Lipid nanoparticles for delivering therapeutic payloads to cells

Abstract

This disclosure provides ionizable lipids for constructing lipid nanoparticles. The disclosure further provides conjugates comprising a target-directed moiety and lipid nanoparticles (LNPs) for encapsulating a therapeutic agent (e.g., a payload) for delivery to immune cells, hematopoietic stem cells (HSCs), or liver cells. The conjugates can be delivered to cells ex vivo or formulated in a pharmaceutical composition and administered directly to a target requiring it (e.g., via in vivo administration).

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefits and priority of U.S. Provisional Application No. 63 / 582,457 filed on 13 September 2023, U.S. Provisional Application No. 63 / 592,195 filed on 22 October 2023, and U.S. Provisional Application No. 63 / 677,892 filed on 31 July 2024, the contents of each of these, are incorporated herein by reference in their entirety.

[0002] Reference to electronic sequence listings The contents of the electronic sequence listing (252052001440seqlist.xml, size: 167,341 bytes, and creation date: September 13, 2024) are incorporated herein by reference in their entirety. [Background technology]

[0003] The development of lipid nanoparticles (LNPs) has recently made significant progress toward the intracellular delivery of payloads such as nucleic acids (e.g., mRNA or siRNA). LNPs generally consist of multiple components, including ionizable lipids, PEGylated lipids, helper lipids, and cholesterol, all of which play a crucial role in the effective delivery of the payload to diseased tissue.

[0004] Despite advances in LNP development, significant challenges remain. Specifically, delivering a sufficient payload to target cells has been difficult. Developing LNPs capable of delivering larger payloads and / or multiple payloads, particularly those used in gene editing, is a key objective.

[0005] In addition, in vivo delivery of therapeutic payloads to cells such as hematopoietic stem cells (HSCs) and immune cells such as T cells is currently being studied, but may be challenging. For example, the specific delivery of genetic medicine payloads, such as gene therapies or gene editor drugs, to rare long-term HSC (LT-HSC) populations or T cells is difficult because any systemically delivered therapeutic agent must circumvent or overcome the numerous mechanisms (e.g., hepatic uptake, phagocytic cell uptake, complement activation, opsonization, phagocytic cell uptake, etc.) that hinder its delivery to the relevant microenvironment. Furthermore, after delivery to target cells, the payload(s) must be able to dissociate from endosomes so that they can be expressed in sufficient quantities in the targeted cells.

[0006] Furthermore, LNPs often exhibit undesirable toxicological profiles that hinder their use as therapeutic delivery vehicles. LNPs can accumulate and deliver payloads to cells other than the intended target, resulting in potential toxicity. The undesirable safety profile is often attributed to the ionizable lipids used in LNPs.

[0007] Therefore, there is a need to develop LNPs containing ionizable lipids that have a favorable safety profile and can be used to promote cell type specificity, high transfection efficiency, and advanced endosomal escape. [Overview of the project]

[0008] This disclosure provides lipid nanoparticles (LNPs) or conjugates comprising lipid nanoparticles (LNPs) that encapsulate a payload, such as a therapeutic agent (e.g., a gene modification system) or a reporter construct, for delivery to cells. In some embodiments, the cells are liver cells. In some embodiments, the cells are T cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or hematopoietic progenitor cells (HPCs). In some embodiments, the cells are long-term hematopoietic stem cells (LT-HSCs). In some cases, the LNPs and conjugates described herein can deliver the payload to cells (e.g., T cells, HSCs, or liver cells) more effectively than baseline conjugates or baseline LNPs. In some embodiments, this disclosure also provides conjugates comprising lipid nanoparticles (LNPs) that encapsulate a payload, such as a therapeutic agent (e.g., a gene modification system) or a reporter construct, for delivery to cells (e.g., T cells, HSCs, or liver cells) having a target-directing portion on its surface. A conjugate having at least one target-directed portion described herein is also referred to as a targeted LNP or tLNP.

[0009] In one embodiment, the present disclosure relates to a compound of formula (I), [ka] The formula provides an ionizable lipid which is either a pharmaceutically acceptable salt thereof, X is -O- or -CH2-, m is 0, 1, 2, or 3. R 1 C 1-4 It is alkyl, R 2 C 1-4 It is alkyl, n is 1, 2, 3, or 4. R 3 C 4-10 It is alkyl, R 4 C 4-10 It is alkyl, p is 2, 3, 4, 5, or 6, R 5 is C 4-10 alkyl, R 6 is C 4-10 alkyl.

[0010] In another aspect, the present disclosure provides an ionizable lipid having a structure shown in Table 1, as disclosed herein.

[0011] In some embodiments, the ionizable lipid has one of the structures shown below.

Chemical Formula

[0012] In some embodiments, the ionizable lipid has one of the structures shown below.

Chemical Formula

[0013] In some embodiments, the ionizable lipid has the structure shown below.

Chemical Formula

[0014] In another embodiment, the Disclosure provides lipid nanoparticles (LNPs) for delivering therapeutic agents encapsulated in LNPs (e.g., to T cells, HSCs, or hepatocytes), wherein the LNPs comprise ionizable lipids and helper lipids, the ionizable lipids being compounds of formula (I). In some embodiments, the ionizable lipids are selected from lipids 154, 155, 209, 232, 262, and 263. In some embodiments, the ionizable lipids are selected from lipids 154, 155, 232, 262, and 263. In some embodiments, the ionizable lipids are selected from lipids 154, 155, and 232. In some embodiments, the ionizable lipids are selected from lipids 154, 155, and 163. In some embodiments, the ionizable lipid is lipid 154. In some embodiments, the ionizable lipid is lipid 155. In some embodiments, the ionizable lipid is lipid 163. In some embodiments, the ionizable lipid is lipid 209. In some embodiments, the ionizable lipid is lipid 232. In some embodiments, the ionizable lipid is lipid 262. In some embodiments, the ionizable lipid is lipid 263.

[0015] In some embodiments, the LNP is delivered in vivo to a patient in need. In some embodiments, the LNP is delivered ex vivo to isolated cells (e.g., T cells, HSCs, or liver cells) of a subject (e.g., a human patient) in need. In some such embodiments, the HSCs are first collected from the bone marrow of the subject. After isolation of the desired cell subpopulation, the targeted LNP of this disclosure can be mixed with the isolated cells, thereby resulting in effective transduction of the payload (e.g., a gene modification system) into the cells. The modified cells can then be administered to the patient for engraftment, as described in the Art.

[0016] In another embodiment, the disclosure provides a conjugate (targeted LNP) comprising an LNP and a target-directing moiety. In some cases, the inclusion of the target-directing moiety of the targeted LNP enhances the LNP's ability to deliver a payload to cells. In some embodiments, the cells are T cells. In other embodiments, the cells are HSCs and / or HPCs (collectively, HSPCs). The conjugate (targeted LNP) can be formulated in a pharmaceutical composition and administered directly to a target (e.g., a patient) that requires it (e.g., via in vivo administration). Once administered, the composition can deliver a significant amount of the therapeutic agent to the targeted cells (e.g., T cells, hepatocytes, or LT-HSCs of the target). Alternatively, the conjugate can be administered ex vivo to isolated cells such as T cells, HSCs (e.g., LT-HSCs), or hepatocytes.

[0017] In some embodiments, the target-directed moiety of the conjugate is an antibody, a Fab fragment or single-stranded variable fragment (scFv), DARPIN, a VHH domain antibody, an FN3 domain, a nanobody, a single-domain antibody, or centinrin. In other embodiments, the target-directed moiety is a folic acid moiety, an antibiotic mimetic, a polynucleotide (such as a DNA or RNA apatamer), a carbohydrate, a vitamin, or N-acetylgalactosamine (GalNac). In some embodiments, the target-directed moiety is a peptide or protein that binds to a receptor (e.g., a receptor on the surface of a T cell, HSC, or liver cell), e.g., a ligand or part of a ligand. In some embodiments, the target-directed moiety is a peptide or protein that binds to a receptor or ligand on the surface of a T cell, HSC, HPC, or LT-HSC, and the affinity of the peptide or protein target-directed moiety to the receptor or ligand on the surface of a T cell, HSC, HPC, or LT-HSC is regulated via phage display.

[0018] In some embodiments, the conjugate comprises an ionizable lipid and a helper lipid, the ionizable lipid being a compound of formula (I). In some embodiments, the ionizable lipid is selected from lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, and lipid 263. In some embodiments, the ionizable lipid is selected from lipid 154, lipid 155, lipid 232, lipid 262, and lipid 263. In some embodiments, the ionizable lipid is selected from lipid 154, lipid 155, and lipid 232. In some embodiments, the lipid is selected from lipid 154, lipid 155, and lipid 163. In some embodiments, the lipid is lipid 154. In some embodiments, the lipid is lipid 155. In some embodiments, the lipid is lipid 163. In some embodiments, the ionizable lipid is lipid 209. In some embodiments, the ionizable lipid is lipid 232. In some embodiments, the ionizable lipid is lipid 262. In some embodiments, the ionizable lipid is lipid 263.

[0019] In some embodiments, where the cells are T cells, the cells can be activated before ex vivo delivery of the LNP or conjugate. In other embodiments, the T cells are not activated before ex vivo delivery of the LNP or conjugate to the T cells.

[0020] This disclosure further provides delivery of specific payloads to cells, the payloads being encapsulated within LNPs or conjugates of this disclosure. In some embodiments, the payload may be a nucleic acid encoding a reporter gene, such as green fluorescent protein (GFP). In some embodiments, the payload may be a therapeutic agent, e.g., a therapeutic peptide or protein, a nucleic acid containing a therapeutic agent, or a nucleic acid encoding a therapeutic agent. In some embodiments, the therapeutic agent may be a gene drug, which can modify, alter, or affect changes in the genomic DNA of cells (e.g., cells in a subject). In some embodiments, the therapeutic agent may be a gene therapy agent or a gene editing agent.

[0021] In certain embodiments, the payload delivered by the LNP or conjugate of this disclosure (e.g., a therapeutic agent) may be a small molecule, a peptide or protein, a non-coding RNA (ncRNA), a gRNA, an siRNA or miRNA, a nucleic acid encoding a peptide or protein (e.g., a protein for substitution gene therapy, or a protein for modifying or altering a genome or epigenome, e.g., a protein for gene editing), one or more components of a system for modifying a genome (e.g., one or more components of a ribonucleic acid protein (RNP) complex for editing or altering a genome or epigenome (e.g., for introducing insertion / deletion mutations (indels), base editing, epigenetic editing, or targeted prime reverse transcription (TPRT), e.g., by a mechanism requiring the function of a recombinase, transposase, retransposase, helicase, reverse transcriptase, polymerase, deaminase, methylase, demethylase, or ligase), or a combination thereof. This is possible. In certain embodiments, the therapeutic agent (i.e., payload) delivered by the LNP or targeted LNP may be a genetically modified protein, a nucleic acid encoding a genetically modified protein, or a genetic modification system, as described herein. In some embodiments, the therapeutic agent (i.e., payload) includes template RNA, as described herein. In some embodiments, the template RNA may be, for example, a template RNA for a genetic modification system, as described herein. In some embodiments, the template RNA is used for the insertion of a nucleic acid sequence at a specific location in genomic DNA. In some embodiments, the template RNA includes spacers from Table 5, Table 6, or Table 11. In some embodiments, the template RNA includes heterologous sequences from Table 7, Table 8, or Table 12. In some embodiments, the template RNA includes PBS sequences from Table 13. In some embodiments, the template RNA includes heterologous object sequences and PBS sequences from Table 14. In some embodiments, the template RNA includes sequences from Table 9, Table 10, or Table 16.

