Tissue regeneration techniques
Patent Information
- Application Number
- JP2026507407
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-07
- Filing Date
- 2024-08-06
- Publication Date
- 2026-09-30
AI Technical Summary
【0009】 薬理学的介入又はデバイスに基づく介入又は外科手術等の古典的な療法は有益な効果をもたらすが、本明細書においては、組織、特に損傷を受けた組織又は傷害を受けた組織の修復又は再生において予想外に有益な効果をもたらす化合物及び組成物が提供される。
Smart Images

Figure 2026532585000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention generally relates to compounds, compositions, and methods for repairing or regenerating damaged or diseased cells or tissues, particularly their use in the repair and / or regeneration of cardiac tissue. [Background technology]
[0002] Many diseases, injuries, and illnesses involve the loss or damage to cells and tissues.
[0003] Examples, though not limited to them, include neurodegenerative diseases, endocrine disorders, cancer, and cardiovascular diseases.
[0004] These non-limiting examples result in substantial medical costs, a decline in quality of life, decreased productivity at work, workers' compensation costs, and, of course, loss of life. Cardiovascular disease (CVD) is the leading cause of death worldwide, claiming an estimated 17.9 million lives each year, and more than 3.9 million deaths in Europe alone. According to the World Health Organization, 85% of these deaths are due to heart attacks and heart attacks. Myocardial infarction or heart attack is a leading cause of cardiovascular disease, with a prevalence of 3.8% of the population under 60 years of age worldwide (Non-Patent Literature 1). Even among those who survive an MI, many die within a year due to declining cardiac function, associated side effects, or progressive heart disease.
[0005] Heart disease is a leading cause of death for both men and women, and coronary heart disease, the most common type of heart disease, caused approximately 400,000 deaths in the United States in 2008. Regardless of the cause, most people with coronary heart disease or heart failure have permanent damage to their heart tissue, which often leads to a reduced quality of life.
[0006] To overcome the drug-induced depletion associated with myocardial infarction and heart failure, it is necessary to find new therapeutic targets and treatments. Current treatments mostly target symptoms associated with heart failure, such as hypertension, cardiac strain, and myocardial contractility, but do not specifically address cardiac regeneration or the repair of damaged hearts (Non-Patent Literature 2). Stem cell therapy is thought to have great potential to enhance cardiac function. However, clinical trials have shown that the benefits of transplanting stem cells after myocardial infarction are uncertain, while at the same time, there is a high risk of tumor formation (Non-Patent Literature 3).
[0007] There is a need for methods and compositions to repair and / or regenerate tissue damaged (or continuing to be damaged) by injury, disease, or a combination of causes. Over the past 20 years, the development of cardiovascular drugs has lagged significantly, with a primary focus on developing and improving drugs that target known processes. The increasing burden of heart failure and the current unmet demand for new drugs make it essential to discover novel cardiovascular and tissue regeneration therapies (Non-Patent Literature 4). [Prior art documents] [Non-patent literature]
[0008] [Non-Patent Document 1] Salari et al., 2023 [Non-Patent Document 2] Heallen et al., 2019 [Non-Patent Document 3] Carbone et al., 2021 [Non-Patent Document 4] Hong Kong, 2022 [Overview of the Initiative]
[0009] While classical therapies such as pharmacological interventions, device-based interventions, or surgical procedures produce beneficial effects, this specification provides compounds and compositions that produce unexpectedly beneficial effects in the repair or regeneration of tissue, particularly damaged or injured tissue.
[0010] The present inventors provide a novel compound of formula (I) that can be used as a TOB1 inhibitor.
[0011] Unexpectedly, the inventors were the first to discover that TOB1 inhibition has beneficial effects on mammalian tissue regeneration.
[0012] As shown below, the inventors initially concluded that inhibition of tob1 is necessary to promote the proliferation of cardiomyocytes (Figures 1 and 2).
[0013] Through further experimental studies, the inventors confirmed that such effects on proliferation are not limited to cardiomyocytes but can be extrapolated to other epithelial tissues. As shown below, the inventors found that reduction of Tob1 function by either siRNA knockdown or CRISPR / Cas9 knockout promoted increased proliferation using two different cell lines, namely MCF7 (in which Tob1 was verified to be relevant in human epithelial tissue) and H9C2 (in which Tob1 played a role in a cardiac tissue-derived cell line) (Figure 3A-C). Therefore, these data support the idea that TOB1 inhibition is involved not only in cardiac tissue regeneration but also in the regeneration of other tissues.
[0014] The experimental data presented below also demonstrate that the compound of formula (I) provided by the present invention can efficiently inhibit Tob1. In fact, Figure 3 and Table 2 show data supporting very high selectivity for Tob1. Focusing on Table 2, it can be seen that the EC50 value of the compound of the present invention, when added to wild-type H9C2 cell lines (cardiocardial blast cell lines expressing tob1), was significantly lower (at least 1 / 200th) than that of H9C2 cell lines lacking the Tob1 gene.
[0015] The compound of the present invention not only provides a strong ability to promote cell proliferation, but also causes a significant increase in cell migration (Figures 5 and 8). This is an important observation, considering that the renewal of lost or damaged tissue depends not only on cell division, but also on the migration of newly generated cells to the injury site.
[0016] In summary, the compound of the present invention can represent a major advance in tissue regeneration due to the significant increase in cell proliferation and migration through selective and potent inhibition of TOB1.
[0017] The present invention provides a compound of formula (I):
Chemical Formula
[0018] Advantageously, the compounds of the present invention are essentially small molecules with low molecular weight, allowing them to easily pass through cell membranes and reach their targets. As a result, the compounds of the present invention offer further advantages, such as being less invasive, minimizing adverse immune responses, and providing greater predictability of pharmacokinetics. In short, small molecules lead to better drug administration protocols for patients and far more cost-effective drug development.
[0019] In a second embodiment, the present invention provides a pharmaceutical composition comprising a compound of formula (I) as defined herein, a solvate, stereoisomer, or salt thereof, together with one or more pharmaceutically acceptable excipients and / or carriers.
[0020] In a third aspect, the present invention provides a topical cosmetic composition comprising a compound of formula (I) as defined in the present invention, a solvate, stereoisomer, or salt thereof, together with one or more cosmetically acceptable excipients and / or carriers.
[0021] In a fourth aspect, the present invention provides the use of a compound of formula (I), its solvate, stereoisomer, or salt for use in therapy.
[0022] In a fifth aspect, the present invention provides compounds of formula (I), solvates, stereoisomers, or salts thereof, used in the repair or regeneration of cell tissue, particularly cardiac cell tissue. This aspect can be explicitly described as compounds of formula (I), solvates, stereoisomers, or salts thereof, for the production of pharmaceuticals for the repair or regeneration of cell tissue. Alternatively, this aspect can be explicitly described as a method for repairing or regenerating cell tissue, comprising the step of administering a therapeutically effective amount of a compound of formula (I), solvates, stereoisomers, or salts thereof, or a pharmaceutical composition provided by the present invention, to a subject in need of repair or regeneration.
[0023] In a sixth aspect, the present invention provides a TOB1 inhibitor for use in the prevention, repair, or regeneration of cardiac tissue injury in mammals by inducing the proliferation and / or migration of cardiomyocytes. Alternatively, this aspect may be explicitly described as the use of a TOB1 inhibitor for the manufacture of a pharmacopoeia for the prevention, repair, or regeneration of cardiac tissue injury in mammals by inducing the proliferation and / or migration of cardiomyocytes. Alternatively, this aspect may be explicitly described as a method for preventing, repairing, or regenerating cardiac tissue injury in mammals, comprising administering a therapeutically effective amount of a TOB1 inhibitor to a subject in need of prevention, repair, or regeneration.
[0024] In a seventh aspect, the present invention provides non-therapeutic cosmetic uses of a compound of formula (I) according to a first aspect of the present invention, its solvate, stereoisomer, or salt, or a topical cosmetic composition according to a third aspect of the present invention, for skin regeneration or repair of skin damage. Alternatively, this aspect can be explicitly described as a cosmetic method for regenerating or repairing skin, comprising applying a certain amount of a compound of formula (I) according to the present invention, its solvate, stereoisomer, or salt, or a cosmetic composition, topically to a subject in need of regeneration or repair. [Brief explanation of the drawing]
[0025] [Figure 1]This figure shows that overexpression of Tob1 inhibits cardiac regeneration in zebrafish. (A) Cardiomyocyte proliferation index in injured hearts of adult control zebrafish (n=7) and adult zebrafish overexpressing Tob1 (n=9). This is assessed by the number of proliferating (BrdU+) cardiomyocytes (MHC+, Mef2C+) per myocardial area (total cardiomyocytes) (B). Individual values are shown in box plots. Asterisks indicate **P<0.01** by an unpaired two-tailed Student's t-test. [Figure 2] This figure shows that loss of Tob1 promotes cell proliferation and migration in MCF-7 cells and H9C2 cells. (A, B) Knockdown of Tob1 expression by 75% to 80% leads to increased proliferation in MCF-7 cells (A) and H9C2 cells (B), as evaluated by an MTT assay that measures cellular metabolic activity and directly correlates it with the number of cells in the sample. C, D) Tob1 knockout H9C2 cells generated by CRISPR / Cas9 gene editing show increased proliferation (C) and migration (D). Data mean ± SEM, normalized to the control, are shown. Asterisks indicate ***P<0.001, **P<0.01, and *P<0.05 by unpaired two-sided Student's t-test. [Figure 3] This figure shows the growth dose-response curves of the parent compound ZXR-807 and its chemical analogues ZXR-810, ZXR-081, and ZXR-090 in control H9C2 cells and Tob1 knockout (KO) cells. Growth was measured by MTT assay according to the increasing concentration of the compound. Data mean ± SEM, normalized to the control, is shown. The data points were fitted to a nonlinear regression model (using GraphPad Prism 8) to calculate the corresponding EC50 values shown in Table 2. [Figure 4]This figure shows the transcriptional activation of growth marker genes in H9C2 cells induced by Tob1 inhibitors. Real-time PCR of the growth marker genes Cdk1 and Ccnb1 in response to 100 nM Tob1 inhibitors ZXR-807, ZXR-810, ZXR-081, and ZXR-090 in H9C2 cells. Histograms of the multiplicative changes in mRNA expression levels in control and treated cells after normalization to vehicle-treated cells are shown. Data mean ± SEM is shown. Asterisks indicate ***P<0.001, **P<0.01, and *P<0.05 from one-way ANOVA followed by Dunnett's multiple comparison test. [Figure 5] This figure shows that a Tob1 inhibitor promotes cell migration in H9C2 cells. (A) Representative image of H9C2 cell migration after treatment with 100 nM lead Tob1 inhibitor. (B) Summary graph showing that the migration rate is higher when the inhibitor is used compared to control vehicle-treated cells. Normalized data mean ± SEM is shown. An asterisk indicates **P<0.01** by an unpaired two-tailed Student's t-test. [Figure 6] This figure shows that Tob1 inhibition promotes proliferation in hiPSC cardiomyocytes. The proliferation rate is evaluated by measuring the amount of metabolically active (ATP-producing) cells using CellTiterGlo 144 hours (6 days) and 336 hours (14 days) after treatment with an 8nM Tob1 inhibitor (A). (B) Nuclear Ki67 signal intensity near and away from the abrasion (wound) area in hiPSC-CM treated with an 8nM Tob1 inhibitor for 144 hours. Normalized data mean ± SEM is shown. Asterisks indicate ***P<0.001, **P<0.01, and *P<0.05 for proliferation using an unpaired two-tailed Student's t-test, and for Ki67 nuclear intensity levels using one-way ANOVA followed by Dunnett's multiple comparison test. [Figure 7]This figure shows that Tob1 inhibition inhibits the differentiation of hiPSC cardiomyocytes. After treatment with 8 nM Tob1 inhibitor for 144 hours, cTnT signal intensity was measured in a migration assay of hiPSC-CM near the wound site. Normalized data mean ± SEM is shown. Asterisks indicate ***P<0.001, **P<0.01, and *P<0.05 from one-way ANOVA followed by Dunnett's multiple comparison test. [Figure 8] This figure shows that Tob1 inhibitors promote cell migration in hiPSC cardiomyocytes. After 144 hours of treatment with 8 nM ZXR-807, ZXR-810, ZXR-081, and ZXR-090, migration rates were evaluated in cells treated with Tob1 inhibitors and normalized to vehicle-treated cells. Normalized data mean ± SEM are shown. Asterisks indicate ***P<0.001 and **P<0.01 from one-way ANOVA followed by Dunnett's multiple comparison test. [Figure 9]This figure shows that ZXR-081 improves cardiac function and prevents left ventricular remodeling in adult mice after myocardial infarction. (A) A schematic diagram of the experimental timeline in a mouse model of MI by ligation of the left anterior descending coronary artery (LAD), intravenous injection of ZXR-081, and time points for echocardiography (Echo) / ECG and sample collection for further processing. (B) Cardiac ejection fraction (%) in vehicle-treated mice (5% DMSO, n=12), ZXR-081 (0.3 mg / kg) injected mice (n=12), and ZXR-081 (3 mg / kg) injected mice (n=12) obtained by standard apical 4-chamber and apical 2-chamber echocardiograms following the Simpson method, 2 days and 30 days before surgery. Data are shown as mean ± SEM. Asterisks indicate *P<0.05 using two-way ANOVA followed by Geyser-Greenhouse method. (C) Infarct size (%) expressed as a percentage of total LV volume. (D) Cross-sections of the left ventricle in control vehicle-treated mice (ZE-10 and ZE-105), ZXR-081 (0.3 mg / kg)-treated mice (ZE-33 and ZE-118t), and ZXR-081 (3 mg / kg)-treated mice (ZE-40 and ZE-109) several days after MI. Infarct area enlargement (dark red), wall thinning, and LV dilation are shown in control animals, while ZXR-081-treated animals show limitation of infarct size and no LV remodeling (wall thickness and lumen size). (E) Quantified wall thickness (posterior and anterior walls) in vehicle, ZXR-081 (0.3 mg / kg), and ZXR-081 (3 mg / kg). The data shown are the mean of n=3 animals for each condition. An asterisk indicates *P<0.05 by an unpaired Student's t-test. (F) QRS intervals from ECG recordings at baseline, 2D>MI, and 30D>MI in vehicle-treated mice, ZXR-081 (0.3 mg / kg)-treated mice, and ZXR-081 (3 mg / kg)-treated mice. The data shown are the mean of n=12 animals for each condition. An asterisk indicates **P<0.01 and ***P<0.001 by one-way ANOVA.(G) Vascular density quantified by isolectin IB4 staining at the border and distal regions of the infarct area in vehicle-treated mice, ZXR-081 (0.3 mg / kg)-treated mice, and ZXR-081 (3 mg / kg)-treated mice. (H) Percentage of proliferative cells (%) indicated by the percentage of Ki67-positive cells at the border and distal regions of the infarct at 2 days (2D) and 30 days (30D) after injury in vehicle-treated mice, ZXR-081 (0.3 mg / kg)-treated mice, and ZXR-081 (3 mg / kg)-treated mice. (I) Quantification of apoptosis via TUNEL assay: Determination of the percentage (%) of TUNEL-positive nuclei, which are indicators of DNA fragmentation and apoptotic cells. The data shown in A-G are averages of n=12 animals. The data shown in H represent the average for n=2 to 4 animals for each condition, while the data shown in I represent the average for n=4 animals for each condition. An asterisk indicates *P<0.05 and **P<0.01 using an independent Student's t-test. An asterisk indicates *P<0.05 using an independent Student's t-test. [Figure 10]This figure shows the doxorubicin-induced cardiotoxicity in zebrafish larvae 5 days after fertilization. (A) Mortality rate (%) in zebrafish larvae treated with vehicle, 60 μM doxorubicin (DOX_60), 60 μM doxorubicin + 100 μM ZXR-081 (DOX_60+ZXR-081), 70 μM doxorubicin (DOX_70), and 70 μM doxorubicin + 100 μM ZXR-081 (DOX_70+ZXR-081). (B) Cardiac ejection rates in zebrafish larvae treated with vehicle, 60 μM doxorubicin (DOX_60), 60 μM doxorubicin + 100 μM ZXR-081 (DOX_60+ZXR-081), 70 μM doxorubicin (DOX_70), and 70 μM doxorubicin + 100 μM ZXR-081 (DOX_70+ZXR-081). (C) Vehicle, ventricular cavity size expressed as the maximum ventricular area in zebrafish larvae treated with 60 μM doxorubicin (DOX_60), 60 μM doxorubicin + 100 μM ZXR-081 (DOX_60+ZXR-081), 70 μM doxorubicin (DOX_70), and 70 μM doxorubicin + 100 μM ZXR-081 (DOX_70+ZXR-081). [Figure 11] This figure shows the proliferation dose-response curves of ZXR-081 in human hepatocyte lineage HepG2. Proliferation was measured by MTT assay according to the escalating concentration of ZXR-081. The normalized mean ± SEM of the data is shown relative to the control. The data points were fitted to a nonlinear regression model (using GraphPad Prism 8) to calculate the corresponding EC50 value of 7.8 × 10⁻⁴ nM. [Modes for carrying out the invention]
[0026] Terms not specifically defined herein should be given the meanings that can be derived by those skilled in the art in consideration of this disclosure and the context. However, when used herein, unless otherwise specified, the following terms have their designated meanings and the following conventions shall be observed.
