REP promoter for AAV production

Abstract

Polynucleotides, vectors, vector systems, cells, and methods for expressing AAV Rep proteins are provided. In certain embodiments, these polynucleotides, vectors, vector systems, cells, and methods may be used to produce higher levels of small Rep transcripts compared to large Rep transcripts. In certain embodiments, these polynucleotides, vector systems, cells, and methods may be used to produce higher levels of small Rep proteins compared to large Rep proteins. In certain embodiments, these polynucleotides, vectors, vector systems, cells, and methods may be used to produce recombinant AAV (rAAV). Enhanced expression of small Rep compared to large Rep is useful in many aspects, for example, to increase the total amount of virions and packaged virions during rAAV production.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefits and priority of U.S. Provisional Application No. 63 / 642,588 filed on 3 May 2024; U.S. Provisional Application No. 63 / 640,791 filed on 30 April 2024; U.S. Provisional Application No. 63 / 625,118 filed on 21 January 2024; U.S. Provisional Application No. 63 / 613,613 filed on 21 December 2023; U.S. Provisional Application No. 63 / 542,479 filed on 4 October 2023; and U.S. Provisional Application No. 2024;63 / 536,904 filed on 6 September 2023. The contents of each of the aforementioned applications are incorporated by reference as a whole. [Background technology]

[0002] Adeno-associated viruses (AAVs) belong to the Parvoviridae family and Dependovirus genus, some of which require co-infection with a helper virus, such as an adenovirus, to facilitate replication. In the absence of a helper virus, AAVs establish latent infection. An AAV virion consists of a 25 nm icosahedral capsid containing a 4.7 kb single-stranded DNA genome with two open reading frames, rep and cap. The unstructured rep gene encodes four AAV Rep proteins, which are regulatory proteins essential for viral replication, while the cap encodes three structural AAV capsid proteins (virion proteins 1-3 "VP1-3") that assemble into a 60-mer capsid shell. This viral capsid gives the AAV vector the ability to overcome numerous biological barriers to viral transduction, including cell surface receptor binding, endocytosis, intracellular transport, and unpackaging in the nucleus.

[0003] In order to provide delivery of payloads of interest to cells by rAAV virions, there is a need in the art for better recombinant AAV (rAAV) production methods that enhance AAV packaging efficiency. [Overview of the project]

[0004] Vectors, vector systems, cells, and methods for expressing AAV Rep proteins are provided. In certain embodiments, these vectors, vector systems, cells, and methods may be used to produce higher levels of small Rep compared to large Rep. In certain embodiments, these vectors, vector systems, cells, and methods may be used to produce rAAV. Regulation of small Rep expression compared to large Rep is useful in numerous contexts. For example, enhanced expression of small Rep compared to large Rep can increase the total amount of both virions and packaged virions during recombinant AAV production. [Brief explanation of the drawing]

[0005] [Figure 1A] The schematic diagrams show the polynucleotides for the expression of the AAV large Rep transcript and the AAV small Rep transcript, respectively, for expressing the large Rep protein and the small Rep protein. Introns are inserted upstream of the small Rep coding sequence, which is located within the large Rep coding sequence. The schematic diagrams further show that the p5 ("P5") promoter has been replaced with a heterologous promoter operably ligated to the large Rep coding sequence. The p19 ("P19") promoter remains unchanged. [Figure 1B] The schematic diagrams show the polynucleotides for the expression of the AAV large Rep transcript and the AAV small Rep transcript, respectively, for expressing the large Rep protein and the small Rep protein. The intron is inserted upstream of the small Rep coding sequence and is located within the large Rep coding sequence. The schematic diagrams further show that the p5 promoter has been replaced with a heterologous promoter operably linked to the large Rep coding sequence, and that the TATA box of the p19 promoter has been mutated. [Figure 2A]The schematic diagrams show the polynucleotides for the expression of the AAV large Rep transcript and the AAV small Rep transcript, respectively, for the expression of the large Rep protein and the small Rep protein. The intron is inserted upstream of the small Rep coding sequence, which is located within the large Rep coding sequence. The heterologous promoter is inserted into the intron and operably ligated to the small Rep coding sequence. The schematic diagram further shows that the p5 ("P5") promoter has been replaced with a heterologous promoter operably ligated to the large Rep coding sequence. The p19 ("P19") promoter remains unchanged. [Figure 2B] The schematic diagrams show the polynucleotides for the expression of the AAV large Rep transcript and the AAV small Rep transcript, respectively, for expressing the large Rep protein and the small Rep protein. The intron is inserted upstream of the small Rep coding sequence and is located within the large Rep coding sequence. The heterologous promoter is inserted into the intron and is operably ligated to the small Rep coding sequence. The schematic diagram further shows that the p5 ("P5") promoter is replaced with a heterologous promoter operably ligated to the large Rep coding sequence, and that the TATA box of the p19 ("P19") promoter is mutated. [Figure 3]Figures 2A-2B show schematic diagrams of mRNA transcripts 1-3 that can be generated from the polynucleotides shown. Discontinuous lines indicate introns that are excised by splicing. Although not shown in Figure 3, transcript 1 can produce two types of mature mRNA by alternative splicing, where these two types of mature RNA are (i) a mature RNA encoding the large Rep protein Rep78, and (ii) a mature RNA encoding the large Rep protein Rep68. Transcript 2 is generated by transcription driven by a heterologous promoter located in an intron. Transcript 3 is generated by transcription driven by the p19 promoter and initially contains an intron (indicated by a discontinuous line), which is excised by splicing. Although not shown in Figure 3, each of transcripts 2 and 3 can produce two types of mature mRNA by alternative splicing of the shown mRNA, where these two types of mature RNA are (i) a mature RNA encoding the small Rep protein Rep52, and (ii) a mature RNA encoding the small Rep protein Rep40. [Figure 4] This shows a Western blot of flag tags for detecting the expression of flag-tagged large and small Rep proteins in cells transiently transfected with a plasmid containing polynucleotides, as shown in Figure 2B, which have different promoter combinations. [Figure 5]These are schematic diagrams of the polynucleotides for the inducible expression of the AAV large Rep transcript and the AAV small Rep transcript, respectively, for the expression of the large Rep protein and the small Rep protein. Introns are inserted upstream of the small Rep coding sequence, which is located within the coding sequence of the large Rep protein. Heterogeneous promoters are inserted into the introns. A conditional by deletion (CODE) module is included in the coding sequence common to both the large and small Rep proteins. The CODE module contains a sequence containing a stop codon and a lox site (represented by two triangles) adjacent to the sequence containing the stop codon. During recombinase expression, the lox site is recombined, resulting in the excision of the sequence containing the stop codon. The schematic diagram further shows that the P5 promoter is replaced with a heterogeneous promoter operably linked to the large Rep coding sequence, and that the TATA box of the P19 promoter is mutated. [Figure 6] Figure 5 is a schematic diagram showing mRNA transcripts 1-3 that can be generated from the polynucleotides shown. Discontinuous lines indicate introns that are excised by splicing. Transcript 1 can be selectively spliced ​​to produce two different mRNAs, one encoding a shortened large Rep protein Rep78 and the other encoding a shortened large Rep protein Rep68, where the shortening occurs at a stop codon in the CODE module. Transcripts 2 and 3 can each be selectively spliced ​​to produce two different mRNAs, one encoding a shortened small Rep protein Rep52 and the other encoding a shortened small Rep protein Rep40, where the shortening occurs at a stop codon in the CODE module. The shortened large and small Rep proteins are non-functional and, consequently, non-toxic. [Figure 7]This figure shows a Western blot of Flag tags for detecting the expression of Flag-tagged Rep proteins in cells transiently transfected with a vector containing polynucleotides with different heterologous promoter combinations (PGK+CAG or UBC+CAG). Several Flag-tagged Rep proteins were transfected using vectors (CODE or Lox) as shown in Figure 5. As shown in Figure 5, in the presence of the CODE module, Rep proteins (e.g., Rep78 and Rep52) are shortened, thereby preventing the generation of Flag tags (encoded near the 3' end of the transcript). By expressing a recombinase or exogenously adding (e.g., Cre recombinase), the CODE module is excised (e.g., at the Lox site), allowing for the expression of full-length Flag-tagged Rep proteins. [Figure 8A] An exemplary system of polynucleotides for inducible production of rAAV is shown. In the absence of the first and second inducers, the system is in the off state. [Figure 8B] Figure 8A shows the on-state after induction by the first and second inducers of the polynucleotide system for inducibly producing RAAV. [Figure 9A] An exemplary system of polynucleotides for inducibly producing rAAV is shown. Compared to the system shown in Figures 8A-8B, this system includes additional polynucleotides for expressing the Cap protein. In the absence of the first and second inducers, the system is in the off state. [Figure 9B] Figure 9A shows the on-state after induction by the first and second inducers of the polynucleotide system for inducibly producing rAAV. [Figure 10]The polynucleotides for the expression of the Rep and Cap proteins are shown, with the Rep protein coding sequence and promoter separated from the Cap protein coding sequence and promoter by a transcriptional blocking element (TBE). An intron is inserted into the coding sequence of the large Rep protein upstream of the small Rep coding sequence. A heterologous promoter is inserted into the intron and operably linked to the small Rep coding sequence. The schematic diagram further shows that the P5 promoter is replaced with a heterologous promoter operably linked to the large Rep coding sequence, and the TATA box of the P19 promoter is mutated. The TBE separates the Rep coding sequence from the Cap coding sequence. Cap expression is regulated by an inducible promoter (e.g., the Tet-on promoter) and includes a polyadenylation signal sequence (Poly-A) downstream of the sequence encoding the Cap protein (capsid). An exemplary polyadenylation signal sequence is the SV40 polyadenylation sequence. Polynucleotides also include selection markers (e.g., antibiotic resistance genes) expressed under the control of a constitutive promoter (e.g., the EF-1α promoter). In this example, the EF-1α promoter contains a mutant TATA box, which reduces its activity and leads to decreased expression of the selection marker. This promoter is useful for increasing the copy number of polynucleotides when present in cells cultured under selective pressure (e.g., antibiotics). [Figure 11A] Figure 10 shows an exemplary polynucleotide system for inducibly producing rAAV using the polynucleotides described therein. In the absence of the first and second inducers, the system is in the off state. [Figure 11B] Figure 11A shows the on-state after induction by the first and second inducers of the polynucleotide system for inducibly producing rAAV. [Figure 12A]Figure 10 shows an exemplary polynucleotide system for inducibly producing rAAV using the polynucleotides described therein. Compared to the systems shown in Figures 11A-11B, this system includes additional polynucleotides for expressing the Cap protein. In the absence of the first and second inducers, the system is in the off state. [Figure 12B] Figure 12A shows the on-state after induction by the first and second inducers of the polynucleotide system for inducibly producing rAAV. [Figure 13A] An exemplary schematic diagram of a v1.0 system construct for inducibly producing rAAV is shown. In the absence of the first and second inducers, the system is in an off state, and no rAAV is produced. A complete description of the v1.0 system is cited in U.S. Patent No. 12,054,738 and PCT International Publication No. WO2022 / 026927 (these disclosures are incorporated in their entirety by reference for all purposes). [Figure 13B] Figure 13A shows the polynucleotide system for inducibly producing rAAV, in the post-induced state after induction by the first and second inducers, with rAAV produced. A complete description of the v1.0 system is provided in U.S. Patent No. 12,054,738 and PCT Public International Publication No. WO2022 / 026927 (these disclosures are incorporated in their entirety by reference for all purposes). [Figure 14A] An exemplary schematic diagram of a v1.2 system construct for inducibly producing rAAV is shown. In the absence of the first and second inducers, the system is in an off state in which no rAAV is produced. A complete description of the v1.0 system is posted in U.S. Patent No. 12,054,738 and PCT International Publication No. WO2022 / 026927 (these disclosures are incorporated in whole by reference for all purposes). [Figure 14B]Figure 14A shows the polynucleotide system for inducibly producing rAAV, in the post-induced state after induction by the first and second inducers, with rAAV produced. A complete description of the v1.0 system is provided in U.S. Patent No. 12,054,738 and PCT Public International Publication No. WO2022 / 026927 (these disclosures are incorporated in their entirety by reference for all purposes). [Figure 15A] An exemplary schematic diagram of the v1.3 system construct for inducibly producing rAAV is shown. In the absence of the first and second inducers, the system is in an off state where no rAAV is produced. [Figure 15B] Figure 15A shows the polynucleotide system for inducibly producing rAAV, in the post-induced state after induction by the first and second inducers, in which rAAV has been produced. [Figure 16A] An exemplary schematic diagram of the v1.4 system construct for inducibly producing rAAV is shown. In the absence of the first and second inducers, the system is in an off state where no rAAV is produced. [Figure 16B] Figure 16A shows the polynucleotide system for inducibly producing rAAV, in the post-induced state after induction by the first and second inducers, in which rAAV has been produced. [Figure 17] Exemplary data is shown for a comparison of rAAV production systems in the v1.0, v1.2, v1.3, and v1.4 pools. [Figure 18] This shows exemplary AEX chromatogram data for measuring capsid-forming rAAV genomes produced by a v1.4 cell pool. [Figure 19A] Exemplary data of cell viability (%) and viable cell density of v1.3 and v1.4 cell pools, measured daily after induction by the first and second inducers, are shown. [Figure 19B] Exemplary data of the titer levels of v1.3 and v1.4 cell pools measured daily after induction by the first and second inducers are shown. [Figure 20] Exemplary absorbance data at 260 nm and 280 nm for v1.3 and v1.4 cell pools as measurements of titer levels are shown. [Figure 21] Exemplary data demonstrating affinity exchange high-performance liquid chromatography as an evaluation of cell pool packing efficiency in v1.3 and v1.4 are shown. [Figure 22] Exemplary data comparing affinity exchange high-performance liquid chromatography of post-production v1.4 cell pools for 3 and 7 days are shown. [Figure 23] This shows exemplary data from high-temperature molecular size exclusion chromatography to measure the packing efficiency of a v1.4 cell pool. [Figure 24A] Exemplary data on insertion fragment production and IC50 of the v1.4 cell pool compared to the triple-transferred control SVEC0935 are shown. [Figure 24B] Exemplary AEX chromatogram data for measuring the capsid-forming rAAV genome produced by the triple-transferred control SVEC0935 are shown. [Figure 25] Exemplary reverse-phase HPLC data are shown to characterize the relative amounts of each capsid protein from the v1.4 cell pool compared to the triple-transferred control SVEC0935. [Figure 26] This shows exemplary data of sequence reads matching various targets derived from rAAV particles produced by the v1.4 cell pool. [Figure 27] Exemplary data from digital droplet PCR for identifying inserted nucleic acids obtained from v1.3 and v1.4 cell pools are shown. [Figure 28] Exemplary gel electrophoresis data showing the size and type of insertion fragments (e.g., self-complementary or single-stranded) from v1.3 and v1.4 cell pools are shown. [Figure 29] This section presents illustrative scatter plot data showing consistent titer levels of capsid proteins and viral genomes produced through multiple repeated trials and production runs using v1.3 and v1.4 cell pools. [Figure 30] Exemplary AEX chromatograms and absorbance data for measuring the capsid-forming rAAV genome after AEX purification produced by the v1.4 cell pool are shown. [Figure 31] A shows exemplary data of titer levels (vg / mL and vp / mL) produced from a cell bank created through a 2-month passaging of a v1.3 cell pool. B shows exemplary data of titer levels (vg / mL and vp / mL) produced from a cell bank created through a 2-month passaging of a v1.4 cell pool. [Figure 32A] The bar graphs illustrate the increased purity resulting from the v1.3 and v1.4 cell pools compared to the v1.0 cell pool, v1.0 monoclonal strains, and triple-transferred cells. [Figure 32B] The table shows illustrative data illustrating the increased purity resulting from the v1.3 and v1.4 cell pools compared to the v1.0 cell pool, v1.0 monoclonal strains, and triple-transferred cells. [Figure 33] Exemplary data showing the production levels and efficiency of rAAV production from cells transiently transfected with the v1.4 construct or from cells with stably incorporated v1.4 constructs are presented. [Figure 34A] Exemplary vg titer data are shown, demonstrating improved yield, quality, and performance of rAAV produced from cells with stably incorporated v1.4 constructs compared to cells transiently transfected with v1.4 constructs. [Figure 34B] Exemplary data of filler capsid percentages are shown, illustrating the improved yield, quality, and performance of rAAV produced from cells with stably incorporated v1.4 constructs compared to cells transiently transfected with the v1.4 construct. [Figure 34C] Exemplary effect curve data are shown, illustrating the improved yield, quality, and performance of rAAV produced from cells with stably incorporated v1.4 constructs compared to cells transiently transfected with the v1.4 construct. [Figure 35A] This shows exemplary chromatographic data demonstrating comparable characteristics between rAAV produced from cells transiently translocated with the v1.4 construct and rAAV produced from cells with stably incorporated v1.4 construct. [Figure 35B] This shows exemplary chromatographic data demonstrating comparable characteristics between rAAV produced from cells transiently translocated with the v1.4 construct and rAAV produced from cells with stably incorporated v1.4 construct. [Figure 35C] Exemplary gel electrophoresis data are shown demonstrating comparable properties between rAAV produced from cells transiently translocated with the v1.4 construct and rAAV produced from cells with stably incorporated v1.4 construct. [Figure 35D] The table shows exemplary data demonstrating comparable characteristics between rAAV produced from cells transiently translocated with the v1.4 construct and rAAV produced from cells with stably incorporated v1.4 construct. [Figure 36] A shows exemplary data of cell titer levels (vg / mL) containing either a triple enhancer (e.g., hTERT, SV40, and CMV) or a double enhancer (e.g., SV40 and CMV), measured 3 and 7 days after induction. B shows exemplary data of cell titer levels (vp / mL) containing either a triple enhancer (e.g., hTERT, SV40, and CMV) or a double enhancer (e.g., SV40 and CMV), measured 3 and 7 days after induction. [Modes for carrying out the invention]

[0006] Polynucleotides, vectors, vector or polynucleotide systems, cells, and methods for expressing AAV Rep proteins are provided. In certain embodiments, these polynucleotides, vectors, vector or polynucleotide systems, cells, and methods may be used to produce higher levels of small Rep RNA transcripts compared to large Rep RNA transcripts. In certain embodiments, these polynucleotides, vectors, vector or polynucleotide systems, cells, and methods may be used to produce higher levels of small Rep proteins compared to large Rep proteins. In certain embodiments, these polynucleotides, vectors, vector or polynucleotide systems, cells, and methods may be used to produce lower levels of large Rep RNA transcripts compared to small Rep RNA transcripts. In certain embodiments, these polynucleotides, vectors, vector or polynucleotide systems, cells, and methods may be used to produce lower levels of large Rep proteins compared to small Rep proteins. In certain embodiments, these polynucleotides, vectors, vector or polynucleotide systems, cells, and methods may be used to produce rAAV. Enhanced expression of small Rep proteins compared to large Rep proteins is useful for increasing the total amount of virions. Enhanced expression of small Rep proteins compared to large Rep proteins is useful for increasing packaged virions during recombinant AAV production. Enhanced expression of small Rep proteins compared to large Rep proteins is useful for increasing the total amount of both virions and packaged virions during recombinant AAV production.

[0007] Before describing the polynucleotides, vectors, systems, cells, and methods of the present invention, it should be understood that the invention is not limited to the specific methods or components described, as such may naturally change. It should also be understood that the scope of the invention is limited only by the appended claims, and that the terms used herein are intended to describe specific embodiments and are not intended to limit them.

[0008] Where a range of values ​​is indicated, it should be understood that each intermediate value between the upper and lower limits of that range (up to one-tenth of the lower limit unit unless otherwise specified in the context) is also clearly disclosed. Each smaller range between any specified values ​​or intermediate values ​​within the specified range, and any other specified values ​​or intermediate values ​​within that specified range, are included within the scope of the invention. The upper and lower limits of these smaller ranges may be independently included in or excluded from that range, and each range in which one of the boundary values ​​is included, neither of the boundary values ​​is included, or both boundary values ​​are included within the scope of the invention according to any specifically excluded boundary values ​​of the specified range. Where one or both of the boundary values ​​are included in the specified range, the range excluding one or both of the boundary values ​​that are included is also included within the scope of the invention.

[0009] Unless otherwise defined, technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention pertains. Any methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the present invention, but several promising and preferred methods and materials are described below. All publications referenced herein are incorporated herein by reference to disclose and explain the methods and / or materials cited in such publications. In the event of any conflict, this disclosure shall be understood to supersede any disclosure in the incorporated publication.

[0010] As will become apparent to those skilled in the art by reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features that can be readily distinguished from or combined with the features of any of several other embodiments without departing from the scope or spirit of the invention. Any enumerated method may be carried out in the order of the enumerated events, or in any other logically possible order.

[0011] In use herein and in the appended claims, it should be noted that the singular forms “a,” “an,” and “the” include plural references unless otherwise specified in the context. Thus, for example, a reference to “cell” includes multiple such cells, and a reference to “vector” includes one or more vectors and their equivalents, such as viral vectors, plasmids, constructs, and other similar ones known to those skilled in the art.

[0012] The publications described herein are provided only for disclosures prior to the filing date of this application. Nothing in this specification should be construed as an acceptance that the present invention has no prior rights to such publications for the sake of prior art. Furthermore, the dates of the publications provided may differ from the actual publication dates and may need to be verified individually.

[0013] definition Unless otherwise defined, all technical and scientific terms used herein have the meanings generally understood by those skilled in the art in which this invention pertains.

[0014] In particular, with respect to a given quantity, the term "approximately" is intended to include a deviation of up to ±5 percent.

[0015] "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives. Unless otherwise specified, the term encompasses all subtypes and both naturally occurring and recombinant forms. The components of the AAV DNA genome consist of two open reading frames, Rep and Cap, flanked by two 145-base pair terminal inverted repeat sequences (ITRs). The Rep gene encodes several distinct proteins, including Rep78, Rep68, Rep52, and Rep40. These proteins are also referred to herein as Rep proteins or simply Rep, and may encompass one or more of Rep78, Rep68, Rep52, and Rep40, as well as their functional variants and homologs. Rep78 and Rep68, as well as their functional variants and homologs, are referred to herein as large Reps. Rep52 and Rep40, as well as their functional variants and homologs, are referred to herein as small Reps. Rep proteins from specific serotypes of AAV may also be referred to as Rep1, Rep2, etc., where these Rep proteins are derived from AAV1 or AAV2 serotypes, respectively. The Cap genes encode the capsid proteins VP1, VP2, and VP3, which are required for the production of rAAV capsids. These proteins are referred to herein as Cap proteins or Cap, and may include VP1, VP2, and VP3, as well as one or more of their functional variants and homologs. Cap proteins from specific serotypes of AAV may also be referred to as Cap1, Cap2, Cap4, etc., where these Rep proteins are derived from AA1, AAV2, or AAV5 serotypes, respectively. In addition to Rep and Cap, AAV requires helper plasmids containing genes derived from helper viruses such as adenoviruses, including E1a, E1b, E4, E2a, and VA genes, for AAV replication.

[0016] "Recombinant viruses" are intended to represent viruses that have been genetically modified, for example, by adding or inserting heterologous nucleic acid constructs into the virus.

[0017] The abbreviation "rAAV," also called recombinant AAV vector (or "rAAV vector"), refers to recombinant adeno-associated virus. The term "AAV" encompasses any AAV serotype and AAV vectors based on combinations of different serotypes (also called "hybrid AAV vectors" or "pseudotyped AAV vectors"). AAV serotypes include AAV1 (AAV-1), AAV2 (AAV-2), AAV3 (AAV-3), AAV4 (AAV-4), AAV5 (AAV-5), AAV6 (AAV-6), AAV7 (AAV-7), AAV8 (AAV-8), AAV9 (AAV-9), AAV10 (AAV-10), AAV11 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, These may include sheep AAVs, evolved capsids with low immunogenicity to mice and humans such as AAV-7m8, AAV-6.2, AAV-Dj, AAV-DJ / 8, AAV2-retro, AAV2-QuadYF, and AAV2.7m8, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.eS, and their variants and combinations. "Primate AAVs" refer to AAVs isolated from primates, "non-primate AAVs" refer to AAVs isolated from non-primate mammals, and "bovine AAVs" refer to AAVs isolated from mammals of the genus Bovine (e.g., cattle). "rAAV vectors" contain polynucleotide sequences that are not of AAV origin (i.e., polynucleotides heterologous to AAVs), typically containing a polynucleotide sequence of interest for introduction into target cells. Generally, heterologous polynucleotides are flanked by at least one, usually two, AAV inverted terminal repeats (ITRs). Heterologous polynucleotides may also be referred to as polynucleotide payloads. The term rAAV vector encompasses both rAAV virions and rAAV vector plasmids.

[0018] "AAV virus," "AAV virus particle," "rAAV vector particle," or "rAAV particle" refers to a viral particle composed of at least one AAV capsid protein (typically all capsid proteins of wild-type AAV) and a polynucleotide rAAV vector enclosed in the capsid. If the particle contains heterologous polynucleotides (i.e., polynucleotides other than those of the wild-type AAV genome, e.g., a transgene delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector." Therefore, the production of rAAV particles inevitably involves the production of such rAAV vectors, since the vector is contained within the rAAV particle.

[0019] "Packaging" refers to a series of intracellular events that result in assembly, capsid formation, and the production of AAV particles.

[0020] The AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication protein and capsid protein of adeno-associated virus. In this specification, AAV rep and cap are referred to as AAV "packaging genes."

[0021] "AAV Rep coding region," "sequence encoding one or more Rep proteins," or "Rep coding sequence" and their grammatical equivalents mean an AAV genomic region recognized in the art that encodes viral replication proteins required to replicate the viral genome and / or payload flanked by the ITR. As used herein, the rep coding region may originate from any viral serotype, such as those described above. This region does not need to contain all of the wild-type genes, but may be modified, for example, by nucleotide insertions, deletions, or substitutions, as long as the rep genes result in the expression of Rep proteins. Rep coding sequences are further described below.

[0022] The terms “AAV Cap coding region,” “sequence encoding one or more Cap proteins,” or “Cap coding sequence” and their grammatical equivalents mean an AAV genomic region recognized in the art that encodes a viral coat protein required for the capsid on which the viral genome or payload is packaged by the Rep protein. For further explanation of the Cap coding region, see, for example, Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158, 97-129 and Kotin, RM (1994) Human Gene Therapy 5, 793-801. As used herein, the AAV Cap coding region may be derived from any AAV serotype as described above. This region does not need to contain all of the wild-type cap genes, but may be modified, for example, by nucleotide insertions, deletions, or substitutions, as long as the genes provide sufficient packaging function. Cap coding sequences are further described below.

[0023] "Adeno-associated virus terminal inverted repeat sequences" or "AAV ITRs" refer to regions found at each end of the AAV genome that function together in cis as initiation points for DNA replication and as packaging signals for the viral genome. The nucleotide sequences of AAV ITR regions are publicly known. For AAV-2 ITR sequences, see, for example, Kotin, RM (1994) Human Gene Therapy 5, 793-801, and Berns, KI "Parvoviridae and their Replication" in Fundamental Virology, 2nd ed. (BNFields and DMKnipe, eds.). As used herein, "AAV ITRs" do not need to have wild-type nucleotide sequences, but may be modified, for example, by nucleotide insertions, deletions, or substitutions. AAV ITRs may originate from any of several AAV serotypes, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, etc. Furthermore, the 5' and 3' ITRs adjacent to the selected nucleotide sequence within the AAV vector do not necessarily have to be identical, nor do they necessarily have to originate from the same AAV serotype or isolate. The ITRs can be single-stranded (ssITRs) or self-complementary (scITRs).

[0024] A "helper virus" for AAV refers to a virus that enables AAV (e.g., wild-type AAV) to replicate and package in mammalian cells. Various such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses, and poxviruses, such as vaccinia. Adenoviruses encompass numerous different subgroups, but adenovirus type 5 of subgroup C is the most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and available from contract laboratories such as ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), which are also available from contract laboratories such as ATCC.

[0025] "Helper virus function(s)" refers to a function(s) encoded in a helper virus genome that enables AAV replication and packaging (in conjunction with other replication and packaging requirements described herein). As described herein, "Helper virus function(s)" can be provided in a number of ways, including providing a helper virus or, for example, providing a polynucleotide sequence encoding the required function(s) in trans to a producing cell.

[0026] An “infectious” virus or viral particle is one that contains polynucleotide components that the viral species can deliver to cells that it is attracted to. This term does not necessarily imply any replication ability of the virus. As used herein, an “infectious” virus or viral particle is one that can reach target cells, infect target cells, and induce heterologous nucleic acids within target cells. Thus, “infectivity” refers to the ability of a viral particle to reach target cells, infect target cells, and induce heterologous nucleic acids within target cells. Infectivity may refer to in vitro or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles may be expressed as the number of viral genome (vg) copies. The ability of a viral particle to induce heterologous nucleic acids within cells may be referred to as “transduction.” The ability of viral particles to express heterologous nucleic acids within cells can be analyzed using a number of techniques, including evaluation of marker genes, e.g., green fluorescent protein (GFP) assays in which GFP is produced in cells infected with viral particles and detected and / or measured (e.g., in this assay, the virus contains a nucleotide sequence encoding GFP); or measurement of the produced protein by enzyme-linked immunosorbent assay (ELISA). Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Methods for determining the ratio of infectious viral particles to total viral particles are known in the art. See, for example, Grainger et al. (2005) Mol.Ther.11:S337 (which describes a TCID50 infectivity titer assay) and Zolotukhin et al. (1999) Gene Ther.6:973.

[0027] The term “polynucleotide” refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides, ribonucleotides, or analogs thereof. Polynucleotides may include modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. Where present, modifications to the nucleotide structure may be conferred before or after the construction of the polymer. As used herein, the term polynucleotide is interchangeable with double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms that are known or expected to constitute the double-stranded form.

[0028] As used herein, the term “polynucleotide construct” refers to a DNA fragment of any size comprising one or more sequences encoding RNA or proteins, and at least one promoter for driving expression from those sequences. A polynucleotide construct may be circular DNA or linear DNA. A polynucleotide construct may be single-stranded or double-stranded. As used herein, the term “vector” encompasses any genetic element that, when bound to a suitable regulatory element, is capable of replicating and transferring gene sequences to and between cells, such as plasmids, phages, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. Thus, the term encompasses cloning and expression media, as well as viral vectors. Throughout this specification, the use of the term “vector” encompasses plasmids or viral vectors that enable the introduction of desired components into host cells by transduction or infection. For example, an adeno-associated virus (AAV) vector is a plasmid containing a recombinant AAV genome. In some embodiments, a useful vector is intended to be a vector in which the nucleic acid segment to be transcribed is under the transcriptional control of a promoter. The vector may be linear or circular, single-stranded or double-stranded DNA or RNA. In certain embodiments, the vector may be circular double-stranded DNA.

[0029] As used herein, the term “vector system” refers to two or more vectors used together, for example, by simultaneous or sequential introduction into cells, to provide cells with at least two different components. The two different components can then cooperate within the cell.

[0030] A polynucleotide or polypeptide has a certain percentage of “sequence identity” with respect to another polynucleotide or polypeptide, meaning that when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. In the context of two or more nucleic acid or polypeptide sequences, the term “sequence identity” percentage refers to two or more sequences or subsequences that have a certain percentage of identical nucleotide or amino acid residues when compared and aligned for the greatest match, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those skilled in the art) or by visual inspection. Depending on the application, the “sequence identity” percentage may be present across a region of the sequences being compared, e.g., a functional domain, or alternatively, across the entire length of the two sequences being compared.

[0031] In sequence comparison, typically, one sequence acts as the reference sequence (also called the subject sequence) compared to the test sequence (also called the query sequence). Sequence identity percentage is defined as the degree of identity of the test sequence with respect to the reference sequence. For example, when we say "sequence A has 50% sequence identity with sequence B," sequence A is the test sequence and sequence B is the reference sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into a computer program, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then aligns the sequences based on the specified program parameters to achieve the maximum possible alignment, introducing gaps in the alignment as needed. The sequence identity percentage of the test sequence(s) with respect to the reference sequence can then be determined from the alignment of the test sequence with respect to the reference sequence. The equation for the sequence identity percentage of the aligned sequences is as follows: [(Number of identical positions) / (Total number of positions in the test sequence)] × 100%.

[0032] For the purposes of this specification, the calculation of identity percentage and sequence similarity is performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J.Mol.Biol.215:403-410 (1990). Software for performing BLAST analysis is available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm searches using a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence), or in some examples, using a database of multiple reference sequences. The BLAST algorithm performs sequence alignment by scoring the alignment of short regions (called "words") of the test sequence with the reference sequence, thereby discovering high-scoring alignment regions between the test sequence and the reference sequence. The scoring of each alignment is determined by the BLAST algorithm, taking into account factors such as the number of aligned positions and whether introducing a gap between the test sequence and the reference sequence improves the alignment. Nucleic acid alignment scores can be scored using a set match / mismatch score. For protein sequences, alignment scores can be scored using a substitution matrix to assess the significance of the sequence alignment, e.g., the similarity between aligned amino acids based on evolutionary substitution probabilities. The substitution matrix used for the purposes described herein is the BLOSUM62 matrix. For the purposes described herein, general default values ​​as of April 6, 2023, are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output “identity percentage” and “query coverage” values. The overall sequence identity percentage, as used herein, can then be calculated from the BLASTN or BLASTP output values ​​as follows: Array identity percentage = ("Identity Percentage" output value) × ("Query Coverage Rate" output value).