[0022] In some embodiments, LNPs or conjugates containing ionizable lipids as described herein can deliver payloads (e.g., therapeutic payloads) to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 99% more T cells, HSCs, HPSCs, LT-HSCs, or hepatocytes than LNPs containing baseline lipids (e.g., V003). In some embodiments, LNPs containing ionizable lipids as described herein can deliver payloads (e.g., therapeutic payloads) to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, or 99% more T cells, HSCs, HSPCs, LT-HSCs, or hepatocytes in animal models than LNPs containing baseline lipids (e.g., V003), as described herein. In some embodiments, the LNPs are conjugates.

[0023] In some embodiments, a payload (e.g., a therapeutic payload) delivered to T cells, HSCs, HPCs, LT-HSCs, or hepatocytes by an LNP containing an ionizable lipid as described herein is expressed at levels at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% higher than a payload containing a baseline lipid (e.g., V003). In some embodiments, a payload (e.g., a therapeutic payload) delivered to T cells, HSCs, HPCSs, LT-HSCs, or hepatocytes by an LNP containing an ionizable lipid as described herein is expressed at levels at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% higher than a payload containing a baseline lipid (e.g., V003). In some embodiments, the LNP is a conjugate.

[0024] In some embodiments, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% of the T cells in a subject contain genomes that have been modified or altered after administration of LNPs described herein, such as targeted LNPs (conjugates) encapsulating a therapeutic agent (e.g., a system for modifying, altering, or editing a genome). In some embodiments, about 5% to about 50%, about 5% to about 20%, about 10% to about 30%, about 20% to about 50%, about 20% to about 40%, or about 20% to about 30% of the T cells in a subject contain genomes that have been modified or altered after administration of LNPs described herein, such as conjugates.

[0025] In some embodiments, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% of the HSCs in the subject (e.g., LT-HSCs) include genomes that have been modified or altered after administration of an LNP as described herein, such as a targeted LNP (conjugate) encapsulating a therapeutic agent (e.g., a system for modifying, altering, or editing a genome). In some embodiments, about 5% to about 50%, about 5% to about 20%, about 10% to about 30%, about 20% to about 50%, about 20% to about 40%, or about 20% to about 30% of the HSCs in the subject include genomes that have been modified or altered after administration of an LNP as described herein, such as a conjugate.

[0026] In some embodiments, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% of the liver cells in the subject contain genomes that have been modified or altered after administration of LNPs described herein, such as targeted LNPs (conjugates) encapsulating a therapeutic agent (e.g., a system for modifying, altering, or editing a genome). In some embodiments, about 5% to about 50%, about 5% to about 20%, about 10% to about 30%, about 20% to about 50%, about 20% to about 40%, or about 20% to about 30% of the liver cells in the subject contain genomes that have been modified or altered after administration of LNPs described herein, such as conjugates.

[0027] In some embodiments, the LNPs of this disclosure, e.g., conjugates, comprise one or more pegylated lipid molecules. In some embodiments, the target-directing moiety of the conjugate (e.g., antibody, Fab fragment, or scFv) is associated with or chemically bound to at least one of the pegylated lipid molecules. In some embodiments, the conjugate comprises about 0.05 mol% to about 2 mol% of the pegylated lipid bound to the target-directing moiety. In some embodiments, the PEG spacer between the lipid and the target-directing moiety comprises at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 200, or 110 ethylene glycol units. In some embodiments, the PEG spacer comprises about 10 to 120 ethylene glycol units. In some embodiments, the molecular weight of the pegylated lipid bound to the target-directing moiety is about 500 (i.e., PEG500) to about 5,000 (i.e., PEG5000). In some embodiments, the molecular weight of the pegylated lipid bound to the target-directing moiety is approximately 1,000 (i.e., PEG1000) to approximately 3,000 (i.e., PEG5300). In some embodiments, the lipid component of the pegylated lipid bound to the target-directing moiety is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, and stearic acid.

[0028] As disclosed herein, different pegylated lipids in targeted LNPs of this disclosure can impart different properties to the LNP, including pharmacokinetics, distribution, and endosomal release. Surprisingly, it has been found that LNPs containing different pegylated lipids that are not covalently bonded to the target-directing moiety can exhibit different toxic properties, even if all other components of the LNP (e.g., ionizable lipids) and their relative proportions are the same. In particular, it has been found that LNPs containing pegylated lipids having PEGylated lipid anchors with 16 carbon atoms (i.e., C16 PEG-lipid anchors) or 18 carbon atoms (i.e., C18 PEG-lipid anchors) can reduce or eliminate toxicity associated with the same LNP other than the pegylated lipid component. In some embodiments, administration (in vivo or ex vivo) of LNPs containing C16 PEG-lipid anchors or C18 PEG-lipid anchors does not result in substantial hepatotoxicity. In some embodiments, LNPs containing PEGylated lipids having 16 carbon atoms (i.e., C16 PEG lipid anchors) or 18 carbon atoms (i.e., C18 PEG lipid anchors) exhibit longer in vivo circulation times compared to LNPs containing PEGylated lipids having shorter PEG lipid anchors (e.g., C14 PEG lipid anchors). In some embodiments, administration of targeted LNPs results in no increase or only a minimal increase in serum levels of the secretory hepatic enzyme alanine aminotransferase (ALT). Reduced liver exposure is particularly useful when targeted delivery of LNPs to specific cell types, such as immune cells or HSCs, is desired, as disclosed herein.

[0029] In other embodiments, transduction of LNPs into liver cells (e.g., hepatocytes) is desirable. For example, transduction of LNPs into liver cells is desirable for treating liver diseases and conditions. In some embodiments, the LNP useful for treating liver diseases and conditions does not contain a target-directing moiety. In some embodiments, the LNP useful for treating liver diseases and conditions includes N-acetylgalactosamine (GalNac).

[0030] In some embodiments, the pegylated lipid has at least one C16 (palmitoyl) PEG lipid anchor. In some embodiments, the pegylated lipid has two C16 PEG lipid anchors (i.e., a dialkyl chain with a carbon length of 16). In some embodiments, the pegylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE-PEG2000). In some embodiments, the pegylated lipid is 1,2-dipalmitoyl-rac-glycero-3-methylpolyoxyethylene (DPG-PEG2000). In some embodiments, the pegylated lipid is C16 PEG ceramide. In some embodiments, targeted LNPs containing C16 pegylated lipids show significantly reduced hepatic uptake compared to other identical LNPs containing C14 pegylated lipids.

[0031] In some embodiments, the pegylated lipid has at least one C18 PEG lipid anchor. In some embodiments, the pegylated lipid has two C18 PEG lipid anchors (i.e., dialkyl chains with a carbon length of 18). In some embodiments, the C18 pegylated lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2000). In some embodiments, the C18 pegylated lipid is distearoyl-rac-glycerol-PEG2000 (DSG-PEG2000).

[0032] In some embodiments, the pegylated lipid has at least one C14 PEG lipid anchor. In some embodiments, the pegylated lipid has two C14 PEG lipid anchors (i.e., dialkyl chains with a length of 14 carbon atoms).

[0033] In some embodiments, the LNP of the Disclosure, e.g., a conjugate, comprises one or more non-pegylated lipids (e.g., non-pegylated phospholipids). Such lipids are often referred to as helper lipids. In some embodiments, a target-directing moiety (e.g., an antibody, Fab fragment, or ScFv) is associated with or chemically bound to at least one of the non-pegylated lipids. In some embodiments, the non-pegylated lipid (helper lipid) is selected from POPC, DOPC, DOPE, and DSPC. In some embodiments, the non-pegylated lipid (helper lipid) is a sphingolipid. In some such embodiments, the non-pegylated lipid is sphingomyelin. In some embodiments, the sphingomyelin has a head group selected from phosphocholine, phosphoethanolamine, or ceramide. In some embodiments, the sphingomyelin is egg sphingomyelin.

[0034] In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in the LNP or conjugate is about 18% to about 32%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in the LNP or conjugate is about 20% to about 30%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in the LNP or conjugate is about 22% to about 28%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in the LNP or conjugate is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, about 30%, about 31%, or about 32%. As used herein, the mol% of helper lipids refers to the mol% of the total lipid components of LNPs that do not include the therapeutic agent (i.e., payload) or target-directed moiety.

[0035] As shown in the following examples, in vivo delivery of a particular payload after administration of the disclosed LNPs having these proportions of helper lipids provides enhanced transduction and / or expression of the payload compared to LNPs having less or more helper lipids.

[0036] In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) in the conjugate is about 1:1 to about 7:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 4:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 3:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC) is about 1:1 to about 2.5:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 2:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC) is about 1.5:1 to about 2.5:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 2:1 to about 2.5:1.

[0037] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 154 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 154 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0038] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 155 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 155 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0039] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 163 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 163 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0040] In some embodiments, the LNP, e.g., targeted LNP (conjugate), comprises lipid 173 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 173 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0041] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 209 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 209 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0042] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 232 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 232 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0043] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 262 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 262 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0044] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 263 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 263 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%. In some embodiments, the LNP further comprises a pegylated lipid containing at least one C16 alkyl chain (e.g., two C16 alkyl chains). In some such embodiments, the pegylated lipid is DPPE-PEG2000 or DPG-PEG2000.

[0045] In any of the embodiments described above, the LNP or conjugate may contain one or more cholesterol molecules. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 6:1 to about 0.5:1. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 3:1 to about 0.5:1. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 2:1 to about 0.5:1. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1.5:1 to about 0.5:1. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 0.5:1. In some embodiments, the molar ratio between cholesterol molecules and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:2 to about 0.8:1.

[0046] In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that targets receptors on the surface of HSCs selected from CD33, CD34, CD38, CD43, CD46, CD49d, CD50, CD59, CD71, CD105, CD117, CD123, CD164, CD184, and CD338. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD33. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD34. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD38. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD43. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD46. In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that binds to CD49d. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to C503. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD59. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD71. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD105. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD117. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD123. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD164. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD184. In some embodiments, the targeted LNP (conjugate) includes a target-directed portion that binds to CD338.