[0027] Throughout this specification and the following accompanying sections, the word “comprise” and variations such as “comprises” and “comprising” should be interpreted comprehensively. That is, these words are intended to convey the possibility of including other elements or components that are not specifically listed, to the extent that the context allows. The word “comprise” also includes the term “consists of.”
[0028] For the purposes of the present invention, any given range includes both the lower and upper limits of the range.
[0029] In a first embodiment, the present invention provides compounds of formula (I), stereoisomers, solvates, or acceptable salts thereof.
[0030] In the context of this invention, the term "alkyl" refers to a linear or branched hydrocarbon chain group that is unsaturated and bonded to the rest of the molecule by a single bond. Typical alkyl groups have 1 to about 10, 1 to about 8, or 1 to about 6 carbon atoms, and include, for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, t-butyl, n-pentyl, etc.
[0031] In the context of the present invention, the term "alkenyl" refers to a linear or branched hydrocarbon chain group comprising at least two carbon atoms and at least one C=C double bond, which is bonded to the rest of the molecule by a single bond. Typical alkenyl groups have 2 to about 10, 2 to about 8, or 2 to about 6 carbon atoms. In certain embodiments, the alkenyl group is vinyl, 1-methylethenyl, 1-propenyl, 2-propenyl, or butenyl.
[0032] In the context of the present invention, the term "alkynyl" refers to a linear or branched hydrocarbon chain group containing one or more C≡C triple bonds. Examples of alkynyl groups include, but are not limited to, ethynyl, 2-propynyl, and 2-butynyl.
[0033] In the context of this invention, the term "halogen" refers to bromo, chloro, iodine, or fluoro.
[0034] In the context of the present invention, the term "haloalkyl" refers to a non-unsaturated linear or branched hydrocarbon chain group in which one or more hydrogen atoms are replaced by halogens. Exemplary, non-limiting examples of haloalkyls include chloromethyl, trifluoromethyl, and 1-chloro-2-fluoroethyl.
[0035] In one embodiment of the first aspect of the present invention, R 2a ~R 2e R is either the same or different and represents hydrogen or halogen. In another embodiment of the first aspect of the present invention, R 2a ~R 2e One of them is a halogen, and the others are hydrogen.
[0036] In another embodiment of the first aspect of the present invention, R1 represents -H or C(O)R6. In another embodiment of the first aspect of the present invention, R6 represents H;(C1~C 10 )alkyl; or -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 ) represents alkyl, and in particular, R6 is H or (C1~C 10 ) Represents alkyl.
[0037] In another embodiment of the first aspect of the present invention, R3 and R4 are the same or different, and (C1~C 10 )alkyl; or -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10)alkenyl or (C2~C 10 )alkynyl, which is substituted with one or more groups selected from (C1~C 10 )alkyl; in particular, R6 represents H or (C1~C 10 )alkyl.
[0038] In an alternative embodiment of the first aspect of the present invention, R3 and R4, together with the N heteroatom to which they are attached, form a ring system consisting of one ring. In one embodiment, the ring system consists of one saturated 5-membered ring or saturated 6-membered ring, in particular a saturated 6-membered ring. In another embodiment, the ring system consists of a saturated 6-membered ring, wherein one of the ring members is the N atom to which R3 and R4 are attached, another ring member is O or S, and the remaining ring members are C(R x )2, and R x is as defined above. In another embodiment, the ring system consists of a saturated 6-membered ring, wherein one of the ring members is the N atom to which R3 and R4 are attached, another ring member is O or S, and the remaining ring members represent CH2.
[0039] In another embodiment of the first aspect of the present invention, R1 represents -H, (C1~C4)alkyl, or C(O)R6.
[0040] In another embodiment of the first aspect of the present invention, R6 represents H or (C1~C4)alkyl, in particular R6 represents H or (C1~C2)alkyl, and more specifically R6 represents H or methyl.
[0041] In one embodiment of the first aspect of the present invention, R 2a ~R 2e are the same or different and represent hydrogen or halogen. In another embodiment of the first aspect of the present invention, one of R 2a ~R 2e is halogen and the others are hydrogen. In a further aspect of the present invention, R 2c is halogen, and more specifically, R 2cis chloro, fluoro, or bromo, more specifically chloro. In a further embodiment of the present invention, R 2a , R 2b , R 2d , and R 2e It is hydrogen.
[0042] In another embodiment of the first aspect of the present invention, R3 and R4 are the same or different and represent (C1-C4) alkyl; or (C1-C4) alkyl substituted with one or more groups selected from -OH, -CN, halogen, -NH2, and (C1-C3) alkyl.
[0043] In an alternative embodiment of the first aspect of the present invention, R3 and R4, together with the N heteroatom to which they are attached, form a ring system consisting of one ring. In one embodiment, the ring system consists of a saturated six-membered ring, where one of the ring members is the N atom to which R3 and R4 are attached, another ring member is O or S, and the remaining ring member is C(R x ) represents 2, where each R x This is independently selected from hydrogen and (C1-C3) alkyl groups, and is preferably hydrogen.
[0044] In another embodiment, the ring system consists of a saturated 6-membered ring, where one of the ring members is an N atom to which R3 and R4 are attached, another ring member is O or S, and the remaining ring member represents CH2.
[0045] In another embodiment, the compound of formula (I) is rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-thiomorpholinomethanone, rel(1R,2R,4R)-4-amino-2-(4-chlorophenyl)-N-isopropyl-N-methylcyclopentanecarboxamide rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-morpholinomethanone hydrochloride, rel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]acetamide, and all solvates, salts, or stereoisomers thereof, Selected from the group consisting of .
[0046] In the context of this invention, the term “salt” should be understood as any form of the compound used in accordance with this invention, whether the compound is in ionic form, charged and conjugated with a counterion (cation or anion), or in solution. This definition includes quaternary ammonium salts, and complexes of active molecules with other molecules and ions, particularly complexes formed by ionic interactions. This definition includes physiologically acceptable salts in particular.
[0047] In the context of the present invention, the term “pharmaceutically acceptable salt” means any salt that is physiologically acceptable (usually meaning not toxic, particularly as a result of counterions) when used in a manner appropriate for a treatment applied or used in humans and / or mammals. These physiologically acceptable salts may be formed with cations or bases and, in the context of the present invention, when used particularly in humans and / or mammals, are understood to be salts formed with at least one compound used according to the present invention, preferably inorganic, usually an acid (deprotonated), e.g., anion and at least one physiologically acceptable cation; salts with alkali metals and alkaline earth metals, as well as ammonium cations (NH4 +) are particularly preferred. Preferred salts are those formed with (i) or (ii) sodium, (i) or (ii) potassium, magnesium, or calcium. These physiologically acceptable salts may also be formed with anions or acids and, in the context of the present invention, particularly when used for humans and / or mammals, are usually understood to be salts formed with at least one compound used according to the present invention, for example, a cation and at least one physiologically acceptable anion, which is protonated with nitrogen. This definition, in the context of the present invention, particularly when used for humans and / or mammals, particularly includes salts formed with physiologically acceptable acids, i.e., salts of a particular active compound with a physiologically acceptable organic or inorganic acid. Examples of this type of salt are salts formed with hydrochloric acid, hydrobromic acid, sulfuric acid, methanesulfonic acid, formic acid, acetic acid, oxalic acid, succinic acid, malic acid, tartaric acid, mandelic acid, fumaric acid, lactic acid, or citric acid.
[0048] In the context of this invention, "cosmetic-grade salt" refers to a salt made from a cosmetic-grade base such as an inorganic base or an organic base, or a salt made from a cosmetic-grade acid. Typical salts obtained from inorganic bases include aluminum salts, ammonium salts, calcium salts, copper salts, ferric salts, ferrous salts, lithium salts, magnesium salts, manganese(III) salts, manganese(II) salts, ammonium salts, potassium salts, sodium salts, and zinc salts. Representative salts obtained from organic bases that are acceptable for cosmetic use include salts of arginine, betaine, caffeine, choline, N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydravamin, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purine, theobromine, triethylamine, trimethylamine, tripropylamine, and other primary, secondary, and tertiary amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins.
[0049] In the context of the present invention, the term "solvate" should be understood to mean any form of compound, particularly hydrates and alcolates such as methanelates, in which the compound according to the present invention is bonded to another molecule (usually a polar solvent) by a non-covalent bond. The preferred solvate is the hydrate.
[0050] Any compound of formula (I) referred to herein is intended to represent not only such specific compound but also certain variations or forms. In particular, compounds referred to herein may have chiral centers and therefore exist in different enantiomer or diastereomer forms. For this reason, a given compound of formula (I) referred to herein is intended to represent one of the following: a racemate, one or more enantiomer forms, one or more diastereomer forms, or a mixture thereof. Similarly, stereoisomerism or geometric isomerism with respect to double bonds is also possible, and therefore, in some cases, the molecule may exist as an (E)-isomer or (Z)-isomer (trans and cis isomer). If a molecule contains several double bonds, each double bond has its own stereoisomerism, which may be the same as or different from the stereoisomerism of the other double bonds in the molecule. Furthermore, compounds referred to herein may exist as atropisomers. All stereoisomers, including enantiomers, diastereoisomers, geometric isomers, and atropisomers of the compounds referred to herein, as well as mixtures thereof, are considered to be within the scope of the present invention.
[0051] Furthermore, any compound of formula (I) as referred to herein may exist as a tautomer. Specifically, the term tautomer refers to one of two or more structural isomers of a compound that exist in equilibrium and are readily convertible from one isomeric form to another.
[0052] The compounds of the present invention can be prepared according to any protocol well known to those skilled in the art. Exemplary, non-limiting examples are given below.
[0053] In one embodiment, the compound of the present invention is of formula (II): [ka] (In the formula, R 2a ~R 2eThe N protecting group is obtained from compounds of the N protecting group (as defined above, and where "Prot" represents an N protecting group). Exemplary, non-limiting examples of N protecting groups are those that can be used in the synthesis of (oligo)peptides. Such groups are known to those skilled in the art. Suitable examples of N protecting groups include carbonyl protecting groups, e.g., "Z" (benzyloxycarbonyl), "Boc" (i.e., t-butyloxycarbonyl), "For" (i.e., formyl), and "PhAc" (phenacetyl), and FMOC (9-fluorenylmethoxycarbonyl). The For or PhAc group can be enzymatically introduced and cleaved using the enzymes peptide deformylase or PenG acylase, respectively. Chemical cleavage methods are generally known in the art.
[0054] The specific reaction conditions under which the compound of formula (II) is subjected depend on the meaning of R3 and R4, primarily whether R3 and R4, together with the N atom to which they are attached, form a heterocycle.
[0055] Specific conditions for each embodiment are shown below. However, mainly when R3 and R4, together with the N atom to which they are attached, form a heterocycle further containing an -O-heteroatom, the compound of formula (II) is mixed with diisopropylethylamine and propanephosphonic anhydride. When R3 and R4, together with the N atom to which they are attached, form a heterocycle further containing an -S-heteroatom, the compound of formula (II) is mixed with 1-hydroxybenzotriazole, carbodiimide (e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), diisopropylethylamine, and thiomorpholine. Once the heterocycle is formed, the resulting compound is subjected to a deprotection step. The conditions for deprotection are well known to those skilled in the art, and are, for example, an acidic medium.
[0056] Alternatively, if R3 and R4 do not form a heterocycle with the N atom, the compound of formula (II) is formula (III): HNR3R4(III) It reacts with the amine (wherein R3 and R4 are as defined above). Once the reaction is complete, the deprotection step is carried out according to one of the well-known protocols.
[0057] In a further embodiment, the present invention provides a pharmaceutical composition comprising not only at least one compound of formula (I), but also pharmaceutically acceptable excipients and / or carriers.