[0033] The following non-restrictive example illustrates the calculation of identity percentage between two nucleic acid sequences. Identity percentage is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)] × 100%. Identity percentage is calculated to compare test sequence 1: AAAAAGGGGG (length = 10 nucleotides) with reference sequence 2: AAAAAAAAAA (length = 10 nucleotides). The identity percentage between test sequence 1 and reference sequence 2 is [(5) / (10)] × 100% = 50%. Test sequence 1 has 50% sequence identity with reference sequence 2. In another example, identity percentage is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides) with reference sequence 4: GGGGGGGGGG (length = 10 nucleotides). The identity percentage between test sequence 3 and reference sequence 4 is [(10) / (20)] × 100% = 50%. Test sequence 3 has 50% sequence identity with reference sequence 4. In another example, the identity percentage is calculated to compare test sequence 5: GGGGGGGGGG (length = 10 nucleotides) with reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides). The identity percentage between test sequence 5 and reference sequence 6 is [(10) / (10)] × 100% = 100 percent. Test sequence 5 has 100 percent sequence identity with reference sequence 6.

[0034] The following non-restrictive example illustrates the calculation of identity percentage between two protein sequences. Identity percentage is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)] × 100%. Identity percentage is calculated to compare test sequence 7: FFFFFYYYYY (length = 10 amino acids) with reference sequence 8: YYYYYYYYYY (length = 10 amino acids). The identity percentage between test sequence 7 and reference sequence 8 is [(5) / (10)] × 100% = 50%. Test sequence 7 has 50% sequence identity with reference sequence 8. In another example, identity percentage is calculated to compare test sequence 9: LLLLFFFFFYYYYYLLLLL (length = 20 amino acids) with reference sequence 10: FFFFFYYYYY (length = 10 amino acids). The percentage of identity between test sequence 9 and reference sequence 10 is [(10) / (20)] × 100% = 50%. Test sequence 9 has 50% sequence identity with reference sequence 10. In another example, the percentage of identity is calculated to compare test sequence 11: FFFFFYYYYY (length = 10 amino acids) with reference sequence 12: LLLLFFFFFYYYYYLLLLL (length = 20 amino acids). The percentage of identity between test sequence 11 and reference sequence 12 is [(10) / (10)] × 100% = 100 percent. Test sequence 11 has 100 percent sequence identity with reference sequence 12.

[0035] For the purposes of this specification, references to polynucleotide sequences (e.g., DNA sequences or RNA sequences) also include their reverse complements. For example, the sequence AAAAAGGGGG also includes the sequence CCCCCTTTTT.

[0036] A "gene" refers to a polynucleotide containing at least one open reading frame that can code for a specific protein after transcription and translation.

[0037] The term “host cell” means, for example, microorganisms, yeast cells, insect cells, and mammalian cells that can or have been used as hosts for AAV vector systems or other transdextrinsed DNA as described herein. This term encompasses the offspring of the transfected original cell. Therefore, as used herein, “host cell” generally refers to a cell transfected with an exogenous DNA sequence. It will be understood that offspring of a single parental cell may not necessarily be completely identical to the original parent in morphology or in genomic DNA complement or whole DNA complement due to spontaneous, accidental, or intentional mutations.

[0038] As used herein, the term “cell line” refers to a population of cells capable of proliferating and dividing sustainably or over a long period in vitro. In many cases, a cell line is a clonal population derived from a single progenitor cell. Furthermore, it is known in the art that spontaneous or induced changes may occur in the karyotype during the preservation or passage of such a clonal population. Thus, cells derived from a cell line referred to may not be exactly identical to the ancestral cell or ancestral culture, and the cell line referred to encompasses such variants.

[0039] The term “cell culture” refers to cells grown attached to and in a bioreactor, roller bottle, HYPERStack, microsphere, macrosphere, flask, or in a suspension state, as well as the components of the supernatant or suspension itself, including, but not limited to, rAAV particles, cells, cell fragments, cellular contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids, and lipids, and flocculants. Large-scale approaches such as bioreactors (including suspension cultures and adherent cells growing attached to microcarriers or macrocarriers in agitated bioreactors) are also encompassed by the term “cell culture.” Cell culture procedures for both large-scale and small-scale protein production are included in this disclosure.

[0040] The capsid formation ratio of a population of rAAV virions can be measured as the ratio of rAAV viral particles (VP) to viral genome (VG). rAAV viral particles include empty capsids, partially complete capsids (e.g., containing a portion of the viral genome), and complete capsids (e.g., containing a complete viral genome).

[0041] The F:E ratio of a population of rAAV virions can be measured as the ratio of complete rAAV capsids to empty capsids. Complete rAAV capsid particles include partially complete capsids (e.g., containing a portion of the viral genome) and complete capsids (e.g., containing a complete viral genome). Empty capsids lack the viral genome.

[0042] The potency or infectivity of a population of rAAV virions can be measured as the percentage of target cells infected with rAAV virions at a given MOI (metabolic index; viral genome / target cell). An example MOI value is 1 × 10⁻⁶. 1 , 1 x 10 2 , 2×10 3 , 5×10 4 , or 1 × 10 5 vg / target cells. MOI is 1 × 10⁻⁶ 1 ~1 × 10 5 The value may be selected from the range of vg / target cells.

[0043] As used herein, the terms “nutrient requirement” or “nutrient requirement selection marker” refer to the use of supplement-deficient media, such as media lacking essential nutrients, such as hypoxanthine and thymidine (HT), which are purine precursors, for the selection of functional enzymes, such as functional dihydrofolate reductase, that enable growth in media lacking essential nutrients.

[0044] The term "tetracycline" is used herein to refer to all antibiotics that are structurally and functionally related to tetracycline, including tetracycline, doxycycline, demeclocycline, minocycline, thalecycline, oxytetracycline, omadacycline, or ellabacycline.

[0045] The terms “constitutive” and “constitutive expression” are used interchangeably herein. They refer to genes that are continuously transcribed. Such genes are driven by constitutive promoters. In some embodiments, this term refers to the expression of a therapeutic payload or nucleic acid sequence that does not depend on the addition of an expression inducer to the cell culture medium. Constitutive promoters can induce sustained gene expression in cells. Constitutive promoters regulate the expression of basic genes such as housekeeping genes. In contrast, inductive promoters induce gene expression in the presence or absence of a specific transcription activator(s) or transcription repressor(s). Thus, inductive promoters can be controlled by controlling the levels of a transcription activator(s) or transcription repressor(s).

[0046] As used herein, the term “polynucleotide payload” refers to the polynucleotide sequence packaged in an rAAV virion for delivery to a cell by said rAAV virion. The polynucleotide payload is flanked by AAV terminal inverted repeats (ITRs). Upon delivery to a cell, the polynucleotide payload may be available to the cell as DNA (e.g., homology regions for homologous recombination repair), or it may be transcribed into RNA (e.g., guide RNA (gRNA), tRNA, suppressor tRNA, siRNA, miRNA, mRNA, shRNA, circular RNA, antisense oligonucleotide (ASO)), or it may be transcribed and translated into polypeptides (e.g., antibodies, hormones, site-specific endonucleases, reporter genes, components of the CRISPR / Cas system, RNA adenosine deaminase (ADAR) enzymes, transcription activators, transcription repressors, ribozymes, or DNA enzymes).

[0047] The term "recombinant" applied to polynucleotides means that the polynucleotide is the product of various combinations of procedures, including cloning, restriction enzymes, or ligation steps, and other procedures that result in constructs different from naturally occurring polynucleotides. Recombinant viruses are viral particles containing recombinant polynucleotides. The term encompasses both the replication of the original polynucleotide construct and the offspring of the original viral construct, respectively.

[0048] A “regulatory element” or “regulatory sequence” is a nucleotide sequence involved in molecular interactions that contribute to the regulation of polynucleotide function, including replication, duplication, transcription, splicing, translation, or degradation of polynucleotides. Regulation can affect the frequency, rate, or specificity of a process and may be inherently enhancing or repressive. Regulatory elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region that, under certain conditions, can bind to RNA polymerase and initiate transcription of a coding region typically located downstream (3') from the promoter. Promoters are usually located upstream of the gene whose expression is regulated by the promoter.

[0049] "Functionally linked" or "operably linked" refers to the juxtaposition of genetic elements in a relationship that enables them to function in the predicted manner. For example, if a promoter assists in the initiation of transcription of a coding sequence, the promoter is functionally linked to the coding region. Residues may be interposed between the promoter and the coding region as long as this functional relationship is maintained.

[0050] "Heterogeneous" means that the entity being compared originates from an entity whose genotype differs from the rest of the entity being compared. For example, a polynucleotide introduced into a plasmid or vector from a different species by genetic engineering is a heterogeneous polynucleotide. A promoter that is extracted from a natural coding sequence and functionally ligated to a coding sequence that is not found to be naturally ligated is a heterogeneous promoter. Therefore, for example, an rAAV containing heterogeneous nucleic acids encoding a heterogeneous payload is an rAAV containing nucleic acids not typically found in naturally occurring wild-type AAVs, and the heterogeneous payload it encodes is a payload not typically encoded by naturally occurring wild-type AAVs. As another example, a large Rep coding sequence functionally ligated to a heterogeneous promoter refers to a large Rep coding sequence functionally ligated to a non-natural promoter.

[0051] Cells are said to have been "stably" modified, transduced, genetically modified, or transformed using a gene sequence that allows the sequence to perform its function during long-term in vitro culture of the cell. Generally, such cells are "genetically" modified (genetically modified) in the sense that a genetic change has been introduced that is inherited by the offspring of the modified cell. For example, a gene integrated into the nuclear genome of a cell can perform its function during long-term in vitro culture of the cell. A gene integrated into the nuclear genome of a cell is inherited by the offspring of the cell.

[0052] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. This term also encompasses modified amino acid polymers (e.g., disulfide bond formation, glycosylation, lipid addition, phosphorylation, or conjugation with labeling components). Polypeptides, such as anti-angiogenic polypeptides and neuroprotective polypeptides, when used in the context of delivery of payloads and their compositions to mammalian subjects, refer to the respective intact polypeptides, or any fragments or genetically modified derivatives thereof, that possess the desired biochemical function of an intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids (which may be referred to as “transgenes” delivered to recipient cells) for use in delivery of payloads to mammalian subjects encompass polynucleotides encoding intact polypeptides or any fragments or genetically modified derivatives possessing the desired biochemical function.

[0053] "Isolated" plasmids, nucleic acids, vectors, viruses, virions, host cells, or other substances mean preparations of a substance or similar substance that lack at least some of other components that may be present in the substance or similar substance in nature or where it was originally prepared. Thus, for example, an isolated substance may be prepared by concentrating it from a source mixture using purification techniques. Concentration may be measured on an absolute standard, such as weight per unit volume of solution, or with respect to other potential interfering substances present in the source mixture. In embodiments of the present invention, greater concentration facilitates greater isolation. In some examples, the isolated plasmids, nucleic acids, vectors, viruses, host cells, or other substances are purified to, for example, about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99% or more pure.

[0054] The terms “treatment,” “to treat,” and “to treat” are used herein to generally refer to obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in that it completely or partially prevents a disease or its symptoms, and / or therapeutic in that it partially or completely stabilizes or cures the disease and / or adverse effects resulting from the disease. The term “treatment” encompasses any treatment of a disease in mammals, in particular humans, and includes: (a) preventing the development of a disease and / or symptoms in a subject that is susceptible to the disease or symptoms but has not yet been diagnosed with it; (b) suppressing the disease and / or symptoms, i.e., preventing the development of the disease and / or associated symptoms; or (c) reducing the disease and / or associated symptoms, i.e., causing regression of the disease and / or symptoms. Those who may require treatment include individuals who are already afflicted (e.g., those with neurological disorders) and those for whom prevention is desirable (e.g., those with a high susceptibility to neurological disorders; those suspected of having neurological disorders; those with one or more risk factors for neurological disorders).

[0055] The "therapeutically effective dose" or "effective dose" means the amount of a compound sufficient to achieve such treatment of a disease in a mammal or other subject with one or more doses, either in combination with another drug or alone, when administered to that subject. The "therapeutically effective dose" varies depending on the compound, the disease and its severity, and the age, weight, etc., of the subject being treated.

[0056] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein and are not limited to them, but refer to mammals, including humans and non-human primates, including monkeys and humans; mammalian athletic animals (e.g., horses, camels, etc.); mammalian domesticated animals (e.g., sheep, goats, cattle, etc.); mammalian pets (e.g., dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some examples, the individual is a human.

[0057] The terms "hybridize" and "hybridization" refer to the formation of a complex between nucleotide sequences that are sufficiently complementary to form a complex through Watson-Crick base pairing.

[0058] The term "homologous region" refers to a region of nucleic acid that has homology to another nucleic acid region. Therefore, whether a "homologous region" exists in a nucleic acid molecule is determined with respect to another nucleic acid region in the same molecule or a different molecule. Furthermore, since nucleic acids are often double-stranded, as used herein, the term "homologous region" refers to the ability of nucleic acid molecules to hybridize with one another. For example, a single-stranded nucleic acid molecule may have two homologous regions that can hybridize with one another. Therefore, the term "homologous region" includes nucleic acid segments having complementary sequences. Homologous regions can vary in length, but are typically 4 to 500 nucleotides long (e.g., approximately 4 to 40, 40 to 80, 80 to 120, 120 to 160, 160 to 200, 200 to 240, 240 to 280, 280 to 320, 320 to 360, 360 to 400, 400 to 440, etc.).

[0059] As used herein, the terms “complementary” or “complementarity” refer to polynucleotides that can form base pairs with one another. Base pairing is typically formed by hydrogen bonds between nucleotide units in antiparallel orientations between polynucleotide chains. Complementary polynucleotide chains can form base pairs in the Watson-Crick manner (e.g., AT, AU, CG) or in any other manner that allows for the formation of double helix. As those skilled in the art will know, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is considered the base complementary to adenosine. However, where uracil is represented in the context of this invention, unless otherwise specified, its ability to substitute for thymine is implied. “Complementarity” can exist between two RNA chains, between two DNA chains, or between an RNA chain and a DNA chain. It is generally understood that two or more polynucleotides may be “complementary” even if they have less than 100% or less complete complementarity, and can form double helix. Two sequences are "perfectly complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence containing a complementary region perfectly base-pairs with the other polynucleotide without any mismatch or interruption within that region. Two or more sequences are considered "perfectly complementary" or "100% complementary" insofar as contiguous complementary regions within each polynucleotide can perfectly hybridize with the other, even if one or both polynucleotides contain additional non-complementary sequences. "Not perfectly complementary" refers to a situation where not all contiguous nucleotides within such complementary region can base-pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of common skill in the art.

[0060] As used herein, the term “recombination site” means a region of a nucleic acid molecule containing a binding site or sequence-specific motif that is recognized by a site-specific recombinase that binds to a target site and catalyzes the recombination of a specific sequence of DNA at that target site. The site-specific recombinase catalyzes recombination between two such target sites. The relative orientation of the target sites determines the outcome of the recombination. For example, if the recombination sites are located on separate DNA molecules, a translocation occurs. DNA between two recombination sites oriented in the same direction on the same DNA molecule is excised as a circular loop of DNA. DNA between two recombination sites oriented in opposite directions on the same DNA molecule becomes an inversion.

[0061] As used herein, the term “enhancer” refers to a non-coding nucleic acid sequence that is (cis) adjacent to a coding sequence and functions to increase the expression of transcripts and / or proteins from the coding sequence. Enhancers may include transcriptional enhancers or translational enhancers. A transcriptional enhancer is a DNA sequence that influences the rate at which nearby genes are transcribed into messenger RNA (mRNA) and ultimately translated into a functional protein. A translational enhancer is a specific sequence or structural element in messenger RNA (mRNA) that plays a role in regulating the translation process. Translational enhancers may be involved in regulating the efficiency or specificity of translation.

[0062] The terms “antibody” and “immunoglobulin” encompass any isotype of antibody or immunoglobulin, or antibody fragments that retain specific binding to an antigen, including, but are not limited to, Fab, Fv, scFv, and Fc fragments, chimeric antibodies, humanized antibodies, antibodies containing only the heavy chain (e.g., Camelidae VHH antibody), single-chain antibodies, bispecific antibodies, and fusion proteins containing the antigen-binding portion and non-antibody proteins of the antibody.

[0063] Polynucleotides for the expression of large and small Rep proteins The large Rep coding sequence partially overlaps with the small Rep coding sequence, such that the small Rep coding sequence is commonly found within a portion of the large Rep coding sequence. The large Rep coding sequence encodes two large Rep proteins, Rep78 and Rep68. The large Rep coding sequence is transcribed into an mRNA precursor, which is selectively spliced ​​to produce two mature mRNAs, one encoding the large Rep protein Rep78 and the other encoding the large Rep protein Rep68. The small Rep coding sequence encodes two small Rep proteins, Rep52 and Rep40. The small Rep coding sequence is transcribed into an mRNA precursor, which is selectively spliced ​​to produce two mature mRNAs, one encoding the small Rep protein Rep52 and the other encoding the small Rep protein Rep40.

[0064] A polynucleotide is provided comprising a first promoter operably ligated to a large Rep-coding sequence. In some embodiments, the first promoter is heterogeneous to the large Rep-coding sequence. The large Rep-coding sequence comprises a small Rep-coding sequence. In some embodiments, the promoter is operably ligated to the small Rep-coding sequence. The promoter operably ligated to the small Rep-coding sequence has higher promoter activity compared to the first promoter. In some embodiments, the large Rep-coding sequence comprises an intron and a small Rep-coding sequence. The intron comprises a second promoter operably ligated to the small Rep-coding sequence. The second promoter has higher promoter activity compared to the first promoter. In some embodiments, the second promoter is heterogeneous to the small Rep-coding sequence, and the second promoter has higher promoter activity compared to the first promoter.

[0065] In certain embodiments, the large Rep coding sequence includes an intron containing (i) a functional p19 promoter operably ligated to the small Rep coding sequence and (ii) a second promoter. In this embodiment, the polynucleotide expresses transcripts encoding two small Reps, one expressed under the control of the p19 promoter and the other under the control of the second promoter. When alternatively spliced, both transcripts encode two small Rep proteins, Rep58 and Rep40. In certain embodiments, the intron and therefore the second promoter are located downstream of the p19 promoter and upstream of the transcription start site of the small Rep coding sequence.

[0066] In other embodiments, the p19 promoter is mutated to substantially reduce promoter activity. In some embodiments, the TATA box of the p19 promoter is mutant. In certain embodiments, the mutant p19 promoter results in a reduction of small rep expression to levels at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or undetectable compared to the expression level of small rep under the control of the native p19 promoter. In some embodiments, the polynucleotide lacks a functional p19 promoter.

[0067] In a particular embodiment, the first promoter operably ligated to the large Rep coding sequence is the native p5 promoter, and expression from the large Rep coding sequence is controlled by the p5 promoter.

[0068] In certain embodiments, the first promoter operably ligated to the large Rep-coding sequence is not a p5 promoter, the polynucleotide contains a native p5 promoter, and both the first promoter and the p5 promoter regulate expression from the large Rep-coding sequence. In certain embodiments, the first promoter is heterogeneous to the large Rep-coding sequence.

[0069] In certain embodiments, the p5 promoter located upstream of the AAV large Rep coding sequence is mutated to substantially reduce promoter activity. In certain embodiments, the first promoter operably ligated to the large Rep coding sequence is not the p5 promoter, the polynucleotide contains a mutant p5 promoter, and both the first promoter and the p5 promoter regulate expression from the large Rep coding sequence. In certain embodiments, the first promoter is heterogeneous to the large Rep coding sequence.

[0070] In other embodiments, the polynucleotide lacks a functional p5 promoter. In certain embodiments, the first promoter operably ligated to the large Rep coding sequence is not a p5 promoter, and the polynucleotide contains the first promoter but lacks a p5 promoter to control expression from the large Rep coding sequence. In certain embodiments, the p5 promoter located upstream of the AAV Rep coding sequence is removed. In certain embodiments, the p5 promoter located upstream of the AAV Rep coding sequence is replaced by the first promoter. In certain embodiments, the first promoter is heterogeneous to the large Rep coding sequence.

[0071] In a particular embodiment, one or both of the first and second promoters for driving the expression of large Rep proteins and small Rep proteins, respectively, are selected independently of constitutive promoters and / or inductive promoters. In certain embodiments, the first and second promoters may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Roussarcoma virus terminal repeat (RSV) promoter, chicken β-actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken β-actin (CAG) promoter, ribosomal protein L13a (RPL13a) promoter, elongation factor 1-α (EF1α or EF1 alpha) promoter, Simian virus 40 (SV40) initial promoter, phosphoglycerate kinase (PGK) promoter, hypoxanthine-guanine phosphoribosyltransferase (Hprt) promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, albumin promoter (ALB), muscle creatine kinase (MSC) promoter, sialophorin promoter (CD43), histone H4 promoter, prostaglandin kinase Tase 2 (PGS2) promoter, activated leukocyte adhesion molecule (ALCAM) promoter, fragile X intellectual disability 1 (FMR1) promoter, CD68 promoter, keratin 14 (K14) promoter, Thy1 promoter, pax6 paired box (P2) promoter, elongation factor 2 (EF2) promoter, platelet-derived growth factor β (PDGF-B) promoter, vascular endothelial growth factor receptor 2 (Flk-1) promoter, glucocorticoid receptor promoter (GRP), Lck promoter, myosin light chain 2 (MLC-2) promoter, chromobox homolog 3 (Cbx3) promoter, Nanog promoter, pancreaticoduodenal homeobox 1 (PDX1) promoter, nerve-specific enolase (NSE) promoter, CCAAT / enhancer-binding protein α (C / EBPα) promoter, Vav1 promoter, Rosa26 promoter, peroxisome proliferator-activated receptor γ coactivator 1α (hPGC1α) promoter,Cytokeratin 19 (Ck19) promoter, myeloperoxidase (MPO) promoter, fatty acid-binding protein 4 (FABP4) promoter, TATA box promoter, endothelial nitric oxide synthase (eNOS) promoter, vimentin promoter, glial fibrillary acidic protein (GFAP) promoter, calcium / calmodulin-dependent protein kinase IIα (CaMKIIα) promoter, γ-actin promoter, plasminogen activator inhibitor-1 (PAI-1) promoter, and stromal cell-derived factor-1 (SDF-1) promoter. In certain embodiments, (ii) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Roussarcoma virus terminal repeat (RSV) promoter; (ii) the first promoter is a chicken β-actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken β-actin (CAG) promoter and the second promoter is an RSV promoter; (iv) the first promoter is a chicken β-actin promoter and the second promoter is an RSV promoter; or (v) the first promoter is a herpes simplex virus (HSV) thymidine kinase (TK) (HSVtk) promoter and the second promoter is a mouse leukemia virus-derived (MND) promoter.

[0072] In a particular embodiment, the intron is a synthetic intron comprising a 5' splice donor site, a second promoter sequence, and a 3' splice acceptor site, wherein the splice donor and acceptor sites are compatible with the cells used to express the Rep protein. The intron is positioned to allow the generation of intron-less mRNA, which can then be translated to produce the large Rep proteins Rep78 and Rep68.

[0073] In certain embodiments, the polynucleotide includes a cleavable element that controls the expression of large and small Rep proteins. Since the small Rep coding sequence is common to the large Rep coding sequence, the cleavable element is positioned in the small Rep coding sequence so that it can control the expression of both small and large Rep proteins. The cleavable element includes a sequence containing a stop codon that prevents translation of the full-length Rep protein, thereby resulting in the expression of a truncated Rep protein that is non-functional and lacks the toxicity associated with the full-length Rep protein. The cleavable element includes a first recombination site and a second recombination site adjacent to the sequence containing the stop codon. The first and second recombination sites are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the cleavage of the sequence containing the stop codon, thereby enabling the expression of both the full-length large Rep protein and the full-length small Rep protein.

[0074] In certain embodiments, a small Rep code sequence may include a first spacer segment and a second spacer segment adjacent to a cleavable element, wherein the first spacer segment includes a 5' splice site (5'SS) at its 5' end, followed by a first intron; the second spacer segment includes a second intron, followed by a first 3' end; and the cleavable element includes, from its 5' end to its 3' end, a first recombination site, a second 3' splice site (3'SS), a stop signal sequence (e.g., a stop codon), and a second recombination site.

[0075] In certain embodiments, the excisable element is flanked by split introns to prevent read-through from the stop signal sequence. For example, a polynucleotide construct includes one or more native AAV Rep promoters operably ligated from 5' to 3' to a first portion of the AAV Rep coding sequence, a 5' splice site (SS), a first portion of an intron, a first recombination site, a first 3' SS, a coding sequence containing a stop signal sequence, a second recombination site, a second portion of an intron, a second 3' SS, and a second portion of the AAV Rep coding sequence, wherein the first recombination site, the first 3' splice site, the coding sequence containing the stop signal sequence, and the second recombination site form an excisable element, the first and second recombination sites are oriented in the same direction, and the one or more promoters are not operably ligated to the second portion of the AAV Rep coding sequence. The first and second recombination sites are recombined by inducible recombinase, resulting in the excision of excisable elements. This ligates the first portion of the AAV Rep coding sequence and the first portion of the intron to the second portion of the intron and the second portion of the AAV Rep coding sequence, resulting in a polynucleotide that forms a complete AAV Rep coding sequence including the intron. During transcription, the intron is excised by splicing via endogenous cellular mechanisms, producing mature mRNA that is translated to generate the AAV Rep protein.

[0076] In certain embodiments, the excisable element is flanked by split introns to prevent read-through from the stop signal sequence. For example, a polynucleotide construct includes one or more native AAV Rep promoters operably ligated from 5' to 3' to a first portion of the AAV Rep coding sequence, a 5' splice site (SS), a first portion of an intron, a first recombination site, a first 3' SS, a coding sequence containing a stop signal sequence, a second recombination site, a second portion of an intron, a second 3' SS, and a second portion of the AAV Rep coding sequence, wherein the first recombination site, the first 3' splice site, the coding sequence containing the stop signal sequence, and the second recombination site form an excisable element, the first and second recombination sites are oriented in opposite directions, and the one or more promoters are not operably ligated to the second portion of the AAV Rep coding sequence. The first and second recombination sites are recombined by inducible recombinase, resulting in the excision of excisable elements. This ligates the first portion of the AAV Rep coding sequence and the first portion of the intron to the second portion of the intron and the second portion of the AAV Rep coding sequence, resulting in a polynucleotide that forms a complete AAV Rep coding sequence including the intron. During transcription, the intron is excised by splicing via endogenous cellular mechanisms, producing mature mRNA that is translated to generate the AAV Rep protein.

[0077] In certain embodiments, the excisable element includes a sequence encoding a marker protein (e.g., a detectable marker) in frame with a stop codon, such that the marker protein is expressed when the excisable element is present. For example, detectable markers intended herein include luminescent markers, fluorescent markers, or radiolabels. Fluorescent markers include, but are not limited to, EGFP, GFP, BFP, RFP, or any combination thereof. In certain embodiments, the 5' splice site is a rabbit β-globin 5' splice site. In certain embodiments, both the first and second 3' splice sites are rabbit β-globin 3' splice sites. In certain embodiments, the vector may include an excisable element as described, for example, in paragraphs 10, 30, and 31 of US20220145328A1, which is incorporated herein by reference.

[0078] In certain embodiments, the polynucleotide comprises a large Rep coding sequence and a small Rep coding sequence, and a tag coding sequence present in frame, resulting in each of the large Rep and small Rep being expressed as a fusion protein containing the tag. Any suitable tag may be used. In certain embodiments, the tag is a purified tag and / or a detectable tag. In certain embodiments, the tag may be a polyhistidine tag, Flag tag, MYC tag, GST tag, MBP tag, Strep tag, etc.

[0079] In certain embodiments, the polynucleotide is configured to produce expression of the large Rep transcript at a lower level than the expression level of the large Rep transcript from a vector lacking a first promoter. In certain embodiments, the vector is configured to produce expression of the large Rep transcript at a lower level than the expression level of the large Rep transcript from a vector having a p5 promoter to drive large Rep expression. In certain embodiments, the first promoter is weaker than the p5 promoter. In certain embodiments, the first promoter is stronger than the p5 promoter but weaker than the second promoter that drives the expression of the small Rep transcript. In certain embodiments, the polynucleotide is configured to produce expression of the large Rep protein at a lower level than the expression level of the large Rep protein from a vector lacking a first promoter. In certain embodiments, the vector is configured to produce expression of the large Rep protein at a lower level than the expression level of the large Rep protein from a vector having a p5 promoter to drive large Rep expression. In certain embodiments, the first promoter is weaker than the p5 promoter. In certain embodiments, the first promoter is stronger than the p5 promoter but weaker than the second promoter that drives the expression of the small Rep protein.

[0080] In certain embodiments, the polynucleotide is configured to produce a higher level of expression of the small Rep transcript than that of the small Rep transcript from a vector lacking a second promoter. In certain embodiments, the vector is configured to produce a higher level of expression of the small Rep transcript than that of the small Rep transcript from a vector having a p19 promoter. In certain embodiments, the second promoter is stronger than the p19 promoter. In certain embodiments, the second promoter is weaker than the p19 promoter. In certain embodiments, the second promoter is weaker than the p19 promoter and stronger than the first promoter that drives the expression of the large Rep transcript. In certain embodiments, the polynucleotide is configured to produce a higher level of expression of the small Rep protein than that of the small Rep protein from a vector lacking a second promoter. In certain embodiments, the vector is configured to produce a higher level of expression of the small Rep protein than that of a vector having a p19 promoter. In certain embodiments, the second promoter is stronger than the p19 promoter. In certain embodiments, the second promoter is weaker than the p19 promoter. In certain embodiments, the second promoter is weaker than the p19 promoter but stronger than the first promoter that drives the expression of large Rep proteins.

[0081] In certain embodiments, the polynucleotide is configured to result in the expression of the large Rep transcript at a lower level than the expression level of the small Rep transcript. In certain embodiments, the polynucleotide is configured to result in the expression of the large Rep protein at a lower level than the expression level of the small Rep protein. In certain embodiments, the first promoter is weaker than the second promoter.

[0082] In certain embodiments, the ratio of expression levels of small Rep transcripts to large Rep transcripts using a vector is higher than the ratio of small Rep transcripts to large Rep transcripts produced using a vector that includes a p5 promoter instead of a first promoter to drive large Rep transcript expression and a p19 promoter instead of a second promoter to drive small Rep transcript expression. In certain embodiments, the ratio of expression levels of small Rep proteins to large Rep proteins using a vector is higher than the ratio of small Rep proteins to large Rep proteins produced using a vector that includes a p5 promoter instead of a first promoter to drive large Rep protein expression and a p19 promoter instead of a second promoter to drive small Rep protein expression.

[0083] In certain embodiments, the ratio of expression levels of small Rep transcripts to large Rep transcripts is in the range of 1.5:1 to 10,000:1, including 1.5:1, 1.8:1, 2:1, 2.3:1, 2.5:1, 2.8:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1, 50:1, 100:1, 300:1, 500:1, 1000:1, 3000:1, 5000:1, or 10,000:1. In certain embodiments, the ratio of small Rep protein expression levels to large Rep protein expression levels is in the range of 1.5:1 to 10,000:1, including 1.5:1, 1.8:1, 2:1, 2.3:1, 2.5:1, 2.8:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1, 50:1, 100:1, 300:1, 500:1, 1000:1, 3000:1, 5000:1, or 10,000:1.

[0084] In certain embodiments, the large Rep coding sequence encodes a transcript containing introns. When expressed in suitable cells, the introns are excised to produce a processed transcript that can be translated into Rep78 and Rep68. In certain embodiments, the large Rep coding sequence also includes excisable elements. When present in suitable cells that also include a recombinase (e.g., an inducible recombinase) that recombinates the first and second recombination sites, the excisable elements are excised, the large Rep coding sequence is transcribed into a transcript containing introns, these introns are excised to produce a processed transcript that can be translated into Rep78 and Rep68.

[0085] In certain embodiments, the open reading frame of the sequence encoding the small Rep protein is located within the large Rep encoding sequence, and a second promoter drives the expression of transcripts translated to Rep52 and Rep40. In certain embodiments, the second promoter is located within an intron.

[0086] Figure 1A shows a schematic diagram of a polynucleotide according to one embodiment described herein. The polynucleotide includes an upstream heterologous promoter (e.g., the first promoter) that replaces the native p5 ("P5") promoter of the AAV large Rep. In this example, the native p19 ("P19") promoter is mutated to reduce the expression of the small Rep (e.g., including a TATA box mutation). The open reading frame (ORF) of the large Rep partially overlaps with the ORF of the small Rep because the large and small Rep genes share the same ORF at their 3' ends. The upstream half of the Rep in this schematic refers to a portion of the large Rep coding sequence that codes for the large Rep sequence and does not overlap with the small Rep coding sequence. The downstream half of the Rep in this schematic refers to the small Rep coding sequence, which also includes the ORF that is part of the 3' end of the large Rep coding sequence. The custom intron in the schematic is an intron inserted between the upstream and downstream halves of the Rep and upstream of the small Rep coding sequence. However, in certain embodiments, the intron may be located further downstream in the small Rep coding sequence relative to the transcription start site of the small Rep, closer to the start site. In certain embodiments, the intron may be located further upstream in the transcription start site of the small Rep, closer to the p19 promoter (e.g., within 10 nucleotides (nt), 25 nt, 50 nt, 100 nt, 250 nt, or 500 nt). By placing the configuration of split introns and excisable elements proximal to the native p19 promoter or a heterologous promoter, the transcript length and potentially related polypeptides can be minimized, which can further minimize the potential for functional polypeptides. The intron may include a multi-cloning site to facilitate the introduction of a second promoter to drive the expression of the small Rep. The second promoter may be heterologous to the small Rep coding sequence. The polynucleotide construct may also include large Rep and small Rep ORFs and any ORF encoding an in-frame tag, thereby resulting in the production of tagged large and small Rep proteins.The p19 ("P19") promoter does not need to contain any mutations that reduce promoter activity. In addition, the 5' splice site and the 3' splice site must be in one or more intron-exon contexts such as: CAG-G, CAG-A, AAG-G, or AAG-A (where hyphens represent insertion sites).

