Derived organisms

Abstract

The present invention relates to novel polypeptides, polynucleotides encoding the polypeptides, and compositions comprising the polypeptides or polynucleotides. The present invention also relates to the use of the polypeptides, polynucleotides, and compositions for the treatment, prevention, and diagnosis of cancer, particularly colorectal cancer.

Description

TECHNICAL FIELD

[0001] The present invention relates to novel polypeptides, polynucleotides encoding said polypeptides, and compositions comprising said polypeptides or polynucleotides. The present invention also relates to the use of said polypeptides, polynucleotides and compositions for the treatment, prevention and diagnosis of cancer, in particular colorectal cancer. BACKGROUND ART

[0002] Tumor-associated antigens (TAA) have been proposed as a promising source of neoantigens for cancer therapy. However, clinical trials have shown significant adverse events such as neurological and respiratory toxicities associated with anti-MAGE-A3 TCR gene and CEACAM5-specific CAR T cell therapy when TAA-based neoantigens are administered, leading to the discontinuation of TAA-based cancer therapies. The present invention further increases the number of published neoantigens for colorectal cancer, and reveals a promising new class of molecules that expands the pool of promising off-the-shelf antigen-targeted therapies. These novel molecules are expressed from large non-coding regions of the genome, for example from long non-coding RNAs (lncRNAs). SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEMS

[0003] The inventors have established the existence of a cohort of lncRNAs (sometimes referred to herein as camyoRNAs) that are specifically expressed in cancer tissue, particularly colorectal cancer tissue. The inventors have also identified smORFs (small open reading frames) contained within these lncRNAs that are translated into proteins (sometimes referred to herein as "camyopeptides") in cancer tissue, particularly colorectal cancer tissue. It is also described herein for the first time that these translated proteins are processed in cells and presented by the major histocompatibility complex (MHC) in the form of immunogenic peptide fragments. These peptides may be referred to herein as "camyotope." Cancer-specific lncRNAs and polypeptides derived therefrom represent promising candidates for the treatment and diagnosis of colorectal cancer, with no or very limited off-target effects.

[0004] In contrast to tumor-specific antigens (TSAs), camyo peptides and camyo topes are not limited to the occurrence of repeat mutations within host genes. Due to the tumor-specific expression profiles of the camyoRNAs from which they originate, any immunogenic peptide derived from translated smORFs can be targeted as TAAs (tumor-associated antigens) in the treatment of colorectal cancer, thus significantly expanding the pool of promising nascent antigens for targeting via immunotherapy. They can also be used as biomarkers for the diagnosis of colorectal cancer. In addition, the workflow for verifying the presence of camyoRNA-derived TAAs is faster and simpler, as it involves differential expression analysis based on direct RNA sequencing of camyoRNAs in normal and colorectal cancer cohorts, rendering variant calling obsolete. The use of camyoRNA-based TAAs can improve the efficiency of "off-the-shelf" therapies (i.e., immunotherapies generally suitable for cancer patients, as opposed to immunotherapies tailored to specific patients with specific antigen variants) by increasing both population coverage and the number of targetable antigens per patient. The camyoRNA, camyo peptide, and camyo tope described herein have expression profiles similar to the well-known protein code, TAA, and are specific to colorectal cancer, and are therefore expected to have similar therapeutic vaccine target potential.

[0005] Ready-made vaccines, such as those described herein, that target camyoRNA, camyo peptides, and camyotopes offer several advantages. Development costs per patient are significantly lower compared to personalized vaccines, as they only need to be produced once, and patient selection can be performed rapidly and cost-effectively, for example, by direct multiplex quantitative PCR (qPCR) analysis. In addition, the tumor-specific nature of camyoRNA may be linked to its role in tumor development and progression. Combined with the multiplicity of camyoRNA present in any given patient, this should reduce opportunities for immune evasion when targeting them as part of a vaccine.

[0006] In summary, the inventors discovered that a cohort of lncRNAs is overexpressed in colorectal cancer cells compared to healthy cells. The polypeptide encoded by the lncRNAs is determined to be presented by MHC and represents an immunogenic oncogenic antigen. Therefore, the inventors have favorably determined that the polypeptides can be utilized in a therapeutic setting for the purpose of inducing an antitumor immune response in colorectal cancer, for example, as a formulation of a cancer vaccine and through its administration. Thus, the present invention relates to a novel polypeptide that can induce an antitumor immune response in a subject. The same cohort of lncRNAs and the polypeptides encoded by them may also be useful as markers for the diagnosis of colorectal cancer in a subject.

[0007] The present invention provides a polypeptide encoded by an open reading frame in a long non-coding RNA gene (lncRNA), wherein the lncRNA is overexpressed in colorectal cancer cells compared to healthy cells, and preferably the lncRNA is defined by one of SEQ ID NOs: 1 to 18 (these sequences are also provided by the present invention and may be referred herein to as exemplary "camyoRNAs" associated with colorectal cancer). The polypeptide may comprise a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or variants thereof, contained in one of the polypeptide sequences defined by SEQ ID NOs: 19 to 97 (these sequences may be referred herein to as exemplary "camyo peptides" associated with colorectal cancer). The polypeptide may comprise or consist of one of the polypeptide sequences defined by SEQ ID NOs: 98 to 611 (these sequences may be referred herein to as exemplary "camyotopes" associated with colorectal cancer—a term indicating that they are immunogenic epitopes of camyo peptides).

[0008] The present invention Polynucleotides encoding one or more of the polypeptides, and vectors and / or cells containing the polynucleotides; A composition comprising the polypeptide, polynucleotide, cell, or vector, and optionally one or more pharmaceutically acceptable carriers, preservatives, or diluents; A method for treating colorectal cancer in an individual, comprising administering the polypeptide, polynucleotide, cell, vector, or composition to the individual. We also offer this. [Brief explanation of the drawing]

[0009] [Figure 1] This figure shows the cumulative distribution of the 10 most highly expressed camyoRNAs (thick lines), 6 well-known TAAs (dotted lines), and TAAs contained in the PolyPEPI1018 multi-target vaccine, which is well-known in the art, in CRCs (dashed lines). The plot visualizes the percentage of cancer samples expressing multiple targets. For example, 50% of cancer samples express 5 or more camyoRNAs. [Figure 2] This figure shows the CRC stage-specific expression coverage. Each bar represents the average expression coverage (%) for stage I, II, III, and IV CRC samples obtained from the TCGA-COAD cohort. The average coverage across the entire COAD-TCGA cohort is shown in green. [Figure 3] This figure shows the expression analysis of camyoRNAs in preferred vaccine compositions of the present invention. The figure shows box plots for each camyoRNA, illustrating their total present quantity (TPM) in tumor samples, healthy transverse colon samples, and healthy sigmoid colon samples. [Figure 4] This figure shows the translation levels of camyo peptides and well-known TAAs. The heatmap values ​​represent the translation levels of each camyo peptide and a series of well-known TAAs across a cohort of healthy colon tissue proteomics samples. [Figure 5]This figure shows the number of MS spectra matching any of the peptides produced by the preferred vaccine composition of the present invention. The x-axis represents six samples; two healthy donor PBMCs electroporated using a short construct (S2), a long construct (L6), or no construct (Mock). [Figure 6] This figure shows homology analysis of a normal human proteome and other animal species. A) Minimum log10 BLASTp E values ​​for each of 73 camyo topopes (blue), 12 well-known TAAs (red), and (positive control) species-specific sequences (green) after alignment to human and B) dog, macaque, mouse, rat, and pig reference proteomes. [Figure 7] This figure shows that granzyme B, interferon gamma, and interleukin II respond to camyo-tope stimulation in five healthy donors. [Figure 8] This figure shows how individual healthy donors respond to camyo tops and TAAs. Each column represents the ELISpot response of one healthy donor to the camyo peptide pool, as well as to positive and negative controls. [Figure 9] Using expression-based metrics, all 239 patients in the analyzed CRC cohort expressed at least one camyoRNA, and more than 60% expressed six or more. [Modes for carrying out the invention]

[0010] [A brief explanation of arrays] Sequence IDs 1-18 are polynucleotide sequences that define 18 lncRNAs, which may be referred to herein as exemplary “camyoRNAs” associated with colorectal cancer.

[0011] Sequence IDs 19–97 are polypeptide sequences translated from the open reading frames in 18 lncRNAs of Sequence IDs 1–18, and these polypeptide sequences may be referred to herein as exemplary "camyo peptides" associated with colorectal cancer.

[0012] Sequence IDs 98-611 are polypeptide sequences derived from larger polypeptide sequences defined by Sequence IDs 19-97, which may be referred to herein as exemplary “camyotopes” associated with colorectal cancer. [Detailed description of the invention] It is understood that various applications of the disclosed products and methods may be adapted to specific needs in the art. It is also understood that the terms used herein are for the purpose of describing specific embodiments of the invention and are not intended to limit them.

[0013] In addition, as used herein and in the appended claims, the singular forms "a," "an," and "the" include multiple references unless the content explicitly indicates otherwise. Thus, for example, referring to "one polypeptide" includes "multiple polypeptides."

[0014] The terms “polypeptide” and “peptide” are used interchangeably herein to refer to polymers of amino acid residues, as well as their variants and synthetic analogs. Accordingly, these terms apply to amino acid polymers, where one or more amino acid residues are synthetic or naturally occurring amino acids, such as chemical analogs of corresponding naturally occurring amino acids, and to naturally occurring amino acid polymers. Polypeptides may undergo maturation or post-translational modification processes, including but not limited to glycosylation, proteolytic cleavage, lipidization, signal peptide cleavage, propeptide cleavage, and phosphorylation. Peptides can be produced using recombinant technology, for example, through the expression of recombinant or synthetic polynucleotides. Typically, recombinantly produced peptides contain substantially no culture medium; for example, the culture medium accounts for less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

[0015] In the context of this disclosure, the term “amino acid” is used in its broadest sense and includes organic compounds containing amine (NH2) and carboxyl (COOH) functional groups along with side chains specific to each amino acid (e.g., R group). In some embodiments, amino acids refer to naturally occurring L α-amino acids or residues. The one- and three-letter abbreviations commonly used for naturally occurring amino acids are used herein: A=Ala; C=Cys; D=Asp; E=Glu; F=Phe; G=Gly; H=His; I=Ile; K=Lys; L=Leu; M=Met; N=Asn; P=Pro; Q=Gln; R=Arg; S=Ser; T=Thr; V=Val; W=Trp; and Y=Tyr (Lehninger, AL, (1975) Biochemistry, 2nd edition, pp. 71-92, Worth Publishers, New York). The general term “amino acid” further includes chemically modified amino acids such as D-amino acids, retroinversoamino acids, and amino acid analogs, naturally occurring amino acids that are not normally incorporated into proteins, such as norleucine, and chemically synthesized compounds that have properties well known in the art as characteristic of amino acids, such as β-amino acids. For example, analogs or mimics of phenylalanine or proline that perform the same stereochemical constraints on peptide compounds as natural phenylalanine or proline do are included in the definition of an amino acid. Such analogs and mimics are referred to herein as “functional equivalents” of the respective amino acids. Other examples of amino acids are listed by reference in Roberts and Vellaccio, The Peptides: Analysis, Synthesis, Biology, Gross and Meiehofer (eds.), Vol. 5, p. 341, Academic Press, Inc., NY 1983.

[0016] The term "protein" is used to describe a folded polypeptide having a secondary or tertiary structure. A protein may be composed of a single polypeptide, or may comprise a plurality of polypeptides associated to form a multimer. The multimer may be a homo-oligomer or a hetero-oligomer. The protein may be a naturally occurring or wild-type protein, or a modified or non-naturally occurring protein. A protein may differ from a wild-type protein, for example, by the addition, substitution, or deletion of one or more amino acids.

[0017] A "variant" of a protein includes peptides, oligopeptides, polypeptides, proteins and enzymes that have amino acid substitutions, deletions and / or insertions as compared to the corresponding unmodified or wild-type protein, and that possess similar biological and functional activities to the unmodified protein from which they are derived. As used herein, the term "amino acid identity" refers to the extent to which sequences are identical on an amino acid-by-amino acid basis over the entire comparison window. Accordingly, the "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the entire comparison window, determining the number of positions at which identical amino acid residues (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) are present in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to obtain the percentage of sequence identity.

[0018] For all aspects and embodiments of the present invention, a polypeptide "variant" has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complete sequence identity to a specific corresponding amino acid sequence. The sequence identity may be for a fragment or portion of a full-length polynucleotide or polypeptide. Accordingly, a sequence may have only 50% overall sequence identity to the full-length reference sequence, while the sequence of a particular region, domain or subunit may share a degree of sequence identity of 80%, 90% or 99% with the reference sequence.

[0019] The term "wild-type" refers to a gene or gene product isolated from a naturally occurring source. A wild-type gene is the one most frequently observed in a population, and is thereby arbitrarily designated as the "normal" or "wild" type of the gene. In contrast, the terms "modified", "mutant" or "variant" refer to a gene or gene product that exhibits alterations (e.g., substitutions, truncations or insertions) in sequence, post-translational modifications and / or altered functional properties (e.g., changed characteristics) when compared to the wild-type gene or gene product.

[0020] Methods for introducing or substituting naturally occurring amino acids are known in the art. For example, methionine (M) can be substituted with arginine (R) by replacing the codon for methionine (ATG) with the codon for arginine (CGT) at the relevant position in the polynucleotide encoding the mutant monomer. Methods for introducing or substituting amino acids that do not exist in nature are also known in the art. For example, amino acids that do not exist in nature can be introduced by including synthetic aminoacyl-tRNA in an IVTT system used to express mutant monomers. Alternatively, they can be introduced by expressing the mutant monomer in Escherichia coli (E. coli) that is trophically dependent on a particular amino acid, in the presence of a synthetic (i.e., non-naturally occurring) analog of that particular amino acid. When mutant monomers are produced using partial peptide synthesis, they can also be produced by naked ligation. Conservative substitutions replace an amino acid with another amino acid having a similar chemical structure, similar chemical properties, or similar side-chain volume. The introduced amino acids may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality, or charge to the amino acids they replace. Alternatively, conservative substitutions may involve introducing another aromatic or aliphatic amino acid in place of an originally present aromatic or aliphatic amino acid. Conservative amino acid substitutions are known in the art and can be selected according to the properties of 20 major amino acids defined in Table 1 below. If the amino acids have similar polarity, this can also be determined by referring to the hydropathic scale for the amino acid chain in Table 2. [Table 1] [Table 2]

[0021] Unless otherwise indicated, nucleic acid sequences in this specification are written from left to right in the 5' to 3' direction.

[0022] As used herein, “polynucleotide,” “nucleotide sequence,” “DNA sequence,” or “nucleic acid molecule” refers to a polymeric form of nucleotides of any length, including ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of molecules. Thereafter, this term includes double-stranded and single-stranded DNA and RNA. As used herein, the term “polynucleotide” may be a sequence of single-stranded or double-stranded nucleotides linked by covalent bonds, with the 3' and 5' ends of each nucleotide linked by phosphodiester bonds. Polynucleotides may consist of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides may be produced synthetically in vitro or isolated from natural sources. Polynucleotides may further include modified DNA or RNA, e.g., methylated DNA or RNA, or RNA subjected to post-translational modifications such as 3'-processing, including 5' capping, cleavage, and polyadenylation with 7-methylguanosine, and splicing. Polynucleotides may also include synthetic nucleic acids (XNAs) such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA), and peptide nucleic acid (PNA).

[0023] The terms "patient" and "subject" are used interchangeably and typically refer to mammals, preferably humans.

[0024] All publications, patents, and patent applications cited herein, whether in whole or in part, are incorporated herein by reference. polypeptide The present invention provides a polypeptide encoded by an open reading frame in a long non-coding RNA gene (lncRNA), wherein the lncRNA is overexpressed in colorectal cancer cells compared to healthy cells, and preferably the lncRNA is defined by any one of SEQ ID NOs: 1 to 18.

[0025] lncRNAs are well known in the art. The inventors have surprisingly discovered for the first time that some lncRNAs are overexpressed in colorectal cancer cells compared to healthy cells, and that polypeptides may be encoded by open reading frames (ORFs) in said cancer cells. Open reading frames, well known in the art as polynucleotide sequences, are contained within lncRNAs that begin with a start codon and end with a stop codon. It is not generally believed that proteins are translated from lncRNAs. However, the inventors have determined that polypeptides encoded by ORFs in lncRNAs overexpressed in colorectal cancer cells are presented via the major histocompatibility complex (MHC), thereby inducing an immune response.

[0026] The overexpression of lncRNA in colorectal cancer cells compared to healthy cells can be determined by any suitable method in the art. Preferably, lncRNA expression is observed in colorectal cancer cells, and such expression is significantly higher than that in healthy cells. More preferably, the expression is substantially absent in healthy cells. The expression of lncRNA in colorectal cancer cells is preferably determined by the same means as the expression of lncRNA in healthy cells. The colorectal cancer cells and healthy cells may be derived from the same source.

[0027] The present invention preferably provides polypeptides encoded by open reading frames in lncRNAs defined by any one of SEQ ID NOs: 1-5, 7, 8, 11, 12 and 15-17.

[0028] The polypeptide may contain at least 6 to 32 amino acids, preferably about 7 to 30 amino acids, most preferably about 8 to 11 or about 12 to 28 amino acids.

[0029] Polypeptides are preferably presentable by MHC, which is expressed on the surface of antigen-presenting cells (APCs). Polypeptides may be presented by MHC-I or MHC-II, most preferably by MHC-I. Polypeptides may contain or consist of human leukocyte antigen (HLA) class I-restricted epitopes. Polypeptides may be determined to be presented by MHC, preferably MHC-I, by preferred methods in the art. Polypeptide presentation may be determined by algorithms utilizing MHC ligandome data derived from mass spectrometry. Most preferably, polypeptide presentation may be determined by methods that incorporate the use of MHC ligandome data derived from mass spectrometry to reliably predict presentation. An exemplary method is disclosed in its entirety in International Publication No. 2022 / 013154, which is incorporated by reference. This method uses the neoMS algorithm to reliably predict MHC presentation.

[0030] Polypeptides are preferably immunogenic, i.e., they can induce an immune response. The immune response can be detected in at least one individual (or in a sample taken from the individual) after administration of the polypeptide to the individual (or the sample). The immune response is preferably a T cell response. Polypeptides include CD4 cells containing CD8+ T cells that can lyse cancer cells. + and / or CD8 +T cells can be preferably stimulated. The polypeptide can be determined to be immunogenic by any suitable method in the art. Preferably, the immunogenicity of the polypeptide can be determined by an algorithm trained using a positive dataset of non-autoimmunogenic peptide sequences and a negative dataset consisting of MHCI-presenting peptides derived from housekeeping genes. Most preferably, polypeptide immunogenicity can be determined by a method that incorporates the use of an algorithm trained using a positive dataset of non-autoimmunogenic peptide sequences and a negative dataset consisting of MHCI-presenting peptides derived from housekeeping genes. An exemplary method is disclosed in its entirety in International Publication No. 2022 / 079255, which is incorporated by reference. This method uses the neoIM algorithm to reliably predict immunogenicity.

[0031] Preferably, the presentation and immunogenicity algorithms take into account a set of alleles common in people of Europe and the United States: HLA-I alleles (A*02:10, A*01:01, A*03:01, A*24:02, A*11:01, B*07:02, B*08:01, B*44:02, B*35:01, B*51:01, B*44:03, C*07:01, C*07:02, C*05:01, C*04:01, C*06:02, C*03:04).

[0032] The polypeptide may be further determined to be immunogenic using any preferred method, including in vitro methods. For example, the polypeptide may have the following characteristics: (i) In a PBL population of healthy subjects and / or cancer patients, the ELISPOT assay can induce a multifunctional T cell response (IFN-γ, IL-2, and / or TNFα-producing cells), and / or (ii) Cytotoxic T lymphocytes (CTLs) that are reactive with polypeptides can be detected in situ in tumor tissue samples; and / or (iii) It can induce in vitro proliferation of specific T cells. It can be identified as immunogenic if it has at least one of the following characteristics.

[0033] A preferred method for determining whether a polypeptide is immunogenic is also described in the Examples section below.

[0034] The polypeptide may include a 6-amino acid sequence, a 7-amino acid sequence, an 8-amino acid sequence, a 9-amino acid sequence, a 10-amino acid sequence, or an 11-amino acid sequence, or variants thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs: 19-97. Most preferably, the polypeptide may include an 8-amino acid sequence, or a variant thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs: 19-97.

[0035] A polypeptide may have at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% sequence identity with an amino acid sequence of the same length contained in any one of the polypeptide sequences defined by SEQ ID NOs. The polypeptide may preferably be an 8-amino acid sequence and may have at least 50%, at least 60%, at least 80%, at least 90%, or at least 95% sequence identity with an 8-amino acid sequence contained in any one of the polypeptide sequences defined by SEQ ID NOs. Preferably, if the polypeptide is a variant, the polypeptide is MHC class I presentable and immunogenic.

[0036] The polypeptide preferably includes a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or variants thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs: 20-22, 29, 33-35, 46, 49, 51, 53, 55, 60, 62, 64, 67, 70, 76, 83, and 97.

[0037] A polypeptide may contain, consist of, or be a variant thereof of any one polypeptide sequence defined by SEQ ID NOs. 98-611. The variant may have at least 50%, at least 60%, at least 80%, at least 90%, or at least 95% sequence identity with the amino acid sequence contained in any one polypeptide sequence defined by SEQ ID NOs. 98-611.

[0038] Preferably, polypeptides are sequence numbers 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, 216, 101, 103, 113, 122, 151, It contains or consists of one of the polypeptide sequences defined by 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, 227, 99, 100, 104, 105, 111, 123, 130, 131, 134, 136, 137, 138, 157, 159, 175, 182, 187, 188, 194, 203, 211, 221, and 234.

[0039] More preferably, the polypeptide comprises or consists of one of the polypeptide sequences defined by SEQ ID NOs: 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, 216, 101, 103, 113, 122, 151, 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, and 227. The polypeptide may further contain any one or more polypeptide sequences defined by SEQ ID NOs: 99, 100, 104, 105, 111, 123, 130, 131, 134, 136, 137, 138, 157, 159, 175, 182, 187, 188, 194, 203, 211, 221, and 234.

[0040] More preferably, the polypeptide comprises or consists of one of the polypeptide sequences defined by SEQ ID NOs: 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, and 216. The polypeptide may further contain any one or more polypeptide sequences defined by SEQ ID NOs: 101, 103, 113, 122, 151, 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, 227, 99, 100, 104, 105, 111, 123, 130, 131, 134, 136, 137, 138, 157, 159, 175, 182, 187, 188, 194, 203, 211, 221, and 234.

[0041] The polypeptide of the present invention may be in a substantially isolated form. It may be mixed with a carrier, preservative or diluent (discussed in more detail below) and / or an adjuvant (likewise discussed in more detail below) that does not interfere with its intended use, and still be considered substantially isolated. It may also be in a substantially purified form if it generally constitutes at least 90%, for example, at least 95%, 98%, or 99% of the protein in the preparation. Polynucleotides, vectors, and cells The present invention provides polynucleotides encoding one or more polypeptides according to the present invention.

[0042] A polynucleotide may encode a single polypeptide of the present invention. Other polynucleotides of the present invention may encode multiple polypeptides of the present invention, and optionally the coding sequences for multiple polypeptides are in-frame with respect to each other, thereby the polynucleotide molecule encodes a polypeptide containing multiple polypeptides of the present invention in a sequential sequence.

[0043] The polynucleotide preferably encodes 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, or 70 or more polypeptides according to the present invention. Preferably, the polynucleotide encodes 34 or more, 50 or more, or 73 or more polypeptides according to the present invention. Most preferably, the polynucleotide encodes 34 or more or 50 or more polypeptides according to the present invention.

[0044] The polynucleotide encodes preferably 10 or more, 20 or more, or most preferably 34 or more polypeptides according to the present invention, and the 34 or more polypeptides include 34 or more polypeptides encoded by an open reading frame in an lncRNA defined by any one of SEQ ID NOs: 1-5, 7, 8, 11, 12 and 15-17.

