Multipurpose HSV-1 pre-vector
Patent Information
- Application Number
- JP2026515903
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-09-18
- Filing Date
- 2024-07-23
- Publication Date
- 2026-09-17
Smart Images

Figure 2026531658000001 
Figure 2026531658000002 
Figure 2026531658000003
Abstract
Description
[Technical Field]
[0001] Herpes simplex virus (HSV) is a complex, non-integrated DNA virus capable of infecting a very wide range of human and animal cells. There are two serotypes of HSV: herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2). The HSV-1 genome is approximately 152 kilobase pairs (kbp) in size. It contains about 90 protein-coding genes and more than 12 microRNAs. The HSV-1 genome consists of two distinct segments, UL and US, each flanked by inverted repeat sequences encoding important genes present in two copies. [Background technology]
[0002] HSV-1-based vectors have been investigated for use as gene transfer vectors, including for therapeutic purposes in human patients. Such vectors are modified to incorporate transgenes expressible within cells or tissues. In the case of non-replicating recombinant vectors, the vector genome is further modified to remove essential immediate-type early (IE) genes such as ICP27 and ICP4. This results in a complete virus defect, preventing the expression of early (E) genes involved in viral genome replication and late (L) genes necessary for the assembly of progeny virions. These replication-deficient viruses can be grown on complementary cells that express (compensate for) the missing gene product and subsequently used to infect non-complementary cells, with the viral genome expressing only the therapeutic transgene. However, removing genes from the HSV genome can negatively impact vector productivity, genome stability, and / or transgene expression. [Overview of the project] [Problems that the invention aims to solve]
[0003] Despite several significant advances in this field, obtaining large quantities of high-titer, high-purity, and non-pathogenic vector stocks remains difficult and costly.
[0004] Therefore, there remains a need for non-replicating HSV-1 vectors that can be modified to contain one or more target transgenes, are non-toxic to cells or tissues, and can efficiently proliferate while maintaining the ability to efficiently express the transgenes. [Means for solving the problem]
[0005] The present invention relates to a viral expression skeleton suitable for therapeutic or in vitro applications, a viral expression vector prepared from this skeleton, a pharmaceutical composition containing the same, and related methods.
[0006] In one embodiment, the present invention provides an HSV-1 prevector containing an HSV-1 genome in which a non-essential gene, an essential gene, or a combination thereof is deleted, resulting in a genome containing less than 130 kbp and more than 75 kbp.
[0007] In one embodiment, the present invention provides a modified HSV-1 vector comprising an HSV-1 prevector according to the present invention, wherein one or more nucleic acids and one or more stuffers are introduced into the HSV-1 prevector as defined herein. In the embodiment, one or more nucleic acids are the transgene of interest. In the embodiment, the transgene is part of an expression cassette.
[0008] In one embodiment, the present invention provides a kit comprising an HSV-1 prevector and instructions according to the present invention. In an embodiment, the kit further optionally comprises a plurality of first vials, each first vial independently comprising a stuffer of varying lengths. In an embodiment, the kit further optionally comprises a plurality of second vials, each second vial independently comprising a nucleic acid encoding a cell-targeting protein. [Brief explanation of the drawing]
[0009] [Figure 1A] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1A shows the universal BAC-A_1del single copy vector skeleton. [Figure 1B] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1B shows the universal BAC-A double copy vector skeleton. [Figure 1C] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1C shows the universal BAC-B1Δ-gD detargeting vector skeleton. [Figure 1D] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1D shows the universal Δ-ICP0 detargeting vector skeleton. [Figure 1E] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1E shows the universal Δ-gD+Δ-ICP0 detargeting vector skeleton. [Figure 1F] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1F shows the universal single copy BAC-A_1del+ΔUL39-41 vector skeleton. [Figure 1G] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1G shows the universal single copy BAC-A_1del+ΔUL39-41+ΔUL43-47 vector skeleton. [Figure 1H]An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1H shows the universal skeleton single copy BAC-A_1del+△UL39-41+△UL43-47+△US2-US6 vector skeleton. [Figure 1I] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1I shows the universal skeleton single copy BAC-A_1del+△UL39-41+△UL43-47+△US7-US12 vector skeleton. [Figure 1J] An embodiment of the HSV-1 prevector according to the present invention is shown. Figure 1J shows the universal skeleton single copy BAC-A_1del+△UL39-41+△UL43-47+△US2-US12 vector skeleton. [Figure 2A] This shows one embodiment of stuffer insertion into a pre-HSV-1 vector according to the present invention. Figure 2A shows a universal BAC-A_1del single copy vector skeleton containing a stuffer in Δ-ICP4. [Figure 2B] This shows one embodiment of stuffer insertion into a pre-HSV-1 vector according to the present invention. Figure 2B shows a universal BAC-A_1del single copy vector skeleton containing stuffers in Δ-ICP4 and the intergenic region. [Figure 2C] This shows one embodiment of stuffer insertion into a pre-HSV-1 vector according to the present invention. Figure 2C shows a universal BAC-A_1del single copy vector skeleton including a stuffer at a Δ-joint. [Figure 2D] This shows one embodiment of stuffer insertion into a pre-HSV-1 vector according to the present invention. Figure 2D shows the universal single copy BAC-A_1del+△UL39-41+△UL43-47+△US2-US12 vector skeleton, which includes stuffers in the intergenetic region and in △-joint 1 and △-joint 4. [Figure 2E] This shows one embodiment of stuffer insertion into a pre-HSV-1 vector according to the present invention. Figure 2E shows the universal BAC-B1Δ-gD retargeting vector skeleton. [Figure 2F]Shows one embodiment of insertion of a stuffer into a pre-HSV-1 vector according to the present invention. Figure 2F shows the universal BAC-A_ stuffer in the joint region and the transgene in the LAT region. [Figure 3] Shows an HSV-1 pre-vector, which is the backbone of a modified HSV-1 vector having an optimal size upon transfection into mammalian cells and simultaneous excision of the BAC sequence. Figure 3 shows an HSV-1 pre-vector that does not contain a stuffer, which has a size of approximately 140,978 bp including the BAC sequence (approximately 131,533 bp when the BAC sequence is not included). [Figure 4A] Shows one embodiment of a modified HSV-1 vector. Figure 4A shows one embodiment of a modified HSV-1 vector that does not contain a stuffer and contains the nucleic acid sequence of interest (i.e., the transgene) after BAC excision, and the final DNA size is approximately 131,559 bp. [Figure 4B] Shows one embodiment of a modified HSV-1 vector. Figure 4B shows one embodiment of a modified HSV-1 vector that contains the nucleic acid sequence of interest containing a stuffer (i.e., the transgene) before excision of the BAC module during transfection into mammalian cells, which has a size of approximately 162,978 bp. [Figure 4C] Shows one embodiment of a modified HSV-1 vector. Figure 4C shows the modified HSV-1 vector of Figure 4B after automatic excision of the BAC module, which has a size of approximately 153,533 bp. [Figure 5A] Shows an image showing the results of Oxford Nanopore Technology sequencing of a modified HSV-1 vector having a fragment containing a stuffer. Figure 5A shows the sequencing results of the DNA of the modified HSV-1 vector shown in Figure 4C. [Figure 5B]Figure shows an image representing the results of Oxford Nanopore Technology sequencing of a modified HSV-1 vector having a fragment containing a stuffer. Figure 5B, which does not contain a stuffer, shows the results of sequencing of the DNA of the modified HSV-1 vector shown in Figure 4A representing the amplicon population. Recombinant byproduct amplicons resulting from genome size reduction (Figure 5B) are indicated by red arrows (dark black arrows shown in Figure 5B). [Figure 5C] Figure shows an image representing the results of Oxford Nanopore Technology sequencing of a modified HSV-1 vector having a fragment containing a stuffer. Figure 5C shows the results of sequencing of the DNA of the modified HSV-1 vector with an original size of 138,012 bp, showing the duplication of a DNA region (9,000 bp). Genome duplication resulting from genome size reduction (Figure 5C) is indicated by a red arrow (the dark black arrow shown in Figure 5C). [Figure 6] The figure shows the effect of genomic stability of a plurality of modified HSV-1 vectors of various sizes over multiple passages. MODE FOR CARRYING OUT THE INVENTION
[0010] For the purposes of a clear and concise description herein, features may be described as part of the same or separate aspects or embodiments of the present invention. It will be understood by those skilled in the art that the scope of the present invention may include embodiments having combinations of all or some of the features described herein, whether as part of the same or separate embodiments.