[0058] pharmaceutically acceptable adjuvants, vehicles, or excipients that can be used in such compositions are adjuvants, vehicles, or excipients that are known to those skilled in the art or are commonly used in the preparation of therapeutic compositions, and these may be selected from the group consisting of, for example, excipients, fillers, solvents, diluents, surfactants, colorants, preservatives, disintegrants, sliding agents, lubricants, fragrances, or binders.
[0059] The term "pharmaceutically acceptable" refers to a pharmaceutically acceptable material, composition, or vehicle. Each component must be pharmaceutically acceptable in the sense that it is compatible with the other components of the pharmaceutical composition. It must also be suitable for use in contact with human tissues or organs in animals, particularly humans, without excessive toxicity, irritation, allergic reactions, immunogenicity, or other problems or complications, in proportion to a reasonable benefit-risk ratio.
[0060] The selection of a physiologically suitable adjuvant or the amount of adjuvant used depends on the administration method of the pharmaceutical composition, i.e., the oral, subcutaneous, parenteral, intravenous, intraperitoneal, intradermal, intramuscular, intranasal, buccal, rectal, intra-aural, or middle ear administration method. Formulations in the form of tablets, sugar-coated tablets, capsules, granules, pills, drops, especially ear drops, juices, or syrups are preferably suitable for oral administration, while solutions, suspensions, easily reconstituted dry formulations, or even sprays are preferably suitable for parenteral, topical, or inhalation administration.
[0061] For example, for oral administration in tablet or capsule form, the active drug component can be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, glucose, methylcellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, mannitol, sorbitol, etc. For oral administration in liquid form, the oral drug component can be combined with any oral, non-toxic, pharmaceutically acceptable inert carrier, such as ethanol, glycerol, water, etc. Furthermore, suitable binders, lubricants, disintegrants, and colorants can be incorporated into the mixture as desired or as needed. Suitable binders include starch, gelatin, natural sugars, such as glucose or β-lactose, corn sweeteners, natural and synthetic rubbers, such as gum arabic, tragacanth gum, or sodium alginate, carboxymethylcellulose, polyethylene glycol, and waxes. Lubricants used in these dosage forms include sodium oleate, sodium stearate, and magnesium stearate. Examples of disintegrants, though not limited to them, include starch, methylcellulose, agar, bentonite, and xanthan gum.
[0062] Gelatin capsules contain the active ingredient and a powder carrier, such as lactose, starch, cellulose derivatives, magnesium stearate, or stearic acid. Compressed tablets can also be prepared using similar diluents. Both tablets and capsules can be manufactured as sustained-release formulations, providing a continuous release of the drug over several hours. Compressed tablets may be coated with sugar or film to mask any unpleasant tastes and protect the tablet from the air, or coated with enteric coating for selective disintegration in the gastrointestinal tract.
[0063] Liquid dosage forms for oral administration may contain colorants and flavorings to improve patient tolerance.
[0064] The combinations of the present invention can be formulated such that the active ingredients are combined within a single dosing unit, but physical contact between the active ingredients is minimized. To minimize contact, for example, one or more of the active ingredients can be enterically coated. Enteric coating of one of the active ingredients not only minimizes contact between the combined active ingredients but also controls the release of one of these ingredients in the gastrointestinal tract, so that one of these ingredients is released in the intestines and not in the stomach. Another embodiment of the present invention provides a combination product in which one or more of the active ingredients are coated with a sustained-release material that provides sustained release throughout the gastrointestinal tract and also minimizes physical contact between the combined active ingredients. Furthermore, the sustained-release ingredients can be further enterically coated so that the release of this ingredient occurs only in the intestines. Another method involves formulating a combination in which one or more ingredients are coated with a sustained-release polymer and / or an enterically released polymer, and the other(s) ingredients are also coated with a polymer such as low-viscosity grade hydroxypropyl methylcellulose or other suitable materials known in the art, thereby further sequestering the active ingredients. Polymer coatings act as an additional barrier against interactions with other components.
[0065] The dosage form of the combination of the present invention, in which one active ingredient is enterically coated, may be in the form of a tablet in which the enterically coated ingredient and the other active ingredient are blended together and then compressed into a tablet, or in the form of a tablet in which the enterically coated ingredient is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, one or more placebo layers may be present so as to further isolate the two layers, with the placebo layer being between the layers of active ingredients. Furthermore, the dosage form of the present invention may be in the form of a capsule in which one active ingredient is compressed into a tablet, or in the form of multiple microtablets, particles, granules, or non-perils, which are then enterically coated. These enterically coated microtablets, particles, granules, or non-perils are then placed in a capsule together with granules of the other active ingredient or compressed into a capsule.
[0066] A "therapeutic effective dose" is understood to be an amount of a compound or composition that, when administered, is sufficient to prevent the development of one or more symptoms of the disease being treated, or to alleviate one or more symptoms of that disease to some extent.
[0067] The dosage of the pharmaceutical composition administered will naturally vary depending on the intended use and known factors such as the recipient's age, health condition, and weight, the nature and severity of symptoms, any concomitant treatments, the frequency of treatment, and the desired effect. The recipient may be any type of mammal, but is preferably human.
[0068] In a further embodiment, the present invention provides a topical cosmetic composition comprising not only at least one compound of formula (I), but also an excipient and / or carrier acceptable for cosmetic use.
[0069] The cosmetic composition of the present invention may contain diluents, excipients, solubilizers, emulsifiers, and salts known to be useful in cosmetic compositions. Examples of suitable active ingredients include thickeners, buffers, preservatives, surfactants, neutral or cationic lipids, lipid complexes, liposomes, and penetration enhancers. In certain embodiments, the cosmetic composition further comprises other cosmetic ingredients known in the art.
[0070] In certain embodiments, the cosmetic composition may contain one or more penetration enhancers. Many types of penetration enhancers are known, including fatty acids, bile salts, chelating agents, surfactants, and non-surfactants. Examples of fatty acids and their derivatives that act as penetration enhancers include cabrylic acid, oleic acid, lauric acid, capric acid, caprylic acid, hexanoic acid, myristic acid, palmitic acid, valeric acid, stearic acid, linoleic acid, linolenic acid, arachidonic acid, oleic acid, elaidic acid, erucic acid, nervonic acid, dicaplate, tricaplate, recinleate, monoolein (also known as 1-monoleoyl-rac-glycerol), dilaurin, arachidonic acid, glyceryl-monocaplate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, monoglycerides and diglycerides, and their physiologically acceptable salts (e.g., oleates, laurates, caprinates, myristates, palmitates, stearates, linoleates).
[0071] In certain embodiments, the cosmetic composition further comprises other cosmetic ingredients known in the art to be useful for cosmetic, skincare, and / or dermatological applications (e.g., anti-wrinkle active ingredients including flavonoid glycosides such as α-glycosylrutin, coenzyme Q10, vitamin E and its derivatives, as well as sunscreen ingredients, moisturizers, and fragrances).
[0072] The cosmetic compositions of the present invention are administered alone or in combination with other suitable active substances or components as "additives" for "cosmetic" or "skincare" (e.g., dermatological) applications. As used herein, "cosmetic" and "skincare" applications include, for example, preventive and / or restorative applications related to dermatological changes in the skin, such as in the process of premature skin aging, dryness, roughness, formation of fine lines due to dryness, itching, decreased firmness (e.g., after washing the face), visible vasodilation (e.g., telangiectasia, cuperosis), sagging, formation of fine lines and wrinkles, localized hyperpigmentation, decreased pigmentation, inaccurate pigmentation (e.g., age spots), increased sensitivity to mechanical stress (e.g., cracking), skin laxity (e.g., lack of firmness), and the appearance of dry or rough skin surface characteristics.
[0073] The cosmetic compositions of the present invention are formulated for topical administration. Such compositions can be administered topically in a variety of forms. Such compositions are suitable in the context of use for application to the skin as described herein.
[0074] Compositions for topical administration include skin patches, ointments, lotions, serums, creams, gels, hydrogels, pastes, foams, oils, semi-solids, shampoos, soaps, drops, sprays, films, liquids, and powders.
[0075] In a further embodiment, the present invention provides the use of compounds of formula (I), stereoisomers, solvates, or salts thereof in tissue repair and organ regeneration.
[0076] In the context of this invention, “regeneration” means reconstructing and restoring lost, destroyed, and damaged tissue to its original state in which its function is restored.
[0077] In the context of this invention, "repair" means the healing of wound tissue, such as when the structure and function of the wound have not yet been fully restored.
[0078] In the context of this invention, “cell damage” means any type of damage that occurs in a cell and can result in changes in the cell’s function and / or structure. Examples of cell damage include necrosis, apoptosis, autophagy, oxidative stress, inflammation, ischemia, and hypoxia.
[0079] The beneficial effects of the compounds and compositions of the present invention do not necessarily have to be limited to directly damaged or injured cells. In some embodiments of the present invention, for example, the cells of the damaged tissue affected by the disclosed method are healthy cells. However, in some embodiments, the cells of the damaged tissue affected by the disclosed method are injured cells.
[0080] In the context of the present invention, therapeutic use relates to cells damaged as a result of a pathological condition or event. On the other hand, the cosmetic (non-therapeutic) use provided in the context of the present invention relates to the appearance of the subject (i.e., the tissue injury or damage is not due to a pathological condition or event).
[0081] In some embodiments, regeneration includes improving tissue function. For example, in a particular embodiment where cardiac tissue is damaged, functional improvement may include increased cardiac output, contractility, ventricular function, and / or a reduction in arrhythmias (among other functional improvements). Similarly, functional improvements may be achieved in other tissues, such as improved cognitive function in response to treatment of nerve damage, improved blood oxygen transport in response to treatment of lung damage, and improved immune function in response to treatment of damaged immune-related tissues.
[0082] The repair of damaged tissue may include both anatomical repair (e.g., tissue regeneration) and functional repair.
[0083] In some embodiments, the damaged tissue requires repair, regeneration, or functional improvement due to an acute event. Acute events include, but are not limited to, trauma such as lacerations, bruises, or collision injuries, shock, loss of blood flow or oxygen flow, infection, exposure to chemicals or heat, exposure to toxins or venoms, or drug overuse or overexposure. For example, in some embodiments, the damaged tissue is cardiac tissue, and the acute event includes myocardial infarction. In additional embodiments, the tissue is damaged due to a chronic disease or an ongoing injury. For example, progressive degenerative diseases can lead to tissue damage that expands over time (sometimes even considering attempts at therapy). On the other hand, chronic diseases do not necessarily have to be degenerative diseases that continue to generate damaged tissue, but in some embodiments, cardiac tissue can also be damaged by chronic diseases such as congestive heart failure, ischemic heart disease, diabetes, valvular heart disease, dilated cardiomyopathy, or infection. Other causes of damage include, but are not limited to, injury, age-related degeneration, cancer treatment, and infection. In some embodiments, the regenerative cells are derived from the same tissue type as the tissue requiring repair or regeneration. In some other embodiments, the regenerative cells are derived from a different tissue type than the tissue requiring repair or regeneration. In some embodiments, the regenerative cells include somatic cells, while in additional embodiments, the regenerative cells include germ cells.
[0084] The compounds and compositions of the present invention can be used in the repair or regeneration of cell tissue. The compounds and compositions of the present invention can be used in the repair or regeneration of cardiac cell tissue. The compounds and compositions of the present invention can be used in the prevention or treatment of myocardial infarction. The compounds and compositions of the present invention can be used in the prevention or treatment of heart failure.
[0085] The compounds and compositions of the present invention can be used to prevent cell damage. The compounds and compositions of the present invention can be used to prevent apoptosis. The compounds and compositions of the present invention can be used to reduce apoptosis.
[0086] In a further embodiment, the present invention relates to the use of TOB1 inhibitors in tissue repair or organ regeneration.
[0087] TOB1 codes for a member of the tob / btg1 family of antiproliferative proteins. The Uniprot accession numbers for the human and mouse protein sequences are P50616 (last updated October 1, 1996, v1) and Q61471 (September 18, 2013, v2), respectively. The Genbank accession numbers for the human and mouse nucleotide sequences are human gene ID: 10140 and mouse gene ID: 22057, respectively.
[0088] In the context of this invention, the term "TOB1 inhibitor" refers to a compound that has the ability to reduce or evade TOB1 activity. There are well-known protocols in the current state of the art for determining TOB1 activity (Doidge et al., 2012). Since TOB1 is known to be an antiproliferative protein, a compound is considered to inhibit TOB1 activity if cell proliferation increases statistically significantly beyond control levels (Winkler et al., 2010).
[0089] Well-known TOB1 small fragment inhibitors exist with the current level of technology (Bai et al., 2015). Based on the predicted structure, it is possible to determine or confirm whether a compound is a TOB1 inhibitor.
[0090] This disclosure may also be described by referring to the following aspects:
[0091] <1> Equation (I): [ka] (In the formula, R1 is H; (C1~C 10 )alkyl;-OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 )alkyl; (C2~C 10 ) Alkenyl; -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10 ) Alkenyl; (C2~C 10 )Alkynyl;-OH,-CN, halogen,-O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10 ) Alkinyl; represents -C(O)R5 and -C(O)OR6, R 2a ~R 2e They are either the same or different, and represent hydrogen, hydroxyl, or halogen. R3 and R4 are either the same or different, and (C1~C 10 )alkyl;-OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 )alkyl; (C2~C 10 ) Alkenyl; -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10) Alkenyl; (C2~C 10 )Alkynyl;-OH,-CN, halogen,-O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10 ) Represents or alternatively represents alkinyl, R3 and R4, together with the N heteroatom to which they are attached, form a 5-membered or 6-membered heteroring containing a second heteroatom selected from N, O, or S. R5 and R6 are H; (C1~C 10 )alkyl;-OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 )alkyl; (C2~C 10 ) Alkenyl; -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10 ) Alkenyl; (C2~C 10 )Alkynyl;-OH,-CN, halogen,-O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenyl, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C2~C 10 ) represents Alkinnil, and, A "complex ring" refers to a system of rings having one or two rings, where each ring is... It is saturated, partially saturated, or aromatic, and It consists of 5 or 6 ring members, where one of the ring members corresponds to the N atom to which R3 and R4 are attached, and the remaining ring members are CR x , C(R x )2, NR y Selected from N, O, or S, R x (C1~C) is hydrogen, optionally substituted with one or more Z substituents. 10 ) alkyl, optionally substituted with one or more Z substituents (C2~C 10 ) Alkenyl, or optionally substituted with one or more Z substituents (C2~C 10 ) Selected from Alkinyl, and R y (C1~C) is hydrogen, optionally substituted with one or more Z substituents. 10 ) alkyl, optionally substituted with one or more Z substituents (C2~C 10 ) Alkenyl, or optionally substituted with one or more Z substituents (C2~C 10 ) Selected from Alkinyl, and Z is (C1~C 10 )alkyl, -O-(C1~C 10 ) alkyl, (C1~C 10 ) Haloalkyl, -O-(C a ~C 10 ) Haloalkyl, (C2~C 10 ) Alkenil, (C2~C 10 Compounds of (selected from the group consisting of alkynyls and halogens), solvates, stereoisomers, or salts thereof.