[0045] The polynucleotide encodes preferably 10 or more, 20 or more, or most preferably 34 or more polypeptides according to the present invention, and each of the 34 or more polypeptides comprises a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or variants thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs. 20-22, 29, 33-35, 46, 49, 51, 53, 55, 60, 62, 64, 67, 70, 76, 83, and 97.

[0046] The polynucleotide encodes preferably 10 or more, 20 or more, or most preferably 34 or more polypeptides according to the present invention, and the 34 or more polypeptides each contain or consist of polypeptide sequences defined by SEQ ID NOs: 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, and 216.

[0047] The polynucleotide encodes preferably 10 or more, 20 or more, 30 or more, 40 or more, or most preferably 50 or more polypeptides according to the present invention, and the 50 or more polypeptides include 50 or more polypeptides encoded by an open reading frame in an lncRNA defined by any one of SEQ ID NOs: 1-5, 7, 8, 11, 12 and 15-17.

[0048] The polynucleotide encodes a polypeptide of which, according to the present invention, preferably 10 or more, 20 or more, 30 or more, 40 or more, or most preferably 50 or more, and each polypeptide of which is 50 or more comprises a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or variants thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs. 20-22, 29, 33-35, 46, 49, 51, 53, 55, 60, 62, 64, 67, 70, 76, 83, and 97.

[0049] The polynucleotide encodes a polypeptide of which preferably 10 or more, 20 or more, 30 or more, 40 or more, or most preferably 50 or more according to the present invention, and the polypeptide of which 50 or more is sequence numbers 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, Each comprises or consists of a polypeptide sequence defined by 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, 216, 101, 103, 113, 122, 151, 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, and 227. A polynucleotide may further encode any one or more polypeptides containing or consisting of sequences defined by sequence numbers 99, 100, 104, 105, 111, 123, 130, 131, 134, 136, 137, 138, 157, 159, 175, 182, 187, 188, 194, 203, 211, 221, and 234.

[0050] The polynucleotide may encode 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, or most preferably 73 or more polypeptides according to the present invention, the 73 or more polypeptides comprising 73 or more polypeptides encoded by an open reading frame in an lncRNA defined by any one of SEQ ID NOs: 1-5, 7, 8, 11, 12 and 15-17.

[0051] The polynucleotide encodes a polypeptide of which, according to the present invention, preferably 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, or most preferably 73 or more, and each of the 73 or more polypeptides comprises a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or variants thereof, contained within any one of the polypeptide sequences defined by SEQ ID NOs. 20-22, 29, 33-35, 46, 49, 51, 53, 55, 60, 62, 64, 67, 70, 76, 83, and 97.

[0052] The polynucleotides encode polypeptides of which, according to the present invention, preferably 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, or most preferably 73 or more, and the 73 or more polypeptides are sequence numbers 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, Each comprises or consists of a polypeptide sequence defined by 212, 215, 218, 222, 229, 216, 101, 103, 113, 122, 151, 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, 227, 99, 100, 104, 105, 111, 123, 130, 131, 134, 136, 137, 138, 157, 159, 175, 182, 187, 188, 194, 203, 211, 221, and 234.

[0053] The generation and delivery of immunogenic polypeptides that are effectively presented on MHC molecules to induce a desired immune response in an organism can be challenging. The polynucleotides of the present invention are in-frame with respect to each other, thus mitigating this challenge by providing coding sequences for multiple polypeptides encoding polypeptides in which multiple polypeptides of the present invention are contained in a continuous sequence. Such polynucleotides can disperse the polypeptides of the present invention having cleavage sites recognized by proteases abundant in antigen-presenting cells (APCs). These methods may mimic antigen processing and result in more effective antigen presentation than can be achieved using polypeptide antigen administration.

[0054] The terms “nucleic acid molecule” and “polynucleotide” are used interchangeably herein and refer to polymeric forms of nucleotides of any length, either deoxyribonucleotides, ribonucleotides, or analogs thereof. Non-limiting examples of polynucleotides include genes, gene fragments, messenger RNA (mRNA), cDNA, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Most preferably, polynucleotides are DNA molecules such as cDNA molecules or mRNA molecules.

[0055] When the polynucleotide of the present invention is mRNA, the polypeptide of the present invention is encoded by a nucleotide sequence contained in an open reading frame (ORF). The mRNA may contain a 5' terminal cap at the 5' end, a 5' untranslated region (UTR) contained in the 5' of the ORF, a 3' UTR contained in the 3' of the ORF, and / or a 3' tailing sequence at the 3' end. The "5' untranslated region (UTR)" is a region of mRNA that does not encode a protein or peptide and is located immediately upstream (i.e., 5') of the start codon (i.e., the first codon of the mRNA transcript translated by the ribosome).

[0056] The "3' untranslated region (UTR)" is a region of mRNA that does not code for a protein or peptide and is located immediately downstream (i.e., at 3') of a stop codon (i.e., the codon in the mRNA transcript that signals the end of translation).

[0057] An "open reading frame" (ORF) is a continuous section of DNA that begins with a start codon and ends with a stop codon, encoding a protein or peptide. The start codon is typically translated as methionine, most commonly ATG, but alternatives such as TTG, GTG, and CTG are also possible. Alternative start codons are also translated as methionine if they are located at the start of the ORF, even if the codon elsewhere codes for a different amino acid. The stop codon is typically selected from TAA, TAG, or TGA.

[0058] A 5'-terminus cap is a specially modified nucleotide at the 5' end of some primary transcripts, such as messenger RNA, that promotes stability and translation. Typically, it consists of a guanine nucleotide linked to mRNA via an unusual 5'-to-5' triphosphate linkage. This guanosine is methylated at position 7 immediately after in vivo capping by methyltransferase. Therefore, it is called a 7-methylguanylate cap and is sometimes abbreviated as m7G. A preferred 5'-terminus cap is m7G(5')ppp(5')NlmpNp.

[0059] The 3' tailing sequence is a poly-A tail, a poly-AG quartet, and / or a stem-loop sequence. The 3' tailing sequence is typically between 40 and 200 nucleotides in length. In some embodiments, the 3' tailing sequence is a poly-A tail. A "poly-A tail" is a region of mRNA located downstream of the 3'UTR, for example, directly downstream (i.e., 3'), that contains multiple consecutive adenosine monophosphates. A poly-A tail may contain 10 to 300 adenosine monophosphates. For example, a poly(A) tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, the poly(A) tail contains 50 to 250 adenosine monophosphates. In relevant biological environments (e.g., in cells, in vivo), the poly(A) tail functions to protect mRNA from enzymatic degradation, for example, in the cytoplasm, and assists in transcription termination, nuclear export, and translation.

[0060] When the polynucleotide of the present invention is mRNA, it can be provided as an mRNA vaccine. The mRNA vaccine can be formulated as a lipid nanoparticle composition, for example, a lipid nanoparticle composition comprising mRNA encoding the polypeptide of the present invention and an ionizable lipid.

[0061] The polynucleotides of the present invention may be provided in isolated or substantially isolated forms. By substantially isolated, it means that the polypeptide may be substantially, but not completely, isolated from any surrounding media. The polynucleotides may be mixed with a carrier or diluent that does not interfere with their intended use, and still be considered substantially isolated. The nucleic acid sequence that “codes” the selected polypeptide is a nucleic acid molecule that, for example, in an expression vector, is transcribed into a polypeptide (in the case of DNA) and translated (in the case of mRNA) in vivo when regulated by appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation termination codon at the 3' (carboxy) terminus. For the purposes of the present invention, such nucleic acid sequences may include, but are not limited to, cDNA derived from virus, prokaryotic or eukaryotic mRNA, genomic sequences derived from virus or prokaryotic DNA or RNA, and even synthetic DNA sequences. The transcription termination sequence may be located at 3' of the coding sequence.

[0062] The polynucleotides of the present invention can function as mRNA but are distinct from wild-type mRNA in functional and / or structural characteristics. The mRNA cancer vaccine of the present invention may be encoded by in vitro translated (IVT) polynucleotides. As used herein, “in vitro transcription template (IVT)” refers to deoxyribonucleic acid (DNA) suitable for use in an IVT reaction for messenger RNA (mRNA) production. In some embodiments, the IVT template encodes a 5' untranslated region, includes an open reading frame, encodes a 3' untranslated region and a poly-A tail. The specific nucleotide sequence composition and length of the IVT template depend on the target mRNA encoded by the template.

[0063] Polynucleotides can also encode polypeptide sequences well known in the art for enhancing T cell activation, particularly in cancer vaccines. Those skilled in the art are aware of examples of polypeptide sequences suitable for enhancing T cell activation. For this reason, the polynucleotides of the present invention include, for example, sequences encoding the LAMP1 and / or DC-LAMP domains.

[0064] Polynucleotides can be synthesized by methods known in the art, as exemplified in Sambrook et al. (1989, Molecular Cloning - a laboratory manual; Cold Spring Harbor Press). The nucleic acid molecule of the present invention may be provided in the form of an expression cassette containing a regulatory sequence operably linked to the inserted sequence, thereby enabling in vivo expression of the polypeptide of the present invention. These expression cassettes are then typically provided within a vector (e.g., a plasmid or recombinant viral vector). Such expression cassettes can be administered directly to a host target. Alternatively, a vector containing the polynucleotide of the present invention can be administered to a host target. Preferably, the polynucleotide is prepared and / or administered using a gene vector. A suitable vector may be any vector capable of containing a sufficient amount of genetic information and enabling the expression of the polypeptide of the present invention.

[0065] mRNA can be prepared by any suitable technique known in the art via any appropriate synthetic pathway. The IVT method is preferred. In vitro transcription (IVT) allows for template-directed synthesis of RNA molecules of almost any sequence. The size of RNA molecules that can be synthesized using the IVT method ranges from short oligonucleotides to long nucleic acid polymers of several thousand bases. The IVT method allows for the synthesis of large quantities of RNA transcripts (e.g., from micrograms to milligrams) (Beckert et al., Synthesis of RNA by in vitro transcription, Methods Mol Biol. 703:29~41 (2011); Rio et al., RNA: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 2011, 205~220.; Cooper, Geoffery M. The Cell: A Molecular Approach. 4th ed., Washington DC: ASM Press, 2007. 262~299). Generally, IVT utilizes a DNA template with a promoter sequence upstream of the target sequence. The promoter sequence is most commonly derived from a bacteriophage (e.g., T7, T3, or SP6 promoter sequences), but numerous other promoter sequences, including newly designed ones, may be acceptable. Typically, transcription of the DNA template is best achieved by using an RNA polymerase corresponding to a specific bacteriophage promoter sequence. Exemplary RNA polymerases, but not limited to, include T7 RNA polymerase, T3 RNA polymerase, or SP6 RNA polymerase. IVT generally begins with dsDNA, but can proceed on a single strand. Preferred methods are, for example, those listed in International Publication No. 2017 / 020026 (incorporated herein by reference).

[0066] Therefore, the present invention includes an expression vector comprising such a polynucleotide sequence. The vector may encode a single polypeptide of the present invention. Thus, other vectors of the present invention may encode multiple polypeptides of the present invention, and optionally the coding sequences for multiple polypeptides are in-frame with each other, so that the vector encodes a polypeptide comprising multiple polypeptides of the present invention in a sequential sequence. The vector is preferably a viral vector.

[0067] Such expression vectors are routinely constructed in the field of molecular biology and, for example, involve the use of plasmid DNA and other elements such as appropriate initiators, promoters, enhancers, and, if necessary to enable the expression of the peptide of the present invention, polyadenylation signals positioned in the correct orientation. Other suitable vectors will be apparent to those skilled in the art. For further examples related thereto, the inventors refer to Sambrook et al., (1989, Molecular Cloning - a laboratory manual; Cold Spring Harbor Press).

[0068] The present invention also provides cells comprising polynucleotides or viral vectors according to the present invention. The cells may be dendritic cells (DCs), which are matured ex vivo, and maturation comprises transfection with polynucleotides according to the present invention or infection with viral vectors according to the present invention. Methods for DC maturation are otherwise known in the art. If such cells are intended to be administered to a patient in any of the treatment methods provided herein, cells that are homologous with respect to the patient are preferred.

[0069] Other cells of the present invention include prokaryotic cells such as bacterial cells, e.g., Escherichia coli. Such prokaryotic cells can be manipulated and cultured using routine methods to produce the polypeptides of the present invention.

[0070] The present invention also provides CAR-T cells, which include cells comprising cell surface receptors produced in response to one or more polynucleotides of the present invention. Methods for manipulating patient-derived T cells to include cell surface receptors produced in response to antigens such as the polypeptides of the present invention are well known in the art. Accordingly, CAR-T cells include receptors that can bind to one or more polypeptides of the present invention. If such cells are intended to be administered to a patient in any of the treatment methods provided herein, cells that are homologous with respect to the patient are preferred.

[0071] The present invention also provides T cells produced in response to one or more polypeptides of the present invention. Compositions comprising polypeptides, polynucleotides, or cells The present invention provides compositions comprising the polypeptide of the present invention, the polynucleotide of the present invention, the vector of the present invention, or the cell and pharmaceutically acceptable carrier of the present invention.

[0072] For example, a composition may comprise at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight different polypeptides of the present invention, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient.

[0073] For example, a composition may comprise at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight different polynucleotides of the present invention, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient.

[0074] Carriers, preservatives, and excipients must be "acceptable" in the sense that they are compatible with the other components of the composition and must not be harmful to the subject to whom the composition is administered. Typically, all components and the final composition are sterile and pyrogen-free. The composition may be a pharmaceutical composition. The composition may preferably contain an adjuvant.

[0075] An adjuvant is any substance, when mixed into a composition, that increases or otherwise alters the immune response induced by the composition. A broadly defined adjuvant is any substance that promotes an immune response. Adjuvants may also preferably have a depot effect, where they also result in a slow, sustained release of the activator from the injection site. A general discussion of adjuvants is provided in Goding, Monoclonal Antibodies: Principles & Practice (2nd edition, 1986), pp. 61-63.

[0076] The adjuvant is AlK(SO4)2, AlNa(SO4)2, AlNH4(SO4), silica, alum, Al(OH)3, Ca3(PO4)2, kaolin, carbon, aluminum hydroxide, muramyl dipeptide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-DMP), N-acetyl-nornuramyl-L-alanyl-D-isoglutamine (CGP11687, also called norMDP), N-acetylmuramyul-L-alanyl-D-isoglutamine-L-alanine-2-(1'2'-di Palmitoyl-sn-glycero-3-hydroxphosphoryloxy-ethylamine (CGP19835A, also known as MTP-PE), 2% squalene / Tween-80.RTM emulsion containing RIBI (MPL+TDM+CWS), lipopolysaccharides including lipid A and various derivatives thereof, Freund's complete adjuvant (FCA), Freund's incomplete adjuvant, Merck adjuvant 65, polynucleotides (e.g., polyIC and polyAU acids), and wax derived from Mycobacterium tuberculosis. Substances may be selected from the group consisting of D, substances found in Corynebacterium parvum, Bordetella pertussis and members of the genus Brucella, Titermax, ISCOMS, Quil A, ALUN (see US58767 and US Patent No. 5,554,372), lipid A derivatives, cholera toxin derivatives, HSP derivatives, LPS derivatives, synthetic peptide matrices, or GMDP, interleukin 1, interleukin 2, montanide ISA-51 and QS-21. Various saponin extracts have also been suggested to be useful as adjuvants in immunogenic compositions. Granulocyte-macrophage colony-stimulating factor (GM-CSF) may also be used as an adjuvant.

[0077] Preferred adjuvants used in conjunction with the present invention include oil / surfactant-based adjuvants, such as montanido adjuvants (Seppic, available from Belgium), preferably montanido ISA-51. Other preferred adjuvants are bacterial DNA-based adjuvants, such as adjuvants containing CpG oligonucleotide sequences. Still other preferred adjuvants are viral dsRNA-based adjuvants, such as poly(I:C). GM-CSF and imidazoquinoline are also examples of preferred adjuvants.

[0078] The adjuvant is most preferably montanide ISA adjuvant. The montanide ISA adjuvant is preferably montanide ISA 51 or montanide ISA 720.

[0079] Goding, Monoclonal Antibodies: Principles & Practice (2nd edition, 1986), pp. 61-63, also mentions that if the target antigen is low molecular weight or poorly immunogenic, coupling it to an immunogenic carrier is recommended. Therefore, the polypeptide of the present invention can be coupled to a carrier. The carrier may exist independently of the adjuvant. The function of the carrier may be, for example, to increase the molecular weight of the polypeptide fragment to increase its activity or immunogenicity, to confer stability, to increase biological activity, or to increase its blood half-life. Furthermore, the carrier may help present the polypeptide or its fragments to T cells. Thus, in the composition, the polypeptide can be coupled to a carrier such as those described below.

[0080] The carrier may be any suitable carrier known to those skilled in the art, such as a protein or an antigen-presenting cell such as a dendritic cell (DC). Examples of carrier proteins include keyhole limpet hemocyanin, serum proteins such as transferrin, bovine serum albumin, human serum albumin, thyroglobulin or ovalbumin, immunoglobulins or hormones such as insulin or palmitic acid. Alternatively, the carrier protein may be tetanus toxoid or diphtheria toxin. Alternatively, the carrier may be dextran such as cephalos. The carrier must be physiologically acceptable and safe for humans.

[0081] If a composition contains excipients, they must be "pharmaceutically acceptable" in the sense that they are compatible with the other components of the composition and must not be harmful to the recipient. Auxiliary substances such as wetting agents or emulsifiers and pH buffers may be present in the excipients. These excipients and auxiliary substances are generally pharmaceuticals that do not induce an immune response in the individual receiving the composition and can be administered without excessive toxicity. Examples of pharmaceutically acceptable excipients, but not limited to, include liquids such as water, saline, polyethylene glycol, hyaluronic acid, glycerol, and ethanol. Pharmaceutically acceptable salts, such as mineral salts like hydrochloride, hydrobromide, phosphate, and sulfate; and salts of organic acids such as acetate, propionate, malonate, and benzoate may also be included. A detailed discussion of pharmaceutically acceptable excipients, vehicles, and auxiliary substances can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0082] The formulation of suitable compositions may be carried out using standard pharmaceutical chemistry and methodologies readily available to those skilled in the art. Such compositions may be prepared, packaged or sold in forms suitable for rapid or continuous administration. Injectable compositions may be prepared, packaged or sold in unit dosage forms such as ampoules or multi-dose containers, optionally containing preservatives. Compositions may include, but are not limited to, suspensions, liquids, emulsions in oily or aqueous vehicles, pastes, and embedded, sustained-release or biodegradable formulations. In one embodiment of a composition, the activator is provided in a dry (e.g., powder or granule) form for reconstitution using a suitable vehicle (e.g., sterile pyrogen-free water) prior to administration of the reconstituted composition. The composition may be prepared, packaged or sold in the form of a sterile, injectable aqueous or oily suspension or solution. This suspension or solution may be formulated by well-known techniques and may contain additional components in addition to the active ingredient, such as adjuvants, excipients, and auxiliary substances described herein. Such sterile, injectable formulations may be prepared using a non-toxic, parenterally administered diluent or solvent, such as water or 1,3-butanediol. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixative oils such as synthetic mono or diglycerides. Other useful compositions include those containing the active ingredient in a microcrystalline form in liposome preparations or as a component of biodegradable polymer systems. Compositions for sustained release or embedding may contain pharmaceutically acceptable polymeric or hydrophobic materials, such as emulsions, ion exchange resins, sparingly soluble polymers, or sparingly soluble salts. Alternatively, the active ingredient of a composition may be encapsulated, adsorbed, or associated with a particulate carrier. Suitable particulate carriers include those derived from polymethyl methacrylate polymers, as well as PLG microparticles derived from poly(lactide) and poly(lactide-co-glycolide). See, for example, Jeffyr et al., (1993) Pharm. Res. 10:362-368. Other particulate systems and polymers, such as polylysine, polyarginine, polyornithine, spermine, spermidine, and conjugates of these molecules, may also be used.

[0083] The composition of the present invention may be a polynucleotide vaccine, preferably the polynucleotide is DNA or mRNA, most preferably the polynucleotide is mRNA, and the composition includes an mRNA (cancer) vaccine.

[0084] mRNA cancer vaccines may be formulated with one or more excipients to (1) improve stability; (2) improve cell transfection; (3) enable sustained or delayed release (e.g., from depot formulations); (4) alter in vivo distribution (e.g., target specific tissues or cell types); (5) increase in vivo translation of the encoded protein; and / or (6) alter the in vivo release profile of the encoded protein (antigen). In addition to any and all conventional excipients such as solvents, dispersions, diluents or other liquid vehicles, dispersants or suspension aids, surfactants, isotonic agents, thickeners or emulsifiers, and preservatives, the excipients of the present invention may, but not limited to, include lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with mRNA cancer vaccines (e.g., for transplantation into a subject), hyaluronidases, nanoparticle mimics, and combinations thereof.

[0085] The mRNA and / or compositions disclosed herein may contain stabilizing elements. Naturally occurring eukaryotic mRNA molecules have been found to contain stabilizing elements, but are not limited to, the 5' and 3' UTRs, 5' caps, and 3' tails discussed elsewhere herein. Other stabilizing elements that may be included in the mRNA disclosed herein include, for example, histone stem loops. In some embodiments, histone stem loops generally originate from histone genes, form a loop structure, and consist of intramolecular base pairings of two adjacent, partially or entirely reverse-complementary sequences separated by a spacer consisting of a short sequence. mRNA may have one or more AU-rich sequences removed. Such sequences may be destabilized. RNA vaccines may or may not contain enhancer and / or promoter sequences that may be modified or unmodified, and may or may not be activated or inactivated.

[0086] In a preferred embodiment, the mRNA cancer vaccine may be formulated into a lipid-polycation complex. The formation of the lipid-polycation complex may be achieved by methods well known in the Art and / or by the method described in U.S. Patent Application Publication 20120178702, which is incorporated herein by reference in whole. Non-limiting examples include, but are not limited to, polycations such as polylysine, polyornithine and / or polyarginine, and cationic peptides or polypeptides such as cationic peptides described in International Patent Publication 2012013326 or U.S. Patent Application Publication 20130142818, which are incorporated herein by reference in whole. In another embodiment, the mRNA cancer vaccine may be formulated in a lipid-polycation complex that may further contain a non-cationic lipid, for example, but is not limited to cholesterol or dioleoyl-phosphatidylethanolamine (DOPE). Liposome formulations, though not limited to these, may be affected by biophysical parameters such as the selection of cationic lipid components, the degree of cationic lipid saturation, the nature of PEGylation, and the proportions and sizes of all components. In one example, Semple et al. (Semple et al., Nature Biotech. 2010 28:172~176; the entire article is incorporated herein by reference) provided a liposome formulation composed of 57.1% cationic lipids, 7.1% dipalmitoylphosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA. In another example, altering the composition of cationic lipids allowed for more effective delivery of siRNA to various antigen-presenting cells (Basha et al., Mol Ther. 2011 19:2186~2200; the entire article is incorporated herein by reference).

[0087] The liposome formulation may contain approximately 35–45% cationic lipids, approximately 40–50% cationic lipids, approximately 50–60% cationic lipids, and / or approximately 55–65% cationic lipids. In some embodiments, the lipid-to-mRNA ratio in the liposome may be approximately 5:1–20:1, approximately 10:1–25:1, approximately 15:1–30:1, and / or at least 30:1. The proportion of PEG in the lipid nanoparticle (LNP) formulation may be increased or decreased, and / or the carbon chain length of the PEG lipid may be changed to C14–C18 to alter the pharmacokinetics and / or biodistribution of the LNP formulation. As a non-limiting example, LNP formulations may contain PEG-c-DOMG (R-3-[(co-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) in lipid molar ratios of approximately 0.5% to approximately 3.0%, approximately 1.0% to approximately 3.5%, approximately 1.5% to approximately 4.0%, approximately 2.0% to approximately 4.5%, approximately 2.5% to approximately 5.0%, and / or approximately 3.0% to approximately 6.0% compared to cationic lipids, DSPC, and cholesterol. In another embodiment, PEG-c-DOMG may be replaced with PEG lipids, for example, but not limited to, PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-dimyristoyl-sn-glycerol), and / or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The cationic lipid may be selected from any lipid well known in the art, such as DLin-MC3-DMA, DLin-DMA, C12-200, and DLin-KC2-DMA, but not limited to these.

