30. In one embodiment, the antibody consists of two HCs and two LCs, where each HC consists of SEQ ID NO: 29 and each LC consists of SEQ ID NO: 30.
[0015] This specification provides an anti-CD30L antibody comprising an HC containing SEQ ID NO: 29 and an LC containing SEQ ID NO: 30. Also provided is an anti-CD30L antibody comprising two HCs and two LCs, each HC comprising SEQ ID NO: 29 and each LC comprising SEQ ID NO: 30. Furthermore, an anti-CD30L antibody comprising two HCs and two LCs is provided, each HC comprising SEQ ID NO: 29 and each LC comprising SEQ ID NO: 30.
[0016] Also provided is an anti-CD30L antibody comprising an HC containing SEQ ID NO: 33, 36, or 39 and an LC containing SEQ ID NO: 30. In one embodiment, the HC contains SEQ ID NO: 33 and the LC contains SEQ ID NO: 30. In one embodiment, the antibody comprises two HCs and two LCs, where each HC contains SEQ ID NO: 33 and each LC contains SEQ ID NO: 30. In another embodiment, the HC contains SEQ ID NO: 36 and the LC contains SEQ ID NO: 30. In one embodiment, the antibody comprises two HCs and two LCs, where each HC contains SEQ ID NO: 36 and each LC contains SEQ ID NO: 30. In a further embodiment, the HC contains SEQ ID NO: 39 and the LC contains SEQ ID NO: 30. In one embodiment, the antibody comprises two HCs and two LCs, where each HC contains SEQ ID NO: 39 and each LC contains SEQ ID NO: 30.
[0017] The present specification also provides an anti-CD30L antibody comprising a heavy chain (HC) comprising SEQ ID NO: 25 and a light chain (LC) comprising SEQ ID NO: 26. An anti-CD30L antibody comprising two HCs and two LCs is provided, wherein each HC comprises SEQ ID NO: 25 and each LC comprises SEQ ID NO: 26. Further provided is an anti-CD30L antibody consisting of two HCs and two LCs, wherein each HC consists of SEQ ID NO: 25 and each LC consists of SEQ ID NO: 26. Also provided is an anti-CD30L antibody comprising an HC comprising SEQ ID NO: 31, 34, or 37 and an LC comprising SEQ ID NO: 26. In one embodiment, the HC comprises SEQ ID NO: 31 and the LC comprises SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, wherein each HC comprises SEQ ID NO: 31 and each LC comprises SEQ ID NO: 26. In one embodiment, the HC comprises SEQ ID NO: 34 and the LC comprises SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, wherein each HC comprises SEQ ID NO: 34 and each LC comprises SEQ ID NO: 26. In another embodiment, the HC comprises SEQ ID NO: 37 and the LC comprises SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, wherein each HC comprises SEQ ID NO: 37 and each LC comprises SEQ ID NO: 26.
[0018] In one embodiment, an antibody described herein: (a) binds to human CD30L with a dissociation constant (KD) value of less than 100, 75, or 50 picomolar as measured by surface plasmon resonance or kinetic exclusion assay; (b) binds to cynomolgus monkey CD30L with a KD value of less than 100, 75, or 50 picomolar as measured by surface plasmon resonance or kinetic exclusion assay; (c) binds to human CD30L and cynomolgus monkey CD30L with affinities within 10-fold of each other; (d) blocks the binding of human CD30L to human CD30 as determined by a cell-based assay; or (e) inhibits CD30L-induced IL-8 secretion as determined by a cell-based assay.
[0019] In one embodiment of the antibody of the present disclosure, the antibody specifically binds to CD30L. For example, there is provided an antibody that specifically binds to CD30L comprising HCDR1 comprising SEQ ID NO: 1, HCDR2 comprising SEQ ID NO: 2, HCDR3 comprising SEQ ID NO: 3, LCDR1 comprising SEQ ID NO: 4, LCDR2 comprising SEQ ID NO: 5, and LCDR3 comprising SEQ ID NO: 6. Also provided is an antibody that specifically binds to CD30L comprising HCDR1 comprising SEQ ID NO: 7, HCDR2 comprising SEQ ID NO: 8, HCDR3 comprising SEQ ID NO: 9, LCDR1 comprising SEQ ID NO: 10, LCDR2 comprising SEQ ID NO: 11, and LCDR3 comprising SEQ ID NO: 12.
[0020] The present disclosure provides a method of treating an inflammatory disorder in a patient, comprising administering to the patient an effective amount of an antibody of the present disclosure. In one embodiment, the inflammatory disorder is asthma. In one embodiment, the inflammatory disorder is severe asthma. In one embodiment, the inflammatory disorder is lupus. In some embodiments, the inflammatory disorder is ulcerative colitis.
[0021] Also provided is an isolated polynucleotide molecule comprising a nucleic acid sequence encoding any heavy chain and / or light chain of the antibody of the present disclosure. In one aspect, there is provided a polynucleotide encoding HCVR; LCVR; HC; LC; or LCVR and HCVR of an antibody that binds to CD30L, wherein the antibody comprises HCDR1 comprising SEQ ID NO: 1, HCDR2 comprising SEQ ID NO: 2, HCDR3 comprising SEQ ID NO: 3, LCDR1 comprising SEQ ID NO: 4, LCDR2 comprising SEQ ID NO: 5, and LCDR3 comprising SEQ ID NO: 6. In one embodiment, the antibody comprises HCVR comprising SEQ ID NO: 19 and LCVR comprising SEQ ID NO: 20. In one embodiment, the antibody comprises HC comprising SEQ ID NO: 25 and LC comprising SEQ ID NO: 26.
[0022] In one embodiment, the polynucleotide encodes the antibody HCVR, where the amino acid sequence of HCVR includes SEQ ID NO: 19. In one embodiment, the polynucleotide encodes the antibody LCVR, where the amino acid sequence of LCVR includes SEQ ID NO: 20. In one embodiment, the polynucleotide encodes both the antibody HCVR and LCVR, where the amino acid sequence of HCVR includes SEQ ID NO: 19 and the amino acid sequence of LCVR includes SEQ ID NO: 20.
[0023] In one embodiment, the polynucleotide encodes the HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 25. In one embodiment, the polynucleotide encodes the LC of the antibody, where the amino acid sequence of LC includes SEQ ID NO: 26. In one embodiment, the polynucleotide encodes both the LC and HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 25, and the amino acid sequence of LC includes SEQ ID NO: 26.
[0024] In one embodiment, the polynucleotide encoding the LC of the antibody includes the nucleic acid sequence of SEQ ID NO: 18. In one embodiment, the polynucleotide encoding the HC of the antibody includes the nucleic acid sequence of SEQ ID NO: 21.
[0025] In one embodiment, a polynucleotide encoding HCVR;LCVR;HC;LC; or LCVR and HCVR is provided for an antibody that binds to CD30L, where the antibody comprises HCDR1 including SEQ ID NO: 7, HCDR2 including SEQ ID NO: 8, HCDR3 including SEQ ID NO: 9, LCDR1 including SEQ ID NO: 10, LCDR2 including SEQ ID NO: 11, and LCDR3 including SEQ ID NO: 12. In one embodiment, the antibody comprises HCVR including SEQ ID NO: 23 and LCVR including SEQ ID NO: 24. In one embodiment, the antibody comprises HC including SEQ ID NO: 29 and LC including SEQ ID NO: 30.
[0026] In one embodiment, the polynucleotide encodes the antibody HCVR, where the amino acid sequence of HCVR includes SEQ ID NO: 23. In one embodiment, the polynucleotide encodes the antibody LCVR, where the amino acid sequence of LCVR includes SEQ ID NO: 24. In one embodiment, the polynucleotide encodes both the antibody HCVR and LCVR, where the amino acid sequence of HCVR includes SEQ ID NO: 23, and the amino acid sequence of LCVR includes SEQ ID NO: 24.
[0027] In one embodiment, the polynucleotide encodes the HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 29. In one embodiment, the polynucleotide encodes the LC of the antibody, where the amino acid sequence of LC includes SEQ ID NO: 30. In one embodiment, the polynucleotide encodes both the LC and HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 29 and the amino acid sequence of LC includes SEQ ID NO: 30.
[0028] In one embodiment, the polynucleotide encoding the antibody LC includes the nucleic acid sequence of SEQ ID NO: 16. In another embodiment, the polynucleotide encoding the antibody HC includes the nucleic acid sequence of SEQ ID NO: 17.