[0092] <2> R 2a ~R 2e are the same or different and represent hydrogen or halogen, in their respective aspects. <1> A compound of formula (I) as described above.
[0093] <3> R 2a ~R 2e A compound of any one of the preceding embodiments of formula (I), wherein one of the atoms is a halogen and the other is hydrogen.
[0094] <4> R1 is a compound of formula (I) in any one of the preceding embodiments, representing -H or C(O)R6.
[0095] <5> R6 is H;(C1~C 10 )alkyl; or -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 ) represents alkyl, and in particular, R6 is H or (C1~C 10 A compound of any one of the preceding embodiments of formula (I) that represents an alkyl group.
[0096] <6> R3 and R4 are either the same or different, and (C1~C 10 )alkyl; or -OH, -CN, halogen, -O-(C1~C 10 )alkyl, -NH2, (C1~C 10 ) Alkyl, (C2~C 10 ) Alkenil, or (C2~C 10 ) Substituted with one or more groups selected from alkynyl groups (C1~C 10 ) represents alkyl, and in particular, R6 is H or (C1~C 10 A compound of any one of the preceding embodiments of formula (I) that represents an alkyl group.
[0097] <7> R3 and R4, together with the N heteroatom to which they are attached, form a six-membered heteroring consisting of one ring with six ring members, where one of the ring members is the N atom to which R3 and R4 are attached, another of the ring members is a second heteroatom selected from O or S, and the remaining ring member is C(R x )2, aspect <1> ~ <5> A compound of any one of the following formulas (I).
[0098] <8> rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-thiomorpholinomethanone, rel(1R,2R,4R)-4-amino-2-(4-chlorophenyl)-N-isopropyl-N-methylcyclopentanecarboxamide rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-morpholinomethanone hydrochloride, rel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]acetamide, and all of those salts, A compound of formula (I) selected from the group consisting of the following.
[0099] <9> Preceding aspects <1> ~ <8> A pharmaceutical composition comprising one or more pharmaceutically acceptable excipients and / or carriers together with a compound of formula (I) as defined in any one of the following.
[0100] <10> Preceding aspects <1> ~ <8> A topical cosmetic composition comprising one or more cosmetically acceptable excipients and / or carriers together with a compound of formula (I) as defined in any one of the following.
[0101] <11> A preceding aspect used in therapy <1> ~ <8> A compound of formula (I) described in any one of the following, its solvate, stereoisomer, or salt.
[0102] <12> A prior embodiment used in the repair or regeneration of cell tissue, particularly cardiac cell tissue. <1> ~ <8> A compound of formula (I) described in any one of the following, its solvate, stereoisomer, or salt, or embodiment <9> The pharmaceutical composition described above.
[0103] <13> The compound or composition inhibits TOB1 activity and promotes cell proliferation, <12> The preceding embodiments used as described above <1> ~ <8> A compound of formula (I) described in any one of the following, its solvate, stereoisomer, or salt, or embodiment <9> The pharmaceutical composition described above.
[0104] <14> TOB1 inhibitors used in the prevention, repair, or regeneration of cardiac tissue injury in mammals by inducing the proliferation and / or migration of cardiomyocytes.
[0105] <15> Prior embodiments for skin regeneration or repair <1> ~ <8> A compound of formula (I) described in any one of the following, its stereoisomer, or salt, or embodiment <9> Cosmetic use of the cosmetic composition described herein.
[0106] Those skilled in the art will find other objects, advantages, or features of the present invention to be apparent, either from this specification or from the practice of the present invention. The following examples are provided for illustrative purposes only and are not intended to limit the present invention. [Examples]
[0107] Materials and methods NMR measurements were performed using a Bruker NMR spectrometer (300 MHz). UHPLC measurements were performed using a uHPLC Agilent 1290 Infinity instrument. Column: ACQUITY UHPLC BEH C18 (1.7 μm) 2.1 mm × 50 mm, temperature 40 °C, detection: DAD-6120 quadrupole, solvent A: water + 0.1% formic acid, solvent B: MeCN + 0.1% formic acid, gradient conditions A: 2% B for 0 min, 2% B for 0.5 min, 98% B for 3.0 min, 98% B for 3.5 min, 2% B for 3.6 min, flow rate 0.6 mL / min.
[0108] Gradient conditions B: 2% B for 0 minutes, 2% B for 0.2 minutes, 98% B for 3.9 minutes, 98% B for 4.1 minutes, 2% B for 4.11 minutes, 2% B for 4.5 minutes, flow rate 1.0 mL / min, 200 nm to 300 nm.
[0109] chemical synthesis Example 1: Synthesis of rel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]acetamide (ZXR-090): [ka]
[0110] a) Preparation of compound 282170, namely rel-(5R)-5-(4-chlorophenyl)-2-azabicyclo[2.2.1]heptan-3one: To a solution of 2-azabicyclo[2.2.2]hepta-5-en-3-one (45.0 g, 412 mmol, 1 equivalent) in dry tetrahydrofuran (700 mL) under a nitrogen atmosphere, 1-chloro-4-iodobenzene (100 g, 412 mmol, 1 equivalent), triethylamine (115 mL, 824 mmol, 2 equivalents), formic acid (22.5 mL, 598 mmol, 1.45 equivalents), and bis(triphenylphosphine)palladium chloride (12 g, 17.5 mmol, 0.05 equivalents) were added, and the reaction mixture was heated under reflux.
[0111] When the reaction progress was monitored by UHPLC, complete conversion was observed after 3 hours.
[0112] The reaction mixture was concentrated under vacuum. The residue was diluted with ethyl acetate (1000 mL) and 1N aqueous HCl (100 mL). Both layers were separated, and the organic layer was filtered through Celite and washed with brine (3 × 300 mL). The organic phase was dried over MgSO4 and then concentrated under vacuum.
[0113] The crude product was suspended in a mixture of petroleum ether / dichloromethane (900 mL, 8:1). The solid was filtered, washed with cold petroleum ether / dichloromethane (100 mL, 8:1), and dried in vacuum to obtain the title compound as a mixture of two positional isomers in a 1:1 ratio (70.8 g, 77%).
[0114] MS(ES-APCI)m / z:[M+H] + C 12 H 13 ClNO + The calculated value for this is 222.1, and the measured value is 222.2. 1¹H NMR (300 MHz, CDCl3, double line (ppm)): 7.23-7.19 (two overlapping double lines, 4H), 7.12-7.07 (two overlapping double lines, 4H), 6.94 (bs, 1H), 6.81 (bs, 1H), 3.97-3.93 (m, 1H), 3.81-3.77 (m, 1H), 3.22-3.14 (m, 2H), 2.76-2.72 (m, 2H), 2.23-2.05 (m, 2H), 1.97-1.86 (m, 4H), 1.65 (t, 2H, J=9.7 Hz).
[0115] b) Preparation of compound 282174, namely tert-butylrel-(5R)-5-(4-chlorophenyl)-3-oxo-2-azabicyclo[2.2.1]heptane-2-carboxylate: To a solution of rel-(5R)-5-(4-chlorophenyl)-2-azabicyclo[2.2.1]heptan-3-one (as a mixture of two positional isomers, 70.8 g, 319 mmol, 1 equivalent) in dichloromethane (1000 mL), di-tert-butyl dicarbonate (139.5 g, 638 mmol, 2 equivalents), DMAP (39.0 g, 319 mmol, 1 equivalent), and triethylamine (110 mL, 798 mmol, 2.5 equivalents) were added, and the reaction mixture was stirred at room temperature (Note: Vigorous carbon dioxide generation was observed during the first hour).
[0116] When the reaction progress was monitored by UHPLC, complete conversion was observed after 12 hours.
[0117] The reaction mixture was concentrated under vacuum. The residue was dissolved in methyl tert-butyl ether (1000 mL) and washed with aqueous citric acid solution (5% by weight, 300 mL), saturated sodium bicarbonate (200 mL), and brine (200 mL). The organic phase was dried via MgSO4 and then concentrated under vacuum. To separate the two positional isomers, the crude was purified by flash column chromatography (cyclohexane / methyl tert-butyl ether) to obtain the target intermediate (41.4 g, 40%).
[0118] MS(ES-APCI)m / z:[M-Boc+H] + C 12 H 13 ClNO + The calculated value for this is 222.6, and the measured value is 222.2. 1 H NMR (300 MHz, CDCl3, double line (ppm)): 7.22 (d, 2H, J=8.5 Hz), 7.09 (d, 2H, J=8.5 Hz), 4.58-4.56 (m, 1H), 3.31 (dd, 1H, J=3.3, 8.8 Hz), 2.87 (d, 1H, J=2.9 Hz), 2.36-2.27 (m, 1H), 1.96 (dd, 1H, J=2.5, 5.2 Hz), 1.93-1.89 (m, 1H), 1.70-1.67 (m, 1H), 1.47 (s, 9H).
[0119] c) Preparation of compound 282414, namely rel-(1R,2R,4R)-4-(tert-butoxycarbonylamino)-2-(4-chlorophenyl)cyclopentanecarboxylic acid: To a solution of tert-butylrel-(5R)-5-(4-chlorophenyl)-3-oxo-2-azabicyclo[2.2.1]heptane-2-carboxylate (40.0 g, 124 mmol, 1 equivalent) in tetrahydrofuran (750 mL) at 0°C, a solution of lithium hydroxide (7.4 g, 310 mmol, 2.5 equivalents) in water (170 mL) was added, and the reaction mixture was stirred at this temperature.
[0120] When the reaction progress was monitored by UHPLC, complete conversion was observed after 3 hours.
[0121] The reaction mixture was diluted with water (1000 mL) and washed with ethyl acetate (600 mL) to remove all organic impurities. The aqueous phase was acidified with HCl aqueous solution (1N, 70 mL) until the pH was approximately 5-6. This was then extracted with ethyl acetate (2 × 800 mL), and the organic extract was dried over MgSO4 and concentrated under vacuum. The product was used in the next step without further purification (36.5 g, 86%).
[0122] MS(ES-APCI)m / z:[MH] - C 17 H 21 ClNO4 - The calculated value for this is 338.1, and the measured value is 338.2. 1 ¹H NMR (300 MHz, CDCl3, double line (ppm)): 7.20 (signal overlapping with CDCl3 signal, 4H), 3.99-3.97 (m, 1H), 3.62-3.56 (m, 1H), 3.45-3.36 (m, 1H), 2.56-2.50 (m, 1H), 2.19-2.16 (m, 1H), 1.89-1.81 (m, 2H), 1.73-1.58 (m, 1H), 1.37 (s, 9H).
[0123] d) Preparation of compound 11079, i.e., tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]carbamate: To a solution of rel-(1R,2R,4R)-4-(tert-butoxycarbonylamino)-2-(4-chlorophenyl)cyclopentanecarboxylic acid (500 mg, 1.47 mmol, 1 equivalent) in ethyl acetate (5 mL), diisopropylethylamine (0.5 mL, 2.94 mmol, 2 equivalents) and propanephosphonic anhydride (approximately 50% by weight in ethyl acetate, 1 mL, 1.61 mmol, 1.1 equivalents) were added. After all solids dissolved and the reaction mixture became a clear solution, morpholine (0.14 mL, 1.61 mmol, 1.1 equivalents) was added, and the reaction mixture was stirred at room temperature.
[0124] When the reaction progress was monitored by UHPLC, complete conversion was observed after 30 minutes.
[0125] The reaction mixture was diluted with ethyl acetate (15 mL) and washed with aqueous sodium bicarbonate solution (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried over MgSO4 and then concentrated under vacuum. The product was used in the next step without further purification (505 mg, 84%).
[0126] MS(ES-APCI)m / z:[M-Boc+H] + C 16 H 22 ClN2O2 + The calculated value for this is 309.2, and the measured value is 309.2. 1 H NMR (300 MHz, CDCl3, double line (ppm)): 7.27 (d, 2H, J=8.4 Hz), 7.16 (d, 2H, J=8.4 Hz), 5.80-5.77 (m, 1H), 4.31-4.29 (m, 1H), 3.77-3.64 (m, 2H), 3.53-3.41 (m, 4H), 3.18-2.99 (m, 4H), 2.39-2.29 (m, 1H), 2.19-2.15 (m, 1H), 1.98-1.89 (m, 2H), 1.44 (s, 9H).
[0127] e) Preparation of compound ZXR-081, i.e., rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-morpholinomethanone hydrochloride: To a solution of tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]carbamate (580 mg, 1.23 mmol, 1 equivalent) in dichloromethane (5 mL), HCl (4N in dioxane, 3 mL, 12.00 mmol, 10 equivalents) was added, and the reaction mixture was stirred at room temperature.
[0128] The reaction was monitored by UHPLC (acidic buffer, gradient condition B), and complete conversion was observed after 20 hours.
[0129] The reaction mixture was concentrated under vacuum, and the crude product was dissolved in acetonitrile / water (1:1) and freeze-dried. The product as an HCl salt was used in the next step without further purification (430 mg, 99%).
[0130] A 100 mg sample was purified by preparative HPLC (column: XBridge BEH Prep C18 (5 μm), 19 mm × 150 mm, solvent system: acetonitrile / water + 5 mM NH4HCO3) to obtain a high-purity product (37 mg) suitable for bioassays.
[0131] MS(ES-APCI)m / z:[M+H] + C 16 H 22 ClN2O2 + The calculated value for this is 309.1, and the measured value is 309.2. 1 ¹H NMR (300 MHz, MeOD-d4, δ(ppm)): 7.37-7.30 (overlapping peaks, 4H), 3.98-3.93 (m, 1H), 3.73-3.33 (m, 8H), 3.24-3.18 (m, 1H), 3.06-2.98 (m, 1H), 2.58-2.49 (m, 1H), 2.39-2.20 (m, 2H), 2.07-1.98 (m, 1H).