[0088] An mRNA cancer vaccine formulation containing polynucleotides may be a nanoparticle that may contain at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and amino alcohol lipids. In another embodiment, the lipid may be a cationic lipid, for example, but is not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and amino alcohol lipids. The amino alcohol cationic lipid may be a lipid described in whole in U.S. Patent Application Publication No. 20130150625, which is incorporated herein by reference, and / or may be prepared by the method described therein. As a non-limiting example, cationic lipids include 2-amino-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-{[(9Z,2Z)-octadeca-9,12-diene-1-yloxy]methyl}propan-1-ol (compound 1 in U.S. Patent Application Publication No. 20130150625); 2-amino-3-[(9Z)-octadeca-9-en-1-yloxy]-2-{[(9Z)-octadeca-9-en-1-yloxy]methyl}propan-1-ol (compound 2 in U.S. Patent Application Publication No. 20130150625); 2-amino-3 -[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (compound 3 in U.S. Patent Application Publication No. 20130150625); and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]methyl}propan-1-ol (compound 4 in U.S. Patent Application Publication No. 20130150625); or any pharmaceutically acceptable salt or stereoisomer thereof.

[0089] Lipid nanoparticle formulations typically contain lipids, particularly ionizable cationic lipids, such as 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), and further contain neutral lipids, sterols, and molecules that can reduce particle aggregation, such as PEG or PEG-modified lipids. Lipid nanoparticle formulations may essentially consist of (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) neutral lipids selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) sterols, e.g., cholesterol; and (iv) PEG lipids, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of approximately 20-60% cationic lipids: 5-25% neutral lipids: 25-55% sterols; 0.5-15% PEG lipids. The formulation may contain, on a molar basis, about 25% to about 75%, for example, about 35 to about 65%, about 45 to about 65%, about 60%, about 57.5%, about 50%, or about 40%, a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0090] The formulation may contain approximately 0.5% to 15% on a molar basis of neutral lipids, for example, approximately 3 to 12%, 5 to 10%, or 15%, 10%, or 7.5% on a molar basis. Examples of neutral lipids, but not limited to these, include DSPC, POPC, DPPC, DOPE, and SM. The formulation may contain approximately 5% to 50% (on a molar basis, for example, approximately 15% to 45%, 20% to 40%, 40%, 38.5%, 35%, or 31%) sterols. An exemplary sterol is cholesterol. The formulation may contain approximately 0.5% to 20% (on a molar basis, for example, approximately 0.5% to 10%, 0.5% to 5%, 1.5%, 0.5%, 1.5%, 3.5%, or 5%) PEG or PEG-modified lipids. PEG or PEG-modified lipids are present in an average amount. This may include PEG molecules with a molecular weight of 2,000 Da, or an average molecular weight of less than 2,000, for example, approximately 1,500 Da, approximately 1,000 Da, or approximately 500 Da. Exemplary PEG-modified lipids include, but are not limited to, PEG-distearoylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG) and PEG-cDMA (the details of which are further discussed in Reyes et al., J. Controlled Release, 107, 276-287 (2005), which is incorporated herein by reference).

[0091] The formulations described herein may contain, on a molar basis, 25-75% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 0.5-15% neutral lipids, 5-50% sterols, and 0.5-20% PEG or PEG-modified lipids. In one embodiment, the formulation of the present invention comprises, on a molar basis, 35-65% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 3-12% neutral lipids, 15-45% sterols, and 0.5-10% PEG or PEG-modified lipids. The formulations described herein may contain, on a molar basis, 45-65% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 5-10% neutral lipids, 25-40% sterols, and 0.5-10% PEG or PEG-modified lipids. The formulations described herein may contain, on a molar basis, about 60% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.5% neutral lipids, about 31% sterols, and about 1.5% PEG or PEG-modified lipids.

[0092] The formulations described herein may contain, on a molar basis, about 50% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% neutral lipids, about 38.5% sterols, and about 1.5% PEG or PEG-modified lipids.

[0093] The formulations described herein may contain, on a molar basis, about 50% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% neutral lipids, about 35% sterols, about 4.5% or about 5% PEG or PEG-modified lipids, and about 0.5% targeted lipids.

[0094] The formulations described herein may contain, on a molar basis, about 40% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 15% neutral lipids, about 40% sterols, and about 5% PEG or PEG-modified lipids. In one embodiment, the formulation contains, on a molar basis, about 57.2% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.1% neutral lipids, about 34.3% sterols, and about 1.4% PEG or PEG-modified lipids.

[0095] The formulations described herein may contain, on a molar basis, approximately 57.5% cationic lipids selected from PEG lipids, which are PEG-cDMA (PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005)), the entire content of which is incorporated herein by reference, approximately 7.5% neutral lipids, approximately 31.5% sterols, and approximately 3.5% PEG or PEG-modified lipids.

[0096] In preferred embodiments, the lipid nanoparticle formulation essentially consists of a lipid mixture in a molar ratio of about 20-70% cationic lipids: 5-45% neutral lipids: 20-55% cholesterol: 0.5-15% PEG-modified lipids; more preferably in a molar ratio of about 20-60% cationic lipids: 5-25% neutral lipids: 25-55% cholesterol: 0.5-15% PEG-modified lipids. In certain embodiments, the lipid ratio by mole is approximately 50 / 10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG, PEG-DSG, or PEG-DPG), 57.2 / 7.1134.3 / 1.4 (mol% cationic lipid / neutral lipid, e.g., DPPC / Chol / PEG modified lipid, e.g., PEG-cDMA), 40 / 15 / 40 / 5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG), 50 / 10 / 35 / 4.5 / 0.5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., The formulas are PEG-DSG, 50 / 10 / 35 / 5 (cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG), 40 / 10 / 40 / 10 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA), 35 / 15 / 40 / 10 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA).

[0097] Exemplary lipid nanoparticle compositions and methods for preparing them are described, for example, in Semple et al., (2010) Nat. Biotechnol. 28:172~176; Jayarama et al., (2012), Angew. Chem. Int. Ed., 51:8529~8533; and Maier et al., (2013) Molecular Therapy 21, 1570~1578 (the contents of each of these are incorporated herein by reference in their entirety).

[0098] The lipid nanoparticle formulations described herein may include cationic lipids, PEG lipids, and structural lipids, and optionally include non-cationic lipids. As an unspecified example, lipid nanoparticles may contain approximately 40-60% cationic lipids, approximately 5-15% non-cationic lipids, approximately 1-2% PEG lipids, and approximately 30-50% structural lipids. As another unspecified example, lipid nanoparticles may contain approximately 50% cationic lipids, approximately 10% non-cationic lipids, approximately 1.5% PEG lipids, and approximately 38.5% structural lipids. As yet another unspecified example, lipid nanoparticles may contain approximately 55% cationic lipids, approximately 10% non-cationic lipids, approximately 2.5% PEG lipids, and approximately 32.5% structural lipids. In one embodiment, the cationic lipids may be any cationic lipid described herein, such as DLin-KC2-DMA, DLin-MC3-DMA, and L319, but are not limited to these.

[0099] The lipid nanoparticle formulations described herein may be four-component lipid nanoparticles. The lipid nanoparticles may include cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. As an unrestricted example, the lipid nanoparticles may contain about 40-60% cationic lipids, about 5-15% non-cationic lipids, about 1-2% PEG lipids, and about 30-50% structural lipids. As another unrestricted example, the lipid nanoparticles may contain about 50% cationic lipids, about 10% non-cationic lipids, about 1.5% PEG lipids, and about 38.5% structural lipids. As yet another unrestricted example, the lipid nanoparticles may contain about 55% cationic lipids, about 10% non-cationic lipids, about 2.5% PEG lipids, and about 32.5% structural lipids. In one embodiment, the cationic lipid may be any cationic lipid described herein, such as DLin-KC2-DMA, DLin-MC3-DMA, and L319, but is not limited to these.

[0100] The lipid nanoparticle formulations described herein may include cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. As a non-limiting example, the lipid nanoparticles may contain approximately 50% cationic lipid DLin-KC2-DMA, approximately 10% non-cationic lipid DSPC, approximately 1.5% PEG lipid PEG-DOMG, and approximately 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles may contain approximately 50% cationic lipid DLin-MC3-DMA, approximately 10% non-cationic lipid DSPC, approximately 1.5% PEG lipid PEG-DOMG, and approximately 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles may contain approximately 50% cationic lipid DLin-MC3-DMA, approximately 10% non-cationic lipid DSPC, approximately 1.5% PEG lipid PEG-DMG, and approximately 38.5% structural lipid cholesterol. As yet another non-limiting example, lipid nanoparticles contain approximately 55% cationic lipid L319, approximately 10% non-cationic lipid DSPC, approximately 2.5% PEG lipid PEG-DMG, and approximately 32.5% structural lipid cholesterol.

[0101] The relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical compositions described herein may vary depending on the identity, size, and / or state of the subject being treated, and may further depend on the route through which the composition is administered. For example, a composition may contain between 0.1% and 99% (w / w) of the active ingredient. For example, a composition may contain between 0.1% and 100%, for example, between 0.5% and 50%, between 1% and 30%, between 5% and 80%, or at least 80% (w / w) of the active ingredient.

[0102] mRNA cancer vaccine compositions may comprise polynucleotides described herein formulated in lipid nanoparticles containing MC3, cholesterol, DSPC, and PEG2000-DMG, a buffer trisodium citrate, sucrose, and water for injection. As a non-limiting example, a composition may comprise: 2.0 mg / mL of active pharmaceutical ingredient (e.g., a polynucleotide encoding the H10N8 influenza virus), 21.8 mg / mL of MC3, 10.1 mg / mL of cholesterol, 5.4 mg / mL of DSPC, 2.7 mg / mL of PEG2000-DMG, 5.16 mg / mL of trisodium citrate, 71 mg / mL of sucrose, and about 1.0 mL of water for injection.

[0103] RNA vaccines may be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. The pharmaceutical composition of an RNA vaccine may contain liposomes. Liposomes are artificially prepared vesicles that may consist primarily of lipid bilayers and can be used as delivery vehicles for the administration of nutrients and pharmaceutical formulations. Liposomes may vary in size, including, but are not limited to, multilayer vesicles (MLVs) which may be several hundred nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments, small unicellular vesicles (SUVs) which may be less than 50 nm in diameter, and large monolayer vesicles (LUVs) which may be 50–500 nm in diameter. Liposome designs may contain opsonins or ligands to improve the binding of liposomes to diseased tissue, or, but are not limited to, to activate events such as endocytosis. Liposomes may have a low or high pH to improve the delivery of pharmaceutical formulations. Liposome formation may depend, but not limited to, on the physicochemical characteristics of the encapsulated pharmaceutical formulation and liposome components, the properties of the medium through which the lipid vesicles are dispersed, the effective concentration and potential toxicity of the encapsulated substance, any additional processes involved in the application and / or delivery of the vesicles, the optimization of vesicle size, polydispersibility and shelf life for the intended application, and the possibility of batch-to-batch reproducibility and large-scale production of safe and efficient liposome products.

[0104] As a non-limiting example, liposomes, such as synthetic membrane vesicles, may be prepared by methods, apparatus and devices described in U.S. Patent Application Publications 20130177638, 20130177637, 20130177636, 20130177635, 20130177634, 20130177633, 20130183375, 20130183373 and 20130183372, the contents of which are incorporated herein by reference in their entirety. The pharmaceutical compositions described herein may, but are not limited to, include liposomes formed from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, WA), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (the whole of which is incorporated herein by reference, U.S. Patent Application Publication No. 20100324120), and, but are not limited to, liposomes capable of delivering small molecule drugs such as Doxil (registered trademark) from Janssen Biotech, Inc. (Horsham, PA).

[0105] The pharmaceutical compositions described herein may, in no particular way, include liposomes, such as those formed from the synthesis of stabilized plasmid-lipid particles (SPLPs) or stabilized nucleic acid-lipid particles (SNALPs) previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (Wheeler et al., Gene Therapy. 1999 6:271~281; Zhang et al., Gene Therapy. 1999 6:1438~1447; Jeffs et al., Pharm Res. 2005 22:362~372; Morrissey et al., Nat Biotechnol. 2005 2:1002~1007; Zimmermann et al., Nature. 2006 441:111~114; Heyes et al., J Contr Rel. 2005 107:276~287; Semple et al., Nature Biotech. 2010 See 28:172~176; Judge et al., J Clin Invest. 2009 119:661~673; de Fougerolles Hum Gene Ther. 2008 19:125~132; U.S. Patent Application Publication No. 20130122104 (all of which are incorporated herein by reference). The original manufacturing method by Wheeler et al. was a surfactant dialysis method, which was later improved by Jeffs et al. and called spontaneous vesicle formation. Liposome formulations consist of polynucleotides in addition to 3-4 lipid components.

[0106] For example, liposomes may contain, but are not limited to, 55% cholesterol, 20% disteloylphosphatidylcholine (DSPC), 10% PEG-S-DSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al. Another example is a particular liposome formulation, but is not limited to, 48% cholesterol, 20% DSPC, 2% PEG-C-DMA, and 30% cationic lipids, where the cationic lipids may be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al.

[0107] Liposome formulations may contain approximately 25.0% to 40.0% cholesterol, approximately 30.0% to 45.0% cholesterol, approximately 35.0% to 50.0% cholesterol, and / or approximately 48.5% to 60% cholesterol. In preferred embodiments, the formulation may contain a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, and 43.5%. In some embodiments, the formulation may contain approximately 5.0% to 10.0% DSPC and / or approximately 7.0% to 15.0% DSPC.

[0108] A pharmaceutical composition may comprise liposomes that can be formed to deliver a polynucleotide capable of encoding at least one immunogen (antigen) or any other polypeptide of interest. The RNA vaccine may be contained in an aqueous core that is encapsulated in the liposome and / or subsequently encapsulated by the liposome (see International Publications 2012031046, 2012031043, 2012030901 and 2012006378 and U.S. Patent Publications 20130189351, 20130195969 and 20130202684; the contents of each are incorporated herein by reference in their entirety).

[0109] Liposomes can be formulated for targeted delivery. In a non-limiting example, liposomes can be formulated for targeted delivery to the liver. Examples of liposomes used for targeted delivery include, but are not limited to, those described in U.S. Patent Application Publication No. 20130195967, which is incorporated herein by reference in its entirety, and the method for preparing such liposomes.

[0110] In another embodiment, a polynucleotide capable of encoding an immunogen (antigen) may be formulated in a cationic oil-in-water emulsion, where the emulsion particles include an oil core and a cationic lipid capable of interacting with the polynucleotide and immobilizing the molecule to the emulsion particles (see International Publication No. 2012006380; the whole is incorporated herein by reference).

[0111] RNA vaccines can also be formulated as water-in-oil emulsions containing a continuous hydrophobic phase in which a hydrophilic phase is dispersed. In non-limiting examples, emulsions may be prepared by the method described in International Publication 201087791, which is incorporated herein by reference in its entirety. Lipid formulations may comprise at least one lipid containing at least a cationic lipid, a transfection-enhancing lipid, and a hydrophilic head linked to the lipid portion (see International Publication 2011076807 and U.S. Patent Application Publication 20110200582; the contents of each are incorporated herein by reference in their entirety). In another embodiment, a polynucleotide encoding an immunogen may be formulated in lipid vesicles having crosslinks between functional lipid bilayers (see U.S. Patent Application Publication 20120177724, the contents of which are incorporated herein by reference in their entirety).

[0112] Polynucleotides may be formulated in liposomes as described in International Publication No. 2013086526, which is incorporated herein by reference in its entirety. RNA vaccines may be encapsulated in liposomes using a reverse pH gradient and / or an optimized internal buffering composition as described in International Publication No. 2013086526, which is incorporated herein by reference in its entirety.

[0113] RNA vaccine pharmaceutical compositions may be formulated in liposomes such as, but are not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), Smarticles (registered trademark) (Marina Biotech, Bothell, WA), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al., Cancer Biology & Therapy 2006 5(12)1708~1713); the whole is incorporated herein by reference), and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).

[0114] The cationic lipid may be a low molecular weight cationic lipid, for example, the contents of which are described in U.S. Patent Application Publication No. 20130090372, which is incorporated herein by reference in whole.

[0115] RNA vaccines can be formulated in lipid vesicles that may have crosslinks between functional lipid bilayers.

[0116] RNA vaccines can be formulated in liposomes containing cationic lipids. The liposomes may have a molar ratio (N:P ratio) of nitrogen atoms in the cationic lipid to phosphate in the RNA between 1:1 and 20:1, as described in International Publication No. 2013006825, which is incorporated herein by reference in its entirety. In another embodiment, the liposomes may have an N:P ratio greater than 20:1 or less than 1:1.

[0117] RNA vaccines can be formulated in lipid-polycation complexes. The formation of lipid-polycation complexes can be achieved by methods well known in the Art and / or by the method described in U.S. Patent Application Publication 20120178702, which is incorporated herein by reference in whole. Non-limiting examples include, but are not limited to, polycations such as polylysine, polyornithine and / or polyarginine, and cationic peptides or polypeptides such as cationic peptides described in International Patent Publication 2012013326 or U.S. Patent Application Publication 20130142818, which are incorporated herein by reference in whole. In another embodiment, RNA vaccines can be formulated in lipid-polycation complexes which may further contain non-cationic lipids, such as, but are not limited to, cholesterol or dioleoyl-phosphatidylethanolamine (DOPE).

[0118] RNA vaccines can be formulated in amino alcohol lipidoids. The amino alcohol lipidoids that can be used in the present invention can be prepared by the method described in U.S. Patent No. 8,450,298, which is incorporated herein by reference in whole. Liposome formulations may be affected by biophysical parameters such as the selection of cationic lipid components, the degree of cationic lipid saturation, the nature of PEGylation, and the ratio and size of all components, although these are not limited to these. In one example, by Semple et al. (Semple et al., Nature Biotech. 2010 28:172~176; the entire article is incorporated herein by reference), the liposome formulation consisted of 57.1% cationic lipids, 7.1% dipalmitoylphosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA. As another example, modifying the composition of cationic lipids can more effectively deliver siRNA to various antigen-presenting cells (Basha et al., Mol Ther. 2011 19:2186~2200; the entire article is incorporated herein by reference). In some embodiments, the liposome formulation may contain about 35–45% cationic lipids, about 40–50% cationic lipids, about 50–60% cationic lipids, and / or about 55–65% cationic lipids. In some embodiments, the lipid-to-mRNA ratio in the liposome may be about 5:1–20:1, about 10:1–25:1, about 15:1–30:1, and / or at least 30:1. In some embodiments, the proportion of PEG in the lipid nanoparticle (LNP) formulation may be increased or decreased, and / or the carbon chain length of the PEG lipid may be modified to C14-C18 to alter the pharmacokinetics and / or biodistribution of the LNP formulation. As a non-limiting example, the LNP formulation may contain PEG-c-DOMG (R-3-[(co-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) in lipid molar ratios of about 0.5% to about 3.0%, about 1.0% to about 3.5%, about 1.5% to about 4.0%, about 2.0% to about 4.5%, about 2.5% to about 5.0%, and / or about 3.0% to about 6.0%, relative to cationic lipids, DSPC, and cholesterol. In another embodiment, PEG-c-DOMG may be replaced with PEG lipids such as PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-dimyristoyl-sn-glycerol), and / or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol), but are not limited to these. The cationic lipid may be selected from any lipid well known in the art, such as DLin-MC3-DMA, DLin-DMA, C12-200, and DLin-KC2-DMA, but are not limited to these.

[0119] RNA vaccines can be formulated in lipid nanoparticles, such as those described in International Patent Application Publication No. 2012170930, the entirety of which is incorporated herein by reference.

[0120] RNA vaccine formulations containing polynucleotides may be nanoparticles that may contain at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and amino alcohol lipids. In another embodiment, the lipid may be a cationic lipid such as DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and amino alcohol lipids. The amino alcohol cationic lipid may be a lipid described in U.S. Patent Application Publication No. 20130150625, which is incorporated herein by reference in whole, and / or may be produced by the method described therein. As a non-limiting example, cationic lipids include 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (compound 1 in U.S. Patent Application Publication No. 20130150625); 2-amino-3-[(9Z)-octadeca-9-en-1-yloxy]-2-{[(9Z)-octadeca-9-en-1-yloxy]methyl}propan-1-ol (compound 2 in U.S. Patent Application Publication No. 20130150625); 2-amino-3- [(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (compound 3 in U.S. Patent Application Publication No. 20130150625); and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]methyl}propan-1-ol (compound 4 in U.S. Patent Application Publication No. 20130150625); or any pharmaceutically acceptable salt or stereoisomer thereof.

[0121] Lipid nanoparticle formulations typically include lipids, particularly ionizable cationic lipids, such as 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), and further include neutral lipids, sterols, and molecules that can reduce particle aggregation, such as PEG or PEG-modified lipids.

[0122] Lipid nanoparticle formulations can essentially consist of (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG-lipid, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of approximately 20-60% cationic lipids: 5-25% neutral lipids: 25-55% sterols; and 0.5-15% PEG-lipids. In one embodiment, the formulation contains a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319) in a molar basis of about 25% to about 75%, for example, about 35 to about 65%, about 45 to about 65%, about 60%, about 57.5%, about 50%, or about 40%.

[0123] In one embodiment, the formulation contains approximately 0.5% to approximately 15% on a molar basis of neutral lipids, for example, approximately 3 to approximately 12%, approximately 5 to approximately 10%, or approximately 15%, approximately 10%, or approximately 7.5% on a molar basis. Examples of neutral lipids, but not limited to these, include DSPC, POPC, DPPC, DOPE, and SM. In one embodiment, the formulation contains about 5% to about 50% (for example, about 15% to about 45%, about 20% to about 40%, about 40%, about 38.5%, about 35%, or about 31%) sterols on a molar basis. An exemplary sterol is cholesterol. In one embodiment, the formulation contains about 0.5% to about 20% (for example, about 0.5% to about 10%, about 0.5% to about 5%, about 1.5%, about 0.5%, about 1.5%, about 3.5%, or about 5%) PEG or PEG-modified lipids on a molar basis. In one embodiment, the PEG or PEG-modified lipids are of average molecular weight. The present embodiment contains PEG molecules with a molecular weight of 2,000 Da. In other embodiments, the PEG or PEG-modified lipid contains PEG molecules with an average molecular weight of less than 2,000, for example, approximately 1,500 Da, approximately 1,000 Da, or approximately 500 Da. Examples of PEG-modified lipids, but not limited to these, include PEG-distearoylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG), and PEG-cDMA (whose details are further discussed in Reyes et al., J. Controlled Release, 107, 276-287 (2005), which is incorporated herein by reference in its entirety).

[0124] In one embodiment, the formulation comprises 25-75% molar basis of cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 0.5-15% neutral lipids, 5-50% sterols, and 0.5-20% PEG or PEG-modified lipids. In one embodiment, the formulation comprises 35-65% molar basis of cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 3-12% neutral lipids, 15-45% sterols, and 0.5-10% PEG or PEG-modified lipids.

[0125] In one embodiment, the formulation comprises 45-65% molar basis of cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 5-10% neutral lipids, 25-40% sterols, and 0.5-10% PEG or PEG-modified lipids.

[0126] In one embodiment, the formulation comprises, on a molar basis, about 60% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.5% neutral lipids, about 31% sterols, and about 1.5% PEG or PEG-modified lipids.

[0127] In one embodiment, the formulation comprises, on a molar basis, about 50% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% neutral lipids, about 38.5% sterols, and about 1.5% PEG or PEG-modified lipids.

[0128] In one embodiment, the formulation comprises, on a molar basis, about 50% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% neutral lipids, about 35% sterols, about 4.5% or about 5% PEG or PEG-modified lipids, and about 0.5% targeted lipids.

[0129] In one embodiment, the formulation comprises, on a molar basis, about 40% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 15% neutral lipids, about 40% sterols, and about 5% PEG or PEG-modified lipids.

[0130] In one embodiment, the formulation comprises, on a molar basis, about 57.2% cationic lipids selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.1% neutral lipids, about 34.3% sterols, and about 1.4% PEG or PEG-modified lipids.