[0011] As used herein, the singular forms "a", "an" and "the" include both singular and plural referents unless the context clearly dictates otherwise.
[0012] Recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within each range in addition to the recited endpoints.
[0013] Throughout this specification, various aspects of the present invention can be presented in range form. It should be understood that range form is merely for convenience and conciseness and should not be interpreted as a strict limitation on the scope of the invention. Therefore, range descriptions should be considered to specifically disclose not only the individual numerical values within that range, but also all possible subranges. For example, a range description such as 1 to 6 should be considered to specifically disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, as well as the individual numerical values within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0014] Where used herein, the term “about” is as understood by those skilled in the art, and to some extent depending on the context in which it is used. Where used herein, when referring to measurable values such as quantity or duration, the term “about” means including variations of ±20% or ±10% from a specified value (including ±5%, ±1%, and ±0.1%), which are appropriate variations for carrying out the disclosed method.
[0015] The wild-type HSV-1 genome is approximately 152 kbp in size and consists of about 90 protein-coding genes and at least 12 microRNAs. However, the majority of this genome encodes non-essential genes, which can, in principle, be individually deleted without significantly inhibiting viral replication and packaging in cultured cells. Furthermore, one or more essential genes can also be deleted, in which case the virus will only replicate if a complementary system (such as a complementary cell line) is present that provides proteins not expressed by the vector genome. Therefore, the HSV-1 genome can be modified to allow for the deletion of non-essential genes, essential genes, or combinations thereof. Overall, these deletions can create a vast genomic space that allows for the introduction and delivery of very large foreign DNA fragments.
[0016] Pre-HSV-1 vector In one embodiment, the present invention provides a mini-HSV-1 skeleton (also known as "mini-HSV-1" or "HSV-1 prevector") obtained by deleting non-essential genes, essential genes, or combinations thereof from the HSV-1 genome, resulting in a genomic skeleton containing less than 130 kbp and more than 75 kbp. The HSV-1 prevector embodying the present invention is described on the premise that, as a "skeleton," one or more nucleic acids can be inserted therein, regardless of the presence or absence of extrinsic regulatory elements.
[0017] According to the present invention, the modifier "essential" in the expressions "essential gene" or "non-essential gene" means that a given gene is (or is not) essential for achieving viral genome replication and packaging, thereby generating infectious progeny virus particles. Essential genes for HSV-1 include UL1, UL5-UL9, UL12, UL14, UL15, UL17-UL19, UL22, UL25-UL38, UL42, UL48, UL49, UL52, UL54, US6, and ICP4 (2 copies). Non-essential genes for HSV-1 include ICP34.5 (2 copies), ICP0 (2 copies), LAT (2 copies), UL2-UL4, UL10, UL11, UL13, UL16, UL20, UL21, UL23, UL24, UL39, UL40, UL41, UL43-UL47, UL50, UL51, UL53, UL55, UL56, US1-US5, and US7-US12.
[0018] In this embodiment, the cluster of deleteable genes is not limited to, but includes, genes UL2, UL3, UL4 (10.200~12.600), genes UL10, UL11 (23.200~25.200), gene UL16 (30.200~31.400), genes UL20, UL21 (40.800~43.700), genes UL23, UL24 (46.700~48.600), genes UL39, UL40, UL41 (86.400~92.700), and genes UL43~UL47 (94.700~103.200). This includes genes UL50, UL51 (107.700~109.100), genes UL55, UL56 (115.400~117.100), one copy of genes LAT, ICP0, UL34.5 (IRL) (118.700~126.100), genes US2~US5 (134.000~138.200), genes US7~US12 (139.700~145.600), and / or a second copy of the ICP0 gene if the first copy within the LAT, ICP0, UL34.5 cluster has already been removed.
[0019] In some embodiments, the HSV-1 prevector includes a genome with at least 23 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 30 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 40 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 45 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 50 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 55 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 60 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 65 kbp deleted. In some embodiments, the HSV-1 prevector includes a genome with at least 75 kbp deleted.
[0020] In some embodiments, the HSV-1 prevector contains a genome with 25kbp–80kbp deleted. In some embodiments, the HSV-1 prevector contains a genome with 30kbp–75kbp deleted. In some embodiments, the HSV-1 prevector contains a genome with 35kbp–70kbp deleted. In some embodiments, the HSV-1 prevector contains a genome with 40kbp–60kbp deleted.
[0021] In embodiments, the present invention provides an HSV-1 prevector comprising an HSV-1 genome in which a non-essential gene, an essential gene, or a combination thereof is deleted, and which has reached a genomic backbone containing less than 130 kbp and more than 75 kbp.
[0022] In embodiments, the HSV-1 prevector further includes a bacterial artificial chromosome (BAC) sequence. As used herein, a BAC is an engineered DNA molecule used in a manner that allows it to grow as a circular artificial chromosome within a bacterium. The BAC vector is a plasmid constructed using an E. coli (E. coli) F factor as an origin of replication and is therefore capable of being maintained as a single copy per cell. These vectors can hold DNA fragments up to 300 kb (see, for example, Figures 3 and 4A-C).
[0023] In principle, it is possible to delete all non-essential HSV-1 genes within BACs that grow in bacteria. However, deleting all of them at once is highly likely to result in a dysfunctional virus that is too weakened to efficiently replicate in mammalian cultured cells. Furthermore, the size of the HSV-1 prevector genome itself is important; if the genome is too short or too long, it cannot be packaged correctly, so the size needs to be corrected.
[0024] It is important that the HSV-1 prevector of the present invention maintains a sufficient HSV-1 genome so as not to become an HSV-1 amplicon. "Amplicon or amplicon vector" refers to a helper-dependent vector having a genome lacking most or all of the HSV genes encoding viral proteins. The genome of an amplicon vector is a chain of DNA consisting of multiple copies of a plasmid (known as an amplicon plasmid) linked in tandem, each having one DNA replication origin and one packaging signal derived from an HSV-1 genome. In cells where all the structural, replication, and DNA packaging functions from HSV-1 are expressed, the amplicon plasmid is amplified by a rolling circle mechanism to form a long head-to-tail concatemer. These are then cleaved and packaged into HSV-1 viral particles up to the size of a single genome (Kwong and Frenkel, 1985; Bataille and Epstein, 1997). Therefore, an ampliconvector is a concatemer-like plasmid DNA packaged in an HSV-1 particle.
[0025] Modified HSV-1 vector As described herein, the HSV-1 prevectors of the present invention have deletions in the HSV genome, resulting in the HSV-1 prevectors having a genomic backbone of less than 130 kbp and greater than 75 kbp. As stated above, these prevector "backbones" of the present invention are vector templates, and the deletions create genomic space that allows for the introduction of one or more target nucleic acid sequences. By introducing one or more nucleic acid sequences, for example, a target transgene, the genomic size (i.e., number of base pairs) of the modified HSV-1 vector according to the present invention increases. While not intended to be bound by any particular theory, if the modified HSV-1 vector of the present invention is approximately the same size as the wild-type HSV-1 genome (152 kbp), the resulting modified HSV-1 vector is thought to be more genomically stable and therefore have improved vector viability.
[0026] In embodiments, the present invention provides a modified HSV-1 vector comprising one or more target nucleic acid sequences and one or more stuffers, wherein the modified HSV-1 vector genome size is approximately 138 kbp to approximately 168 kbp.
[0027] In embodiments, the present invention provides a modified HSV-1 vector comprising one or more target nucleic acid sequences and one or more stuffers, wherein the modified HSV-1 vector genome size is approximately 142 kbp to approximately 160 kbp.
[0028] In any embodiment disclosed herein, at least one of the one or more target nucleic acid sequences encodes the target protein.
[0029] In any embodiment disclosed herein, one or more target nucleic acid sequences include one or more target transgenes, one or more nucleic acids encoding cell-targeting proteins, or a combination thereof. In any embodiment disclosed herein, one or more nucleic acid sequences include one or more target transgenes. For clarity, the term “one or more target nucleic acid sequences” does not include one or more stuffers described herein.