[0029] In one embodiment, the Disclosure provides a vector comprising any of the polynucleotides of the Disclosure. In one embodiment, the vector is a recombinant expression vector. In one embodiment, the vector comprises polynucleotides encoding HCVR;LCVR;HC;LC; or LCVR and HCVR of an antibody bound to CD30L, wherein the antibody comprises HCDR1 comprising SEQ ID NO: 1, HCDR2 comprising SEQ ID NO: 2, HCDR3 comprising SEQ ID NO: 3, LCDR1 comprising SEQ ID NO: 4, LCDR2 comprising SEQ ID NO: 5, and LCDR3 comprising SEQ ID NO: 6. In one embodiment, the antibody comprises HCVR comprising SEQ ID NO: 19 and LCVR comprising SEQ ID NO: 20. In one embodiment, the antibody comprises HC comprising SEQ ID NO: 25 and LC comprising SEQ ID NO: 26.
[0030] In one embodiment, the vector comprises a polynucleotide encoding the HCVR of the antibody, wherein the amino acid sequence of HCVR includes SEQ ID NO: 19. In one embodiment, the vector comprises a polynucleotide encoding the LCVR of the antibody, wherein the amino acid sequence of LCVR includes SEQ ID NO: 20. In one embodiment, the vector comprises a polynucleotide encoding both the HCVR and LCVR of the antibody, wherein the amino acid sequence of HCVR includes SEQ ID NO: 19, and the amino acid sequence of LCVR includes SEQ ID NO: 20.
[0031] In one embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 25. In one embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, where the amino acid sequence of LC includes SEQ ID NO: 26. In one embodiment, the vector comprises a polynucleotide encoding both the LC and HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 25, and the amino acid sequence of LC includes SEQ ID NO: 26.
[0032] In one embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, where the polynucleotide encoding the LC comprises the nucleic acid sequence of SEQ ID NO: 18. In another embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, where the polynucleotide encoding the HC comprises the nucleic acid sequence of SEQ ID NO: 21.
[0033] Also provided are vectors containing polynucleotides encoding HCVR;LCVR;HC;LC; or LCVR and HCVR, which bind to CD30L, wherein the antibody comprises HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12. In one embodiment, the antibody comprises HCVR containing SEQ ID NO: 23 and LCVR containing SEQ ID NO: 24. In one embodiment, the antibody comprises HC containing SEQ ID NO: 29 and LC containing SEQ ID NO: 30.
[0034] In one embodiment, the vector comprises a polynucleotide encoding the HCVR of the antibody, where the amino acid sequence of HCVR includes SEQ ID NO: 23. In one embodiment, the vector comprises a polynucleotide encoding the LCVR of the antibody, where the amino acid sequence of LCVR includes SEQ ID NO: 24. In one embodiment, the vector comprises a polynucleotide encoding both the HCVR and LCVR of the antibody, where the amino acid sequence of HCVR includes SEQ ID NO: 23, and the amino acid sequence of LCVR includes SEQ ID NO: 24.
[0035] In one embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 29. In another embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, where the amino acid sequence of LC includes SEQ ID NO: 30. In yet another embodiment, the vector comprises a polynucleotide encoding both the LC and HC of the antibody, where the amino acid sequence of HC includes SEQ ID NO: 29 and the amino acid sequence of LC includes SEQ ID NO: 30.
[0036] In one embodiment, the vector comprises a polynucleotide encoding the LC of the antibody, where the polynucleotide encoding the LC comprises the nucleic acid sequence of SEQ ID NO: 16. In another embodiment, the vector comprises a polynucleotide encoding the HC of the antibody, where the polynucleotide encoding the HC of the antibody comprises the nucleic acid sequence of SEQ ID NO: 17.
[0037] This disclosure provides a host cell comprising any of the polynucleotides of this disclosure or any of the vectors of this disclosure. In one embodiment, a host cell into which a vector of this disclosure has been introduced is provided. In one embodiment, the host cell comprises a vector comprising a polynucleotide encoding the HC of an antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25. In one embodiment, the host cell comprises a vector comprising a polynucleotide encoding the LC of an antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 26. In one embodiment, a host cell is provided comprising a vector comprising polynucleotides encoding the HC and LC of an antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25 and the amino acid sequence of the LC comprises SEQ ID NO: 26. The present invention also provides a process for producing an antibody comprising two HCs and two LCs, wherein the process comprises (i) culturing a host cell of this disclosure under conditions in which the antibody is expressed, and (ii) recovering the expressed antibody. In one embodiment, each HC comprises SEQ ID NO: 25 and each LC comprises SEQ ID NO: 26. The disclosure also provides an antibody obtained by the said process.
[0038] In one embodiment, the host cell comprises a vector containing a polynucleotide encoding the HC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29. In one embodiment, the host cell comprises a vector containing a polynucleotide encoding the LC of the antibody, wherein the amino acid sequence of the LC comprises SEQ ID NO: 30. In one embodiment, a host cell is provided comprising a vector containing polynucleotides encoding the HC and LC of the antibody, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29 and the amino acid sequence of the LC comprises SEQ ID NO: 30. The present invention also provides a process for producing an antibody comprising two HCs and two LCs, wherein the process comprises (i) culturing the host cell of the present disclosure under conditions in which the antibody is expressed, and (ii) recovering the expressed antibody. In one embodiment, each HC comprises SEQ ID NO: 29 and each LC comprises SEQ ID NO: 30. The present disclosure also provides an antibody obtained by the process described above.
[0039] The present invention provides antibodies for therapeutic use.
[0040] This disclosure provides antibodies for use in the treatment of inflammatory disorders. In one embodiment, the inflammatory disorder is asthma. In one embodiment, the inflammatory disorder is lupus. In some embodiments, the inflammatory disorder is ulcerative colitis.
[0041] This disclosure provides antibodies for the manufacture of pharmaceuticals for the treatment of inflammatory disorders. In one embodiment, the inflammatory disorder is asthma. In one embodiment, the inflammatory disorder is lupus. In some embodiments, the inflammatory disorder is ulcerative colitis.
[0042] This disclosure also provides a pharmaceutical composition comprising the antibody of this disclosure and one or more pharmaceutically acceptable carriers, diluents, or excipients. [Modes for carrying out the invention]
[0043] This disclosure provides an anti-CD30L antibody and methods for producing and using the antibody. The antibody of this disclosure exhibits improved properties, such as stability-related properties, compared to other antibodies evaluated during antibody production. Following an initial screening of over 3,500 antibodies, 368 clones were further evaluated for their functional activity in binding to CD30L and blocking the interaction between CD30 (receptor) and CD30L (ligand), using cell-based assays measuring IL-8 secretion. Of these 368 clones, 22 were found to bind with high affinity to native CD30L expressed on human and cynomolgus monkey primary T cells. These 22 clones were subjected to various in silico analytical tools, and 12 clones were selected for further optimization. These 12 antibodies were subjected to an extensive hotspot repair process using a yeast display screening platform that analyzed a total of 395 combinatorial mutant Fab variants, and then tested for CD30L binding using yeast display methods. Next, nine antibodies were converted to IgG1-SEFL2-YTE and tested using five different cell-based assays before and after heat and light stress. These nine antibodies were also tested for biochemical and biophysical characterization, in part, for solubility, viscosity, chemical stability, physical stability, and photostability. Of these nine antibodies, antibodies 46265 and 46183 exhibited desirable physicochemical properties and were more stable compared to the other antibodies, which exhibited undesirable properties, including high viscosity, low activity, antibody clipping, and / or solubility and aggregation problems after increasing pH. All nine antibodies were binned together, indicating that they bind to the same or similar epitopes; however, after considerable manipulation and screening, only antibodies 46265 and 46183 exhibited desirable properties as potential therapeutic agents.
[0044] In one embodiment, the anti-CD30L antibody disclosed herein (i) specifically binds to human CD30L and cynomolgus monkey CD30L with affinity of no more than 10-fold to each other in a low picomolar concentration range; (ii) exhibits an IC50 value at picomolar concentration in a functional assay; (iii) shows an increased half-life; and / or (iv) exhibits acceptable physicochemical properties such as acceptable levels of viscosity and stability.