[0047] In some embodiments, as described herein, a targeted LNP (conjugate) for delivering a therapeutic agent to HSCs is used. Multiple target-direction portions conjugated to an LNP, wherein the multiple target-direction portions are coupled to CD33, CD34, CD38, CD43, CD59, CD105, CD123, CD164, CD338, CD71, CD117, CD50, CD49d, CD46, or CD184 (CXCR4), It includes a therapeutic agent encapsulated within the LNP.

[0048] In certain embodiments, the target-directing portion of the targeted LNP (conjugate) is an antibody, Fab fragment, or scFv that binds to a T cell antigen selected from the group consisting of CD2, CD3, CD4, CD5, CD7, CD8, CD28, CD137, CD45, T cell receptor (TCR)β, TCR-α, TCR-α / β, TCR-γ / δ, PD1, CTLA4, TIM3, LAG3, CD18, IL-2 receptor, CD11a, TLR2, TLR4, TLR5, IL-7 receptor, and IL-15 receptor. In some embodiments, the CD80 target-directing portion is the CD80 extracellular domain (ECD).

[0049] In some embodiments, the target LNP (conjugate) includes a target-directing moiety that targets a receptor on the surface of a T cell selected from CD2, CD3, CD4, CD5, CD6, CD7, and CD8. In some embodiments, the target-directing moiety targets the CD3 receptor on the surface of the T cell. In some embodiments, the target-directing moiety targets the CD7 receptor on the surface of the T cell. In some embodiments, the target-directing moiety targets the CD5 receptor on the surface of the T cell.

[0050] In some embodiments, the targeted LNP (conjugate) includes a target-directed moiety that targets CD3 on the surface of T cells, the target-directed moiety being an antibody, Fab fragment, or scFv selected from SP34, tecristamag, mosnetuzumab, odronexitamab, teventafusp, tepilizumab, muromonab, and bicilizumab, or their antigen-binding moiety. In certain embodiments, the target-directed moiety is SP34 or its antigen-binding moiety. In other embodiments, the target-directed moiety is tecristamag or its antigen-binding moiety. In other embodiments, the target-directed moiety is bicilizumab or its antigen-binding moiety. In other embodiments, the target-directed moiety is tepilizumab or its antigen-binding moiety.

[0051] In some embodiments, the LNP includes GalNAc.

[0052] In some embodiments, the conjugate is formed via a click reaction between a first click handle on a target-directed moiety (e.g., an antibody, Fab fragment, or scFv) and a second click handle on an LNP, thereby generating a click product. The second click handle may be on one or more lipids containing the LNP. In some embodiments, the second click handle is covalently bound to a pegylated lipid containing the LNP.

[0053] In one embodiment, the click product can be formed using a copper-catalyzed click reaction. One such copper-catalyzed click reaction is the hysgene 1,3-dipolar cycloaddition (CuAAC) between an azide and an alkyne. In some embodiments, the first or second click handle includes a cyclic derivative of the alkynyl group. In some embodiments, the cyclic derivative of the alkynyl group is selected from dibenzocyclooctine, cyclooctine, and difluorinated cyclooctine. In some embodiments, the click chemistry involves strain-enhanced cycloaddition of the azide. In some embodiments, the click chemistry is based on the reaction of a strained alkene. In another embodiment, the click product can be formed using a copper-free click chemistry. For example, the click product can be formed between an azide and dibenzocyclooctene (DBCO). Alternatively, the click product can be formed using a Staudinger reaction between an azide and a phosphine, thus producing an aza-ylide. In some embodiments, the click product can be formed from an inverse electron-demanded Diels-Alder reaction between a trans-cyclooctene (TCO) moiety on a first or second click handle and a tetrazine ring on a first or second click handle. In some embodiments, the first click handle comprises a tetrazine (Tz) ring, and the second click handle comprises a TCO moiety. In some embodiments, the tetrazine ring is unsubstituted. In some such embodiments, the tetrazine ring is methyltetrazine. In some embodiments, the tetrazine ring is 6-methylsubstituted tetrazine.

[0054] In some embodiments, the click product is formed by conjugating an LNP to a target-directed moiety modified with an enzyme recognition sequence. For example, an antibody, Fab fragment, or single-stranded variable fragment (ScFv) can be covalently bound to a first click handle via a linker containing the enzyme recognition sequence, and an LNP can be covalently bound to a second click handle on the LNP, thereby generating the click product. In some embodiments, the enzyme recognition sequence is a saltase recognition motif or an LplA acceptor peptide. In some embodiments, the antibody, Fab fragment, or ScFv is directly bound to the enzyme recognition sequence. In some embodiments, the antibody, Fab fragment, or ScFv is bound to the enzyme recognition sequence via one or more amino acid residues. Specific amino acid residues that can be covalently bound to the C-terminus of an antibody, Fab fragment, or ScFv include, but are not limited to, (GGGGS)v (SEQ ID NO: 1), (G) v , (EAAAK)v(Sequence ID 2) 、 (PAPAP)v(SEQ ID NO: 3), (AP) v Examples include A(EAAAK)u ALEA(EAAAK)vA (sequence number 4), where u is 1-10 and v is 1-10.

[0055] In some embodiments, the conjugate is (i) Contacting the Fab fragment with a reducing reagent, wherein the Fab fragment contains heavy chains and light chains, as well as constant light chain domains (C L ) and constant heavy chain domain 1 (C H 1) contains interchain disulfide bonds that connect the two components, thereby allowing the reducing agent to reduce the interchain disulfide bonds of the Fab fragment, generating two free cysteine ​​residues, by contact. (ii) The product of step (i) is brought into contact with a precursor LNP containing multiple thiol-reactive groups covalently bonded to one or more lipids of the precursor LNP, thereby forming a targeted LNP.

[0056] In some embodiments, the conjugate is (i) Contacting the Fab fragment with a reducing reagent, wherein the Fab fragment contains heavy chains and light chains, as well as constant light chain domains (C L ) and constant heavy chain domain 1 (C H 1) contains interchain disulfide bonds that connect the two components, thereby allowing the reducing agent to reduce the interchain disulfide bonds of the Fab fragment, generating two free cysteine ​​residues, by contact. (ii) The product of step (i) is brought into contact with a precursor LNP containing multiple thiol-reactive groups covalently bonded to one or more lipids of the precursor LNP, thereby forming a targeted LNP.

[0057] In some embodiments, targeted delivery of a system for modifying or altering genomic DNA (e.g., a gene modification system) using an LNP containing two or more HSC-specific binders conjugated to the LNP results in synergistic enhancement of gene editing or modification of target HSCs, LT-HSCs, or immune cells (e.g., T cells), wherein the LNP contains a lipid of formula (I) (e.g., lipid 154).

[0058] In some embodiments, the targeted LNP comprises two or more different target-directing moieties, each of which may bind to the same or different targets. A targeted LNP having two different target-directing moieties that bind to the same or different targets may be referred to as a “double-binding” or “double-binding” LNP. For example, in some embodiments, each of the target-directing moieties is conjugated to a lipid nanoparticle via a linker, and each linker contains a click product formed from a click reaction between a first click handle of the target-directing moiety and a second click handle of the LNP. In some such embodiments, the target-directing moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directing moiety is an ScFv. In some embodiments, the target-directing moiety is a Fab fragment.

[0059] In some embodiments, LNPs containing a double binder can modify at least 5% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify at least 10% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify at least 15% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify at least 20% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify at least 25% of the genome of HSCs or LT-HSCs. In some embodiments, LNPs containing a double binder can modify at least 30% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify at least 30% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify about 10% to about 30% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify about 20% to about 30% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In some embodiments, LNPs containing a double binder can modify about 10% to about 20% of the genome of target HSCs, LT-HSCs, or immune cells (e.g., T cells). In any of the embodiments described above, the system for modifying or altering genomic DNA induces single-strand breaks in the genomic DNA. In some such embodiments, the system for modifying or altering genomic DNA comprises a gene modification polypeptide and template RNA for a nucleic acid sequence to be inserted at a specific location in the genomic DNA, thus resulting in modification of the genomic DNA. In some embodiments, the gene modification system includes Cas9 niccas fused to a reverse transcriptase (RT) domain.In some embodiments, a system for modifying or altering genomic DNA induces targeted primed reverse transcription (TPRT) to insert a heterologous nucleic acid sequence into a DNA sequence, such as genomic DNA.

[0060] In some embodiments, the double binder can be added to the surface of the LNP by the method described in Section III of the Detailed Description. For example, in some embodiments, each of the target-directed moieties is conjugated to a lipid nanoparticle via a linker, and each linker contains a click product formed from a click reaction between a first click handle of the target-directed moiety and a second click handle of the LNP. In some such embodiments, the target-directed moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directed moiety is an scFv. In some embodiments, the target-directed moiety is a Fab fragment.

[0061] In some aspects, the Disclosure provides a method for treating sickle cell disease in a subject (e.g., a human patient) that requires treatment, and such method is i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iii. One or more target-directed portions conjugated to an LNP, wherein one or more target-directed portions bind to one or more targets on the surface of an HSC (e.g., LT-HSC), iv. The method comprises administering targeted lipid nanoparticles (LNPs) comprising one or more nucleic acids (e.g., two or more nucleic acids) encoding components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, the one or more nucleic acids are RNA molecules. In some embodiments, the targeted LNP comprises two RNA molecules.

[0062] In some aspects, the Disclosure provides a method for treating sickle cell disease in a subject (e.g., a human patient) that requires treatment, and such method is i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iii. One or more target-directed portions conjugated to an LNP, wherein one or more target-directed portions bind to one or more targets on the surface of an HSC (e.g., LT-HSC), iv. The method comprises administering targeted lipid nanoparticles (LNPs) comprising one or more nucleic acids (e.g., two or more nucleic acids) encoding components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, the one or more nucleic acids are RNA molecules. In some embodiments, the targeted LNP comprises two RNA molecules.

[0063] In some aspects, the Disclosure provides a method for treating sickle cell disease in a subject (e.g., a human patient) that requires treatment, and such method is i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iii. Two different target-directed portions conjugated to an LNP, each of which is conjugated to a target on the surface of an HSC (e.g., an LT-HSC), iv. The method comprises administering targeted lipid nanoparticles (LNPs) comprising one or more nucleic acids (e.g., two or more nucleic acids) encoding components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, the one or more nucleic acids are RNA molecules. In some embodiments, the targeted LNP comprises two RNA molecules.

[0064] In some embodiments, a double-binding agent that targets HSCs can be added to the surface of the LNP by the method described in Section III of the Detailed Description. For example, in some embodiments, each of the target-directing moieties is conjugated to a lipid nanoparticle via a linker, and each linker contains a click product formed from a click reaction between a first click handle of the target-directing moiety and a second click handle of the LNP. In some such embodiments, the target-directing moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directing moiety is an ScFv. In some embodiments, the target-directing moiety is a Fab fragment.