[0030] In any embodiment disclosed herein, one or more target nucleic acid sequences can be introduced into the HSV-1 prevector skeleton by site-directed recombination (SSR), homologous recombination (HR), or en passant mutagenesis techniques. In any embodiment disclosed herein, one or more target nucleic acid sequences are introduced by homologous recombination or en passant mutagenesis techniques.
[0031] In one embodiment, the modified HSV-1 vector comprises one or more transgenes and one or more stuffers, and the modified HSV-1 vector can sustainly express one or more transgenes, such as therapeutic transgenes.
[0032] In any embodiment of this specification, the size of the modified HSV-1 genome after the addition of one or more stuffers and one or more target nucleic acids is approximately 138 kbp to 168 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 142 kbp to 164 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 142 kbp to 155 kbp. In a preferred embodiment of this specification, the size of the modified HSV-1 genome is approximately 142 kbp to 153 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 159 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 156 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 150 kbp to 156 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 153 kbp.
[0033] In any embodiment described herein, the size of the modified HSV-1 genome after the addition of one or more stuffers and one or more target nucleic acids is approximately 142 kbp to 160 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 142 kbp to 158 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 142 kbp to 155 kbp. In a preferred embodiment described herein, the size of the modified HSV-1 genome is approximately 142 kbp to 153 kbp.
[0034] In any embodiment described herein, the size of the modified HSV-1 genome is approximately 143 kbp to 160 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 143 kbp to 158 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 143 kbp to 155 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 143 kbp to 153 kbp.
[0035] In any embodiment described herein, the size of the modified HSV-1 genome is approximately 145 kbp to 160 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 145 kbp to 158 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 145 kbp to 155 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 145 kbp to 153 kbp.
[0036] In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 160 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 158 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 155 kbp. In any embodiment of this specification, the size of the modified HSV-1 genome is approximately 147 kbp to 153 kbp.
[0037] In any embodiment described herein, the size of the modified HSV-1 genome is approximately 149 kbp to approximately 160 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 149 kbp to approximately 158 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 149 kbp to approximately 155 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 149 kbp to approximately 153 kbp.
[0038] In any embodiment described herein, the size of the modified HSV-1 genome is approximately 150 kbp to 155 kbp. In any embodiment described herein, the size of the modified HSV-1 genome is approximately 150 kbp to 153 kbp.
[0039] In this specification, the term “stuffer” refers to any random non-coding DNA sequence and / or one or more target genes, or a combination thereof. The primary purpose of the stuffer is to reintroduce nucleic acids of appropriate size (base pairs) so that, based on the initial size of the HSV-1 prevector, the size of the modified HSV-1 vector is equal to or close to the size of the wild-type HSV-1 genome, i.e., approximately 152 kbp, after all other target nucleic acids (e.g., one or more transgenes and / or one or more exogenous nucleic acids and / or one or more endogenous nucleic acids) have been added to the HSV-1 prevector. In selecting a stuffer, the properties of the stuffer, the size of the stuffer, and the placement of the stuffer within the genome of the modified HSV-1 vector of the present invention are taken into consideration.
[0040] Therefore, the design of the stuffers is determined last, after all other design decisions regarding the modified HSV-1 vector have been made. For example, if the HSV-1 prevector of the present invention contains 105 kilobase pairs (kbps) and the transgene described herein contains 5 kbps, then one or more stuffers containing a total of approximately 33 kbps to 58 kbps are introduced into the modified HSV-1 vector. Alternatively, in this scenario, one or more stuffers containing a total of approximately 36 kbps to 50 kbps are introduced. Alternatively, in this scenario, one or more stuffers containing a total of approximately 39 kbps to 47 kbps are introduced. Alternatively, in this scenario, one or more stuffers containing a total of approximately 42 kbps are introduced.
[0041] In embodiments, one or more stuffers include non-coding DNA sequences. For example, in one embodiment, scrambled sequences derived from the HSV-1 genome (e.g., scrambled HSV-1 DNA) can be used. The scrambled sequences of HSV-1 DNA are each 20 nucleotides or less, but may include sequences representative of the entire genome so as to preserve a similar GC content and "natural pattern," e.g., "natural behavior," of the HSV-1 DNA.
[0042] In one embodiment, one or more stuffer sequences have a GC content in the range of 60% to 75%. In another embodiment, the stuffer sequence has a GC content in the range of 65% to 69%. In a preferred embodiment, the stuffer sequence has a GC content in the range of 67% to 68%.
[0043] Sequences of 20 nucleotides or less can be repeated by one or more stuffers until the desired size is achieved. These sequences can be obtained from non-coding DNA to avoid introducing transcriptionally important signals. Furthermore, sequences such as Kozak sequences, start codons, repetitive sequences, potential miRNA clusters, and long palindromes should not be included. Additionally, sequences present in the human genome or the genome of the manufacturing cell line should not be included to avoid vector genome recombination. Stop codons can be periodically introduced to prevent the occurrence of long open reading frames. In general, random DNA stuffers should be of no biological significance, as their usefulness is limited solely to size increase.
[0044] In some embodiments, one or more stuffers may be scrambled nucleotide sequences of genes deleted from the HSV-1 genome.
[0045] In the embodiment, one or more stuffers may be derived from cellular DNA introns that have been modified to avoid vector genome recombination.
[0046] In embodiments, the stuffer can be divided into two or more fragments and inserted at different locations within the HSV-1 prevector genome. In preferred embodiments, the two or more stuffer fragments must not have homologous sequences in order to avoid internal recombination within the vector genome.
[0047] In some embodiments, the primary purpose of one or more stuffers may be achieved by any random non-coding DNA sequence and / or one or more target genes, or a combination thereof. That is, the role of the “stuffer” in restoring the size of the modified HSV-1 vector genome to approximately 152 kb may be achieved by using only any random non-coding DNA sequence. Alternatively, in some embodiments, the role of the stuffer may be achieved by using one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, one or more target exogenous genes (as defined herein), either alone or in combination thereof, with or without the use of one or more random non-coding DNA sequences.
[0048] The term "transgene" refers to a specific nucleic acid sequence that codes for coding RNA or non-coding RNA, and / or polypeptides or parts of polypeptides, which are expressed in the cell into which the nucleic acid sequence is introduced. The term "transgene" includes (1) nucleic acid sequences that do not naturally exist in the cell (i.e., heterologous nucleic acid sequences), (2) nucleic acid sequences that are variants of nucleic acid sequences that naturally exist in the target cell, (3) nucleic acid sequences that serve to add an additional copy of an identical (i.e., homologous) or similar nucleic acid sequence that naturally exists in the introduced cell, or (4) naturally occurring or homologous nucleic acid sequences that are silent and whose expression is induced in the introduced cell. "Mutant" means a nucleic acid sequence that contains one or more nucleotides that differ from the wild-type or naturally occurring sequence. That is, a mutant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and / or insertions. In some cases, the transgene may include a sequence encoding a leader peptide or signal sequence so that the transgene product is secreted from the cell, or it may include both a leader peptide or signal sequence and a membrane-anchored peptide, or it may be a fusion protein of two naturally occurring proteins or parts thereof so that the transgene remains fixed to the cell membrane, or it may include a sequence that allows the protein to accumulate in a specific region within the cell, such as a nuclear localization signal.
[0049] Non-limiting examples of transcription sequences included in the transgenes within the vector of the present invention include, but are not limited to, sequences expressing long transgenes, sequences expressing transgenes capable of generating different splice variants, sequences expressing two or more transgenes as a single transcription unit or as separate transcription units, sequences expressing transgenes under the control of very long upstream and / or downstream regulatory sequences, sequences expressing short regulatory RNAs (miRNA, siRNA, etc.), sequences conferring the ability to be replicated and correctly separated in dividing cells, or combinations of the above sequences.
[0050] As described above, the vector of the present invention may include at least one transgene inserted in a functionally linked manner with one or more LTE and / or DNA insulator sequences within the HSV-1 prevector. Here, "functionally linked" means that one or more LTE and / or DNA insulator sequences enable the transgene to be expressed in an intracellular environment where the genetic elements (i.e., "genes") originally present in the HSV genome are transcriptionally inactive.