[0045] As used herein, “antibody” is an immunoglobulin molecule comprising two heavy chains (HC) and two light chains (LC) linked together by disulfide bonds. The amino-terminal portions of each LC and HC contain a variable region of approximately 100–120 amino acids, primarily involved in antigen recognition via the CDRs contained therein. The CDRs are separated by a more conserved region called the framework region ("FR"). Each LCVR and HCVR consists of three CDRs and four FRs arranged in the following order from amino-terminal to carboxyl-terminal: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The three CDRs of the LC are referred to as “LCDR1, LCDR2, and LCDR3,” and the three CDRs of the HC are referred to as “HCDR1, HCDR2, and HCDR3.” The CDRs contain most of the residues that form specific interactions with the antigen. Therefore, the functional ability of an antibody to bind to a particular antigen is greatly influenced by the amino acid residues within these six CDRs. The assignment of amino acids to the CDR domains within the LCVR and HCVR regions of the antibodies disclosed herein is based on the well-known Kabat numbering rules (Kabat, et al., Ann.NY Acad.Sci.190:382-93(1971); Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, USD Department of Health and Human Services, NIH Publication No.91-3242(1991)) unless otherwise stated.Furthermore, it is understood that other numbering conventions may also be used, such as Chothia (Chothia et al., “Canonical structures for the hypervariable regions of immunoglobulins”, Journal of Molecular Biology, 196, 901-917 (1987); Al-Lazikani et al., “Standard conformations for the canonical structures of immunoglobulins”, Journal of Molecular Biology, 273, 927-948 (1997)) and / or North (North et al., “A New Clustering of Antibody CDR Loop Conformations”, Journal of Molecular Biology, 406, 228-256 (2011)).
[0046] An "anti-CD30L antibody" is an antibody that binds to CD30L. In one embodiment, the anti-CD30L antibody specifically binds to CD30L. The antigen-binding protein has a dissociation constant (KD) of ≤10, as measured by surface plasma resonance (e.g., BIACore, GE-Healthcare Uppsala, Sweden) or binding equilibrium exclusion (KinExA, Sapidyne, Boise, Idaho). -7 When an antigen is bound at M, the antigen-binding protein is said to "specifically bind" to the antigen. In one embodiment, an anti-CD30L antibody specifically binds to human CD30L. In one embodiment, an anti-CD30L antibody specifically binds to cynomolgus monkey (cyno) CD30L. In one embodiment, an anti-CD30L antibody specifically binds to human CD30L with an affinity no more than 10 times that of an anti-CD30L antibody that binds to cynomolgus monkey CD30L. The antibodies, polypeptides, and other molecules of this disclosure are "isolated" if they exist in a physical environment different from the environment in which they were produced or would naturally exist.
[0047] Furthermore, as part of this disclosure, Fabs, scFabs, and scFvs containing the CDR of the anti-CD30L antibody of this disclosure are also intended. Furthermore, as part of this disclosure, Fabs and scFvs containing the variable region (LCVR and / or HCVR) of the anti-CD30L antibody of this disclosure are also intended.
[0048] The antibodies disclosed herein may be IgG1, IgG2, or IgG4. The antibodies disclosed herein may be human antibodies or humanized antibodies. In the context of monoclonal antibodies, the terms “human” and “humanized” are well known to those skilled in the art (Weiner LJ, J.Immunother.2006;29:1-9; Mallbris L, et al., J.Clin.Aesthet.Dermatol.2016;9:13-15).
[0049] The antibodies of this disclosure, for example, IgG1 antibodies, may have YTE mutations (EU numbering M252Y, S254T, and T256E) that increase the antibody half-life, and / or SEFL2 mutations (EU numbering R292C, N297G, and V302C) that reduce or eliminate effector function. Antibodies containing YTE and / or SEFL2 mutations, as well as antibodies not containing YTE and SEFL2 mutations, are envisioned as part of this disclosure. The antibodies may also have a cysteine clamp added to enhance stability after removal of glycosylation sites.
[0050] The term "nucleic acid sequence" is intended to encompass polymers of DNA or RNA, i.e., polynucleotides, which may be single-stranded or double-stranded, and may include unnatural or modified nucleotides. The terms "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," and "polynucleotide" may be used interchangeably herein to refer to polymeric forms of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of a molecule and therefore include double-stranded DNA and single-stranded DNA, as well as double-stranded RNA and single-stranded RNA. The term "modified nucleic acid sequence" includes analogues of either RNA or DNA made from nucleotide analogues, and modified polynucleotides such as methylated and / or end-protected polynucleotides as equivalents, but are not limited to these. The polynucleotides of this disclosure include DNA molecules containing polynucleotide sequences that do not exist in nature, encoding a polypeptide having at least one amino acid sequence from the polypeptides of the anti-CD30L antibody of this disclosure (e.g., heavy chain, light chain, variable heavy chain, and variable light chain).
[0051] By operably ligating the DNA encoding the HCVR to another DNA molecule encoding the heavy chain constant region, isolated DNA encoding the HCVR region can be converted into a full-length heavy chain gene. The sequences of heavy chain constant region genes in other mammals, as in humans, are known in the art. DNA fragments containing these regions can be obtained, for example, by standard PCR amplification.
[0052] By operably ligating the DNA encoding the LCVR to another DNA molecule encoding the light chain constant region, the isolated DNA encoding the LCVR region can be converted into a full-length light chain gene. The sequences of light chain constant region genes in other mammals, as in humans, are known in the art. DNA fragments containing these regions can be obtained by standard PCR amplification. The light chain constant region can be a kappa or lambda constant region. In some embodiments, the light chain constant region is a kappa constant region.
[0053] The terms “coding” or “encoding” refer to a polynucleotide sequence that codes for one or more amino acids. This term does not require a start codon or stop codon. This disclosure encompasses nucleic acid molecules that code for anti-CD30L antibody polypeptide sequences, including a heavy chain variable region, a light chain variable region, a heavy chain, and a component that codes for the light chain.
[0054] The polynucleotides of this disclosure can be expressed in host cells after their sequences have been operably ligated to an expression control sequence. Such expression vectors can typically be replicated within a host organism, either as an episome or as an integral part of host chromosomal DNA. Expression vectors usually include selection markers, such as tetracycline, neomycin, and dihydrofolate reductase, so that these cells transformed with the desired DNA sequence can be detected.
[0055] Transformed cells can be cultured under conditions that promote polypeptide expression, and these polypeptides can be recovered by conventional protein purification procedures. The polypeptides intended for use herein include substantially homogeneous recombinant mammalian polypeptides that are substantially free from the contamination of endogenous material. Cells containing nucleic acids encoding the anti-CD30L antibody of this disclosure also include hybridomas.
[0056] The polynucleotide encoding the amino acid sequence of the anti-CD30L antibody of this disclosure may be of any length suitable for the desired use or function, may include one or more further sequences, such as regulatory sequences, and / or may be part of a larger nucleic acid, such as a vector. Those skilled in the art will understand that, due to the degeneracy of genetic coding, each of the polypeptide sequences disclosed herein may be encoded by a number of other nucleic acid sequences. Mutations can also be introduced into nucleic acids without significantly altering the biological activity of the polypeptide they encode. For example, nucleotide substitutions can be made that lead to amino acid substitutions at non-essential amino acid residues.
[0057] It will be understood that the anti-CD30L antibodies of this disclosure may have at least one amino acid substitution, insofar as the anti-CD30L antibody retains the same or better desired binding specificity (e.g., binding to CD30L). Therefore, modifications to anti-CD30L antibodies are encompassed within the scope of this disclosure. Such modifications may include amino acid substitutions that are conserved or non-conservative, as long as they do not impair the desired binding ability of the binding construct. Conservative amino acid substitutions may include non-native amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptide mimes and other forms in which the amino acid moiety is reversed or inverted. Conservative amino acid substitutions may also include substitutions of native amino acid residues with normative residues, which have little effect on the polarity or charge of the amino acid residue at that position.
[0058] Human CD30L consists of the amino acid sequence of SEQ ID NO: 40. Crynomolgus monkey CD30L consists of the amino acid sequence of SEQ ID NO: 41.
[0059] As used herein with respect to nucleic acid sequences, the term “variant” means (i) a portion or fragment of a referenced nucleotide sequence, (ii) a complement to a referenced nucleotide sequence or a portion thereof, (iii) a nucleic acid substantially identical to a referenced nucleic acid or its complement, or (iv) a nucleic acid that hybridizes under stringent conditions with a referenced nucleic acid, its complement, or a sequence substantially identical thereto. As used herein with respect to peptides or polypeptides, the term “variant” means a peptide or polypeptide whose amino acid sequence differs due to an amino acid insertion, deletion, or conservative substitution, but which retains at least one biological activity of the reference peptide or polypeptide. A variant may also mean a protein having an amino acid sequence substantially identical to a reference protein having an amino acid sequence that retains at least one biological activity. The term “isoform” may be used herein to refer to a variant of a polypeptide or protein. Typically, a protein isoform is a set of very similar members of a group of proteins that originate from a single gene or gene family and are the result of genetic differences. Some protein isoforms exhibit the same or similar biological functions, while others have their own unique functions. Isoforms can be generated from alternative splicing of a single gene, the use of a variable promoter, or other post-transcriptional modifications.