[0065] In some embodiments, the nucleic acid component does not introduce double-strand breaks into the genomic DNA. In some embodiments, more than 5% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, more than 10% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, more than 15% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, more than 20% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, more than 30% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, approximately 5% to approximately 15% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, approximately 10% to 30% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, approximately 10% to 20% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, approximately 15% to 20% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs. In some embodiments, approximately 15% to 25% of HSCs or LT-HSCs in patients with sickle cell disease are modified after administration of targeted LNPs.

[0066] In some embodiments, after in vivo administration of targeted LNPs to patients with sickle cell disease, HSCs or LT-HSCs maintain their hematopoietic capacity and function to support multiseries development. In some embodiments, gene modification systems correct E6V HBB mutations in the patient's HSCs and LT-HSCs.

[0067] In some embodiments, targeted delivery of a system for modifying or altering genomic DNA (e.g., a gene modification system) using an LNP containing two or more HSC-specific binders conjugated to the LNP results in synergistic enhancement of gene editing or modification in target immune cells (e.g., T cells), wherein the LNP contains a lipid of formula (I) (e.g., lipid 154).

[0068] In some aspects, the present disclosure provides targeted lipid nanoparticles (LNPs) for ex vivo or in vivo delivery of therapeutic agents to immune cells (e.g., T cells), and the targeted LNPs are i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iii. One or more target-directed moieties conjugated to an LNP, wherein one or more target-directed moieties bind to one or more targets on the surface of immune cells (e.g., T cells), iv. comprising one or more nucleic acids (e.g., two or more nucleic acids) that encode components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, one or more nucleic acids are RNA molecules. In some embodiments, the targeted LNP comprises two RNA molecules.

[0069] In some aspects, the present disclosure provides targeted lipid nanoparticles (LNPs) for ex vivo or in vivo delivery of therapeutic agents to immune cells (e.g., T cells), and the targeted LNPs are i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iii. Two different target-directing moieties conjugated to an LNP, each of which binds to a target on the surface of an immune cell (e.g., a T cell), iv. comprising one or more nucleic acids (e.g., two or more nucleic acids) that encode components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, one or more nucleic acids are RNA molecules. In some embodiments, the targeted LNP comprises two RNA molecules.

[0070] In some embodiments, a double conjugate that targets T cells can be added to the surface of the LNP by the method described in Section III of the Detailed Description. For example, in some embodiments, each of the target-directing moieties is conjugated to a lipid nanoparticle via a linker, and each linker contains a click product formed from a click reaction between a first click handle of the target-directing moiety and a second click handle of the LNP. In some such embodiments, the target-directing moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directing moiety is an scFv. In some embodiments, the target-directing moiety is a Fab fragment.

[0071] In some embodiments, the present disclosure provides lipid nanoparticles (LNPs) for ex vivo or in vivo delivery of therapeutic agents to liver cells, where the LNPs are i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iv. comprising one or more nucleic acids (e.g., two or more nucleic acids) that encode components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, one or more nucleic acids are RNA molecules. In some embodiments, the LNP comprises two RNA molecules. In some embodiments, the LNP for delivering a therapeutic agent to liver cells includes galNAc.

[0072] In some aspects, the Disclosure provides a method for treating liver diseases (e.g., alpha-1 antitrypsin deficiency or phenylketonuria in human patients, but not limited to these) in subjects requiring such treatment, and such method is i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154, lipid 155, lipid 209, lipid 232, lipid 262, or lipid 263), ii. Helper lipids and, iv. The method involves administering lipid nanoparticles (LNPs) comprising one or more nucleic acids (e.g., two or more nucleic acids) encoding components of a system for modifying or altering genomic DNA (e.g., a gene modification system). In some embodiments, the one or more nucleic acids are RNA molecules. In some embodiments, the LNP comprises two RNA molecules. [Brief explanation of the drawing]

[0073] [Figure 1] This demonstrates the formation of an LNP conjugated to the C-terminus of the Fab fragment via saltase-mediated ligation, followed by a click reaction. [Figure 2] This demonstrates the formation of an LNP conjugated to the C-terminus of the Fab fragment via lipoic acid ligase-mediated ligation, followed by a click reaction. [Figure 3] This paper describes an enzymatic approach to site-specifically introduce a Tz ring into the sugar portion of an antibody. [Figure 4] This example shows a photo-guided crosslinking approach that site-specifically induces a Tz ring on an antibody. [Figure 5] This example demonstrates the use of non-natural amino acids to site-specifically introduce a Tz ring onto an antibody or Fab fragment. [Figure 6] This example demonstrates the use of a cysteine-maleimide reaction to site-specifically introduce a first click handle into a Fab fragment, which then reacts with an LNP bound to a second click handle, thereby generating a targeted LNP (conjugate). [Figure 7]The Fab fragment is shown modified with free cysteine ​​designed to react with the maleimide group. [Figure 8] Figure A shows a schematic example of producing a site-specific conjugate by reaction of an anti-CD117 Fab fragment with a site-specific saltase recognition motif with LNP. In the schematic diagram, the wavy lines represent PEG bound to the lipids of the LNP. Figure B shows a schematic diagram of producing a conjugate by reaction of a Fab fragment modified using a random approach (NHS modification) with LNP. [Figure 9A] This shows the synthesis of lipid 154. [Figure 9B] This shows the synthesis of lipid 154. [Figure 9C] This shows the synthesis of lipid 154. [Figure 9D] This shows the synthesis of lipid 154. [Figure 9E] This shows the synthesis of lipid 154. [Figure 9F] This shows the synthesis of lipid 154. [Figure 10A] This shows the synthesis of lipid 155. [Figure 10B] This shows the synthesis of lipid 155. [Figure 10C] This shows the synthesis of lipid 155. [Figure 10D] This shows the synthesis of lipid 155. [Figure 10E] This shows the synthesis of lipid 155. [Figure 11] A and B show enhanced transduction and / or expression levels of GFP in LSK cells using LNPs containing ionizable lipid 154 or ionizable lipid 155, compared to LNPs containing ionizable lipid V003 in an in vivo mouse model. C and D show enhanced transduction and / or enhanced GFP expression of GFP in LT-HSCs using LNPs containing ionizable lipid 154 or ionizable lipid 155, compared to LNPs containing ionizable lipid V003. [Figure 12]A and C, respectively, show enhanced transduction of GFP in HSPCs or LT-HSPCs using LNPs containing ionizable lipid 154 or ionizable lipid 155, compared to LNPs containing ionizable lipid V003, in a humanized in vivo mouse model. B and D, respectively, show enhanced expression of GFP in HSPCs or LT-HSCs using LNPs containing ionizable lipid 154 or ionizable lipid 154, compared to LNPs containing ionizable lipid V003, in a humanized in vivo mouse model. [Figure 13A] The results of screening for targeted LNPs (tLNPs) in humanized NBSGW mice with increased levels of helper lipids are shown. The results of transduction in HSPC are also shown. [Figure 13B] The results of screening for targeted LNPs (tLNPs) in humanized NBSGW mice with increased levels of helper lipids are shown. The expression results in HSPCs are also shown. [Figure 13C] The results of screening for targeted LNPs (tLNPs) in humanized NBSGW mice with increased levels of helper lipids are shown. The results of transduction in LT-HSC mice are also shown. [Figure 13D] The results of screening for targeted LNPs (tLNPs) in humanized NBSGW mice with increased levels of helper lipids are shown. The expression results in LT-HSCs are also shown. [Figure 14] A and B demonstrate that administered anti-CD117 tLNPs can deliver a payload suitable for gene editing to human HSPCs in an animal model, resulting in in vivo gene editing in HSPCs. A shows that tLNPs formulated with lipid 154 and wtCas9-RT mRNA and B2M gRNA payloads resulted in a 15.7% indel in B2M in HSPCs. B shows that tLNPs formulated with lipid 154 and nCas9-RT and B2M template RNA payloads generated a high TPRT-mediated knockout of B2M in HPSCs (mean 5.2%). [Figure 15] This study demonstrates that lipid 154 tLNP delivers GFP mRNA to liver tissue. [Figure 16] This study demonstrates that lipid 154 LNP administered at 4 mpk causes a significant increase in ALT levels compared to rats administered at 2 mpk or untreated rats. [Figure 17] This study demonstrates that lipid PEG type and mol% affect the number of human CD34+ cells transfected with tLNP (GFP+ cell %) and the amount of GFP expression (MFI) in those cells. Increasing the proportion of lipid PEG in tLNP leads to a decrease in GFP+ cell % (A) and MFI (B). In addition, increasing the lipid anchor length (C14 to C16 to C18) reduces GFP+ cell % and MFI levels at the same mol%, both in the presence and absence of serum. [Figure 18] A shows that administration of tLNPs formulated with a smaller anchor length (C14) PEG resulted in higher GFP+ MFI levels in human LT-HSCs in vivo. Administration of tLNPs formulated with C18 anchor length PEG resulted in significantly lower GFP MFI. However, administration of tLNPs formulated with C16 anchor length PEG resulted in only a minimal decrease in MFI levels compared to the MFI levels produced using C14 anchor length PEG in LT-HSCs. B shows that, regardless of the mol% tested in this study, tLNPs formulated with C14-PEG exhibited a higher tendency for liver delivery compared to tLNPs formulated with either C16-PEG or C18-PEG. [Figure 19] This study demonstrates that lipid 154 LNP formulated with 2% DPG-PEG2000(C16) does not result in an increase in serum ALT levels compared to baseline levels. [Figure 20]A shows that administration of anti-CD117 tLNP formulated with lipid 154 and 2mol% C16-PEG resulted in high proportions of GFP+ HSPCs and LT-HSCs (96% GFP+ and 91% GFP+ cells, respectively) in macaques (n=2). B shows GFP mRNA expression after administration with lipid 154 tLNP. [Figure 21] Administration of anti-CD117 / anti-CD34 bi-tLNP formulated with C16-PEG generated a significant number of human HSPCs in vivo, including B2M indels (over 45% indels). [Figure 22] This study demonstrates that anti-CD117 / anti-CD34 bitargeted tLNPs formulated with lipid 154 and C16 PEG resulted in an average of 11.8% complete gene modification in HSPCs and an average of 14.3% complete gene modification in LT-HSCs in vivo. [Figure 23] A shows that administration of lipid-154-formulated bilayer tLNPs to cynomolgus monkeys (n=2) resulted in an average of over 90% GFP+HSPCs and LT-HSCs for anti-CD117 / anti-CD34 bilayer tLNPs, and over 80% GFP+HSPCs and over 70% GFP+LT-HSCs for anti-CD117 / anti-CD71 bilayer tLNPs. B shows that HSPCs and LT-HSCs in NHP expressed GFP after administration of each bilayer tLNP. [Figure 24A] This shows the synthesis of lipid 232. [Figure 24B] This shows the synthesis of lipid 232. [Figure 24C] This shows the synthesis of lipid 232. [Figure 24D] This shows the synthesis of lipid 232. [Figure 24E] This shows the synthesis of lipid 232. [Figure 25] An exemplary conjugate containing Fab fragments and lipid nanoparticles (LNPs) is shown. [Figure 26A]This shows an assembly of an LNP containing a therapeutic payload having a functional group (e.g., maleimide, 2,3-dibromomaleimide, saltase tag, etc.) that reacts with an antibody or its antigen-binding fragment. [Figure 26B] This shows the assembly of an LNP with a therapeutic payload encapsulated using post-insertion techniques. [Figure 27] An illustrative schematic diagram of the reduction of interchain disulfide bonds in the Fab fragment is shown. After reduction, each cysteine ​​residue is available to react with thiol-reactive groups conjugated on the surface of the LNP. [Figure 28] An exemplary schematic diagram of conjugate formation is shown. A Fab fragment containing an interchain disulfide bond between the heavy and light chains is brought into contact with a reducing agent, thereby reducing the interchain disulfide to produce two free cysteine ​​residues (step (i)). In step (ii), the Fab fragment is brought into contact with an LNP containing multiple thiol-reactive groups (e.g., multiple maleimide or DBM groups) conjugated on the surface of the LNP, thereby the multiple thiol-reactive groups react with at least one of the two free cysteine ​​residues of the Fab fragment. [Figure 29] An illustrative schematic diagram of conjugate formation is shown. A Fab fragment containing an interchain disulfide bond between the heavy and light chains is brought into contact with a reducing agent, thereby reducing the interchain disulfide to produce two free cysteine ​​residues (step (i)). In step (ii), the Fab fragment is brought into contact with an LNP containing multiple maleimide groups conjugated on the surface of the LNP, thereby the multiple maleimide groups react with one of the two free cysteine ​​residues of the Fab fragment. [Figure 30] A schematic diagram illustrating an example of conjugate formation using DBM as a crosslinking agent is shown. [Figure 31]A schematic diagram illustrating conjugate formation is shown. In Figure 31, the first Fab fragment (Fab1) and the second Fab fragment (Fab2) are each brought into contact with a reducing agent, thereby reducing the interchain disulfide between the heavy and light chains of each Fab. After step (i), each Fab contains two free cysteine ​​residues, one free cysteine ​​residue on the heavy chain and one free cysteine ​​residue on the light chain. In step (ii), the first and second Fab fragments are brought into contact with an LNP containing multiple thiol-reactive groups (e.g., maleimide or DBM) conjugated on the surface of the LNP, thereby the multiple thiol-reactive groups react with at least one of the two free cysteine ​​residues of the first Fab fragment, and the multiple other thiol-reactive groups react with at least one of the two free cysteine ​​residues of the second Fab fragment. [Figure 32] Here are some examples of pegylated lipids bound to the maleimide moiety. [Figure 33] Here are some examples of non-pegylated lipids bound to the maleimide moiety. [Figure 34] Here are some examples of ionizable lipids bound to the maleimide moiety. [Figure 35] Here are some examples of sterols bound to the maleimide moiety. [Figure 36A] This bar graph shows that administration of lipid 232 LNPs, including an exemplary gene modification system, to transgenic mice containing the human SERPINA1 (hSERPINA1) gene with a PiZ mutation results in an average modification of approximately 15.9% of the SERPINA1 allele at 8 days post-administration. [Figure 36B] This shows that administration of each LNP, including those in gene modification systems, resulted in a very low indel rate. [Figure 37A] A bar graph is provided showing that a mean 22.7% of SERPINA1 alleles in hepatocytes administered NHP (at a dose of 2 mg / kg) had the intended exact edits in the SERPINA1 gene after administration of LNP formulated with lipid 232 and exemplary gene modification systems. [Figure 37B] Increasing the LNP dose to 3 mg / kg resulted in a corresponding increase in complete rewriting of the SERPINA1 locus in NHP hepatocytes, with an average of 42.7% of SERPINA1 alleles having the intended, precise edits. Approximately 76.3 percent of liver cDNA had the intended, precise edits at SERPINA1. [Figure 38] A bar graph is provided showing that approximately 36.3% of the SERPINA1 alleles in administered hepatocytes of NHP patients had the intended exact edits after administration of lipid 232 and GalNAc-conjugated LNPs formulated with exemplary gene modification systems. [Modes for carrying out the invention]