[0131] In one embodiment, the formulation comprises, on a molar basis, about 57.5% of a PEG lipid that is PEG-cDMA (PEG-cDMA is a cationic lipid selected from Reyes et al. (J. Controlled Release, 107, 276-287 (2005)), the entire composition of which is incorporated herein by reference, about 7.5% of a neutral lipid, about 31.5% of a sterol, and about 3.5% of a PEG or PEG-modified lipid.

[0132] In preferred embodiments, the lipid nanoparticle formulation essentially consists of a lipid mixture in a molar ratio of about 20-70% cationic lipids: 5-45% neutral lipids: 20-55% cholesterol: 0.5-15% PEG-modified lipids; more preferably in a molar ratio of about 20-60% cationic lipids: 5-25% neutral lipids: 25-55% cholesterol: 0.5-15% PEG-modified lipids.

[0133] In certain embodiments, the ratio of lipids by mole is approximately 50 / 10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG, PEG-DSG, or PEG-DPG), 57.2 / 7.1134.3 / 1.4 (mol% cationic lipid / neutral lipid, e.g., DPPC / Chol / PEG modified lipid, e.g., PEG-cDMA), 40 / 15 / 40 / 5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG), 50 / 10 / 35 / 4.5 / 0.5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., The formulas are PEG-DSG, 50 / 10 / 35 / 5 (cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG), 40 / 10 / 40 / 10 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA), 35 / 15 / 40 / 10 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / neutral lipid, e.g., DSPC / Chol / PEG modified lipid, e.g., PEG-DMG or PEG-cDMA).

[0134] Exemplary lipid nanoparticle compositions and methods for preparing them are described, for example, in Semple et al., (2010) Nat. Biotechnol. 28:172~176; Jayarama et al., (2012) Angew. Chem. Int. Ed., 51:8529~8533; and Maier et al., (2013) Molecular Therapy 21, 1570~1578 (the contents of each of these are incorporated herein by reference in their entirety).

[0135] In one embodiment, the lipid nanoparticle formulation described herein may include cationic lipids, PEG lipids, and structural lipids, and optionally include non-cationic lipids. As an unspecified example, the lipid nanoparticles may contain about 40-60% cationic lipids, about 5-15% non-cationic lipids, about 1-2% PEG lipids, and about 30-50% structural lipids. As another unspecified example, the lipid nanoparticles may contain about 50% cationic lipids, about 10% non-cationic lipids, about 1.5% PEG lipids, and about 38.5% structural lipids. As yet another unspecified example, the lipid nanoparticles may contain about 55% cationic lipids, about 10% non-cationic lipids, about 2.5% PEG lipids, and about 32.5% structural lipids. In one embodiment, the cationic lipids may be any cationic lipid described herein, such as DLin-KC2-DMA, DLin-MC3-DMA, and L319, but are not limited to these.

[0136] In one embodiment, the lipid nanoparticle formulation described herein may be a four-component lipid nanoparticle. The lipid nanoparticle may include a cationic lipid, a non-cationic lipid, a PEG lipid, and a structural lipid. As an unrestricted example, the lipid nanoparticle may contain about 40-60% cationic lipid, about 5-15% non-cationic lipid, about 1-2% PEG lipid, and about 30-50% structural lipid. As another unrestricted example, the lipid nanoparticle may contain about 50% cationic lipid, about 10% non-cationic lipid, about 1.5% PEG lipid, and about 38.5% structural lipid. As yet another unrestricted example, the lipid nanoparticle may contain about 55% cationic lipid, about 10% non-cationic lipid, about 2.5% PEG lipid, and about 32.5% structural lipid. In one embodiment, the cationic lipid may be any cationic lipid described herein, such as DLin-KC2-DMA, DLin-MC3-DMA, and L319, but is not limited to these.

[0137] In one embodiment, the lipid nanoparticle formulation described herein may comprise cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. In a non-limiting example, the lipid nanoparticles may comprise about 50% cationic lipid DLin-KC2-DMA, about 10% non-cationic lipid DSPC, about 1.5% PEG lipid PEG-DOMG, and about 38.5% structural lipid cholesterol. In a non-limiting example, the lipid nanoparticles may comprise about 50% cationic lipid DLin-MC3-DMA, about 10% non-cationic lipid DSPC, about 1.5% PEG lipid PEG-DOMG, and about 38.5% structural lipid cholesterol. In a non-limiting example, the lipid nanoparticles may comprise about 50% cationic lipid DLin-MC3-DMA, about 10% non-cationic lipid DSPC, about 1.5% PEG lipid PEG-DMG, and about 38.5% structural lipid cholesterol. As yet another non-limiting example, lipid nanoparticles contain approximately 55% cationic lipid L319, approximately 10% non-cationic lipid DSPC, approximately 2.5% PEG lipid PEG-DMG, and approximately 32.5% structural lipid cholesterol.

[0138] In one embodiment, cationic lipids are not limited to these, but their contents are incorporated herein by reference in their entirety; International Publication Nos. 2012040184, 2011153120, 2011149733, 2011090965, 2011043913, 2011022460, 2012061259, 2012054365, 2012044638, 2010080724, 201021865, 2008103276, 20130 Cationic lipids may be selected from those described in Patent No. 86373 and International Publication No. 2013086354, U.S. Patent Nos. 7,893,302, 7,404,969, 8,283,333 and 8,466,122, and U.S. Patent Publication Nos. 20100036115, 20120202871, 20130064894, 20130129785, 20130150625, 20130178541 and 20130225836. In another embodiment, cationic lipids may be selected from formula A as described in International Publication Nos. 2012040184, 2011153120, 2011149733, 2011090965, 2011043913, 2011022460, 2012061259, 2012054365, 2012044638, and 2013116126 or U.S. Patent Application Publication Nos. 20130178541 and U.S. Patent Application Publication Nos. 20130225836. In yet another embodiment, cationic lipids are, but are not limited to, cationic lipids in their entirety incorporated herein by reference; formula CLI-CLXXIX in International Publication No. 2008103276, formula CLI-CLXXIX in U.S. Patent No. 7,893,302, and U.S. Patent No. 7,404.Formulas CLI-CLXXXXII of Patent No. 969, formulas I-VI of U.S. Patent Publication No. 20100036115, and formula I of U.S. Patent Publication No. 20130123338 may be selected. As non-limiting examples, cationic lipids include (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, and (14Z,17Z)-N,N -dimethyltricosa-14,17-diene-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-diene-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-diene-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-diene-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-diene-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-1 9,22-diene-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-diene-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-diene-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-diene-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-diene-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-diene-9-amine, (18Z)-N, N-dimethylheptacosa-18-en-10-amine, (17Z)-N,N-dimethylhexacosa-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosa-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(HZ,14Z)-1-nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacosa-20-en-10-amine, (15Z)-N,N-dimethyleptacosa-15-en-10-amine, (14Z)-N,N-dimethylnonacosa-14-en-10-amine, (17Z)-N,N-dimethylnonacosa-17-en-10-amine, (24Z)-N,N-dimethyltriaconto-24-en-10-amine, (20Z)-N,N-dimethylnonacosa-20-en-10-amine, (22Z)-N,N-dimethylhentriaconto-22-en-10-amine, (16Z)-N,N-dimethylpentacosa-1 6-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecane-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecane-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecane-10-amine, N,N-di Methyl-21-[(1S,2R)-2-octylcyclopropyl]henicosane-10-amine,N,N-dimethyl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecane-10-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecane-8-amine,N,N-dimethyl-[(1R,2S)-2-undecyl(undecyI)cyclopropyl]tetradecane-5-amine,N,N-dimethyl-3-{7-[(1S,2R)-2-octylcy [Clopropyl]heptyl}dodecane-1-amine,1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecane-9-amine,1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecane-6-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecane-8-amine,RN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-3-(octyloxy)propane-2-amine,SN,N-dimethyl-1-[(9Z,12Z)-Octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine,1-{2-[(9Z,12Z)-Octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine,(2S)-N,N-dimethyl-1-[(9Z,12Z)-Octadeca-9,12-dien-1-yloxy]-3-[(5Z)-Octadeca-5-en-1-yloxy]propan-2-amine,1-{2-[(9Z,12Z)-Octadeca-9,12-dien-1-yl [Oxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]propan-2- Amine, N,N-dimethyl-1-[(9Z)-octadeca-9-en-1-yloxy]-3-(octyloxy)propane-2-amine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-octadeca-6,9,12-triene-1-yloxy]-3-(octyloxy)propane-2-amine, (2S)-1-[(11Z,14Z)-icosa-11,14-diene-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propane-2-amine, (2S)-1-(hexyloxy)-3-[(11Z ,14Z)-Icosa-11,14-diene-1-yloxy]-N,N-dimethylpropane-2-amine,1-[(11Z,14Z)-Icosa-11,14-diene-1-yloxy]-N,N-dimethyl-3-(octyloxy)propane-2-amine,1-[(13Z,16Z)-docosa-13,16-diene-1-yloxy]-N,N-dimethyl-3-(octyloxy)propane-2-amine,(2S)-1-[(13Z,16Z)-docosa-13,16-diene-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docosa-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine,1-[(13Z)-docosa-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine,1-[(9Z)-hexadeca-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-methoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethylo [(octyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-octyl(oc1yl)cyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-triene-10-amine, or pharmaceutically acceptable salts or stereoisomers thereof can be selected.

[0139] In one embodiment, the lipid may be a cleavable lipid, such as that described in whole in International Publication No. 2012170889, which is incorporated herein by reference. In another embodiment, the lipid may be a cationic lipid, for example, but not limited to, the composition of formula (I) of U.S. Patent Application Publication No. 20130064894, which is incorporated herein by reference.

[0140] Cationic lipids can be synthesized by methods well known in the art, and / or by methods described in International Publications 2012040184, 2011153120, 2011149733, 2011090965, 2011043913, 2011022460, 2012061259, 2012054365, 2012044638, 2010080724, 201021865, 2013086373, and 2013086354, the contents of which are incorporated herein by reference in their entirety.

[0141] Cationic lipids can be trialkyl cationic lipids. Non-limiting examples of trialkyl cationic lipids and methods for preparing and using trialkyl cationic lipids are described in International Publication No. 2013126803, which is incorporated herein by reference in its entirety.

[0142] The RNA vaccine LNP formulation may contain PEG-c-DOMG at a lipid molar ratio of 3%. In another embodiment, the RNA vaccine LNP formulation may contain PEG-c-DOMG at a lipid molar ratio of 1.5%. The RNA vaccine pharmaceutical composition may comprise at least one of the PEGylated lipids described in International Publication No. 2012099755, which is incorporated herein by reference in whole.

[0143] The LNP formulation may contain PEG-DMG2000 (1,2-dimyristoyl-sn-glycero-3-phophoethanolamine-N-[methoxy(polyethylene glycol)-2000]). In one embodiment, the LNP formulation may contain PEG-DMG2000, a cationic lipid well known in the art, and at least one other component. In another embodiment, the LNP formulation may contain PEG-DMG2000, a cationic lipid well known in the art, DSPC, and cholesterol. As a non-limiting example, the LNP formulation may contain PEG-DMG2000, DLin-DMA, DSPC, and cholesterol. As another non-limiting example, an LNP formulation may contain PEG-DMG2000, DLin-DMA, DSPC, and cholesterol in a molar ratio of 2:40:10:48 (see, for example, Geall et al., Nonviral delivery of self-amplifying RNA vaccines, PNAS 2012; PMID:22908294; the entire article is incorporated herein by reference).

[0144] The LNP formulations may be formulated by the methods described in International Publication No. 2011127255 or International Publication No. 2008103276, the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, the RNA vaccines described herein may be encapsulated in the LNP formulations described in International Publication No. 2011127255 and / or International Publication No. 2008103276, the contents of which are incorporated herein by reference in their entirety.

[0145] The RNA vaccines described herein may be formulated in nanoparticles such that their contents are delivered by a parenteral route as described in U.S. Patent Application Publication No. 20120207845, which is incorporated herein by reference in its entirety. In one embodiment, the RNA vaccine may be formulated in lipid nanoparticles prepared by the methods described in U.S. Patent Application Publication No. 20130156845 or International Publication No. 2013093648 or International Publication No. 2012024526, which are incorporated herein by whole reference, respectively. The lipid nanoparticles described herein may be prepared in a sterile environment by the system and / or method described in U.S. Patent Application Publication No. 20130164400, which are incorporated herein by whole reference, respectively.

[0146] LNP formulations can be formulated in nanoparticles, such as nucleic acid lipid particles, the contents of which are described in their entirety in U.S. Patent No. 8,492,359, which is incorporated herein by reference. In non-limiting examples, the lipid particles may contain one or more activators or therapeutic agents; one or more cationic lipids accounting for about 50 mol% to about 85 mol% of the total lipids present in the particles; one or more non-cationic lipids accounting for about 13 mol% to about 49.5 mol% of the total lipids present in the particles; and one or more conjugated lipids accounting for about 0.5 mol% to about 2 mol% of the total lipids present in the particles, which inhibit particle aggregation. The nucleic acids in the nanoparticles may be polynucleotides as described herein and / or are well known in the art.

[0147] The contents of each LNP formulation may be formulated by the method described in International Publication No. 2011127255 or International Publication No. 2008103276, which are incorporated herein by reference in their entirety. In non-limiting examples, the modified RNAs described herein may be encapsulated in the LNP formulations described in International Publication No. 2011127255 and / or International Publication No. 2008103276, which are incorporated herein by reference in their entirety. The LNP formulations described herein may include a polycationic composition. In non-limiting examples, the contents of the polycationic composition may be selected from formulas 1 to 60 of U.S. Patent Application Publication No. 20050222064, which are incorporated herein by reference in their entirety. LNP formulations containing a polycationic composition may be used for in vivo and / or in vitro delivery of the modified RNAs described herein.

[0148] In one embodiment, the LNP formulation described herein may additionally include permeability-enhancing molecules. Non-limiting permeability-enhancing molecules are incorporated herein by reference in their entirety; they are described in U.S. Patent Application Publication No. 20050222064.

[0149] RNA vaccine pharmaceutical compositions may be formulated in liposomes such as, but are not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), Smarticles (registered trademark) (Marina Biotech, Bothell, WA), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al., Cancer Biology & Therapy 2006 5(12)1708~1713); the whole is incorporated herein by reference), and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).

[0150] In one embodiment, the RNA vaccine may be formulated in a lyophilized gel-phase liposome composition described in U.S. Patent Application Publication No. 2012060293, which is incorporated herein by whole reference.

[0151] RNA vaccines include cationic or polycationic compounds such as protamine, nucleolin, spermine, or spermidine, or other cationic peptides or proteins, such as poly-L-lysine (PLL), polyarginine, basic polypeptides, cell-permeable peptides (CPPs), such as HIV-binding peptides, HIV-1 Tat (HIV), Tat-derived peptides, penetratin, VP22-derived or analog peptides, pestivirus Erns, HSV, VP22 (herpes simplex), MAP, KALA, or protein transduction domains (PTDs), PpT620, proline-rich peptides, arginine-rich peptides, lysine-rich peptides, MPG peptides, Pep-1, L-oligomers, calcitonin peptides, and Drosophila-derived peptides (specifically, Drosophila antenapedia). (from antennapedia), pAntp, plsl, FGF, lactoferrin, transportan, buforin-2, Bac715-24, SynB, SynB(l), pVEC, hCT-derived peptide, SAP, histone, cationic polysaccharide, e.g., chitosan, polybrene, cationic polymer, e.g., polyethyleneimine (PEI), cationic lipid, e.g., DOTMA:[1-(2,3-sioleyloxy)propyl)]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Choi, BGTC, CTAP, DOPC, DODAP, DO PE: Dioleylphosphatidylethanolamine, DOSPA, DODAB, DOIC, DMEPC, DOGS: Dioctadecylamideglycylspermine, DIMRI: Dimyristooxypropyldimethylhydroxyethylammonium bromide, DOTAP: Dioleoyloxy-3-(trimethylammonio)propane, DC-6-14: 0,0-Ditetradecanoyl-N-alpha-trimethylammonioacetyl)diethanolamine chloride, CLIP1: rac-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,[3-Dihexadecyloxypropyloxymethyloxy)ethyl]-trimethylammonium, CLIP9:rac-[2(2,3-Dihexadecyloxypropyloxysuccinyloxy)ethyl]-trimethylammonium, oligofectamines or cationic or polycationic polymers, e.g., modified polyamino acids, e.g., beta-amino acid polymers or reverse polyamides, modified polyethylene, e.g., PVP (poly(N-ethyl-4-vinylpyridinium bromide)), modified acrylates, e.g., pDMAEMA (poly(dimethylaminoethylmethyl acrylate)), modified amide amines, e.g., pAMAM (poly(amide amine)), modified polybeta-amino esters (PBAEs), e.g., diamine-terminated 1,4-butanediol It can be associated with dendrimers, such as polypropylamine dendrimers or pAMAM-based dendrimers, polyimines, such as PEL-poly(ethyleneimine), poly(propyleneimine), polyallylamines, sugar-based polymers, such as cyclodextrin-based polymers, dextran-based polymers, chitosan, silane-based polymers, such as PMOXA-PDMS copolymers, and block polymers consisting of a combination of one or more cationic blocks (e.g., selected from the cationic polymers described above) and one or more hydrophilic or hydrophobic blocks (e.g., polyethylene glycol); and so on.

[0152] Alternatively, RNA vaccines are not associated with cationic or polycationic compounds. Nanoparticle formulations may contain phosphate conjugates. Phosphate conjugates can increase the in vivo circulation time of nanoparticles and / or increase targeted delivery. Phosphate conjugates for use in the present invention may be prepared by the methods described in International Publication No. 2013033438 or U.S. Patent Application Publication No. 20130196948, the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, phosphate conjugates may contain any one compound of the formulas described in International Publication No. 2013033438, the entirety of which is incorporated herein by reference.

[0153] The nanoparticle formulation may contain a polymer conjugate. The polymer conjugate may be a water-soluble conjugate. The polymer conjugate may have a structure described in U.S. Patent Application Publication 20130059360, which is incorporated herein by reference in whole. In one embodiment, the polymer conjugate containing the polynucleotide of the present invention may be prepared using the method and / or segmented polymer reagent described in U.S. Patent Application Publication 20130072709, which is incorporated herein by reference in whole. In another embodiment, the polymer conjugate may have a pendant side chain group containing a cyclic portion, such as the polymer conjugate described in U.S. Patent Application Publication 20130196948, which is incorporated herein by reference in whole.

[0154] The nanoparticle formulation may include a conjugate to enhance the delivery of the nanoparticles of the present invention in a target. Furthermore, the conjugate can inhibit the phagocytic clearance of the nanoparticles in the target. In one embodiment, the conjugate may be a "self-peptide" designed from the human membrane protein CD47 (e.g., a "self-particle" as described by Rodriguez et al., (Science 2013 339, 971-975), the whole of which is incorporated herein by reference). As shown by Rodriguez et al., the self-peptide delayed macrophage-mediated clearance of the nanoparticles and enhanced the delivery of the nanoparticles. In another embodiment, the conjugate may be the membrane protein CD47 (e.g., see Rodriguez et al., Science 2013 339, 971-975), the whole of which is incorporated herein by reference. Rodriguez et al. showed that, similar to the "self-peptide," CD47 can increase the proportion of circulating particles in a target compared to scrambled peptides and PEG-coated nanoparticles.

[0155] RNA vaccines can be formulated in nanoparticles containing a conjugate to enhance the delivery of the nanoparticles of the present invention to a target. The conjugate may be a CD47 membrane, or the conjugate may be derived from a CD47 membrane protein, such as the "self-peptide" described above. In another embodiment, the nanoparticles may comprise a PEG and CD47 conjugate or derivatives thereof. In yet another embodiment, the nanoparticles may comprise both the "self-peptide" and the membrane protein CD47 described above. The "self-peptide" and / or the CD47 protein may be conjugated to virus-like particles or pseudovirions described herein for the delivery of RNA vaccines.

[0156] The formulations described herein may include RNA vaccine pharmaceutical compositions comprising the polynucleotide and a conjugate that may have a degradable linkage. Non-limiting examples of the conjugate include aromatic moieties comprising ionizable hydrogen atoms, spacer moieties, and water-soluble polymers. Non-limiting examples of pharmaceutical compositions comprising a conjugate having a degradable linkage and methods for delivering such pharmaceutical compositions are described in U.S. Patent Application Publication No. 20130184443, which is incorporated herein by reference in its entirety.

[0157] Nanoparticle formulations may include carbohydrate nanoparticles comprising a carbohydrate carrier and an RNA vaccine. Examples of carbohydrate carriers, but not limited to, include anhydrous-modified phytoglycogen or glycogen-type substances, phytoglycogen octenyl succinate, phytoglycogen betadextrin, and anhydrous-modified phytoglycogen betadextrin (see, for example, International Publication No. 2012109121; the contents of which are incorporated herein by reference in their entirety).

[0158] Nanoparticle formulations may be coated with surfactants or polymers to improve particle delivery. In one embodiment, nanoparticles may be coated with hydrophilic coatings, such as, but not limited to, PEG coatings and / or coatings having a neutral surface charge. Hydrophilic coatings, but not limited to, may help deliver nanoparticles with large payloads, such as RNA vaccines, to the central nervous system. Nanoparticles including hydrophilic coatings and methods for producing such nanoparticles are described in U.S. Patent Application Publication No. 20130183244, which is incorporated herein by reference in whole. In one embodiment, the lipid nanoparticles of the present invention may be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods for producing hydrophilic polymer particles are described in U.S. Patent Application Publication No. 20130210991, which is incorporated herein by reference in its entirety. In another embodiment, the lipid nanoparticles of the present invention may be hydrophobic polymer particles.

[0159] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids, known as rapidly excreted lipid nanoparticles (reLNPs). Ionizable cationic lipids, such as DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and may be a potential source of toxicity. The rapid metabolism of rapidly excreted lipids can improve the tolerability and therapeutic index of lipid nanoparticles by an order of magnitude, from a 1 mg / kg dose to 10 mg / kg in rats. The inclusion of enzymatically degradable ester bonds can improve the metabolic profile of cationic component degradation and metabolism while maintaining the activity of the reLNP formulation. Ester bonds may be located internally within the lipid chain or at the terminal end of the lipid chain. Internal ester bonds can replace any carbon in the lipid chain. In one embodiment, internal ester bonds may be located on either side of the saturated carbon.

[0160] In one embodiment, an immune response may be induced by delivering lipid nanoparticles, which may include nanoparticles, polymers, and immunogens (U.S. Patent Application Publication No. 20120189700 and International Publication No. 2012099805; each incorporated herein by whole reference). The polymer may encapsulate or partially encapsulate nanomolecular species. The immunogen may be recombinant proteins, modified RNA, and / or polynucleotides as described herein. In one embodiment, lipid nanoparticles may be formulated for use in vaccines against pathogens, for example, but not limited to these. Lipid nanoparticles may be manipulated to modify the surface properties of the particles so that the lipid nanoparticles can penetrate the mucosal barrier. Mucus is found in mucosal tissues such as, but is not limited to, the oral cavity (e.g., buccal and esophageal membranes and tonsil tissue), the eyes, the gastrointestinal tract (e.g., stomach, small intestine, large intestine, colon, rectum), the nose, the respiratory system (e.g., nose, pharynx, trachea and bronchial membranes), and the reproductive organs (e.g., vagina, cervix and urethral membranes). Nanoparticles larger than 10-200 nm, which are preferred for their ability to provide high drug encapsulation efficiency and sustained delivery of a broad range of drugs, have been considered too large to rapidly diffuse across mucosal barriers. Mucus is continuously secreted, flushed, discarded, or digested and recycled, so that most of the captured particles can be removed from mucosal tissue within seconds or hours. Large polymeric nanoparticles (200 nm to 500 nm in diameter) densely coated with low molecular weight polyethylene glycol (PEG) diffused through mucus at only 1 / 4 to 1 / 6 the rate at which the same particles diffuse in water (Lai et al., PNAS 2007 104(5):1482-487; Lai et al., Adv Drug Deliv Rev. 2009 61(2):158-171; each is incorporated herein by reference in its entirety). Nanoparticle transport can be determined using fluorescence microscopy techniques, including but not limited to penetration rate and / or post-fade fluorescence recovery (FRAP) and high-resolution multi-particle tracking (MPT).As a non-limiting example, compositions capable of penetrating mucosal barriers may be prepared as described in U.S. Patent No. 8,241,670 or International Publication No. 2013110028, the contents of which are incorporated herein by reference in their entirety.