[0087] Figure 1B: Schematic diagram of polynucleotides for the expression of AAV large Rep and small Rep transcripts, and subsequent expression of AAV large Rep and small Rep proteins from these transcripts. Introns are inserted upstream of the small Rep coding sequence, which is located within the large Rep coding sequence. The schematic diagram further shows that the p5 ("P5") promoter has been replaced with a heterologous promoter operably linked to the large Rep coding sequence, and the TATA box of the p19 ("P19") promoter has been mutated to reduce promoter activity.

[0088] Figure 2A shows a schematic diagram of the polynucleotides shown in Figure 1A for the expression of AAV large Rep and small Rep transcripts, and subsequent expression of AAV large Rep and small Rep proteins from these transcripts. Introns are inserted upstream of the small Rep coding sequence and are located within the large Rep coding sequence. A heterologous promoter (e.g., a second promoter) is introduced into the intron to drive transcription from the small Rep coding sequence. The schematic diagram further shows that the p5 ("P5") promoter is replaced by a heterologous promoter (e.g., a first promoter) operably ligated to the large Rep coding sequence. The p19 ("P19") promoter has not been modified to reduce promoter activity.

[0089] Figure 2B shows a schematic diagram of the polynucleotides shown in Figure 2A for the expression of AAV large Rep and small Rep transcripts, and subsequent expression of AAV large Rep and small Rep proteins from these transcripts. The intron is inserted upstream of the small Rep coding sequence and is located within the large Rep coding sequence. A heterologous promoter (e.g., a second promoter) is inserted into the intron and operably ligated to the small Rep coding sequence. The schematic diagram further shows that the p5 ("P5") promoter is replaced by a heterologous promoter (e.g., a first promoter) operably ligated to the large Rep coding sequence, and the TATA box of the P19 promoter is mutated to reduce promoter activity.

[0090] Figure 3 shows three types of transcripts produced from the polynucleotide shown in Figure 2B. Transcript 1 is produced under the control of an upstream heterologous promoter (e.g., the first promoter) and initially contains an intron. Once the intron is cleaved by splicing, a large Rep protein is translated from the processed transcript. Transcript 2 is produced under the control of an internal heterologous promoter (e.g., the second promoter) and is translated into a small Rep protein. Transcript 3 is produced under the control of the p19 promoter and is similar to transcript 2.

[0091] Figure 5 shows a schematic diagram of the polynucleotide shown in Figure 2B, which has a resectable element inserted at a position encoding a sequence common to both large and small Rep proteins. The resectable element contains a stop codon sandwiched between the recombination sites. The presence of this resectable element prevents the expression of full-length large and small Rep proteins. In the presence of recombinase, the recombination sites are ligated and the stop codon is removed, thereby enabling the expression of full-length large and small Rep proteins.

[0092] Figure 6 shows three types of transcripts generated from the polynucleotide shown in Figure 5. Transcript 1 is generated under the control of an upstream heterologous promoter (e.g., the first promoter), initially contains an intron, and is not translated into a large Rep protein due to the presence of a stop codon in a cleavable element. Transcript 2 is generated under the control of an internal heterologous promoter (e.g., the second promoter), and is not translated into a small Rep protein due to the presence of a stop codon in a cleavable element. Transcript 3 is generated under the control of the p19 promoter, initially contains an intron, and is not translated due to the presence of a stop codon in a cleavable element. In certain embodiments, the encoded Rep proteins are large and small Rep proteins derived from chimeric AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, and AAV-11, or combinations thereof. In certain embodiments, the encoded Rep proteins are large and small Rep proteins derived from AAV serotype 2.

[0093] The nucleotide sequences of AAV serotype genomes are publicly known. For example, the complete genome of AAV-1 is listed under GenBank accession number: NC_002077, and the complete genome of AAV-2 is listed under GenBank accession number: NC_001401 and Srivastava et al. The genomes of AAV-3 and AAV-4 are listed in al., J. Virol, 45:555-564 (1983). The complete genome of AAV-3 is listed under GenBank accession number: NC_1829, the complete genome of AAV-4 is listed under GenBank accession number: NC_001829, the genome of AAV-5 is listed under GenBank accession number: AF085716, the complete genome of AAV-6 is listed under GenBank accession number: NC_001862, and at least portions of the genomes of AAV-7 and AAV-8 are listed under GenBank accession numbers: AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 for AAV-8). The genome of AAV-9 is listed by Gao et al. The genome is published in al. Virol, 78:6381-6388 (2004), the AAV-10 genome in Mol Ther, 13(1):67-76 (2006), and the AAV-11 genome in Virology, 330(2):375-383 (2004).

[0094] In some embodiments, the Rep polypeptide is a wild-type Rep polypeptide. In other embodiments, the Rep polypeptide is a mutant Rep polypeptide. In some embodiments, the Cap polypeptide is a wild-type Cap polypeptide. In other embodiments, the Cap polypeptide is a mutant Cap polypeptide. The wild-type Rep polypeptide may be selected from one or more of SEQ ID NOs: 139-148, and the wild-type Cap polypeptide may be selected from one or more of SEQ ID NOs: 149-164. The following table provides an overview of which polypeptide sequences are associated with which AAV serotypes. [Table 1]

[0095] Polynucleotides containing enhancers for Rep protein expression In certain embodiments, a polynucleotide is provided comprising an AAV Rep coding sequence operably linked to a native Rep promoter, a poly(A) signal sequence, and an enhancer downstream of the poly(A) signal sequence. A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer. The enhancer increases the expression of the Rep protein compared to expression from a polynucleotide lacking the enhancer.

[0096] A suitable polyA signal sequence may be a signal sequence that increases the length of polyA added to Rep mRNA and / or the amount of Rep mRNA having long polyA, compared to a coding sequence that does not contain a polyA signal sequence. In certain examples, the polyA signal sequence may be an AAV Rep polyA signal sequence. In certain examples, the polyA signal sequence may be a natural AAV Rep polyA signal sequence. In certain examples, the polyA signal sequence may be a polyA signal sequence stronger than the AAV Rep polyA signal sequence. In certain embodiments, a polyA signal sequence stronger than the AAV Rep polyA signal sequence may be a bGH polyA signal sequence or an SV40 polyA signal sequence, as described herein. Additional suitable polyA signal sequences are described in the following section titled “PolyA Signal Sequences”.

[0097] In specific embodiments, a polynucleotide is provided comprising an AAV Rep coding sequence operably linked to a natural Rep promoter, a bGH polyA signal sequence downstream of the AAV Rep coding sequence, and an enhancer downstream of the bGH polyA signal sequence.

[0098] Suitable enhancers may be translational enhancers and / or transcriptional enhancers. Suitable promoters are listed in the section titled “Enhancers” below.

[0099] PolyA signal sequence In certain cases, the polyA signal sequence may be an AAV Rep polyA signal sequence containing a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with respect to SEQ ID NO: 1.

[0100] In certain cases, the polyA signaling sequence may be a stronger polyA signaling sequence than the AAV Rep polyA signaling sequence, where the native AAV Rep polyA signaling sequence contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1. The stronger polyA signaling sequence than the AAV Rep polyA signaling sequence results in a higher level of Rep protein expression compared to the expression level of Rep protein using the AAV Rep polyA signaling sequence, e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, or more.

[0101] In various examples, the polyadenylation signal sequence includes one or more of the following: bovine growth hormone polyadenylation (bGH polyA), human growth hormone polyadenylation (hGH polyA), and / or Chinese hamster growth hormone polyadenylation (chGH polyA).

[0102] The bGH polyA signal may contain nucleotide sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 2.

[0103] The hGH polyA signal may contain nucleotide sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence of SEQ ID NO: 3, or 100% sequence identity.

[0104] The chGH polyA signal may contain a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to the nucleotide sequence of SEQ ID NO: 4.

[0105] Further details regarding the poly(A) signal sequence can be found in U.S. Patents No. 11,793,180, 11,752,181, 10,912,826, 8,975,391, 7,557,197, and 5,122,458; U.S. Patent Application Publications No. 2023 / 0332169, 2023 / 0330265, and 2023 / 0323390; or Gene Volume 231, Issues 1-2, 29 April 1999, Pages 77-86, Mol Cell Biol. 1989 Oct;9(10):4248-4258, and Nucleic Acids Research, Volume 15, Issue 23, 10 December 1987, Pages The poly(A) signal sequences disclosed in 9627-9640 are incorporated herein by reference in their entirety.

[0106] In certain cases, the SV40 polyA signal sequence may contain a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0107] Additional suitable polyA signal sequences may be selected from one or more of the following: human neuropilin-1 polyA signal sequences, nopalin synthase polyA signal sequences, α-globulin polyA signal sequences, rabbit globin polyA signal sequences, and / or other applicable polyadenylated signal sequences. In such examples, the polyA signal sequences may include nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any of SEQ ID NOs. 6-10.

[0108] Enhancer An enhancer can be any enhancer or combination of enhancers that enhance the transcription and / or translation of a gene. In certain examples, an enhancer located downstream of a poly(A) signaling sequence located downstream of a Rep coding sequence (e.g., the AAV Rep poly(A) signaling sequence or a stronger poly(A) signaling sequence, e.g., the bGH poly(A) signaling sequence or the SV40 poly(A) signaling sequence) can be a single enhancer or a combination of enhancers that enhance the transcription and / or translation of the AAV Rep protein. A combination of enhancers can include two enhancers (i.e., a double enhancer), three enhancers (i.e., a triple enhancer), four enhancers, five enhancers, or more.

[0109] In certain examples, the enhancer is selected from the cytomegalovirus (CMV) enhancer (SEQ ID NO: 165), the Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), and the human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167). In certain embodiments, the enhancer includes a sequence selected from SEQ ID NOs: 165-167. In various embodiments, the enhancer includes a sequence having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to one of SEQ ID NOs: 165-167. In certain embodiments, the enhancer includes at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to one of SEQ ID NOs: 165-167.

[0110] Several embodiments employ a “double enhancer” that includes any two enhancers selected from the CMV enhancer (SEQ ID NO: 165), the SV40 enhancer (SEQ ID NO: 166), and the hTERT enhancer (SEQ ID NO: 167). In some embodiments employing a double enhancer, the double enhancer includes the CMV enhancer and the SV40 enhancer. In some embodiments employing a double enhancer, the double enhancer includes the hTERT enhancer and the SV40 enhancer. In some embodiments employing a double enhancer, the double enhancer includes the CMV enhancer and the hTERT enhancer.

[0111] In a particular embodiment, the double enhancer includes the sequence of sequence number 168. In various embodiments, the double enhancer includes sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to sequence number 168. In a particular embodiment, the double enhancer includes at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to sequence number 168.

[0112] Several embodiments employ a “triple enhancer” comprising a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments, the 5' to 3' order of the enhancers in the triple enhancer is 5'-hTERT enhancer-SV40 enhancer-CMV enhancer-3'. In some embodiments, the enhancers, such as the triple enhancer, are operably ligated to the Rep gene. Further details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a REIC / Dkk-3-encoding adenoviral vector, Oncology Reports 31:1089-95 (2014) (the disclosure thereof is incorporated herein by reference in its entirety).

[0113] In a particular embodiment, the triple enhancer includes the sequence of sequence number 11. In various embodiments, the triple enhancer includes sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to sequence number 11. In a particular embodiment, the triple enhancer includes at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to sequence number 11.

[0114] In some embodiments, the enhancer is a transcription enhancer that includes a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any of sequence numbers 11-25. In some embodiments, the enhancer may include two or more of these sequences.

[0115] In addition to or instead of a transcription enhancer, some embodiments include a translation enhancer. In various embodiments, the translation enhancer is selected from SARS-CoV2 5'-UTR or variants thereof (SEQ ID NOs. 26-42). Specifically, SEQ ID NOs. 26 represents the entire SARS-CoV2 5'-UTR, while SEQ ID NOs. 27-42 represent variants of SARS-CoV2 5'-UTR. Such variants include substitution of a region of SARS-CoV2 5'-UTR with another element (SEQ ID NOs. 27), modification of the sequence of SARS-CoV2 5'-UTR (SEQ ID NOs. 28), or deletion variants of SARS-CoV2 5'-UTR (SEQ ID NOs. 29-42), where each deletion variant is a fragment of the entire SARS-CoV2 5'-UTR. In some embodiments, SARS-CoV2 5'UTR is operably concatenated to a Rep-code sequence. Further details can be found in WO2021 / 231503 (the disclosure thereof is incorporated herein by reference in its entirety). In many cases, the SARS-CoV-2 5'UTR is located upstream (i.e., on the 5' side) of the Rep-code sequence. In many cases, the SARS-CoV-2 5'UTR is located downstream (i.e., on the 3' side) of the Rep-code sequence.

[0116] Additionally or alternatively, in some embodiments, the translation enhancer is selected based on an IRES-like element of mouse homeobox a9 (Hoxa9). The Hoxa9 IRES-like element has four pair-forming elements (P1-P4). The P4 element (SEQ ID NO: 43) forms a stem-loop structure that has shown the ability to enhance translation. Certain embodiments may utilize variants of the P4 element, e.g., sequence variants selected from SEQ ID NOs: 44-54 or structural variants selected from SEQ ID NOs: 55-56. The structural variants of SEQ ID NOs: 55-56 correspond to each arm of the P4 stem-loop structure. In some embodiments, the Hoxa9 IRES-like element is operably ligated to the Rep gene. Further details can be found in WO2021 / 231502 (the disclosure thereof is incorporated herein by reference in its entirety). In many examples, the Hoxa9 IRES-like element is located upstream of the Rep coding sequence. In many cases, Hoxa9 IRES-like elements are located downstream of the Rep code array.

[0117] In various examples, the translation enhancer contains sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any of sequence numbers 11-116 and 165-168.

[0118] Further details regarding the enhancer are disclosed in one or more of the following: U.S. Patent No. 5,723,332; U.S. Patent Application Publications 2023 / 0323390, 2023 / 0321238, 2023 / 0272378, 2023 / 0265381, 2023 / 0203515, 2023 / 0193304, 2023 / 0175018, 2021 / 0060182, and 2013 / 0177581; PCT Publications WO2021 / 231503 and WO2021 / 231502; and Scientific Reports volume 8, Article number: 13753 (2018), Proc Natl Acad Sci US A. 2012 Apr 24;109(17):6626-6631, PNAS January 7, 2010 107(4) 1385-1390, Transgenic Research volume 19, pages 667-674 (2010), Journal of Bioscience and Bioengineering Volume 105, Issue 3, March 2008, Pages 300-302, Journal of Bioscience and Bioengineering, Volume 98, Issue 1, 2004, Pages 1-8, Virology Volume 321, Issue 1, 30 March 2004, Pages 36-46 (their disclosures are incorporated herein by reference in their entirety).

[0119] In certain embodiments, the polynucleotide also includes an AAV Cap coding sequence. The AAV Cap coding sequence may be functionally ligated to an inductive promoter or a constitutive promoter.

[0120] In certain embodiments, the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further includes an inductive or constitutive promoter operably ligated to the Cap coding sequence. In certain embodiments, the polynucleotide includes an inductive promoter operably ligated to the Cap coding sequence. In certain embodiments, the intervening sequence includes a transcriptional blocking element (TBE). In these embodiments, the TBE separates the p5 promoter operably ligated to the large Rep coding sequence and the inductive promoter p3 operably ligated to the AAV Cap coding sequence. In certain embodiments, the TBE includes the sequence of SEQ ID NO: 117. In various embodiments, the TBE includes a sequence having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to SEQ ID NO: 117. In a particular embodiment, the TBE includes a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to sequence number 117.

[0121] In certain embodiments, the Cap coding sequence may be operably ligated to a polyadenylation (polyA) signal sequence. The polyA signal sequence may be a functional polyA signal sequence in the cells used to produce rAAV. In some examples, the polyA signal sequence may be a bovine growth hormone polyA (bGH polyA) signal sequence or an SV40 polyA signal sequence.

[0122] The bGH polyA signal sequence may contain a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to the nucleotide sequence of SEQ ID NO: 2, or 100% sequence identity.

[0123] In certain cases, the SV40 polyA signal sequence may contain a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0124] In certain embodiments, a first promoter functionally linked to a large Rep coding sequence is located adjacent to an inductive or constitutive promoter functionally linked to an AAV Cap coding sequence, where the adjacent promoters are prevented from mutually promoting transcription by the presence of an intervening sequence between them. The intervening sequence may include a TBE, and as a result, the first promoter cannot influence the transcription of the Cap coding sequence, and the inductive or constitutive promoter functionally linked to the AAV Cap coding sequence cannot influence the transcription from the large Rep coding sequence.

[0125] In certain embodiments, both large and small Rep-coding sequences are operably linked to polyadenylation (polyA) signal sequences. In certain embodiments, both large and small Rep-coding sequences are operably linked to transcription and / or translation enhancers located downstream of the large and small Rep-coding sequences. In certain embodiments, the transcription and / or translation enhancers may be located downstream of the polyA signal sequence. The polyA signal sequence may be a functional polyA signal sequence in cells used to produce rAAV. In some examples, the polyA signal sequence may be a bovine growth hormone polyA (bGH polyA) signal sequence or an SV40 polyA signal sequence.

[0126] In certain embodiments, transcription and / or translation enhancers located downstream of large and small Rep-coding sequences may be any functional transcription and / or translation enhancers in cells used to produce rAAV. In certain examples, enhancers located downstream of large and small Rep-coding sequences and / or downstream of polyA signals (e.g., bGH polyA signal or SV40 polyA signal) may be a single enhancer or a combination of enhancers that enhance gene transcription and / or translation. In certain embodiments, the enhancer may be any enhancer or combination of enhancers that enhance gene transcription and translation.

[0127] Several embodiments utilize one or more enhancers selected from cytomegalovirus (CMV) enhancers, Simianvirus 40 (SV40) enhancers, and human telomerase reverse transcriptase (hTERT) enhancers. Several embodiments employ a “triple enhancer” comprising the CMV enhancer, SV40 enhancer, and hTERT enhancer. In some embodiments, the 5' to 3' order of the enhancers in the triple enhancer is 5'-hTERT enhancer-SV40 enhancer-CMV enhancer-3'. In some embodiments, the enhancers, such as the triple enhancer, are operably ligated to the Rep gene. Further details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a REIC / Dkk-3-encoding adenoviral vector, Oncology Reports 31:1089-95 (2014) (the disclosure is incorporated herein by reference in its entirety).

[0128] In a particular embodiment, the triple enhancer includes the sequence of sequence number 11.

[0129] In various embodiments, the triple enhancer includes approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 11, or 100% sequence identity. In a particular embodiment, the triple enhancer includes at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to SEQ ID NO: 11.

[0130] The bGH polyA signal sequence may contain a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to the nucleotide sequence of SEQ ID NO: 2, or 100% sequence identity.

[0131] In certain cases, the SV40 polyA signal sequence may contain a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0132] Figure 10 shows an exemplary polynucleotide for expressing Rep and Cap proteins. In this embodiment, the TBE separates a first promoter operably ligated to the large Rep coding sequence and an inducible promoter functionally ligated to the AAV Cap coding sequence. The triple enhancer is located downstream of the polyA signal sequence (represented as polyA).

[0133] In other embodiments, the AAV Cap coding sequence may be operably coupled to a promoter, such as a constitutive promoter. In certain embodiments, the promoter may be a native promoter. In certain embodiments, the native promoter may be p40. In certain embodiments, the p40 promoter may reside within a large Rep coding sequence that is common to a small Rep coding sequence. The AAV Cap coding sequence may be operably coupled to an inducible promoter.

[0134] In some embodiments, the capsid is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3 The capsid is selected from B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, or AAVhu68 (described in WO2020 / 033842, which is incorporated herein in its entirety by reference). The hu68 capsid is described in WO2018 / 160582 (which is incorporated herein in its entirety by reference). In some embodiments, the capsid is AAV5 capsid.

[0135] In some embodiments, the capsid is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, It is a derivative, modified, or pseudotype of AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, or a derivative, modified, or pseudotype of AAVhu68.

[0136] In some embodiments, the capsid protein is AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, A The capsid is a chimera of a capsid protein derived from two or more serotypes selected from AV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 (described in WO2020 / 033842, which is incorporated herein by reference in its entirety). In certain embodiments, the capsid is the rh32.33 capsid described in U.S. Patent No. 8,999,678 (which is incorporated herein by reference in its entirety).

[0137] In certain embodiments, the polynucleotide also includes a coding sequence for a selection marker. The coding sequence for the selection marker may be functionally ligated to a constitutive promoter. In some embodiments, the selection marker is a mammalian cell selection element. In some embodiments, the selection marker is a nutrient-requiring selection element. In some embodiments, the nutrient-requiring selection element encodes an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR).

[0138] The polynucleotides described herein may be used in vectors. A vector containing polynucleotides may be used in conjunction with one or more additional vectors to produce rAAV. Such vector systems are listed in the following sections.

[0139] Vector system for inducible production of rAAV A vector system for producing rAAV may include a vector for producing a Rep protein, provided herein and containing the polynucleotides described in the above section. This vector is referred to as the first vector, as described in this section and in the section on methods for producing recombinant AAV. Note that the use of terms such as first, second, third, etc., is intended to distinguish the components being referred to. In other examples, a vector for producing a Rep protein, provided herein and containing the polynucleotides described in the above section, may be referred to as the second vector, for example, in a method for creating cells that inducibly produce rAAV. One or more vectors, as described in this section, can be stably incorporated into cells. A vector system, as described herein, can be stably incorporated into cells to create a stable cell line, which can produce rAAV when induced.

[0140] A vector system for producing rAAV may include a first vector containing the polynucleotides described in the section above, a second vector containing sequences encoding one or more AAV helper proteins, and a third vector containing a polynucleotide payload flanked by AAV terminal inverted repeats (ITRs). The ITRs may be ssITRs or scITRs.

[0141] In certain embodiments, the second vector includes an inductive promoter operably ligated to a sequence encoding an inductive recombinase; an autoexcision element comprising a third and a fourth recombination site adjacent to the sequence encoding the inductive recombinase, wherein the third and fourth recombination sites are oriented in the same direction, and the autoexcision element separates the inductive promoter from a sequence encoding one or more AAV helper proteins, such that the inductive promoter is not operably ligated to the sequence encoding one or more AAV helper proteins; a constitutive promoter operably ligated to a sequence encoding an activator, wherein the activator cannot activate the inductive promoter in the absence of the first inducer; and a constitutive promoter operably ligated to a sequence encoding a second choice marker. Unless otherwise specified, downstream and upstream in the context of promoters and coding sequences are used to refer to the relative positions of the promoter and coding sequence when the promoter is upstream of the coding sequence.

[0142] In a particular embodiment, the first vector comprises a sequence encoding a first portion of a first selection marker and a constitutive promoter operably linked to the sequence, and the third vector comprises a sequence encoding a second portion of the first selection marker and a constitutive promoter operably linked to the sequence, wherein the first and second portions combine to form a functional first selection marker, such as blastcydin.

[0143] In a particular embodiment, the first vector includes a VA-RNA coding sequence. In a particular embodiment, the first vector includes a second excisable element containing a fifth and a sixth recombination site adjacent to the stuffer sequence, the fifth and sixth recombination sites being oriented in the same direction, separated by the second excisable element, a first portion of a constitutive promoter and a second portion of a constitutive promoter, and an insertion fragment containing a VA-RNA coding sequence, wherein excision of the second excisable element by an inducible recombinase generates a functional fifth complete constitutive promoter operably linked to the VA-RNA coding sequence, thereby enabling VA-RNA expression. In a particular embodiment, the first portion of the constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter.

[0144] In various embodiments, the VA-RNA sequence is selected from one or more of sequence numbers 169 to 172. [Table 2]

[0145] In various embodiments, the fourth construct containing the VA-RNA encoding sequence may include any of the sequences of SEQ ID NOs: 173-174, where SEQ ID NO: 173 represents the non-inducible or off state, while SEQ ID NO: 174 represents the inducible or "on" state. In various embodiments, the fourth polynucleotide or fourth construct contains sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to one or more of SEQ ID NOs: 173-174. In a particular embodiment, the fourth polynucleotide or fourth construct contains sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one or more of SEQ ID NOs: 173-174.

[0146] In certain embodiments, the second or fourth polynucleotide comprises a suspended constitutive promoter operably ligated to the VA-RNA coding sequence. The suspended constitutive promoter is inactive due to the presence of an insertion fragment. In one embodiment, the split constitutive promoter comprises a first portion of a constitutive promoter and a second portion of a constitutive promoter separated by a second excisable element. The second excisable element comprises a fifth and a sixth recombination site adjacent to a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and excision of the second excisable element by an inducible recombinase generates a complete, functional constitutive promoter operably ligated to the VA-RNA coding sequence, thereby enabling VA-RNA expression.

[0147] In certain embodiments, the first portion of the constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter. In certain embodiments, the stuffer sequence includes a constitutive promoter operably linked to a selection marker. In certain embodiments, the selection marker is a second selection marker. In various embodiments, the interrupted constitutive promoter operably includes the sequence of SEQ ID NO: 175. If the stuffer sequence is excised (e.g., after induction by an inducer and / or contact with a recombinase), the resulting constitutive promoter operably includes the sequence of SEQ ID NO: 176.

[0148] The adenovirus helper protein may be any adenovirus helper protein selected from E1A, E1B, E2A, and E4 that is not present in the host cell for the production of rAAV. In some embodiments, the host cell provides one, two, or three of the four helper proteins. For example, in a host cell expressing E1A and E1B, the second vector provides E2A and E4. In a host cell expressing E2A and E4, the second vector provides E1A and E1B. In a host cell expressing E1B, the second vector provides E1A, E2A, and E4. In a host cell expressing E2A, the second vector provides E1B, E1A, and E4. In a host cell expressing E4, the second vector provides E1B, E2A, and E1A. In a host cell expressing E1A, E2A, and E4, the second vector provides E1B. In host cells expressing E1B, E1A, and E4, the second vector provides E2A. In host cells expressing E1B, E2A, and E1A, the second vector provides E4. In some embodiments, E4 is E4 or E6.

[0149] In certain embodiments, a sequence encoding one or more AAV helper proteins includes a bicistronic open reading frame encoding at least two AAV helper proteins. In certain embodiments, the helper proteins include E2A and E4. In some embodiments, the E4 coding sequence is an E4 or f6 coding sequence.

[0150] In certain embodiments, the inductive promoter in a second vector operably ligated to a sequence encoding an inductive recombinase includes a tetracycline-responsive promoter element (TRE). In certain embodiments, the activator is Tet-on 3G.

[0151] In a particular embodiment, the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus of a cell containing a second vector in the presence of a second inducer.

[0152] In a particular embodiment, the first inducer is doxycycline, and the second inducer is tamoxifen.

[0153] In a particular embodiment, the second vector includes a VA-RNA coding sequence. In a particular embodiment, the second vector includes a second excisable element containing a fifth and a sixth recombination site adjacent to the stuffer sequence, the fifth and sixth recombination sites being oriented in the same direction, separated by the excisable element, a first portion of a constitutive promoter and a second portion of a constitutive promoter, and an insertion fragment containing a VA-RNA coding sequence, wherein excision of the second excisable element by an inducible recombinase generates a functional fifth complete constitutive promoter operably ligated to the VA-RNA coding sequence, thereby enabling VA-RNA expression. In a particular embodiment, the first portion of the constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter. In a particular embodiment, the stuffer sequence codes for a constitutive promoter operably ligated to a selection marker.

[0154] In certain embodiments, the second vector may comprise a Cre coding sequence, an adenovirus helper protein coding sequence, an activator, such as a Tet-responsive activating protein (e.g., Tet-on 3G), and a selection marker (e.g., an antibiotic resistance gene). The Cre coding sequence is flanked by a first lox site and a second lox site and functionally linked to an inducible promoter. The inducible promoter comprises a plurality of tetracycline (Tet) operator elements that can bind to the activator in the presence of a first expression inducer, such as doxycycline or tetracycline. In some embodiments, the inducible promoter is a tetracycline-responsive element (TRE) promoter comprising a plurality of tetracycline (Tet) operator elements (tetO) that can bind to the activator in the presence of a first expression inducer. In certain embodiments, tetO comprises a 19-base pair tet operator sequence of 7 repeats located upstream of the minimal CMV promoter. The activator may be Tet-on 3G. The sequence encoding the activator may be functionally linked to a constitutive promoter (e.g., the EF-1α promoter). The selection marker may be puromycin resistance (see Figure 8A). Figures 9A–12B further illustrate the arbitrary incorporation of polynucleotides encoding the inducible production of VA-RNA, a short non-coding transcript essential for adenovirus replication. This schematic diagram shows a Cre-inducible U6 promoter driving the expression of transcriptionally inactive variants of VA RNA1 (e.g., double-point variants G16A–G60A). The U6 promoter is split into two parts separated by a stuffer sequence flanked by Lox (see, e.g., Figure 12A). The U6 promoter is inactive due to the presence of the stuffer sequence. Cre-mediated excision of the stuffer activates the U6 promoter, which then drives the expression of VA RNA (Figure 12B). Other embodiments may provide alternative sources of VA-RNA.

[0155] In some embodiments, the Cre coding sequence is estrogen-inducible Cre with a strong polyadenylation signal (poly-A signal) at its 3' end, followed by a bicistronic E2A / E4 or f6 cassette. The plasmid also contains a constitutive promoter (CMV) that drives the expression of a Tet-responsive activating protein (Tet-on 3G). In the off state, when doxycycline (Dox) is absent, the promoter is inactive because Tet-on 3G cannot bind to the Tet operator element of the TRE promoter. Estrogen-responsive Cre (ER2 Cre) is used in place of simple Cre to counteract basal expression or leaks of expression from the TRE promoter. In the off state, leaks of ER2 Cre protein expression from the ER2 Cre gene are retained inactively in the cytoplasm. The strong polyadenylation signal at 3' of the cre gene prevents basal expression of the adenovirus helper genes E2A and E4. To induce expression, doxycycline and tamoxifen are added to the cell culture. Doxycycline binds to the Tet-on 3G protein, which promotes the binding of Tet-on 3G to the tet operator element of the TRE promoter (also called the doxycycline-inducible promoter). This leads to promoter activation. ER2 Cre is expressed at high levels, and tamoxifen directs ER2 Cre to the nucleus. In the nucleus, Cre results in excision at the lox site.

[0156] In certain embodiments, the sequence encoding VA-RNA is a transcriptionally inactive sequence. In certain embodiments, the sequence encoding VA-RNA contains at least two mutations in the internal promoter. In some embodiments, the sequence encoding VA-RNA contains a deletion of approximately 5 to 10 nucleotides in the promoter region. In some embodiments, the sequence encoding VA-RNA contains at least one mutation. In some embodiments, at least one mutation is located in the A-box promoter region. In some embodiments, at least one mutation is located in the B-box promoter region. In some embodiments, at least one mutation is G16A and G60A.

[0157] In certain embodiments, the vector system includes a third vector containing a polynucleotide payload flanked by AAV terminal inverted repeats (ITRs). When delivered to a cell using the rAAV containing the polynucleotide payload, the polynucleotide payload may deliver DNA to the cell, or be transcribed into RNA (e.g., siRNA, guide RNA) within the cell, and / or be transcribed within the cell and subsequently translated into a protein. The polynucleotide payload is described further in another section herein.

[0158] In certain embodiments, the first vector comprises a sequence encoding a first portion of the first selection marker and a constitutive promoter operably coupled to the sequence encoding the first portion of the first selection marker, and the third vector comprises a sequence encoding a second portion of the first selection marker and a constitutive promoter operably coupled to the sequence encoding the second portion of the first selection marker, wherein the first and second portions combine to form a functional first selection marker. In certain embodiments, the first selection marker is a split selection marker comprising N-terminal and C-terminal inteins, which are further described in another section of this specification.

[0159] In certain embodiments, the vector system may further include a fourth vector containing an AAV Cap coding sequence. An inducible promoter may be functionally ligated to the AAV Cap coding sequence. The fourth vector may further include a selection marker. The selection marker may be expressed under the control of a constitutive promoter. An exemplary fourth vector is shown in Figures 12A and 12B. The inducible promoter may be the same as the inducible promoter for controlling the expression of an inducible recombinase. In certain embodiments, the inducible promoter may be inducible by binding of a Tet-on 3G activator-doxycycline complex.

[0160] In certain embodiments, a polynucleotide system or vector system may include: a polynucleotide (e.g., a first polynucleotide or a first vector) comprising a sequence encoding a Rep protein and further encoding a sequence encoding a Cap protein, which may include any of the sequences of SEQ ID NOs. 118-121, for encoding the Rep and Cap genes as described above, wherein PGK is replaced with p5 to express a large Rep protein, CAG is present in the intron to express a small Rep protein, SEQ ID NOs. 119 represents the non-inducible or off state, while SEQ ID NOs. 120 represents the inducible or "on" state, and SEQ ID NOs. 121 is a plasmid containing the polynucleotide sequence of SEQ ID NOs. 119.

[0161] In certain embodiments, a polynucleotide system or vector system may include: a polynucleotide (e.g., a first polynucleotide or a first vector) comprising a sequence encoding a Rep protein and further encoding a sequence encoding a Cap protein, which may include any of the sequences of SEQ ID NOs. 122-125, for encoding the Rep and Cap genes as described above, wherein UBC is replaced with p5 to express a large Rep protein, CAG is present in the intron to express a small Rep protein, SEQ ID NOs. 123 represents a non-inducible or off state, while SEQ ID NOs. 124 represents an induced or "on" state, and SEQ ID NOs. 125 is a plasmid containing the polynucleotide sequence of SEQ ID NOs. 123.

[0162] In certain embodiments, a polynucleotide system or vector system may include: a polynucleotide (e.g., a first polynucleotide or a first vector) comprising a sequence encoding a Rep protein and further encoding a sequence encoding a Cap protein, which may include either of the sequences of Sequence ID No. 126, so as to encode the Rep and Cap genes as described above, where p5 is for expressing a large Rep protein and p19 is for expressing a small Rep protein.