[0074] I. Definition Antigen-binding domain: As used herein, the term “antigen-binding domain” refers to the portion of an antibody or chimeric antigen receptor that binds to an antigen. In some embodiments, the antigen-binding domain binds to a cell surface antigen of a cell. In some embodiments, the antigen-binding domain binds to an antigen specific to cancer, for example, a tumor-associated antigen in a newly formed cell. In some embodiments, the antigen-binding domain binds to an antigen specific to an infectious disease, for example, a virus-associated antigen in a virus-infected cell. In some embodiments, the antigen-binding domain binds to an antigen specific to a cell targeted by the immune system in an autoimmune disease, for example, an O-antigen. In some embodiments, the antigen-binding domain is or includes an antibody or its antigen-binding portion. In some embodiments, the antigen-binding domain is or includes an scFv or Fab.

[0075] Expression Cassette: As used herein, the term "expression cassette" refers to a nucleic acid construct containing sufficient nucleic acid elements for the expression of the nucleic acid molecule of the present invention.

[0076] gRNA spacer: As used herein, “gRNA spacer” refers to a portion of nucleic acid that is complementary to the target nucleic acid and, together with the gRNA scaffold, can enable the Cas protein to target the target nucleic acid.

[0077] gRNA scaffold: As used herein, “gRNA scaffold” refers to a portion of nucleic acid that can bind to a Cas protein and, together with a gRNA spacer, can target the Cas protein to a target nucleic acid. In some embodiments, the gRNA scaffold includes a crRNA sequence, a tetraloop, and a tracrRNA sequence.

[0078] Genetically Modified Polypeptide: As used herein, “genetically modified polypeptide” refers to a polypeptide comprising a retroviral reverse transcriptase, or a polypeptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with respect to a retroviral reverse transcriptase, which can incorporate a nucleic acid sequence (e.g., a sequence provided on a template nucleic acid) into a target DNA molecule (e.g., a mammalian host cell, or a genomic DNA molecule within a host cell). In some embodiments, the genetically modified polypeptide can incorporate the sequence substantially without relying on host mechanisms. In some embodiments, the genetically modified polypeptide incorporates the sequence into a specific target site. In some embodiments, the genetically modified polypeptide comprises one or more domains that comprehensively facilitate 1) binding of the template nucleic acid, 2) binding of the target DNA molecule, and 3) incorporation of at least a portion of the template nucleic acid into the target DNA. The genetically modified polypeptide includes both naturally occurring polypeptides and the aforementioned manipulated variants, for example, having one or more amino acid substitutions to a naturally occurring sequence. Genetically modified polypeptides also include heterologous constructs in which one or more of the domains listed above are heterologous to each other, for example, through heterologous fusion (or other conjugate) of other wild-type domains, or through fusion of modified domains via substitution or fusion of heterologous subdomains or other substitution domains. Exemplary genetically modified polypeptides that can be used in the manner provided herein, as well as systems comprising them and methods of using them, are described, for example, in PCT / US2021 / 020948, which is incorporated herein by reference with respect to genetically modified polypeptides comprising retroviral reverse transcriptase domains. In some embodiments, the genetically modified polypeptides incorporate a sequence into a gene. In some embodiments, the genetically modified polypeptides incorporate a sequence outside of a gene. As used herein, “genetic modification system” refers to a system comprising a genetically modified polypeptide and a template nucleic acid.

[0079] Genetic modification system: As used herein, “genetic modification system” means a system comprising a genetically modified polypeptide, or a nucleic acid (e.g., mRNA) encoding a genetically modified polypeptide, and a template nucleic acid.

[0080] Domain: As used herein, the term “domain” refers to a structure of a biomolecule that contributes to a particular function of that biomolecule. A domain may include a continuous region (e.g., a continuous sequence) or a distinct discontinuous region (e.g., a discontinuous sequence) of a biomolecule. Examples of protein domains, but not limited to these, include endonuclease domains, DNA-binding domains, and reverse transcriptase domains, while examples of nucleic acid domains include regulatory domains such as transcription factor-binding domains.

[0081] Exogenous: As used herein, the term “exogenous” means, when used in reference to a biomolecule (such as a nucleic acid sequence or polypeptide), that the biomolecule has been introduced into a host genome, cell, or organism by human intervention. For example, a nucleic acid that is added to an existing genome, cell, tissue, or subject using recombinant DNA technology or other methods is exogenous to the existing nucleic acid sequence, cell, tissue, or subject.

[0082] First Strand and Second Strand: When used herein, the terms “first strand” and “second strand” describe the individual DNA strands of the target DNA and distinguish the two DNA strands based on which strand the reverse transcriptase domain begins polymerization on, for example, where the targeted priming synthesis begins. The first strand refers to the strand of target DNA from which the reverse transcriptase domain begins.

[0083] Heterogeneous: When the term “heterogeneous” is used herein to describe a first element in relation to a second element, it means that the first and second elements do not exist in nature in the configuration described. For example, heterogeneous polypeptides, nucleic acid molecules, constructs, or sequences mean (a) a polypeptide, nucleic acid molecule, or a portion of a polypeptide or nucleic acid molecule sequence that is not native to the cell in which it is expressed, (b) a polypeptide or nucleic acid molecule, or a portion of a polypeptide or nucleic acid molecule that is modified or mutated from its native state, or (c) a polypeptide or nucleic acid molecule having modified expression compared to its native expression level under similar conditions. For example, heterogeneous regulatory sequences (e.g., promoters, enhancers) may be used to regulate the expression of a gene or nucleic acid molecule in a manner different from that of a gene or nucleic acid molecule that is normally expressed in nature. In another example, heterogeneous domains of a polypeptide or nucleic acid sequence (e.g., the DNA-binding domain of a polypeptide or the nucleic acid encoding the DNA-binding domain of a polypeptide) may be configured relative to other domains, or may be of a different sequence, or may be from a different source relative to other domains or portions of the polypeptide or its coding nucleic acid. In certain embodiments, heterologous nucleic acid molecules may be present in the native host cell genome but may have modified expression levels, different sequences, or both. In other embodiments, heterologous nucleic acid molecules may not be endogenous to the host cell or host genome, but may instead be introduced into the host cell by transformation (e.g., transfection, electroporation), and the added molecules may be integrated into the host genome or exist as extrachromosomal genetic material, either transiently (e.g., mRNA) or semi-stable for two or more generations (e.g., episomal viral vectors, plasmids, or other self-replicating vectors).

[0084] Mutant or Mutant: When applied to a nucleic acid sequence, the term "mutant" means that nucleotides within the nucleic acid sequence may be inserted, deleted, or altered compared to a reference (e.g., native) nucleic acid sequence. A single alteration may occur at a locus (point mutation), or multiple nucleotides may be inserted, deleted, or altered at a single locus. In addition, one or more alterations may occur at any number of loci within the nucleic acid sequence. A nucleic acid sequence may be mutated by any method known in the art. In some embodiments, mutations occur naturally. In some embodiments, desired mutations can be produced by the systems described herein.