[0161] Lipid nanoparticles manipulated to penetrate mucus may comprise polymeric materials (i.e., polymeric cores) and / or polymer-vitamin conjugates and / or triblock copolymers. Examples of polymeric materials, but not limited to, include polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrene), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The polymeric materials may be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. 2013116804, the contents of which are incorporated herein by reference in their entirety. The polymeric materials may further be irradiated. As a non-limiting example, polymeric materials may be gamma irradiated (see, for example, International Publication No. 201282165, which is incorporated herein by reference in its entirety). Specific non-limiting examples of polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), and poly(D,L-lactide-co- Poly(D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkylcyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acid), polyacid anhydride, polyorthoester, poly(esteramide), polyamide, poly(ester ether), polycarbonate, polyalkylene, for example, polyethylene and polypropylene.Polyalkylene glycols, e.g., poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates, e.g., poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters, e.g., poly(vinyl acetate), polyvinyl halides, e.g., poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxane, polystyrene (PS), polyurethane, derivatized celluloses, e.g., alkylcellulose, hydroxyalkylcellulose, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropylcellulose, carboxymethylcellulose, acrylic acid polymers, e.g., poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate) Examples include poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl(methyl)acrylate), poly(isopropyl(isopropyl)acrylate), poly(isobutyl(meth)acrylate), poly(octadecyl(octadecyl)acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamer, poly(ortho)esters, poly(butanoic acid), poly(valeric acid), poly(lactide-co-caprolactone), PEG-PLGA-PEG, trimethylene carbonate, and polyvinylpyrrolidone. Lipid nanoparticles include copolymers, for example, block copolymers (e.g., branched polyether-polyamide block copolymer described in International Publication No. 2013012476, which is incorporated herein by reference in whole), and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymers (e.g.,The copolymer may be coated or associated with U.S. Patent Publication No. 20120121718, U.S. Patent Publication No. 20100003337, and U.S. Patent No. 8,263,665 (see U.S. Patent Publication No. 20120121718, U.S. Patent Publication No. 20100003337, and U.S. Patent No. 8,263,665; each is incorporated herein by reference in its entirety). The copolymer may be a generally recognized safe (GRAS) polymer, and the formation of the lipid nanoparticles may be in a manner that does not create new chemical components. For example, the lipid nanoparticles may include poloxamer-coated PLGA nanoparticles without forming new chemical components, and still be able to rapidly penetrate human mucus (Yang et al., Angew. Chem. Int. Ed. 2011 50:2597~2600; its contents are incorporated herein by reference in their entirety).

[0162] A non-limiting and scalable method for producing nanoparticles that can penetrate human mucus is described by Xu et al. (see, for example, J Control Release 2013, 170(2):279~86; the contents thereof are incorporated herein by reference in their entirety). The vitamin in the polymer-vitamin conjugate may be vitamin E. The vitamin portion of the conjugate may be substituted with other suitable components, for example, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties, or hydrophobic components of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains, and alkylene oxide chains).

[0163] Lipid nanoparticles manipulated to penetrate mucus may contain, but are not limited to, surface altering agents such as polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucus-solving agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocysteine, eprazinon, mesna, ambroxol, sobrelol, domiodol, letosteine, stepronin, thiopronin, gelzolin, thymosin β4-dolenase alpha, neltenexin, erdosteine), and various DNases including rhDNases. The surface modifier may be embedded or incorporated into the surface of the particles, or placed on the surface of the lipid nanoparticles (e.g., by coating, adsorption, covalent bonding or other processes) (see, for example, U.S. Patent Application Publication Nos. 20100215580, 20080166414, and 20130164343; the contents of each are incorporated herein by reference in their entirety).

[0164] Mucosal permeable lipid nanoparticles may comprise at least one polynucleotide as described herein. The polynucleotide may be encapsulated within the lipid nanoparticle and / or positioned on the surface of the particle. The polynucleotide may be covalently coupled to the lipid nanoparticle. Formulations of mucosal permeable lipid nanoparticles may comprise multiple nanoparticles. Furthermore, formulations may contain particles that can interact with mucus and modify the structure and / or adhesive properties of the surrounding mucus to reduce mucosal adhesion, thereby increasing the delivery of mucosal permeable lipid nanoparticles to mucosal tissue. Mucosal permeable lipid nanoparticles may be hypotonic formulations comprising a mucosal penetration-enhancing coating. Formulations may be hypotonic with respect to the epithelium to which they are delivered. Non-limiting examples of hypotonic formulations can be found in International Publication No. 2013110028, the contents of which are incorporated herein by reference in their entirety. To enhance delivery across the mucosal barrier, RNA vaccine formulations may comprise or be comprising a hypotonic solution. Low-osmotic solutions have been found to increase the rate at which mucoinert particles, for example, but not limited to mucoinert particles, can reach the vaginal epithelial surface (see, for example, Ensign et al., Biomaterials 2013 34(28):6922~9; the contents of which are incorporated herein by reference in their entirety).

[0165] In one embodiment, the RNA vaccine may be formulated as a lipoplex, for example, not limited to, the ATUPLEX™ system, the DACC system, the DBTC system, and other siRNA-lipoplex technologies from Silence Therapeutics (London, UK), STEMFECT™ from STEMGENT® (Cambridge, MA), and as a delivery of polyethyleneimine (PEI) or protamine-based targeted or untargeted nucleic acids (Aleku et al., Cancer Res. 2008 68:9788~9798; Strumberg et al., Int J Clin Pharmacol Ther 2012 50:76~78; Santel et al., Gene Ther 2006 13:1222~1234; Santel et al., Gene Ther 2006 13:1360~1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334~344;Kaufmann et al., Microvasc Res 2010 80:286~293 Weide et al., J Immunother.2009 32:498~507;Weide et al., J Immunother.2008 31:180~188;Pascolo Expert Opin.Biol.Ther.4:1285~1294;Fotin-Mleczek et al., 2011 J.Immunother.34:1~15;Song et al., Nature Biotechnol.2005,23:709~717;Peer et al., Proc Natl Acad Sci US A.2007 6;104:4095~4100;deFougerolles Hum Gene Ther.2008 19:125-132; all of these are incorporated herein by reference in their entirety.

[0166] Similarly, such formulations, though not limited to these, can be constructed or their composition modified so that they are passively or actively directed to various in vivo cell types, including hepatocytes, immune cells, tumor cells, endothelial cells, antigen-presenting cells, and leukocytes (Akinc et al., Mol Ther. 2010 18:1357~1364; Song et al., Nat Biotechnol. 2005 23:709~717; Judge et al., J Clin Invest. 2009 119:661~673; Kaufmann et al., Microvasc Res 2010 80:286~293; Santel et al., Gene Ther 2006 13:1222~1234; Santel et al., Gene Ther 2006 13:1360~1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334~344; Basha et al., Mol.Ther.2011 19:2186~2200; Fenske and Cullis, Expert Opin Drug Deliv.2008 5:25~44; Peer et al., Science.2008 319:627~630; Peer and Lieberman, Gene Ther.2011 18:1127~1133; all of these are incorporated herein by reference in their entirety). An example of passive targeting of formulations to hepatocytes includes DLin-DMA, DLin-KC2-DMA, and DLin-MC3-DMA-based lipid nanoparticle formulations that have been shown to bind to apolipoprotein E and promote the binding and uptake of these formulations to hepatocytes in vivo (Akinc et al., Mol Ther.2010 18:1357~1364; the entirety of which is incorporated herein by reference).While not limited to these, formulations can also be selectively targeted through the expression of various ligands on their surfaces, as exemplified by folic acid, transferrin, N-acetylgalactosamine (GalNAc), and antibody-targeted approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197~206; Musacchio and Torchilin, Front Biosci. 2011 16:1388~1412; Yu et al., Mol Membr Biol. 2010 27:286~298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1~61; Benoit et al., Biomacromolecules. 2011 12:2708~2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309~319; Akinc et al., Mol Ther. 2010 18:1357~1364; Srinivasan et al., Methods Mol Biol. 2012 820:105~116; Ben-Arie et al., Methods Mol Biol. 2012 757:497~507; Peer 2010 J Control Release. 20:63~68; Peer et al., Proc Natl Acad Sci US A. 2007 104:4095~4100; Kim et al., Methods Mol Biol. 2011 721:339~353; Subramanya et al., Mol Ther. 2010 18:2028~2037; Song et al., Nat Biotechnol. 2005 23:709~717; Peer et al., Science. 2008 319:627~630; Peer and Lieberman, Gene Ther. 2011 18:1127~1133; all of these are incorporated herein by reference in their entirety.

[0167] RNA vaccines can be formulated as solid lipid nanoparticles. Solid lipid nanoparticles (SLNs) may be spherical with an average diameter between 10 and 1000 nm. SLNs have a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized using surfactants and / or emulsifiers. In further embodiments, the lipid nanoparticles may be self-assembled lipid polymer nanoparticles (see Zhang et al., ACS Nano, 2008, 2(8), pp. 1696-1702; the contents thereof are incorporated herein by reference in their entirety). As a non-limiting example, the SLN may be the SLN described in International Publication No. 2013105101, the contents thereof are incorporated herein by reference in their entirety. As another non-limiting example, the SLN may be prepared by the method or process described in International Publication No. 2013105101, the contents thereof are incorporated herein by reference in their entirety.

[0168] Liposomes, lipoplexes, or lipid nanoparticles can be used to improve the effectiveness of polynucleotide-directed protein production, as these formulations can increase cell transfection by RNA vaccines and / or increase translation of encoded proteins. One such example involves the use of lipid encapsulation to enable effective systemic delivery of polyplex plasmid DNA (Heyes et al., Mol Ther. 2007 15:713-720; the whole is incorporated herein by reference). Liposomes, lipoplexes, or lipid nanoparticles can also be used to increase the stability of polynucleotides.

[0169] The RNA vaccines of the present invention may also be formulated for sustained-release and / or targeted delivery. As used herein, “sustained-release” refers to a profile of the release of a pharmaceutical composition or compound that matches a specific pattern of release to produce a therapeutic outcome. In one embodiment, the RNA vaccine may be encapsulated in a delivery agent described herein and / or known in the art for sustained-release and / or targeted delivery. As used herein, the term “encapsulated” means to seal, surround, or wrap. In relation to the formulation of a compound of the present invention, the encapsulation may be substantially, completely, or partially. The term “substantially encapsulated” means that at least 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.9, or more than 99.999% of the pharmaceutical composition or compound of the present invention may be sealed, surrounded, or wrapped in a delivery agent. "Partially encapsulated" means that 10, 10, 20, 30, 40, 50 or fewer of the pharmaceutical compositions or compounds of the present invention may be sealed, surrounded, or wrapped in a delivery agent.

[0170] Advantageously, encapsulation can be determined by measuring the escape or activity of the pharmaceutical composition or compound of the present invention using fluorescence and / or electron microscopy. For example, pharmaceutical compositions or compounds of the present invention in amounts of at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99, or more than 99.99% are encapsulated in the delivery agent. Sustained-release formulations may, but are not limited to, include triblock copolymers. In non-limiting examples, a formulation may include two different types of triblock copolymers (International Publication Nos. 2012131104 and International Publication Nos. 2012131106; the contents thereof are incorporated herein by reference in their entirety).

[0171] RNA vaccines may be encapsulated in lipid nanoparticles or rapidly eliminated lipid nanoparticles, which may then be encapsulated in polymers, hydrogels, and / or surgical sealants described herein and / or known in the art. Non-limiting examples include polymers, hydrogels, or surgical sealants such as PLGA, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, FL), HYLENEX® (Halozyme Therapeutics, San Diego, CA), surgical sealants such as fibrinogen polymer (Ethicon Inc. Cornelia, GA), TISSELL® (Baxter International, Inc. Deerfield, IL), PEG-based sealants, and COSEAL® (Baxter International, Inc. Deerfield, IL).

[0172] Lipid nanoparticles can be encapsulated in any polymer known in the art that can form a gel when injected into a target. As another, non-limiting example, lipid nanoparticles can be encapsulated in a polymer matrix that may be biodegradable.

[0173] RNA vaccine formulations for sustained-release and / or targeted delivery may also include at least one sustained-release coating. Examples of sustained-release coatings include, but are not limited to, OPADRY®, polyvinylpyrrolidone / vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, EUDRAGIT RL®, EUDRAGIT RS®, and cellulose derivatives, such as aqueous dispersions of ethylcellulose (AQUACOAT® and SURELEASE®). In one embodiment, an RNA vaccine sustained-release and / or targeted delivery formulation may comprise at least one degradable polyester that may contain a polycationic side chain. Examples of degradable polyesters include, but are not limited to, poly(serine esters), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline esters), and combinations thereof. In another embodiment, the degradable polyester may comprise a PEG conjugation such as forming a PEGylated polymer. An RNA vaccine sustained-release and / or targeted delivery formulation comprising at least one polynucleotide may comprise at least one PEG and / or PEG-related polymer derivative described in U.S. Patent No. 8,404,222, which is incorporated herein by reference in whole.

[0174] An RNA vaccine sustained-release formulation containing at least one polynucleotide may be a sustained-release polymer system as described in U.S. Patent Application Publication 20130130348, which is incorporated herein by reference in its entirety. The RNA vaccine of the present invention may be encapsulated in therapeutic nanoparticles, which are collectively referred to herein as “therapeutic nanoparticle RRNA vaccine.” Therapeutic nanoparticles are as described herein by method and, but are not limited to, the contents of which are incorporated herein by reference in their entirety in International Publications 2010005740, 2010030763, 2010005721, 2010005723, 2012054923, U.S. Patent Application Publication 20110262491, U.S. Patent Application Publication 20100104645, U.S. Patent Application Publication 20100087337, and U.S. Patent Application Publication They may be formulated by methods well known in the art, such as Publication No. 20100068285, U.S. Patent Application Publication No. 20110274759, U.S. Patent Application Publication No. 20100068286, U.S. Patent Application Publication No. 20120288541, U.S. Patent Application Publication No. 20130123351 and U.S. Patent Application Publication No. 20130230567, and U.S. Patents 8,206,747, 8,293,276, 8,318,208 and 8,318,211. In another embodiment, therapeutic polymer nanoparticles may be identified by the method described in U.S. Patent Application Publication No. 20120140790, the entirety of which is incorporated herein by reference.

[0175] Therapeutic nanoparticle RNA vaccines may be formulated for sustained release. As used herein, “sustained release” refers to a pharmaceutical composition or compound that is adapted to a release rate over a specific period of time. This period may include, but is not limited to, hours, days, weeks, months, and years. In non-limiting examples, sustained-release nanoparticles may include polymers and therapeutic agents, such as, but is not limited to, the polynucleotides of the present invention (see International Publication No. 2010075072 and U.S. Patent Application Publication Nos. 20100216804, U.S. Patent Application Publication Nos. 20110217377, and U.S. Patent Application Publication Nos. 20120201859; each of these is incorporated herein by reference in whole). In another non-limiting example, sustained-release formulations may include agents that enable sustained bioavailability, such as, but not limited to, crystals, polymer gels, and / or particulate suspensions (see U.S. Patent Application Publication No. 20130150295, the contents of which are incorporated herein by reference in their entirety).

[0176] In one embodiment, a therapeutic nanoparticle RNA vaccine may be formulated to be target-specific. In a non-limiting example, the therapeutic nanoparticles may include corticosteroids (see International Publication 2011084518, which is incorporated herein by reference in its entirety). In a non-limiting example, the therapeutic nanoparticles may be formulated in the nanoparticles described in International Publication 2008121949, International Publication 2010005726, International Publication 2010005725, International Publication 2011084521, and U.S. Patent Application Publication 20100069426, U.S. Patent Application Publication 20120004293, and U.S. Patent Application Publication 20100104655, which are each incorporated herein by reference in their entirety.

[0177] The nanoparticles of the present invention may include a polymeric matrix. As a non-limiting example, the nanoparticles may include two or more polymers, for example, but not limited to, polyethylene, polycarbonate, polyacid anhydride, polyhydroxy acid, polypropylfumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), or a combination thereof. In one embodiment, the therapeutic nanoparticles include a dibroc copolymer. In one embodiment, the dibroc copolymer may include PEG in combination with polymers such as polyethylene, polycarbonate, polyacid anhydride, polyhydroxy acid, polypropyl fumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In another embodiment, the dibroc copolymer may include a dibroc copolymer described in a European patent application publication, the entirety of which is incorporated herein by reference. In yet another embodiment, the diblock copolymer may be a high-X diblock copolymer, such as the one described in International Publication No. 2013120052, the entirety of which is incorporated herein by reference.

[0178] In a non-limiting example, therapeutic nanoparticles include a PLGA-PEG block copolymer (see U.S. Patent Publication No. 20120004293 and U.S. Patent No. 8,236,330; each of these is incorporated herein by reference in whole). In another non-limiting example, therapeutic nanoparticles are stealth nanoparticles including a diblock copolymer of PEG and PLA or PEG and PLGA (see U.S. Patent No. 8,246,968 and International Publication No. 2012166923; the contents of each are incorporated herein by reference in whole). In yet another non-limiting example, therapeutic nanoparticles are stealth nanoparticles or target-specific stealth nanoparticles as described in U.S. Patent Publication No. 20130172406, the contents of which are incorporated herein by reference in whole.

[0179] Therapeutic nanoparticles may include multiblock copolymers (see, for example, U.S. Patent Nos. 8,263,665 and 8,287,910 and U.S. Patent Application Publication No. 20130195987; the contents of each are incorporated herein by reference in their entirety). In yet another non-limiting example, lipid nanoparticles include the block copolymer PEG-PLGA-PEG (for example, temperature-sensitive hydrogel (PEG-PLGA-PEG) was used as a TGF-β1 gene delivery vehicle in Lee et al., Thermosensitive Hydrogel as a Tgf-βi Gene Delivery Vehicle Enhances Diabetic Wound Healing. Pharmaceutical Research, 2003 20(12):1995~2000; Li et al., Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel. Pharmaceutical Research 2003 20(6):884~888; and Chang et al., Non-ionic amphiphilic biodegradable PEG-PLGA-PEG copolymer enhances gene delivery efficiency in rat skeletal muscle. J Controlled Release. 2007 118:245~253; see these; each of these is incorporated herein by reference in whole).

[0180] The RNA vaccine of the present invention can be formulated into lipid nanoparticles containing PEG-PLGA-PEG block copolymers. The therapeutic nanoparticles may contain multiblock copolymers (see, for example, U.S. Patent Nos. 8,263,665 and 8,287,910 and U.S. Patent Application Publication No. 20130195987; the contents of each are incorporated herein by reference in their entirety). The block copolymers described herein may be contained in polyionic complexes containing nonpolymeric micelles and block copolymers (see, for example, U.S. Patent Application Publication No. 20120076836; the contents of which are incorporated herein by reference in their entirety).

[0181] Therapeutic nanoparticles may contain at least one acrylic polymer. Examples of acrylic polymers, but not limited to, include acrylic acid, methacrylic acid, acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkyl methacrylate copolymers, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylate, and combinations thereof.

[0182] Therapeutic nanoparticles may comprise at least one poly(vinyl ester) polymer. The poly(vinyl ester) polymer may be a copolymer, such as a random copolymer. In non-limiting examples, the random copolymer may have a structure such as that described in whole by International Publication No. 2013032829 or U.S. Patent Application Publication No. 20130121954, which are incorporated herein by reference in whole. In one embodiment, the poly(vinyl ester) polymer may be conjugated to a polynucleotide described herein. In another embodiment, the poly(vinyl ester) polymer that may be used in the present invention may be one described in whole by whole by reference.

[0183] Therapeutic nanoparticles may comprise at least one diblock copolymer. The diblock copolymer may be, but is not limited to, a poly(lactic acid)-poly(ethylene) glycol copolymer (see, for example, International Publication No. 2013044219; the whole is incorporated herein by reference). In a non-limiting example, therapeutic nanoparticles may be used to treat cancer (see, for example, International Publication No. 2013044219; the whole is incorporated herein by reference).

[0184] In one embodiment, the therapeutic nanoparticles may comprise at least one cationic polymer described herein and / or well known in the art.

[0185] Therapeutic nanoparticles may include at least one amine-containing polymer, for example, but not limited to, polylysine, polyethyleneimine, poly(amidoamine)dendrimer, poly(beta-aminoester) (see, for example, U.S. Patent No. 8,287,849; the whole of which is incorporated herein by reference), and combinations thereof. In another embodiment, the nanoparticles described herein may include amine cationic lipids, such as those described in International Publication No. 2013059496, which are incorporated herein by reference in their entirety. In one embodiment, the cationic lipid may have an aminoamine or aminoamide moiety.

[0186] The therapeutic nanoparticles may comprise at least one biodegradable polyester that may contain polycationic side chains. Examples of biodegradable polyesters, but not limited to, include poly(serine esters), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline esters), and combinations thereof. In another embodiment, the biodegradable polyester may comprise PEG conjugations that form PEGylated polymers.

[0187] Therapeutic nanoparticles may contain a conjugation of at least one targeted ligand. The targeted ligand may be any ligand well known in the art, but is not limited to, a monoclonal antibody (Kirpotin et al., Cancer Res. 2006 66:6732~6740; the entire article is incorporated herein by reference).

[0188] Therapeutic nanoparticles can be formulated in aqueous solutions that can be used to target cancer (see International Publication No. 2011084513 and U.S. Patent Application Publication No. 20110294717; the contents of each are incorporated herein by reference in their entirety). Therapeutic nanoparticle RNA vaccines, for example, therapeutic nanoparticles comprising at least one RNA vaccine, can be formulated using the method described by Podobinski et al. in U.S. Patent No. 8,404,799, the entirety of which is incorporated herein by reference.

[0189] RNA vaccines may be encapsulated, ligated, and / or associated with synthetic nanocarriers. Synthetic nanocarriers include, but are not limited to, the following, each incorporated herein by reference in its entirety: International Publication Nos. 2010005740, 2010030763, 201213501, 2012149252, 2012149255, 2012149259, 2012149265, 2012149268, 2012149282, and International Publication Nos. 2012149282. Examples include those described in Patent Publication No. 2012149301, International Publication No. 2012149393, International Publication No. 2012149405, International Publication No. 2012149411, International Publication No. 2012149454, and International Publication No. 2013019669, as well as U.S. Patent Application Publication No. 20110262491, U.S. Patent Application Publication No. 20100104645, U.S. Patent Application Publication No. 20100087337, and U.S. Patent Application Publication No. 20120244222. Synthetic nanocarriers can be formulated using methods well known in the art and / or methods described herein. As a non-limiting example, synthetic nanocarriers may be formulated by the methods described in International Publication No. 2010005740, International Publication No. 2010030763, and International Publication No. 201213501, and U.S. Patent Application Publication No. 20110262491, U.S. Patent Application Publication No. 20100104645, U.S. Patent Application Publication No. 20100087337, and U.S. Patent Application Publication No. 2012024422, respectively, whose entire contents are incorporated herein by reference. In another embodiment, the synthetic nanocarrier formulation may be lyophilized by the methods described in International Publication No. 2011072218 and U.S. Patent No. 8,211,473, whose entire contents are incorporated herein by reference. In yet another embodiment, the formulations of the present invention, including synthetic nanocarriers not limited thereto, can be freeze-dried or restored by the method described in U.S. Patent Application Publication No. 20130230568, the contents of which are incorporated herein by reference in their entirety.

[0190] In one embodiment, the synthetic nanocarrier may contain a reactive group for releasing the polynucleotides described herein (see International Publication No. 20120952552 and U.S. Patent Application Publication No. 20120171229; the wholes of each are incorporated herein by reference).