[0051] The transgene inserted into the vector of the present invention contains at least one promoter sequence and a transcription sequence, the transcription sequence being controlled by the promoter. As used herein, “promoter” is a DNA regulatory region in mammalian cells that can bind RNA polymerase and initiate the transcription of a downstream (3' direction) sequence that is operably linked. For the purposes of the present invention, the promoter sequence contains at least the minimum number of bases or elements necessary to initiate the transcription of the gene of interest at a level detectable above background levels. The promoter sequence contains a transcription initiation site and an RNA polymerase binding domain. Eukaryotic promoters often, though not always, contain a “TATA” box and other DNA motifs such as a “CAT” box or “SP1” box.
[0052] The promoter within the transgene can be any desired promoter for controlling / regulating the expression of the transcribed sequence. For example, a promoter may be a cell-specific or tissue-specific promoter (e.g., EOS, OCT4, Nanog (for ESC / iPSC), SOX2 (for neural stem cells), aMHC, Brachyury, Tau, GFAP, NSE, Synapsin I (for nerve cells), Apo AI, Albumin, ApoE (for liver), MCK, SMC α-Actin, Myosin heavy chain, Myosin light chain (for muscle cells), etc.), for example, a promoter that specifically or preferentially regulates gene expression in a particular cell type (e.g., hepatocytes, lung cells, epithelial cells, cardiomyocytes, nerve cells, skeletal muscle cells, embryonic stem cells, induced pluripotent stem cells, other stem cells, cancer cells, etc.).
[0053] In embodiments, promoters used for sensory nerve cells include promoters for genes encoding sensory nerve receptors such as Transient Receptor Potential Vanilloid 1 (TRPV1) or Transient Receptor Potential cation channel subfamily M member 8 (TRPM8), or promoters for genes encoding sensory neuromodulators or sensory neurotransmitters, such as promoters for Substance P, PACAP, or Calcitonin Gene Related Peptide (CGRP). In embodiments, the promoter for a gene encoding a sensory nerve receptor according to the present invention is a promoter of the TRP gene family, more preferably promoter TRPV1 or TRPM8. In embodiments, the promoter for a gene encoding a sensory neuromodulator or sensory neurotransmitter according to the present invention is CGRP, or a promoter of a gene involved in neurite outgrowth and stress response in sensory nerve cells, preferably a promoter for a gene encoding advilin (ADVL). In other embodiments, the promoter within the transgene inserted into the vector of the present invention may be an inducible promoter.
[0054] In any embodiment disclosed herein, one or more transgenes may be part of one or more expression cassettes. As used herein, the term “expression cassette” refers to a nucleic acid sequence comprising a promoter and a downstream coding sequence or transgene, wherein expression is driven by the promoter, followed by a polyadenylation signal.
[0055] In embodiments, the promoter in the transgene expression cassette inserted into the vector of the present invention may be a constitutive mammalian promoter, such as those well known to those skilled in the art (e.g., EFlα, UbC, β-actin, PGK, etc.).
[0056] In addition to promoters and coding sequences, the transgenes inserted into the genome of the vector of the present invention may also include additional regulatory elements. For example, a transgene may include one or more sites for microRNA binding. The presence of such sites promotes downregulation of transgene expression in specific cell types. Therefore, for example, a vector containing a transgene that is desired to be specifically expressed in cancer cells or tumor cells (which may be toxic to many cell types) may include binding sites for microRNA in "normal" (i.e., non-malignant) cells. This suppresses the expression of the transgene in non-malignant cells.
[0057] In embodiments, the transgene in the vector of the present invention may be monocistronic (i.e., encoding a single mRNA and producing a single protein or polypeptide) or polycistronic (i.e., encoding multiple mRNAs and producing multiple proteins or polypeptides). Alternatively, it may be possible to express one or more mRNAs encoding self-cleaving polyproteins. In embodiments, all or part of the transcriptional region of the transgene may also encode non-coding RNA such as siRNA or miRNA. In embodiments, the vector of the present invention may contain multiple distinct monocistronic or polycistronic transgene units, each having its own promoter, translational sequence or non-coding RNA sequence, and other regulatory elements.
[0058] In any embodiment disclosed herein, one or more target nucleic acid sequences can be introduced at various locations, such as LAT regions, one or more intergenetic regions, one or more gene regions, or combinations thereof.
[0059] A LAT (Latency Associated Transcripts) locus or region is a repeat locus contained within the inverted repeat sequence known as b and b' of the viral genome. The b and b' sequences of the viral genome are also known as TRL (Terminal Repeat Long) and IRL (Internal Repeat Long), respectively. In embodiments, the pre-HSV-1 vector genome contains both LAT regions, one in the TRL and the other in the IRL. In embodiments, one of the LAT regions, either in the TRL or IRL, is deleted. In embodiments, if the pre-HSV-1 vector genome contains two LAT loci, foreign DNA can be introduced into both the TRL and IRL loci, as shown in Figure 1B. In embodiments, if the LAT locus in the IRL region is deleted, foreign DNA can be introduced only into the LAT locus in the TRL region. In embodiments, if the LAT locus in the TRL region is deleted, foreign DNA can be introduced only into the LAT locus in the IRL region.
[0060] The LAT locus includes an upstream DNA insulator (INS) sequence, a latency-associated promoter (LAP), a region conferring long-term expression (LTE), and a downstream DNA insulator (INS). In embodiments, foreign DNA is introduced either between the latency-associated promoter (LAP) and the long-term expression (LTE) region (as shown in Figures 4A-C), or between the LTE region and a DNA insulator (INS) sequence located downstream of the LTE (as shown in Figures 1A and 1B).
[0061] Importantly, the LAT locus contains both the long-term expression (LTE) region and a DNA insulator sequence (INS) that confers long-term expression to any foreign DNA introduced into this region (e.g., a therapeutic transgene). In embodiments, the foreign DNA is localized between the long-term expression (LTE) region and the downstream DNA insulator (INS) motif.
[0062] A “long-term expression sequence” or “long-term expression element (LTE)” refers to a nucleotide sequence that, when operably ligated with the target foreign DNA, enables sustained expression of a gene product for 15–45 days, 30–45 days, 45–90 days, 90–365 days, 365 days to several years, or even throughout the patient's lifetime. In HSV-1, the long-term expression (LTE) sequence was identified as a region of the latent-associated transcript (LAT) derived from the LAT-associated promoter (LAP). This LTE is located downstream of the LAT transcription start site. Preferably, the LTE is located between approximately 1.5 kb and 3 kb downstream of the LAT transcription start site. Furthermore, DNA insulators also contribute to providing long-term expression. While not intended to be bound by any particular theory, DNA insulators may suppress epigenetic silencing. The sequences conferring long-term expression (both LTE and DNA insulator sequences) can be located either upstream and / or downstream of the foreign DNA.
[0063] Those skilled in the art will recognize that other LTE-like sequences and other DNA insulator sequences have been reported to date and are still being discovered. All such LTE-like sequences and DNA insulator sequences are included in the present invention.
[0064] In this specification, the term "exogenous gene of interest" includes, but is not limited to, reporter genes whose expression is driven by transient promoters for internal expression regulation or for in vivo distribution studies (e.g., GFP, RFP, luciferase, or fusion proteins), recombinases whose expression is driven by inducible promoters that enable modification of cellular or viral genes in vivo, antibiotic resistance genes such as chloramphenicol, components of tetracycline-inducible systems (TREs), any foreign DNA encoding a gene of interest, or combinations thereof. The use of reporter genes such as cherry, RFP, GFP, or CFP facilitates the identification of recombinant genomes, assessment of stuffer stability, and measurement of both infectious particles (PFUs) and transducing units (TUs).
[0065] In embodiments, the modified HSV-1 vector of the present invention comprises two or more target nucleic acid sequences, which may be identical or different, and can be introduced into one or more intergeneric regions (IRs) of the modified HSV-1 vector. As used herein, an intergeneric region generally refers to the space between the poly(A) signals of two genes having a convergent orientation. Multiple IRs have been reported in the viral genome that can introduce long foreign DNA fragments without interfering with the proliferation of neighboring gene expression, such as IRs localized between genes UL3 and UL4, between genes UL7 and UL8, between genes UL26 and UL27, or between genes UL35 and UL36. In embodiments, one of the nucleic acid sequences is introduced into the LAT region.