[0132] f) Preparation of compound ZXR-090, i.e., rel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]acetamide: To a solution of [(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-morpholinomethanone hydrochloride (50 mg, 0.14 mmol, 1 equivalent) in dichloromethane (3 mL), diisopropylethylamine (0.1 mL, 0.58 mmol, 4 equivalents) and acetyl chloride (0.013 mL, 0.16 mmol, 1.1 equivalents) were added, and the reaction mixture was stirred at room temperature.
[0133] The reaction was monitored by UHPLC (acidic buffer, gradient condition B), and complete conversion was observed after 20 hours.
[0134] The reaction mixture was concentrated under vacuum, and the crude product was purified by preparative HPLC (column: XBridge BEH Prep C18 (5 μm), 19 mm × 150 mm, solvent system: acetonitrile / water + 0.1% formic acid) to obtain the title compound (34.8 mg, 68%).
[0135] MS(ES-APCI)m / z:[M+H] + C 18 H 24 ClN2O3 + The calculated value for this is 351.1, and the measured value is 351.2. 1 H NMR (300 MHz, CDCl3, δ (ppm)): 7.33 (bs, 1H), 7.23 (d, 2H, J=8.5 Hz), 7.10 (d, 2H, J=8.5 Hz), 4.50-4.46 (m, 1H), 3.77-3.60 (m, 2H), 3.49 (dt, 1H, J=2.8, 7.9 Hz), 3.40-3.23 (m, 3H), 3.15-3.02 (m, 3H), 2.95-2.89 (m, 1H), 2.30-2.177 (m, 2H), 1.96 (s, 3H), 1.92-1.82 (m, 2H).
[0136] Example 2: Synthesis of compound ZXR-807, i.e., rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-thiomorpholinomethanone: [ka]
[0137] a) Preparation of compound 282420, i.e., tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(thiomorpholine-4-carbonyl)cyclopentyl]carbamate: To a solution of rel-(1R,2R,4R)-4-(tert-butoxycarbonylamino)-2-(4-chlorophenyl)cyclopentancarboxylic acid (7.0 g, 20.6 mmol, 1.0 equivalent) in dichloromethane (100 mL), 1-hydroxybenzotriazole (4.4 g, 30.9 mmol, 1.5 equivalent), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (8.0 g, 41.2 mmol, 2.0 equivalent), diisopropylethylamine (14.4 mL, 82.4 mmol, 4.0 equivalent), and thiomorpholine (4.2 mL, 41.2 mmol, 2.0 equivalent) were added, and the reaction mixture was stirred at room temperature.
[0138] When the reaction progress was monitored by UHPLC, complete conversion was observed after 20 hours.
[0139] The reaction mixture was washed with citric acid (5% by weight, 2 × 100 mL), ammonium chloride (200 mL), and sodium bicarbonate (200 mL). The organic phase was dried over MgSO4 and then concentrated under vacuum. The product was used in the next step without further purification (7.2 g, 83%).
[0140] MS(ES-APCI)m / z:[M-Boc+H] + C 16 H 22 ClN2OS + The calculated value for this is 325.1, and the measured value is 325.1. 1H NMR (300 MHz, CDCl3,(ppm)): 7.21 (d, 2H, J=8.4 Hz), 7.09 (d, 2H, J=8.4 Hz), 5.73-5.71 (m, 1H), 4.30-4.19 (m, 1H), 3.92-3.84 (m, 1H), 3.73-3.65 (m, 1H), 3.46-3.34 (m, 3H), 3.05-2.96 (m, 1H), 2.53-2.41 (m, 2H), 2.39-2.20 (m, 2H), 2.14-1.78 (m, 4H), 1.38 (s, 9H).
[0141] b) Preparation of compound ZXR-807, i.e., rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-thiomorpholinomethanone: To a solution of tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(thiomorpholine-4-carbonyl)cyclopentyl]carbamate (7.0 g, 16.5 mmol, 1 equivalent) in 1,4-dioxane (50 mL), HCl (4N in dioxane, 40 mL, 160.0 mmol, 10 equivalents) was added, and the reaction mixture was stirred at room temperature.
[0142] The reaction was monitored by UHPLC (acidic buffer, gradient condition A), and complete conversion was observed after 20 hours.
[0143] The reaction mixture was concentrated under vacuum. The crude product was suspended in diethyl ether (100 mL) and stirred for 30 minutes. The solid was filtered and dried under vacuum to obtain the target compound as an HCl salt (6.3 g, quantitative).
[0144] MS(ES-APCI)m / z:[M+H] + C 16 H 22 ClN2OS + The calculated value for this is 325.1, and the measured value is 325.0. 1¹H NMR (300 MHz, MeOD-d4, δ(ppm)): 7.36-7.32 (overlapping peaks, 4H), 4.03-3.97 (m, 2H), 3.61-3.49 (m, 4H), 3.33-3.32 (m, 1H), 2.62-2.48 (m, 3H), 2.43-2.24 (m, 3H), 2.05-1.96 (m, 2H).
[0145] Example 3: Synthesis of compound ZXR-810, i.e., rel(1R,2R,4R)-4-amino-2-(4-chlorophenyl)-N-isopropyl-N-methylcyclopentanecarboxamide [ka]
[0146] a) Preparation of compound 282421, i.e., tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-[isopropyl(methyl)carbamoyl]cyclopentyl]carbamate: To a solution of rel-(1R,2R,4R)-4-(tert-butoxycarbonylamino)-2-(4-chlorophenyl)cyclopentancarboxylic acid (7.0 g, 20.6 mmol, 1.0 equivalent) in dichloromethane (100 mL), 1-hydroxybenzotriazole (4.4 g, 30.9 mmol, 1.5 equivalent), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (8.0 g, 41.2 mmol, 2.0 equivalent), diisopropylethylamine (14.4 mL, 82.4 mmol, 4.0 equivalent), and isopropylmethylamine (4.3 mL, 41.2 mmol, 2.0 equivalent) were added, and the reaction mixture was stirred at room temperature.
[0147] The reaction was monitored by UHPLC, and complete conversion was observed after 20 hours. The reaction mixture was washed with ammonium chloride (5 × 75 mL) and sodium bicarbonate (2 × 75 mL). The organic phase was dried via MgSO4 and then concentrated under vacuum. The crude product was purified by flash column chromatography (solvent system: cyclohexane / methyl tert-butyl ether) to obtain the title compound (4.9 g, 60%).
[0148] MS(ES-APCI)m / z:[M-Boc+H] + C 16 H 24 ClN2O + The calculated value for this is 295.1, and the measured value is 295.3. 1 ¹H NMR (300 MHz, CDCl3, double line (ppm); observed rotational isomers): 7.19 (d, 4H), J=8.4 Hz), 7.08 (d, 4H, J=8.4 Hz), 5.90 (bs, 2H), 4.8 (septuplicate line, 1H, J=6.8 Hz, major rotational isomer), 4.30-4.15 (m, 2H), 3.64 (septuplicate line, 1H, minor rotational isomer, J=6.6 Hz), 3.48-3.37 (m, 2H), 3.12-2.96 (m, 2H), 2.67 (s, 3H, minor rotational isomer), 2.36 (s, 3H, major rotational isomer), 2.30-2.22 (m, 2H), 2.12-2.06 (m, 2H), 1.97-1.75 (m, 4H), 1.38 (s, 18H), 0.98 (d, 3H, J=6.6 Hz, minor rotational isomer), 0.96 (d, 3H, J=6.8 Hz, major rotational isomer), 0.94 (d, 3H, J=6.8 Hz, major rotational isomer), 0.98 (d, 3H, J=6.6 Hz, minor rotational isomer).
[0149] b) Preparation of compound ZXR-810, i.e., rel(1R,2R,4R)-4-amino-2-(4-chlorophenyl)-N-isopropyl-N-methylcyclopentanecarboxamide: To a solution of tert-butylrel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-[isopropyl(methyl)carbamoyl]cyclopentyl]carbamate (4.9 g, 12.5 mmol, 1.0 equivalent) in 1,4-dioxane (45 mL), HCl (4N in 1,4-dioxane, 31 mL, 124.0 mmol, 10 equivalents) was added, and the reaction mixture was stirred at room temperature.
[0150] When the reaction progress was monitored by UHPLC (acidic buffer, gradient condition A), complete conversion was observed after 4 hours.
[0151] The precipitated solid was filtered, resuspended in diethyl ether (100 mL), and stirred for 30 minutes. The solid was filtered and dried under vacuum to obtain the target compound as an HCl salt (3.6 g, quantitative).
[0152] MS(ES-APCI)m / z:[M+H] + C 16 H 24 ClN2O + The calculated value for this is 295.1, and the measured value is 295.7. 1¹H NMR (300 MHz, DMSO-d6, δ(ppm): 8.4 (bs, 6H-protonated amino group), 7.32 (d, 4H, J=8.4 Hz), 7.25 (d, 4H, J=8.4 Hz), 4.57 (septatum, 1H, J=6.7 Hz, major rotational isomer), 3.96 (septatum, 1H, J=6.5 Hz, minor rotational isomer), 3.86-3.70 (m, 2H), 3.56-3.47 (m, 2H), 3.29 (m, 2H), 2.56 (s, 3H, minor rotational isomer), 2.49 (s, 3H, major rotational isomer), 2.43-2.32 (m, 2H), 2.15-2.01 (m, 4H), 1.84-1.75 (m, 2H), 1.02 (d, 3H, J=6.5 Hz, minor rotational isomer), 0.93 (d, 3H, J=6.7 Hz, major rotational isomer), 0.83 (d, 3H, J=8.7 Hz, major rotational isomer), 0.69 (d, 3H, J=6.5 Hz, minor rotational isomer).
[0153] Construction of a Tob1a overexpressing zebrafish strain To generate a Tob1a overexpressing zebrafish strain (myl7:loxP-myc-BFP-loxP-Kusabira orange-p2A-Tob1a), fertilized eggs were obtained from mating AB wild-type adult zebrafish. A pool of 50 embryos was randomly selected, and RNA extraction and cDNA synthesis were performed. The Tob1a coding sequence (CDS) was amplified from the cDNA of 48 hpf embryos using the following primers: forward (Fw): ATGCAGCTTGAAATCCAAGTAG (SEQ ID NO: 1), reverse (Rv): GTTGGCCATCACTGGCTG (SEQ ID NO: 2). The amplified fragments were then cloned downstream of Kusabira orange in open reading frame (ORF) and in frame using Gibson assembly. After digestion with ClaI and SnaBI (Mercader lab, confidential), cloning was performed in the pDestTol2pA2AC vector (Kwan et al., 2007) containing the following elements: (myl7-LoxP-myc-BFP-rabbit β-globin polyA signaling - LoxP-p2A-Crysalis orange-SV40 polyA;cryaa:cerulean). To facilitate gene transfer, the entire construct was sandwiched between Tol2 sites. In this transgenic line, cardiomyocytes express myctag-BFP. Cre recombination leads to the specific expression of Crysalis orange-p2A-Tob1a in cardiomyocytes. The formal name of this transgenic line is Tg(myl7:loxP-myc-BFP-loxP-Crysalis orange-p2A-Tob1a;cryaa:cerulean). This transgenic line was generated by co-injecting Tol2 mRNA and plasmid into one-cell stage AB zebrafish embryos. F0 founders were screened and selected based on cerulean expression in crystallin and BFP expression in cardiomyocytes. The selected F0 founders were transfected to Tg(cmlc2:CreER). pd10 They were bred and raised to adulthood.
[0154] Tg(cmlc2:CreER) pd10The following was generated: The cmlc2:CreER Cre-ERT2 cDNA from pCre-ERT230 was cloned downstream of the cmlc2 promoter 31, which is 5.1kb. A DsRed-Ex cassette controlled by a lens-specific α-crystallin promoter (α-cry:DsRed) was also included, allowing for visual identification of transgenic animals by lens fluorescence 32, and this was subcloned upstream of the cmlc2:CreER sequence in the opposite direction. The entire construct was sandwiched between two copies of the core element of the chicken β-globin insulator (two core insulator elements), as described in Kikuchi et al., 2010.
[0155] Preparation of adult zebrafish for cardiomyocyte proliferation analysis. In short, adult animals at 9 months of age Tg(myl7:loxP-myc-BFP-loxP-kusabira orange-p2A-Tob1a;cryaa:cerulean);Tg(cmlc2:CreER) pd10 I used it.
[0156] CreErT2 was fused to a triple mutant form of the human estrogen receptor that does not bind to the natural ligand (17β-estradiol) at physiological concentrations but binds to the synthetic estrogen receptor ligand 4-hydroxytamoxifen (OHT). Using OHT, the loxP-myc-BFP-loxP sequence was specifically excised, enabling the expression of the Kusabira orange-p2A-Tob1a transgene under the cardiomyocyte promoter cmlc2. 36 hours prior to cardiac cryoinjury, synthetic estrogen receptor 4-hydroxytamoxifen (4OHT) was administered overnight at a concentration of 10 μM in E3 medium (12-hour pulse). 24 hours prior to cardiac injury, the 4-OHT medium was flushed out and replaced with fresh E3 medium. Cardiac cryoinjury was performed on day 0. 20 μl of BrdU (2.5 mg / ml) in phosphate-buffered saline (PBS) was administered intraperitoneally at 6 dpi. The heart was collected and analyzed at 7 dpi (24-hour BrdU pulse).
[0157] 4-OHT treatment Prior to administration, a 10 mM stock of 4-OHT (dissolved in ethanol) was heated at 65°C for 10 minutes. Adult zebrafish were administered 10 μM of 4-OHT (Sigma, H7904) 36 hours before cardiac freeze injury. The treatment was carried out overnight (12-hour pulse).
[0158] Zebrafish cardiac freeze injury Ventricular cryo-injury experiments were performed on adult zebrafish according to the protocol described (Gonzalez-Rosa and Mercader, 2012). In summary, adult fish were anesthetized, and their pericardial cavities were opened to expose the hearts. Copper filaments, pre-cooled in liquid nitrogen, were carefully applied to the ventricular surface of the heart until they warmed up. After the surgical procedure, the animals were resuscitated by gently supplying water to the gills using a plastic Pasteur pipette.