[0191] Synthetic nanocarriers may contain immunostimulants to enhance the immune response derived from the delivery of the synthetic nanocarrier. In non-limiting examples, synthetic nanocarriers may contain Th1 immunostimulants capable of enhancing the Th1-based response of the immune system (see International Publication 2010123569 and U.S. Patent Application Publication 20110223201; both are incorporated herein by reference in their entirety). Synthetic nanocarriers may be formulated for targeted release. In one embodiment, a synthetic nanocarrier is formulated to release polynucleotides at a specific pH and / or after a desired period of time. As a non-limiting example, synthetic nanoparticles may be formulated to release an RNA vaccine after 24 hours and / or at pH 4.5 (see International Publications 2010138193 and 2010138194 and U.S. Patent Application Publications 20110020388 and 20110027217, respectively; each incorporated herein by reference in its entirety).

[0192] Synthetic nanocarriers may be formulated for sustained and / or sustained release of polynucleotides as described herein. In non-limiting examples, synthetic nanocarriers for sustained release may be formulated by methods well known in the Art, methods described herein, and / or by methods described in International Publication No. 2010138192 and U.S. Patent Application Publication No. 20100303850, which are incorporated herein by reference in whole. In one embodiment, the RNA vaccine may be formulated for sustained release and / or prolonged release, wherein the formulation comprises at least one polymer, which is a crystalline side-chain (CYSC) polymer. CYSC polymers are described in U.S. Patent No. 8,399,007, which is incorporated herein by reference in whole.

[0193] Synthetic nanocarriers can be formulated for use as vaccines. In one embodiment, a synthetic nanocarrier may encapsulate at least one polynucleotide encoding at least one antigen. In a non-limiting example, a synthetic nanocarrier may comprise at least one antigen and excipients for a vaccine formulation (see International Publication 2011150264 and U.S. Patent Application Publication 20110293723; both are incorporated herein by reference in their entirety). In another non-limiting example, a vaccine formulation may comprise at least two synthetic nanocarriers with the same or different antigens and excipients (see International Publication 2011150249 and U.S. Patent Application Publication 20110293701; both are incorporated herein by reference in their entirety). Vaccine formulations may be selected by the methods described herein, methods well known in the art, and / or by the methods described herein, each incorporated herein by whole by reference, International Publication No. 2011150258 and U.S. Patent Application Publication No. 20120027806.

[0194] The synthetic nanocarrier may comprise at least one polynucleotide encoding at least one adjuvant. In non-limiting examples, the adjuvant may comprise dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, dimethyldioctadecylammonium phosphate, or dimethyldioctadecylammonium acetate (DDA) and a nonpolar fraction or portion thereof of a total lipid extract of mycobacteria (see, for example, U.S. Patent No. 8,241,610; the whole of which is incorporated herein by reference). In another embodiment, the synthetic nanocarrier may comprise at least one polynucleotide and an adjuvant. In non-limiting examples, the synthetic nanocarrier comprising the adjuvant may be formulated by the methods described in International Publication No. 2011150240 and U.S. Patent Application Publication No. 20110293700, the whole of which is incorporated herein by reference. The synthetic nanocarrier can encapsulate at least one polynucleotide encoding a virus-derived peptide, fragment, or region. Non-limiting examples include, but are not limited to, the synthetic nanosupports described in International Publication Nos. 2012024621, 201202629, 2012024632, and U.S. Patent Publication Nos. 20120064110, 20120058153, and 20120058154, each of which is incorporated herein by reference in its entirety. The synthetic nanocarriers can be coupled to polynucleotides that can induce humoral and / or cytotoxic T lymphocyte (CTL) responses (see, for example, International Publication No. 2013019669; the whole is incorporated herein by reference). In one embodiment, an RNA vaccine may be encapsulated, linked, and / or associated with a zwitterionic lipid. Non-limiting examples of zwitterionic lipids and methods of using zwitterionic lipids are described in U.S. Patent Application Publication No. 20130216607, the contents of which are incorporated herein by reference in their entirety. In one embodiment, zwitterionic lipids may be used in liposomes and lipid nanoparticles as described herein. In one embodiment, the RNA vaccine may be formulated into colloidal nanoparticles whose contents are described in U.S. Patent Application Publication No. 20130197100, the entirety of which is incorporated herein by reference.

[0195] Nanoparticles can be optimized for oral administration. The nanoparticles may comprise at least one cationic biopolymer, for example, chitosan or a derivative thereof, but not limited to this. In a non-limiting example, the nanoparticles may be formulated by the method described in U.S. Patent Application Publication 20120282343, which is incorporated herein by whole reference. In some embodiments, the LNP comprises the lipid KL52 (an aminolipid disclosed in U.S. Patent Application Publication 2012 / 0295832, which is expressly incorporated herein by whole reference). The activity and / or stability of LNP administration (measured by examining one or more of ALT / AST, leukocyte count, and cytokine induction) may be improved by the incorporation of such lipids. LNPs containing KL52 may be administered intravenously and / or in one or more doses. In some embodiments, administration of LNPs containing KL52 results in equivalent or improved mRNA and / or protein expression compared to LNPs containing MC3.

[0196] In some embodiments, RNA vaccines may be delivered using even smaller LNPs. Such particles may range from less than 0.1 μm to 100 μm, for example, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 μm, less than 60 μm, less than 65 μm, less than 70 μm, less than 75 μm, less than 80 μm, less than 85 μm, less than 90 μm, less than 95 μm, less than 100 μm, less than 125 μm, less than 150 μm, less than 175 μm, less than 200 μm, less than 225 μm, less than 250 μm, and 27 μm. It may have a diameter of less than 5um, less than 300um, less than 325um, less than 350um, less than 375um, less than 400um, less than 425um, less than 450um, less than 475um, less than 500um, less than 525um, less than 550um, less than 575um, less than 600um, less than 625um, less than 650um, less than 675um, less than 700um, less than 725um, less than 750um, less than 775um, less than 800um, less than 825um, less than 850um, less than 875um, less than 900um, less than 925um, less than 950um, and less than 975um.

[0197] RNA vaccines are approximately 1 nm to approximately 100 nm, approximately 1 nm to approximately 10 nm, approximately 1 nm to approximately 20 nm, approximately 1 nm to approximately 30 nm, approximately 1 nm to approximately 4 0nm, about 1nm to about 50nm, about 1nm to about 60nm, about 1nm to about 70nm, about 1nm to about 80nm, about 1nm to about 90nm, about 5n m ~ about 100nm, about 5nm - about 10nm, about 5nm - about 20nm, about 5nm - about 30nm, about 5nm - about 40nm, about 5nm - about 50 nm, approximately 5 nm to approximately 60 nm, approximately 5 nm to approximately 70 nm, approximately 5 nm to approximately 80 nm, approximately 5 nm to approximately 90 nm, approximately 10 to approximately 50 nm, approximately 20 to approximately They can be delivered using even smaller LNPs that may have diameters of 50 nm, approximately 30-50 nm, approximately 40-50 nm, approximately 20-60 nm, approximately 30-60 nm, approximately 40-60 nm, approximately 20-70 nm, approximately 30-70 nm, approximately 40-70 nm, approximately 50-70 nm, approximately 60-70 nm, approximately 20-80 nm, approximately 30-80 nm, approximately 40-80 nm, approximately 50-80 nm, approximately 60-80 nm, approximately 20-90 nm, approximately 30-90 nm, approximately 40-90 nm, approximately 50-90 nm, approximately 60-90 nm and / or approximately 70-90 nm.

[0198] Such LNPs can be synthesized using methods involving microfluidic mixers. Exemplary microfluidic mixers, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria), include slit-interdigital micromixers and / or staggered herringbone micromixers (SHMs). (Examples include: Zhigaltsev, IV et al., "Bottom-up design and synthesis system for limit-size lipid nanoparticles with aqueous and triglyceride cores using millisecond microfluidic mixing," published in Langmuir. 2012.28:3633~40; Belliveau, NM et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy-Nucleic Acids. 2012.I:e37; Chen, D et al., "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation," J Am Chem.) Examples include, but are not limited to, those disclosed in Soc.2012.134(16):6948~51 (each of which is incorporated herein by reference in its entirety). In some embodiments, a method for LNP production including SHM further includes mixing of at least two inflows, the mixing occurring by microstructure-induced chaotic advection (MICA). In this method, the liquid flow flows through channels present in a herringbone pattern, creating a swirling flow and causing the flows to wrap around each other. The method may also include a surface for mixing the liquids, where the surface changes direction during liquid circulation. Methods for producing LNPs using SHM include those disclosed in U.S. Patent Application Publication 2004 / 0262223 and U.S. Patent Application Publication 2012 / 0276209, both of which are expressly incorporated herein by reference in their entirety.

[0199] The RNA vaccine of the present invention can be formulated into lipid nanoparticles produced using a micromixer, for example, but not limited to, the Slit Interdigital Microstructured Mixer (SIMM-V2), Standard Slit Interdigital Micro Mixer (SSIMM), Caterpillar (CPMM), or Impinging-jet (IJMM) manufactured by the Institut fiir Mikrotechnik Mainz GmbH, Mainz, Germany. The RNA vaccine of the present invention can be formulated into lipid nanoparticles produced using microfluidic technology (see Whitesides, George M. The Origins and the Future of Microfluidic s. Nature, 2006 442:368~373; and Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295:647~651; the entirety of each is incorporated herein by reference). As a non-limiting example, a controlled microfluidic formulation could be a passive method for mixing water flows in a flow delivered at a steady pressure in a microchannel at a low Reynolds number (see, e.g., Abraham et al., Chaotic Mixer for Microchannels. Science, 2002 295:647-651; the whole is incorporated herein by reference). The RNA vaccine of the present invention may be formulated into lipid nanoparticles produced using, for example, but not limited to, micromixer chips such as those manufactured by Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). Micromixer chips may be used for rapid mixing of two or more liquid flows having a splitting and recombining mechanism.

[0200] The RNA vaccines of the present invention may be formulated for delivery using drug-encapsulating microspheres as described in International Publication No. 2013063468 or U.S. Patent No. 8,440,614, each of which is incorporated herein by reference in whole. The microspheres may contain compounds of formulas (I), (II), (III), (IV), (V), or (VI) as described in International Publication No. 2013063468, which is incorporated herein by reference in whole. In other embodiments, amino acids, peptides, polypeptides, and lipids (APPL) are useful in delivering the RNA vaccines of the present invention to cells (see International Publication No. 2013063468, whose contents are incorporated herein by reference in whole).

[0201] The RNA vaccine of the present invention has a wavelength of approximately 10 to approximately 200 nm, for example, not limited to this, but including approximately 10 to approximately 20 nm, approximately 10 to approximately 30 nm, approximately 10 to approximately 40 nm, approximately 10 to approximately 50 nm, approximately 10 to approximately 60 nm, approximately 10 to approximately 70 nm, approximately 10 to approximately 80 nm, approximately 10 to approximately 90 nm, approximately 20 to approximately 30 nm, approximately 20 to approximately 40 nm, approximately 20 to approximately 50 nm, approximately 20 to approximately 60 nm, approximately 20 to approximately 70 nm, and approximately 20 to approximately 8 0nm, about 20 to about 90nm, about 20 to about 100nm, about 30 to about 40nm, about 30 to about 50nm, about 30 to about 60nm, about 30 to about 70nm, about 30 to about 80nm, about 30 to about 90nm, about 30 ~about 100nm, about 40 to about 50nm, about 40 to about 60nm, about 40 to about 70nm, about 40 to about 80nm, about 40 to about 90nm, about 40 to about 100nm, about 50 to about 60nm, about 50 to about 70nm It can be formulated into lipid nanoparticles having diameters of approximately 50-80 nm, 50-90 nm, 50-100 nm, 50-150 nm, 50-200 nm, 60-70 nm, 60-80 nm, 60-90 nm, 60-100 nm, 60-150 nm, 60-200 nm, 70-80 nm, 70-90 nm, 70-100 nm, 70-150 nm, 70-200 nm, 80-90 nm, 80-100 nm, 80-150 nm, 80-200 nm, 90-100 nm, 90-150 nm and / or 90-200 nm.

[0202] Lipid nanoparticles can have a diameter of approximately 10 to 500 nm. In one embodiment, lipid nanoparticles may have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm, or greater than 1000 nm.

[0203] Lipid nanoparticles may be limit-size lipid nanoparticles as described in International Publication No. 2013059922, which is incorporated herein by reference in whole. Limit-size lipid nanoparticles may comprise a lipid bilayer surrounding an aqueous or hydrophobic core; the lipid bilayer may comprise phospholipids, for example, but not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, cephalin, cerebroside, C8-C20 fatty acid diacylphosphatidylcholine, and 1-palmitoyl-2-oleylphosphatidylcholine (POPC). In another embodiment, limit-size lipid nanoparticles may comprise polyethylene glycol lipids, for example, but not limited to, DLPE-PEG, DMPE-PEG, DPPC-PEG, and DSPE-PEG.

[0204] RNA vaccines may be delivered, localized, and / or concentrated at specific locations using a delivery method described in International Publication No. 2013063530, the entirety of which is incorporated herein by reference. In a non-limiting example, a subject may be administered empty polymeric particles before, simultaneously with, or after delivery of the RNA vaccine to the subject. The empty polymeric particles undergo a change in volume upon contact with the subject and are retained, embedded, fixed, or encapsulated at specific locations on the subject.

[0205] RNA vaccines can be formulated in an active substance release system (see, for example, U.S. Patent Application Publication No. 20130102545, the contents of which are incorporated herein by reference in their entirety). The active substance release system may comprise 1) at least one nanoparticle bound to an oligonucleotide inhibitor chain that hybridizes with a catalytically active nucleic acid, and 2) a compound (e.g., a polynucleotide as described herein) bound to at least one substrate molecule bound to a therapeutic active substance, the therapeutic active substance being released by cleavage of the substrate molecule by the catalytically active nucleic acid.

[0206] RNA vaccines can be formulated into nanoparticles comprising an inner core containing noncellular material and an outer surface containing a cellular membrane. The cellular membrane may be derived from cells or from a viral membrane. In a non-limiting example, nanoparticles may be prepared by the method described in International Publication No. 2013052167, which is incorporated herein by reference in whole. In a non-limiting example, nanoparticles described in International Publication No. 2013052167, which is incorporated herein by reference in whole, may be used to deliver the RNA vaccine described herein.

[0207] RNA vaccines can be formulated into porous nanoparticle-supported lipid bilayers (protocells). The contents of protocells are described in International Publication No. 2013056132, which is incorporated herein by reference in its entirety.

[0208] The RNA vaccines described herein may be formulated into polymeric nanoparticles whose contents are described in whole by U.S. Patent No. 8,420,123 and U.S. Patent No. 8,518,963 and European Patent No. 2073848B1, or produced by the methods described herein. In a non-limiting example, polymeric nanoparticles may have a high glass transition temperature, such as the nanoparticles described in U.S. Patent No. 8,518,963, or produced by the methods described herein, whose contents are described in whole by U.S. Patent No. 8,518,963, or produced by the methods described herein. In another non-limiting example, polymeric nanoparticles for oral and parenteral formulations may be produced by the method described in European Patent No. 2073848B1, whose contents are described in whole by European Patent No. 2073848B1.

[0209] The RNA vaccines described herein may be formulated into nanoparticles for use in medical imaging. The nanoparticles may be liposome nanoparticles, for example, those described in U.S. Patent Application Publication 20130129636, which is incorporated herein by reference in whole. In non-limiting examples, the liposomes may comprise gadolinium(III)2-{4,7-bis-carboxymethyl-10-[(N,N-distearylamidemethyl-N'-amide-methyl]-1,4,7,10-tetra-azacyclododeca-1-yl}acetic acid and a neutral, fully saturated phospholipid component (see, for example, U.S. Patent Application Publication 20130129636, which is incorporated herein by reference in whole). The nanoparticles that may be used in the present invention may be formed by the method described in U.S. Patent Application Publication No. 20130130348, the contents of which are incorporated herein by reference in their entirety. The nanoparticles of the present invention may further include nutrients, for example, those whose deficiency may cause health problems ranging from anemia to neural tube defects (see, for example, the nanoparticles described in International Publication No. 2013072929, the contents of which are incorporated herein by reference in their entirety). In non-limiting examples, the nutrients may be iron in the form of ferrous iron, ferric iron salts or elemental iron, iodine, folic acid, vitamins or micronutrients.

[0210] The RNA vaccine of the present invention may be formulated as swellable nanoparticles. These swellable nanoparticles may, but are not limited to, those described in U.S. Patent No. 8,440,231, which is incorporated herein by reference in its entirety. In non-limiting embodiments, swellable nanoparticles may be used for delivery of the RNA vaccine of the present invention to the lung system (see, for example, U.S. Patent No. 8,440,231, which is incorporated herein by reference in its entirety).

[0211] The RNA vaccine of the present invention can be formulated into polyacid anhydride nanoparticles, for example, but not limited to, those described in U.S. Patent No. 8,449,916, which is incorporated herein by reference in its entirety.

[0212] The nanoparticles and microparticles of the present invention can be geometrically manipulated to modulate macrophages and / or immune responses. In one embodiment, the geometrically manipulated particles may have a variety of shapes, sizes and / or surface charges for targeted delivery of the polynucleotides of the present invention, for example, to the lungs, for example (see International Publication No. 2013082111, the contents of which are incorporated herein by reference in their entirety). Other physical properties of geometrically manipulated particles, including but not limited to fenestration, angled arms, asymmetry and surface roughness, and charges that can alter interactions with cells and tissues. In a non-limiting example, the nanoparticles of the present invention may be prepared by the method described in International Publication No. 2013082111, the contents of which are incorporated herein by reference in their entirety.

[0213] The nanoparticles of the present invention may be water-soluble nanoparticles, for example, but not limited to those described in International Publication No. 2013090601, which is incorporated herein by reference in its entirety. The nanoparticles may be inorganic nanoparticles having compact, biionic ligands to exhibit good water solubility. The nanoparticles may also have a small hydrodynamic diameter (HD), stability with respect to time, pH, and salinity, and low levels of nonspecific protein binding. In one embodiment, the nanoparticles of the present invention may be developed by the method described in U.S. Patent Application Publication No. 20130172406, which is incorporated herein by reference in its entirety.

[0214] The nanoparticles of the present invention may be stealth nanoparticles or target-specific stealth nanoparticles, for example, but not limited to those described in U.S. Patent Application Publication No. 20130172406, which is incorporated herein by reference in its entirety. The nanoparticles of the present invention may be produced by the method described in U.S. Patent Application Publication No. 20130172406, which is incorporated herein by reference in its entirety.

[0215] Stealth or target-specific stealth nanoparticles may include a polymeric matrix. The polymeric matrix may include, but is not limited to, two or more polymers such as polyethylene, polycarbonate, polyacid anhydride, polyhydroxy acid, polypropyl fumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polyester, polyacid anhydride, polyether, polyurethane, polymethacrylate, polyacrylate, polycyanoacrylate, or combinations thereof. The nanoparticles may have a nanoparticle nucleic acid hybrid structure having a high-density nucleic acid layer. As a non-limiting example, the nanoparticle nucleic acid hybrid structure may be prepared by the method described in U.S. Patent Application Publication No. 20130171646, the entirety of which is incorporated herein by reference. Nanoparticles may include nucleic acids, for example, polynucleotides, which are not limited to those described herein and / or are well known in the art.

[0216] The nanoparticles may be embedded in the core of the nanostructure, or coated with a low-density porous 3-D structure or a coating capable of holding or associating with at least one payload within or on the surface of the nanostructure. Non-limiting examples of nanostructures containing at least one nanoparticle are described in International Publication No. 2013123523, the contents of which are incorporated herein by reference in their entirety.

[0217] Other formulations include those described in U.S. Patent Application Publication No. 20170136121A1, U.S. Patent No. 9221891B2, European Patent No. 2971033B1, and U.S. Patent Application Publication No. 20160331828A1, which are incorporated herein by reference in their entirety.

[0218] Similarly, a method for producing mRNA encoding at least one immunogenic peptide fragment, (a) A step of conjugating a first polynucleotide containing an open reading frame encoding an immunogenic peptide fragment and a second polynucleotide containing a 5'-UTR to a polynucleotide conjugated on a solid support; (b) A step of ligating the 3' end of a second polynucleotide to the 5' end of a first polynucleotide under suitable conditions including a DNA ligase, thereby producing a first ligation product; (c) A step of ligating the 5' end of a third polynucleotide containing a 3'-UTR to the 3' end of a first ligation product under suitable conditions including an RNA ligase, thereby producing a second ligation product; and (d) The step of releasing a second ligation product from the solid support, thereby producing mRNA encoding an immunogenic peptide fragment. Methods including this are also provided.

[0219] Similarly, a kit for preparing mRNA cancer vaccines is provided. The kit may have one or more containers containing instructions for ligating one or more polynucleotides containing a 5'-ORF, one or more polynucleotides containing a 3'-ORF, one or more polynucleotides containing a poly(A) tail, a ligase enzyme, and one or more polynucleotides containing an ORF encoding a patient-specific epitope to one or more polynucleotides containing a 5'-ORF, a 3'-ORF, and a poly(A) tail.

[0220] Exemplary preferred compositions according to the present invention, but not limited to the following: The present invention comprises two or more different polypeptides (more preferably the composition comprises 2 to about 20, about 30, about 40, or preferably about 50 different polypeptides, the different polypeptides optionally being included in a continuous polypeptide sequence). The present invention provides a polynucleotide (preferably the polynucleotide is mRNA, more preferably the mRNA encodes 2 to about 20, about 30, about 40, or preferably about 50 different polypeptides, and optionally the polynucleotide is a single mRNA molecule encoding 2 to about 20, about 30, about 40, or preferably about 50 different polypeptides). Multiple polypeptides of the present invention (preferably comprising 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably with polypeptides being 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611)), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. The present invention comprises a polypeptide preferably comprising 2 to 20, 30, 40, or preferably 50 different polypeptides (preferably each polypeptide of the present invention is 8 to 11mer (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. An mRNA molecule containing sequences encoding multiple polypeptides of the present invention (preferably the mRNA molecule encodes 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11 mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), optionally the mRNA molecule encodes multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. Multiple mRNA molecules encoding multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11 mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. A DNA molecule containing sequences encoding multiple polypeptides of the present invention (preferably the DNA molecule encodes 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11 mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), optionally the DNA molecule encoding multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. Multiple DNA molecules encoding multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. A viral vector comprising sequences encoding multiple polypeptides of the present invention (preferably the viral vector encoding 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides being 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), optionally the viral vector encoding the multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. Multiple viral vectors encoding multiple polypeptides of the present invention (preferably the plurality of polypeptides comprising 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides being 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. The present invention comprises a plurality of polypeptides (preferably comprising 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., a plurality of camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably with polypeptides being 8 to 100mers), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. An mRNA molecule containing sequences encoding multiple polypeptides of the present invention (preferably the DNA molecule encoding 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides being 8 to 100 mers, optionally the DNA molecule encoding multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. Multiple mRNA molecules encoding multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100 mers), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. A DNA molecule containing sequences encoding multiple polypeptides of the present invention (preferably the DNA molecule encodes 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100mers, optionally the DNA molecule encodes multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. Multiple DNA molecules encoding multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100mer), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. A viral vector comprising sequences encoding multiple polypeptides of the present invention (preferably the viral vector encoding 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides being 8 to 100mers, optionally the viral vector encoding multiple polypeptides in frame to form a continuous polypeptide), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative, and / or excipient. Multiple viral vectors encoding multiple polypeptides of the present invention (preferably the plurality of polypeptides comprising 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides being 8 to 100 mers), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11 mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably maturation is by transfection with mRNA carrying the coding sequences of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11 mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably maturation is by transfection with multiple mRNA molecules, each mRNA molecule possessing a coding sequence of one of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100 mers, preferably maturation is by transfection with mRNA carrying the coding sequences of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100 mers, preferably maturation is by transfection with multiple mRNA molecules, each mRNA molecule possessing a coding sequence of one of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably maturation is by infection with a viral vector possessing the coding sequences of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation using multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention, preferably the polypeptides are 8 to 11mers (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably maturation by infection with multiple viral vectors, each viral vector molecule possessing the coding sequence of one of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100mer, preferably maturation is by infection with a viral vector possessing the coding sequences of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Syngeneic (patient-derived) dendritic cells (DCs) matured ex vivo by incubation with multiple polypeptides of the present invention (preferably the multiple polypeptides comprise 2 to 20, 30, 40, or preferably 50 different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably the polypeptides are 8 to 100 mers, preferably maturation is by infection with multiple viral vectors, each viral vector molecule possessing the coding sequence of one of the multiple polypeptides, the syngeneic DCs are suitable for reintroduction into the patient), and optionally at least one adjuvant, pharmaceutically acceptable carrier, preservative and / or excipient. The present invention comprises one or more polypeptides (preferably CAR-T cells possessing receptors produced for 20 or fewer, 30 or fewer, 40 or fewer, or preferably 50 or fewer different polypeptides, preferably polypeptides being 8-11mer (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98-611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. The present invention comprises one or more polypeptides (preferably 20 or less, 30 or less, 40 or less, or preferably 50 or less different polypeptides (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98-611)) possessing receptors, preferably polypeptides of 8-100mer, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. The present invention comprises one or more polypeptides (preferably 20 or less, 30 or less, 40 or more, or preferably 50 or less, of which multiple antibodies produced against different polypeptides of the present invention, preferably polypeptides being 8-11mer (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98-611)), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative and / or excipient. The present invention comprises one or more polypeptides (preferably 20 or less, 30 or less, 40 or less, or preferably 50 or less different polypeptides of the present invention (e.g., multiple camyotopes as defined herein by SEQ ID NOs. 98 to 611), preferably polypeptides of 8 to 100 mers), and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative, and / or excipient. Any of the described vaccine compositions in combination with other tumor antigens as a combination vaccine, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative and / or excipient. Any of the described vaccine compositions, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative and / or excipient (preferably the composition is also suitable for any type of route of administration (e.g., intravenous, intramuscular, intrathecal)). Any of the described vaccine compositions in any combination with other modes of therapy, and optionally at least one adjuvant, a pharmaceutically acceptable carrier, a preservative and / or excipient. Treatment methods, diagnostic methods, and other uses.