[0066] In embodiments, the modified HSV-1 vector of the present invention further comprises a third target nucleic acid sequence, which may be identical or different from the first and / or second target nucleic acid sequences, and may be introduced into an intergenetic region (IR) or a gene region. In embodiments, the third target nucleic acid sequence is introduced into an intergenetic region (IR) different from the IRs of the first and second target nucleic acid sequences. In embodiments, the third target nucleic acid sequence is introduced into a gene region.
[0067] In embodiments, the third target nucleic acid sequence includes exogenous or endogenous DNA, or a combination thereof, in the modified HSV-1 vector of the present invention. In embodiments, the third target nucleic acid sequence provides exogenous DNA in the modified HSV-1 vector. In embodiments, the third nucleic acid sequence provides endogenous DNA in the modified HSV-1 vector. In embodiments, the third target nucleic acid sequence provides a combination of exogenous and endogenous DNA in the modified HSV-1 vector.
[0068] In embodiments, the introduction of a third target nucleic acid sequence plays two important roles. The first role is to introduce the target DNA into the modified HSV-1 vector. The second objective is to bring the size of the modified HSV-1 vector produced from the HSV-1 prevector to a final size of approximately 152 kb, or in the range of 142 kb to 155 kb. In other words, the genome size of the modified HSV-1 vector produced from the HSV-1 prevector of the present invention is equivalent to the size of the wild-type HSV-1 genome.
[0069] In some embodiments, the third nucleic acid sequence to be introduced is selected from one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, one or more exogenous genes of interest (as defined herein), or a combination thereof.
[0070] In some embodiments, the third nucleic acid sequence is one or more HSV-1 essential genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer as defined herein and one or more HSV-1 essential genes.
[0071] In some embodiments, the third nucleic acid sequence is one or more non-essential HSV-1 genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer and one or more non-essential HSV-1 genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer, one or more essential HSV-1 genes, and one or more non-essential HSV-1 genes. In some embodiments, the third nucleic acid sequence is a combination of one or more essential HSV-1 genes and one or more non-essential HSV-1 genes.
[0072] In some embodiments, the third nucleic acid sequence is one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer and one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer, one or more HSV-1 essential genes, and one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of a stuffer, one or more HSV-1 non-essential genes, and one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, and one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of one or more HSV-1 essential genes and one or more target exogenous genes. In some embodiments, the third nucleic acid sequence is a combination of one or more HSV-1 non-essential genes and one or more exogenous genes of interest.
[0073] In some embodiments, when the third nucleic acid sequence is introduced into a gene region, it is introduced into a region containing the HSV essential gene encoding glycoprotein D (gD), which may result in an inactivation deletion of gD. In some embodiments, the gD inactivation deletion includes a deletion of the entire gD coding sequence. By introducing the third nucleic acid sequence into the gD deletion and its location, the gD sequence can be replaced with another cell-targeting sequence. In some embodiments, the original gD sequence or a modified version thereof can be reintroduced by the third nucleic acid sequence.
[0074] In some embodiments, the inactivation deletion of gD includes a deletion of a portion of the gD coding sequence. For example, the inactivation deletion may include a deletion of amino acids 6-38 of gD, which is primarily involved in cell targeting. By introducing a third nucleic acid sequence into this region, it is possible to replace the gD cell targeting sequence with another cell targeting sequence. For example, the gD cell targeting sequence can be replaced with scFv (a single-chain antibody) against HER2. In some embodiments, the original gD cell targeting sequence or a modified version thereof can be reintroduced by the third nucleic acid sequence.
[0075] In some embodiments, the modified HSV-1 vector of the present invention comprises at least a fourth nucleic acid sequence, the fourth nucleic acid sequence comprising one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, one or more exogenous genes of interest, or a combination thereof.
[0076] In some embodiments, the modified HSV-1 vector of the present invention comprises at least a fourth nucleic acid sequence, the fifth nucleic acid sequence comprising one or more HSV-1 essential genes, one or more HSV-1 non-essential genes, one or more exogenous genes of interest, or a combination thereof.
[0077] In some embodiments, the modified HSV-1 vector of the present invention comprises one or more nucleic acid sequences, including DNA sequences encoding cell-targeting proteins, such as endogenous and / or exogenous DNA sequences. These cell-targeting proteins can retarget viral entry to any desired tissue or cell type. Cell-targeting genes inserted into the modified HSV-1 vector of the present invention include, but are not limited to, HER-2, IL13α2, or modified versions thereof. An example of a modified gD can be found, for example, in European Patent No. 3469071, which is incorporated herein by reference.
[0078] In any embodiment of this specification, the size of one or more stuffers is determined based on the size of other nucleic acid sequences introduced into the modified HSV-1 vector (e.g., one or more transgenes and / or one or more nucleic acids encoding cell-targeting proteins).
[0079] For example, if the HSV-1 prevector of the present invention contains 105 kilobase pairs (kbp), and a transgene containing 5 kbp and a nucleic acid encoding the cell-targeting sequence described herein containing 3 kbp are introduced, then one or more stuffers totaling approximately 25 kbp to 55 kbp are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 33 kbp to 47 kbp are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 36 kbp to 44 kbp are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 40 kbp are introduced.
[0080] For example, if the HSV-1 prevector of the present invention comprises 105 kilobase pairs (kbps) and a transgene containing 5 kbps, and a nucleic acid encoding a cell-targeting sequence described herein containing 3 kbps is introduced, then one or more stuffers totaling approximately 30 kbps to approximately 50 kbps are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 32 kbps to approximately 45 kbps are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 34 kbps to approximately 42 kbps are introduced. Alternatively, in this scenario, one or more stuffers totaling approximately 39 kbp are introduced.
[0081] In any embodiment of this specification, the stuffer can be introduced into the modified HSV-1 vector of the present invention as a single long nucleic acid sequence. In embodiments, the stuffer can be introduced into the modified HSV-1 vector of the present invention as two or more stuffers of the same or different lengths.
[0082] In embodiments, the stuffer can be introduced as multiple smaller stuffers in different intergenic regions of the modified HSV-1 genome. In embodiments, the smaller stuffers may be the same length or different.
[0083] It is important to note that if the BAC sequence is present in the HSV-1 prevector, it can be removed when preparing the modified HSV-1 vector of the present invention. Therefore, when the BAC sequence is removed in the final modified HSV-1 vector, its size is not considered when determining the size of one or more stuffers in order to make the modified HSV-1 vector approximately 152 kbp.
[0084] Therefore, the preparation of any modified HSV-1 vector from an HSV-1 prevector also requires the construction of a cell line that simultaneously complements the deleted essential gene and, optionally, one or more of these non-essential genes.
[0085] Therefore, in order to facilitate the culture, production, and proliferation of the modified HSV-1 vector of the present invention and the preparation of its stock, one aspect of the present invention provides a complementary cell line that complements the gene deleted from the HSV genome. Accordingly, preferred complementary cells according to the present invention are derived from cell types that naturally complement the deleted HSV gene. Such cells can be manipulated to express such gene by methods well known to those skilled in the art (for example, by introducing an expression cassette into the cell and expressing the gene from a gene construct other than the HSV genome, such as a cell chromosome).
[0086] Furthermore, complementary cell lines can be engineered to express genes encoding selection markers, such as markers commonly used in the manipulation of packaging cells or other cells expressing exogenous genes. Suitable selection genes include those that confer resistance to neomycin / G418, hygromycin, blasticidine, promycin, and zeosin.
[0087] It will be understood that methods for manipulating a source cell type (e.g., Vero cells) to include expression constructs encoding deleted HSV proteins and other proteins (such as recombinases and / or select gene products) are well known to those skilled in the art. For example, a gene of interest with a select marker can be subcloned into a lentiviral vector, source cells can be infected with the lentiviral vector, sorted based on marker expression (e.g., blastisidine resistance), and then the expression of the gene of interest can be confirmed.
[0088] The complementary cells of the present invention are capable of proliferation and cloning. Accordingly, the present invention provides a clonal population, i.e., a cell line, that comprises, or is derived from, or essentially derived from, the complementary cell lines described herein.