[0060] A variant may be a nucleic acid sequence that is substantially identical over the entire length of the entire gene sequence or fragment thereof. The nucleic acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the entire length of the gene sequence or fragment thereof. In other embodiments, a variant may be an amino acid sequence that is substantially identical over the entire length of the amino acid sequence or fragment thereof. The amino acid sequence may be 95%, 96%, 97%, 98%, 99%, or 100% identical over the entire length of the amino acid sequence or fragment thereof. In one embodiment, a variant of a particular antibody amino acid sequence is one in which the mutation occurs outside the CDR of the antibody, and such a mutation occurs in the HCVR, LCVR, or both HCVR and LCVR framework regions. In another embodiment, a variant of a specific amino acid sequence is one in which the mutation occurs outside the CDR of the antibody, and such a mutation occurs in the HCVR, LCVR, or both HCVR and LCVR framework regions, where the antibody retains the mutated residue during antibody hotspot repair.
[0061] "Sequence identity" refers to the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences as determined by comparing the sequences. The identity between two sequences is defined, as identified herein, preferably by evaluating their identity over the entire length of the sequences.
[0062] When comparing the identity of two or more nucleotide or amino acid sequences, the degree of sequence identity between the first and second sequences may be calculated using methods known to those skilled in the art, for example, by dividing the number of residues in the first sequence that are identical to the residues at corresponding positions in the second sequence by the total number of residues in the first sequence and multiplying by 100%, or by using computer algorithms known for sequence alignment, such as NCBI Blast, e.g., BLASTN and BLASTP (Altschul, SF et al, J. Mol. Biol. 215:403-410 (1990), GCG program package (Devereux, J., et al, Nucleic Acids Research 12(1); 387 (1984)), BestFit, FASTA, and EMBOSS Needle (Madeira, F., et al, Nucleic Acids Research 47(W1); W636-W641 (2019)).
[0063] The antibodies of this disclosure can be readily produced in mammalian cells, including, but not limited to, CHO cells, NSO cells, HEK293 cells, or COS cells. The host cells are cultured using techniques well known in the art.
[0064] Vectors containing the target polynucleotide sequence (e.g., polynucleotides encoding antibody polypeptides and regulatory expression sequences) can be introduced into host cells by well-known methods that vary depending on the type of cell host. Examples of vectors, but not limited to, include plasmids, viral vectors, non-episome mammalian vectors, and expression vectors, such as recombinant expression vectors.
[0065] The recombinant expression vectors of this disclosure may contain the nucleic acids of this disclosure in a form suitable for expression of those nucleic acids in host cells. The recombinant expression vectors include one or more regulatory sequences selected based on the host cells to be used for expression, which are operably ligated to the nucleic acid sequence to be expressed. Regulatory sequences may include those that constitutively direct the expression of nucleotide sequences in many types of host cells (e.g., SV40 early gene enhancer, Rouss sarcoma virus promoter, and cytomegalovirus promoter), or those that direct the expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences, Voss et al., 1986, Trends Biochem. Sci. 11:287, Maniatis et al., 1987, Science). See 236:1237 (the entire text of which is incorporated herein by reference) and those that direct the inducible expression of nucleotide sequences in response to specific treatments or conditions (e.g., metallothionein promoters in mammalian cells and tet-responsive and / or streptomycin-responsive promoters in both prokaryotes and eukaryotes (see ibid.)). Those skilled in the art will understand that the design of expression vectors may depend on factors such as the selection of host cells to be transformed and the desired level of protein expression. When an expression vector of the present disclosure is introduced into a host cell, it is possible to produce a protein or peptide, including a fusion protein or peptide encoded by nucleic acids as described herein.
[0066] Typically, an expression vector used in any host cell will include sequences for plasmid maintenance and sequences for the cloning and expression of exogenous nucleotide sequences. In certain embodiments, such sequences, collectively referred to as “flanking sequences,” will typically include the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence having donor and acceptor splice sites, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and one or more selectable marker elements. The leader sequence may include sequence number 32 (MDMRVPAQLLGLLLLWLRGARC) encoded by sequence number 28 (atggacatgagagtgcctgcacagctgctgggcctgctgctgctgctgtggctgagaggcgccagatgc). The leader sequence may include the amino acid sequence shown by sequence number 27 (MAWALLLLTLLTQGTGSWA), which can be coded by sequence number 22 (atggcctggg ctctgctgct cctcaccctc ctcactcagg gcacagggtc ctgggcc).
[0067] Various protein purification methods may be used to purify proteins, including but not limited to antibodies, and such methods are well known in the art.
[0068] The anti-CD30L antibody of this disclosure can be biosynthesized, purified, and formulated for administration by well-known methods. For example, suitable host cells such as HEK293 or CHO are transfected transiently or stably with an expression system for secreting the antibody or binding domain, using a predetermined HC:LC vector ratio when two vectors are used. Well-known vectors are suitable for expressing and secreting antibodies from these commonly used host cells. After antibody expression and secretion, the medium is clarified to remove cells, and the clarified medium is purified using one of many commonly used techniques. For example, the medium may be added to a protein A or G column equilibrated with a buffer such as phosphate-buffered saline (pH 7.4). The column is washed to remove nonspecific binding components. For example, the bound antibody is eluted by a pH gradient (e.g., from 0.1M sodium phosphate buffer pH 6.8 to 0.1M sodium citrate buffer pH 2.5). The antibody fraction is detected and then pooled, for example by SDS-PAGE. Further purification is optional and depends on the intended use. Antibodies may be concentrated and / or filtered using conventional techniques. Host cells and growth medium components, as well as other substances other than antibodies, such as soluble aggregates and polymers of the antibody, may be efficiently reduced or removed by conventional techniques including size exclusion chromatography, hydrophobic interaction chromatography, cation exchange chromatography, anion exchange chromatography, affinity chromatography, or hydroxyapatite chromatography. The purity of the antibody after these chromatographic steps is typically greater than 95%. The product may be frozen at -70°C or lyophilized.
[0069] In exemplary embodiments, the antibodies of this disclosure contain HCs with C-terminal lysine, as shown in SEQ ID NOs. 25, 29, 34, and 36. In alternative embodiments, the antibodies contain HCs without C-terminal lysine, as shown in SEQ ID NOs. 31, 33, 37, and 39. In addition, the N-terminal glutamine and / or N-terminal glutamic acid of the HCs may be converted to pyroglutamic acid, as shown in SEQ ID NOs. Any of these forms are envisioned for the antibodies of this disclosure.
[0070] The anti-CD30L antibody or pharmaceutical composition containing the same described herein is intended to treat inflammatory diseases. Inflammatory diseases include, but are not limited to, asthma (including severe asthma), rheumatoid arthritis, lupus, and autoimmune diseases such as multiple sclerosis, ulcerative colitis, and atopic dermatitis.
[0071] Arthritis can be treated by the methods and compositions disclosed herein. As used herein, the term “arthritis” refers primarily to a chronic inflammatory condition affecting the joints or the connective tissue surrounding the joints, although various other organs may also be affected.
[0072] Arthritis may be caused by autoimmunity or trauma, or it may be triggered by exposure to an external antigen, leading to a chronic state that is no longer dependent on the continued presence of the triggering antigen. As used herein, the term “arthritis” includes: osteoarthritis; degenerative arthritis; rheumatoid arthritis (adult and juvenile); Lyme disease arthritis; reactive arthritis, including Reiter’s disease; psoriatic arthritis; tuberous arthritis; and seronegative spondyloarthritis, including but not limited to ankylosing spondylitis.
[0073] The antibodies described herein are useful for treating a variety of rheumatic disorders, which are defined herein as chronic diseases involving painful, often multiple, localized inflammation of the joints, muscles, nerves, tendons, skin, eyes, connective tissue, or various other organ systems. These include, but are not limited to, arthritis; scleroderma; gout; systemic lupus erythematosus; polymyalgia rheumatica; Still's disease; chronic uveitis; dermatomyositis and polymyositis (including sporadic inclusion body myositis), disorders resulting in inflammation of voluntary muscles. Systemic lupus erythematosus can cause inflammation of the joints, skin, kidneys, heart, lungs, blood vessels, and brain. In its advanced forms, systemic lupus erythematosus can lead to renal failure.