[0221] The polypeptides, polynucleotides, vectors, cells, or compositions of the present invention may be used in methods for treating or preventing diseases or conditions in a subject. The polypeptides, polynucleotides, vectors, cells, or compositions of the present invention may be used in the manufacture of drugs for use in methods for treating or preventing diseases or conditions in a subject.

[0222] The terms “treatment,” “to treat,” or “to restore” refer to either therapeutic or prophylactic treatment. A treatment is therapeutic if it improves at least one symptom of the disease in the individual receiving the treatment, or if it can slow the progression of a progressive disease in the individual, or if it prevents the onset of additional related diseases.

[0223] The terms “prevent,” “prevention,” and “preventively” refer to the administration of a compound before the onset of a disease (for example, before the onset of a specific symptom of the disease). Preventing a disease may include reducing the likelihood of the disease developing, delaying the onset of the disease, promoting long-term recovery of symptoms, or slowing the eventual progression of the disease.

[0224] The method comprises administering the polypeptide, polynucleotide, vector, cells, or composition to the subject. The administration may be a therapeutically or prophylactically effective amount of the polypeptide, polynucleotide, vector, cells, or composition to the subject in need. The administration may be by any preferred route, e.g., intranasal, intravenous (IV), intradermal, intramuscular (IM), intrathecal (IT), or intraperitoneal. In some embodiments, the administration is a single dose. IV, IM, and IT are preferred. In some embodiments, the subject is administered the polypeptide, polynucleotide, vector, cells, or composition two or more times.

[0225] In the method of the present invention in which the cells of the present invention are administered to a target, it is preferable that the cells are of the same lineage as the target.

[0226] The disease or condition may typically be colorectal cancer, preferably microsatellite-stable colorectal cancer (MSS-CRC). Treatment or prevention methods may include inducing an immune response against colorectal cancer in the individual. Subjects may have colorectal cancer at any stage.

[0227] Subjects requiring treatment may have an active or exhausted immune system. Those skilled in the art will understand what characterizes an exhausted immune system. For example, an exhausted immune system may be characterized by effector T cells with a reduced ability to secrete cytokines compared to individuals with a healthy immune system.

[0228] The method may include simultaneous or sequential administration of additional cancer therapies. Additional cancer therapies may be selected from cytokine therapy, T-cell therapy, NK therapy, immune system checkpoint inhibitors, chemotherapy, radiotherapy, immunostimulants, gene therapy, or antibodies. The additional cancer therapy may preferably be any well-known colorectal cancer therapy.

[0229] Immune system checkpoint inhibitors are preferred as an add-on cancer therapy. Examples of immune system checkpoints are: a) Interaction between indoleamine 2,3-dioxygenase (IDO1) and its substrate; b) Interactions between PD1 and PDL1, and / or between PD1 and PDL2; c) Interactions between CTLA4 and CD86, and / or between CTLA4 and CD80; d) Interactions between B7-H3 and / or B7-H4 and their respective ligands; e) Interaction between HVEM and BTLA; f) Interaction between GAL9 and TIM3; g) Interactions between MHC class I or II and LAG3; and h) Interactions between MHC class I or II and KIR Includes. A checkpoint inhibitor may be any immunomodulator (e.g., an antibody) that blocks or inhibits an immune system checkpoint, or it may be an immunotherapy composition containing a component of an immune system checkpoint or an immunogenic fragment of said component that stimulates the immune system to target the checkpoint.

[0230] Additional cancer therapy may involve antibodies. The antibodies include avagovomab, absiximab, actoxumab, adalimumab, adecatumumab, afelimomab, aftuzumab, alacizumab pegol, ALD518, alemtuzumab, alirocumab, altumomab pentetate, amatsuximab, and anatumomab mafenatox. mafenatox), anrukinzumab, apolizumab, alsitumomab, aselizumab, atinumab, atlizumab (=tocilizumab), atorolimumab, bapineozumab, basiliximab, bavituximab, bectumomab, belimumab, benralizumab, bertilimumab, becilesomab, bevacizumab, bezlotoxumab, bicilomab, bimagrumab, bibatuzumab meltansine mertansine), blinatumomab, brosozumab, brentuximab vedotin, briakinumab, brodalumab, canakinumab, cantuzumab mertansine, cantuzumab ravtansine, caplacizumab, capromab pendetide, carlumab, catumakisomab, CC49, cedelizumab, certolizumab pegol, cetuximab, Ch.14.18, citatuzumab bogatox, ixtumumab, crazakizumab, clenoliximab, clivatuzumab tetraxetan tetraxetan), conatumumab, concizumab, crenezumab, CR6261, dasetuzumab, dacrizumab, darotuzumab, daratumumab, demicizumab, denosumab, detumomab, detumomab, dorlimomab aritoxaritox), dolizumab, duligotumab, dupilumab, dusigitumab, ecromeximab, eculizumab, edobacomab, edrecolomab, efalizumab, efungumab, elotuzumab, elsilimomab, enavatuzumab, enlimomab pegol, enokizumab, enoticumab, ensituximab, epitumomab cituxetan, epratuzumab, erlizumab, ertumaxomab, etaracizumab, etrolizumab, evolocumab, exbivirumab, fanolesomab, faralimomab Faretuzumab, Facinumab, FBTA05, Felvizumab, Fezakinumab, Ficlatuzumab, Figitumumab, Flambotumab, Fortrizumab, Foralumab, Foravirumab, Fresolimumab, Fluranumab, Futuximab, Galiximab, Ganitumab, Gantenerumab, Gavilimomab, Gemtuzumab Ozogamicin, Gevokizumab, Girentuximab, Glembatumumab VedotinVedotin, golimumab, gomiliximab, GS6624, ibarizumab, ibritumomab tiuxetan, iccurcumab, igobomab, imciromab, imgatuzumab, inclacumab, indatuximab tansine ravtansine), infliximab, intetumumab, inorimomab, inotuzumab ozogamicin, ipilimumab, iratumumab, itorizumab, ixekizumab, keriximab, rabetuzumab, lampalizumab, lebrikizumab, remalesomab, lerdelimumab, lexatumumab, livivirumab, ligerizumab, lintuzumab, lirilumab, lodelcizumab, lorbotuzumab meltansine Mertansine), Lucatumumab, Lumiliximab, Mapatumumab, Maslimomab, Mavrilimumab, Matsuzumab, Mepolizumab, Metelimumab, Miratuzumab, Minretumomab, Mitumomab, Mogamulizumab, Morolimmumab, Motabizumab, Moxetumomab pasudotox, Muromonab-CD3, Nacolomab Tafenatox), Namilumab, Naptumomab Estafenatox, Narnatumab, Natalizumab, Nevacumab, Necitumumab, Nerelimomab, Nesvacumab, Nimotuzumab, Nivolumab, Nofetumomab Merpentanmerpentan), obinutuzumab, ocaratuzumab, ocrelizumab, odulimomab, ofatumumab, olaratuzumab, olokizumab, omalizumab, onartuzumab, oporutuzumab monatox Monatox), olegobomab, orticumab, oterixizumab, oxelumab, ozanezumab, ozoralizumab, pagibaximab, palivizumab, panitumumab, panobacumab, parsatuzumab, pascolizumab, pateclizumab, patrizumab, pembrolizumab, pemtumomab, perakizumab, pertuzumab, pexerizumab, pidilizumab, pinatuzumab vedotin Vedotin, Pintumomab, Placulumab, Polatuzumab Vedotin, Ponezumab, Priliximab, Pritoxaximab, Pritumumab, PRO 140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ramucirumab, Ranibizumab, Laxibakumab, Regavirumab, Reslizumab, Rilotumumab, Rituximab, Robatumumab, Rolledumab, Romosozumab, Rontalizumab, Robelizumab, Ruplizumab, Samalizumab, Sarilumab, Satumomab pendetidependetide), secukinumab, seribantumab, setoxaximab, sevilumab, sibrotuzumab, sifalimumab, siltuzumab, simtuzumab, ciprizumab, silumab, solanezumab, solitomab, sonepcizumab, sontuzumab, stamulumab, sulesomab, suvizumab, tabarumab, tacutuzumab tetraxetan tetraxetan), tadocizumab, talizumab, tanezumab, taplitumomab paptox, tefibazumab, telimomab aritox), tenatumomab, teneliximab, teprizumab, teprotumumab, TGN1412, tisilimmab (=tremelimumab), tildrakizumab, tigatuzumab, TNX-650, tocilizumab (=atlizumab), toralizumab, tocitumomab, tralokinumab, trastuzumab, TRBS07, tregalizumab, tremelimumab tucotuzumab cermoloukin celmoleukin), tuvirumab, ublituximab, urerumab, urtoxazumab, ustekinumab, vapaliximab, batelizumab, vedolizumab, vertzuzumab, bepalimomab, besencumab, vizilizumab, borosiximab, borsetuzumab mafodotinThis may include mafodotin, botumumab, zaltumumab, zanolimmab, zatuximab, ziralimumab, or zolimomab aritox.

[0231] Preferred antibodies include natalizumab, vedolizumab, belimumab, atacicept, alefacept, otelixizumab, teprizumab, rituximab, ofatumumab, ocrelizumab, epratuzumab, alemtuzumab, abatacept, eculizumab, omalizumab, canakinumab, meplizumab, reslizumab, tocilizumab, ustekinumab, and briakinumab. Examples include mab, etanercept, inlfliximab, adalimumab, certolizumab pegol, golimumab, trastuzumab, gemtuzumab, ozogamicin, ibritumomab, tiuxetan, tostitumomab, cetuximab, bevacizumab, panitumumab, denosumab, ipilimumab, brentuximab, and vedotin.

[0232] Anti-PD1 antibodies such as nivolumab and pembrolizumab are also preferred.

[0233] Additional cancer therapies may be selected from the group consisting of actimide, azacitidine, azathioprine, bleomycin, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil, gemcitabine, hydroxyurea, idarubicin, irinotecan, lenalidomide, leucovorin, mechloretamine, melphalan, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, revlimid, temozolomide, teniposide, thioguanine, barrubicin, vinblastine, vincristine, vindesine, and vinorelbine.

[0234] The present invention also provides a method for diagnosing a disease or condition in a subject. The method comprises analyzing a sample taken from an individual for the presence of one or more camyoRNAs, camyo peptides, or camyotope sequences disclosed herein, the presence of such sequences, optionally at elevated levels compared to corresponding levels in samples taken from healthy subjects, indicates that the individual has colorectal cancer or an increased risk thereof. The sample may be any suitable sample, e.g., a tumor biopsy or other tissue or body fluid sample. The sequences may be detected in the sample by any suitable method, including the methods described herein. For example, the method may involve measuring an immune response induced against the sample.

[0235] The present invention is further illustrated by the following embodiments, which are not to be construed as limiting the scope of protection. The characteristics disclosed in the preceding description and in the subsequent embodiments may, both individually and in any combination thereof, be material for realizing the present invention in its various forms. [Table 3] [Table 4] JPEG2026533958000005.jpg210149JPEG2026533958000006.jpg217149JPEG2026533958000007.jpg187149 [Table 5] JPEG2026533958000009.jpg202149JPEG2026533958000010.jpg191149JPEG2026533958000011.jpg210149JPEG2026533958000012.jpg215149JPEG2026533958000013.jpg212149JPEG2026533958000014.jpg203149JPEG2026533958000015.jpg208149JPEG2026533958000016.jpg209149JPEG2026533958000017.jpg209149JPEG2026533958000018.jpg208149JPEG2026533958000019.jpg215149JPEG2026533958000020.jpg212149JPEG2026533958000021.jpg209149JPEG2026533958000022.jpg209149JPEG2026533958000023.jpg185149JPEG2026533958000024.jpg211149JPEG2026533958000025.jpg208149JPEG2026533958000026.jpg212149JPEG2026533958000027.jpg201149JPEG2026533958000028.jpg176149JPEG2026533958000029.jpg199149JPEG2026533958000030.jpg215149JPEG2026533958000031.jpg211149JPEG2026533958000032.jpg202149JPEG2026533958000033.jpg189149JPEG2026533958000034.jpg209149JPEG2026533958000035.jpg168149JPEG2026533958000036.jpg212149JPEG2026533958000037.jpg209149JPEG2026533958000038.jpg189149JPEG2026533958000039.jpg208149JPEG2026533958000040.jpg212149JPEG2026533958000041.jpg166149JPEG2026533958000042.jpg168149JPEG2026533958000043.jpg20814 9JPEG2026533958000044.jpg205149JPEG2026533958000045.jpg195149JPEG2026 533958000046.jpg215149JPEG2026533958000047.jpg175149JPEG2026533958000 048.jpg198149JPEG2026533958000049.jpg205149JPEG2026533958000050.jpg20 1149JPEG2026533958000051.jpg209149JPEG2026533958000052.jpg208149JPEG 2026533958000053.jpg214149JPEG2026533958000054.jpg208149JPEG202653395 8000055.jpg215149JPEG2026533958000056.jpg201149JPEG2026533958000057.j pg206149JPEG2026533958000058.jpg209149JPEG2026533958000059.jpg221149. [Examples]

[0236] Example 1 - Expression and Translation RNA sequence data were obtained from colorectal cancer tissue and healthy colorectal tissue. Analysis of the data identified 18 lncRNAs (camyoRNAs; defined by SEQ ID NOs: 1-18) that were expressed in colorectal cancer tissue but substantially absent in healthy colon tissue and any other healthy tissue. Table 3 shows that the average number of transcripts per million (TPM) for these 18 camyoRNAs (defined by SEQ ID NOs: 1-18) in healthy tissue was approximately zero, and significantly lower than the TPM observed in colorectal cancer tissue. Therefore, these 18 camyoRNAs are considered to be specifically expressed in colorectal cancer tissue compared to normal tissue.

[0237] Mass spectrometry was used to derive proteomics data from colorectal cancer tissue. Analysis of the data revealed that 79 polypeptides (camyo peptides; defined by sequence numbers 19–97) corresponding to open reading frames (ORFs) in 18 camyoRNAs, defined by sequence numbers 1–18, were translated. Table 4 shows that camyo peptides within sequence numbers 19–97 were detected in approximately 81% of the examined cohort of colorectal cancer tissue samples, and all 79 camyo peptides were detected as translated in at least 1% of the examined colorectal cancer tissue samples.

[0238] Example 2 - Presentation and immunogenicity Next, the presentability and immunogenicity of epitopes produced by camyo peptides defined by Sequence IDs 19-97 are evaluated using methods incorporating the neoMS and neoIM algorithms disclosed in International Publication No. 2022 / 013154 and International Publication No. 2022 / 079255, respectively (both of which are incorporated by reference).

[0239] neoMS is an MHC-I presentation prediction algorithm that utilizes mass spectrometry-derived MHC ligand mix data to effectively isolate antigens presented from potentially very large populations. The neoMS model is a transformer-based peptide sequence versus HLA sequence neural network algorithm trained on 386,647 epitopes detected in lingadomes from 92 HLA single-allele datasets and 66 patient-derived HLA-multiple-allele datasets. It utilizes a cautionary mechanism that isolates the most relevant portions of both the putative epitope and the HLA allele. Further details are provided in International Publication No. 2022 / 013154.

[0240] neoIM is a random forest classifier specifically trained to classify short peptides of 9–11 amino acids as immunogenic or non-immunogenic. The algorithm was trained using a positive dataset of non-autoimmunogenic peptide sequences and a negative dataset consisting of MHC-I display peptides derived from housekeeping genes. Peptide properties were constructed by performing principal component analysis of the physicochemical properties of amino acids and by matching the values ​​of three major components for each amino acid in the peptide. Further details are provided in International Publication No. 2022 / 079255.

[0241] This presentation and immunogenicity prediction is carried out considering a set of alleles common in people in Europe and the United States (A*02:10, A*01:01, A*03:01, A*24:02, A*11:01, B*07:02, B*08:01, B*44:02, B*35:01, B*51:01, B*44:03, C*07:01, C*07:02, C*05:01, C*04:01, C*06:02, C*03:04). This set of HLA alleles covers 99% of the populations in Europe and the United States, and it is predicted that 99% of the populations in Europe and the United States will express at least one of these HLA alleles. This epitope screening yielded a total of 514 presented and immunogenic camyotopes, thereby indicating a set of useful immunotherapeutic targets.

[0242] In conclusion, we obtained a series of 79 camyo peptides that demonstrated evidence of tumor-specific expression and translation, as well as absence in normal tissues. From these camyo peptides, we computer-calculated 514 camyo topopes (see Table 5; defined by SEQ ID NOs. 98-611) that are presented in significant proportions of the European and US populations and are predicted to be immunogenic.

[0243] Example 3 - Lead Selection and Optimization The parameters of camyoRNAs, camyo peptides, and camyotopes can be evaluated to determine the optimal combination of camyotopes to achieve broad population coverage with a range of targetable organisms. This camyotope selection largely depends on the number of epitopes that can be incorporated into the final vaccine formulation.

[0244] Figure 1 illustrates camyotope selection for 20 camyotopes that could be used for small peptide vaccine formulations targeting large populations in Europe and the United States. It is interesting to select combinations of camyotopes derived from various camyoRNAs expressed at high percentages in cancer samples to increase the chances of inducing an immune response against at least one of the camyotopes. Therefore, we select 10 CRC-specific camyoRNAs with the highest population coverage (in terms of expression level) to ensure that 99% of the population expresses at least one of the camyoRNAs defined by SEQ ID NOs: 1–18 (Figure 1). Furthermore, 50% of the population expresses 5 of the 10 camyoRNAs defined by SEQ ID NOs: 1–18.

[0245] For each camyoRNA, we select two non-overlapping, actionable camyotopes with the highest immunogenicity score (neoIM). This results in a table of 20 camyotopes (further details can be found in Table 6). However, it should be noted that this is an illustrative selection of camyotopes. Any other strategy can also be used to select a set of camyotopes to be used for the final product. [Table 6]

[0246] Example 4 - Product Depending on the characteristics of the final product, a camyotope, a large window around the camyotope, or a camyo peptide is selected for the final product. These selection strategies can be fine-tuned based on the requirements for the final product, as illustrated below: A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, provided in the vaccine formulation as individual small peptides A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, arranged in sequence on one long peptide A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are arranged in sequence in a single mRNA molecule A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are provided in the vaccine formulation as individual mRNA molecules A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are arranged in sequence in a single DNA molecule A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are provided in the vaccine formulation as individual DNA molecules A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are integrated into the genome (RNA or DNA) of a viral vector A series of several camyotopes (8~11mers), ideally 2 to 20 thereof, whose encoding nucleotide sequences are individually integrated into the genomes (RNA or DNA) of several viral vectors A series of several camyo peptides (8~100 amino acids), ideally 2 to 20 thereof, provided in the vaccine formulation as individual peptides A series of several camyo peptides (8~100 amino acids), ideally 2 to 20 thereof, whose encoding nucleotide sequences are arranged in sequence in a single mRNA molecule A series of several camyo peptides (8~100 amino acids), ideally 2 to 20 thereof, whose encoding nucleotide sequences are provided in the vaccine formulation as individual mRNA molecules A series of several camyo peptides (8-100 amino acids), ideally 2-20 of them, in which the coding nucleotide sequence is arranged sequentially within a single DNA molecule. The coding nucleotide sequence is provided in the vaccine formulation as individual DNA molecules, along with a series of several camyo peptides (8-100 amino acids), ideally 2-20 of them. A series of several camyo peptides (8-100 amino acids), ideally 2-20 of which have coding nucleotide sequences incorporated into the genome (RNA or DNA) of the viral vector. A series of several camyo peptides (8-100 amino acids), ideally 2-20 of them, whose coding nucleotide sequences are individually incorporated into the genome (RNA or DNA) of several viral vectors. Syngeneic (patient-derived) DC cells mature ex vivo through incubation with a series of several camyo topes (8-11mers), ideally 2-20 of them, and are then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by transfection using mRNA containing a series of sequentially arranged camyo topes (8-11mers), ideally 2-20 of which have their coding sequences, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by transfection using a series of several camyo topopes (8-11mers), ideally containing 2-20 single coding sequences of those mRNAs, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by transfection using mRNA containing a series of camyo peptides (8-100 amino acids) arranged in a specific order, ideally 2-20 of which have their coding sequences, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by transfection using a series of several camyo peptides (8-100 amino acids), ideally containing 2-20 single coding sequences from each of these peptides, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by infection with a viral vector containing a series of sequentially arranged camyo topes (8-11mers), ideally 2-20 of their coding sequences, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by infection with several viral vectors containing a series of several camyo topes (8-11mers), ideally each containing 2-20 of their single coding sequences, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by infection using a viral vector containing a series of camyo peptides (8-100 amino acids) arranged in a specific order, ideally 2-20 of which have their coding sequences, and then reintroduced into the patient. Syngeneic (patient-derived) DC cells are matured ex vivo by infection with several viral vectors containing a series of several camyo peptides (8-100 amino acids), ideally each containing 2-20 of their single coding sequences, and then reintroduced into the patient. T cells possessing receptors produced for one or more (ideally 20 or fewer) camyotopes (8-11mers). T cells possessing receptors produced for one or more (ideally 20 or fewer) camyo peptides (8-100 amino acids). CAR T cells possessing receptors produced for one or more (ideally 20 or fewer) camyotopes (8-11mers). CAR-T cells possessing receptors produced for one or more (ideally 20 or fewer) camyo peptides (8-100 amino acids). Antibodies produced against one or more (ideally 20 or fewer) camyotopes (8-11mers) Antibodies produced against one or more (ideally 20 or fewer) camyotopes (8-11mers) Any of the previously described vaccine formulations in combination with other tumor antigens as a combination vaccine Any of the previously described vaccine formulations for any type of administration route (IV, IM, IT) Any of the previously described vaccine formulations in any combination of other therapies.

[0247] Example 5 By all metrics, the top camyo peptides identified in the discovery achieve significant coverage in the target population. Camyo peptides achieve RNA-based coverage of 97.5%–7.5% on average at 52% (evaluated as the proportion of CRC patients expressing camyoRNA >1 TPM). Notably, using the proportion of CRC patients expressing camyoRNA at levels higher than the maximum expression detected in any healthy colon sample, instead of RNA-based coverage, reports similar coverage for camyoRNA.

[0248] Results from the advanced technology workflow used to identify camyo peptides, proteomics analysis of CRC patients, provided evidence of translation for all camyo peptides in the studied cohort. Various camyo peptides were identified as translated in 81.05% to 1.05% of CRC patients, with an average of 18.7% (assessed as the proportion of patients with two or more spectra that could uniquely contribute to a camyo peptide).