[0163] In various embodiments, the first polynucleotide or first vector contains sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to one or more of SEQ ID NOs. In a particular embodiment, the first polynucleotide or first vector contains sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to one or more of SEQ ID NOs.

[0164] A polynucleotide (e.g., a second polynucleotide or second vector) containing a sequence encoding an inducible helper protein may contain any of the sequences of SEQ ID NOs. 127-129, where SEQ ID NOs. 127 represents the non-inducible or off state, while SEQ ID NOs. 128 represents the inducible or "on" state, and SEQ ID NOs. 129 represents a plasmid containing the polynucleotide sequence of SEQ ID NOs. 127. In various embodiments, the second polynucleotide or second vector contains a sequence having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to one or more of SEQ ID NOs. 127-129. In a particular embodiment, the second polynucleotide or second vector contains a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to one or more of SEQ ID NOs. 127-129.

[0165] A polynucleotide (e.g., a third polynucleotide or third vector) containing a payload encoding sequence may contain any of the sequences of SEQ ID NOs. 130-133, where SEQ ID NOs. 130 contains the payload in a self-complementary format, SEQ ID NOs. 131 is a plasmid sequence containing the sequence of SEQ ID NOs. 130, SEQ ID NOs. 132 contains the payload in a single-stranded format, and SEQ ID NOs. 133 is a plasmid sequence containing the sequence of SEQ ID NOs. 132. In various embodiments, the third polynucleotide or third vector contains a sequence having approximately 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to one or more of SEQ ID NOs. 130-133. In certain embodiments, the third polynucleotide or third vector comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity to one or more of SEQ ID NOs. In some embodiments, the third polynucleotide or third vector comprises a sequence having about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% sequence identity to one or more of SEQ ID NOs.

[0166] Vectors according to this section may include features or components to assist in the incorporation of constructs. Various such components are known in the art and include enzyme-based methods, e.g., the use of nucleases, integrases, transposases, and / or any other relevant enzymes; machine-based systems, e.g., gene guns; and vector-based systems, e.g., virus-based and / or bacterial-based systems (e.g., the use of Agrobacterium species). In some examples, incorporation may utilize innate mechanisms, e.g., DNA repair pathways (e.g., non-homologous end joining, double-strand break repair, etc.). In some examples, homology-based incorporation may be utilized (e.g., terminal repeat sequences, terminal inversion repeat sequences, etc.). In some examples, features specific to exogenously added transposases include (but are not limited to) PiggyBac sites and combinations with PiggyBac, Tol2, Sleeping Beauty, Mariner, Minos, Hermes, Frog Prince, any other applicable transposon systems, and combinations thereof.

[0167] Vector system for transient production of rAAV A vector system for producing rAAV by triple translocation of cells is disclosed. In a particular embodiment, the vector system for triple translocation includes a first vector, as described in the above section, for expressing Rep proteins and Cap proteins. For example, large Rep transcripts and small Rep transcripts are expressed under the control of the first and second promoters, respectively, such that the ratio of small Rep transcript expression to large Rep transcript expression is increased compared to a first vector without the first and / or second promoters. For example, large Rep proteins and small Rep proteins are expressed under the control of the first and second promoters, respectively, such that the ratio of small Rep protein expression to large Rep protein expression is increased compared to a first vector without the first and / or second promoters. The vector system may further include a second vector encoding an adenovirus helper protein and optionally VA RNA. The vector system may further include a third vector containing a polynucleotide payload flanked by ITRs.

[0168] cell One or more of the polynucleotides, vectors, and / or other constructs described herein may be present in cells, cell lines, and / or other cell collections. In certain embodiments, the Disclosure provides cells containing the polynucleotides and / or the first vector described in the above section. In certain embodiments, the Disclosure provides cells containing the polynucleotides and / or the second vector described in the above section. In certain embodiments, the Disclosure provides cells containing the polynucleotides and / or the third vector described in the above section. In certain embodiments, cells containing the first vector may also contain the second vector. In certain embodiments, cells containing the first vector may also contain the third vector. In certain embodiments, cells containing the second vector may also contain the third vector. In certain embodiments, cells containing the first and second vectors may also contain the third vector.

[0169] The transiently translocated constructs may include readily available vectors, constructs, and / or polynucleotides, including other vectors, constructs, and / or polynucleotides described herein, as well as commercially available constructs and custom constructs for expressing the encoded components. For example, the AAV helper construct may be stably incorporated into cells, while the Rep / Cap construct and payload construct are transiently translocated into cells. Alternatively, the AAV helper construct and Rep / Cap construct may be stably incorporated into cells, while the payload construct is transiently translocated. Similarly, the AAV helper construct and payload construct may be stably incorporated into cells, while the Rep / Cap construct is transiently translocated. As is evident, stable cell lines in all other combinations can be prepared according to the embodiments (e.g., using one, two, or three of the AAV helper construct, rep / Cap construct, and payload construct).

[0170] Cells may transiently contain polynucleotides, or one or more of these polynucleotides may be incorporated into the nuclear genome of cells, cell lines, and / or other cell collections.

[0171] Cells may transiently contain vectors, or one or more of these vectors may be incorporated into the nuclear genome of cells, cell lines, and / or other cell collections.

[0172] Cells may transiently contain the first vector, the second vector, the third vector, or any combination of these vectors, or one or more of these vectors may be incorporated into the nuclear genome of cells, cell lines, and / or other cell collections.

[0173] Alternative constructs, such as those described herein, may be used in the complete system. In some embodiments, the complete system may be incorporated into a host cell genome to create a stable cell line. In other embodiments, the complete system may be transfused into a host cell, which may then induce conditional production of AAV virions from the plasmid. In some embodiments, the complete system includes the episome of the host cell, and conditional production of AAV virions from the episome is induced.

[0174] In certain embodiments, the cells may be mammalian cells, including, but not limited to, mouse cells and primate cells (e.g., human cells). Preferred mammalian cells include, but not limited to, primary cells and cell lines, where preferred cell lines include, but not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, and CHO cells. Non-limiting examples of suitable host cells include, for example, HeLa cells (e.g., American Type Culture Collection (ATCC) number: CCL-2), CHO cells (e.g., ATCC numbers: CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC number: CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC number: CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC number: CCL10), PC12 cells (ATCC number: CRL1721), COS cells, COS-7 cells (ATCC number: CRL1651), RAT1 cells, mouse L cells (ATCC number: CCLI.3), human embryonic kidney (HEK) cells (ATCC number: CRL1573), and HLHepG2 cells.

[0175] In certain embodiments, the cells are mammalian cells, which optionally are HEK293 cells, and which optionally express AAV helper proteins E1A and E1B. HEK293 cells were established by transfusion of human embryonic cells with fragmented adenovirus type 5 DNA. The stable expression of adenovirus E1A and E1B proteins in HEK293 cells is widely recognized (see, for example, Olsen PA & S Krauss, The Adenoviral E1B-55k Protein Present in HEK293 Cells Mediates Abnormal Accumulation of Key WNT Signaling proteins in Large Cytoplasmic Aggregates, Genes (Basel), 2021 Nov 29;12(12):1920 (the disclosure is incorporated in its entirety by reference)).

[0176] Such cells are also called host cells. The target host cells may be isolated cells, such as in vitro cultured cells. These target host cells may be useful for inducing AAV virions.

[0177] Vector systems can be introduced into host cells simultaneously or sequentially in any order using established translocation techniques, including, but not limited to, electroporation, calcium phosphate precipitation, and liposome-mediated translocation. In certain embodiments, host cells containing a first polynucleotide or first vector may be selected before translocation of additional polynucleotides or vectors (e.g., a second and / or third vector). Selection may be performed using cell media for selecting the expression of enzymes that make cells resistant to antibiotics or that allow them to grow in the absence of certain amino acids, or by FACS of cells expressing cell surface proteins.

[0178] In some embodiments, the cells are propagated to produce a cell population. In some embodiments, the cell population gives rise to a stable cell line in which a polynucleotide as described herein is integrated into the genome of the cell. In some embodiments, the cell population gives rise to a stable cell line in which a first vector as described herein is integrated into the genome of the cell. In some embodiments, the cell population gives rise to a stable cell line in which a first vector, a second vector, a third vector, or any combination thereof as described herein is integrated into the genome of the cell. In some embodiments, the cells are passaged at least 3 times. In some embodiments, the cells can be passaged up to 60 times. In some embodiments, the cells can be passaged more than 60 times. In some embodiments, propagating the cell population comprises passaging the cell population at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 times. In some embodiments, the cells retain the ability to be conditionally induced after each passage.

[0179] In some embodiments, the cell population is capable of conditionally producing rAAV virions having a payload encapsidation ratio of 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or greater. In some embodiments, the rAAV virions have a payload encapsidation ratio of 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or greater prior to purification. In some embodiments, the cell population produces 1×10 6 , 2×10 6 , 5×10 6 , or 1×10 7 viable cells / mL or greater, and can reach said viable cell density. In some embodiments, the rAAV has a titer of 1×10 11 viral genomes / mL or greater, or 5×10 11 viral genomes / mL or greater, 1×10 12 viral genomes / mL or greater, 5×10 12 viral genomes / mL or greater, 1×10 13More than 1 / milliliter of viral genome, or 1 x 10⁶ 14 The concentration is greater than or equal to viral genome / milliliter. In some embodiments, the cell population is 1 × 10⁻⁶ 8 More than 5 × 10⁻¹⁶ viral genomes / milliliter, or 5 × 10⁻¹⁶ 8 More than 1 × 10⁻¹⁶ viral genomes / milliliter 9 More than 5 × 10⁻¹ viral genomes / milliliters 10 More than 1 × 10⁻¹⁶ viral genomes / milliliter 10 , 5×10 11 More than 1 × 10⁻¹⁶ viral genomes / milliliter 12 More than 5 × 10⁻¹ viral genomes / milliliters 12 More than 1 × 10⁻¹⁶ viral genomes / milliliter 13 More than 1 / milliliter of viral genome, or 1 x 10⁶ 14 rAAV containing the payload nucleic acid sequence can be produced with titers of more than 1 / milliliter of viral genome. In some embodiments, the cell population is 1 × 10⁶ before purification. 11 More than 5 × 10⁻¹⁶ viral genomes / milliliter, or 5 × 10⁻¹⁶ 11 More than 1 × 10⁻¹⁶ viral genomes / milliliter 12 More than 5 × 10⁻¹ viral genomes / milliliters 12 More than 1 × 10⁻¹⁶ viral genomes / milliliter 13 More than 1 / milliliter of viral genome, or 1 x 10⁶ 14 rAAV virions containing the payload nucleic acid sequence can be produced at concentrations of viral genome / milliliter or higher. In some embodiments, the rAAV virion containing the capsid protein and payload nucleic acid sequence is 1 × 10⁻¹⁶ 5In some embodiments, rAAV virions have an infectivity of 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more at an MOI of less than or equal to vg / target cell. In some embodiments, rAAV virions have enhanced infectivity compared to rAAV virions of the same MOI produced by a different comparable cell population capable of producing rAAV virions upon transient translocation. In some embodiments, rAAV virions have at least 1%, 5%, 10%, 15%, 20%, 30%, 40%, or 50% higher infectivity compared to rAAV virions of the same MOI produced by a different comparable cell population capable of producing rAAV virions upon transient translocation. In some embodiments, rAAV virions have at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% higher infectivity compared to AAV virions of the same MOI. In some embodiments, the AAV virion is a wild-type AAV virion produced by a cell containing wild-type AAV. In some embodiments, the MOI is 1 × 10⁻⁶ 1 , 1 x 10 2 , 2×10 3 , 5×10 4 , or 1 × 10 5 vg / target cells. In some embodiments, the MOI is 1 × 10⁻⁶ 1 ~1 × 10 5The range is selected from vg / target cells. In some embodiments, cells can conditionally produce rAAV virions having an F:E ratio of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or higher. In some embodiments, the rAAV virions have an F:E ratio of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or higher before purification. In some embodiments, cells can conditionally produce rAAV virions, where at least 1% of the rAAV virions contain a polynucleotide payload. In some embodiments, at least 2%, at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or more of the rAAV virions contain a polynucleotide payload. In some embodiments, a cell population incorporating polynucleotides for rAAV production provides a consistent rAAV titer between different production batches. For example, a cell population incorporating polynucleotides for rAAV production provides an rAAV titer that does not vary by more than 5%, 10%, or 20% between different production batches. In some embodiments, the cells are cryopreserved. In some embodiments, the cells are contained in vials, flasks, syringes, or other suitable cell storage containers.

[0180] Rep / Cap stable cell line Rep / Cap stable cell lines as described herein may include a cell population comprising cells containing a polynucleotide construct encoding AAV Rep and Cap proteins, the polynucleotide construct comprising spacers or excisable elements and integrated into the cell genome. This polynucleotide is used for the production of rAAV virions and / or is also referred to as the "AAV Rep / Cap construct." The Rep / Cap construct integrated into cells to create a Rep / Cap stable cell line may be any Rep / Cap construct, or an AAV Rep / Cap construct as illustrated in Figures 1A-2B, Figure 5, and Figures 8A-16B.

[0181] In various embodiments incorporating AAV Rep / Cap constructs as described herein, a polynucleotide encoding a helper gene (e.g., a helper construct or adenovirus helper construct) and a polynucleotide encoding a payload (e.g., a payload construct) can be transiently transfected. The polynucleotide encoding the helper and the polynucleotide encoding the payload may be constructs such as those described herein, or readily available (e.g., commercially available) constructs. When transfecting using a polynucleotide encoding a helper gene and a polynucleotide encoding a payload, as illustrated in Figures 8A-9B and 11A-16B and described herein, the first and second inducers include doxycycline and tamoxifen, respectively. In such examples, doxycycline induces the expression of cre recombinase. In certain embodiments (for example, in the case of a Tet-On inducible promoter operably linked to the AAV Cap protein, including the constructs in Figures 10–12B, 14A–14B, and 16A–16B), doxycycline further induces the expression of the AAV Cap protein. Tamoxifen enables the expression of the AAV Rep protein and possibly the AAV Cap protein by allowing an estrogen-responsive element fused to the cre recombinase to move the cre recombinase to the nucleus.

[0182] Easily available AAV helper constructs may not contain cre recombinase within the construct. In such situations, cre can be used as an inducer to induce the expression of AAV Rep protein and possibly AAV Cap protein. In the exemplary embodiments of Figures 10-12B, 14A-14B, and 16A-16B, the expression of some or all of the AAV Cap protein is driven by an inducible promoter, and therefore a suitable inducer (e.g., doxycycline) may be added to induce the expression of the AAV Cap protein.

[0183] In some embodiments, if the cell contains polynucleotides encoding AAV Rep and AAV Cap proteins integrated into the cell's nuclear genome (e.g., Figures 1A-2B, 5, 8A-16B), transiently transfected polynucleotides encoding helper genes, and transiently transfected polynucleotides encoding payloads, then in the absence of activation of a second inducible promoter by a first inducer, the cell does not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of the second inducer, the inducible recombinase cannot translocate to the nucleus. In some embodiments, in the absence of the first inducer, the cell does not express detectable levels of one or more AAV capsid proteins, and in the absence of the second inducer, the cell expresses a fusion protein containing a partial Rep protein encoded by a first portion of an AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some cases, the fusion protein contains a tag encoded within the excisable element (e.g., BFP, His, etc., as mentioned above).

[0184] AAV Helper Stable Cell Line AAV helper stable cell lines as described herein may include a cell population comprising cells containing a polynucleotide encoding a helper gene (e.g., a helper construct and / or AAV helper construct), the polynucleotide encoding one or more adenovirus helper proteins and integrated into the cell genome. In some embodiments, the polynucleotide encoding the AAV helper protein, integrated into the cells to create an AAV helper stable cell line, may be any adenovirus helper construct as described herein and / or WO2022026927 (which is incorporated herein by reference in its entirety). In some embodiments, the polynucleotide encoding the helper gene is integrated into the cell's nuclear genome.

[0185] In some embodiments, in the presence of a first inducer, the activator activates a second inductive promoter that results in the expression of inductive recombinase, and inductive recombinase is expressed. In some embodiments, in the presence of the second inducer, the inductive recombinase translocates to the cell nucleus and induces recombination between a third and a fourth recombination site, thereby resulting in the excision of an autoexcision element, which in turn operably ligates the second inductive promoter to a sequence encoding one or more adenovirus helper proteins, enabling the expression of one or more adenovirus helper proteins.

[0186] In some embodiments, in the absence of activation of the inducible promoter by a first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, and in the absence of a second inducer, the inducible recombinase cannot translocate to the nucleus.

[0187] In some embodiments, if the cell contains polynucleotides encoding helper genes integrated into the cell's nuclear genome, the cell also contains transiently transfected polynucleotides encoding AAV Rep and AAV Cap proteins, as well as transiently transfected polynucleotides encoding the payload. In some embodiments, if the cell contains polynucleotides encoding helper genes integrated into the cell's nuclear genome, transiently transfected polynucleotides encoding AAV Rep and AAV Cap proteins, and transiently transfected polynucleotides encoding the payload, the polynucleotides encoding AAV Rep and AAV Cap proteins and the polynucleotides encoding the payload are not integrated into the cell's nuclear genome.

[0188] In some embodiments, if the cell contains polynucleotides encoding helper genes integrated into the cell's nuclear genome, transiently transfected polynucleotides encoding the AAV Rep and AAV Cap proteins (Figures 1A-2B, 5, 8A-16B), and transiently transfected polynucleotides encoding the payload, then in the absence of the first and second inducers, the cell expresses a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag (e.g., BFP, His, etc., as described above) encoded within the cleavable element. In some embodiments, in the absence of activation of the inducible promoter by a first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of a second inducer, the inducible recombinase cannot translocate to the nucleus, and optionally, in the absence of both the first and second inducers, the cells express a fusion protein containing a partial Rep protein encoded by a first portion of an AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag encoded within the cleavable element (e.g., BFP, His, etc., as described above).

[0189] In some embodiments, if the cell contains a polynucleotide encoding one or more helper proteins integrated into the cell's nuclear genome, a transiently translocated polynucleotide encoding the AAV Rep and AAV Cap proteins (Figures 1A-2B, 5, 8A-16B), and a transiently translocated polynucleotide encoding the payload, then in the absence of activation of a second inducible promoter by a first inducer, the cell does not express detectable levels of inducible recombinase and one or more adenovirus helper proteins, where, in the absence of the second inducer, the inducible recombinase cannot translocate to the nucleus. In some embodiments, in the absence of the first inducer, the cell does not express detectable levels of one or more AAV capsid proteins, and in the absence of the second inducer, the cell expresses a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some cases, the fusion protein contains a tag encoded within the excisable element (e.g., BFP, His, etc., as mentioned above).

[0190] Payload stable cell lines A payload-stable cell line as described herein may include a cell population comprising cells containing a polynucleotide encoding an expressible payload, the polynucleotide being incorporated into the cell's genome. This polynucleotide encoding the payload may also be referred to as a payload construct used for the production of rAAV virions. The payload construct incorporated into cells to create a payload-stable cell line may be any polynucleotide or payload construct encoding a payload, as described in WO2022026927 (which is incorporated herein by reference in its entirety). In some embodiments, the payload construct encodes progranulin. In some embodiments, the payload construct encodes dystrophin. In some embodiments, the expressible payload is progranulin. In some embodiments, the expressible payload is dystrophin. In some embodiments, dystrophin is a shortened functional form of dystrophin. In some embodiments, the third polynucleotide construct comprises a promoter operably ligated to a sequence encoding a payload and a third choice marker, wherein the sequence encoding the payload is flanked by a 5'AAV terminal inverted repeat (5'ITR) and a 3'AAV terminal inverted repeat (3'ITR). In some embodiments, the payload is progranulin or dystrophin, wherein optionally, dystrophin is a functionally truncated dystrophin. In some embodiments, the third polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs. 130-133, wherein optionally, the sequence encoding progranulin is replaced by the sequence encoding dystrophin, and further optionally, the sequence encoding dystrophin encodes a functionally truncated dystrophin.In some embodiments, the second plasmid contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to sequence numbers 130–133, wherein optionally the sequence encoding progranulin is replaced with the sequence encoding dystrophin, and further optionally the sequence encoding dystrophin encodes a functionally truncated dystrophin. In some embodiments, the payload encoding sequence sandwiched between the 5'AAV terminal inverted repeat (5'ITR) and the 3'AAV terminal inverted repeat (3'ITR) comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs. 130–133, where optionally the sequence encoding progranulin is replaced by the sequence encoding dystrophin, and further optionally the sequence encoding dystrophin encodes a functionally truncated dystrophin. In some embodiments, the payload encoding polynucleotide further comprises a spacer between the 5'ITR and the sequence encoding a third choice marker, or a spacer between the sequence encoding the third choice marker and the 3'ITR, or a combination thereof. In some embodiments, the spacer is in the range of 500 to 5000 base pairs in length.

[0191] In some embodiments, if the cell contains a polynucleotide encoding a payload integrated into the cell's nuclear genome, a transiently translocated polynucleotide encoding the AAV Rep and AAV Cap proteins (Figures 1A-2B, 5, 8A-16B), and a transiently translocated polynucleotide encoding one or more helper proteins, then in the absence of activation of a second inducible promoter by a first inducer, the cell does not express detectable levels of inducible recombinase and one or more adenovirus helper proteins, where, in the absence of the second inducer, the inducible recombinase cannot translocate to the nucleus. In some embodiments, in the absence of the first inducer, the cell does not express detectable levels of one or more AAV capsid proteins, and in the absence of the second inducer, the cell expresses a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some cases, the fusion protein contains a tag encoded within the excisable element (e.g., BFP, His, etc., as mentioned above).

[0192] dual stable cell line A stable cell line may include a cell population comprising cells containing polynucleotides encoding AAV Rep and / or Cap proteins as described herein, incorporated into the cell genome, and polynucleotides encoding one or more helper proteins as described herein, incorporated into the cell genome. A stable cell line may include a cell population comprising cells containing polynucleotides encoding payloads as described herein, incorporated into the cell genome, and polynucleotides encoding one or more helper proteins as described herein, incorporated into the cell genome. A stable cell line may include a cell population comprising cells containing polynucleotides encoding AAV Rep and / or Cap proteins as described herein, incorporated into the cell genome, and polynucleotides encoding payloads as described herein, incorporated into the cell genome.

[0193] In certain embodiments, two of the three polynucleotides described herein are incorporated into the cell's nuclear genome, for example, i) a polynucleotide encoding the AAV Rep / Cap protein and a second polynucleotide encoding the AAV helper protein, ii) a polynucleotide encoding the AAV Rep / Cap protein and a polynucleotide encoding the payload, or iii) a polynucleotide encoding the AAV helper protein and a polynucleotide encoding the payload. In some embodiments, one or more other polynucleotides may be transiently transfused into the cell. In some embodiments, one or more other polynucleotides are not incorporated into the cell's nuclear genome.

[0194] Integrated AAV Rep / Cap and helper In some embodiments, a polynucleotide encoding the AAV Rep and / or Cap protein, and a polynucleotide encoding the AAV helper gene, is stably incorporated into the cell's nuclear genome, and a payload construct (e.g., a polynucleotide encoding the payload) is transfused. In these embodiments, the polynucleotide encoding the AAV Rep and / or Cap protein, and the polynucleotide encoding the helper gene, correspond to one or more of those shown in Figures 8A-9B, Figures 11A-16B, and the description herein. In some embodiments, the polynucleotide encoding the payload is transiently transfused into the cell. In some embodiments, the polynucleotide encoding the payload is not incorporated into the cell's nuclear genome.

[0195] In some embodiments, the polynucleotide encoding the AAV Rep and / or Cap protein contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any of SEQ ID NOs. 118-126, and the polynucleotide encoding one or more helper genes contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any of SEQ ID NOs. 118-126.

[0196] In some embodiments, the polynucleotide encoding the AAV Rep and / or Cap protein contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs. 118-126, and the polynucleotide encoding one or more helper genes contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any of SEQ ID NOs. 118-126.

[0197] In some embodiments, the polynucleotide encoding the payload may correspond to a payload construct described herein or may be a readily available payload construct. In some embodiments, the polynucleotide encoding the payload contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs. 130–133. In some embodiments, the sequence encoding progranulin is replaced with the sequence encoding dystrophin. In some embodiments, the sequence encoding dystrophin encodes a functionally truncated dystrophin.

[0198] In such embodiments, the first and second inducers include doxycycline and tamoxifen, respectively. In such examples, doxycycline induces the expression of cre recombinase (e.g., as shown in Figures 8A-9B and 11A-16B). In some embodiments, doxycycline further induces the expression of AAV Cap protein (e.g., as shown in Figures 10-12B, 14A-14B, and 16A-16B). Tamoxifen enables the expression of AAV Rep protein and possibly AAV Cap protein by allowing an estrogen-responsive element fused to cre recombinase to translocate cre recombinase to the nucleus.

[0199] In some embodiments (for example, where the polynucleotides encoding the AAV Rep and Cap proteins are similar to those in the exemplary embodiments of Figures 1A-2B, Figure 5, and Figures 8A-16B), in the absence of activation of the inducible promoter by a first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of a second inducer, the inducible recombinase cannot translocate to the nucleus, and optionally, in the absence of both the first and second inducers, the cells express a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag encoded within the cleavable element (e.g., BFP, His, etc., as described above).

[0200] Integrated AAV Rep / Cap and payload In some embodiments, a polynucleotide encoding the AAV Rep and / or Cap protein, and a polynucleotide encoding the payload, are stably incorporated, and a polynucleotide encoding a helper protein is transfected. In some embodiments, the polynucleotide encoding the AAV Rep and / or Cap protein, and the polynucleotide encoding the payload, correspond to the examples shown in Figures 8A-9B, Figures 11A-16B, and the description herein. In some embodiments, the polynucleotide encoding the AAV Rep and / or Cap protein contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any of SEQ ID NOs. 118-126, and the polynucleotide encoding the payload may correspond to a plasmid described herein. The AAV helper structure may be an readily available (e.g., commercially available) structure, or it may correspond to an inductive AAV helper structure as illustrated in Figures 8A-9B and 11A-16B and described herein.

[0201] In embodiments in which translocation is performed using a polynucleotide encoding a payload corresponding to the polynucleotides described herein, the AAV helper construct contains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any of SEQ ID NOs. 130–133. In such embodiments, the first and second inducers comprise doxycycline and tamoxifen, respectively. In such examples, doxycycline induces the expression of cre recombinase (e.g., as shown in Figures 8A–9B and 11A–16B). In the exemplary embodiments shown in Figures 10–12B, 14A–14B, and 16A–16B, doxycycline further induces the expression of the AAV Cap protein. (For example, in the exemplary embodiments of Figures 14A-14B and 16A-16B) Tamoxifen enables the expression of AAV Rep protein and possibly AAV Cap protein by allowing the estrogen-responsive element fused to cre recombinase to move cre recombinase to the nucleus.

[0202] A readily available polynucleotide encoding a helper protein may not contain a cre recombinase in the construct. In such circumstances, exogenously provided cre (for example, in the exemplary embodiments of Figures 1A-2B, 5, and 8A-16B) can be used as an inducer to induce the expression of the AAV Rep protein and possibly the AAV Cap protein. In the exemplary embodiments of Figures 10-12B, 14A-14B, and 16A-16B, the expression of the AAV Cap protein is driven by an inducible promoter, and therefore a suitable inducer (e.g., doxycycline) may be added to induce the expression of the AAV Cap protein.

[0203] In some embodiments (for example, where the polynucleotides encoding the AAV Rep and Cap proteins are similar to those in the exemplary embodiments of Figures 1A-2B, Figure 5, and Figures 8A-16B), in the absence of activation of the inducible promoter by a first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of a second inducer, the inducible recombinase cannot translocate to the nucleus, and optionally, in the absence of both the first and second inducers, the cells express a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag encoded within the cleavable element (e.g., BFP, His, etc., as described above).

[0204] Integrated helper and payload A third combination of constructs stably incorporated according to several embodiments comprises a cell containing a polynucleotide encoding an AAV helper protein and a polynucleotide encoding a payload, both incorporated into the cell's nuclear genome. In some embodiments, the polynucleotide encoding the AAV helper protein and the polynucleotide encoding the payload correspond to Figures 8A–16B and the description herein. In some such embodiments, the polynucleotide encoding the AAV helper protein and the polynucleotide encoding the payload correspond to plasmids and nucleic acid constructs described herein. The transfected AAV Rep / Cap construct may be a readily available or commercially available construct, or it may correspond to an AAV Rep / Cap construct as described herein, including Figures 1A–2B, Figure 5, and Figures 8A–16B. In such embodiments, the first and second inducers comprise doxycycline and tamoxifen, respectively. In such examples, doxycycline induces the expression of cre recombinase (e.g., as shown in Figures 8A–16B). In the exemplary embodiments shown in Figures 10-12B, 14A-14B, and 16A-16B, doxycycline further induces the expression of the AAV Cap protein. (For example, in the exemplary embodiments of Figures 14A-14B and 16A-16B) Tamoxifen enables the expression of the AAV Rep protein and possibly the AAV Cap protein by allowing the estrogen-responsive element fused to the cre recombinase to move the cre recombinase to the nucleus.

[0205] In some embodiments, if polynucleotides encoding AAV Rep and / or Cap proteins that are not incorporated and / or transiently transfected correspond to the exemplary embodiments of Figures 1A-2B, Figure 5, and Figures 8A-16B, then in the absence of activation of the inducible promoter by the first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of the second inducer, the inducible recombinase cannot translocate to the nucleus, and optionally, in the absence of both the first and second inducers, the cells express a fusion protein containing a partial Rep protein encoded by a first portion of the AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag encoded within the cleavable element (e.g., BFP, His, etc., as described above).

[0206] In some embodiments, if polynucleotides encoding AAV Rep and / or Cap proteins that are not incorporated and / or transiently transfected correspond to the exemplary embodiments of Figures 1A-2B, Figure 5, and Figures 8A-16B, then in the absence of activation of the second inducible promoter by the first inducer, the cells do not express detectable levels of inducible recombinase and one or more AAV helper proteins, where, in the absence of the second inducer, the inducible recombinase cannot translocate to the nucleus, optionally, in the absence of the first inducer, the cells do not express detectable levels of one or more AAV capsid proteins, and in the absence of the second inducer, the cells express a fusion protein containing a partial Rep protein encoded by a first portion of an AAV Rep coding sequence that terminates with a stop signal sequence contained within a cleavable element. In some examples, the fusion protein contains a tag encoded within the cleavable element (e.g., BFP, His, etc., as described above).

[0207] Method for producing recombinant AAV In a specific embodiment, a method for producing recombinant AAV is provided. The method may comprise performing triple transfection of cells using the vector system described herein.

[0208] In a specific embodiment, a method for inducibly producing recombinant AAV (rAAV) is provided. The method may comprise contacting a cell comprising a vector described herein with a first inducing agent and a second inducing agent, thereby inducing production of rAAV.

[0209] In a specific embodiment, the cell comprises a vector comprising the native p19 promoter in place of a second promoter, and expresses higher levels of small Rep compared to a cell comprising the second and third vectors.

[0210] In a specific embodiment, the cell comprises a vector comprising the native p5 promoter in place of a first promoter, and expresses lower levels of large Rep compared to a cell comprising the second and third vectors.

[0211] In a specific embodiment, the cell comprises a vector comprising the native p5 promoter in place of a first promoter and the p19 promoter in place of a second promoter, and produces a higher small Rep:large Rep ratio compared to a cell comprising the second and third vectors.

[0212] In a specific embodiment, the cell expresses lower levels of large Rep compared to small Rep. In some embodiments, the cell expresses small Rep:large Rep at a ratio ranging from 1.5:1 to 10,000:1. In some embodiments, the cell expresses small Rep:large Rep at a ratio of 1.5:1, 1.8:1, 2:1, 2.3:1, 2.5:1, 2.8:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1, 50:1, 100:1, 300:1, 500:1, 1000:1, 3000:1, 5000:1, or 10,000:1.

[0213] In certain specific aspects, the cell comprises a vector comprising a native p19 promoter in place of the second promoter, and expresses higher levels of rAAV compared to a cell comprising the second and third vectors.

[0214] In certain specific aspects, the cell comprises a vector comprising a native p5 promoter in place of the first promoter, and expresses higher levels of rAAV compared to a cell comprising the second and third vectors. In certain specific aspects, the cell comprises a vector comprising a native p5 promoter in place of the first promoter and a p19 promoter in place of the second promoter, and produces higher levels of rAAV compared to a cell comprising the second and third vectors.

[0215] In some embodiments, the cell population has 1 × 10 11 viral genomes per milliliter or more, or more than 5 × 10 11 viral genomes per milliliter or more, 1 × 10 12 viral genomes per milliliter or more, 5 × 10 12 viral genomes per milliliter or more, 1 × 10 13 viral genomes per milliliter or more, or 1 × 10 14 viral genomes per milliliter or more at a concentration, and is capable of producing rAAV virions comprising a payload nucleic acid sequence. In some embodiments, the cell population, before purification, has 1 × 10 11 viral genomes per milliliter or more, or more than 5 × 10 11 viral genomes per milliliter or more, 1 × 10 12 viral genomes per milliliter or more, 5 × 10 12 viral genomes per milliliter or more, 1 × 10 13 viral genomes per milliliter or more, or 1 × 10 14rAAV virions containing the payload nucleic acid sequence can be produced at concentrations of viral genome / milliliter or higher. In some embodiments, the cell population can conditionally produce rAAV virions having capsid formation ratios of 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or higher. In some embodiments, the rAAV virions have capsid formation ratios of 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 or higher before purification. In some embodiments, the cell population is a pool of cells produced after transient translocation of the vector system described herein. In some embodiments, the cell population is a pool of cells produced after transient translocation and subsequent selection of genomic integration of the vector system. In some embodiments, the cell population is a monoclonal cell population.

[0216] Method for creating cells that inducibly produce rAAV Methods for constructing cells to inducibly produce recombinant AAV (rAAV) containing a polynucleotide payload using the vectors described in the preceding section are also provided herein.