[0085] Variant region: As used herein, the term “variant region” refers to a region in template RNA that has one or more sequence differences compared to the corresponding sequence in the target nucleic acid. Sequence differences may include, for example, substitutions, insertions, frameshifts, or deletions.

[0086] Nucleic acid molecules: “Nucleic acid molecules” means both RNA molecules and DNA molecules, including complementary DNA (“cDNA”), genomic DNA (“gDNA”), and messenger RNA (“mRNA”), and also includes synthetic nucleic acid molecules, such as RNA templates, which are chemically synthesized or produced by recombination, as described herein. Nucleic acid molecules can be double-stranded or single-stranded, circular, or linear. If single-stranded, a nucleic acid molecule can be a sense strand or an antisense strand. Unless otherwise indicated, and as an example of all sequences described herein in the general format “Sequence Number” or “Nucleic Acid Containing Sequence Number 1”, a nucleic acid refers to at least a portion having either (i) the sequence of Sequence Number 1, or (ii) a sequence complementary to Sequence Number 1. The choice between the two is determined by the context in which Sequence Number 1 is used. For example, when a nucleic acid is used as a probe, the choice between the two is determined by the requirement that the probe is complementary to the desired target. The nucleic acid sequences of this disclosure may be chemically or biochemically modified, or may contain unnatural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution with one or more naturally occurring nucleotide analogs, uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds (e.g., phosphorothioates, phosphorodithioates, etc.), pendant moieties (e.g., polypeptides), intercalators (e.g., acridines, psoralens, etc.), chelating agents, alkylating agents, and modified bonds (e.g., alpha-anomeric nucleic acids, etc.). Chemically modified bases (e.g., see Table 13), skeletons (e.g., see Tables 14 and 16), and modified caps are also included. Synthetic molecules that mimic polynucleotides in their ability to bind to specified sequences via hydrogen bonding and other chemical interactions are also included. Such molecules are known in the art, and include, for example, those in which peptide bonds are replaced by phosphate bonds within the backbone of a molecule, such as a peptide nucleic acid (PNA).Other modifications include analogues that include other structures such as modifications in which a ribose ring is found in a bridging portion or "locked" nucleic acid (LNA). In various embodiments, the nucleic acid is operationally associated with additional gene elements such as tissue-specific expression regulatory sequences (plural) (e.g., tissue-specific promoters and tissue-specific microRNA recognition sequences), as well as additional elements such as inverted repeats (e.g., inverted end repeats such as elements from or derived from viruses, e.g., AAV ITR) and tandem repeats, inverted repeats / direct repeats, homology regions (segments having varying degrees of homology to target DNA), untranslated regions (UTRs) (5', 3', or both 5' and 3' UTRs), and various combinations thereof. The nucleic acid elements of the system provided by the present invention can be provided in various topologies, including single-stranded, double-stranded, circular, linear, linear with open ends, linear with closed ends, and specific versions thereof, e.g., doggy-bone DNA (dbDNA), closed-end DNA (ceDNA).

[0087] Primer-binding sequence: As used herein, the terms “primer-binding site sequence” or “PBS sequence” refer to a portion of template RNA that can bind to a region contained in a target nucleic acid sequence. In some cases, the PBS sequence is a nucleic acid sequence containing at least 3, 4, 5, 6, 7, or 8 nucleotides that are 100% identical to a region contained in the target nucleic acid sequence. In some embodiments, the primer region contains at least 5, 6, 7, or 8 nucleotides that are 100% identical to a region contained in the target nucleic acid sequence. While not intended to be theoretically constrained, in some embodiments, when the template RNA contains both a PBS sequence and a heterologous object sequence, the PBS sequence binds to a region contained in the target nucleic acid sequence, allowing the reverse transcriptase domain to use that region as a primer for reverse transcription and the heterologous object sequence as a template for reverse transcription.

[0088] It is understood that the embodiments and models described herein as "including" include embodiments that "consist of" and "essentially consist of".

[0089] References to values ​​or parameters “about” in this specification include (and also include) embodiments of the value or parameter itself. For example, a statement referring to “about X” includes a statement of “X”.

[0090] In some embodiments, references to measurable parameter values ​​include variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from a specified value.

[0091] II. Lipid Nanoparticles In some embodiments, the lipid nanoparticles include one or more ionic lipids, such as noncationic lipids (e.g., neutral, anionic, or amphoteric lipids), also referred to herein as helper lipids; one or more conjugated lipids (e.g., PEG-conjugated lipids, or lipids conjugated to polymers listed in Table 5 of WO2019 / 217941 (which is incorporated herein by reference in its entirety)); one or more sterols (e.g., cholesterol); and optionally one or more target molecules (e.g., conjugated receptors, receptor ligands, antibodies); or a combination thereof.

[0092] Lipids that can be used to form nanoparticles (e.g., lipid nanoparticles) include, for example, those listed in Table 4 of WO2019 / 217941 incorporated by reference. For example, lipid-containing nanoparticles may contain one or more lipids from Table 4 of WO2019 / 217941. Lipid nanoparticles may contain additional elements such as polymers, such as those listed in Table 5 of WO2019 / 217941 incorporated by reference.

[0093] In some embodiments, the conjugated lipids, if present, include PEG-diacylglycerol (DAG) (e.g., l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-diachyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), and PEG-succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecane)). This may include one or more of the following: (e.g., noyloxy)propyl-l-O-(w-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG), PEG dialkoxypropyl carbam, N-(carbonyl-methoxypolyethylethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019 / 051289 (incorporated by reference), as well as any combination thereof.

[0094] In some embodiments, the sterols that can be incorporated into lipid nanoparticles include one or more cholesterol or cholesterol derivatives, such as W02009 / 127060 or US2010 / 0130588, which are incorporated herein by reference. Further exemplary sterols include phytosterols, including those described in Eygeris et al (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated herein by reference.

[0095] In some embodiments, the lipid particles include ionizable lipids, noncationic lipids, conjugated lipids that inhibit particle aggregation, and sterols. The amounts of these components can be independently varied to achieve desired properties. For example, in some embodiments, the lipid nanoparticles include about 20 mol% to about 90 mol% of the total lipids in the ionizable lipids (in other embodiments, this may be 20-70% (mol), 30-60% (mol), or 40-50% (mol); about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles), about 5 mol% to about 35 mol% of the total lipids in the noncationic lipids, about 0.5 mol% to about 20 mol% of the total lipids in the conjugated lipids, and about 20 mol% to about 50 mol% of the total lipids in the sterols. The ratio of total lipids to nucleic acids (e.g., including therapeutic agents and / or encoding genetically modified polypeptides, template nucleic acids, or genetically modified systems) can be varied as desired. For example, the ratio of total lipids to nucleic acids (by mass or weight) can be approximately 10:1 to 30:1.

[0096] In some embodiments, the average LNP diameter of the targeted LNP formulation may be in the range of nm from 10s to 100s, measured, for example, by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the targeted LNP formulation may be in the range of about 40nm to about 150nm, for example, about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm. In some embodiments, the average LNP diameter of the targeted LNP formulation may be approximately 50 nm to 100 nm, approximately 50 nm to 90 nm, approximately 50 nm to 80 nm, approximately 50 nm to 70 nm, approximately 50 nm to 60 nm, approximately 60 nm to 100 nm, approximately 60 nm to 90 nm, approximately 60 nm to 80 nm, approximately 60 nm to 70 nm, approximately 70 nm to 100 nm, approximately 70 nm to 90 nm, approximately 70 nm to 80 nm, approximately 80 nm to 100 nm, approximately 80 nm to 90 nm, or approximately 90 nm to 100 nm. In some embodiments, the average LNP diameter of the targeted LNP formulation may be approximately 70 nm to 100 nm. In certain embodiments, the average LNP diameter of the targeted LNP formulation may be approximately 80 nm. In some embodiments, the average LNP diameter of the targeted LNP formulation may be approximately 100 nm. In some embodiments, the average LNP diameter of the targeted LNP formulation is in the range of approximately 1 mm to 500 mm, approximately 5 mm to 200 mm, approximately 10 mm to 100 mm, approximately 20 mm to 80 mm, approximately 25 mm to 60 mm, approximately 30 mm to 55 mm, approximately 35 mm to 50 mm, or approximately 38 mm to 42 mm.

[0097] LNPs described herein, such as targeted LNPs, may be relatively homogeneous in some cases. The polydispersity index can be used to indicate the homogeneity of LNPs, for example, the particle size distribution of lipid nanoparticles. Small polydispersity indices (e.g., less than 0.3) generally indicate a narrow particle size distribution. LNPs may have polydispersity indices ranging from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.

[0098] The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In some embodiments, the zeta potential can account for the surface charge of the LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally preferred because higher-charged species may interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP may be approximately -10mV to approximately +20mV, approximately -10mV to approximately +15mV, approximately -10mV to approximately +10mV, approximately -10mV to approximately +5mV, approximately -10mV to approximately 0mV, approximately -10mV to approximately -5mV, approximately -5mV to approximately +20mV, approximately -5mV to approximately +15mV, approximately -5mV to approximately +10mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately 0mV, approximately 0mV to approximately +20mV, approximately 0mV to approximately +15mV, approximately 0mV to approximately +10mV, approximately 0mV to approximately +5mV, approximately +5mV to approximately +20mV, approximately +5mV to approximately +15mV, or approximately +5mV to approximately +10mV.

[0099] The efficiency of protein and / or nucleic acid (e.g., mRNA encoding a polypeptide) encapsulation describes the amount of protein and / or nucleic acid encapsulated in the LNP after preparation, or otherwise associated with the LNP, compared to the initial amount provided. The encapsulation efficiency is preferably high (e.g., close to 100%). The encapsulation efficiency may be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after decomposition of the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resin may be used to measure the amount of free protein or nucleic acid (e.g., RNA) in the solution. Fluorescence may be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in the solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids may be at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0100] The LNPs of this disclosure may optionally include one or more coatings. In some embodiments, the LNPs may be formulated into capsules, films, or tablets having the coatings. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0101] Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught by WO2020 / 061457, which is incorporated herein in its entirety by reference.

[0102] In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA transfection reagent (Mirus Bio). In certain embodiments, the LNP is formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, the targeted LNP of this disclosure is formulated using 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (dLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (dLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012) (the whole of which is incorporated herein by reference).

[0103] Additional specific LNP formulations useful for nucleic acid delivery are described in US8158601 and US8168775 (both incorporated by reference), which include the formulation used in patisiran, marketed under the name ONPATTRO.

[0104] Ionizable lipids The LNPs of this disclosure (e.g., targeted LNPs) comprise one or more ionizable lipids, as shown below. The LNPs can encapsulate therapeutic agents (e.g., one or more nucleic acids). The therapeutic agents (e.g., one or more nucleic acids) may be adsorbed onto the surface of the LNP, e.g., the LNP comprising the ionizable lipids. Any reference to ionizable lipids in the LNPs provided herein will be understood to also include pharmaceutically acceptable salts of the lipids.