[0074] Methods for using the antibodies described herein in therapies for treating various endocrine disorders, including but not limited to: juvenile or adult-onset diabetes (including autoimmune, insulin-dependent diabetes; non-insulin-dependent and obesity-mediated diabetes); idiopathic adrenal atrophy; Addison's disease; hypothyroidism; Graves' disease; autoimmune thyroiditis such as Hashimoto's thyroiditis; and polyglandular autoimmune syndromes (types I and II).
[0075] The antibodies described herein are also useful in the treatment of gastrointestinal conditions, including but not limited to: autoimmune sclerosing cholangitis; celiac disease; inflammatory bowel diseases, including Crohn's disease and ulcerative colitis; autoimmune pancreatitis, including chronic pancreatitis; idiopathic gastroparesis; and idiopathic ulcers, including gastric and duodenal ulcers.
[0076] Furthermore, this also includes methods for using the antibodies described herein in the treatment of genitourinary disorders, such as autoimmune and idiopathic glomerulonephritis, and chronic idiopathic prostatitis (nonbacterial), including benign prostatic hyperplasia.
[0077] Furthermore, this specification also provides methods for using the antibodies described herein in therapeutics for treating a variety of blood disorders, including but not limited to: malignant and aplastic anemia, and Fanconi aplastic anemia; autoimmune hemolytic anemia; idiopathic thrombocytopenic purpura (ITP); myelodysplastic syndromes (including refractory anemia, refractory anemia with ring sideroblasts, refractory anemia with superblasts, refractory anemia with superblasts in transformation); and autoimmune lymphoproliferative syndrome (ALPS).
[0078] The disclosed antibodies are even more useful in treating liver-affecting conditions such as autoimmune or chronic inflammatory hepatitis.
[0079] In addition, the disclosed antibodies and combinations are used to treat a variety of autoimmune or chronic inflammatory disorders accompanied by hearing loss. One of these is inner ear or cochlear nerve-related hearing loss, i.e., autoimmune hearing loss, which is thought to result from an autoimmune process. This condition is currently treated with steroids, methotrexate and / or cyclophosphamide, which may be administered concurrently with CD30 / CD30L interaction inhibitors or blockers.
[0080] The disclosed antibodies can also treat several inflammatory lung disorders, including: idiopathic lymphangioleiomyomatosis; chronic obstructive pulmonary disease (COPD) associated with chronic non-infectious bronchitis or emphysema; and fibrous lung diseases such as cystic fibrosis and idiopathic pulmonary fibrosis.
[0081] Transplant-related disorders, including graft-versus-host disease, can also be treated with the disclosed antibodies. To prevent or improve graft-versus-host disease, compositions comprising one or more of the disclosed antibodies may be administered before, concurrently with, or after, bone marrow or solid organ transplantation, including the transplantation of the heart, liver, lungs, skin, kidney, or other organs.
[0082] The disclosed antibodies are also useful in treating chronic inflammatory eye diseases, including autoimmune uveitis.
[0083] Such antibodies may also be useful in treating diseases associated with airway inflammation, such as asthma.
[0084] The antibodies described herein are also useful in treating inflammatory disorders affecting the female reproductive system, including: multiple implantation failure / infertility; fetal loss syndrome or IV embryo loss (spontaneous abortion); and endometriosis.
[0085] Other medical disorders that can be treated with the antibodies described herein include chronic inflammatory and / or degenerative diseases of the central nervous system. These include, for example, demyelinating diseases such as multiple sclerosis, systemic sclerosis, and Guillain-Barré syndrome (including acute inflammatory demyelinating polyneuropathy, acute motor axonal neuropathy, acute sensorimotor axonal neuropathy, and Fisher syndrome). Multiple sclerosis is a representative example of a chronic degenerative disease of the central nervous system that can be treated with agents that have the ability to inhibit or block the interaction between CD30 and CD30L.
[0086] Other chronic inflammatory conditions that can be treated with the disclosed antibodies include cold agglutinin disease; Behçet's syndrome; Sjögren's syndrome; and idiopathic tenosynovitis, as well as various chronic inflammatory disorders associated with genetic defects. Furthermore, the inhibitors, compositions, and combination therapies of the present invention are also useful in treating Bell's palsy (idiopathic facial nerve palsy), chronic fatigue syndrome (without ongoing infection), chronic degenerative disc disease, Gulf War syndrome, and myasthenia gravis, which can be treated concurrently with corticosteroids.
[0087] Disorders relating to the skin or mucous membranes can also be treated with the antibodies described herein. These include: acantholytic diseases, including lupus discoid, subacute cutaneous lupus erythematosus, cutaneous vasculitis, Darier's disease, folliculoid keratosis, pemphigus vulgaris, and paraneoplastic pemphigus; rosacea; alopecia areata; bullous pemphigoid; eczema; erythema, including erythema multiforme and erythema multiforme (Stevens-Johnson syndrome); inflammatory skin diseases; lichen planus; linear IgA bullous disease (chronic bullous dermatosis in children); loss of skin elasticity; neutrophilic dermatitis (Sweet's syndrome); pityriasis rubra pilaris; psoriasis; pyoderma gangrenosum; loss of skin elasticity, toxic epidermal necrolysis.
[0088] Other diseases that can be treated with the disclosed antibodies include autoimmune-associated chronic mucocutaneous candidiasis; allergies; sarcoidosis; multicentric reticular histiocytosis; Wegener's granulomatosis; arteritis, including giant cell arteritis; vasculitis; and chronic autoimmune myocarditis.
[0089] The anti-CD30L antibody of this disclosure, or a pharmaceutical composition containing the same, may be administered by parenteral routes, non-limiting examples of which include subcutaneous and intravenous administration. The anti-CD30L antibody of this disclosure may be administered to a patient in single or multiple doses together with a pharmaceutically acceptable carrier, diluent, or excipient. The pharmaceutical composition of this disclosure can be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 22nd ed. (2012), A. Loyd et al., Pharmaceutical Press) and comprises an antibody as disclosed herein and one or more pharmaceutically acceptable carriers, diluents, or excipients.
[0090] In this specification, the interchangeable terms “treatment” and / or “to treat” and / or “to treat” are intended to refer to all processes that may slow, interrupt, restrain, control, stop, or reversing the progression of the disorder as described herein, but do not necessarily indicate the complete elimination of all disorder symptoms. Treatment includes the administration of the anti-CD30L antibody of this disclosure for the treatment of a disease or condition in a person who would benefit from the activity of the anti-CD30L antibody of this disclosure, and includes (a) inhibiting further progression of the disease; and (b) alleviating the disease, i.e., causing regression of the disease or disorder or reducing its symptoms or complications.
[0091] A therapeutically effective dose (or amount) of the anti-CD30L antibody of this disclosure may be administered. The amount of anti-CD30L antibody constituting the therapeutic dose may vary depending on the indication being treated, the patient's weight, and the patient's calculated skin surface area. The administration of anti-CD30L antibody may be adjusted to achieve the desired effect. Repeated administration may often be necessary. The dose and frequency of administration may vary depending on factors such as the route of administration, the specific anti-CD30L antibody used, the nature and severity of the disease to be treated, whether the symptoms are acute or chronic, and the patient's physique and general condition.
[0092] Anti-CD30L antibodies, or pharmaceutical compositions containing such molecules, may be administered by any feasible method. In the absence of certain special formulations or circumstances, protein-based therapeutics are usually administered via parenteral routes, such as injection, because oral administration would result in protein hydrolysis in the acidic environment of the stomach. Possible routes of administration include subcutaneous, intramuscular, intravenous, intra-arterial, intrafocal, or peritoneal bolus injection. Anti-CD30L antibodies can also be administered by infusion, such as intravenous or subcutaneous infusion.
[0093] The anti-CD30L antibody may be administered in the form of a composition comprising one or more additional components, such as a physiologically acceptable carrier, excipient, or diluent. Optionally, the composition may further contain one or more physiological activators. In various specific embodiments, the composition may contain one or more anti-CD30L antibodies in addition to one, two, three, four, five, or six physiological activators.