[0217] In certain aspects, this method, (i) an inductive promoter operably ligated to a sequence encoding an inductive recombinase; an autoexcision element comprising a first recombination site and a second recombination site adjacent to the sequence encoding the inductive recombinase, wherein the first and second recombination sites are oriented in the same direction, and the autoexcision element separates the inductive promoter from a sequence encoding one or more AAV helper proteins, such that the inductive promoter is not operably ligated to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably ligated to a sequence encoding an activator, such that the cell constitutively expresses the activator, and the activator cannot activate the inductive promoter in the absence of the first inducer; and a second constitutive promoter operably ligated to a sequence encoding a first selection marker, such that the cell constitutively expresses the first selection marker; the introduction of a first vector comprising the second constitutive promoter into a cell, (ii) Selecting cells that express the first selection marker, (iii) Introducing a second vector and a third vector into cells expressing the first selection marker, wherein the second vector is a first promoter operably ligated to a large Rep-coding sequence, the large Rep-coding sequence comprises (i) an intron containing the second promoter, and (ii) a small Rep-coding sequence, the second promoter is operably ligated to the small Rep-coding sequence, the second promoter is heterogeneous to the small Rep-coding sequence, the second promoter has higher promoter activity than the first promoter, and the small Rep-coding sequence contains a third recombination site and a fourth recombination site adjacent to a sequence containing a stop codon. The introduction includes a first promoter comprising a sequence encoding an AAV capsid protein, and a third constitutive promoter operably ligated to a sequence encoding a first portion of a second choice marker, wherein the third vector comprises a fourth constitutive promoter operably ligated to a sequence encoding a payload and a sequence encoding a second portion of the second choice marker, the sequence encoding the payload being flanked by AAV terminal inverted repeats (ITRs), and the introduction includes a sequence encoding a payload, wherein the sequence encoding the payload is flanked by AAV terminal inverted repeats (ITRs), and the introduction includes a sequence encoding a payload, wherein the third and fourth recombination sites are oriented in the same direction, and recombination between the third and fourth recombination sites by an inducible recombinase results in the excision of a sequence containing a stop codon. (iv) Selecting cells expressing the first and second selection markers, including growing cells expressing the first and second selection markers, thereby creating cells for inducible production of recombinant AAV (rAAV) virions containing a polynucleotide payload. In certain embodiments, the sequence encoding the first portion of the selection marker is operably ligated to a constitutive promoter, and the sequence encoding the second portion of the selection marker is operably ligated to a constitutive promoter, and when expressed in cells, the first portion and the second portion of the selection marker interact to produce a complete selection marker. In some embodiments, the constitutive promoter is a cytomegalovirus promoter or an EF1α promoter. In some embodiments, the constitutive promoter is a weak or attenuated promoter.

[0218] In certain embodiments, the first and second selection markers are antibiotic resistance proteins. In certain embodiments, the second selection marker is a blastosidine resistance gene. In some embodiments, the second selection marker is a blastosidine resistance gene, where the first part of the second selection marker is the first part of the blastosidine resistance gene, and the second part of the second selection marker is the second part of the blastosidine resistance gene. In certain embodiments, this selection marker is referred to as "split blastosidine" because a functional blastosidine is formed by the association of the first and second parts. In various embodiments, the first and second parts of split blastosidine are encoded by sequence numbers 177-178.

[0219] In certain embodiments, the first promoter in the second vector is heterogeneous to the large Rep-coding sequence. In certain embodiments, the large Rep-coding sequence contains a p19 promoter operably ligated to the small Rep-coding sequence, and the intron containing the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Rep-coding sequence. In certain embodiments, the p19 promoter is mutated to substantially reduce promoter activity. In certain embodiments, the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or undetectable compared to the native p19 promoter activity.

[0220] In certain embodiments, the second vector lacks a functional p5 promoter. In certain embodiments, the first promoter is replaced by a p5 promoter. In certain embodiments, the first promoter and / or the second promoter in the second vector are constitutive promoters.

[0221] In certain embodiments, the second vector lacks a functional p5 promoter located upstream of the large Rep coding sequence. In certain embodiments, the second vector lacks a functional p5 promoter located upstream of the large Rep coding sequence and lacks a functional p5 promoter located downstream of the small Rep coding sequence. In certain embodiments, the second vector lacks a functional p5 promoter located upstream of the large Rep coding sequence but includes a functional p5 promoter located downstream of the small Rep coding sequence. In certain embodiments, the first promoter replaces the p5 promoter located upstream of the large Rep coding sequence. In certain embodiments, the first promoter and / or the second promoter in the second vector are constitutive promoters.

[0222] In certain embodiments, the second vector may have the following characteristics: (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Roussarcoma virus terminal repeat (RSV) promoter; (ii) the first promoter is a chicken β-actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken β-actin (CAG) promoter and the second promoter is an RSV promoter; or (iv) the first promoter is a chicken β-actin promoter and the second promoter is an RSV promoter.

[0223] In a particular embodiment, the intron is a synthetic intron comprising a 5' splice donor site, a second promoter sequence, and a 3' splice acceptor site that are compatible with the cell used to express the large Rep protein.

[0224] In a particular embodiment, the small Rep code sequence includes a resectable element comprising a first recombination site and a second recombination site adjacent to a sequence containing a stop codon, wherein the first and second recombination sites are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the resection of the sequence containing the stop codon.

[0225] In a particular embodiment, the second vector comprises a large Rep coding sequence and a small Rep coding sequence and an in-frame sequence encoding a tag, where each of the large Rep protein and the small Rep protein is expressed as a fusion protein containing the tag. The tag may be a purified tag and / or a detectable tag.

[0226] In certain embodiments, the AAV capsid protein coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further comprises an inducible or constitutive promoter operably ligated to the Cap coding sequence. In certain embodiments, the second vector comprises an inducible promoter operably ligated to the AAV capsid protein coding sequence. In certain embodiments, the intervening sequence comprises a transcriptional blocking element (TBE).

[0227] In certain embodiments, the TBE includes nucleotide sequences that are at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the following nucleotide sequences.

[0228] AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT.

[0229] In certain embodiments, an inductive promoter operably ligated to a sequence encoding an inductive recombinase and an inductive promoter operably ligated to an AAV capsid protein-coding sequence are the same promoter. In certain embodiments, the promoter includes a tetracycline-responsive promoter element (TRE) as described in the above section of this specification. In certain embodiments, the activator that binds to the TRE in the presence of a first inducer is Tet-on 3G. In certain embodiments, the inductive recombinase is fused to an estrogen-responsive element (ER2) and translocates to the nucleus of a cell containing a second vector in the presence of a second inducer. In certain embodiments, the first inducer is doxycycline and the second inducer is tamoxifen.

[0230] In certain embodiments, a polynucleotide payload may encode a payload that is a progranulin. Polynucleotide payloads are described in detail in another section.

[0231] In a particular embodiment, the first vector further comprises a VA-RNA coding sequence. The VA-RNA coding sequence may be a transcriptionally inactive sequence. The VA-RNA coding sequence may contain at least two mutations in its internal promoter.

[0232] Expression of the inducible recombinase is induced by an activator and a first inducer. The recombinase may be linked to an estrogen-responsive element that prevents translocation of the recombinase to the nucleus. The recombinase translocates to the nucleus upon binding to a second inducer. In the nucleus, the recombinase can induce one or more recombination events (e.g., two recombination events). The recombinase can excise itself. This excision can place the AAV helper gene in operative linkage to an inducible promoter that is induced in the presence of an activator and the first inducer, thereby inducing expression of an AAV helper protein (e.g., E1a, E1b, E2A, or E4, or any combination thereof). Expression of the recombinase can also result in excision of other segments in the construct flanked by recombination sites. For example, a sequence encoding a stop codon in a second vector is excised from the AAV Rep coding sequence, thereby allowing expression of the Rep protein.

[0233] In some embodiments, the segment flanked by recombination sites that splits a constitutive promoter operably linked to VA RNA1 is also excised, thereby resulting in ligation of the split constitutive promoter and thus allowing expression of the operably linked VA RNA1 sequence. Here, the cell can express all adenoviral helper genes required for AAV production, thereby completing expression of all components required for AAV production and conferring on the cell the ability to produce recombinant AAV.

[0234] Figure 9A shows the off state of an exemplary embodiment. In the illustrated embodiment, three constructs of synthetic polynucleotides are separately incorporated into the nuclear genome of cells expressing adenovirus E1A and E1B, for example, HEK293 cells. These polynucleotides may also be introduced as vectors, and cells with these vectors incorporated into their genomes may be selected as described above. In the off state, transcriptional read-through of the Rep-coding sequence of construct 2 ("Rep2") is blocked by an excisable element containing a stop codon. Construct 2 encodes a split mammalian selection marker under the control of a constitutive promoter, a large AAV Rep protein under the control of the p1 promoter, and a small Rep protein under the control of the p2 promoter. The p1 promoter refers to a first promoter described herein for controlling the expression of the large Rep protein, and the p2 promoter refers to a second promoter described herein for controlling the expression of the small Rep protein. p2 may be located within a synthetic intron inserted upstream of the transcription start site of the sequence encoding the small Rep protein. p1 and p2 may be promoters as described herein, where the promoter activity of p2 is stronger than that of p1.

[0235] In the off state (Figure 9A), the ER2-Cre coding sequence is under the control of an inducible promoter. For example, the inducible promoter is the Tet-inducible promoter. In the absence of a first inducer (e.g., tetracycline or doxycycline), the Tet-inducible promoter is inactive. In the absence of tetracycline such as doxycycline ("Dox"), the Tet-activating protein (Tet-On 3G) cannot bind to the Tet-On promoter and therefore cannot activate it. In this figure, the Tet-inducible promoter is interchangeably referred to as the doxycycline-inducible promoter and the Tet-On promoter. In addition, Cre localization is under the control of an estrogen-responsive element ("ER2") that requires the binding of a second inducer, e.g., an estrogen agonist or selective modulator, e.g., tamoxifen, for translocation from the cytoplasm to the nucleus. This method suppresses Cre expression leaks, thereby reducing the associated disorderly recombination events and toxicity. The ER2 Cre coding sequence also contains a strong 3' polyadenylation signal that prevents the basal expression of the downstream adenovirus helper genes E2A and E4.

[0236] In some embodiments, Cre is split into two fragments that can associate in the presence of a chemical agent such as rapamycin. In some embodiments, Cre is photoinducible Cre.

[0237] When a first inducer (e.g., Dox) and a second inducer (tamoxifen) are added to the culture medium, Tet-On 3G and Dox bind to the Tet-responsive basal promoter, leading to the expression and translocation of ER2 Cre to the nucleus. ER2 Cre excises its own coding sequence from construct 1, leaving the construct shown in Figure 9B. Excision of the ER2 Cre coding sequence enables the expression of E2A and E4 helper proteins. Similarly, for any additional VA RNA coding sequences shown in Figure 9B, the VA RNA is expressed by excision of a Cre-mediated stuffer sequence that results in ligation of the U6 promoter region and subsequently drives VA RNA expression.

[0238] Construct 1 also includes a constitutively expressed select marker, such as puromycin.

[0239] Figure 9A shows the off state of the incorporated nucleic acid construct 2. Constructor 2 is designed to prevent the expression of ER2 Cre in the presence of the first inducer and the expression of AAV large Rep protein and small Rep protein before activation of ER2 Cre by the second inducer. Constructor 2 is also designed to prevent the expression of Cap before activation of ER2 Cre by the second inducer.

[0240] In Figures 11A and 11B, the Cap coding sequence, like ER2 Cre, is under the control of the Tet-On promoter. Therefore, the addition of the first inducer induces the expression of the Cap protein.

[0241] Construction 2 also codes the first part of the split selection marker, and Construction 3 codes the second part of the split selection marker.

[0242] In construct 2, the small Rep code sequence includes a resectable element containing a first lox region and a second lox region adjacent to a sequence containing a stop codon, wherein the lox regions are oriented in the same direction, and recombination between the lox regions by ER2 Cre results in the resection of the sequence containing the stop codon.

[0243] Figure 9B shows the conversion of constructs 1 and 2 to the ON state after exposure to ER2 Cre in the cell nucleus. ER2 Cre excises excisable elements located within the small Rep coding sequence. Upon reconstitution, construct 2 becomes capable of expressing a functional Rep transcript.

[0244] Construct 3 comprises a polynucleotide payload, which may be the gene of interest, flanked by ITRs, and a second portion of a selection marker expressed from a constitutive promoter. The polynucleotide payload may be any payload for which rAAV is a suitable medium, including a transgene encoding the protein of interest, homology elements for homologous recombination repair, or guide RNA. The polynucleotide payload is flanked by AAV ITRs represented by parentheses.

[0245] In another specific embodiment, the payload-coding sequence includes a reporter gene, a therapeutic gene, a transgene encoding a protein of interest, an antibody-coding sequence, a regulatory element-coding sequence, an antigen (e.g., an immunogen), and the like. In yet another specific embodiment, the payload-coding sequence is a progranulin-coding sequence. In yet another specific embodiment, the payload-coding sequence includes a suppressor tRNA, a guide RNA, a heterologous messenger RNA, a small RNA (e.g., for RNA interference), or a homology region for homologous recombination repair.

[0246] In various embodiments, the payload encoding sequence includes a sequence of about 4700 nucleotides. In various embodiments, the payload encoding sequence includes a sequence of about 4400 to 4700 nucleotides. In various embodiments, the payload encoding sequence includes a sequence of at least about 2200 nucleotides. Some examples include the payload as a self-complementary sequence, and such embodiments may be useful when the desired payload is less than about 2200 nucleotides. Further details on payload design can be found in Li, L., et al., Advances in Recombinant Adeno-Associated Virus Vectors for Neurodegenerative Diseases, Biomedicines, 2023 Oct 8;11(10):2125 (the disclosure is incorporated in whole by reference for all purposes).

[0247] Figure 9B shows the on-state construct after the addition of tamoxifen and doxycycline to the cell culture medium. Adenovirus E2A and E4 helper proteins are expressed from the incorporated construct 1 under the control of an inducible promoter (e.g., the Tet-On promoter activated in the presence of Dox). AAV Rep and Cap coding sequences are expressed from construct 2. The ratio of small Rep proteins to large Rep proteins is controlled by the selection of promoters p1 and p2. p1 and p2 may be promoters as described herein, where the promoter activity of p2 is stronger than that of p1. The payload is expressed under the control of a constitutive promoter suitable for the payload to obtain the desired payload expression level, such as a constitutive promoter, tissue-specific promoter, or ubiquitous promoter. This produces rAAV virions in which the polynucleotide payload is encapsulated in a capsid.

[0248] Figures 11A and 11B illustrate another embodiment of the present disclosure.

[0249] Figure 11A shows the off state of an exemplary embodiment. In the illustrated embodiment, three constructs of synthetic polynucleotides are separately integrated into the nuclear genome of cells expressing adenovirus E1A and E1B, e.g., HEK293 cells. These polynucleotides may also be introduced as vectors, and cells with these vectors integrated into their genomes can be selected as described above. In the off state, transcriptional read-through of the Rep-coding sequence of construct 2 is blocked by a cleavable element (e.g., a sequence encoding blue fluorescent protein "BFP") containing a first lox site and a second lox site adjacent to a sequence containing a stop codon, where the first and second lox sites are oriented in the same direction, and recombination between the first and second lox sites by ER2 Cre results in the cleavage of the sequence containing the stop codon. Construct 2 encodes a split mammalian selection marker under the control of a constitutive promoter, as well as a large AAV Rep protein under the control of the p1 promoter and a small Rep protein under the control of the p2 promoter. The p1 promoter refers to a first promoter described herein for controlling the expression of large Rep proteins, and the p2 promoter refers to a second promoter described herein for controlling the expression of small Rep proteins. p2 may be located within a synthetic intron inserted upstream of the transcription start site of small Rep, as described in the above section. p1 and p2 may be promoters as described herein, where the promoter activity of p2 is stronger than that of p1.

[0250] In construct 2, the AAV capsid protein (Cap) coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further includes an inducible promoter operably ligated to the Cap coding sequence. The intervening sequence contains a transcriptional blocking element (TBE). For example, the inducible promoter is a Tet inducible promoter.

[0251] In the off state (Figure 11A), the ER2-Cre coding sequence is under the control of an inductive promoter, and the sequence encoding the Cap protein is also under the control of an inductive promoter. For example, each of these inductive promoters is a Tet-inductive promoter. In the absence of a first inducer (e.g., tetracycline or doxycycline), the Tet-inductive promoter is inactive. In the absence of tetracycline such as doxycycline ("Dox"), the Tet-activating protein (Tet-On 3G) cannot bind to the Tet-On promoter and therefore cannot activate it. In this figure, the Tet-inductive promoter is interchangeably referred to as the doxycycline-inductive promoter and the Tet-On promoter. In addition, Cre localization is under the control of an estrogen-responsive element ("ER2") that requires the binding of a second inducer, e.g., an estrogen agonist or selective modulator, e.g., tamoxifen, for translocation from the cytoplasm to the nucleus. This method suppresses Cre expression leaks, along with the associated disorderly recombination events and toxicity. The ER2 Cre coding sequence also contains a strong 3' polyadenylation signal that prevents the basal expression of the downstream adenovirus helper genes E2A and E4.

[0252] In some embodiments, Cre is split into two fragments that can associate in the presence of a chemical agent such as rapamycin. In some embodiments, Cre is photoinducible Cre.

[0253] When a first inducer (e.g., Dox) and a second inducer (tamoxifen) are added to the culture medium, Tet-On 3G and Dox bind to the Tet-responsive basal promoter, resulting in the expression of ER2 Cre, which then translocates to the nucleus. ER2 Cre excises its own coding sequence from construct 1, leaving the construct shown in Figure 11B. The excision of the ER2 Cre coding sequence enables the expression of E2A and E4 helper proteins. Similarly, for any additional VA RNA coding sequences shown in Figure 11B, the VA RNA results in ligation of the U6 promoter region, followed by expression by Cre-mediated excision of a stuffer sequence that drives VA RNA expression. In addition, when the first inducer is added to the culture medium, Tet-On 3G and Dox bind to the Tet-responsive basal promoter upstream of the sequence encoding the Cap protein, resulting in the expression of the Cap protein.

[0254] Construct 1 also includes a constitutively expressed select marker, such as puromycin.

[0255] Figure 11A shows the off state of the incorporated nucleic acid construct 2. Constructor 2 is designed to prevent the expression of ER2 Cre in the presence of the first inducer and the expression of AAV large and small Rep proteins before activation of ER2 Cre by the second inducer. Constructor 2 is also designed to prevent the expression of Cap in the presence of the first inducer.

[0256] Construction 2 also codes the first part of the split selection marker, and Construction 3 codes the second part of the split selection marker.

[0257] In construct 2, the small Rep-coding sequence includes a resectable element comprising a first lox site and a second lox site adjacent to a sequence containing a stop codon (for example, in the blue fluorescent protein "BFP"), wherein the lox sites are oriented in the same direction, and recombination between the lox sites by ER2 Cre results in the resection of the sequence containing the stop codon.

[0258] Figure 11B shows the conversion of constructs 1 and 2 to the ON state after exposure to ER2 Cre in the cell nucleus. ER2 Cre excises excisable elements located within the small Rep coding sequence. Upon reconstitution, construct 2 becomes capable of expressing a functional Rep transcript.

[0259] Construct 3 comprises a polynucleotide payload, which may be the gene of interest, flanked by ITRs, and a second portion of a selection marker expressed from a constitutive promoter. The polynucleotide payload may be any payload for which rAAV is a suitable medium, including a transgene encoding the protein of interest, homology elements for homologous recombination repair, or guide RNA. The polynucleotide payload is flanked by AAV ITRs represented by parentheses.

[0260] Figure 11B shows the on-state construct after the addition of tamoxifen and doxycycline to the cell culture medium. Adenovirus E2A and E4 helper proteins are expressed from the incorporated construct 1 under the control of an inducible promoter (e.g., a Tet-On promoter activated in the presence of Dox). AAV Rep and Cap coding sequences are expressed from construct 2. The ratio of small Rep proteins to large Rep proteins is controlled by the selection of promoters p1 and p2. p1 and p2 may be promoters as described herein, where the promoter activity of p2 is stronger than that of p1. The payload is expressed under the control of a promoter suitable for the payload to obtain the desired payload expression level, such as a constitutive promoter, tissue-specific promoter, or ubiquitous promoter. This produces rAAV virions in which the polynucleotide payload is encapsulated in a capsid.

[0261] Cap protein expression is regulated by its native promoter.

[0262] Structures 1 and 3 in Figures 10A and 10B are the same as Structures 1 and 3 shown in Figures 9A and 9B, respectively.

[0263] Figures 10A and 10B show the same constructs as Figures 9A and 9B, respectively, and include construct 4, which is an additional polynucleotide for the expression of the CAP protein from the inductive promoter. Construct 4 also includes a constitutively expressed selection marker (e.g., hygromycin resistance). The Tet-inductive promoter is the same promoter as the doxycycline-inductive promoter and is activated in the presence of Tet-on 3G and doxycycline.

[0264] Structures 1 and 3 in Figures 12A and 12B are the same as Structures 1 and 3 shown in Figures 11A and 11B, respectively.

[0265] Figures 12A and 12B show the same constructs as Figures 11A and 11B, respectively, and include construct 4, which is an additional polynucleotide for the expression of the Cap protein from the inductive promoter. Construct 4 also includes a constitutively expressed selection marker (e.g., hygromycin resistance). The Tet-inductive promoter is the same promoter as the doxycycline-inductive promoter and is activated in the presence of Tet-on 3G and doxycycline.

[0266] Site-specific recombinase system Any suitable site-specific recombinase system may be used to recombinate the recombination sites described herein. The term "recombination system" refers to the site-specific recombinase and the recombination site that the recombinase recombines. Exemplary site-specific recombinase systems include, but are not limited to, the Cre-lox, Flp-FRT, PhiC31-att, Dre-lox, and Tre-loxLTR site-specific recombinase systems. The Cre-lox system uses Cre recombinase to catalyze site-specific recombination between two lox sites, e.g., between two loxp sites, two loxB sites, two loxl sites, two loxR sites, or two loxC2 sites. As used herein, the term "lox" refers to a specific nucleotide sequence recognized by Cre recombinase. The Flp-FRT system uses flippase (FLP) recombinase to catalyze site-specific recombination between two flippase-recognition target (FRT) sites. The PhiC31-att system uses phiC31 recombinase to catalyze site-specific recombination between two attachment (att) sites, designated attB and attP. The Dre-rox system uses DreO recombinase to catalyze site-specific recombination between two rox sites. The Tre-loxLTR system uses Tre recombinase to catalyze site-specific recombination between two loxP sites modified with an HIV terminal repeat sequence (loxLTR). For descriptions of various site-specific recombinase systems, see, for example, Stark et al. (2011) Biochem.Soc.Trans.39(2):617-22, Olorunniji et al. (2016) Biochem.J.473(6):673-684, Birling et al. (2009) Methods Mol.Biol.561:245-63, Garcia-Otin et al. (2006) Front.Biosci.11:1108-1136, and Weasner et al. (2017) Methods Mol.Biol.1642:195-209 (these are incorporated herein by reference in their entirety).

[0267] In certain embodiments, inducible recombinases, such as ligand-site-specific recombinases, may be used to control the activity of the recombinase. In some embodiments, the ligand-binding region of a steroid receptor is fused to the recombinase to confer ligand-dependent regulation of recombination. For example, ligand-site-specific recombination may be performed by a tamoxifen-inducible Cre-ER (or a modified version such as CreERT2) containing an estrogen-responsive element (ER) fused to Cre as a transgene (Cre-ER). The Cre-ER fusion is activated and translocated to the nucleus only in the presence of an inducer (e.g., a second inducer), such as tamoxifen (see Metzger et al. (1995) Proc.Natl.Acad.Sci.USA 92(15):6991-5, Feil et al. (1996) Proc.Natl.Acad.Sci.USA 93(20):10887-90, Indra et al. (1999) Nucleic Acids Res.27(22):4324-7, Zhong et al. (2015) Bone 81:614-619 (these entire references are incorporated herein by reference)). Alternatively, a tamoxifen-inducible FLP recombinase containing an estrogen-responsive element (ER) fused to FLP as a transgene (FLP-ER) may be used. The FLP-ER fusion is similarly activated and translocated to the nucleus only in the presence of tamoxifen (see, e.g., Hunter et al. (2005) Genesis 41(3):99-109, Nichols et al. (1997) Mol. Endocrinol. 11(7):950-61 (these are incorporated herein by reference)).

[0268] Recombination sites for site-directed recombinases can be linked to oligonucleotides in numerous ways. For example, oligonucleotides can be amplified using primers containing the recombination site. In addition, selection markers can be used to select clones that have successfully undergone site-directed recombination.

[0269] In certain embodiments, examples of polynucleotides disclosed herein, including first and second recombination sites and third and fourth recombination sites, the first and second recombination sites are the same as the third and fourth recombination sites. In certain embodiments, examples of polynucleotides disclosed herein, including first and second recombination sites, third and fourth recombination sites and fifth and sixth recombination sites, the first and second recombination sites are the same as the third and fourth recombination sites and fifth and sixth recombination sites. For example, all of these recombination sites may be loxP sites or flt sites.

[0270] In certain embodiments, in examples of polynucleotides disclosed herein, including first and second recombination sites and third and fourth recombination sites, the first and second recombination sites, unlike the third and fourth recombination sites, are recombined by the recombinase between the first and second recombination sites and between the third and fourth recombination sites, but not between the first and fourth recombination sites, for example.

[0271] In a particular embodiment, in a particular example, the first and second recombination sites may be loxP sites, while the third and fourth recombination sites may be loxL sites, and the recombinase may be cre. In another example, the first and second recombination sites may be loxP sites, and the third and fourth recombination sites may be flt sites.

[0272] In certain examples, the fifth and sixth recombinant sites disclosed herein may be the same as the first and second recombinant sites or the third and fourth recombinant sites.

[0273] Inducible promoter In certain embodiments, inducible promoters are selected based on regulatory sequences that enable control of the promoter. These regulatory sequences may be operably ligated to the promoter or located upstream of it. Such regulatory sequences are known to those skilled in the art and include, for example, those that turn gene expression on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. The regulatory sequences used to control expression may be endogenous or exogenous to the host cell. In some embodiments, combinations of bacterial gene regulatory elements and viral transactivator proteins are used to produce inducible expression in mammals. Examples of mammalian-compatible regulatory sequences, but not limited to, tetracyclines, streptogramins, and macrolides, that can regulate transcription by controlling genetically engineered promoters in response to antibiotics. For example, the incorporation of a bacterial tetracycline response element (TRE) into a construct allows for the induction of mammalian expression by tetracycline or its derivatives (e.g., doxycycline). See, for example, Weber et al. (2004) Methods Mol. Biol. 267:451-66, Das et al. (2016) Curr. Gene Ther. 16(3):156-67, Chruscicka et al. (2015) J. Biomol. Screen. 20(3):350-8, Yarranton (1992) Curr. Opin. Biotechnol. 3(5):506-11, Gossen & Bujard (1992) Proc. Natl. Acad. Sci. USA 89(12):5547-51, and Gossen et al. (1995) Science 268(5218):1766-9, which are incorporated herein by reference. In some embodiments, the TRE includes a 19-base pair operator region (tetO) of 7 repeats. In a further embodiment, the TRE includes a 19-base-pair operator region of 7 repeats upstream of the minimal human cytomegalovirus (CMV) promoter.

[0274] Selection Marker In addition, the polynucleotide constructs of the vector system can be constructed to include selection markers. Preferred markers include genes that confer resistance or sensitivity to antibiotics or toxins, or confer color, or modify antigenic properties, when cells transfected with the nucleic acid construct are grown in a suitable selective medium. Examples of selection marker genes, but not limited to, include the neomycin resistance gene (neo, encoding aminoglycoside phosphotransferase (APH)) that enables the selection of mammalian cells by conferring resistance to G418 (genetisin), the hygromycin B resistance gene (hygB, encoding hygromycin-B-phosphotransferase (HPH)) that confers resistance to hygromycin B, the puromycin resistance gene (pac, encoding puromycin-N-acetyltransferase) that confers resistance to puromycin, the zeosin resistance gene (Sh bla, encoding a protein that binds to zeosin) that prevents zeosin from binding to and damaging DNA, and the blastosidine resistance gene (BSD) that confers resistance to blastosidine. Furthermore, methotrexate (MTX) selection based on dihydrofolate reductase (DHFR) or methionine sulfoximine (MSX) selection based on glutamine synthetase (GS) may be used in mammalian cells. Other suitable markers and selection methods are known to those skilled in the art.

[0275] In some embodiments, the selection marker is an antibiotic resistance protein. In some embodiments, the selection marker is a split selection marker that allows selection of cells holding two different polynucleotides using a single selective pressure. In some embodiments, the antibiotic resistance protein is split into two parts that can associate to form a functional antibiotic resistance protein. The first part of the antibiotic resistance protein is encoded by a first polynucleotide, and the second part of the antibiotic resistance protein is encoded by a second polynucleotide. In some embodiments, a split intermediary protein (intine) system is used that allows stable retention of two incorporated nucleic acid constructs under a single selective pressure. The intein autocatalyzes a protein splicing reaction that results in the excision of the intein and linkage of adjacent amino acids (extine sequences) by peptide bonds. Inteins exist in nature as a single domain within host proteins, or, less often, in a split form. In split inteins, protein transsplicing must occur so that the two distinct polypeptide fragments of the intein can associate to excise the intein. The fragmented intein system is described in Cheriyan et al, J. Biol. Chem 288:6202-6211 (2013), Stevens et al, PNAS 114:8538-8543 (2017), Jillette et al., Nat Comm 10:4968 (2019), US2020 / 0087388A1, and US2020 / 0263197A1. In some embodiments, the fragmented intein is derived from the DnaE intein of Nostoc punctiforme (Npu), the DnaE intein of the Synechocystis genus PCC6803 strain (Ssp), or consensus DnaE intein (Cfa). In some embodiments, the first portion of the antibiotic resistance protein is an N-terminal portion whose C-terminus is fused to an N-terminal intein, and the second portion of the antibiotic resistance protein is a C-terminal portion whose N-terminus is fused to a C-terminal intein.When both parts are present, the N-terminal intein associates with the C-terminal intein, resulting in the cleavage of the intein and the splicing of the C-terminal portion of the antibiotic resistance protein to the N-terminal portion, thereby forming a functional antibiotic resistance protein.

[0276] In some embodiments, the selection marker is a trophotropic selection element. In some embodiments, the trophotropic selection element encodes an inactive protein that requires the expression of a second trophotropic selection element for activity. In some embodiments, the trophotropic selection element encodes the C-terminal fragment Z-Cter of a trophotropic protein, and the second trophotropic selection element encodes the N-terminal fragment Z-Nter of a trophotropic protein, or vice versa. In some embodiments, the trophotropic selection element encodes DHFR Z-Cter and DHFR Z-Nter. In some embodiments, the trophotropic selection element encodes the C-terminal fragment of a trophotropic protein fused to the C-terminal intein of a split intein, and the second trophotropic selection element encodes the N-terminal fragment of a trophotropic protein fused to the N-terminal intein of a split intein. In some embodiments, the trophotropic selection element encodes the C-terminal fragment of PAH, GS, TYMS, or DHFR fused to the C-terminal intein of a split intein. In some embodiments, the nutrient-selective element encodes an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to the N-terminal intein of the split intein.

[0277] In certain embodiments, a split-type nutrient-requiring selection system may be used to enable stable retention of two incorporated nucleic acid constructs under a single selective pressure. One construct encodes the N-terminal fragment of mammalian dihydrofolate reductase (DHFR) fused to a leucine zipper peptide ("Nter-DHFR"). This N-terminal fragment is a non-functional enzyme. The other construct encodes the C-terminal fragment of DHFR fused to a leucine zipper peptide ("Cter-DHFR"). This C-terminal fragment is a non-functional enzyme. When both fragments are expressed simultaneously in a cell, the association of the leucine zipper peptide forms a functional DHFR enzyme complex. Both constructs can be stably retained in the genome of DHFR null cells by growth in a hypoxanthine and thymidine-deficient medium.

[0278] Polynucleotide payload A sequence encoding a payload as disclosed herein includes any nucleotide sequence to be delivered to a cell. The nucleotide sequence may be used by the cell, for example, for insertion of the nucleotide sequence or a portion thereof. For example, the nucleotide sequence may be used to repair endogenous DNA. In such cases, the nucleotide sequence itself is the payload delivered to the cell by rAAV.

[0279] In other cases, the polynucleotide payload is transcribed into RNA that is not translated into protein within the cell. In such cases, the RNA is the payload delivered by the polynucleotide payload present in the rAAV. In other cases, the polynucleotide payload is transcribed into mRNA that is translated into protein within the cell. In such cases, the protein is the payload delivered by the polynucleotide payload present in the rAAV.

[0280] A polynucleotide payload may include a promoter operably ligated to a DNA sequence. The promoter may be any promoter that enables DNA transcription within a cell. The payloads disclosed herein may be therapeutic payloads.

[0281] DNA sequences can be transcribed to produce RNA within a cell. RNA can be mRNA. RNA can be guide RNA (gRNA), tRNA, suppressor tRNA, mRNA, or circular RNA. RNA can be regulatory RNA of interest, such as, but not limited to, microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), nuclear small RNA (snRNA), long non-coding RNA (lncRNA), or antisense nucleic acid.

[0282] The polynucleotide payload may be a polypeptide, such as an antibody, hormone, site-specific endonuclease, reporter gene, component of the CRISPR / Cas system, RNA adenosine deaminase (ADAR) enzyme, transcription activator, transcription repressor, ribozyme, DNA enzyme, or any combination thereof.