[0105] In some embodiments, a therapeutic agent (e.g., one or more nucleic acids) may be encapsulated in the LNP. In some embodiments, the lipid nanoparticles may include, for example, a target-directing moiety coated with a targeting agent. In embodiments, the LNP formulation is biodegradable. In some embodiments, the lipid nanoparticles containing one or more lipids described herein encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% RNA molecules (e.g., mRNA molecules).

[0106] In some embodiments, the lipid-to-nucleic acid ratio (mass / mass ratio; w / w ratio) can be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipids and nucleic acids can be adjusted to provide a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or higher. Generally, the overall lipid content of the lipid nanoparticle formulation can be in the range of about 5 mg / ml to about 30 mg / mL.

[0107] In some embodiments, the LNP, for example, the targeted LNP, is given by formula (I'), [ka] or comprising an ionizable lipid having the structure of a pharmaceutically acceptable salt thereof, wherein the formula includes, X is -O- or -CH2-, m is 0, 1, 2, or 3. R 1 C 1-4 It is alkyl, R 2 C 1-4 It is alkyl, n is 1, 2, 3, or 4. R 3 C 4-10It is alkyl, R 5 C 4-10 One or more alkylene units of the alkyl group are optionally -O-, -NH-, -N(C) 1-4 Replaced with a group selected from alkyl)- and -S-, R 4 C 4-10 It is alkyl, R 5 C 4-10 One or more alkylene units of the alkyl group are optionally -O-, -NH-, -N(C) 1-4 Replaced with a group selected from alkyl)- and -S-, p is 2, 3, 4, 5, or 6. R 5 C 4-10 It is alkyl, R 5 C 4-10 One or more alkylene units of the alkyl group are optionally -O-, -NH-, -N(C) 1-4 Replaced with a group selected from alkyl)- and -S-, R 6 C 4-10 It is alkyl, R 6 C 4-10 One or more alkylene units of the alkyl group are optionally -O-, -NH-, -N(C) 1-4 It is replaced with a group selected from alkyl)- and -S-.

[0108] In some embodiments, the LNP, for example, the targeted LNP, is given by formula (I), [ka] or comprising an ionizable lipid having the structure of a pharmaceutically acceptable salt thereof, wherein the formula includes, X is -O- or -CH2-, m is 0, 1, 2, or 3. R 1 C 1-4 It is alkyl, R 2 C 1-4 It is alkyl, n is 1, 2, 3, or 4. R 3 C 4-10 It is alkyl, R 4 C 4-10 It is alkyl, p is 2, 3, 4, 5, or 6. R 5 C 4-10 It is alkyl, R 6 C 4-10 It is alkyl.

[0109] In some embodiments, the compound of formula (I) is the compound of formula (IA), [ka] or a pharmaceutically acceptable salt thereof, in the formula, p is 2, 3, 4, 5, or 6. R 5 C 4-10 It is alkyl, R 6 C 4-10 It is alkyl.

[0110] In some embodiments, the compound of formula (I) is the compound of formula (IB), [ka] or a pharmaceutically acceptable salt thereof, in the formula, R 5 C 4-6 It is alkyl, R 6 C 4-6 It is alkyl.

[0111] In some embodiments, the ionizable lipid is a compound selected from the exemplary compounds in Table 1. [Table 1-1] [Table 1-2]

[0112] In some embodiments, the ionizable lipid has one of the structures shown below. [ka]

[0113] In some embodiments, the ionizable lipid has one of the structures shown below. [ka]

[0114] In some embodiments, the ionizable lipid has one of the structures shown below. [ka]

[0115] In some cases, LNPs containing the ionizable lipid of formula (I) or the ionizable lipids shown in Table 1 exhibit higher levels of transduction in HSCs and / or higher expression of payload proteins in HSCs compared with LNPs containing V003 as the ionizable lipid. In some cases, LNPs containing the ionizable lipid of formula (I) or the ionizable lipids shown in Table 1 exhibit higher levels of transduction in T cells and / or higher expression of payload proteins in T cells compared with LNPs containing V003 as the ionizable lipid. In some cases, LNPs containing the ionizable lipid of formula (I) or the ionizable lipids shown in Table 1 exhibit higher levels of transduction in hepatocytes and / or higher expression of payload proteins in hepatocytes compared with LNPs containing V003 as the ionizable lipid. V003 is shown below. V003 is shown below and is described in U.S. Patent No. 10,059,655. [ka]

[0116] In some embodiments, lipid 154 is used as an ionizable lipid to generate LNPs for delivery to cells (e.g., T cells, HSCs, or liver cells). In some embodiments, lipid 155 is used as an ionizable lipid to generate LNPs for delivery to cells (e.g., T cells, HSCs, or liver cells). In some embodiments, lipid 163 is used as an ionizable lipid to generate LNPs for delivery to cells (e.g., T cells, HSCs, or liver cells). In some embodiments, lipid 173 is used as an ionizable lipid to generate LNPs for delivery to cells (e.g., T cells, HSCs, or liver cells). In some embodiments, lipid 232 is used as an ionizable lipid to generate LNPs for delivery to cells (e.g., T cells, HSCs, or liver cells).

[0117] In some embodiments, the mol% of ionizable lipids in LNPs, e.g., targeted LNPs, is about 25% to about 65%. In some embodiments, the mol% of ionizable lipids in LNPs, e.g., targeted LNPs, is about 35% to about 60%. In some embodiments, the mol% of ionizable lipids in LNPs, e.g., targeted LNPs, is about 40% to about 50%. In some embodiments, the mol% of ionizable lipids in LNPs, e.g., targeted LNPs, is about 45% to about 50%.

[0118] The compounds disclosed herein (e.g., the lipids in Table 1), or their pharmaceutically acceptable salts, may contain asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric forms. This disclosure intends various stereoisomers and mixtures thereof, and includes “enantiomers” referring to two stereoisomers whose molecules are mirror images of each other and cannot be superimposed on each other, and “diastereomers” referring to stereoisomers having at least two asymmetric atoms but not being mirror images of each other. This disclosure means including all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), or (R)- and (S)- isomers may be prepared using chiral synthones or chiral reagents, or may be decomposed using conventional techniques, e.g., chromatography and fractionation crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include, for example, chiral synthesis from suitable optically pure precursors or racemic decomposition using chiral high-pressure liquid chromatography (HPLC). If a compound described herein contains an olefin double bond or other geometrically asymmetrical center, unless otherwise specified, the compound is intended to include both E and Z geometric isomers.

[0119] Helper lipids The LNPs of this disclosure, for example, targeted LNPs, comprise one or more ionizable lipids. Examples of helper lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylglycerol (DPPG), and dioleoyl-phosphatidylethanolamine. Min (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), monomethylphosphatidylethanol Amines (e.g., 16-O-monomethylPE), dimethylphosphatidylethanolamine (e.g., 16-O-dimethylPE), l8-l-transPE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine, egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosph Phosphatidylglycerol (DSPG), Diethylphosphatidylcholine (DEPC), Palmitoyloleoylphosphatidylglycerol (POPG), Diethyloylphosphatidylethanolamine (DEPE), Lecithin, Phosphatidylethanolamine, Lysolecithin, Lysophosphatidylethanolamine, Phosphatidylserine, Phosphatidylinositol, Sphingomyelin, Egg sphingomyelin (ESM), Cephalin, Cardiolipin, Phosphatidic acid, Cerebroside, Dicetylphosphate,Examples include lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof. It is understood that other diacylphosphatidylcholines and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, pimitoyl, stearoyl, or oleoyl. Additional exemplary lipids, in certain embodiments but not limited to those described herein, are those described in Kim et al. (2020)dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated herein by reference.

[0120] Other examples of noncationic lipids suitable for use in lipid nanoparticles include, but are not limited to, nonphospholipids such as stearylamine, dodeeylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramides, and sphingomyelin. Other noncationic lipids are described in WO2017 / 099823 or U.S. Patent Publication US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the noncationic lipid is oleic acid or a compound of formula I, II, or IV of US2018 / 0028664 (the entire text of which is incorporated herein by reference).

[0121] In some embodiments, the helper lipid is a sphingolipid. In some such embodiments, the non-pegylated lipid is sphingomyelin. In some embodiments, the sphingomyelin has a head group selected from phosphocholine, phosphoethanolamine, or ceramide. In some embodiments, the sphingomyelin is egg sphingomyelin.

[0122] In some embodiments, helper lipids comprise 5–40% (mol), 8–30%, 10–28%, 20–36%, 22–32%, or 10–15% (mol) of the total lipids present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipids to neutral lipids is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0123] In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in LNPs, e.g., targeted LNPs, is about 18% to about 32%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in LNPs, e.g., targeted LNPs, is about 20% to about 30%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in LNPs, e.g., targeted LNPs, is about 22% to about 32%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in LNPs, e.g., targeted LNPs, is about 22% to about 28%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in targeted LNPs is about 21% to about 23%. In some embodiments, the mol% of helper lipids (e.g., DSPC or sphingomyelin) in the targeted LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, about 30%, about 31%, or about 32%. As shown in the following examples, in vivo delivery of a particular payload after administration of a disclosed LNP (e.g., a targeted LNP) having these proportions of helper lipids provides enhanced transduction and expression of the payload compared to a targeted LNP having less or more helper lipids.

[0124] In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) in LNPs, e.g., targeted LNPs, is about 1:1 to about 7:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 4:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 3:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC) is about 1:1 to about 2.5:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 2:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC) is about 1.5:1 to about 2.5:1. In some embodiments, the molar ratio between ionizable lipids and non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 2:1 to about 2.5:1.

[0125] In some embodiments, the LNP, e.g., targeted LNP, comprises the ionizable lipids and DSPCs listed in Table 1. In some embodiments, the LNP, e.g., targeted LNP, comprises the ionizable lipids and sphingomyelin listed in Table 1. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 22% to about 28%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0126] In some embodiments, the LNP, e.g., targeted LNP, comprises an ionizable lipid of formula I and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises an ionizable lipid of formula I and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 22% to about 28%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0127] In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 154 and DSPC. In some embodiments, the LNP, e.g., targeted LNP, comprises lipid 154 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, e.g., targeted LNP, is about 22% to about 28%. In some embodiments, the mol% of DSPC or sphingomyelin in the targeted LNP is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0128] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 155 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 155 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0129] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 163 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 163 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0130] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 173 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 173 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0131] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 209 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 209 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0132] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 232 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 232 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0133] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 262 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 262 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0134] In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 263 and DSPC. In some embodiments, the LNP, for example, the targeted LNP, comprises lipid 263 and sphingomyelin. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 25%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20% to about 30%. In some embodiments, the mol% of DSPC or sphingomyelin in the LNP, for example, the targeted LNP, is about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 25%, about 27%, about 28%, about 29%, or about 30%.