[0159] Histological analysis and imaging of zebrafish As described in Gonzalez-Rosa and Mercader, 2012, adult zebrafish were euthanized by immersion in 0.16% tricaine, and the hearts were dissected and processed. The samples were fixed overnight in 2% PFA at 4°C and encapsulated in gelatin according to conventional histological procedures. Immunofluorescence of 7 μm sections embedded in gelatin was performed as described in Gonzalez-Rosa et al., 2011. Briefly, the samples were permeabilized with 0.5% Triton X-100 in PBS, blocked in histoblock (5% BSA, 5% goat serum, 20 mM MgCl2) at room temperature for 2 hours, and incubated overnight at 4°C with primary antibody in PBS containing 5% BSA. The samples were incubated with secondary antibody at room temperature for 2 hours and incubated with DAPI for 10 minutes. The primary antibodies used were mouse IgG1 anti-MHC (DSHB F59, 1:20), mouse anti-BrdU (BD PharMingen, 1:250), and rabbit anti-Mef2c (Santa Cruz Biotechnology, C21, sc-313, 1:200). The secondary antibodies were Alexa Fluor 488, Alexa Fluor 568, and Alexa Fluor 647 (Life Technologies, 1:250). The nuclei were counterstained with DAPI, and the slides were mounted in Dako's fluorescent mounting medium.
[0160] Imaging of tissue sections Immunostained sections were imaged using a Zeiss Leica SP8 confocal microscope.
[0161] Cardiomyocyte proliferation: Immunostaining analysis For each heart, three ventricular sections containing the largest injury area were imaged. ImageJ software was used to image the entire ventricle and BrdU. + MHC + Mef2C + (Proliferating cardiomyocytes) and BrdU - MHC + Mef2C +(Non-proliferating cardiomyocytes) were counted. The cardiomyocyte proliferation index represents the number of proliferating cardiomyocytes relative to the total number of cardiomyocytes and is evaluated in the boundary zone close to the injury site. The final cardiomyocyte proliferation index for each animal was calculated as the average of three intercepts.
[0162] Cell culture of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) Human induced pluripotent stem cell-derived (iPSC) cardiomyocytes (iCell® cardiomyocytes, catalog number 11713) were purchased from FUJIFILM Cellular Dynamics. The hiPSC cardiomyocytes were seeded into 96-well plates coated with 0.1% gelatin (STEMCELL tech, 07903) containing iCell cardiomyocyte plating medium (Fujifilm, M1001). After 48 hours, the medium was changed to iCell cardiomyocyte maintenance medium (Fujifilm, M1003), and the cells were cultured for two weeks, changing the medium every 48 to 72 hours. The cells were maintained at 37°C in a humidified incubator (Thermo Scientific, HERACELL 150i) under conditions of 95% air and 5% CO2.
[0163] Eight days later, hiPSC-CMs spontaneously begin to pulsate, and these cells are known to exhibit molecular, electrophysiological, metabolic, mechanical, and hyperstructural properties similar to those of primary human cardiomyocytes (Karakikes et al., 2015). Using this cell model, proliferation (CellTiterGLo marker and Ki67 marker), migration (wound healing assay), and differentiation marker (cardiac troponin T: cTnT) were evaluated in response to compounds ZXR-807, ZXR-810, ZXR-081, and ZXR-090.
[0164] Tob1 knockdown using small interfering silencing RNA H9C2 cells and MCF-7 cells were plated at 100000 cells per ml in DMEM + 10% FBS in a 24-well p24 plate and incubated at 37°C for 24 hours. Tob1 was knocked down using Silencer™ Select siRNA (s139396 and s139397 from ThermoFisher Scientific).
[0165] siRNA (final concentration 90 nmol / l) was transfected using Lipofectamine 3000 (ThermoFisher, L3000001) according to the manufacturer's instructions. Briefly, siRNA (final concentration 90 nmol / l) and Lipofectamine 3000 were first diluted separately in Opti-DMEM medium (Gibco™, Life Technologies, Grand Island, New York, USA) containing neither antibiotics nor serum, and incubated together for 15 minutes. The lipofectamine-siRNA complex was added to the cells, after 4 hours of incubation, the transfection medium was changed to DMEM + 10% FBS, and gene expression was analyzed at 48 hours.
[0166] Tob1 Knockout in H9C2 Cells Using the CRISPR / Cas9 System One day prior to transfection with lipofectamine CRISPRMAX® (Thermofisher, CMAX00001), 100,000 H9C2 cells were plated in a 24-well plate to achieve 70% confluence. The CRISPRMAX® assay was performed according to the manufacturer's instructions. In short, the Cas9 nuclease / gRNA RNP complex was prepared by combining the following components: 3.85 μl of 2 μM Alt-R SpCas9 nuclease v3 (1081059, IDT)1 in 16.65 μl of Opti-MEM (Gibco®, Life Technologies, Grand Island, New York, USA) in tube 1; 2.25 μl of 2 μM sgRNA (Tob1 sgRNA1: AAAAATGTTGACACGTCTCC (SEQ ID NO: 3) and Tob1 sgRNA2: GTTAAAGGCTGAGTGGACCG (SEQ ID NO: 4), negative control: GCACUACCAGAGCUAA (SEQ ID NO: 5), Synthego); 2.5 μl of Cas9 plus reagent; and 1.5 μl of lipofectamine CRISPRMAX (Trademark) in 25 μl of Opti-MEM (Trademark) in tube 2. The Cas9 / sgRNA ribonucleoprotein (RNP) complex was obtained by incubating the mixture in tubes 1 and 2 at room temperature for 10 minutes. 50 μL of the RNP complex was added to cells in 450 μL of fresh, antibiotic-free high-glucose DMEM (ATCC, 30-2002) supplemented with 10% FBS, and the cells were incubated with the RNP complex at 37°C for 48 hours.
[0167] 48 hours after transfection, cells were washed with phosphate-buffered saline and detached using trypsin-EDTA. To confirm successful gene editing, DNA from Tob1-edited H9C2 cells and negative control transfected cells was extracted using COBO SCIENTIFIC Xtract reagent (Cobo Scientific, CX0150), and amplified by PCR (oneTaqQuick, NEB, 174M0486L) using Tob1 primers (Fw: TTTGTTTCTCTGCCACAAACTGA (SEQ ID NO: 6) and Rv: CTGAGGTTAAGGGGGCTGTC (SEQ ID NO: 7), IDT).
[0168] DNA was purified directly from the PCR reaction mixture using a QIAquick PCR purification kit (Qiagen, catalog number / ID: 28104) or purified from an agarose band using a QIAquick gel extraction kit (Qiagen, catalog number / ID: 28704) according to the manufacturer's instructions. In both cases, DNA was finally eluted with 11 μl of nuclease-free water, and 0.4 μl of 100 μM Tob1 forward primer was added to the mixture. Samples were sent to StabVida, LDA (Caparica, Portugal) for Sanger sequencing.
[0169] Cell Proliferation Assay 1) MTT Reduction Assay and Tob1 Knockdown The 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma, M5655-500MG) assay was used as a surrogate to evaluate cell number and proliferation in H9C2 and MCF-7 cells. MTT is a colorimetric assay that measures cellular metabolic activity in viable cells, derived from the activity of mitochondrial dehydrogenase, which cleaves the tetrazolium ring of the yellow tetrazolium salt MTT to yield formazan crystals. The protocol was designed to match the peak decline in Tob1 mRNA expression levels (48 to 96 hours after transfection) with the exponential growth period of cells (24 to 72 hours after replating).
[0170] MCF-7 and H9C2 cells were seeded at 100,000 cells per well in 24-well DMEM+10% FBS plates, reaching 80%-90% at transfection. MCF-7 and H9C2 cells were transfected with Silencer® Select siRNA 24 hours after plating to knock down Tob1. 48 hours after transfection, the cells were lifted and plated in 96-well plates at 10,000 cells (MCF-7) and 8,000 cells (H9C2) per well, and grown for 144 hours. On day 6 (144 hours), 0.5 mg / ml MTT was added and incubated for 3 hours to generate formazan crystals, which were then solubilized with SDS (20%) + HCl (0.02N). After 24 hours, the absorbance was measured at 590 nm using a FLUOstar Omega plate reader (BMG LabTech) spectrophotometer.
[0171] 2) MTT assay in cells treated with the compound of the present invention Both Tob1-expressing H9C2 cells and Tob1 knockout H9C2 cells were seeded in 96-well plates at a rate of 8000 cells per well. After 48 hours, cells were treated with 1.28 nM, 6.4 nM, 32 nM, 160 nM, 800 nM, 4 μM, and 20 μM of ZXR-807, ZXR-810, ZXR-081, and ZXR-090, and cell proliferation was measured 144 hours after treatment using the MTT assay described above.
[0172] 3) CellTiter-Glo® assay in hiPSC-CM The activity of the compounds of the present invention in inducing proliferation in hiPSC-CMs was measured using CellTitler-Glo® (Promega, G7570). The CellTiter-Glo® bioluminescent cell viability assay is similar to the MTT assay but has higher sensitivity and determines the number of metabolically active viable cells, which is based on the quantification of intracellular ATP levels.
[0173] hiPSC-CM cells were seeded in 96-well plates at a rate of 7000 cells per well and treated with 8 nM, 40 nM, and 200 nM of the compounds of the present invention in 0.3% DMSO containing iCell cardiomyocyte medium, as well as with a control treatment, i.e., a vehicle containing 0.3% DMSO in iCell cardiomyocyte medium. Growth of hiPSC-CM cells was measured 144 hours (6 days) and 336 hours (14 days) after treatment. At each time point, 100 μL of CellTiter Glo (CellTiter Glo:cell culture medium ratio 1:1) was added to each well containing 100 μL of iCell cardiomyocyte medium, according to the manufacturer's instructions. Luminescence was measured 30 minutes after adding the reagent using a Varioskan (Thermo Fisher Scientific).
[0174] Cell migration (wound healing) assay in H9C2 cells and hiPSC-CM To prioritize migration over proliferation, H9C2 cells were seeded at a rate of 100,000 cells per well in a 24-well plate using a low-serum-containing medium (DMEM high glucose + 1% FBS). Two hours after seeding, cells were detached from the center of each well using a 1000 μL tip and treated with 100 nM ZXR-807, ZXR-810, ZXR-081, and ZXR-090, as well as 0.3% DMSO (vehicle) under control conditions. The plates were imaged using an inverted microscope (Leica, DMI6000B) immediately after wound creation (0 hours) and 28 hours after abrasion.
[0175] hiPSC-CM cells were seeded in 96-well plates at a rate of 25,000 cells per well. 168 hours after seeding, cells were detached using a 200 μL tip and treated with 8 nM, 40 nM, and 200 nM ZXR-807, ZXR-810, ZXR-081, and ZXR-090, respectively. The plates were imaged using an inverted microscope (Leica, DMI6000B) immediately after wound creation (0 hours) and 144 hours after detachment.
[0176] All images were analyzed using Fiji software (Schindelin et al., 2012), and the amount of cell migration was determined by calculating the wound area at 0 hours and 28 or 144 hours, normalized to control vehicle-treated cells (0.3% DMSO).
[0177] Immunocytochemistry and fluorescence microscopy: Proliferation markers and differentiation markers in hiPSC-CM After the migration assay, the culture medium was aspirated from the 96-well plate, and the cells were washed twice with phosphate-buffered saline (PBS) (1×) (Fisher bioreagents, BP399-4). The cells were fixed with 4% paraformaldehyde (Sigma, 158127) at room temperature for 10 minutes and washed three times with PBS (1×). The cells were permeabilized with Triton® X-100 (0.03%) (Merck, T8787) and blocked with 0.5% goat serum in PBS (1×) (ThermoFisher, 16210064) at room temperature for 1 hour. The primary antibody Ki67 rabbit antibody (1 / 100) (Santacruz, sc-23900) and cardiac troponin (cTnT mouse antibody (1 / 100) (ThermoFisher, MA5-12960)) were diluted in the following buffers: Triton® X-100 (0.03%) and 1% bovine serum albumin (BSA) (10%) (nzytech, MB04602) and PBS (1×). hiPSC-CMs were incubated overnight with the primary antibody at 4°C, washed three times with PBS (1×), and incubated with goat anti-mouse or goat anti-rabbit secondary antibodies coupled to Alexa fluorescent dye (company). Nuclei were visualized by incubation with DAPI (1 / 1000) (Merck, D9542-5MG) at room temperature for 20 minutes. Cells were washed three times with PBS and retained in PBS at 4°C.
[0178] The specimens were examined using a Leica DMI6000B inverted fluorescence microscope with a Leica 20x dry objective lens. Images were analyzed using the open-source image processing package Fiji to quantify nuclear Ki67 fluorescence intensity and cellular cardiac troponin T (cTnT), normalized to the number of nuclei in the field of view.
[0179] Quantitative real-time PCR 1) To evaluate the efficiency of Tob1 knockdown in MCF-7 cells and H9C2 cells, and 2) to evaluate the expression levels of proliferation markers (Cdk1 and Ccnb1) in H9C2 cells treated with the compound of the present invention, H9C2 cells were collected by trypsin treatment and centrifuged at 300×g for 5 minutes. Total mRNA was isolated using the Maxwell 16 LEV simplyRNA Cells Kit or Tissue Kit (Promega, Madison, Wisconsin) according to the manufacturer's instructions. The amount of extracted RNA was quantified using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts). cDNA synthesis was performed from 300 ng of total RNA using a SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific, Waltham, Massachusetts).
[0180] Real-time PCR was performed using a LightCycler 480 SYBR Green I Master on a LightCycler 480 thermal cycler (Roche, Basel, Switzerland). The expression levels of the indicated genes were compared to the conventional 2 -DDCt The sequences were calculated by law and normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of the housekeeping gene. The sequences of the forward and reverse primers are listed in Table 1:
[0181] [Table 1]
[0182] result 1. Tob1 as a relevant target in in vivo cardiac regeneration The Tob1 OE strain of zebrafish shows a decrease in reproduction. To verify the role of tob1 in cardiac regeneration, tob1a was overexpressed in cryo-injured hearts of zebrafish by using a cardiomyocyte-specific, temporally inducible gene overexpression system. In the hearts of adult controls, a high proliferation rate of cardiomyocytes in the myocardial region, reflected by a high density of BrdU-positive cells, was detected. This result was as expected for the endogenous cardiac regeneration process specific to zebrafish at 7 days after injury. However, overexpression of tob1a caused a significant reduction in cardiomyocyte proliferation, which is demonstrated by a decrease in the proliferation index that dropped to half of the value observed under control conditions (Figure 1A). The reduction in proliferative cardiomyocytes in the hearts of Tob1 OE zebrafish after injury is also associated with a decreased density (number of cells per unit area) of proliferating BrdU-positive cardiomyocytes (Figure 1B). These results suggest that overexpression of Tob1 inhibits the proliferation of cardiomyocytes in adult zebrafish, leading to a reduction in the number of cardiomyocytes after injury.
[0183] 2. Tob1 inhibits the proliferation and migration of relevant cell types The present inventors verified the effect of Tob1 inhibition in two different cell lines: MCF7, a human breast cancer cell line used to verify that Tob1 is associated with human tissues, and H9C2, a rat cardiomyoblast cell line used to verify that Tob1 plays a role in cardiac tissue-derived cell lines.