[0089] The modified HSV-1 vector of the present invention can be propagated using the complementary cells of the present invention. Therefore, the present invention provides a method for propagating the modified HSV-1 vector of the present invention. According to the method of the present invention, a complementary cell line is infected with the modified HSV-1 vector and cultured until plaques are formed. The viral population is amplified by repeatedly passaging infectious particles into increasingly larger populations of fresh complementary cells. In these repeated passagings, the MOI (metabolic area) can be approximately 0.001 pfu / cell to approximately 0.03 pfu / cell. Finally, the vector of the present invention (as a packaged virus) is purified from the cells with a 90% cytopathic effect.
[0090] Generally, the modified HSV-1 vector of the present invention is most useful when it can deliver a sufficient amount of virus to a cell population and ensure that the cells are exposed to an appropriate number of viruses. Therefore, the present invention provides a stock, preferably a homogeneous stock, containing the modified HSV-1 vector of the present invention. The preparation and analysis of HSV stocks are well known to those skilled in the art. For example, a viral stock can be produced in a roller bottle containing cells infected with the HSV-1 vector. The viral stock can then be purified by continuous gradient, aliquoted, and stored until needed. The titer of a viral stock varies considerably, mainly depending on the genotype of the virus and the protocol and cell line used for its preparation. Preferably, the viral titer of such a stock is about 10 6 pfu / ml, or more preferably about 10 7 The titer is pfu / ml (or at least approximately such a value). In a more preferred embodiment, the titer is about 10 8 pfu / ml, or approximately 10 9 It is pfu / ml (or at least close to that value), and about 10 10 pfu / ml or about 10 11 pfu / ml, or even approximately 10 12A high-titer stock of pfu / ml (or at least approximately such a value) is most preferred. Therefore, the titer of the HSV-1 vector stock according to the present invention is about 10 6 pfu / ml to about 10 12 pfu / ml (preferably about 10 9 to about 10 11 pfu / ml).
[0091] The present invention further provides a composition comprising the HSV-1 prevector and / or modified HSV-1 vector of the present invention, and a physiologically acceptable carrier. The carrier of the composition may be any carrier suitable for the vector. The carrier is preferably a pharmaceutically acceptable (e.g., physiologically or pharmacologically acceptable) carrier (e.g., an excipient or diluent). Pharmacologically acceptable carriers are well known and readily available. The choice of carrier is determined, at least in part, by the particular vector and the particular method used to administer the composition. The composition may further comprise any other suitable ingredients, particularly to improve the stability of the composition and / or its end use. Accordingly, a wide variety of suitable formulations exist for the composition of the present invention. The following formulations and methods are merely exemplary and are not limiting in any way.
[0092] Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which may comprise antioxidants, buffers, antibacterial agents, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may comprise suspending agents, solubilizers, thickeners, stabilizers, and preservatives. The formulations can be presented in sealed single-dose or multi-dose containers such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid excipient such as water for injection immediately before use.
[0093] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind described above.
[0094] Furthermore, the composition may contain additional therapeutic agents or bioactive agents. For example, it may contain therapeutic factors useful for treating specific indications. By including anti-inflammatory factors such as ibuprofen or steroids in the composition, swelling, inflammation, and physiological discomfort associated with the in vivo administration of the vector can be reduced. By administering immunosuppressants in conjunction with the composition method, immune responses to the vector itself or to the disease can be reduced. Alternatively, immunoenhancing agents may be included in the composition to enhance the body's natural defense mechanisms against the disease. Antibiotics, i.e., bactericides and fungicides, can be included to reduce the risk of infection associated with gene transfer procedures and other diseases.
[0095] Using the modified HSV-1 vector of the present invention (as well as stocks and compositions containing this vector), the present invention provides a method for expressing a transgene in nucleated cells, particularly non-complementary cells. According to this method, the vector of the present invention is exposed to cells under conditions suitable for the vector's infection. Upon cell infection, the transgene is transcribed (expressed) within the cell unless the promoter within the transgene is active and the transgene is not repressed by other regulatory mechanisms (e.g., microRNAs discussed herein). In other words, the vector of the present invention functions as a gene transfer and expression vector in mammalian cells.
[0096] The present invention can be used, as necessary, to express transgenes in cells, either in vivo or in vitro. In vivo use, the cells may be any type of desired cell, including exocrine cells (e.g., glandular cells such as salivary gland cells, mammary gland cells, sweat gland cells, and digestive gland cells), hormone-secreting glandular cells (e.g., pituitary cells, thyroid cells, parathyroid cells, and adrenal cells), ectoderm-derived cells (e.g., keratinized epithelial cells (those that make up skin and hair), moist multilayer barrier epithelial cells (e.g., those of the cornea, tongue, oral cavity, digestive tract, urethra, vagina, etc.), nervous system cells (e.g., peripheral and central nervous system cells, glial cells, etc.)), mesoderm-derived cells, cells of many internal organs (e.g., kidney, liver, pancreas, heart, lung, etc.), bone marrow cells, and cancer cells located in tumors or other locations. Preferred and not limited examples of cells suitable for infection with the vector of the present invention include hepatocytes, lung cells, epithelial cells, cardiomyocytes, adipocytes, muscle cells, stem cells, and cancer cells.
[0097] When the method of the present invention is used in vivo, if the transgene in the vector encodes one or more prophylactically or therapeutically active proteins, polypeptides, or other factors (e.g., non-coding RNAs (ncRNAs) such as siRNA or miRNA), it can treat a disease or condition in the subject. Accordingly, the present invention provides a method for treating a disease or condition in the subject, comprising administering the vector of the present invention to the subject in an amount and location sufficient to infect the subject's cells, thereby causing the transgene to be expressed in the subject's cells, and the transgene encoding one or more prophylactically or therapeutically active proteins, polypeptides, or ncRNAs. For example, the disease or condition is a type of cancer, in which case the transgene may encode a factor that enhances tumor-killing activity (e.g., TRAIL or tumor necrosis factor (TNF)).
[0098] In other embodiments, the method of the present invention can be used in vitro to induce the expression of a transgene in cells under culture. Here again, any type of cell, such as stem cells and fibroblasts, e.g., human dermal fibroblasts (HDF) or human lung fibroblasts (HLF), can be infected in vitro using the method of the present invention. Other preferred cell types suitable for in vitro use include keratinocytes, peripheral blood mononuclear cells, hematopoietic stem cells (CD34+), or mesenchymal stem cells / progenitor cells. In one embodiment, the transgene encodes one or more factors that may affect cell differentiation.
[0099] In embodiments, when cells are infected in vivo or in vitro using the vector, composition, or stock of the present invention, the cells may be any mammalian nucleated cells in which the expression of the transgene is desired. Therefore, this vector can be used to infect cells of many mammalian species. The method of the present invention is considered applicable to veterinary treatments for reproduction in animals such as cattle, horses, sheep, goats, and pigs, such as expressing exogenous genes or supplementing deficient genes. Similarly, the method of the present invention can also be used in veterinary applications for companion animals such as cats and dogs.
[0100] The modified HSV-1 vector of the present invention can be used in human vivo to produce drugs or factors that are effective for prevention or treatment in a clinical setting. These factors (supplied by the expression of one or more transgenes in the vector of the present invention) can be exogenous or can complement a genetic defect.
[0101] In embodiments, the present invention provides a kit comprising an HSV-1 prevector and instructions according to the present invention. In embodiments, the kit optionally further comprises a plurality of first vials, each first vial independently comprising identical or varying lengths of stuffers. In embodiments, the kit optionally further comprises a plurality of second vials, each second vial independently comprising identical or different nucleic acids encoding cell-targeting proteins.
[0102] In any embodiment of the present invention, the HSV-1 subspecies can be replaced with HSV-2 in either the HSV-1 prevector or the modified HSV-1 vector of the present invention.
[0103] The following embodiments further illustrate the present invention, but should be understood as not limiting the scope of the invention in any way. [Examples]
[0104] In the preparation of the pre-HSV-1 vector according to the present invention, the gene clusters that may be potentially deleted include, but are not limited to, the following: 1. Genes UL2, UL3, UL4 (10,200~12,600): 2,400 nt, 2. Genes UL10, UL11 (23,200~25,200): 2,000 nt, 3. Gene UL16 (30,200~31,400): 1,200 nt, 4. Genes UL20, UL21 (40,800~43,700): 2,900 nt, 5. Genes UL23, UL24 (46,700~48,600): 1,900 nt, 6. Genes UL39, UL40, UL41 (86,400~92,700): 6,300 nt, 7. Genes UL43~UL47 (94,700~103,200): 8,500 nt, 8. Genes UL50, UL51 (107,700~109,100): 1,400 nt, 9. Genes UL55, UL56 (115,400~117,100): 1,700 nt, 10. One copy of gene LAT, ICP0, UL34.5(IRL): (118,700~126,100): 7,400 nt, 11. Genes US2~US5 (134,000~138,200): 4,200 nt, and / or 12. Genes US7~US12 (139,700~145,600): 5,900 nt.