[0283] The payload may include any or a combination of a transgene, a tRNA suppressor, a guide RNA, or any other target-binding / modifying oligonucleotide or its derivative, or the payload may include an immunogen for a vaccine and any gene editing mechanism (DNA or RNA editing). The payload may also include those that deliver a transgene encoding an antibody chain or fragment suitable for viral vector-mediated expression (also referred to as a “vector antibody or vectorized antibody for gene delivery”). See, for example, Curr Opin HIV AIDS.2015 May;10(3):190-197, which describes the delivery of a vector antibody gene for the prevention or treatment of HIV infection. See also U.S. Patent No. 10,780,182, which describes the AAV delivery of trastuzumab (Herceptin) for the treatment of HER2+ brain metastases. The payloads disclosed herein may not be therapeutic payloads (e.g., encoding a detectable marker such as GFP). In some specific examples, the polynucleotide payload refers to a polynucleotide that may be a homology element for homologous recombination repair or a polynucleotide that is transcribed into a guide RNA delivered for various purposes. In some embodiments, the transgene refers to a nucleic acid sequence that encodes the expression of a guide RNA for ADAR editing or ADAT editing. In some embodiments, the transgene refers to a transgene packaged for gene therapy. In some embodiments, the transgene refers to a synthetic construct packaged for vaccines. In certain embodiments, the polynucleotide payload may be described as encoding RNA, which is intended to refer to RNA transcribed from the polynucleotide.

[0284] In certain examples, the payload-coding sequence includes two expressible sequences, where the first expressible sequence encodes a first gRNA and the second expressible sequence encodes a second gRNA. In some embodiments, the first and second gRNAs are different. In some embodiments, the first and second gRNAs are the same. In certain examples, the payload-coding sequence includes two or more expressible sequences. In some embodiments, the two or more expressible sequences encode two or more gRNAs. In some embodiments, the two or more gRNAs are either all different gRNAs, all the same gRNAs, or a combination of the same and different gRNAs.

[0285] In some examples, the payload-coding sequence includes expressible sequences encoding heterologous RNA and heterologous polypeptide. In other examples, the expressible sequence encodes two or more heterologous payloads. When the expressible sequence encodes two heterologous payloads, in some examples, the nucleotide sequences encoding the two heterologous payloads are operably ligated to the same promoter. When the expressible sequence encodes two heterologous payloads, in some examples, the nucleotide sequences encoding the two heterologous payloads are operably ligated to two different promoters. In some examples, the payload-coding sequence includes expressible sequences encoding three heterologous payloads. When the expressible sequence encodes three heterologous payloads, in some examples, the nucleotide sequences encoding the three heterologous payloads are operably ligated to the same promoter. When the expressible sequence encodes three heterologous payloads, in some examples, the nucleotide sequences encoding the three heterologous payloads are operably ligated to two or three different promoters. In some examples, the fourth polynucleotide construct of this disclosure includes two or more expressible sequences, each containing a nucleotide sequence encoding a heterologous payload.

[0286] In some embodiments, the expressible sequence encodes a polypeptide of interest. The polypeptide of interest may be any type of protein / peptide, but is not limited to, an enzyme, extracellular matrix protein, receptor, transporter, ion channel, or other membrane protein, hormone, neuropeptide, antibody, or cytoskeletal protein; or a fragment thereof, or containing the biologically active domain of interest. In some examples, the payload is a therapeutic polypeptide, e.g., a polypeptide that provides clinical benefit.

[0287] When the payload is interfering RNA (RNAi), preferred RNAi include RNAi that reduce the levels of apoptotic factors or angiogenic factors in cells. For example, the RNAi may be shRNA or siRNA that reduces the levels of a payload that induces or promotes apoptosis in cells. The payload may be a gene whose gene product induces or promotes apoptosis, and is referred to herein as a “pro-apoptotic gene,” and the products (mRNA; proteins) of those genes are referred to as “pro-apoptotic gene products.” Examples of pro-apoptotic gene products include the products of the Bax, Bid, Bak, and Bad genes. See, for example, U.S. Patent No. 7,846,730. In another example, the RNAi specifically reduces the levels of RNA and / or polypeptide products of a deficient allele.

[0288] In some embodiments, the payload is an aptamer. In some examples, the aptamer is a therapeutic aptamer. For example, an aptamer may function as an antagonist by blocking the interaction of disease-related targets (e.g., receptor-ligand interactions). Alternatively, an aptamer may function as an agonist to activate the function of a target receptor. Exemplary aptamers of interest include aptamers for growth factor receptors and growth factors, such as epidermal growth factor receptor (see, e.g., Wang et al. (2014) Biochem. Biophys. Res. Commun. 453(4):681-5), transforming growth factor β receptor type III (see, e.g., Ohuchi et al. (2006) Biochimie 88(7):897-904), vascular endothelial growth factor (VEGF) (see, e.g., Ng et al. (2006) Nat. Rev. Drug Discovery 5:123, and Lee et al. (2005) Proc. Natl. Acad. Sci. USA 102:18902), or aptamers that bind to platelet-derived growth factor (PDGF), such as E10030 (see, e.g., Ni and Hui (2009) Ophthalmologica See also 223:401 and Akiyama et al. (2006) J.Cell Physiol. 207:407.

[0289] In some embodiments, the expressible sequence encodes a sequence-specific endonuclease used for genome editing. The sequence-specific endonuclease can be used to induce double-strand breaks at specific sites in the genome. The double-strand breaks can then be repaired via non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), or homologous recombination repair (HDR) pathways. The desired genome edit can be introduced into the genome using donor DNA for repairing the double-strand breaks by homologous recombination. A variety of sequence-specific endonucleases for inducing double-strand breaks in DNA can be used for genome editing, but are not limited to, genetically engineered zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), meganucleases, and clustered, regularly arranged short palindromic sequence repeats (CRISPR) / Cas9. See, for example, Targeted Genome Editing Using Site-Specific Nucleases: ZFNs, TALENs, and the CRISPR / Cas9 System (T. Yamamoto ed., Springer, 2015), Genome Editing: The Next Step in Gene Therapy (Advances in Experimental Medicine and Biology, T. Cathomen, M. Hirsch, and M. Porteus eds., Springer, 2016), and Aachen Press Genome Editing (CreateSpace Independent Publishing Platform, 2015), which are incorporated herein by reference. Precise control of the timing of genome editing enzyme generation can be achieved by inducibly producing recombinant adenovirus-associated virus (rAAV) virions using a vector system that allows expression to be turned on / off as desired.

[0290] In some cases, the payload of interest is a site-specific endonuclease that results in site-specific knockdown of gene function, where, for example, the endonuclease knocks out a disease-associated allele. For example, if a dominant allele codes for a defective copy of a gene and the wild-type gene provides normal function, the site-specific endonuclease can target the defective allele and knock it out. In some cases, the site-specific endonuclease is an RNA-induced endonuclease.

[0291] Site-specific nucleases can be used to promote homologous recombination by donor DNA encoding a functional copy of the protein encoded by the defect allele. For example, the rAAV virion in this subject could be used to deliver a site-specific endonuclease that knocks out the defect allele, and also to deliver a functional copy of the defect allele that results in repair of the defect allele, thereby leading to the generation of a functional gene product.

[0292] In some examples, the payload is an RNA-inducible endonuclease. In some examples, the payload is RNA containing a nucleotide sequence encoding an RNA-inducible endonuclease. In some examples, the payload is a guide RNA, e.g., a single guide RNA. In some examples, the payload is 1) a guide RNA and 2) an RNA-inducible endonuclease. The guide RNA may include a) a protein-binding region that binds to the RNA-inducible endonuclease and b) a region that binds to the target nucleic acid. RNA-inducible endonucleases are also referred to herein as “genome editing nucleases”.

[0293] An example of an RNA-inducible artificial nuclease is a CRISPR / Cas endonuclease (e.g., a class 2 CRISPR / Cas endonuclease, e.g., type II, type V, or type VI CRISPR / Cas endonuclease). A preferred genome editing nuclease is a CRISPR / Cas endonuclease (e.g., a class 2 CRISPR / Cas endonuclease, e.g., type II, type V, or type VI CRISPR / Cas endonuclease). In some examples, the preferred RNA-inducible endonuclease is a class 2 CRISPR / Cas endonuclease. In some examples, the preferred RNA-inducible endonuclease is a class 2 type II CRISPR / Cas endonuclease (e.g., Cas9 protein). In some examples, the genome-targeting composition includes a class 2 type V CRISPR / Cas endonuclease (e.g., Cpf1 protein, C2c1 protein, or C2c3 protein). In some cases, a suitable RNA-induced endonuclease is a class 2 type VI CRISPR / Cas endonuclease (e.g., the C2c2 protein; also known as the "Cas13a" protein). Similarly suitable is the CasX protein. Similarly suitable is the CasY protein.

[0294] In some cases, the genome editing endonuclease is a type II CRISPR / Cas endonuclease. In some cases, the genome editing endonuclease is a Cas9 polypeptide. The Cas9 protein is guided (e.g., stabilized at the target site) within a target nucleic acid sequence (e.g., chromosomal or extrachromosomal sequence, e.g., episome sequence, minicircle sequence, mitochondrial sequence, chloroplast sequence, etc.) by association with the protein-binding segment of the Cas9 guide RNA. In some cases, the Cas9 polypeptide used in the compositions or methods of this disclosure is the Cas9 (saCas9) polypeptide from Staphylococcus aureus. In some cases, a preferred Cas9 polypeptide is a high-fidelity (HF) Cas9 polypeptide. See, for example, Kleinstiver et al. (2016) Nature 529:490. In some cases, a preferred Cas9 polypeptide exhibits modified PAM specificity. See, for example, Kleinstiver et al. (2015) Nature 523:481. In some cases, the genome editing endonuclease is a type V CRISPR / Cas endonuclease. In some cases, the type V CRISPR / Cas endonuclease is the Cpf1 protein. In some cases, the genome editing endonuclease is a CasX or CasY polypeptide. CasX and CasY polypeptides are described in Burstein et al. (2017) Nature 542:237.

[0295] In some cases, genome editing nucleases are fusion proteins that are fused to heterologous polypeptides (also called "fusion partners"). In some cases, genome editing nucleases are fused to an amino acid sequence (fusion partner) that results in intracellular localization (e.g., one or more nuclear localization signals (NLS) for targeting the nucleus, two or more NLS, three or more NLS, etc.), i.e., a fusion partner.

[0296] Similarly suitable for use are RNA-induced endonucleases with reduced enzyme activity. Such RNA-induced endonucleases are referred to as “inactive” RNA-induced endonucleases. For example, a Cas9 polypeptide containing certain amino acid substitutions that substantially lacks endonuclease activity but still binds to a target nucleic acid when complexed with a guide RNA is referred to as “inactive” Cas9 or “dCas9.” In some cases, “inactive” Cas9 proteins have a reduced ability to cleave both the complementary and non-complementary strands of a double-stranded target nucleic acid. For example, “nuclease-deficient” Cas9 lacks a functional RuvC domain (i.e., does not cleave the non-complementary strand of a double-stranded target DNA) and a functional HNH domain (i.e., does not cleave the complementary strand of a double-stranded target DNA). Such Cas9 proteins have a reduced ability to cleave target nucleic acids (e.g., single-stranded or double-stranded target nucleic acids) but retain the ability to bind to the target nucleic acid. Cas9 proteins that are unable to cleave target nucleic acids (for example, due to one or more mutations in the catalytic domains of the RuvC and HNH domains) are referred to as "nuclease-deficient Cas9," "inactive Cas9," or simply "dCas9." Other residues may be mutated to achieve the above effect (i.e., to inactivate one of the nuclease moieties).

[0297] In some cases, genome editing endonucleases are RNA-inducible endonucleases (and their corresponding guide RNAs) known as Cas9 synergistic activators (Cas9-SAMs). The RNA-inducible endonuclease (e.g., Cas9) in the Cas9-SAM system is an "inactive" Cas9 fused to a transcriptional activation domain (where preferred transcriptional activation domains include, for example, VP64, p65, MyoD1, HSF1, RTA, and SET7 / 9) or a transcriptional repressor domain (where preferred transcriptional repressor domains include, for example, the KRAB domain, NuE domain, NcoR domain, SID domain, and SID4X domain). The guide RNA in the Cas9-SAM system contains a loop that binds to an adapter protein fused to either an activator domain (e.g., VP64, p65, MyoD1, HSF1, RTA, or SET7 / 9) or a repressor domain (e.g., a KRAB domain, NuE domain, NcoR domain, SID domain, or SID4X domain). For example, in some cases, the guide RNA is a single guide RNA containing an MS2 RNA aptamer inserted into one or two loops of sgRNA, dCas9 is a fusion polypeptide containing dCas9 fused to VP64, and the adapter / functional protein is a fusion polypeptide containing i) MS2, ii) p65, and iii) HSF1. See, for example, U.S. Patent Application Publication 2016 / 0355797.

[0298] Similarly suitable for use are a) inactive RNA-induced endonucleases and b) chimeric polypeptides containing heterogeneous fusion polypeptides. Examples of suitable heterogeneous fusion polypeptides include polypeptides having methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcription termination factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, DNA integration activity, or nucleic acid binding activity.

[0299] A nucleic acid that binds to a class 2 CRISPR / Cas endonuclease (e.g., Cas9 protein; type V or VI CRISPR / Cas protein; Cpf1 protein, etc.) and targets the complex to a specific location within the target nucleic acid is referred to herein as “guide RNA,” “CRISPR / Cas guide nucleic acid,” or “CRISPR / Cas guide RNA.” The guide RNA provides target specificity to the complex (RNP complex) by including a targeting segment containing a guide sequence (also referred herein as a targeting sequence), which is a nucleotide sequence complementary to the sequence of the target nucleic acid.

[0300] In some cases, the guide RNA comprises two distinct nucleic acid molecules: an "activator" and a "targeting factor," and is referred to herein as "dual guide RNA," "double-molecule guide RNA," "two-molecule guide RNA," or "dgRNA." In some cases, the guide RNA is a single molecule (for example, in some class 2 CRISPR / Cas proteins, the corresponding guide RNA is a single molecule, and in some cases, the activator and targeting factor are covalently linked to each other, for example, by intervening nucleotides), and the guide RNA is referred to as "single guide RN," "single-molecule guide RNA," "one-molecule guide RNA," or simply "sgRNA."

[0301] In some cases, the guide RNA is at least partially complementary to the target RNA sequence and can recruit ADAR enzymes for RNA editing of the target RNA sequence.

[0302] If the payload is an RNA-induced endonuclease, or both an RNA-induced endonuclease and a guide RNA, the payload can modify the target nucleic acid. In some examples, for instance, if the target nucleic acid contains a harmful mutation in a deficient allele (e.g., a harmful mutation in a neuronal target nucleic acid), the RNA-induced endonuclease / guide RNA complex may be used, for example, with a donor nucleic acid containing a nucleotide sequence that corrects the harmful mutation (e.g., a donor nucleic acid containing a nucleotide sequence that codes for a functional copy of the protein encoded by the deficient allele) to correct the harmful mutation, for example, by homologous recombination repair (HDR).

[0303] In some cases, the payload consists of an RNA-induced endonuclease and two distinct sgRNAs, where these two distinct sgRNAs result in the deletion of the target nucleic acid via non-homologous end joining (NHEJ).

[0304] In some cases, the payload consists of i) an RNA-induced endonuclease and ii) a single guide RNA. In some cases, the guide RNA is a single-molecule (or "single-guide") guide RNA ("sgRNA"). In some cases, the guide RNA is a dual-molecule (or "dual-guide") guide RNA ("dgRNA").

[0305] In some cases, the payload consists of i) an RNA-induced endonuclease and ii) two distinct sgRNAs, where these two distinct sgRNAs result in the deletion of the target nucleic acid via non-homologous end joining (NHEJ). In some cases, the guide RNA is an sgRNA. In some cases, the guide RNA is a dgRNA.

[0306] In some cases, the payload consists of i) a Cpf1 polypeptide and ii) a guide RNA precursor. In these cases, the precursor may be cleaved by the Cpf1 polypeptide to produce two or more guide RNAs.

[0307] The payload may be sandwiched between ITRs as described herein.

[0308] Pharmaceutical composition This disclosure provides pharmaceutical compositions comprising a polynucleotide or vector system as described herein, or an rAAV virion in which a polynucleotide payload produced from such a vector system (e.g., encoding a therapeutic protein, e.g., an antibody or any fragment or derivative thereof) is encapsulated in a capsid, and a pharmaceutically acceptable carrier, diluent, excipient, or buffer. In some examples, the pharmaceutically acceptable carrier, diluent, excipient, or buffer is suitable for use in humans. Such excipients, carriers, diluents, and buffers include any pharmaceuticals that can be administered without excessive toxicity.

[0309] Examples of pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, physiological saline, glycerol, polyethylene glycol, hyaluronic acid, and ethanol. These may also include pharmaceutically acceptable salts, such as mineral salts (e.g., hydrochloride, hydrobromide, phosphate, sulfate, etc.) and salts of organic acids (e.g., acetate, propionate, malonate, benzoate, etc.). In addition, auxiliary agents, such as wetting agents or emulsifiers and pH buffers, may be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and do not need to be described in detail herein. Pharmaceutically acceptable excipients are described in detail in various publications, including, for example, A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy,” 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HCAnsel et al., eds., 7th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., eds., 3rd ed. Amer. Pharmaceutical Assoc. Certain substances that promote nucleic acid uptake and / or expression may also be included in the composition or administered concurrently.

[0310] Methods for delivering payloads or proteins Once formulated, compositions comprising rAAV virions or proteins (e.g., therapeutic proteins, e.g., antibodies or any fragments or derivatives thereof) can be administered directly to a subject or, alternatively, delivered ex vivo to cells derived from the subject. For example, methods for ex vivo delivery and re-implantation of transformed cells into a subject are known in the art and may include, for example, dextran-mediated transfusion, calcium phosphate precipitation, polybrene-mediated transfusion, lipofectamine and LT-1-mediated transfusion, protoplast fusion, electroporation, encapsulation of polynucleotides into liposomes, and direct microinjection of DNA into the nucleus. In vivo direct delivery of vector systems containing expressible sequences encoding a payload of interest is generally achieved by injection using either conventional syringes, needle-free devices such as Bioject, or gene guns such as the Accell gene delivery system (PowderMed Ltd, Oxford, England).

[0311] In certain embodiments, rAAV or compositions comprising rAAV of the present disclosure may be administered to subjects requiring it by any suitable route, such as intravenous, intramuscular, intracranial, intraventricular, subarachnoid, intracisional, or brain surgery.

[0312] In some embodiments, an rAAV virion containing an expressible sequence encoding a payload of interest is used in gene therapy applications to treat a disease. The payload may be, for example, a polypeptide, a protein, or RNA. The polypeptide or protein may be, for example, an enzyme, antibody, hormone, aptamer, or endonuclease (e.g., site-specific endonuclease, e.g., RNA-induced endonuclease), a component of the CRISPR / Cas system, an RNA adenosine deaminase (ADAR) enzyme, a transcription activator, a transcription repressor, or any combination thereof. The payload may be progranulin. The RNA may be, for example, a guide RNA, tRNA, suppressor tRNA, siRNA, miRNA, mRNA, shRNA, circular RNA, antisense oligonucleotide (ASO), ribozyme, DNA enzyme, aptamer, or any combination thereof. In some embodiments, an rAAV virion used in gene therapy applications to treat a disease contains one or more expressible sequences encoding one or more payloads of interest. For example, an rAAV virion contains two expressible sequences, where the first expressible sequence encodes a first gRNA and the second expressible sequence encodes a second gRNA. In some embodiments, the first and second gRNAs are different. In some embodiments, the first and second gRNAs are the same.

[0313] In some embodiments, proteins (e.g., therapeutic proteins, e.g., antibodies or any fragment or derivative thereof) are used in gene therapy applications to treat diseases. Proteins may be, for example, polypeptides. Polypeptides or proteins may be, for example, enzymes, antibodies, hormones, aptamers, or endonucleases (e.g., site-directed endonucleases, e.g., RNA-induced endonucleases), components of the CRISPR / Cas system, RNA adenosine deaminase (ADAR) enzymes, transcription activators, transcription repressors, or any combination thereof.

[0314] rAAV virions or proteins (e.g., therapeutic proteins) can be formulated into compositions for delivery to vertebrate subjects (e.g., mammalian subjects, preferably humans). These compositions may be either prophylactic (to prevent a disease or condition) or therapeutic (to treat a disease or condition). A composition contains a "therapeutically effective dose" of rAAV virions such that a sufficient amount of the payload of interest to exhibit a therapeutic effect in the individual to which it is administered can be produced in vivo. A composition also contains a "therapeutically effective dose" of proteins (e.g., therapeutic proteins) such that the amount exhibits a therapeutic effect in the individual to which it is administered. The exact amount required varies depending on the subject being treated, the age and general condition of the subject being treated, the desired degree of protection, the severity of the condition being treated, the specific therapeutic agent to be produced, and the mode of administration, among other factors. A suitable effective dose can be readily determined by those skilled in the art. Thus, the "therapeutically effective dose" is within a relatively broad range that can be determined by standard tests.

[0315] The "therapeutic effective dose" of a virion containing an expressible sequence encoding the payload of interest is within a relatively wide range that can be determined by experiment and / or clinical trials. For example, in in vivo injection, the therapeutic effective dose of rAAV virion is approximately 10 6 ~about 10 15 A few billion rAAVs, for example, about 10 8 ~10 12 This is rAAV virion. In in vitro transduction, the effective amount of rAAV virion delivered to cells is approximately 10 8 ~about 10 13 This is approximately rAAV virions. Other effective doses can be readily determined by those skilled in the art through standardized tests to establish dose-response curves.

[0316] In some cases, more than two doses (e.g., two, three, four or more doses) may be used to achieve the desired gene expression level. In some cases, more than two doses may be administered at various intervals, such as daily, weekly, twice a month, once a month, every three months, every six months, or once a year. In some cases, multiple doses may be administered over periods of one to two months, two to four months, four to eight months, eight to twelve months, one to two years, two to five years, or more than five years.

[0317] Method for filtering filled and unfilled capsids Some embodiments involve filtering or selecting packed capsids. Some embodiments utilize chromatographic methods to separate packed rAAV capsids (i.e., capsids containing payloads) from unpacked capsids. The chromatographic methods may include one or more of high-performance liquid chromatography, density separation, and ion (including anions and / or cations) exchange chromatography. A preferred method in some embodiments is anion exchange chromatography (AEX), which can separate molecules based on their net negative charge. The principle of this method lies in the interaction between negatively charged molecules (anions) and positively charged functional groups of the stationary phase of the chromatography column.

[0318] Due to the negative charge of the phosphate group on the nucleic acid backbone, packed rAAV capsids can be retained in the AEX column longer than unpacked capsids. In some embodiments, traces or chromatograms are monitored (manually and / or automatically) to determine when to collect and / or discard the eluate.

[0319] kit Kits are also provided that include polynucleotides, vector systems, rAAV virions, or cell lines for inducibly producing rAAV virions as described herein. In some embodiments, the AAV vector system is provided together with or separately from cells (e.g., already transfected with one or more of the AAV polynucleotide constructs of the vector system). Other agents, such as transfection agents, suitable cell culture media, buffers, antibiotics, and agents for inducing rAAV virion production, expression of expressible sequences encoding payloads of interest, and / or sequences encoding inducible Rep / Cap (e.g., tetracycline, doxycycline, tamoxifen), may also be included in the kit.

[0320] In addition to the components described above, the subject kit may further include instructions for carrying out the subject method (in certain embodiments). In some embodiments, the kit provides instructions for inducibly producing recombinant AAV (rAAV) virions containing an expressible sequence of interest using a vector system or cell line. These instructions may be present in the subject kit in various forms, and one or more of these forms may be present in the kit. One possible form of these instructions is as information printed on a suitable medium or substrate, e.g., as paper or multiple sheets of paper on which the information is printed, such as the kit packaging or accompanying documents. Yet another form of these instructions is as computer-readable media on which the information is recorded, e.g., diskettes, compact discs (CDs), DVDs, flash drives, SD drives, etc. Yet another possible form of these instructions is as a website address that can be used via the Internet to access the information remotely.

[0321] cell preservation Various embodiments relate to cells, cell lines, and / or other cell collectibles as described herein, including cells, cell lines, and / or other cell collectibles that are maintained and / or preserved, for example, cells, cell lines, and / or other cell collectibles that contain one or more polynucleotides, plasmids, and / or other constructs as described herein (but not limited to). Such processes may include, for example, “cell banking” for long-term storage and / or storage using a freezer. In such examples, appropriate media may be used to maintain the integrity and viability of the cells, cell lines, and / or other cell collectibles during storage. In various examples, the cells, cell lines, and / or other cell collectibles are not induced (for example, by adding one or more inducers). In many examples, the cells are grown to a specific concentration (e.g., cells / mL). Such concentrations may be minimum, maximum, and / or a range of concentrations. To prepare cells for banking, the cells may be collected, for example, by centrifugation. The collected cells may then be resuspended in an appropriate buffer. Such buffers may contain one or more components that prevent freezing, ice crystal formation, and / or reduce ice crystal size. Such properties can prevent damage to cells, cell lines, and / or other cell collections. The cells, cell lines, and / or other cell collections may then be placed in a storage facility such as a freezer (e.g., -20°C, -80°C, dry ice, liquid nitrogen, etc.).

[0322] How to collect rAAV Also provided are methods for collecting rAAV after cells, cell lines, and / or other cell collections as described herein, which include cells, cell lines, and / or other cell collections containing (but not limited to) one or more polynucleotides, plasmids, and / or other constructs as described herein, after a certain period of time. In some examples, cellular structures (e.g., plasma membranes) remain intact and thus sequester the produced rAAV.

[0323] To release the isolated produced rAAV, various embodiments lyse or otherwise destroy the cells, cell lines, and / or other cell collections. Lysis can be achieved by a variety of known methods, including heat shock, electroporation, surfactant-based lysis, protein disruption, sonication, and / or any other method capable of lysing cells, cell lines, and / or other cell collections. In preferred embodiments, a lysis method is used that has little to no effect on the produced rAAV.

[0324] Once the cells are lysed or destroyed, the produced rAAV can be collected. Such collection may utilize one or more of the following methods: filtration, centrifugation, and chromatography (e.g., size exclusion, affinity). In various examples, larger fragments or other components with a higher sedimentation rate than rAAV can be collected and removed by centrifugation, while the remaining suspension is subjected to one or more filters to further remove fragments. For example, filtration may utilize one or more filters with pore sizes of approximately 1.00 μm, 0.95 μm, 0.90 μm, 0.85 μm, 0.80 μm, 0.75 μm, 0.70 μm, 0.65 μm, 0.60 μm, 0.55 μm, 0.50 μm, 0.45 μm, 0.40 μm, 0.35 μm, 0.30 μm, 0.25 μm, 0.20 μm, 0.15 μm, 0.10 μm, or 0.05 μm. In certain cases, a filter with a larger pore size (e.g., about 0.50 μm (or 0.50 μm ± 0.10 μm)) may be used followed by a filter with a smaller pore size (e.g., about 0.25 μm (or 0.25 μm ± 0.10 μm)).

[0325] In various examples, filtration may be performed at a specific pressure or based on differential pressure. Such pressures may be approximately 0 psi, 5 psi, 10 psi, 15 psi, 20 psi, 25 psi, 30 psi, 35 psi, 40 psi, 45 psi, 50 psi, or higher.

[0326] In certain cases, affinity chromatography is used to further purify the collected rAAV. Such chromatography may use a resin (or matrix) that allows for the reversible binding of the collected rAAV. Certain resins can bind to all AAV serotypes, while some resins may be serotype and / or epitope specific. Once the sample containing the collected rAAV has moved through the affinity column, an elution buffer may be used to release the captured rAAV, thereby further removing any remaining material (e.g., by centrifugation and / or filtration). The resin may contain particles of any suitable size. Certain commercially available types contain particles with an average size of about 50 μm. Other resins may contain particles of other average sizes, e.g., approximately 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, 55 μm, 60 μm, 65 μm, 70 μm, 75 μm, 80 μm, 85 μm, 90 μm, 95 μm, 100 μm, or larger. The retention and elution amounts of captured rAAV are functions of the resin's binding capacity and the amount of resin used. The specific volume of sample added to the affinity column may vary based on the expected or estimated production volume. For example, the binding capacity may be approximately 100 particles / mL resin, 250 particles / mL resin, 500 particles / mL resin, 750 particles / mL resin, 1000 particles / mL resin, 1250 particles / mL resin, 1500 particles / mL resin, 1750 particles / mL resin, 2000 particles / mL resin, 2500 particles / mL resin, 5000 particles / mL resin, 7500 particles / mL resin, 10000 particles / mL resin, or more.

[0327] Method for quantifying rAAV production Methods for quantifying rAAV production are also provided. Such production may be measured based on rAAV collected from cells, cell lines, and / or other cell collectibles as described herein, including (but not limited to) cells, cell lines, and / or other cell collectibles containing one or more polynucleotides, plasmids, and / or other constructs as described herein. In various examples, rAAV may be measured based on viral protein (vp), titer level of viral genome (vg), fill rate (e.g., percentage of capsidized viral genome), and / or any other quantifiable metric.

[0328] Various embodiments utilize fluorescence and / or colorimetric detection, chromatography, and / or other methods for quantifying the target protein to quantify vp production. Examples include liquid chromatography (including HPLC), SDS-PAGE, quantitative TOF, protein blotting (e.g., Western blotting), and / or any other applicable chromatographic method. Several embodiments utilize fluorescence and / or colorimetric detection. Such methods may include antibody-based detection methods. In certain examples, ELISA is used as the detection method. In various examples, ELISA utilizes an antibody specific to one AAV serotype (e.g., AAV5, AAV7, etc.), and / or in certain examples, ELISA may utilize an AAV-ambivalent (e.g., capable of binding to multiple AAV serotypes) antibody. In some embodiments, one of the aforementioned antibodies may produce a measurable signal and / or reaction. Additional embodiments utilize one or more secondary antibodies to increase the signal and / or produce a measurable reaction. In certain embodiments, reaction plates or containers may be coated with serotype-specific antibodies, while serotype-ambivalent antibodies are used for detection. In other embodiments, plates may be coated with serotype-ambivalent antibodies, while serotype-specific antibodies are used for detection. To prevent overestimation, some antibodies are specific to epitopes present only in fully formed capsids (e.g., they do not bind to unstable or free capsid proteins). Secondary antibodies may be used to conjugate to detection antibodies for the reasons mentioned above. In certain situations, detection may take the form of fluorescence, while in certain embodiments, catalytic reactions using enzymes conjugated to one of the aforementioned antibodies may be utilized.

[0329] Various examples utilize quantitative methods for measuring vg. Such methods may include electrophoresis (gel, column, capillary, etc.), sequencing, amplification, and / or any other applicable method for quantifying specific nucleic acids. Amplification-based methods may include PCR and / or isothermal amplification. In various examples, quantitative PCR and / or real-time PCR, droplet PCR, droplet digital PCR (ddPCR), and / or other PCR-based amplification methods are used. Certain examples use probe-based methods, e.g., TaqMan assays, while others use dye-based methods (e.g., SYBR Green, SYBR Gold, ethidium bromide, etc.). In certain embodiments, non-capsidized nucleic acids are removed from the sample before any quantitative analysis to avoid overestimation of vg titer levels. Such removal may include any applicable method for removing nucleic acids, including hydrolysis with nucleases. In certain embodiments, the capsids are dissolved or ruptured to release the capsidized nucleic acids for quantitative determination.

[0330] Certain embodiments determine the packing density based on the ratio of vg and vp as described above. Various embodiments use chromatography-based methods to determine the packing density. Certain embodiments use anion exchange chromatography (e.g., AEX-HPLC) to separate and quantify packed capsids from empty capsids. Due to the negative charge of nucleic acids, packed capsids (containing nucleic acids) have a slightly negative charge compared to unpacked (or empty) capsids (not containing nucleic acids). This charge difference results in packed capsids having a lower isoelectric point (pI) than unpacked capsids. pI is a measure of pH at which molecules have no charge. The lower pI of packed capsids can be utilized to allow packed capsids to be retained in anion exchange columns for longer periods, thereby enabling empty capsid vs. packed capsid measurement. The lower pI of the packed capsid can also be used to concentrate the packed capsid of the sample, resulting in the discarding of the unpacked capsid while the packed capsid is eluted into a separate container.

[0331] Various anion exchange resins are known in the art, differing in specificity, strength, and particle size. Generally, anion exchange resins contain polymer beads having positively charged functional groups. In various examples, specific resins may be selected for flow rate, particle size, functional groups, and / or other properties. In various examples, particle sizes can be between approximately 5 μm and 100 μm or larger, including approximately 5 μm, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, 55 μm, 60 μm, 65 μm, 70 μm, 75 μm, 80 μm, 85 μm, 90 μm, 95 μm, 100 μm, or larger. Depending on the column characteristics, the column may be loaded to the amount present, for example, a specific number of capsids may be added to the column regardless of the total volume. In a particular example, the total load on the column is approximately 1 × 10⁻⁶ 10 Capsid, 1.5 × 10 10 Capsid, 2 x 10 10 Capsid, 2.5 × 10 10 Capsid, 3 x 10 10 Capsid, 3.5 × 10 10 Capsid, 4 x 10 10 Capsid, 4.5 × 10 10 Capsid, 5 x 10 10 Capsid, 7.5 × 10 10 Capsid, 1 x 10 11 Capsid, 1.5 × 10 11 Capsid, 2 x 10 11 Capsid, 2.5 × 10 11 Capsid, 3 x 10 11 Capsid, 3.5 × 10 11 Capsid, 4 x 10 11 Capsid, 4.5 × 10 11 Capsid, 5 x 10 11 Capsid, 7.5 × 10 11 Capsid, 1 x 10 12 Capsid, 1.5 × 10 12 Capsid, 2 x 10 12 Capsid, 2.5 × 10 12 Capsid, 3 x 10 12 Capsid, 3.5 × 10 12 Capsid, 4 x 1012 Capsid, 4.5 × 10 12 Capsid, 5 x 10 12 Capsid, 7.5 × 10 12 It is a capsid, or something more.