[0184] The relevance of Tob1 was first demonstrated by its expression in MCF-7 cells and H9C2 cells at the perinuclear and intracellular nuclear locations. This observation was obtained from fluorescence microscopy images of both cell types, wherein Tob1 was detected using fluorescence immunohistochemistry by means of a mouse-derived antibody against Tob1 and a green fluorescent secondary antibody against the mouse antibody epitope, and the nuclei were labeled with the DNA-specific probe DAPI.
[0185] Next, to confirm that Tob1 is involved in the process of cell proliferation, we reduced Tob1 mRNA expression by more than 70% by siRNA knockdown in MCF-7 cells and H9C2 cells (Figures 2A and 2B). In both cases, Tob1 promoted a significant increase in proliferation of 37% in MCF-7 cells and 10% in H9C2 cells, respectively (Figures 2A and 2B, left panel). Furthermore, complete depletion of Tob1 in H9C2 cells by CRISPR / Cas9 knockout technology was confirmed to promote a 15% increase in proliferation (Figure 2C). H9C2 Tob1 knockout cells also showed a significant increase in cell migration, which was indicated by a migration-wound healing assay showing that these cells had a greater ability to relocate to injured sites (Figure 2D).
[0186] 3. The compounds of the present invention are potent and selective Tob1 inhibitors. After selecting lead compounds, their efficacy, potency, and selectivity in promoting the proliferation response were evaluated in vitro in rat cardiomyocytes (H9C2 cells) using the MTT assay. H9C2 cells were treated with a vehicle of 0.3% DMSO, along with escalating concentrations of Tob1 inhibitors: ZXR-807, ZXR-810, ZXR-081, and ZXR-090 (1.28 nM to 20 μM). Subsequently, the cells were grown for 144 hours (6 days), and proliferation was evaluated using the MTT assay.
[0187] All four Tob1 inhibitors induced growth increases that were between 26% and 36% higher than the control level, with the greatest biological response observed at low micromolar concentrations (4 μM), as shown in Table 1.
[0188] [Table 2]
[0189] The selectivity of Tob1 inhibitors was evaluated by comparing the dose-response of ZXR-807, ZXR-810, ZXR-081, and ZXR-090 in H9C2 control cells and H9C2 Tob1 KO cells with reduced Tob1 levels by CRISPR / Cas9 technology. The compounds exhibited good selectivity for targeting Tob1, with ZXR-807 and ZXR-081 in particular activating proliferation in H9C2 cells at EC50 values less than 60,000 compared to Tob1 KO H9C2 cells. This indicates that these two Tob1 inhibitors are highly selective for Tob1 (Table 2 and Figure 3). ZXR-810 and ZXR-090 showed lower selectivity for Tob1, but still activated proliferation in H9C2 cells at EC50 values less than 200-300 compared to Tob1 KO cells.
[0190] [Table 3]
[0191] Dose-response studies of Tob1 inhibitors revealed that all four compounds, ZXR-807, ZXR-810, ZXR-081, and ZXR-090, exhibited high potency (EC50) and significantly increased H9C2 cell proliferation at low nanomolar concentrations (Table 2 and Figure 3).
[0192] 4. The compounds of the present invention activate the expression of cell cycle genes. The compounds of the present invention demonstrated a potent ability to promote cell proliferation in rat cardiomyocytes. Indeed, the increased proliferation was associated with the activation of cell cycle gene transcription, which controls the progression of the cell cycle through the G1-S-G2-M phases. Consistently, the Tob1 inhibitors ZXR-807, ZXR-810, ZXR-081, and ZXR-090 promoted the transcriptional activation of Cdk1, a major marker of the G2 / M transition phase, with an approximately 3-fold increase observed in the case of ZXR-081 and ZXR-090. However, the expression of Ccnb1, which regulates early mitotic events together with Cdk1, increased more gradually with ZXR-807, ZXR-810, and ZXR-090 (Figure 4).
[0193] 5. The compounds of the present invention activate cell migration. Furthermore, these molecules show a significant increase in cell migration (Figure 5). H9C2 cells were detached to create wounds in the center of wells, and the migration of cells toward the injury site was measured after 28 hours under control conditions (vehicle) and in the presence of a Tob1 inhibitor. All compounds promoted an increase in migration of over 50% compared to vehicle-treated cells. This is a crucial cellular process, considering that migration, in conjunction with proliferation, is known to maintain cardiac regeneration by ensuring not only the renewal of lost cardiomyocytes but also the replacement of damaged cells by their migration to the injury site.
[0194] 6. Tob1 inhibitors promote the proliferation and migration of human iPSC-derived cardiomyocytes. 6.1. The compounds of the present invention induce proliferation and inhibit differentiation of hiPSC-CM. The inventors tested the compounds of the present invention at a concentration of 8 nM and found that ZXR-807, ZXR-810, and ZXR-081 increased the proliferation rate of hiPSC cardiomyocytes by 20% to 28% 144 hours (6 days) after treatment, and ZXR-807 and ZXR-810 increased it by 40% 336 hours (14 days) after treatment (Figure 6A). ZXR-081 had a transient effect on the increase in proliferation, peaking 144 hours after treatment and disappearing by 336 hours after treatment. The nuclear signal intensity of Ki67, a known marker for proliferative cells used clinically, was evaluated by immunohistochemistry in hiPSC cardiomyocytes treated with Tob1 inhibitors, both near the abrasion or wound area and further away from the wound (Figure 6B). Ki67 is expressed in cells in the G1, S, G2, and M phases of the cell cycle, but not in G0 (quiescent) cells. ZXR-081 significantly increased nuclear Ki67 signaling intensity in hiPSC cardiomyocytes near the abrasion site, while inhibitors of ZXR-807, ZXR-810, and ZXR-081 increased nuclear Ki67 expression away from the abrasion site, reflecting increased concomitant proliferation in these cells.
[0195] On the other hand, when hiPSCs differentiate into cardiomyocytes, they express typical mature cardiac markers such as cardiac troponin T (cTnT). In response to Tob1 inhibitors (144 hours after treatment), differentiated hiPSC cardiomyocytes show a decrease in the expression of the differentiation marker cTnT, particularly near the abrasion-wound area (Figure 7). The decrease in cTnT expression after Tob1 inhibition supports the idea that cells dedifferentiate and enter an intermediate state in which the sarcomere is partially dismantled, which is necessary for the cells to re-enter the cell cycle and proliferate (Jopling et al., 2011).
[0196] 6.2. Lead compounds promote the migration of hiPSC-CMs. As mentioned earlier, cell migration is a crucial component of cardiac regeneration. Interestingly, as shown in Figure 8, the lead compounds ZXR-807, ZXR-810, ZXR-081, and ZXR-090 all activate cell migration in the low nanomolar concentration range (8 nM).
[0197] In short, our results demonstrate that Tob1, a transducer of ERBB21, is involved in regulating cardiomyocyte proliferation and migration, and is a promising new target for cardiac regeneration both in vitro and in vivo.
[0198] 7. Lead compound ZXR-081 improves cardiac function and prevents LV remodeling in adult mice after myocardial infarction. The in vivo efficacy of ZXR-081 was tested by evaluating cardiac function in a mouse model of non-reperfusion myocardial infarction. In adult male and female mice, myocardial infarction was induced by permanent ligation of the left anterior descending artery (LAD). At the end of surgery, mice were intravenously injected with either 0.3 mg / kg (MTD / 10) or 3 mg / kg of ZXR-081 or 5% DMSO vehicle. Administration was repeated 3 days and 6 days after injury (dpi). Animal body weight and welfare were monitored daily, and cardiac function was evaluated by echocardiography and electrocardiogram 2 days before arterial ligation (baseline), 2 days after injury (2D>MI), and before sacrifice at 30 days (30D>MI) (Figure 9A).
[0199] The hearts of mice were imaged by two-dimensional echocardiography according to Simpson's two-plane rule based on apical four-chamber and two-chamber images to obtain end-diastolic and end-systolic ventricular volumes, which were then used to calculate the ejection fraction (EF) = [(EDV-ESV) / EDV] × 100. Infarcted mice treated with 0.3 mg / kg of ZXR-081 showed a higher ejection fraction than vehicle-treated mice two days after injury, after a single dose of the lead compound. Mice treated with 3 mg / kg of ZXR-081 had a higher ejection fraction than vehicle-treated mice both two days after injury (ZXR-081: 41.2±1.87 vs. vehicle: 31.6±2.3) and 30 days after injury (ZXR-081: 41.1±1.44 vs. vehicle: 31.6±1.1). The recovery of ejection rates was enhanced by ZXR-081 two days after injury, followed a similar recovery curve to that of vehicle-treated animals, and resulted in higher ejection rates 30 days after injury, which may indicate an early regenerative and / or protective effect of ZXR-081 (Figure 9B).
[0200] Permanent ligation of the LAD in mice completely blocks blood flow, resulting in severe ischemia and consequently leading to the formation of large, permanent scars in the infarcted area, ranging from 30% to 40% of the total LV volume (Figure 9C).
[0201] To evaluate cardiac remodeling and infarct area size, the heart was transversely sectioned from apex to base, stained with picrosilius red to visualize the LV structure, and infarct size was measured 30 days after injury. Scar-infarct area was measured in individual sections, and all partial scar areas were summed and expressed as a percentage of the total LV wall surface. The infarct area in control cardiac sections, indicated by dark red staining, extends over a very large portion of the LV wall surface in the hearts of vehicle-treated mice. In mice treated with ZXR-081, the infarct area was limited to a much smaller, localized portion of the LV wall surface, and in the evaluation of infarct size across the entire LV, administration of the Tob1 inhibitor ZXR-081 at the lowest dose of 0.3 mg / kg showed a significant and clear reduction in infarct size (Figure 9C).
[0202] Furthermore, in control vehicle-treated mice (Figure 9D, left), clear remodeling of the LV is observed, as indicated by dramatic thinning of the LV wall and enlargement of the LV lumen. Consistent with the improvement in cardiac function 30 days after MI, ZXR-081 prevents severe adverse remodeling of the LV lumen, as indicated by the restoration of LV anterior wall thickness in treated animals (Figure 9D, Figure 9E).
[0203] When cardiomyocytes are lost in the infarcted area and replaced by fibrous tissue, structural remodeling occurs, involving not only thinning of the LV wall and significant dilation of the LV, but also electrical remodeling, as assessed by electrocardiogram (ECG) (Figure 9F). After myocardial injury, the QRS interval associated with the expansion of ventricular depolarization is delayed in all conditions (Figure 9F, 2D>MI), which is almost certainly due to left bundle branch block. The QRS interval is known to be an important indicator of survival in patients after MI, and QRS prolongation is associated with a worse prognosis. In 30D>MI, the duration of the QRS interval remained high in vehicle-treated mice, while the duration of the QRS interval in mice treated with 0.3 mg / kg or 3 mg / kg of ZXR-081 did not differ significantly from baseline levels, suggesting that ZXR-081 treatment may lead to a better prognosis after myocardial infarction.
[0204] Following severe cardiac injury and ischemic attacks induced by permanent ligation of the laryngeal vascular barrier (LAD), the restoration of blood flow and the transport of oxygen and nutrients to the damaged area are crucial for post-infarction healing. To prevent necrosis and death of cardiomyocytes and restore blood supply, the formation of new blood vessels, known as angiogenesis, is induced, primarily in the infarct boundary zone, by the secretion of pro-angiogenic factors in response to hypoxia. ZXR-081 promoted angiogenesis not only at the infarct boundary but also at more distal sites by increasing the number or density of blood vessels supplying tissues compared to vehicle-treated mice (Figure 9G).
[0205] A key observation from this study is that cardiac function, as measured by ejection fraction, had already recovered two days after injury (Figure 9B). Proliferative results demonstrating that ZXR-081 activates cardiomyocyte proliferation at this stage (Figure 9H) may be the reason for this recovery. However, an additional mechanism that may contribute is cardioprotection from apoptosis. To demonstrate whether this mechanism is in place, we evaluated the percentage of apoptotic cells present in infarcted tissue in mice administered with and without ZXR-081. Interestingly, in mice administered 3 mg / kg of ZXR-081, a significant 40% reduction in apoptotic cells was detected compared to the vehicle (Figure 9I).
[0206] 8. Lead compound ZXR-081 reverses contractility reduction and ventricular atrophy in a zebrafish larval model of doxorubicin-induced cardiac injury. The cardioprotective effects of ZXR-081 were evaluated using a transgenic zebrafish model with cardiomyocytes expressing green fluorescent protein (GFP) under the control of the myosin light chain 7 (myl7) promoter. Cardiac injury was simulated by exposing zebrafish larvae to the cardiotoxic chemotherapeutic agent doxorubicin at 60 mM and 70 mM for 4 days. To assess the potential of ZXR-081 to mitigate doxorubicin-induced cardiotoxicity, embryos were incubated with either the vehicle DMSO (0.3%), doxorubicin, or 100 mM ZXR-081 together with doxorubicin from 24 hpf (time after fertilization) to 120 hpf.
[0207] Embryos were continuously exposed to each treatment over a 96-hour period without changing the culture medium. Daily monitoring was performed, and all larvae that died experimentally were removed. After 4 days of treatment, zebrafish larvae were anesthetized with 0.28 mg / ml tricaine and individually plated in 96-well plates for in vivo functional imaging using the ZeCardio imaging platform.
[0208] The cardiac function of zebrafish larvae was evaluated using a highly automated in vivo imaging platform. This system combines two components: 1) a Union Biometrica VAST (Vertebrate Automated Screening Technology) system consisting of an LP sampler, an automated fluid system that gently aspirates 2-7 day old zebrafish larvae, transfers them to a VAST BioImager, and precisely positions each larva within a glass capillary; and 2) an integrated imaging system that detects larvae within the capillary and rotates them in the desired direction to capture images using a Leica DM6B upright wide-field microscope equipped with a Leica DFC9000 GTC CMOS camera optimized for high-speed fluorescence imaging. Videos of cardiac function were recorded at 100 frames per second, with each time-lapse sequence lasting 20 seconds. The resulting video data was saved for subsequent analysis.
[0209] This high-performance system enables high-throughput, standardized imaging of zebrafish larval hearts, and when combined with the ZeCardio 2.0 software, it can recognize and segment cardiac chambers (based on deep learning algorithms). Furthermore, it can extract functional parameters such as heart rate, arrhythmia, ejection fraction, shortening ratio, atrial and ventricular chamber area, atrial and ventricular diameter, global strain, segment strain, and radial strain.