[0105] In addition to two copies of ICP4 (127,200–131,300: 4,100 nts) and one copy of ICP27 (113,800–115,300: 1,500 nts), there is a potential deletion of 45,800 nts of non-essential DNA (totaling 9.7). Including these two genes, the total deletion of the skeleton could be 9.7 + 45.8 = 55.5 kbp. These figures are approximate, and the estimated value is probably around 3 kbp. At a moderate level of deletion, in a skeleton with fewer deletions, the deletions may be limited to cluster numbers 6, 7, 10, 11, and 12 (as mentioned above). In this case, the total deletion would be 43.5 kbp.
[0106] This deletion can be introduced into the HSV-1 genome derived from the wild-type genome of the HSV-1F strain, which contains a BAC module (pBeloBAC11) inserted into the intergenetic region between genes UL3 and UL4 (BAC-HSV-1).
[0107] Before initiating the deletion of non-essential genes, two essential genes, namely ICP27 and ICP4 (both copies), can be deleted from BAC-HSV-1. The promoters of both ICP22 / 47 genes can be slightly modified by deleting the TAATGARAT box. Thus, this is a non-replicating (NR) vector genome that can be proliferated in Vero7b (or other complementary) cells. Furthermore, it is also possible to introduce transgenes (e.g., BoNT-F or Luc, etc.) into the LAT region. Combining a single large deletion from the ICP27 coding gene (including the entire joint region containing one copy of ICP4) with the deletion of a second copy of ICP4 yields a 128kb HSV-1 prevector without the BAC module (Figure 1A).
[0108] Additions and / or deletions can be introduced using site-directed recombination (SSR), homologous recombination (HR), or Crisp.Cas. The stuffers described herein can be introduced at the same location as the deleted gene (including deletions of ICP4 and ICP27).
[0109] Next, the deleted BAC-HSV1 is introduced into 7b cells, and the corresponding modified HSV-1 vector is isolated, cloned, and produced. [Examples]
[0110] Two parallel strategies are being developed for introducing stuffers into the HSV-1 vector. The first strategy aims to introduce stuffers of different lengths into the same single site, while the second strategy aims to introduce smaller stuffers into different sites.
[0111] We use an HSV-1 vector (hereinafter referred to as BAC-3) that expresses firefly luciferase (2 kbp) and still retains the BAC module (7.5 kbp) located in the intergenetic region between UL3 and UL4. This BAC-3 has long deletion regions (approximately 22 kbp), the first of which extends from the start of UL54 (ICP27) to the internal oriS (deletion of UL54, 55, 56, LAT, ICP0, ICP34.5, pac, and ICP4), and the second of which spans the second copy of ICP4. Since this BAC-3 contains the transgene (2 kbp) and the BAC module (7.5 kbp), the total deletion is approximately 13 kbp. After the deletion of the BAC module, the theoretical size at the start of BAC-3 is approximately 130 kbp (20% shorter than the wild-type genome). [Examples]
[0112] We investigated whether the genomic stability of HSV-1 vectors depends on net genome size. We analyzed the genomic stability of HSV-1 viral vectors with different genome sizes due to the deletion of non-essential viral genes. Because the vector size needed to be maintained within a limiting range for efficient DNA packaging, ideally within 100% of the wild-type genome length, these deletions were replaced with "stuffer" segments of non-coding DNA. For this purpose, stuffer fragments based on HSV-1 non-coding sequences with a GC content similar to that of the wild-type virus were designed (see stuffer sequences below). Furthermore, screening was performed to ensure that the stuffer sequences did not contain open reading frames (ORFs).
[0113] To construct a reliable, non-toxic, and non-replicating DNA delivery platform for genomic medicine, it was necessary to delete a large portion of the HSV-1 genome. However, this deletion resulted in a vector genome size below the packaging limit. Sequencing experiments using Oxford Nanopore Technology (ONT) revealed that when the genome size of the modified HSV-1 vector was reduced to 131,553 bp as a result of skeletal manipulation (Figure 3) (Figure 4a), the resulting vector underwent rapid rearrangement during continuous passaging in cell culture (Figure 5b). This manifested as genomic instability in the viral population, leading to significant genomic mutations such as amplicon formation, nucleotide substitutions, and / or duplication of genomic regions after only a few passages. Therefore, these undesirable recombination events prevented the generation of vector strains with genomic homogeneity. These findings suggest that there are relatively strict limitations on the amount of DNA that can be packaged in a viral particle, and that reducing genome size drastically reduces viral genomic stability.
[0114] To mitigate the risk of genome rearrangement and consequently vector instability, the HSV-1 prevector was modified by inserting a non-coding sequence of a “stuffer” module that did not contain an open reading frame or promoter region (Figure 4b). The modified HSV-1 vector with the stuffer inserted (Figure 4c) was genetically very stable, with vector DNA close to the net genome size of the wild-type virus (153,533 bp) after gene transfer in mammalian cells and auto-excision of the BAC module. No recombination byproducts, such as amplicons or overlapping regions of the viral genome, were observed in the modified HSV-1 vector containing the stuffer (Figure 5a). In contrast, the “stuffer-free” construct with a genome size of 131,599 bp (Figure 3) generated a vector with approximately 1.5 kb of amplicon-like genome sequence, including oriS and packaging signals (Figure 5b). This is likely due to the concatenating nature of the fragments, which are repeated multiple times and are observed in the over-detected fragments (>90%) in the sequencing data. The generation of amplicons is likely a form of genomic instability resulting from an inoptimal (short) vector size. Another small vector (size 138,012 bp) underwent overlapping and rearrangement of the genomic region (9,000 bp) to reach the optimal size (147,000 bp) (Figure 5c). Such instability was not observed at the optimal size in the modified HSV-1 vector shown in Figure 5a after repeated passages. [Examples]
[0115] To further investigate the size limits at which modified HSV-1 vectors can maintain genomic stability, multiple modified HSV-1 vectors of various sizes were constructed using different HSV-1 prevectors and stuffer sizes. These vectors were grown up to 10 times in Vero7b cells, and genomic stability was evaluated. Viral genomic DNA was extracted and sequenced using Oxford Nanopore Technology. Analysis was performed using Geneious software. Genomics containing DNA region duplication or amplicons (recombination byproducts) were classified as unstable (Figure 6, circles). Genomics without recombination events were identified as stable sequences (Figure 6, triangles). Amplicons (recombination byproducts) and genomic duplication were correlated with smaller genome sizes (<142kb) (Figure 6, circles). On the other hand, stable sequences without recombination events were associated with larger genome sizes (145kb–154kb) (Figure 6, triangles).
[0116] To maintain the genome size of the modified HSV-1 vector at 147–154 kbp regardless of the size of the transgene, a library of BAC-HSV1 backbone fragments with reduced stuffer size was created based on a 22 kbp stuffer fragment. The following 6 kbp, 12 kbp, 15 kbp, or 19 kbp stuffer sequences are reduced-size fragments of SEQ.1, and their GC rates are similar to those of WT HSV-1.