[0094] As used herein, “effective dose” means the amount of the anti-CD30L antibody or pharmaceutical composition of this disclosure containing such antibody that elicits a biological or medical response or a desired therapeutic effect in a tissue, system, animal, mammal, or human, as determined by a researcher, physician, or other clinician. The effective dose of antibody may vary depending on factors such as the individual’s disease state, age, sex, and weight, as well as the antibody’s ability to elicit a desired response in the individual. The effective dose is also such that the beneficial effects of the treatment outweigh any toxic or adverse effects of the antibody. Such benefits include improvement of signs or symptoms of inflammatory diseases. The effective dose can be readily determined by those skilled in the art by using known techniques and observing the results obtained under similar circumstances. The effective dose of the anti-CD30L antibody of this disclosure may be administered in single or multiple doses. In determining the effective dose for a patient, several factors will be considered by the attending physician, including, but are not limited to, the patient's size (e.g., weight or mass), body surface area, age and overall health; the specific disease or disability involved; the degree, involvement, or severity of the disease or disability; the individual patient's response; the specific compound administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dose regimen; the use of concomitant medications; and other relevant circumstances known to the physician. [Examples]
[0095] Example 1: CD30L specificity To determine the species cross-reactivity and specificity of the antibody, HEK 293T cells cultured in Freestyle® 293 expression medium (Gibco) containing GlutaMAX, supplemented with 2% fetal bovine serum (HyClone) and 50 μg / mL G-418 disulfate solution (Sigma-Aldrich), were transiently transfected using 293fectin® transfection reagent (Gibco) as described below.
[0096] The TNF superfamily members most closely related to CD30L, CD27L, 4-1BBL, and FasL were identified by sequence homology. HEK293T cells were expressed by transfection using human CD30L (SEQ ID NO: 40), cynomolgus monkey CD30L (SEQ ID NO: 41), human CD27L (SEQ ID NO: 15), human 4-1BBL (SEQ ID NO: 38), human FasL (SEQ ID NO: 35), or a control expression vector, Gibco® Opti-MEM® medium (Gibco), and 293Fectin® reagent (Invitrogen), according to the manufacturer's instructions. Human B-cell lymphoma (Ramos) cell lines were also used to measure specificity for endogenously expressed CD30L.
[0097] Transfected cells were incubated overnight at 37°C and 5% CO2 in a humidified incubator on a 120 RPM orbital shaker. The following day, the transfected cells were washed and resuspended in FACS buffer (PBS supplemented with 2% FBS). Cells were added to 96-well clear V-bottom polystyrene plates (Corning®) at a rate of 50,000 cells per well, washed twice with FACS buffer incubated with 5 μg / mL (or a 2-fold dilution if the concentration is less than 5 μg / mL) test antibody at 4°C for 2 hours, and then stained with Alexa Fluor® 647 conjugate AffiniPure goat anti-human IgG Fc gamma fragment specific (Jackson ImmunoResearch) and 2.5 μg / mL 7-aminoactinomycin D (Sigma-Aldrich) at 4°C for 20 minutes. After an additional washing step, the cells were resuspended in FACS buffer, and binding strength was determined using an iQue flow cytometry instrument equipped with an Intellicyt autosampler (Intellicyt). The obtained data were analyzed using Intellicyt Forecyt® Enterprise Client software.
[0098] Table 1 shows the hybridoma data derived from three cohorts of immunized animals.
[0099] These data demonstrate that the antibodies bound only to human and cynomolgus monkey CD30L. None of the antibodies in the tested supernatant bound to human CD27L, human 4-1BBL, human FasL, or 293T cells transfected with a control expression vector. Further testing demonstrated that purified antibody 46265 did not bind to mouse CD30L (SEQ ID NO: 13; ratio 1.0) or rat CD30L (SEQ ID NO: 14; ratio 1.1).
[0100] [Table 1]
[0101] Example 2: Antibodies that bind to human and cynomolgus monkey PBMCs The binding of anti-CD30L antibodies to endogenous CD30L expressed in primary human and cynomolgus monkey peripheral blood mononuclear cells (human or cynomolgus monkey PBMCs) was evaluated by flow cytometry. In the human primary cell binding assay, purified human T cells (Biological Specialty Corp.) were thawed and 2.5 × 10⁶ cells were used. 6 T cells were suspended at a concentration of cells / mL. T cells were stimulated with 5 μg / mL anti-human CD3 clone OKT3 (eBioscience) bound to a plate and 1 μg / mL anti-human CD28 (BD Pharmingen) in suspension at 37°C / 5% CO2 for 72 hours. After 72 hours, cells were removed, washed, and 0.5 × 10⁶ cells were mixed with 10 ng / mL IL-2 (Pepro Tech). 6 The cells were suspended at a concentration of cells / mL. The cells were then incubated at 37°C and 5% CO2 for a further 7 days. For the cynomolgus monkey primary cell binding assay, cynomolgus monkey PBMCs (SNBLs) were thawed and 4 × 10⁶ cells were attached. 6 ~5×10 6Cells were suspended at a concentration of cells / mL. PBMCs were stimulated at 37°C / 5% CO2 for 72 hours with a 1 μg / mL suspension of anti-human CD28 (BD Pharmingen) and 1 μg / mL of anti-human CD3 clone SP34 (BD Pharmingen), conjugated to plates pre-coated with 5 μg / mL anti-mouse IgGFc (Pierce). Cells were prepared for flow cytometry 72 hours after thawing for cynomolgus monkey PBMCs and 10 days after thawing for human T cells. Both human T cells and cynomolgus monkey PBMCs were first incubated with hybridoma supernatant, positive control antibody, and isotype control antibody. After the washing step, cells were incubated with 5 μg / mL Alexa Fluor 647 AffiniPure F(ab')2 fragment goat anti-human IgG Fc (Jackson ImmunoResearch) and 8.25 nM YoPro1 (Invitrogen). Anti-human CD4 conjugated with Pacific Blue fluorophore (BioLegend) was also included in cynomolgus monkey PBMCs to gate the T cell population. The cells were then electrophoresed using a BD FACSCanto II flow cytometer to detect CD30L antibody binding. Geometric mean fluorescence intensity (gMFI) values were obtained for fluorescently labeled human and cynomolgus monkey PBMCs. These values were divided by the values obtained for unlabeled PBMCs to derive values representing the binding ratio to the isotype control.
[0102] [Table 2]
[0103] These data demonstrate that hybridoma supernatant containing the antibodies of this disclosure binds to endogenously expressed human and cynomolgus monkey CD30L expressed on primary T cells.
[0104] Example 3: Affinity of anti-CD30L antibody The affinity of hybridoma supernatants containing antibody clone 46183 or antibody clone 46265 for natural cynomolgus monkey CD30L transiently expressed on 293T cells, or for natural human CD30L expressed on Ramos cells, was evaluated using the binding equilibrium exclusion method (KinExA).
[0105] KinExA is performed, and after equilibrium is established between the antibody and the antigen expressed on the cell surface, the concentration of free antibody remaining in the solution is measured from K off The following was measured. KinExA provides a highly sensitive measurement of binding affinity to native CD30L compared to soluble CD30L. The binding equilibrium exclusion method was basically performed as described in Rathanaswami et al. Anal. Biochem:373(1):52-60(2008).
[0106] In short, equilibrium sets were established with each antibody using either human CD30L-expressing Ramos cells or cynomolgus monkey CD30L-expressing 293T cells. Cells were counted using a hemocytometer. Ramos cells were titrated and incubated with 0.05% sodium azide in HUT medium (RPMI 1640, 10% FBS, 10 mM HEPES, 2 mM L-Glut, 1 mM Sod.Pyr, 0.1 mM NEAA, 50 μM 2-ME) at two different constant antibody concentrations (one 48 pM, the other 2 nM). For the high [Ab] equilibrium sets, Ramos cells were titrated in Eppendorf tubes from a concentration of 25 million cells per milliliter at a 1:2 ratio for 10 points and equilibrated with 1 nM antibody in a total volume of 400 μl. In the low [Ab] equilibrium set, Ramos cells were titrated in 50 ml Fulcon tubes at a concentration of 3.89 million cells per milliliter (1:2 ratio for 10 points) and equilibrated with 20–30 pM antibody in a total volume of 15.5 mL.
[0107] Cynomolgus monkey CD30L-expressing 293T cells were titrated and incubated with 0.05% sodium azide in 293T medium (Freestyle-expressed 293T medium containing 2% FBS and 50 pg / ml G418) at two different constant antibody concentrations (one 118 pM and the other 5 nM). In the high [Ab] equilibrium set, 293T cells were titrated in Eppendorf tubes at a concentration of 25 million cells per milliliter (1:3 for 10 points) and equilibrated with 5 nM antibody in a total volume of 200 μl. In the low [Ab] equilibrium set, 293T cells were titrated in 15 ml Fulcon tubes at a concentration of 980,000 cells per milliliter (1:3 for 10 points) and equilibrated with 118 pM antibody in a total volume of 10.2 mL. In each equilibrium set, the reference point control included samples containing only cell medium and samples without cells. The equilibrium sets were incubated at room temperature for 24 hours with shaking. After 24 hours of incubation, the supernatant was separated from the cell pellet by centrifugation at 500 × g for 5 minutes. The supernatants from both the high [Ab] equilibrium sets and the low [Ab] equilibrium sets were then subjected to KinExA 3200 incubator.