[0210] Before evaluating cardiac function, the mortality rates of zebrafish larvae exposed to 60 mM and 70 mM doxorubicin were determined. This was done by counting the number of larvae that died 120 hours after fertilization (hpf). While doxorubicin is known to cause cardiac injury and cardiotoxicity, it also caused significant mortality (50%–65%) in zebrafish larvae, and ZXR-081 was able to reduce this mortality rate by approximately half (Figure 10A).
[0211] Figure 10B shows that zebrafish larvae treated with 60 mM and 70 mM doxorubicin had lower ejection rates than larvae treated with vehicle (vehicle: 33.2 ± 1.7 vs. doxorubicin (60 mM): 20.5 ± 4.3 and doxorubicin (70 mM): 22.1 ± 5.6). Co-incubation with 100 mM ZXR-081 and either 60 mM or 70 mM doxorubicin promoted the recovery of ejection rates at both doxorubicin concentrations (ZXR-081 + 60 mM DOX: 36.8 ± 3.9 and ZXR-081 + 70 mM DOX: 38.1 ± 2.7).
[0212] Furthermore, doxorubicin induces ventricular atrophy in zebrafish larvae, likely due to cardiomyocyte death and apoptosis (Christidi and Brunham, 2021), a well-characterized process associated with doxorubicin. Figure 10C shows that doxorubicin-induced ventricular atrophy was significantly reversed in zebrafish larvae treated with 100 mM ZXR-081, as estimated by ventricular area, and this effect was consistent across both concentrations of doxorubicin tested.
[0213] The Tob1 inhibitor ZXR-081 not only preserves cardiac function and ventricular remodeling in a mouse model of myocardial infarction, but can also promote cardiac regeneration and / or cardioprotection in a zebrafish model of cardiac injury.
[0214] Zebrafish lineage We used a zebrafish transgenic strain, Tg(myl7:GFP), which expresses green fluorescent protein (GFP) under the control of the myl7 (myosin light chain 7) promoter in cardiomyocytes.
[0215] Treatment of zebrafish larvae 25 to 30 zebrafish embryos were plated in a 6-well plate at 24 hpf with 3 ml of E3 in a final volume, treated with 0.2 mM PTU to ensure larval clarity, and then treated with the vehicle DMSO (0.3%), 60 mM and 70 mM doxorubicin, with and without the use of the regeneration-promoting molecule ZXR-081, to induce cardiotoxicity.
[0216] In vivo cardiac imaging On day 5 post-fertilization, the larvae were washed with embryo medium E3 (1×), anesthetized with 0.28 mg / ml tricaine, individually plated in 96-well plates containing tricaine along with 200 ml of zebrafish embryo medium E3, and imaged using the in vivo imaging platform ZeCardio.
[0217] Cardiac function parameters of zebrafish larvae were evaluated using an automated in vivo imaging platform integrating the VAST system (Union Biometrica), which consists of two complementary devices: (1) an LP sampler, an automated fluid system capable of aspirating zebrafish larvae from 2 to 7 days old and delivering them directly to a VAST BioImager; and (2) a VAST BioImager, an automated fluid system that positions zebrafish larvae in glass capillaries. Once introduced into the glass capillaries, the larvae were recognized by the integrated imaging system, rotated to the desired angle, and imaged using a Leica DM6B upright wide-field microscope connected to a Leica DFC9000 GTC CMOS camera suitable for high-speed fluorescence imaging. Video was acquired at a frame rate of 100 frames per second (fps). Each time-lapse movie had a duration of 20 seconds, and the video data was saved in .lif format.
[0218] analysis Data and output from VAST (under sufficiently associated conditions) were uploaded to a drive for automated analysis, along with .lif videos. The ZeCardio software (based on deep learning algorithms) can recognize and segment cardiac chambers and extract functional parameters such as heart rate, arrhythmias, ejection fraction, shortening ratio, atrial and ventricular chamber area, atrial and ventricular diameter, global strain, segment strain, and radial strain.
[0219] Significant differences between different treatment groups were determined by Student's test: * p<0.05, ** p<0.01, and *** The comparison was performed with p<0.001.
[0220] 9. Tob1 inhibits the proliferation and migration of related cell types. HepG2 cells were seeded in 96-well plates at a rate of 10,000 cells per well. After 24 hours, the cells were treated with 3 nM, 30 nM, and 300 nM solutions, and cell proliferation was measured 24 hours after treatment using the MTT assay described above (Figure 11).
[0221] The effects of Tob1 inhibition were investigated in three different cell lines: MCF7, a human breast cancer cell line, which verifies the involvement of Tob1 in human tissue; HepG2, a human hepatocellular carcinoma cell line, which highlights the role of Tob1 in liver tissue; and H9C2, a rat cardiomyocyte line, which verifies the role of Tob1 in cardiac tissue-derived cell lines.
[0222] The inventors have successfully identified a novel, bioactive small molecule that acts as a Tob1-Cnot7 interaction inhibitor, capable of promoting proliferation, migration, and regeneration processes in mammalian cardiomyocytes. In fact, this small molecule offers a valuable and necessary alternative to stem cell therapy and palliative care for improving cardiac function after myocardial infarction.
[0223] Bibliographic References Bai Y, Tashiro S, Nagatoishi S, Suzuki T, Yan D, Liu R, Tsumoto K, Bartlam M, Yamamoto T. Structural basis for inhibition of the Tob-CNOT7 interaction by a fragment screening approach. Protein Cell. 2015 Dec;6(12):924-8. doi: 10.1007 / s13238-015-0225-6. PMID: 26518565; PMCID: PMC4656213. Carbone RG, Monselise A, Bottino G, Negrini S, Puppo F. Stem cells therapy in acute myocardial infarction: a new era? Clin Exp Med. 2021 May;21(2):231-237. doi: 10.1007 / s10238-021-00682-3. Epub 2021 Jan 23. PMID: 33484381; PMCID: PMC8053645. Christidi, E., Brunham, L.R. Regulated cell death pathways in doxorubicin-induced cardiotoxicity. Cell Death Dis 12, 339 (2021) Doidge R, Mittal S, Aslam A, Winkler GS. The anti-proliferative activity of BTG / TOB proteins is mediated via the Caf1a (CNOT7) and Caf1b (CNOT8) deadenylase subunits of the Ccr4-not complex. PLoS One. 2012;7(12):e51331. doi: 10.1371 / journal.pone.0051331. Epub 2012 Dec 7. PMID: 23236473; PMCID: PMC3517456. Gonzalez-Rosa JM, Martin V, Peralta M, Torres M, Mercader N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 2011 May;138(9):1663-74. doi: 10.1242 / dev.060897. Epub 2011 Mar 23. PMID: 21429987. Gonzalez-Rosa JM, Mercader N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nat Protoc. 2012 Mar 29;7(4):782-8. doi: 10.1038 / nprot.2012.025. PMID: 22461067. Heallen TR, Kadow ZA, Kim JH, Wang J, Martin JF. Stimulating Cardiogenesis as a Treatment for Heart Failure. Circ Res. 2019 May 24;124(11):1647-1657. doi: 10.1161 / CIRCRESAHA.118.313573. PMID: 31120819; PMCID: PMC6534162. Hong CC. The grand challenge of discovering new cardiovascular drugs. Front Drug Discov (Lausanne). 2022;2:1027401. doi: 10.3389 / fddsv.2022.1027401. Epub 2022 Sep 23. PMID: 37123434; PMCID: PMC10134778. Jopling, C., Boue, S. & Belmonte, J. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol12, 79-89 (2011). https: / / doi.org / 10.1038 / nrm3043. Karakikes I, Ameen M, Termglinchan V, Wu JC. Human induced pluripotent stem cell-derived cardiomyocytes: insights into molecular, cellular, and functional phenotypes. Circ Res. 2015 Jun 19;117(1):80-8. doi: 10.1161 / CIRCRESAHA.117.305365. PMID: 26089365; PMCID: PMC4546707. Kikuchi K, Holdway JE, Werdich AA, Anderson RM, Fang Y, Egnaczyk GF, Evans T, Macrae CA, Stainier DY, Poss KD. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 2010 Mar 25;464(7288):601-5. doi: 10.1038 / nature08804. PMID: 20336144; PMCID: PMC3040215. Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yost HJ, Kanki JP, Chien CB. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn. 2007 Nov;236(11):3088-99. doi: 10.1002 / dvd.21343. PMID: 17937395. Salari N, Morddarvanjoghi F, Abdolmaleki A, Rasoulpoor S, Khaleghi AA, Hezarkhani LA, Shohaimi S, Mohammadi M. The global prevalence of myocardial infarction: a systematic review and meta-analysis. BMC Cardiovasc Disord. 2023 Apr 22;23(1):206. doi: 10.1186 / s12872-023-03231-w. PMID: 37087452; PMCID: PMC10122825. Schindelin J, Arganda-Carreras I, Frize E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012 Jun 28;9(7):676-82. doi: 10.1038 / nmeth.2019. PMID: 22743772; PMCID: PMC3855844. Winkler GS. The mammalian anti-proliferative BTG / Tob protein family. J Cell Physiol. 2010 Jan;222(1):66-72. doi: 10.1002 / jcp.21919. PMID: 19746446.
Claims
1. Equation (I): 【Chemistry 1】 (In the formula, R 1 H, (C 1 ~C 10 ) alkyl, -C(O)R 5 , or -C(O)OR 6 This represents, R 2a ~R 2e They are either the same or different, and represent hydrogen, hydroxyl, or halogen. R 3 and R 4 are the same or different, and are (C 1 -C 10 )alkyl; (C 2 , or (C 1 -C 10 )alkyl substituted with one or more groups selected from -OH, -CN, halogen, -NH 1 -C 10 )alkyl, or R 3 and R 4 Together with the N heteroatoms to which they are attached, they form a five- or six-membered heteroring containing a second heteroatom selected from N, O, or S. R 5 and R 6 H; (C 1 ~C 10 ) Alkyl; -OH, -CN, halogen, -NH 2 , or (C 1 ~C 10 (C) Substituted with one or more groups selected from alkyl groups 1 ~C 10 ) Represents alkyl, A "heterogeneous ring" refers to a system of rings having one or two rings, where each of the rings is: It is saturated, partially saturated, or aromatic, and It consists of five or six ring members, where one of the ring members is R 3 and R 4 It corresponds to the N atom to which it is attached, and the remaining ring members are CR x , C(R x ) 2 , NR y Selected from N, O, or S, R x is hydrogen or (C 1 ~C 10 ) Selected from alkyl, and R y is hydrogen or (C 1 ~C 10 Compounds of alkyl groups (selected from alkyl groups), their solvates, stereoisomers, or salts.
2. R 2a ~R 2e A compound of formula (I) according to claim 1, wherein is the same or different and represents hydrogen or halogen.
3. R 2a ~R 2e A compound of formula (I) according to claim 1 or 2, wherein one of the elements is a halogen and the other is hydrogen.
4. R 2c A compound of formula (I) according to any one of claims 1 to 3, wherein is a halogen.
5. R 2c A compound of formula (I) according to any one of claims 1 to 4, wherein is chloro.
6. R 1 is -H, (C 1 ~C 4 ) alkyl, or C(O)R 6 A compound of formula (I) according to any one of claims 1 to 5, which represents [the specified formula].
7. R 1 is -H or C(O)R 6 A compound of formula (I) according to any one of claims 1 to 6, which represents [the specified formula].
8. R 6 is H or (C 1 ~C 10 A compound of formula (I) according to any one of claims 1 to 7, representing an alkyl group.
9. R 6 is H or (C 1 ~C 2 A compound of formula (I) according to any one of claims 1 to 8, representing an alkyl group.
10. R 6 A compound of formula (I) according to any one of claims 1 to 9, wherein is H or methyl.
11. R 3 and R 4 They are either the same or different, and (C 1 ~C 4 ) alkyl; or -OH, -CN, halogen, -NH 2 , (C 1 ~C 3 (C) Substituted with one or more groups selected from alkyl groups 1 ~C 4 A compound of formula (I) according to any one of claims 1 to 10, representing an alkyl group.
12. R 3 and R 4 They are either the same or different, and (C 1 ~C 4 A compound of formula (I) according to any one of claims 1 to 11, representing an alkyl group.
13. R 3 and R 4 Together with the N heteroatoms to which they are attached, they form a six-membered heterocycle consisting of one ring having six ring members, where one of the ring members is R 3 and R 4 The N atom to which is attached is the other ring member, the other of which is a second heteroatom selected from O or S, and the remaining ring member is C(R x ) 2 A compound of formula (I) according to any one of claims 1 to 10.
14. Each R x Independently, hydrogen and (C 1 ~C 3 A compound of formula (I) according to any one of claims 1 to 10, selected from alkyl groups.
15. Each R x A compound of formula (I) according to any one of claims 1 to 10, wherein is hydrogen.
16. rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-thiomorpholinomethanone, rel(1R,2R,4R)-4-amino-2-(4-chlorophenyl)-N-isopropyl-N-methylcyclopentanecarboxamide rel-[(1R,2R,4R)-4-amino-2-(4-chlorophenyl)cyclopentyl]-morpholinomethanone hydrochloride, rel-N-[(1R,3R,4R)-3-(4-chlorophenyl)-4-(morpholine-4-carbonyl)cyclopentyl]acetamide, and all of those salts, A compound of formula (I) according to claim 1, selected from the group consisting of the following.
17. A pharmaceutical composition comprising one or more pharmaceutically acceptable excipients and / or carriers together with a compound of formula (I) as defined in any one of claims 1 to 16.
18. A topical cosmetic composition comprising one or more cosmetically acceptable excipients and / or carriers together with a compound of formula (I) as defined in any one of claims 1 to 16.
19. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, used in therapeutic purposes.
20. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, used in the repair or regeneration of cell tissue.
21. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, used in the repair or regeneration of cardiac cell tissue.
22. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, used in the prevention or treatment of myocardial infarction.
23. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, used in the prevention or treatment of heart failure.
24. A compound of formula (I) according to any one of claims 1 to 16, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, used in the prevention of cell damage.
25. The compound or composition is a compound of formula (I) according to any one of claims 1 to 16 used according to claim 20 or 21, a solvate, stereoisomer, or salt thereof, or a pharmaceutical composition according to claim 17, which inhibits TOB1 activity and promotes cell proliferation.
26. A cosmetic use of a compound of formula (I) according to any one of claims 1 to 16, a stereoisomer thereof, or a salt thereof, or a cosmetic composition according to claim 18, for the regeneration or repair of skin.