[0117] Non-limiting examples of sequences suitable for the present invention include the following:
[0118] SEQ.1 - Stuffer's complete sequence (22000bp): GC content: 68%
[0119] SEQ.2: 19kb stuffer GC content: 68%
[0120] SEQ.3: 15kb stuffer GC content: 68% ccgacgacaggggacggcctcctgaaccgcagacgagcttctcaactgggtcagccaggcgacgaggggtcgctggcgcaggtgagagcccgtccggactgaaggtagattgccaagtttggtctgtagcaaatgaatgacggttcttggtcgtaatccaggataaattcgaggccacacgcgtcagggacttttggagtcgccctgcgattttcgagcgccgcgtttgttgggaacttgggtgtgccgatacagccgtcgggggccccaaacgggtctccccgcccccgccttgtttgaggcaggaccacgagcacaaacgtgcgagatcgagtggcgtctaacccgactgcgcgctgcggtcgtccctctacgttgcggggtagcgtccgggcgcttggcagcgcccggcgggtccgctgtcctcgcggtccgcctggcgtcgcgggacagggcctgcttccggccccagcgcagccacccaaagtgccccgaccccgagagtgggggggcctgggtccgcgtcctgcagggcgccgaactgacagccaccgggccgtgtcacgatcaccgcgggagcggtgcggcctgggttggcgtcgggtccttcgcgtttaagcttggtctcccatcagcagtttccaatcccggccccggggaatcagaagcggagcgggctggggacggggacggcgtacgagaagggccagggcgaggtgcggcgcgctttagcgaccgacgcggcaccaacaacgacaccgagccggcggagagccgccgccctcaccaacctgttcttacgtcgccggtaggggcagacgccccctgctccccggaccccggcgccggaaccgagccccgcgggggcgtggccaagccccccgcccctgggcacgcgcacggcgatcagagggtcagtggtgtttcctcatggccccttatcgggggttcccaccaaacctgcggccaacacaacggtggatgcctctctcaagatggg。
[0121] SEQ.4: 12kb stuffer GC content: 68%
[0122] SEQ.5: 9kb stuffer GC content: 67% ccgacgacaggggacggcctcctgaaccgcagacgagcttctcaactgggtcagccaggcgacgaggggtcgctggcgcaggtgagagcccgtccggactgaaggtagattgccaagtttggtctgtagcaaatgaatgacggttcttggtcgtaatccaggataaattcgaggccacacgcgtcagggacttttggagtcgccctgcgattttcgagcgccgcgtttgttgggaacttgggtgtgccgatacagccgtcgggggccccaaacgggtctccccgcccccgccttgtttgaggcaggaccacgagcacaaacgtgcgagatcgagtggcgtctaacccgactgcgcgctgcggtcgtccctctacgttgcggggtagcgtccgggcgcttggcagcgcccggcgggtccgctgtcctcgcggtccgcctggcgtcgcgggacagggcctgcttccggccccagcgcagccacccaaagtgccccgaccccgagagtgggggggcctgggtccgcgtcctgcagggcgccgaactgacagccaccgggccgtgtcacgatcaccgcgggagcggtgcggcctgggttggcgtcgggtccttcgcgtttaagcttggtctcccatcagcagtttccaatcccggccccggggaatcagaagcggagcgggctggggacggggacggcgtacgagaagggccagggcgaggtgcggcgcgctttagcgaccgacgcggcaccaacaacgacaccgagccggcggagagccgccgccctcaccaacctgttcttacgtcgccggtaggggcagacgccccctgctccccggaccccggcgccggaaccgagccccgcgggggcgtggccaagccccccgcccctgggcacgcgcacggcgatcagagggtcagtggtgtttcctcatggccccttatcgggggttcccaccaaacctgcggccaacacaacggtggatgcctctctcaagatggg。
[0123] SEQ.6: 6kb stuffer GC content: 67%
[0124] SEQ.7: 3kb stuffer GC content: 67% ccgacgacaggggacggcctcctgaaccgcagacgagcttctcaactgggtcagccaggcgacgaggggtcgctggcgcaggtgagagcccgtccggactgaaggtagattgccaagtttggtctgtagcaaatgaatgacggttcttggtcgtaatccaggataaattcgaggccacacgcgtcagggacttttggagtcgccctgcgattttcgagcgccgcgtttgttgggaacttgggtgtgccgatacagccgtcgggggccccaaacgggtctccccgcccccgccttgtttgaggcaggaccacgagcacaaacgtgcgagatcgagtggcgtctaacccgactgcgcgctgcggtcgtccctctacgttgcggggtagcgtccgggcgcttggcagcgcccggcgggtccgctgtcctcgcggtccgcctggcgtcgcgggacagggcctgcttccggccccagcgcagccacccaaagtgccccgaccccgagagtgggggggcctgggtccgcgtcctgcagggcgccgaactgacagccaccgggccgtgtcacgatcaccgcgggagcggtgcggcctgggttggcgtcgggtccttcgcgtttaagcttggtctcccatcagcagtttccaatcccggccccggggaatcagaagcggagcgggctggggacggggacggcgtacgagaagggccagggcgaggtgcggcgcgctttagcgaccgacgcggcaccaacaacgacaccgagccggcggagagccgccgccctcaccaacctgttcttacgtcgccggtaggggcagacgccccctgctccccggaccccggcgccggaaccgagccccgcgggggcgtggccaagccccccgcccctgggcacgcgcacggcgatcagagggtcagtggtgtttcctcatggccccttatcgggggttcccaccaaacctgcggccaacacaacggtggatgcctctctcaagatggg。
[0125] Although the present invention has been specifically shown and described with reference to its preferred embodiments, those skilled in the art will understand that various modifications can be made in its form and detail without departing from the scope of the invention as encompassed by the appended claims.
Claims
1. A modified HSV-1 vector comprising one or more target nucleic acid sequences and one or more stuffers, wherein the size of the modified HSV-1 vector genome is approximately 142 kbp to approximately 160 kbp.
2. The modified HSV-1 vector according to claim 1, wherein the one or more target nucleic acid sequences include one or more target transgenes, one or more nucleic acids encoding cell-targeting proteins, or a combination thereof.
3. The modified HSV-1 vector according to claim 2, wherein the one or more target nucleic acid sequences include one or more target transgenes.
4. The modified HSV-1 vector according to claim 3, wherein one or more of the introduced genes for the purposes are operably linked to at least one sequence that confers long-term expression.
5. The modified HSV-1 vector according to any one of claims 1 to 4, wherein the size of the modified HSV-1 genome is approximately 143 kbp to approximately 158 kbp.
6. The modified HSV-1 vector according to claim 5, wherein the size of the modified HSV-1 genome is approximately 145 kbp to approximately 155 kbp.
7. The modified HSV-1 vector according to claim 6, wherein the size of the modified HSV-1 genome is approximately 152 kbp.
8. The modified HSV-1 vector according to any one of claims 1 to 7, wherein one or more of the aforementioned stuffers independently contain non-coding DNA with a GC content of 60 to 75%.
9. The modified HSV-1 vector according to claim 8, wherein one or more stuffers independently select from sequences selected from SEQ ID NO: 1 to SEQ ID NO:
7.
10. The modified HSV-1 vector according to any one of claims 2 to 9, wherein the one or more introduced genes for the purposes are independently part of an expression cassette.
11. The modified HSV-1 vector according to claim 10, wherein the expression cassette is operably linked to at least one sequence that confers long-term expression.
12. The modified HSV-1 vector according to any one of claims 4 to 11, wherein at least one sequence conferring long-term expression is selected from an LTE and / or DNA insulator derived from the HSV-1 genome.
13. A method for producing a modified HSV-1 vector, a) Removing non-essential genes, essential genes, or combinations thereof from the HSV-1 genome to obtain an HSV-1 prevector skeleton genome containing less than 130 kbp and more than 75 kbp, b) Inserting one or more target nucleic acid sequences into the HSV-1 prevector skeletal genome, c) Inserting one or more stuffers into the HSV-1 prevector skeletal genome. A method comprising (b) and (c) wherein the size of the modified HSV-1 vector genome after (b) and (c) is approximately 142 kbp to approximately 160 kbp.
14. The method according to claim 13, wherein the one or more target nucleic acid sequences include one or more target transgenes, one or more nucleic acids encoding cell-targeting proteins, or a combination thereof.
15. The method according to claim 14, wherein the one or more target nucleic acid sequences include one or more target transgenes.
16. The modified HSV-1 vector according to claim 15, wherein one or more of the introduced genes for the purpose are operably linked to at least one sequence that confers long-term expression.
17. The method according to any one of claims 13 to 16, wherein the size of the modified HSV-1 genome after steps b) and c) is about 143 kbp to about 158 kbp.
18. The method according to claim 17, wherein the size of the modified HSV-1 genome after (b) and (c) is approximately 147 kbp to approximately 155 kbp.
19. The method according to claim 18, wherein the size of the modified HSV-1 genome after (b) and (c) is approximately 152 kbp.