[0108] Each equilibrium sample set was read twice using the KinExA instrument. For low [Ab] equilibrium samples, 6.8 mL and 4.6 mL samples were each used twice for equilibrium experiments with human and cynomolgus monkey CD30L. For high [Ab] equilibrium samples, 16 pL and 75 pL samples were each used twice for equilibrium experiments with human and cynomolgus monkey CD30L.
[0109] PMMA (polymethyl methacrylate particle) beads were coated with goat anti-human Fc Ab or goat anti-hIgG(Fl+L) Ab, followed by blocking with a blocking solution (1×PBS pF 17.4 + 10 mg / mL BSA + 0.05% sodium azide). For each equilibrium sample, free [Ab] was detected by passing the equilibrium sample through the coated beads and then rapidly washing with running buffer (1×PBS + 1% BSA + 0.05% sodium azide). A secondary detection antibody (Alexa 647, goat anti-huIgG(Fl+L)) was passed through a flow cell at 680 ng / mL and 500 pL per pass. Kd was calculated using KinExA voltage output signals in KinExA software. Krf was obtained from plots at two different initial total [Ab] concentrations by curve fitting using n-curve analysis in KinExA Pro software version 4.3.11 (Sapidyne Instruments Inc.). 95% confidence intervals were obtained for low and high Kd. The results are shown in Table 3.
[0110] These data demonstrate that the antibodies described herein bind to human CD30L and cynomolgus monkey CD30L with high affinity.
[0111] [Table 3]
[0112] Example 4: Antibody-mediated functional activity The antibody was tested for its ability to block the stimulation of interleukin-8 (IL-8) production by the K299 cell line (endogenous expression of CD30) in a Ramos cell line (endogenous expression of CD30L). Antibody Ab was prepared in assay medium (RPMI1640 containing 10% FBS and 2 mM L-Glut) starting at 80 nM in a 1:5 dilution step and packed into a flat-bottom 96-well plate at 50 ul / well (final starting concentration 20 nM).
[0113] CD30L-expressing Ramos cells were prepared in assay medium at a concentration of 10 million cells / ml and added to anti-CD30L antibody at a concentration of 500,000 cells / well. CD30-expressing Karpas-299 cells were prepared in assay medium at a concentration of 1 million cells / ml and added to wells containing test Ab and Ramos cells at a concentration of 100 μL / well, resulting in 100,000 cells / well and a Ramos:Karpas-299 ratio of 5:1.
[0114] Cells and anti-CD30L antibody were incubated overnight at 37°C and 5% CO2. The supernatant was collected at the end of incubation, and induced IL-8 secretion was measured using the R&D IL-8 ELISA kit. The results are shown in Table 4.
[0115] These data demonstrate that the antibodies described herein inhibit CD30L-induced IL-8 secretion at IC50 values within the picomolar concentration range.
[0116] [Table 4]
[0117] Example 5: The YTE-modified Fc domain exhibits enhanced interaction with FcRn. Standard running buffers were as follows: 20 mM MES / HCl, 140 mM NaCl, pH 5.5 (Buffer A); 20 mM Tris / HCl, 140 mM NaCl, pH 8.8 (Buffer B). Briefly, each analyte was diluted to 0.5 mg / mL in Buffer A with a minimum 5-fold dilution where possible. After injecting 20 µL of the analyte onto a pre-equilibrated column in 20% Buffer B, gradient elution was performed. Gradient conditions were as follows: after 10 minutes of loading, Buffer B was increased from 20% to 100% over 80 minutes, followed by a 10-minute wash with 100% Buffer B, and then rapidly returned to 20% Buffer B over 3 minutes. Antibodies without YTE (YTE negative control) and antibodies with YTE (YTE positive control) were used to normalize the retention time (r.t.) of the analyte: (analyte r.t. - YTE negative control r.t.) / (YTE positive control r.t. - YTE negative control r.t.). After baseline subtraction, the data was fitted to a Gaussian function using OriginPro (OriginLab, Northampton, MA), and peak retention time and full width at half maximum (FWHM) were obtained from the fitted data. Trel indicates the time until elution. A Trel between 0 (YTE negative control) and 1 (YTE positive control) indicates reduced interaction with FcRn. t rel =(t sample -t standard1 ) / (t standard2 -t standard1 ). The results are shown in Table 5.
[0118]
Table 5
[0119] Example 6: The YTE-modified Fc domain extends in vivo half-life. Mouse PK studies were performed in male huFcRn transgenic 32 homozygous mice. Anti-CD30L antibodies with and without YTE mutations were formulated in 10 mM sodium acetate, pH 5.2, containing 9% sucrose. Mice received a single 1 mg / kg injection of the appropriate test substance via lateral caudal vein injection. Blood samples were collected by submandibular vein puncture at predetermined time points up to 42 days. Whole blood was collected and placed in a Microvette® 500 μl K3 EDTA plasma separator (20.1341.102, Sarstedt, Newton, NC), gently mixed by 8-10 manual inversions, and centrifuged at 11,500 × g for 5 minutes at 4°C. The resulting plasma was stored at -70°C (±10°C) until analysis.
[0120] The concentration of anti-CD30L antibody in mouse plasma samples was determined by ELISA specific to intact, full-length test material, using biotinylated mouse anti-human IgG Fc 1.35.1 mAb (Amgen, PL-50510) as the capture reagent and biotinylated recombinant human CD30 ligand / TNFSF8 protein (R&D Systems, 1028-CL-050) followed by streptavidin-horseradish peroxidase conjugate (R&D Systems, Inc., Minneapolis, MN) as the detection reagent. Analyte serum concentrations were interpolated from standard curves using corresponding analytes 46265-2 and 46183-1. The LLOQ of the assay in serum was 0.61 ng / mL. The ULOQ of the assay in serum was 10000 ng / mL. Sample concentrations were interpolated from standard curve fitting to a 4-parameter logistic model using Watson LIMS (V7.4; Thermo Fisher). PK parameters were estimated from individual plasma concentration-nominal time data by non-compartmental analysis using Phoenix®WinNonlin® (v6.4; Certara, Princeton, NJ). The results are shown in Table 6.
[0121] These data demonstrate that the anti-CD30L antibody modified in the YTE Fc domain showed an extended half-life consistent with the YTE modification in the Fc domain.
[0122] [Table 6]
[0123] Example 7: Anti-CD30L antibody reduces the antibody response to immunization. Eight-week-old female Balb / c mice were immunized by intraperitoneal injection of 100 μg of 2,4,6-trinitrophenylhaptenized ovalbumin (TNP-ova) antigen, precipitated with alum (InVivoGen), administered in 200 μl of PBS. Three weeks after immunization, the mice were treated with anti-muCD30L-muIgG1 (clone M15) or muIgG1 isotype control (N=5 mice per group). M15 is an anti-mouse CD30L antibody without mouse effector function, a substitute for the two antibodies described herein, having equivalent in vitro affinity and potency. One day after treatment, the mice were challenged with 100 μg of TNP-ova in alum. Seven days after antigen challenge, the mice were euthanized and serum was collected. Serum was also collected from unimmunized mice. IgE and IgG antibody titers were evaluated by ELISA. The results are shown in Table 7.
[0124] These data demonstrate that administration of a mouse surrogate anti-CD30L antibody reduced the concentrations of both IgE (associated with type 2 inflammatory response) and IgG antibodies (associated with type 1 inflammatory response) compared to controls.
[0125] [Table 7]
[0126] Example 8: CD30L in a mouse airway inflammation model Eight-week-old female Balb / c mice were immunized by intraperitoneal injection of 100 μg of ovalbumin (ova) antigen precipitated with alum (InVivoGen). Two weeks after immunization, the mice were treated with anti-mouse CD30L antibody M15 or IgG1 isotype control (N=5 mice per group). Mice were treated twice a week until the end of the study. Inflammation of the mouse airways was induced by intranasal administration of ovalbumin for three consecutive days each week for three weeks, starting one day after the first treatment. Four days after the final airway challenge, the mice were euthanized and tissue was collected. Tissue was also collected from naive, unimmunized mice as a control. Blood was collected in serum separation tubes (GE Healthcare) and processed according to the manufacturer's instructions. Serum was frozen at -20°C. Serum was thawed at a later point for analysis of IgE and IgG antibody titers by ELISA. Lungs were perfused with PBS before collection. Perfused lung tissue was processed into single-cell suspensions using Miltenyi C tubes and passed through a 100 μm cell strainer. Live cells were counted, and 1 × 10^6 cells were stained with an antibody panel for flow cytometry analysis. After excluding non-viable cells using Live / Dead staining reagents, eosinophils, B cells, and T cells were counted using standard serial markers. The results are shown in Table 8.