[0332] Embodiments of the present invention The following sections disclose various aspects of the present invention. Each of the aspects described below may be combined with other aspects and embodiments disclosed elsewhere in this specification, including the claims, where the combinations are obviously adaptable. Some specific aspects include: Embodiment 1. A first promoter operably coupled to a large Rep code sequence, The aforementioned large Rep code array, An intron containing a second promoter operably linked to a small Rep code sequence, The aforementioned small Rep code array includes, The second promoter is heterogeneous for the small Rep code sequence, A polynucleotide comprising a first promoter, wherein the second promoter has higher promoter activity compared to the first promoter.

[0333] Embodiment 2. The polynucleotide according to Embodiment 1, wherein the first promoter is heterogeneous for the large Rep coding sequence.

[0334] Embodiment 3. The polynucleotide according to Embodiment 1 or 2, wherein the large Rep coding sequence includes a p19 promoter operably linked to the small Rep coding sequence, and the intron including the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Rep coding sequence.

[0335] Embodiment 4. The polynucleotide according to Embodiment 3, wherein the p19 promoter is mutated to substantially reduce promoter activity.

[0336] Embodiment 5. The polynucleotide according to Embodiment 4, wherein the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the natural p19 promoter activity, or is undetectable.

[0337] Embodiment 6. A polynucleotide according to any one of Embodiments 1 to 5, wherein the vector lacks a functional p5 promoter.

[0338] Embodiment 7. The polynucleotide according to Embodiment 6, wherein the first promoter is replaced with the p5 promoter.

[0339] Embodiment 8. The polynucleotide according to any one of Embodiments 1 to 7, wherein the first promoter and / or the second promoter is a constitutive promoter.

[0340] Embodiment 9. The polynucleotide according to any one of Embodiments 1 to 7, wherein the first promoter and / or the second promoter is an inducible promoter.

[0341] Embodiment 10. The polynucleotide according to any one of Embodiments 1 to 9, wherein (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Roussarcoma virus terminal repeat (RSV) promoter, (ii) the first promoter is a chicken β-actin promoter and the second promoter is a cytomegalovirus (CMV) promoter, (iii) the first promoter is a CMV enhancer / chicken β-actin (CAG) promoter and the second promoter is an RSV promoter, or (iv) the first promoter is a chicken β-actin promoter and the second promoter is an RSV promoter.

[0342] Embodiment 11. The polynucleotide according to any one of Embodiments 1 to 10, further comprising a polyadenylation (poly-A) signal sequence downstream of the Rep coding sequence, wherein the poly-A signal sequence is stronger than the natural AAV Rep poly-A signal sequence.

[0343] Embodiment 12. The polynucleotide according to Embodiment 11, wherein the polyA signal sequence is selected from bovine growth hormone (bGH) polyA signal sequence, human growth hormone (hGH) polyA signal sequence, Simian virus 40 (SV40) polyA signal sequence, Chinese hamster growth hormone polyA signal sequence, human neuropilin-1 polyA signal sequence, nopalin synthase polyA signal sequence, α-globulin polyA signal sequence, and rabbit globin polyA signal sequence.

[0344] Embodiment 13. The polynucleotide according to Embodiment 11 or 12, wherein the polyadenylation signal sequence comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO: 2.

[0345] Embodiment 14. The polynucleotide according to any one of Embodiments 11 to 13, wherein the polyadenylation signal sequence includes the nucleotide sequence of SEQ ID NO: 2.

[0346] Embodiment 15. The polynucleotide according to any one of Embodiments 11 to 14, further comprising an enhancer downstream of the poly(A) signal sequence.

[0347] Embodiment 16. The polynucleotide according to Embodiment 15, wherein the enhancer is selected from a transcription enhancer, a translation enhancer, and a transcription and translation enhancer.

[0348] Embodiment 17. The polynucleotide according to Embodiment 15 or 16, wherein the enhancer comprises one or more sequences selected from SEQ ID NOs: 11-116 and 165-168.

[0349] Embodiment 18. The polynucleotide according to any one of Embodiments 15 to 17, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

[0350] Embodiment 19. The polynucleotide according to any one of Embodiments 15 to 18, wherein the enhancer is a double enhancer.

[0351] Embodiment 20. The polynucleotide according to Embodiment 19, wherein the double enhancer comprises one of the following: telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or CMV enhancer (SEQ ID NO: 165).

[0352] Embodiment 21. The polynucleotide according to Embodiment 19 or 20, wherein the double enhancer comprises two of the following: telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or CMV enhancer (SEQ ID NO: 165).

[0353] Embodiment 22. The polynucleotide according to any one of Embodiments 19 to 21, wherein the double enhancer comprises a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166) and a CMV enhancer (SEQ ID NO: 165).

[0354] Embodiment 23. The polynucleotide according to any one of Embodiments 19 to 22, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 168.

[0355] Embodiment 24. The polynucleotide according to any one of Embodiments 19 to 23, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO: 168.

[0356] Embodiment 25. The polynucleotide according to any one of Embodiments 15 to 18, wherein the enhancer is a triple enhancer.

[0357] Embodiment 26. The polynucleotide according to Embodiment 25, wherein the triple enhancer comprises telomerase reverse transcriptase (hTERT) (SEQ ID NO: 167), Simian virus 40 (SV40) (SEQ ID NO: 166), or CMV enhancer (SEQ ID NO: 165).

[0358] Embodiment 27. The polynucleotide according to Embodiment 25 or 26, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 10.

[0359] Embodiment 28. The polynucleotide according to any one of Embodiments 25 to 27, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO: 10.

[0360] Embodiment 29. The polynucleotide according to any one of Embodiments 1 to 28, wherein the intron is a synthetic intron comprising a 5' splice donor site, the second promoter sequence, and a 3' splice acceptor site, and the splice donor and acceptor sites are compatible with cells used to express a large Rep protein.

[0361] Embodiment 30. The polynucleotide according to any one of Embodiments 1 to 29, wherein the small Rep code sequence includes a cleavable element comprising a first recombination site and a second recombination site adjacent to a sequence containing a stop codon, the first recombination site and the second recombination site are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the cleavage of the sequence containing the stop codon.

[0362] Embodiment 31. The polynucleotide according to any one of Embodiments 1 to 30, further comprising the large Rep coding sequence and the small Rep coding sequence and a sequence encoding a tag in frame, wherein each of the large Rep protein and the small Rep protein is expressed as a fusion protein containing the tag.

[0363] Embodiment 32. The polynucleotide according to Embodiment 31, wherein the tag is a purified tag and / or a detectable tag.

[0364] Embodiment 33. The polynucleotide according to any one of embodiments 1 to 32, wherein the vector is designed to result in the expression of a large Rep protein and / or large Rep transcript at a lower level than the expression level of a large Rep protein and / or large Rep transcript from a vector that does not have the first promoter and / or has the p5 promoter.

[0365] Embodiment 34. The polynucleotide according to any one of Embodiments 1 to 32, wherein the vector is designed to result in a higher level of expression of the small Rep protein and / or small Rep transcript than the expression of the small Rep protein and / or small Rep transcript from a vector that does not have the second promoter and / or has the p19 promoter.

[0366] Embodiment 35. The polynucleotide according to any one of Embodiments 1 to 34, wherein the vector is designed to result in the expression of a large Rep protein and / or large Rep transcript at a level lower than the expression level of a small Rep protein and / or small Rep transcript.

[0367] Embodiment 36. A polynucleotide according to any one of Embodiments 1 to 35, wherein the ratio of the expression level of small Rep protein and / or small Rep transcript to the expression level of large Rep protein and / or large Rep transcript is in the range of 1.5:1 to 10,000:1, including 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 100:1, 1000:1, or 5000:1;5.

[0368] Embodiment 37. A polynucleotide according to any one of Embodiments 1 to 36, further comprising an AAV Cap coding sequence.

[0369] Embodiment 38. The polynucleotide according to any one of Embodiments 1 to 37, further comprising a sequence encoding a first selection marker operably linked to a constitutive promoter.

[0370] Embodiment 39. The polynucleotide according to Embodiment 38, wherein the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further comprises an inducible or constitutive promoter operably ligated to the Cap coding sequence.

[0371] Embodiment 40. The polynucleotide according to Embodiment 39, wherein the polynucleotide comprises an inductive promoter operably linked to the Cap coding sequence, and optionally the inductive promoter comprises a tetracycline-responsive promoter element (TRE).

[0372] Embodiment 41. The polynucleotide according to Embodiment 39 or 40, wherein the intervening sequence includes a transcriptional blocking element (TBE).

[0373] Embodiment 42. The polynucleotide according to Embodiment 38, wherein the AAV Cap coding sequence is operably linked to a natural promoter.

[0374] Embodiment 43. The polynucleotide according to Embodiment 42, wherein the natural promoter is a p40 promoter located within the small Rep coding sequence.

[0375] Embodiment 44. The polynucleotide according to Embodiment 38, wherein the AAV Cap coding sequence is operably linked to a heterologous promoter.

[0376] Embodiment 45. The polynucleotide according to Embodiment 44, wherein the heterogeneous promoter is an inducible promoter.

[0377] Appearance 46. A vector comprising a polynucleotide as described in any one of Appearances 1 to 41.

[0378] Embodiment 47. A vector comprising a polynucleotide as described in any one of Embodiments 1 to 37 and 42 to 45.

[0379] Appearance 48. A vector according to Appearance 46, wherein the vector is the first vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide payload flanked by AAV terminal inverted repeat sequences (ITRs), A vector system for producing recombinant adenovirus-associated viruses (rAAV), including [specific component].

[0380] Appearance 49. A vector according to Appearance 47, wherein the vector is the first vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide encoding a payload flanked by AAV terminal inverted repeat sequences (ITRs), A vector system for producing recombinant adenovirus-associated viruses (rAAV), including [specific component].

[0381] Appearance 50. A vector according to Appearance 47, wherein the first vector is the vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide encoding a payload flanked by AAV terminal inverted repeat sequences (ITRs), A fourth vector containing the AAV Cap code sequence, A vector system for producing recombinant adenovirus-associated viruses (rAAV), including [specific component].

[0382] Embodiment 51. A vector system according to any one of embodiments 48 to 50 for inducibly producing rAAV, wherein the second vector comprises: an inducible promoter operably ligated to a sequence encoding an inducible recombinase; an autoexcision element including a third recombination site and a fourth recombination site adjacent to the sequence encoding the inducible recombinase, wherein the third and fourth recombination sites are oriented in the same direction, and the autoexcision element separates the inducible promoter from the sequence encoding the one or more AAV helper proteins, so that the inducible promoter is not operably ligated to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably ligated to a sequence encoding an activator, wherein the activator cannot activate the inducible promoter in the absence of a first inducer; and a constitutive promoter operably ligated to a sequence encoding a second choice marker.

[0383] Embodiment 52. The vector system according to any one of embodiments 48 to 51, wherein the first vector comprises an array encoding a first portion of the first selection marker and a constitutive promoter operably coupled to the array encoding the first portion of the first selection marker, and the third vector comprises an array encoding a second portion of the first selection marker and a constitutive promoter operably coupled to the array encoding the second portion of the first selection marker, and the first and second portions combine to form a functional first selection marker.

[0384] Embodiment 53. The vector system according to any one of Embodiments 51 to 52, wherein the sequence encoding one or more AAV helper proteins includes a bisistronic open reading frame encoding at least two AAV helper proteins.

[0385] Embodiment 54. The vector system according to any one of Embodiments 51 to 53, wherein the helper proteins include E2a and E4.

[0386] Embodiment 55. The vector system according to any one of embodiments 51 to 54, wherein the inducible promoter in the second vector comprises a tetracycline-responsive promoter element (TRE) operably linked to a sequence encoding the inducible recombinase, and the activator is Tet-on 3G.

[0387] Embodiment 56. The vector system according to any one of embodiments 51 to 55, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus of a cell containing the second vector in the presence of the second inducer.

[0388] Embodiment 57. The vector system according to Embodiment 56, wherein the first inducer is doxycycline and the second inducer is tamoxifen.

[0389] Embodiment 58. The vector system according to any one of Embodiments 48 to 57, wherein the payload is progranulin.

[0390] Embodiment 59. The vector system according to any one of Embodiments 48 to 58, wherein the second vector further comprises a VA-RNA coding sequence.

[0391] Embodiment 60. The second vector is A second excisable element comprising a fifth and a sixth recombination site adjacent to a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and a first portion of a constitutive promoter and a second portion of a constitutive promoter separated by the excisable element, The VA-RNA coding sequence wherein the excision of the second excisable element by the inducible recombinase generates a functional fifth complete constitutive promoter operably linked to the VA-RNA coding sequence, thereby enabling the expression of the VA-RNA, The vector system according to embodiment 59, further comprising an inserted fragment containing the

[0392] Embodiment 61. The vector system according to Embodiment 60, wherein the first portion of the constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter.

[0393] Embodiment 62. The vector system according to Embodiments 59-61, wherein the sequence encoding VA-RNA is a transcriptionally inactive sequence.

[0394] Embodiment 63. The vector system according to any one of Embodiments 59 to 62, wherein the sequence encoding the VA-RNA includes at least two mutations in the internal promoter.

[0395] Applicable aspect 64. A cell containing a polynucleotide according to any one of Applicable aspects 1 to 45 or a vector according to Applicable aspect 46 or 47.

[0396] Embodiment 65. The cell according to Embodiment 64, wherein the polynucleotide or the vector is incorporated into the genome of the cell.

[0397] Appearance 66. A cell comprising the first vector and the second vector as described in any one of Appearances 48 to 50.

[0398] Embodiment 67. The cell according to Embodiment 66, wherein the first vector and the second vector are incorporated into the genome of the cell.

[0399] Appearance 68. A cell comprising the vector system described in any one of Appearances 48 to 51.

[0400] Embodiment 69. The cell according to any one of Embodiments 64 to 68, wherein the cell is a mammalian cell, optionally the mammalian cell is a HEK293 cell, and optionally the HEK293 cell expresses AAV helper proteins E1A and E1B.

[0401] Embodiment 70. The cell according to Embodiment 68 or 69, wherein the vector system is incorporated into the genome of the cell.

[0402] Embodiment 71. A method for producing recombinant AAV, comprising performing cell translocation using a vector system described in any one of Embodiments 48 to 51.

[0403] Embodiment 72. A method for inducibly producing recombinant AAV (rAAV), comprising contacting cells described in any one of Embodiments 68 to 70 with a first inducer and a second inducer, thereby inducing the production of rAAV.

[0404] Embodiment 73. The method according to Embodiment 71 or 72, wherein the cells contain the first vector having a native p19 promoter instead of the second promoter, and express higher levels of small Rep protein compared to cells containing the second and third vectors.

[0405] Embodiment 74. The method according to any one of embodiments 71 to 73, wherein the cells contain the first vector having a native p5 promoter instead of the first promoter, and express lower levels of large Rep compared to cells containing the second and third vectors.

[0406] Embodiment 75. The method according to any one of Embodiments 71 to 74, wherein the cells express a lower level of large Rep protein compared to small Rep protein.

[0407] Embodiment 76. The method according to any one of embodiments 71 to 75, wherein the cells comprise the first vector having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter, and produce higher levels of rAAV compared to cells comprising the second and third vectors.

[0408] Embodiment 77. A method for producing cells that inducibly produce recombinant AAV (rAAV) containing a payload, (i) Introducing a first vector into a cell, wherein the first vector An inductive promoter operably linked to a sequence encoding an inductive recombinase; an autoexcision element comprising a first recombination site and a second recombination site adjacent to the sequence encoding the inductive recombinase, wherein the first and second recombination sites are oriented in the same direction, and the autoexcision element separates the inductive promoter from a sequence encoding one or more AAV helper proteins, such that the inductive promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator, and the activator cannot activate the inductive promoter in the absence of the first inducer; and a second constitutive promoter operably linked to a sequence encoding a first selection marker, wherein the cell constitutively expresses the first selection marker; (ii) Selecting cells that express the first selection marker, (iii) Introducing the second vector and the third vector into the cells expressing the first selection marker, The second vector described above is A first promoter operably coupled to a large Repcode sequence, wherein the large Repcode sequence includes (i) an intron containing a second promoter, and (ii) a small Repcode sequence, and the second promoter is operably coupled to the small Repcode sequence. The second promoter is heterogeneous for the small Rep code sequence, The second promoter has higher promoter activity compared to the first promoter. The small Rep code sequence includes a resectable element comprising a third recombination site and a fourth recombination site adjacent to a sequence containing a stop codon, wherein the third and fourth recombination sites are oriented in the same direction, and recombination between the third and fourth recombination sites by an inducible recombinase results in the resection of the sequence containing the stop codon, the first promoter, AAV capsid protein coding sequence and A third constitutive promoter operably coupled to an sequence encoding a first portion of a second selection marker, The third vector comprises a fourth constitutive promoter operably ligated to a polynucleotide payload sequence and a sequence encoding a second portion of the second selection marker, wherein the polynucleotide payload sequence is flanked by AAV terminal inverted repeats (ITRs), and the introduction is as follows: (iv) Select cells expressing the first selection marker and the second selection marker, thereby creating cells that inducibly produce recombinant AAV (rAAV) virions containing the payload, The method, including the method described above.

[0409] Embodiment 78. The method according to Embodiment 77, further comprising growing cells expressing the first and second selection markers.

[0410] Embodiment 79. The method according to Embodiment 77 or 78, wherein the first and second selection markers are antibiotic resistance proteins.

[0411] Embodiment 80. The method according to Embodiment 79, wherein the second selection marker is a segmented blast cydin.

[0412] Embodiment 81. The method according to any one of Embodiments 77 to 80, wherein the first promoter in the second vector is heterogeneous for the large Rep coding sequence.

[0413] Embodiment 82. The method according to any one of Embodiments 77 to 81, wherein the large Rep code sequence includes a p19 promoter operably coupled to the small Rep code sequence, and the intron including the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Rep code sequence.

[0414] Embodiment 83. The method according to Embodiment 82, wherein the p19 promoter is mutated to substantially reduce promoter activity.

[0415] Embodiment 84. The method according to Embodiment 83, wherein the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% compared to the natural p19 promoter activity, or is undetectable.

[0416] Embodiment 85. The method according to any one of Embodiments 77 to 84, wherein the second vector lacks a functional p5 promoter.

[0417] Embodiment 86. The method according to Embodiment 85, wherein the first promoter is replaced with a p5 promoter.

[0418] Embodiment 87. The method according to any one of Embodiments 77 to 86, wherein the first promoter and / or second promoter in the second vector is a constitutive promoter or an inducible promoter.

[0419] Embodiment 88. The method according to any one of Embodiments 77 to 87, wherein the second vector is (i) a ubiquitin C (UBC) promoter and a Rous sarcoma virus terminal repeat (RSV) promoter, (ii) a chicken β-actin promoter and a cytomegalovirus (CMV) promoter, (iii) a CMV enhancer / chicken β-actin (CAG) promoter and an RSV promoter, or (iv) a chicken β-actin promoter and an RSV promoter.

[0420] Embodiment 89. The method according to any one of Embodiments 77 to 88, wherein the intron is a synthetic intron comprising a 5' splice donor site compatible with cells used to express a large Rep protein, the second promoter sequence, and a 3' splice acceptor site.

[0421] Embodiment 90. The method according to any one of Embodiments 77 to 89, wherein the small Rep code sequence includes a resectable element comprising a first recombination site and a second recombination site adjacent to a sequence containing a stop codon, the first recombination site and the second recombination site are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the resection of the sequence containing the stop codon.

[0422] Embodiment 91. The method according to any one of Embodiments 77 to 90, wherein the second vector comprises the large Rep coding sequence and the small Rep coding sequence and a sequence encoding a tag in frame, and each of the large Rep protein and the small Rep protein is expressed as a fusion protein containing the tag.

[0423] Embodiment 92. The method according to Embodiment 91, wherein the tag is a refined tag and / or a detectable tag.

[0424] Embodiment 93. The method according to any one of Embodiments 77 to 92, wherein the AAV capsid protein coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.

[0425] Embodiment 94. The method according to Embodiment 93, wherein the second vector comprises an inducible promoter operably ligated to the AAV capsid protein coding sequence.

[0426] Embodiment 95. The method according to Embodiment 93 or 94, wherein the intervening sequence includes a transcriptional blocking element (TBE).

[0427] Embodiment 96. The method according to Embodiment 94 or 95, wherein the inductive promoter operably linked to the sequence encoding the inductive recombinase and the inductive promoter operably linked to the AAV capsid protein coding sequence are the same promoter.

[0428] Embodiment 97. The method according to Embodiment 96, wherein the promoter comprises a tetracycline-responsive promoter element (TRE).

[0429] Embodiment 98. The method according to Embodiment 97, wherein the activator that binds to the TRE in the presence of the first inducer is Tet-on 3G.

[0430] Embodiment 99. The method according to any one of Embodiments 77 to 98, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus of a cell containing the second vector in the presence of the second inducer.

[0431] Embodiment 100. The method according to any one of Embodiments 77 to 99, wherein the first inducer is doxycycline and the second inducer is tamoxifen.

[0432] Embodiment 101. The method according to any one of Embodiments 77 to 100, wherein the payload is progranulin.

[0433] Embodiment 102. The method according to any one of Embodiments 77 to 101, wherein the first vector further comprises a VA-RNA coding sequence.

[0434] Embodiment 103. The method according to Embodiment 102, wherein the sequence encoding VA-RNA is a transcriptionally inactive sequence.

[0435] Embodiment 104. The method according to Embodiment 102 or 103, wherein the sequence encoding the VA-RNA includes at least two mutations in the internal promoter.

[0436] Embodiment 105. A method for increasing small Rep protein expression, comprising introducing a polynucleotide according to any one of Embodiments 1 to 45 into cells, thereby increasing the expression of small Rep protein compared to the introduction of a polynucleotide according to any one of Embodiments 1 to 45 having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

[0437] Embodiment 106. A method for increasing small Rep protein expression, comprising introducing a vector system according to any one of Embodiments 48 to 63 into cells, and contacting the cells with the first inducer and the second inducer, thereby increasing the expression of small Rep protein compared to the introduction of a vector system according to any one of Embodiments 48 to 63 having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

[0438] Embodiment 107. A method for reducing large Rep protein expression, comprising introducing a vector according to any one of Embodiments 46 or 47 into cells, thereby reducing the expression of a large Rep protein compared to the introduction of a vector according to any one of Embodiments 46 or 47 having a native p5 promoter instead of the first promoter.

[0439] Embodiment 108. A method for increasing small Rep protein expression, comprising introducing a vector system according to any one of Embodiments 48 to 63 into cells, and bringing the cells into contact with a first trigger and a second trigger, thereby increasing the expression of small Rep protein compared to the introduction of a vector system according to any one of Embodiments 48 to 63 having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

[0440] Embodiment 109. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid comprising a first polynucleotide construct as described in any one of embodiments 1 to 45, (b) A second polynucleotide construct incorporated into the nuclear genome of the cell, comprising a sequence encoding one or more AAV helper proteins, (c) A second plasmid comprising a third polynucleotide construct containing a sequence encoding a payload flanked by AAV terminal inverted repeats (ITRs), The cells, including the cells.

[0441] Embodiment 110. The cell according to Embodiment 109, wherein the first polynucleotide construct and the third polynucleotide construct are not incorporated into the nuclear genome of the cell.

[0442] Embodiment 111. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first polynucleotide comprising a first polynucleotide construct incorporated into the nuclear genome of the cell, wherein the first polynucleotide construct comprises a polynucleotide construct according to any one of embodiments 1 to 45, (b) A second polynucleotide comprising a second polynucleotide construct incorporated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins, (c) A first plasmid comprising a third polynucleotide construct containing a sequence encoding a payload flanked by AAV terminal inverted repeats (ITRs), The cells, including the cells.

[0443] Embodiment 112. The third polynucleotide construct is The cell according to embodiment 111, which is not incorporated into the nuclear genome of the cell.

[0444] Embodiment 113. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid comprising a first polynucleotide construct as described in any one of embodiments 1 to 45, (b) A second polynucleotide comprising a second polynucleotide construct incorporated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins, (c) The cell comprising a third polynucleotide comprising a third polynucleotide construct incorporated into the nuclear genome of the cell, wherein the third polyplasmid comprises the third polynucleotide construct comprising a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV terminal inverted repeats (ITRs).

[0445] Embodiment 114. The cell according to Embodiment 113, wherein the first polynucleotide construct is not incorporated into the nuclear genome of the cell.

[0446] Embodiment 115. The second polynucleotide is A second inductive promoter operably ligated to a sequence encoding an inductive recombinase, The sequence encoding the inducible recombinase is sandwiched between the third and fourth recombination sites to form an autoexcision element. The third recombinant region and the fourth recombinant region are oriented in the same direction. The self-excision element separates the second inducible promoter from the sequence encoding the one or more AAV helper proteins, and as a result, the second inducible promoter is operably linked to the sequence encoding the one or more AAV helper proteins, A constitutive promoter operably linked to a sequence encoding an activator, The activating factor is a constitutive promoter that cannot activate the first inducible promoter or the second inducible promoter in the absence of the first inducing agent, A cell according to any one of embodiments 109 to 114, including the cell described in any one of these embodiments.

[0447] Embodiment 116. A cell according to any one of Embodiments 109 to 105, wherein the second polynucleotide comprises a constitutive promoter operably linked to a sequence encoding a second selection marker.

[0448] Embodiment 117. The cell according to any one of Embodiments 109 to 116, wherein the second polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 127.

[0449] Embodiment 118. The cell according to any one of Embodiments 109 to 117, wherein the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 127.

[0450] Embodiment 119. A cell according to any one of Embodiments 109 to 1118, wherein the first selection marker is a split selection marker comprising a first portion of the first selection marker, the third polynucleotide comprising a sequence encoding a second portion of the first selection marker, and the first and second portions associate to form a functional first selection marker.

[0451] Embodiment 120. The cell according to any one of Embodiments 109 to 119, wherein the second inducible promoter comprises a tetracycline-responsive promoter element (TRE).

[0452] Embodiment 121. The cell according to Embodiment 120, wherein the TRE comprises a Tet operator (tetO) sequence concatemer fused to a minimal promoter.

[0453] Embodiment 122. The cell according to Embodiment 121, wherein the minimum promoter is a human cytomegalovirus promoter.

[0454] Embodiment 123. The cell according to any one of Embodiments 115 to 122, wherein the sequence encoding the activator is operably linked to a constitutive promoter.

[0455] Embodiment 124. The cell according to Embodiment 123, wherein the constitutive promoter is an EF1α promoter or a human cytomegalovirus promoter.

[0456] Embodiment 125. The cell according to any one of Embodiments 115 to 124, wherein the activator is a reverse tetracycline regulatory transactivator (rTA) containing a Tet repressor-binding protein (TetR) fused to a VP16 transactivation domain.

[0457] Embodiment 126. The cell according to any one of Embodiments 115 to 125, wherein the first inducer for inducing a tetracycline-inducible promoter is tetracycline or doxycycline.

[0458] Embodiment 127. The inducible recombinase is fused to an estrogen-responsive element (ER), A cell according to any one of embodiments 115 to 126, which translocates to the nucleus in the presence of a second inducer.

[0459] Embodiment 128. A cell according to any one of Embodiments 109 to 127, comprising a fourth polynucleotide encoding virus-associated RNA (VA-RNA).

[0460] Embodiment 129. The cell according to Embodiment 128, wherein the VA-RNA is a mutant VA-RNA.

[0461] Embodiment 130. The cell according to Embodiment 128 or 129, wherein the first and fourth polynucleotides are present in a single construct.

[0462] Embodiment 131. The cell according to any one of Embodiments 109 to 130, wherein the sequence encoding the payload includes a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest.

[0463] Embodiment 132. The cell according to any one of Embodiments 109 to 131, wherein the sequence encoding the payload is a sequence encoding progranulin.

[0464] Embodiment 133. A cell according to any one of Embodiments 109 to 132, wherein the sequence encoding the payload includes a suppressor tRNA, a guide RNA, or a homology region for homologous recombination repair.

[0465] Embodiment 134. The cell according to any one of Embodiments 109 to 133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO: 130.

[0466] Embodiment 135. The cell according to any one of Embodiments 109 to 133, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 130.

[0467] Embodiment 136. The cell according to any one of Embodiments 105 to 133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO: 132.

[0468] Embodiment 137. The cell according to any one of Embodiments 109 to 133 and 136, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 132.

[0469] Embodiment 138. The payload is progranulin or dystrophin, The cell according to any one of embodiments 109 to 137, wherein the dystrophin is optionally a functionally shortened dystrophin.

[0470] Embodiment 139. A cell according to any one of Embodiments 109 to 138, wherein the coding sequence encoding a stop signal sequence of a first sequence encodes an exon and a stop signal sequence from 5' to 3', and optionally the coding sequence encoding the stop signal sequence of the first sequence further comprises a sequence encoding a protein marker, the sequence encoding the protein marker being in-frame with the stop signal sequence.

[0471] Appearance 140. The cells further contain adenovirus E1A protein and E1B protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are adenovirus E2A protein and E4 protein, or The cell according to any one of embodiments 109 to 139, wherein the cell further comprises adenovirus E2A protein and E4 protein, and the one or more AAV helper proteins expressed by the second...

Claims

1. A first promoter operably coupled to a large Repcode sequence, The aforementioned large Repcode sequence is An intron including a second promoter operably linked to a small Repcode sequence, The aforementioned miniature Repcode array includes, The second promoter is heterogeneous for the small Repcode sequence, A polynucleotide comprising a first promoter, wherein the second promoter has higher promoter activity compared to the first promoter.

2. The polynucleotide according to claim 1, wherein the first promoter is heterogeneous for the large Repcoding sequence.

3. The polynucleotide according to claim 1 or 2, wherein the large Rep-coding sequence includes a p19 promoter operably linked to the small Rep-coding sequence, and the intron including the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Rep-coding sequence.

4. The polynucleotide according to claim 3, wherein the p19 promoter is mutated to substantially reduce promoter activity.

5. The polynucleotide according to claim 4, wherein the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the natural p19 promoter activity, or is undetectable.

6. The polynucleotide according to any one of claims 1 to 5, wherein the vector lacks a functional p5 promoter.

7. The polynucleotide according to claim 6, wherein the first promoter is replaced by the p5 promoter.

8. The polynucleotide according to any one of claims 1 to 7, wherein the first promoter and / or the second promoter is a constitutive promoter.

9. The polynucleotide according to any one of claims 1 to 7, wherein the first promoter and / or the second promoter is an inducible promoter.

10. (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Roussarcoma virus terminal repeat (RSV) promoter; (ii) the first promoter is a chicken β-actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken β-actin (CAG) promoter and the second promoter is an RSV promoter; or (iv) the first promoter is a chicken β-actin promoter and the second promoter is an RSV promoter, according to any one of claims 1 to 9.

11. The polynucleotide according to any one of claims 1 to 10, further comprising a polyadenylation (poly-A) signal sequence downstream of the Rep coding sequence, wherein the poly-A signal sequence is stronger than the natural AAV Rep poly-A signal sequence.

12. The polynucleotide according to claim 11, wherein the polyA signal sequence is selected from a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neuropilin-1 polyA signal sequence, a nopalin synthase polyA signal sequence, an α-globulin polyA signal sequence, and a rabbit globin polyA signal sequence.

13. The polynucleotide according to claim 11 or 12, wherein the polyadenylation signal sequence includes a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO:

2.

14. The polynucleotide according to any one of claims 11 to 13, wherein the polyadenylation signal sequence includes the nucleotide sequence of SEQ ID NO:

2.

15. The polynucleotide according to any one of claims 11 to 14, further comprising an enhancer downstream of the polyA signal sequence.

16. The polynucleotide according to claim 15, wherein the enhancer is selected from a transcription enhancer, a translation enhancer, and a transcription and translation enhancer.

17. The polynucleotide according to claim 15 or 16, wherein the enhancer comprises one or more sequences selected from sequence numbers 11 to 116 and 165 to 168.

18. The polynucleotide according to any one of claims 15 to 17, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

19. The polynucleotide according to any one of claims 15 to 18, wherein the enhancer is a double enhancer.

20. The polynucleotide according to claim 19, wherein the double enhancer comprises one of the following: telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or CMV enhancer (SEQ ID NO: 165).

21. The polynucleotide according to claim 19 or 20, wherein the double enhancer comprises two of the following: a telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

22. The polynucleotide according to any one of claims 19 to 21, wherein the double enhancer comprises a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166) and a CMV enhancer (SEQ ID NO: 165).

23. The polynucleotide according to any one of claims 19 to 22, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with respect to the nucleotide sequence of SEQ ID NO:

168.

24. The polynucleotide according to any one of claims 19 to 23, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO:

168.

25. The polynucleotide according to any one of claims 15 to 18, wherein the enhancer is a triple enhancer.

26. The polynucleotide according to claim 25, wherein the triple enhancer comprises telomerase reverse transcriptase (hTERT) (SEQ ID NO: 167), Simian virus 40 (SV40) (SEQ ID NO: 166), or CMV enhancer (SEQ ID NO: 165).

27. The polynucleotide according to claim 25 or 26, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with respect to the nucleotide sequence of SEQ ID NO:

10.

28. The polynucleotide according to any one of claims 25 to 27, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO:

10.

29. The polynucleotide according to any one of claims 1 to 28, wherein the intron is a synthetic intron comprising a 5' splice donor site, the second promoter sequence, and a 3' splice acceptor site, and the splice donor and acceptor sites are compatible with cells used to express a large Rep protein.

30. The polynucleotide according to any one of claims 1 to 29, wherein the small Repcode sequence includes a cleavable element comprising a first recombination site and a second recombination site adjacent to a sequence containing a stop codon, the first recombination site and the second recombination site are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the cleavage of the sequence containing the stop codon.