[0249] Furthermore, all camyo peptides showed little to no expression or translation in any normal tissue.

[0250] Notably, the mass spectrometry approach is unsuitable for assessing camyo peptide coverage. Camyo peptides are small compared to other proteins and therefore lack the high frequency of trypsin cleavage sites that would allow for accurate MS-based distribution rate estimation (a fact comprised of a different distribution of trypsin cleavage sites in camyoRNA compared to coding genes). Consequently, the MS approach consistently underestimates camyo peptide distribution rate. As a result, we used expression-based coverage metrics to investigate the usability of camyo-tope-based approaches, while using MS-based identification of camyo-topes to confirm the translational and presentation potential of the peptides.

[0251] Using expression-based metrics, all 239 patients in the analyzed CRC cohort expressed at least one camyoRNA, and over 60% expressed six or more (Figure 9). This makes camyoRNA-derived epitopes highly attractive as ready-made solutions, because any given patient in the target population is susceptible to most vaccine formulations, thereby stimulating multiple targeted antitumor immune responses and limiting the risk of immune evasion and the possibility that some of the epitopes may not be effectively introduced into the patient.

[0252] In fact, the coverage achieved by camyo peptide-based approaches is significantly broader than that of other antigen-based, off-the-shelf approaches that can be used in CRCs. Shared nascent antigens or TAAs yield the highest coverage per epitope, representing only 12.5% ​​of the population (22% each), which is less than any of the top 10 camyoRNAs targeted.

[0253] It is important to note that camyoRNA expression is stage-agnostic. In fact, when CRC cohorts are divided across various cancer stages, the camyoRNA distribution remains relatively similar regardless of stage (Figure 2), indicating that camyotope-based therapies can be used both in the early (post-surgery) and metastatic stages to prevent recurrence.

[0254] In summary, these results strongly demonstrate the potential of camyotopes as therapeutic targets, particularly compared to other therapeutic antigen targets such as classical TAAs and neogeneic antigens: superior population coverage, a large number of actionable epitopes per patient on average minimizing avoidance risk, and high immunogenicity.

[0255] Differential expression analysis of camyoRNA in CRC tissue versus healthy tissue The initial stages of the camyoRNA pipeline involved performing differential expression analysis to identify camyoRNA expression levels in colorectal cancer (CRC) tumor samples compared to those in healthy colon samples. This rigorous analysis compared 240 CRC tumor RNA-seq samples against 200 healthy colon tissue samples, specifically 100 sigmoid and 100 transverse colon samples. The objective was to isolate camyoRNAs that were significantly upregulated in CRC tumor samples, using strict criteria to ensure the identification of tumor-specific expression.

[0256] Differential expression analysis of camyoRNA targets demonstrates significant upregulation in tumor CRC samples compared to healthy colon samples. Table X (below) shows the log2 multiplier changes and corrected p-values ​​derived from differential expression analysis, comparing tumor samples with healthy sigmoid and transverse colon (two anatomically distinct parts of the colon) tissue. In addition, Figure 3 visually illustrates the expression patterns in tumor CRC samples and healthy colon tissue, highlighting the different expression profiles. [Table 7]

[0257] Collectively, the present inventors emphasize the tumor-specific expression of camyoRNA and conclude that camyoRNA is significantly upregulated when compared to a cohort of healthy sigmoid and transverse colon tissue samples.

[0258] CamyoRNA expression in healthy tissue To further ensure the exclusivity of camyoRNA expression in healthy tissues, a rigorous screening process using a sufficient transcriptomics database encompassing diverse healthy tissue samples was utilized. This expression analysis was performed on 100 RNAseq samples from 53 non-diseased tissue sites. The aim was to verify that camyoRNA is not expressed in other healthy tissues, thereby reducing the risk of unintended immune responses. Furthermore, in efforts to mitigate potential immune adverse events, the expression level of camyoRNA was compared with a series of established tumor-associated antigens (TAA), namely MAGE-A3, NY-ESO-1, GP100, TYR, TPTE and ACP3, whose safety profiles have already been confirmed. This comparative analysis aimed to confirm the unique expression pattern of camyotopes and to evaluate their safety profiles in the context of well-known TAAs that have already been investigated for safety concerns (Table Y). [Table 8]

[0259] The expression of the selected set of camyoRNA remains low or absent in the completely normal tissue cohort. Furthermore, the selected set of camyoRNA exhibits similar tumor-specific expression compared to the set of well-known TAAs that show tumor-specific expression. Thus, based on the observation that camyoRNA and TAAs have similar expression profiles in healthy tissues, it can be hypothesized that camyoRNA may induce similar toxicity profiles.

[0260] Translation of camyo peptides in healthy tissues Next, the translation levels of camyo peptides were evaluated using a comprehensive proteomics dataset containing a wide array of healthy tissue samples (29 tissue types). This evaluation aimed to determine the translation levels of camyo tops and to compare them with a well-established set of known TAAs to assess their safety.

[0261] Translation was not observed for 11 of the 31 camyo peptides tested across all 29 tissue types. Limited translation was observed for other camyo peptides. Furthermore, these translation levels were lower than those of a range of well-known TAAs (Figure 4).

[0262] Presentation in healthy donors Preferred vaccine compositions of the present invention (SEQ ID NOs: 98, 102, 106, 110, 115, 135, 139, 141, 144, 148, 153, 165, 166, 167, 168, 169, 173, 174, 176, 179, 183, 184, 191, 193, 197, 200, 201, 209, 212, 215, 218, 222, 229, 216, 101, 103, During preclinical validation of polynucleotides encoding polypeptide sequences defined by 113, 122, 151, 152, 156, 172, 186, 189, 195, 204, 205, 208, 220, and 227, the translation, correct processing, and presentation of camyo tops were confirmed using a MAPPS assay (MHC-related peptide proteomics).

[0263] For the study, PBMCs from two healthy donors were isolated, differentiated into immature dendritic cells, and then transfected via electroporation. Various conditions, including the preferred vaccine composition of the present invention, MART-1 mRNA as a positive control, and a negative control (mock, vector-free), were tested. Since the negative control lacked any camyo-tope targets derived from the preferred vaccine composition of the present invention, the MAPPS assay should not detect any camyo-tope-derived peptides. This confirms the absence of camyo-tope peptides in a healthy proteome and ensures the safety of the vaccine in relation to immune-related adverse effects.

[0264] After maturation, cells were collected and lysed, and the MHC-I complex was purified using affinity chromatography with a bound immunopeptide. The presented peptide was then eluted, analyzed, and identified by liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS).

[0265] The MAPPS assay (Figure 5) demonstrated the presentation of the peptide derived from the present invention in the preferred vaccine composition in healthy donor PBMCs treated with the CAMYO-01 construct. In contrast, the MS spectrum corresponding to the preferred vaccine composition of the present invention was not detected in any donor-derived mock samples. This evidence highlights the absence of the camyo-tope peptide in healthy PBMCs and thereby supports the safety profile of the preferred vaccine composition of the present invention.

[0266] Homology of camyo peptides to the human proteome In addition to the expression and translation of camyoRNA and camyo peptides in healthy tissues, we also investigated whether the selected camyotopes have very similar counterparts in the human proteome, given that administration of the preferred vaccine composition of the present invention may result in off-target toxicity and potentially dangerous reactions.

[0267] In this regard, protein BLAST alignment was performed against the human classical reference proteome containing camyo tops, a series of positive control peptides derived from housekeeping genes, and well-known TAAs. It was observed that no camyo tops had a direct or near-direct match to the human proteome. This is in stark contrast to the TAAs and housekeeping genes, which are present in the coding genome and annotated as functional proteins in the human reference proteome. Thus, they show even higher homology to the human proteome in the analysis (Figure 6). Similar results were observed when protein BLAST alignment was performed against canine, macaque, mouse, rat, and porcine reference proteomes.

[0268] Since camyo topes are not similar to any proteins (or fragments thereof) in the human reference proteome, it is assumed that including them in vaccine formulations is unlikely to cause undesirable off-target effects. Epitope efficacy To evaluate the immunogenicity of 73 selected camyo topes, an in-vitro ELISpot (DC-T cell) assay was performed using five healthy donors. Three cytokines (IFN-γ, IL-2, and GranB) were screened to assess the abundance of pluripotent T cells.

[0269] For the ELISpot experiment, 73 camyo topopes were divided into 30 pools, each containing an epitope derived from the same camyo peptide. This allowed for the evaluation of immunogenicity at the camyo peptide level rather than at the individual camyo topope level. In addition to the camyo topope pools, three pools containing immunogenic epitopes derived from classical TAAs (MAGE-A3, GP100, PRAME) were included as positive controls.

[0270] After both the first and second stimulation cycles, positive responses for all three cytokines were observed for the majority of the camyo peptide pool (Figure 7). Based on the number of significant responses in both restimulation cycles compared to well-known TAAs (left x-axis), a preferred set of camyo peptides was selected. Overall, the results represent exceptionally high immunogenic responses for the majority of the camyo peptide pool (Figure 7), making the immunological responses to well-known TAAs almost inconspicuous in both magnitude and frequency. Given that only 5–10% of the peptide pool is predicted to be positive in a randomized sample, this experiment demonstrates the superior ability of the myNEO Tx procedure in identifying and selecting the most immunogenic epitopes for further clinical development. Furthermore, the camyo-tope immune responses are consistently high and directed towards more targets compared to exposure to well-known TAAs (PRAME, GP100, MAGE-A3). Similar responses can be observed using other immune-related readout information, e.g., IFN-γ and IL-2.

[0271] In addition, a strong antitumor immune response was equally induced by camyo topologies in both donors with highly active immune systems (responding to varying degrees with most of the peptide pool tested, e.g., IMXP01150) and individuals with a narrower T cell repertoire (not responding to TAA, e.g., IMXP01143), demonstrating that camyo topologies induce strong antitumor activity in both active and exhausted immune systems (Figure 8).

[0272] From this ELISpot experiment, we can conclude that most camyo peptide pools showed a strong immunogenic response, far superior to well-known TAAs. Both the fact that numerous camyo peptide pools produced immunogenic responses and that camyo tops were able to induce immunogenic responses even in less active immune systems suggest a multi-target approach that combines multiple camyo top targets and thus improves vaccine efficacy in both exhausted and active immune systems.

[0273] camyoRNA sequence >LINC02418:9 (Sequence ID 8) >lnc-TACR3-1:1 (SEQ ID NO: 13) CAGCCCGCCTGCACCCAGGTGAAATAGACAGCCATGTTGCTCACACAAAGCCTGTTTGCTGGTCTCTTCACACTGACTCGAGTGAAATTTGGTGCCGTGACTAGGATCGGGGGACCTCCCTTGGGAGATCAATCCCCCGTCCTCCTACACTTTGCTCTGTGAGAAAGATCCACCTACAACCTCAGGTCCTCAGACCAACCAGCCCAAGAAACATCTCACCAATTTCAAATCCGTGATAGATCACAACAAGAGATCATGAAGAGGGCATGGCCGCCATGTCATTCTGGAGAGAGACAGAGTAAAACAAAGAAGACAGAGTCTTGTTCTGCAACCCAGGCTGGAGTGGAGGGCAGTGGTGTGATCTCGGCTCACTTCAACCTCCGCCTCTTAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGCAGCCTCTCTACAAGTCTCCTAACTTAACCTGATGGGAAAACACTTCCTACCACTAACAGCATCTACTTGATTACTGATACTTTGATCATGGAGTTTGGGCATGCCACTTGATAGAAATTTGAAGAGCAATTATATTTTTCAAAAAGAGTTTTGAATAATGTTAAGATAGATTGCAACATGACTATCAATTCTTCCCTTCCCATCAAAGGAGAGAGTCCGTTTATCCAGCCTTTGAATCTTGATTATTCATGTGACTTGCTTCACCCAATGTAACATTAATAAGCACAATACAAGCAGAGGCTTGCCAAGAACTTGGTTTGTTTCTAATGCTTAGAAGAAGAATGGTGTATGCCATATTTCTGCATTTAGAACTCACGTGGAGACATGTGT >lnc-SLC39A10-2:1 (SEQ ID NO: 3) CCACCATGTGAAGAAGGTCCTTGCTTCCTCTTCATCATCTATCATGATTGCAAGTTTAGGCCTCCTCAGCCACGTGCAACTTTTATTTCACCCTGAAGCCAAAGAGAACTTTCTGAAAGACAAATTTGCTCATGCTATAATAGTTACTGACAAATATTTAAAGGACTAAGTTGTGTAAGGAATCTACACTGTCAGGCAGAACCAGGATTCCTGGAAGTAGAACTGGGCTGCTTCATAAGTCTGACTTCATATGACAGCTAGATTCAAAAGGATGAAATCAGTAGAGGTGAGACCTCTTGATGCCTTGGCTTGGAAGTCACATATTCTATTGGCCAAAGCAAATCACAAGGCCACCACAAATTCAAGGAGATGAAGAAATAGACTCTACCTCTCTTGATTGGCTTATAATATGGTCAGTTCTTCAGAGGAAGAGGAAAATTTCATCTGGCCTCAAATCTCAGTGATCGCATTTGTGGGAACATAATGTCTGAAGTAAAGACTAAGTAGAAGTCTGACAAGCAAAAAAAGAAAAAAAGACAAAGACACTCCAAGCAAGAGAAACAACCTGAGCAGAAGCACCCAGGTATGACAGAAAACGTAGAGAGGAAAGGCTTCCAAAAGCAACAGAGATTCACAGGAAGCTCCACAGAAAAACGGGTGGTGCAAAAAATTAGGCAAGAGGGAAAATGGGGTTAGGCCATGTACCAACATGTTCATCATTATACAGTGATTGGACTTGGAAAGGCAGAAGAGAAGCAAGAGCCAGCATCCTCATCTTATAAACAGAAAAGCTGTCTGGGCGTGGTGGCTCATGCCTGTAATCCTAGCACTTTGGGAGGCCAAAGCGGGCGGATCACGAGATCAGGAGATCGAGACCATCCTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAATACAAAAAATATTAGCCGGGCATAGTGGCGGGCGCCCGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAA >lnc-CHM-1:1 (SEQ ID NO: 18) GCCATCTTTAGCCGAACTAAGGAAAAGTCCTGCAACATTTTTAGCGCCCAACGTGGAGGTCGAGAAACGGCCGTCAAACTCCAAATGGTGATGCAACTGGAACCTCTGATGATGGCCCCTTCTGCCGGGAACCCTTAAATAGGCCTCTGATGGAGCCCTGACTGCCATTTCCCCCAAACAGCACCACCTATCAGCAGGAATCAGTTAAGATCAGTCCTCGT >LINC02563:3 (SEQ ID NO: 9) AACCAGGATAAGTTGATCACCCTCCCTGAGAGTTTGGGATTCTATGAGGACTCCTGTCTAGAGTGCAGCGCCACTGCGAGGGTGGTCCTTTATTGTCAGAAACCTCATTCCCAGAAGGAGACATGCAGTGGAAACTGAGCGTCCTCTGCCCTGCGGTGCCCAGCTCCATTCAAGAAAGCACACCTGTGGATGAGAGGCGCAATTAACGTTATCAGTCGTGAAGGATCAGAAGGAAAACCCAGTGGCCGTTGGGAATTTAGAGATGGTGTTTCGCCAT >lnc-CTR9-1:2 (SEQ ID NO: 16) GAGTGTTTTCCAGGACATGCTAGTTCCAAAAGATACTCCTTAAAAAAGAGTTCGATAGTCAAAACGTTGCTTCCAGAAGAAGACTGTCTCATTACTGTTACATCTCTGGCCCTGGAGTAGCCCCTGGCAAATATGTACTCAGTACATGTTTGCGAGACGCATGGACTTGTAGAACAGTTCCACAGCTGTCCATCACTGATGTTCCATACCTAGCGATGCGGCCCCTCGAAACGCACTGGAGAGCTGGGCAGACCAAGGATAATTTCACAGACTTTAGGAGACTTGCCCTCATATCTCATAATCTTCGCTCACAGGACGCTGGACATTCAAAGAAAGAAAAAGAAGTATAGAAAAGAGAGAAAAACGTCAAGAACTCCAGCATAAAGTCCTCTTAATAACGCGTCTTTTTATAATCATCGGGCAATAAATTTCTGAATGGAC >lnc-HOXB8-1:5 (SEQ ID NO: 2) >lnc-TH-1:1 (Sequence ID 4) >lnc-OR52J3-1:1 (SEQ ID NO: 10) AGAGGTAGGAAGGCTAAACTGAGGAATTATGTCTGACAGAAGGGAAGAAGAAGGTAATGTGGAGTGGGTAGCCTCCATACTGATTAAGAAGGGTACAGACTTACCCTCCACTGTGAGAATTACCTAAAGCTCGGTGTCTGTGATGGTCTACAGGGCTTCCGAGGCGATCAGGCAGTGGCAGTCTTCAGCTGCAAAGCCGAGAAGATCTGGGAAGGAGTCAGTCAGGGAGCCTTGGGCCAGAGTTCCAGGGGCTCTAGGAGTGGCTGCCAGGTGAGTTGAACAGTCCGATTTCTAGTGGGGTCCTGCACAGATGGGACACGGCTTAGGAGGAATCCTGGGCTGCGGGCATTCCTTGGCCTGGTGGCCAGATTTCTGGCACTTGTAGCAAGCTCCTGGGGGAGGTGGTTCCGGAGGAACGCCTGGCCACTGCGGTTTAGGCATTTGGAAGTTCTTGTGTGCTGGAGATGTGGCTGGGGTTTGTCTCACAGTGGAGGCAAGGAATTGCAACTCAAAAATATGTTG >lnc-FANCM-10:1 (SEQ ID NO: 11) GCAGCAGCTGCTGCACAGAGACATGATGGCTAGGCTAAAAACAGTAAGGTCAAGTTGTTTGGACAGAAAGGCTACAGGGTGCAGTCCTGGCTCTTGTGTAAGAATTCTGACTGCACTAACCATGCCTAGGAAGGGAAGGAGTTGTTGTTTTATAAGGGATTGAGGTTTGGGAGATTGATCGGACACGATCAGCAGGGAAAGCATGTGTGTTTGTATGAGAATTATGCCGAGATAGGTTTTAGAAGCCCATGCTGTAGCAGGCAAGTGATAACAGGCTTTAATCCTTTAAAGCGTGCTGTGGGATGGGATATTGGCGTTGAGCAGGGTAAGGGTGATTAGGTTTTAATCGGATGGTAATGGGCATGTGATCGGTTGCCAGGGAAGTAGAGATGTCCCAT >lnc-LRRTM4-3:3 (SEQ ID NO: 7) >lnc-SLC39A10-7:1 (Sequence ID 5) >lnc-HSF5-2:1 (Sequence ID 12) AACTT >lnc-CAMK1D-2:1 (Sequence ID 14) >CYP1B1-AS1:12 (SEQ ID NO: 6) GAGAATTATGCTGAGATAGGTAACAGATGAGGATGAAATTTGGGCTTGACTGAAGTAATGGGGGCTGTCTGTGAAGCCTTGCGGCAGTACAGCCCAGGGGGCTTCCAAGGCAGTCGGGCAGCATCAGTCTTCAGCCGCTAAGCCAAGAAGATCTGGGAAGCAGTCAGAGAGCCTTGGGCCAGAGTTCCAGGGGCTCTGGGAGTGGCTGCCAGTGGTCTCAAATAGTCAAGACCCCCTGCTGGGAGGAGCTTCTATCCTGCTCTGTGGAA >lnc-TRPC5-3:1 (SEQ ID NO: 1) >LINC01715:13 (Sequence ID 17) >lnc-PLA2G1B-2:3 (Sequence ID 15)

Claims

1. A polypeptide encoded by an open reading frame in a long non-coding RNA gene (lncRNA), wherein the lncRNA is overexpressed in colorectal cancer cells compared to healthy cells, and preferably the lncRNA is defined by any one of sequence numbers 1 to 18.

2. A polypeptide comprising a 6-amino acid sequence, a 7-amino acid sequence, or preferably an 8-amino acid sequence, or a variant thereof, contained in any one of the polypeptide sequences defined by Sequence IDs 19 to 97.

3. The polypeptide according to claim 2, wherein the variant has at least 70%, at least 80%, or at least 90% sequence identity with an 8-amino acid sequence contained in any one of the polypeptide sequences defined by SEQ ID NOs: 19 to 97.

4. The polypeptide according to any one of the claims, comprising one polypeptide sequence defined by sequence numbers 98 to 611.

5. A polypeptide according to any one of the claims, comprising a sequence of about 6 to 32 amino acids, preferably about 7 to 30 amino acids, most preferably about 8 to 11 or about 12 to 28 amino acids.

6. A polynucleotide that encodes one or more polypeptides according to any one of the preceding claims, and is a DNA or mRNA molecule.

7. A vector comprising the polynucleotide described in claim 6.

8. (i) T cells expressing a receptor specific to a polypeptide as defined in any one of claims 1 to 5, and / or a polypeptide encoded by a polynucleotide as described in claim 6, and / or a polypeptide encoded by a vector as described in claim 7, wherein the T cells are optionally engineered to express the receptor (e.g., CAR-T), or are T cells produced in response to the polypeptide; or (ii) Dendritic cells (DCs) matured ex vivo using a plurality of polypeptides defined in any one of claims 1 to 5, wherein optionally, a. The plurality of polypeptides comprises 2 to 20 different polypeptides; and / or b. The one or more polypeptides are 8 to 11 mer; and / or c. Each of the polypeptides is defined by 2 to 20 of the sequence numbers 98 to 611, Preferably, the maturation process is i. Transfection using multiple mRNA molecules, each mRNA molecule possessing a coding sequence of one of the plurality of polypeptides; or ii. Infection using multiple viral vectors, each viral vector molecule possessing one coding sequence from the multiple polypeptides. dendritic cells (DCs) are formed by and / or (iii) The polynucleotide described in claim 6 and / or the vector described in claim 7 cell.

9. A composition comprising a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6, a vector according to claim 7, or a cell and pharmaceutically acceptable carrier according to claim 8.

10. comprising a plurality of polypeptides according to any one of claims 1 to 5, optionally, i. The plurality of polypeptides comprises 2 to 20 different polypeptides; and / or ii. The one or more polypeptides are 8 to 11 mer; and / or iii. Each polypeptide is defined by 2 to 20 of sequence numbers 98 to 611. The composition according to claim 9.

11. The polynucleotide is described in claim 6, wherein the polynucleotide is mRNA, and optionally, i. The mRNA encodes a plurality of polypeptides according to any one of claims 1 to 5, preferably the mRNA molecule encodes 2 to 20 different polypeptides; and / or ii. The one or more polypeptides are 8 to 11 mer; and / or iii. Each polypeptide is defined by any 2 to 20 of sequence numbers 98 to 611; and / or iv. The mRNA molecule encodes in frame a plurality of polypeptides according to any one of claims 1 to 5 to form a continuous polypeptide. The composition according to claim 9.

12. Includes the vector described in claim 7, optionally, i. The vector is a viral vector; and / or ii. The vector encodes a plurality of polypeptides according to any one of claims 1 to 5, preferably the vector encodes 2 to 20 different polypeptides; and / or iii. The one or more polypeptides are 8 to 11 mer; and / or iv. Each polypeptide is defined by any 2 to 20 of sequence numbers 98 to 611; and / or v. The vector molecule encodes in frame a plurality of polypeptides according to any one of claims 1 to 5 to form a continuous polypeptide. The composition according to claim 9.

13. A method for treating or preventing colorectal cancer in an individual, comprising the step of administering to the individual a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6, a vector according to claim 7, or a cell according to claim 8, or a composition according to any one of claims 9 to 12.

14. A method for inducing an immune response against colorectal cancer in an individual, comprising the step of administering to the individual a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6, a vector according to claim 7, or a cell according to claim 8, or a composition according to any one of claims 9 to 12.

15. A method for diagnosing colorectal cancer in an individual, comprising the step of analyzing a sample taken from the individual for the presence of at least one lncRNA from sequence numbers 1 to 18; one polypeptide from sequence numbers 19 to 97; or one polypeptide from sequence numbers 98 to 611.

Images