[0127] These data demonstrate that, compared to controls, administration of a mouse surrogate anti-CD30L antibody reduced pulmonary infiltration of eosinophils (associated with type 2 inflammation), B cells, and T cells, and showed decreased antibody titers for IgE and IgG isotypes in this mouse airway inflammation model.
[0128] [Table 8]
[0129] [Table 9]
[0130] [Table 10]
[0131] Table 11
[0132] Table 12
[0133] Table 13
[0134] Table 14
[0135] Table 15
Claims
1. An antibody that binds to CD30L, a. HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6; or b. HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12 Antibodies containing antibodies.
2. The antibody according to claim 1, wherein the antibody comprises HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO:
6.
3. The antibody according to claim 1, wherein the antibody comprises HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO:
12.
4. a. A heavy chain variable region (HCVR) containing SEQ ID NO: 19, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 19, and a light chain variable region (LCVR) containing SEQ ID NO: 20, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 20; or b. HCVR containing SEQ ID NO: 23, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 23, and LCVR containing SEQ ID NO: 24, or a variant thereof containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 24 The antibody according to any one of claims 1 to 3, comprising:
5. The antibody according to any one of claims 1, 2, or 4, comprising HCVR containing SEQ ID NO: 19 and LCVR containing SEQ ID NO:
20.
6. The antibody according to any one of claims 1, 3, or 4, comprising HCVR containing SEQ ID NO: 23 and LCVR containing SEQ ID NO:
24.
7. a. A heavy chain (HC) containing SEQ ID NO: 25, and a light chain (LC) containing SEQ ID NO: 26, or b. HC containing SEQ ID NO: 29, and LC containing SEQ ID NO: 30 The antibody according to any one of claims 1 to 6, comprising:
8. The antibody according to any one of claims 1, 2, 4, 5, or 7, comprising HC containing SEQ ID NO: 25 and LC containing SEQ ID NO:
26.
9. The antibody according to any one of claims 1, 3, 4, 6, or 7, comprising HC containing SEQ ID NO: 29 and LC containing SEQ ID NO:
30.
10. a. Each HC is two HCs containing sequence number 25, and each LC is two LCs containing sequence number 26; or b. Each HC contains two HCs including sequence number 29, and each LC contains two LCs including sequence number 30. An antibody according to any one of claims 1 to 9, comprising:
11. The antibody according to any one of claims 1, 2, 4, 5, 7, 8, or 10, wherein each HC comprises two HCs containing SEQ ID NO: 25, and each LC comprises two LCs containing SEQ ID NO:
26.
12. The antibody according to any one of claims 1, 3, 4, 6, 7, 9, or 10, wherein each HC comprises two HCs containing SEQ ID NO: 29, and each LC comprises two LCs containing SEQ ID NO:
30.
13. An anti-CD30L antibody comprising a heavy chain containing SEQ ID NO: 29 and a light chain containing SEQ ID NO:
30.
14. An anti-CD30L antibody comprising a heavy chain containing SEQ ID NO: 25 and a light chain containing SEQ ID NO:
26.
15. It is an anti-CD30L antibody, a. HC containing SEQ ID NO: 33 and LC containing SEQ ID NO: 30; b. HC containing SEQ ID NO: 36 and LC containing SEQ ID NO: 30; c. HC containing SEQ ID NO: 39 and LC containing SEQ ID NO: 30; d. HC containing SEQ ID NO: 31 and LC containing SEQ ID NO: 26; e. HC containing SEQ ID NO: 34 and LC containing SEQ ID NO: 26; or f. HC containing SEQ ID NO: 37 and LC containing SEQ ID NO: 26 Anti-CD30L antibody, including
16. a. Whether it binds to human CD30L at dissociation constant (KD) values of less than 100, 75, or 50 picomolar concentrations as measured by surface plasmon resonance or binding equilibrium exclusion; b. Whether it binds to cynomolgus monkey CD30L at KD values of less than 100, 75, or 50 picomolar concentrations as measured by surface plasmon resonance or coupled equilibrium exclusion; c. Whether human CD30L and cynomolgus monkey CD30L bind to each other with an affinity of no more than 10 times; d. Blocking the binding of human CD30L to human CD30 as determined by a cell-based assay; or e. Inhibit CD30L-induced IL-8 secretion as determined by cell-based assays. The antibody according to any one of claims 1 to 15.
17. A method for treating an inflammatory disorder in a patient, comprising administering to the patient an effective amount of an antibody according to any one of claims 1 to 16.
18. The method according to claim 17, wherein the inflammatory disorder is asthma.
19. The method according to claim 17, wherein the inflammatory disorder is lupus.
20. The method according to claim 17, wherein the inflammatory disorder is ulcerative colitis.
21. A polynucleotide encoding HCVR;LCVR; both HCVR and LCVR;LC;HC; or both HC and LC of an antibody that binds to CD30L, wherein the antibody is a. HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6; or b. HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12 Polynucleotides, including [specifically, polynucleotides].
22. The polynucleotide according to claim 21, wherein the antibody comprises HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR1 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO:
6.
23. The polynucleotide according to claim 21, wherein the antibody comprises HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR1 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO:
12.
24. The polynucleotide according to claim 21 or 22, wherein the amino acid sequence of the LC encodes the LC of the antibody, which includes SEQ ID NO:
26.
25. The polynucleotide according to claim 21 or 22, wherein the amino acid sequence of the HC encodes the HC of the antibody, which includes SEQ ID NO:
25.
26. The polynucleotide according to claim 21 or 22, wherein the amino acid sequence of the HC comprises SEQ ID NO: 25, and the amino acid sequence of the LC comprises SEQ ID NO: 26, thereby encoding both the HC and the LC of the antibody.
27. The polynucleotide according to claim 21 or 23, wherein the amino acid sequence of the LC encodes the LC of the antibody, which includes SEQ ID NO:
30.
28. The polynucleotide according to claim 21 or 23, wherein the amino acid sequence of the HC encodes the HC of the antibody, which includes SEQ ID NO:
29.
29. The polynucleotide according to claim 21 or 23, wherein the amino acid sequence of the HC comprises SEQ ID NO: 29, and the amino acid sequence of the LC comprises SEQ ID NO: 30, thereby encoding both the HC and the LC of the antibody.
30. The polynucleotide according to claim 21, 22, 25, or 26, wherein the polynucleotide encoding the HC of the antibody includes SEQ ID NO:
21.
31. The polynucleotide according to claim 21, 22, 24, or 26, wherein the polynucleotide encoding the LC of the antibody includes SEQ ID NO:
18.
32. The polynucleotide according to claim 21, 23, 28, or 29, wherein the polynucleotide encoding the HC of the antibody includes SEQ ID NO:
17.
33. The polynucleotide according to claim 21, 23, 27, or 29, wherein the polynucleotide encoding the LC of the antibody includes SEQ ID NO:
16.
34. A vector comprising one or more polynucleotides according to any one of claims 21 to 33.
35. A host cell comprising one or more polynucleotides according to any one of claims 21 to 33 or the vector according to claim 34.
36. A process for producing an anti-CD30L antibody comprising two HCs and two LCs, comprising culturing the host cells described in claim 35 under conditions such as expressing the antibody and recovering the expressed antibody.
37. The process according to claim 36, wherein HC comprises the amino acid sequence of SEQ ID NO: 25 and LC comprises the amino acid sequence of SEQ ID NO:
26.
38. The process according to claim 36, wherein HC comprises the amino acid sequence of SEQ ID NO: 29 and LC comprises the amino acid sequence of SEQ ID NO:
30.
39. An antibody obtained by the process described in claim 37.
40. An antibody obtained by the process described in claim 38.
41. An antibody according to any one of claims 1 to 16, 39, or 40, for use in the treatment of inflammatory disorders.
42. The antibody according to claim 41, for use in the treatment of an inflammatory disorder, wherein the inflammatory disorder is asthma, lupus, or ulcerative colitis.
43. Use of the antibody according to any one of claims 1 to 16, 39, or 40 for the manufacture of a pharmaceutical product for the treatment of inflammatory disorders.
44. The use according to claim 43, wherein the inflammatory disorder is asthma, lupus, or ulcerative colitis.
45. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 16, 39, or 40, and one or more pharmaceutically acceptable carriers, diluents, or excipients.
Citation Information
Patent Citations
Human CD30 ligand antigen binding proteins
WO2013163377A1
Anti-CD30l antibodies and uses thereof
WO2022177963A1