31. The polynucleotide according to any one of claims 1 to 30, further comprising the large Rep coding sequence and the small Rep coding sequence and a sequence that codes for a tag in frame, wherein each of the large Rep protein and the small Rep protein is expressed as a fusion protein containing the tag.

32. The polynucleotide according to claim 31, wherein the tag is a purified tag and / or a detectable tag.

33. The polynucleotide according to any one of claims 1 to 32, wherein the vector is designed to result in the expression of a large Rep protein and / or large Rep transcript at a level lower than the expression level of a large Rep protein and / or large Rep transcript from a vector that does not have the first promoter and / or has a p5 promoter.

34. The polynucleotide according to any one of claims 1 to 32, wherein the vector is designed to result in a higher level of expression of the small Rep protein and / or small Rep transcript than the expression of the small Rep protein and / or small Rep transcript from a vector that does not have the second promoter and / or has the p19 promoter.

35. The polynucleotide according to any one of claims 1 to 34, wherein the vector is designed to result in the expression of a large Rep protein and / or large Rep transcript at a level lower than the expression level of a small Rep protein and / or small Rep transcript.

36. A polynucleotide according to any one of claims 1 to 35, wherein the ratio of the expression level of a small Rep protein and / or small Rep transcript to the expression level of a large Rep protein and / or large Rep transcript is in the range of 1.5:1 to 10,000:1, including 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 100:1, 1000:1, or 5000:1;5.

37. A polynucleotide according to any one of claims 1 to 36, further comprising an AAV Cap coding sequence.

38. The polynucleotide according to any one of claims 1 to 37, further comprising a sequence encoding a first selection marker operably linked to a constitutive promoter.

39. The polynucleotide according to claim 38, wherein the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.

40. The polynucleotide according to claim 39, wherein the polynucleotide comprises an inductive promoter operably linked to the Cap coding sequence, and optionally the inductive promoter comprises a tetracycline-responsive promoter element (TRE).

41. The polynucleotide according to claim 39 or 40, wherein the intervening sequence comprises a transcriptional blocking element (TBE).

42. The polynucleotide according to claim 38, wherein the AAV Cap coding sequence is operably linked to a natural promoter.

43. The polynucleotide according to claim 42, wherein the natural promoter is a p40 promoter located within the small Repcode sequence.

44. The polynucleotide according to claim 38, wherein the AAV Cap coding sequence is operably linked to a heterologous promoter.

45. The polynucleotide according to claim 44, wherein the heterogeneous promoter is an inducible promoter.

46. A vector comprising a polynucleotide according to any one of claims 1 to 41.

47. A vector comprising a polynucleotide according to any one of claims 1 to 37 and 42 to 45.

48. A vector according to claim 46, wherein the first vector is the vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide payload flanked by AAV terminal inverted repeat sequences (ITRs), A vector system for producing recombinant adenovirus-associated viruses (rAAVs), including [specific component].

49. A vector according to claim 47, wherein the first vector is the vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide encoding a payload flanked by AAV terminal inverted repeat sequences (ITRs), A vector system for producing recombinant adenovirus-associated viruses (rAAVs), including [specific component].

50. A vector according to claim 47, wherein the first vector is the vector, A second vector containing sequences encoding one or more AAV helper proteins, A third vector containing a polynucleotide encoding a payload flanked by AAV terminal inverted repeat sequences (ITRs), A fourth vector containing the AAV Cap code sequence, A vector system for producing recombinant adenovirus-associated viruses (rAAVs), including [specific component].

51. A vector system according to any one of claims 48 to 50 for inducibly producing rAAV, wherein the second vector comprises: an inducible promoter operably linked to a sequence encoding an inducible recombinase; an autoexcision element including a third recombination site and a fourth recombination site adjacent to the sequence encoding the inducible recombinase, wherein the third and fourth recombination sites are oriented in the same direction, and the autoexcision element separates the inducible promoter from the sequence encoding the one or more AAV helper proteins, such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator cannot activate the inducible promoter in the absence of a first inducer; and a constitutive promoter operably linked to a sequence encoding a second choice marker.

52. The vector system according to any one of claims 48 to 51, wherein the first vector comprises an array encoding a first portion of the first selection marker and a constitutive promoter operably coupled to the array encoding the first portion of the first selection marker, and the third vector comprises an array encoding a second portion of the first selection marker and a constitutive promoter operably coupled to the array encoding the second portion of the first selection marker, and the first and second portions combine to form a functional first selection marker.

53. The vector system according to any one of claims 51 to 52, wherein the sequence encoding one or more AAV helper proteins includes a bisistronic open reading frame encoding at least two AAV helper proteins.

54. The vector system according to any one of claims 51 to 53, wherein the helper proteins include E2a and E4.

55. The vector system according to any one of claims 51 to 54, wherein the inducible promoter in the second vector comprises a tetracycline-responsive promoter element (TRE) operably linked to a sequence encoding the inducible recombinase, and the activator is Tet-on 3G.

56. The vector system according to any one of claims 51 to 55, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus of a cell containing the second vector in the presence of the second inducer.

57. The vector system according to claim 56, wherein the first inducer is doxycycline and the second inducer is tamoxifen.

58. The vector system according to any one of claims 48 to 57, wherein the payload is progranulin.

59. The vector system according to any one of claims 48 to 58, wherein the second vector further comprises a VA-RNA coding sequence.

60. The second vector described above is A second excisable element comprising a fifth and a sixth recombination site adjacent to a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and a first portion of a constitutive promoter and a second portion of a constitutive promoter separated by the excisable element, The VA-RNA coding sequence wherein the excision of the second excisable element by the inducible recombinase generates a functional fifth complete constitutive promoter operably linked to the VA-RNA coding sequence, thereby enabling the expression of the VA-RNA, The vector system according to claim 59, further comprising an insertion fragment containing the following.

61. The vector system according to claim 60, wherein the first portion of the constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter.

62. The vector system according to claims 59 to 61, wherein the sequence encoding VA-RNA is a transcriptionally inactive sequence.

63. The vector system according to any one of claims 59 to 62, wherein the sequence encoding VA-RNA includes at least two mutations in the internal promoter.

64. A cell comprising a polynucleotide according to any one of claims 1 to 45 or a vector according to claim 46 or 47.

65. The cell according to claim 64, wherein the polynucleotide or the vector is incorporated into the genome of the cell.

66. A cell comprising the first vector and the second vector according to any one of claims 48 to 50.

67. The cell according to claim 66, wherein the first vector and the second vector are incorporated into the genome of the cell.

68. A cell comprising the vector system according to any one of claims 48 to 51.

69. The cell according to any one of claims 64 to 68, wherein the cell is a mammalian cell, optionally the mammalian cell is a HEK293 cell, and optionally the HEK293 cell expresses AAV helper proteins E1A and E1B.

70. The cell according to claim 68 or 69, wherein the vector system is incorporated into the genome of the cell.

71. A method for producing recombinant AAV, comprising performing cell translocation using a vector system described in any one of claims 48 to 51.

72. A method for inducibly producing recombinant AAV (rAAV), comprising contacting cells according to any one of claims 68 to 70 with a first inducer and a second inducer, thereby inducing the production of rAAV.

73. The method according to claim 71 or 72, wherein the cells contain the first vector having a native p19 promoter instead of the second promoter, and express higher levels of the miniature Rep protein compared to cells containing the second and third vectors.

74. The method according to any one of claims 71 to 73, wherein the cells contain the first vector having a native p5 promoter instead of the first promoter, and express lower levels of large Rep compared to cells containing the second and third vectors.

75. The method according to any one of claims 71 to 74, wherein the cells express a lower level of large Rep protein compared to small Rep protein.

76. The method according to any one of claims 71 to 75, wherein the cells comprise the first vector having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter, and produce higher levels of rAAV compared to cells comprising the second and third vectors.

77. A method for creating cells that inducibly produce recombinant AAV (rAAV) containing a payload, (i) Introducing a first vector into a cell, wherein the first vector An inductive promoter operably linked to a sequence encoding an inductive recombinase; an autoexcision element comprising a first recombination site and a second recombination site adjacent to the sequence encoding the inductive recombinase, wherein the first and second recombination sites are oriented in the same direction, and the autoexcision element separates the inductive promoter from a sequence encoding one or more AAV helper proteins, such that the inductive promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator, and the activator cannot activate the inductive promoter in the absence of the first inducer; and a second constitutive promoter operably linked to a sequence encoding a first selection marker, wherein the cell constitutively expresses the first selection marker; (ii) Selecting cells that express the first selection marker, (iii) Introducing the second vector and the third vector into the cells expressing the first selection marker, The second vector described above is A first promoter operably coupled to a large Repcode sequence, wherein the large Repcode sequence includes (i) an intron containing a second promoter, and (ii) a small Repcode sequence, and the second promoter is operably coupled to the small Repcode sequence. The second promoter is heterogeneous for the small Repcode sequence, The second promoter has higher promoter activity compared to the first promoter. The small Repcode sequence includes a resectable element comprising a third recombination site and a fourth recombination site adjacent to a sequence containing a stop codon, wherein the third and fourth recombination sites are oriented in the same direction, and recombination between the third and fourth recombination sites by an inducible recombinase results in the resection of the sequence containing the stop codon, the first promoter and AAV capsid protein coding sequence and A third constitutive promoter operably coupled to an sequence encoding a first portion of a second selection marker, The third vector comprises a fourth constitutive promoter operably ligated to a polynucleotide payload sequence and a sequence encoding a second portion of the second selection marker, wherein the polynucleotide payload sequence is flanked by AAV-terminal inverted repeat sequences (ITRs), and the introduction is as follows: (iv) The method comprising selecting cells expressing the first selection marker and the second selection marker, thereby producing cells for inducible production of recombinant AAV (rAAV) virions containing the payload.

78. The method according to claim 77, further comprising growing cells expressing the first and second selection markers.

79. The method according to claim 77 or 78, wherein the first and second selection markers are antibiotic resistance proteins.

80. The method according to claim 79, wherein the second selection marker is a segmented blast sizing.

81. The method according to any one of claims 77 to 80, wherein the first promoter in the second vector is heterogeneous for the large Repcode sequence.

82. The method according to any one of claims 77 to 81, wherein the large Repcode sequence includes a p19 promoter operably coupled to the small Repcode sequence, and the intron including the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Repcode sequence.

83. The method according to claim 82, wherein the p19 promoter is mutated to substantially reduce promoter activity.

84. The method according to claim 83, wherein the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the natural p19 promoter activity, or is undetectable.

85. The method according to any one of claims 77 to 84, wherein the second vector lacks a functional p5 promoter.

86. The method according to claim 85, wherein the first promoter is replaced with the p5 promoter.

87. The method according to any one of claims 77 to 86, wherein the first promoter and / or second promoter in the second vector is a constitutive promoter or an inducible promoter.

88. The method according to any one of claims 77 to 87, wherein the second vector is (i) a ubiquitin C (UBC) promoter and a second promoter a Roussarcoma virus terminal repeat (RSV) promoter, (ii) a chicken β-actin promoter and a second promoter a cytomegalovirus (CMV) promoter, (iii) a CMV enhancer / chicken β-actin (CAG) promoter and a second promoter an RSV promoter, or (iv) a chicken β-actin promoter and a second promoter an RSV promoter.

89. The method according to any one of claims 77 to 88, wherein the intron is a synthetic intron comprising a 5' splice donor site compatible with cells used to express a large Rep protein, the second promoter sequence, and a 3' splice acceptor site.

90. The method according to any one of claims 77 to 89, wherein the small Repcode sequence includes a resectable element comprising a first recombination site and a second recombination site adjacent to a sequence containing a stop codon, the first recombination site and the second recombination site are oriented in the same direction, and recombination between the first and second recombination sites by an inducible recombinase results in the resection of the sequence containing the stop codon.

91. The method according to any one of claims 77 to 90, wherein the second vector comprises the large Rep-coding sequence and the small Rep-coding sequence and a sequence encoding a tag in frame, and each of the large Rep protein and the small Rep protein is expressed as a fusion protein containing the tag.

92. The method according to claim 91, wherein the tag is a refined tag and / or a detectable tag.

93. The method according to any one of claims 77 to 92, wherein the AAV capsid protein coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence, and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.

94. The method according to claim 93, wherein the second vector comprises an inducible promoter operably linked to the AAV capsid protein coding sequence.

95. The method according to claim 93 or 94, wherein the intervening sequence includes a transcriptional blocking element (TBE).

96. The method according to claim 94 or 95, wherein the inductive promoter operably linked to the sequence encoding the inductive recombinase and the inductive promoter operably linked to the AAV capsid protein coding sequence are the same promoter.

97. The method according to claim 96, wherein the promoter comprises a tetracycline-responsive promoter element (TRE).

98. The method according to claim 97, wherein the activator that binds to the TRE in the presence of the first inducer is Tet-on 3G.

99. The method according to any one of claims 77 to 98, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus of a cell containing the second vector in the presence of the second inducer.

100. The method according to any one of claims 77 to 99, wherein the first inducing agent is doxycycline and the second inducing agent is tamoxifen.

101. The method according to any one of claims 77 to 100, wherein the payload is progranulin.

102. The method according to any one of claims 77 to 101, wherein the first vector further comprises a VA-RNA coding sequence.

103. The method according to claim 102, wherein the sequence encoding VA-RNA is a transcriptionally inactive sequence.

104. The method according to claim 102 or 103, wherein the sequence encoding VA-RNA comprises at least two mutations in the internal promoter.

105. A method for increasing the expression of a small Rep protein, comprising introducing a polynucleotide according to any one of claims 1 to 45 into a cell, thereby increasing the expression of the small Rep protein compared to the introduction of a polynucleotide according to any one of claims 1 to 45 having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

106. A method for increasing the expression of a small Rep protein, comprising introducing the vector system according to any one of claims 48 to 63 into cells, and contacting the cells with the first inducer and the second inducer, thereby increasing the expression of the small Rep protein compared to the introduction of the vector system according to any one of claims 48 to 63, which has a natural p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

107. A method for reducing large Rep protein expression, comprising introducing the vector according to any one of claim 46 or 47 into cells, thereby reducing the expression of the large Rep protein compared to the introduction of the vector according to any one of claim 46 or 47 having a native p5 promoter instead of the first promoter.

108. A method for increasing the expression of a small Rep protein, comprising introducing the vector system according to any one of claims 48 to 63 into a cell, and bringing the cell into contact with a first trigger and a second trigger, thereby increasing the expression of the small Rep protein compared to the introduction of the vector system according to any one of claims 48 to 63, having a native p5 promoter instead of the first promoter and a p19 promoter instead of the second promoter.

109. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid comprising a first polynucleotide construct according to any one of claims 1 to 45, (b) A second polynucleotide construct incorporated into the nuclear genome of the cell, comprising sequences encoding one or more AAV helper proteins, (c) A second plasmid comprising a third polynucleotide construct containing a sequence encoding a payload flanked by AAV-terminal inverted repeat sequences (ITRs), The cells, including the cells.

110. The cell according to claim 109, wherein the first polynucleotide construct and the third polynucleotide construct are not incorporated into the nuclear genome of the cell.

111. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first polynucleotide comprising a first polynucleotide construct incorporated into the nuclear genome of the cell, wherein the first polynucleotide construct comprises the polynucleotide construct according to any one of claims 1 to 45, (b) A second polynucleotide comprising a second polynucleotide construct incorporated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins, (c) A first plasmid comprising a third polynucleotide construct containing a sequence encoding a payload flanked by AAV-terminal inverted repeat sequences (ITRs), The cells, including the cells.

112. The cell according to claim 111, wherein the third polynucleotide construct is not incorporated into the nuclear genome of the cell.

113. Cells for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid comprising a first polynucleotide construct according to any one of claims 1 to 45, (b) A second polynucleotide comprising a second polynucleotide construct incorporated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins, (c) A third polynucleotide comprising a third polynucleotide construct incorporated into the nuclear genome of the cell, wherein the third polyplasmid comprises a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV-terminal inverted repeat sequences (ITRs), The cells, including the cells.

114. The cell according to claim 113, wherein the first polynucleotide construct is not incorporated into the nuclear genome of the cell.

115. The second polynucleotide is A second inductive promoter operably ligated to a sequence encoding an inductive recombinase, The sequence encoding the inducible recombinase is sandwiched between the third and fourth recombination sites to form an autoexcision element. The third recombination region and the fourth recombination region are oriented in the same direction. The self-excision element separates the second inducible promoter from the sequence encoding the one or more AAV helper proteins, and as a result, the second inducible promoter is operably linked to the sequence encoding the one or more AAV helper proteins, A constitutive promoter operably linked to a sequence encoding an activator, The activating factor is a constitutive promoter that cannot activate the first inducible promoter or the second inducible promoter in the absence of the first inducing agent, A cell according to any one of claims 109 to 114, including the cell.

116. The cell according to any one of claims 109 to 105, wherein the second polynucleotide comprises a constitutive promoter operably ligated to a sequence encoding a second selection marker.

117. The cell according to any one of claims 109 to 116, wherein the second polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO:

127.

118. The cell according to any one of claims 109 to 117, wherein the second polynucleotide comprises the nucleotide sequence of SEQ ID NO:

127.

119. The cell according to any one of claims 109 to 118, wherein the first selection marker is a split selection marker and comprises a first portion of the first selection marker, the third polynucleotide comprises a sequence encoding a second portion of the first selection marker, and the first and second portions associate to form a functional first selection marker.

120. The cell according to any one of claims 109 to 119, wherein the second inducible promoter comprises a tetracycline-responsive promoter element (TRE).

121. The cell according to claim 120, wherein the TRE comprises a Tet operator (tetO) sequence concatemer fused to a minimal promoter.

122. The cell according to claim 121, wherein the minimum promoter is a human cytomegalovirus promoter.

123. The cell according to any one of claims 115 to 122, wherein the sequence encoding the activator is operably linked to a constitutive promoter.

124. The cell according to claim 123, wherein the constitutive promoter is an EF1α promoter or a human cytomegalovirus promoter.

125. The cell according to any one of claims 115 to 124, wherein the activator is a reverse tetracycline-regulating transactivator (rTA) containing a Tet repressor-binding protein (TetR) fused to a VP16 transactivation domain.

126. The cell according to any one of claims 115 to 125, wherein the first inducer for inducing a tetracycline-inducible promoter is tetracycline or doxycycline.

127. The cell according to any one of claims 115 to 126, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus in the presence of a second inducer.

128. A cell according to any one of claims 109 to 127, comprising a fourth polynucleotide encoding virus-associated RNA (VA-RNA).

129. The cell according to claim 128, wherein the VA-RNA is a mutant VA-RNA.

130. The cell according to claim 128 or 129, wherein the first and fourth polynucleotides are present in a single construct.

131. The cell according to any one of claims 109 to 130, wherein the sequence encoding the payload includes a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest.

132. The cell according to any one of claims 109 to 131, wherein the sequence encoding the payload is a sequence encoding progranulin.

133. The cell according to any one of claims 109 to 132, wherein the sequence encoding the payload includes a suppressor tRNA, a guide RNA, or a homology region for homologous recombination repair.

134. The cell according to any one of claims 109 to 133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO:

130.

135. The cell according to any one of claims 109 to 133, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO:

130.

136. The cell according to any one of claims 105-133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the nucleotide sequence of SEQ ID NO:

132.

137. The cell according to any one of claims 109 to 133 and 136, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO:

132.

138. The payload is progranulin or dystrophin. The cell according to any one of claims 109 to 137, wherein the dystrophin is optionally a functionally shortened dystrophin.

139. A cell according to any one of claims 109 to 138, wherein a coding sequence encoding a stop signal sequence of a first sequence encodes an exon and a stop signal sequence from 5' to 3', and optionally the coding sequence encoding the stop signal sequence of the first sequence further comprises a sequence encoding a protein marker, the sequence encoding the protein marker being in-frame with the stop signal sequence.

140. The cells further comprise adenovirus E1A protein and E1B protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are adenovirus E2A protein and E4 protein. or The cell according to any one of claims 109 to 139, wherein the cell further comprises adenovirus E2A protein and E4 protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are adenovirus E1A protein and E1B protein.

141. The cell according to any one of claims 109 to 140, further comprising a fourth polynucleotide construct comprising an inducible or constitutive promoter operably linked to a sequence encoding one or more helper proteins.

142. The cell according to any one of claims 109 to 141, wherein the sequence encoding one or more AAV helper proteins comprises a bisistronic open reading frame encoding two AAV helper proteins.

143. The cell according to claim 142, wherein the two AAV helper proteins are E2A and E4 or E1A and E1B.

144. The cell according to claim 142 or 143, wherein the bisistronic open reading frame comprises an internal ribosome entry site (IRES) or a 2A peptide (P2A) sequence.

145. The cell according to any one of claims 109 to 144, wherein the AAV capsid protein comprises VP1, VP2, and VP3.

146. The aforementioned cells are mammalian cells, and optionally, The cell according to any one of claims 109 to 145, wherein the mammalian cell is a HEK293 cell.

147. The cell according to any one of claims 109 to 146, wherein the inducible recombinase is fused to an estrogen-responsive element (ER) and translocates to the nucleus in the presence of tamoxifen.

148. The cell according to any one of claims 109 to 147, wherein the second inducer for moving the inducible recombinase is a hormone, and optionally the second inducer is tamoxifen.

149. A cell according to any one of claims 109 to 148, wherein the recombination site in the first polynucleotide construct and the second polynucleotide construct is a lox site and the inducible recombinase is a cré recombinase, or the recombination site in the first polynucleotide construct and the second polynucleotide is a flippase recognition target (FRT) site and the inducible recombinase is a flippase (Flp) recombinase.

150. The cell according to any one of claims 109 to 149, wherein the second polynucleotide construct further comprises an insertion fragment containing a sequence encoding VA-RNA, or optionally, the fifth construct comprises an insertion fragment containing a sequence encoding VA-RNA.

151. The cell according to claim 150, wherein the VA-RNA is wild-type VA-RNA or VA-RNA containing one or more mutations in the VA-RNA internal promoter.

152. The aforementioned insert fragment, A second excisable element comprising a fifth recombination site and a sixth recombination site adjacent to a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and a first portion of a fifth constitutive promoter and a second portion of a fifth constitutive promoter separated by the excisable element, The VA-RNA coding sequence wherein the excision of the second excisable element by the inducible recombinase generates a functional fifth complete constitutive promoter operably linked to the VA-RNA coding sequence, thereby enabling the expression of the VA-RNA, The cell according to claim 150 or 151, comprising:

153. The first portion of the fifth constitutive promoter includes a distal sequence element (DSE) of the RNA polymerase III promoter, and the second portion of the fifth constitutive promoter includes a proximal sequence element (PSE) of the RNA polymerase III promoter, The first portion of the fifth constitutive promoter includes a distal sequence element (DSE) of the U6 promoter, and the second portion of the fifth constitutive promoter includes a proximal sequence element (PSE) of the U6 promoter, or The cell according to claim 152, wherein the first portion of the fifth constitutive promoter includes a distal sequence element (DSE) of the U7 promoter, and the second portion of the fifth constitutive promoter includes a proximal sequence element (PSE) of the U7 promoter.

154. The first polynucleotide construct is (i) a first spacer segment and a second spacer segment adjacent to the excisable element, wherein the first portion of the AAV Repcode sequence and the second portion of the AAV Repcode sequence are separated by the first spacer segment, the excisable element, and the second spacer segment, wherein the first spacer segment comprises a first intron, the second spacer segment comprises a second intron, and the first polynucleotide construct further comprises a 5' splice site at the 5' end of the first spacer segment, a first 3' splice site at the 3' end of the second spacer segment, and a second 3' splice site at the 3' end of the first recombination site; or (ii) A cell according to any one of claims 109 to 153, further comprising a first spacer segment and a second spacer segment adjacent to an invertible element, wherein the first portion of the AAV Repcode sequence and the second portion of the AAV Repcode sequence are separated by the first spacer segment, the invertible element, and the second spacer segment, wherein the first spacer segment comprises a first intron, the second spacer segment comprises a second intron, and the first polynucleotide construct further comprises a 5' splice site at the 5' end of the first spacer segment, a first 3' splice site at the 3' end of the second spacer segment, and a second 3' splice site at the 3' end of the first recombination site.

155. The cell according to any one of claims 109 to 154, wherein the second polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs: 127-129.

156. The cell according to any one of claims 109 to 155, wherein the third polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs: 130-133, and optionally the sequence encoding progranulin is replaced by the sequence encoding dystrophin, and further optionally the sequence encoding dystrophin encodes a functionally truncated dystrophin.

157. A cell according to any one of claims 109 to 156, wherein the sequence encoding the payload, flanked by a 5'AAV-terminal inverted repeat (5'ITR) and a 3'AAV-terminal inverted repeat (3'ITR), comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to sequence numbers 130 to 133, and optionally the sequence encoding progranulin is replaced by the sequence encoding dystrophin, and further optionally the sequence encoding dystrophin encodes a functionally truncated dystrophin.

158. The cell according to any one of claims 109 to 157, wherein the third polynucleotide construct further comprises a spacer between the 5'ITR and the sequence encoding the third selection marker, or a spacer between the sequence encoding the third selection marker and the 3'ITR, or a combination thereof.

159. The cell according to claim 158, wherein the spacer has a length in the range of 500 base pairs to 5000 base pairs.

160. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid according to any one of claims 109, 110, or 115-137, (b) A cell comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 109, 110, or 115-137, (c) A second plasmid according to any one of claims 109, 110, or 115-137, Includes, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 150 to 159.

161. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) the first polynucleotide construct of the first plasmid according to any one of claims 109, 110, or 115-137, (b) A cell comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 109, 110, or 115-137, (c) The third polynucleotide construct of the second plasmid according to any one of claims 109, 110, or 115-137, Includes, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 150 to 159.

162. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A cell comprising the first polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 111, 112, or 115 to 137, (b) The cell further comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 111, 112, or 115 to 137, (c) A first plasmid according to any one of claims 111, 112, or 115 to 137, Includes, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 151 to 159.

163. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A cell comprising the first polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 111, 112, or 115 to 137, (b) The cell further comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 111, 112, or 115 to 137, (c) comprising the third polynucleotide construct of the first plasmid according to any one of claims 111, 112, or 115-137, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 150 to 159.

164. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) A first plasmid according to any one of claims 113 to 137, (b) A cell comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 113 to 137, (c) the cell further comprising the third polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 113 to 137, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 150 to 159.

165. A system for inducibly producing recombinant adenovirus-associated virus (rAAV) virions, (a) The first polynucleotide construct of the first plasmid according to any one of claims 113 to 137, (b) A cell comprising the second polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 113 to 137, (c) The cell further comprising the third polynucleotide construct incorporated into the nuclear genome of the cell according to any one of claims 113 to 137, (d) optionally further comprising a fourth polynucleotide construct according to any one of claims 141 to 159, and (e) optionally further comprising a fifth polynucleotide construct according to any one of claims 150 to 159.

166. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 109, 110, or 115-137 into a cell, Selecting cells that express the second selection marker, Introducing a first polynucleotide construct according to any one of claims 109, 110, or 115-137 and a third polynucleotide construct according to any one of claims 109, 110, or 115-137 into cells expressing the second selection marker, wherein the introduction is by transient translocation, and the introduction is performed by... This includes selecting cells that express the second selection marker, the first selection marker, and the third selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the second polynucleotide construct is incorporated into the nuclear genome of the cells, and the first polynucleotide construct and the third polynucleotide construct are not incorporated into the genome of the cells.

167. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 109, 110, or 115-137 into a cell, Selecting cells that express the second selection marker, Introducing the first plasmid according to any one of claims 109, 110, or 115-137 and the second plasmid according to any one of claims 109, 110, or 115-137 into the cells of the cell expressing the second selection marker, wherein optionally the introduction is by transient translocation, and the introduction is performed by transient translocation. This includes selecting cells that express the second selection marker, the first selection marker, and the third selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the first polynucleotide construct is incorporated into the nuclear genome of the cells, and the first plasmid and the second plasmid are not incorporated into the genome of the cells.

168. The method according to claim 166 or 167, wherein the first selection marker is a first portion of a selection marker, and the third selection marker is a second portion of a selection marker.

169. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 111, 112, or 115-137 into a cell, Selecting cells that express the second selection marker, Introducing the first polynucleotide according to any one of claims 111, 112, or 115-137 into the cells of the cell expressing the second selection marker, Selecting cells that express the second selection marker and the first selection marker, Introducing a third polynucleotide construct according to any one of claims 111, 112, or 115-137, wherein the introduction is by transient translocation, and the introduction is This includes selecting cells that express the second selection marker, the first selection marker, and the third selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the first polynucleotide construct and the second polynucleotide construct are incorporated into the nuclear genome of the cells, and the third polynucleotide construct is not incorporated into the genome of the cells.

170. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 111, 112, or 115-137 into a cell, Selecting cells that express the second selection marker, Introducing the first polynucleotide according to any one of claims 111, 112, or 115-137 into the cells of the cell expressing the second selection marker, Selecting cells that express the second selection marker and the first selection marker, Introducing a first plasmid according to any one of claims 111, 112, or 115-137, wherein the introduction is by transient translocation, and the introduction is This includes selecting cells that express the second selection marker, the first selection marker, and the third selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the first polynucleotide construct and the second polynucleotide construct are incorporated into the nuclear genome of the cells, and the first plasmid is not incorporated into the genome of the cells.

171. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 113 to 137 into a cell, Selecting cells that express the second selection marker, Introducing the third polynucleotide construct according to any one of claims 113 to 137 into the cells of the cell expressing the second selection marker, Selecting cells that express the second selection marker and the third selection marker, Introducing a first polynucleotide construct according to any one of claims 113 to 137, wherein the introduction is by transient translocation, and the introduction is... This includes selecting cells that express the second selection marker, the third selection marker, and the first selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the second polynucleotide construct and the third polynucleotide construct are incorporated into the nuclear genome of the cells, and the first polynucleotide construct is not incorporated into the genome of the cells.

172. A method for creating cells that inducibly produce recombinant AAV (rAAV) virions containing a payload, Introducing a second polynucleotide construct according to any one of claims 113 to 137 into a cell, Selecting cells that express the second selection marker, Introducing the third polynucleotide construct according to any one of claims 113 to 137 into the cells of the cell expressing the second selection marker, Selecting cells that express the second selection marker and the third selection marker, Introducing a first plasmid according to any one of claims 113 to 137, wherein the introduction is by transient translocation, and the introduction is performed by This includes selecting cells that express the second selection marker, the third selection marker, and the first selection marker, The method wherein cells are produced that inducibly produce recombinant AAV (rAAV) virions containing a payload, the second polynucleotide construct and the third polynucleotide construct are incorporated into the nuclear genome of the cells, and the first plasmid is not incorporated into the genome of the cells.

173. The method further comprises contacting cells for inducibly producing recombinant AAV (rAAV) virions containing a payload with the first inducer and the second inducer, wherein in the presence of the first inducer, the activator activates the inducible promoter resulting in the expression of the inducible recombinase; in the presence of the second inducer, the inducible recombinase translocates to the nucleus, and recombination between the third and fourth recombination sites in the second polynucleotide construct results in the excision of the autoexcision element containing the sequence encoding the inducible recombinase; the inducible promoter operably ligates to the sequence encoding the one or more AAV helper proteins, thereby enabling the expression of the one or more AAV helper proteins; optionally, (i) Recombination between the first recombination site and the second recombination site in the first polynucleotide construct results in the excision of the excisable element, and the first portion of the AAV Repcoded sequence and the second portion of the AAV Repcoded sequence are linked together to form a complete AAV Repcoded sequence, or (ii) Recombination between the first recombination site and the second recombination site in the first polynucleotide construct results in inversion of an invertible element, and the first portion of the AAV Rep coding sequence and the second portion of the AAV Rep coding sequence are linked to form a complete AAV Rep coding sequence, and one or more promoters are operably linked to the complete AAV Rep coding sequence to enable the expression of AAV Rep protein and AAV Cap protein, One or more promoters are operably linked to the complete AAV Rep coding sequence to enable the expression of the AAV Rep protein and the AAV Cap protein. The method according to any one of claims 166 to 172, wherein recombinant AAV (rAAV) virions containing a payload are inducibly produced.

174. The method according to any one of claims 166 to 173, wherein the first polynucleotide construct is present in a plasmid having at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity with respect to SEQ ID NOs. 126 to 128.

175. A method for producing recombinant adenovirus-associated virus (rAAV) virions containing a payload-coding sequence, comprising contacting a cell according to any one of claims 115 to 143 with the first inducer and the second inducer, In the presence of the first inducer, the activator activates the inductive promoter of the second polynucleotide construct that results in the expression of the inductive recombinase; in the presence of the second inducer, the inductive recombinase translocates to the nucleus, and recombination between the third and fourth recombination sites in the second polynucleotide construct that results in the expression of the inductive recombinase results in the excision of the autoexcision element containing the sequence encoding the inductive recombinase; the inductive promoter operably ligates to the sequence encoding one or more AAV helper proteins, thereby enabling the expression of one or more AAV helper proteins. Optionally, recombination between the first and second recombination sites in the first polynucleotide construct by an inducible recombinase results in the excision of a cleavable element or the inversion of an invertible element, and the first portion of the AAV Rep-coding sequence and the second portion of the AAV Rep-coding sequence are linked to form a complete AAV Rep-coding sequence, and one or more promoters are operably linked to the complete AAV Rep-coding sequence to enable the expression of one or more Rep proteins and one or more capsid proteins. The method wherein the expression of one or more AAV helper proteins results in the expression of one or more Rep proteins and one or more capsid proteins, thereby producing an rAAV virion containing the sequence encoding the payload of interest.

176. The payload is progranulin or dystrophin, optionally, The method according to claim 175, wherein the dystrophin is a functionally shortened dystrophin.

177. The method according to claim 175 or 176, wherein the first inducing agent is doxycycline.

178. The method according to any one of claims 175 to 177, wherein the second inducer is tamoxifen.

Images