[0135] Sterols In some embodiments, the LNPs of this disclosure, e.g., targeted LNPs, may include components such as sterols to provide membrane integrity. One exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include 5α-coestanol, 53-coprostanol, and coesteryl-(2 , Polar analogs such as hydroxy-ethyl ether, coesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as coesteryl-(4'-hydroxy)-buty-1 ether. Exemplary cholesterol derivatives are described in PCT Publication W02009 / 127060 and U.S. Patent Publication US2010 / 0130588, each of which is incorporated herein by reference in whole.

[0136] In some embodiments, components that provide membrane integrity, such as sterols, may include 0-50% (mol) of the total lipids present in the lipid nanoparticles (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components may be 20-50% (mol) or 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0137] In some embodiments, the molar ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 6:1 to about 0.5:1. In some embodiments, the ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 3:1 to about 0.5:1. In some embodiments, the ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 2:1 to about 0.5:1. In some embodiments, the ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1.5:1 to about 0.5:1. In some embodiments, the ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:1 to about 0.5:1. In some embodiments, the ratio of cholesterol molecules to non-pegylated helper lipids (e.g., DSPC or sphingomyelin) is about 1:2 to about 0.8:1.

[0138] PEGylated lipids In some embodiments, the LNPs of this disclosure, e.g., target LNPs, may include polyethylene glycol (PEG) or conjugated lipid molecules. Generally, these are used to inhibit aggregation of lipid nanoparticles and / or to provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic-polymeric lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, e.g., a (methoxypolyethylene glycol) conjugated lipid.

[0139] Examples of PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (e.g., l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-diakiloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG-2K), and PEG-succinate diacylglycerol ( Examples include PEG-S-DMG)(4-O-(2',3'-di(tetradecanoyloxy)propyl-l-O-(w-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG)), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are, for example, US5,885,613, US6,287,591, U The contents of S2003 / 0077829, US2003 / 0077829, US2005 / 0175682, US2008 / 0020058, US2011 / 0117125, US2010 / 0130588, US2016 / 0376224, US2017 / 0119904, and US / 099823 are described, and all of these contents are incorporated herein by reference in their entirety. In some embodiments, PEG-lipids are derived from formulas III, III-aI, III-a-2, III-b-1, III-b-2 of US2018 / 0028664. or a compound of V, the contents thereof are incorporated herein by reference in whole. In some embodiments, the PEG-lipid is of formula II of US20150376115 or US2016 / 0376224, the contents thereof are incorporated herein by reference in whole. In some embodiments, the PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl.PEG-lipids include PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (l-[8'-(cholest-5-ene-3[beta]-oxy)carboxamide-3',6'-dioxaoctanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB(3,4-di The PEG-lipid may be one or more of tetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid is as follows: [ka] Includes structures selected from.

[0140] In some embodiments, lipids conjugated with molecules other than PEG can also be used instead of PEG lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic-polymer lipid (GPL) conjugates can be used instead of or in addition to PEG lipids.

[0141] Exemplary conjugated lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019 / 051289A9 and WO2020 / 106946A1, all of which are incorporated herein by reference in their entirety.

[0142] In some embodiments, the pegylated lipid has at least one C16 (palmitoyl) PEG lipid anchor. In some embodiments, the pegylated lipid has two C16 PEG lipid anchors (i.e., dialkyl chains with a carbon length of 16). In some embodiments, the pegylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DPPE-PEG2000). In some embodiments, the pegylated lipid is 1,2-dipalmitoyl-rac-glycero-3-methylpolyoxyethylene (DPG-PEG2000). In some embodiments, the pegylated lipid is C16 PEG ceramide. In some embodiments, target LNPs containing C16 pegylated lipids show reduced hepatic uptake compared to other identical LNPs containing C14 pegylated lipids.

[0143] In some embodiments, the pegylated lipid has at least one C18 PEG lipid anchor. In some embodiments, the pegylated lipid has two C18 PEG lipid anchors (i.e., dialkyl chains with a carbon length of 18). In some embodiments, the C18 pegylated lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2000). In some embodiments, the C18 pegylated lipid is distearoyl-rac-glycerol-PEG2000 (DSG-PEG2000).

[0144] In some embodiments, PEG or conjugated lipids may be present in amounts of 0-20% (mol) of the total lipids in the lipid nanoparticles. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipids in the lipid nanoparticles.

[0145] Additional components In some embodiments, one or more additional compounds may also be included in the LNPs of this disclosure, e.g., targeted LNPs. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain a payload, e.g., other compounds such as therapeutic agents, as described herein. In some embodiments, the lipid nanoparticles may contain one or more nucleic acids. In some embodiments, the lipid nanoparticles may contain at least a first nucleic acid and a second nucleic acid, the second nucleic acid being different from the first nucleic acid. Other additional compounds may be selected from the group consisting of small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, their peptide analogs and derivatives, peptide mimes, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.

[0146] In some embodiments, lipid nanoparticles (or formulations containing lipid nanoparticles) are either devoid of reactive impurities (e.g., aldehydes or ketones) or contain reactive impurities (e.g., aldehydes or ketones) below a pre-selected level. While we do not wish to be constrained by theory, in some embodiments, lipid reagents are used to prepare lipid nanoparticle formulations, and these lipid reagents may contain contaminating reactive impurities (e.g., aldehydes or ketones). Lipid reagents may be selected for production based on having reactive impurities (e.g., aldehydes or ketones) below a pre-selected level. While we do not wish to be constrained by theory, in some embodiments, aldehydes can cause RNA modification and damage, e.g., crosslinking between bases and / or covalent conjugation of lipids to RNA (e.g., forming lipid-RNA adducts). This can, in some cases, lead to failure of the reverse transcriptase reaction and / or improper base incorporation, e.g., at lesion sites, e.g., mutations in newly synthesized target DNA.

[0147] In some embodiments, lipid nanoparticle formulations are prepared using lipid reagents containing a total reactive impurity (e.g., aldehyde) content of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, lipid nanoparticle formulations are prepared using lipid reagents containing any single reactive impurity (e.g., aldehyde) species in a concentration of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, the lipid nanoparticle formulation is prepared using a lipid reagent containing (i) a total reactive impurity (e.g., aldehyde) content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.4%, 0.3%, 0.2%, or 0.1%, and (ii) any single reactive impurity (e.g., aldehyde) species in amounts of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%. In some embodiments, the lipid nanoparticle formulation is prepared using multiple lipid reagents, each of which independently satisfies one or more criteria described in this paragraph. In some embodiments, each of which lipid reagents satisfies the same criteria, e.g., the criteria in this paragraph.

[0148] In some embodiments, the lipid nanoparticle formulations include total reactive impurity (e.g., aldehyde) content of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, the lipid nanoparticle formulations include any single reactive impurity (e.g., aldehyde) species in amounts of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, the lipid nanoparticle formulation contains (i) a total reactive impurity (e.g., aldehyde) content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.4%, 0.3%, 0.2%, or 0.1%, and (ii) any single reactive impurity (e.g., aldehyde) species in a content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%.

[0149] In some embodiments, one or more, or optionally all, of the lipid reagents used in the lipid nanoparticles or formulations described herein contain a total reactive impurity (e.g., aldehyde) content of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, one or more, or optionally all, of the lipid reagents used in the lipid nanoparticles or formulations described herein contain any single reactive impurity (e.g., aldehyde) species in a content of 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or less than 0.1%. In some embodiments, one or more, or all of the lipid reagents used in the lipid nanoparticles or formulations described herein, contain (i) a total reactive impurity (e.g., aldehyde) content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.4%, 0.3%, 0.2%, or 0.1%, and (ii) any single reactive impurity (e.g., aldehyde) species in amounts of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%.

[0150] In some embodiments, the total aldehyde content and / or amount of any single reactive impurity species (e.g., aldehyde) is determined, for example, by liquid chromatography (LC) combined with tandem mass spectrometry (MS / MS), according to the method described in Example 34. In some embodiments, the reactive impurity content and / or amount of a reactive impurity species (e.g., aldehyde) is determined, for example, by detecting one or more chemical modifications of nucleic acid molecules (e.g., RNA molecules, as described herein) associated with the presence of the reactive impurity species (e.g., aldehyde) in the lipid reagent. In some embodiments, the reactive impurity content and / or amount of a reactive impurity species (e.g., aldehyde) is determined, for example, by detecting one or more chemical modifications of nucleotides or nucleosides (e.g., ribonucleotides or ribonucleosides, for example, as described herein, for example, contained in or isolated from template nucleic acids) associated with the presence of the reactive impurity species (e.g., aldehyde) in the lipid reagent. In the embodiment, chemical modifications of nucleic acid molecules, nucleotides, or nucleosides are detected, for example, by determining the presence of one or more modified nucleotides or nucleosides using LC-MS / MS analysis.

[0151] III. Conjugate In one embodiment, the present disclosure provides LNPs comprising ionizable lipids as described herein (e.g., Table 1), which can deliver a payload, such as a therapeutic agent (e.g., a gene modification system), to a cell. In some embodiments, the cell is an HSC (e.g., LT-HSC) or an HPC. In other embodiments, the cell is a T cell. In other embodiments, the cell is a liver cell.

[0152] In another embodiment, the LNP (conjugate) includes a target-directing moiety that binds to a protein (e.g., a protein receptor) on a cell such as an HSC (e.g., LT-HSC), HPC, T cell, or liver cell, as described herein. In some embodiments, the LNP conjugate includes both an ionizable lipid and a target-directing moiety, as described herein.

[0153] In one embodiment, the Disclosure provides a targeted LNP (conjugate) comprising a target-directed moiety and lipid nanoparticles (LNPs) encapsulating a payload (e.g., a therapeutic agent as described herein, such as a gene-modified polypeptide or gene-modification system), wherein the target-directed moiety binds to proteins (e.g., protein receptors) on HSCs (e.g., LT-HSCs), HPCs, T cells, or liver cells. In some embodiments, the target-directed moiety is an antibody or its antigen-binding fragment. In some examples, the target-directed moiety is an antibody, a Fab fragment, scFv, DARPIN, a VHH domain antibody, an FN3 domain, a nanobody, a single-domain antibody, or centinrin. In other embodiments, the target-directed moiety is a folic acid moiety, an antibiotic mimetic, a polynucleotide (e.g., a DNA or RNA apatamer), a carbohydrate, a vitamin, or N-acetylgalactosamine (GalNac). In some embodiments, the payload (e.g., a therapeutic agent as described herein, such as a gene-modified polypeptide or gene-modification system) can modify one or more genes of the target HSC.

[0154] In some embodiments, the constituent element of the targeting moiety of the conjugate of the present disclosure can target a cell surface antigen or receptor. In some embodiments, the constituent element of the targeting moiety of the conjugate of the present disclosure targets a T cell receptor, including but not limited to CD2, CD3, CD4, CD5, CD6, or CD7. In other embodiments, the constituent element of the targeting moiety of the conjugate of the present disclosure targets a hematopoietic stem cell (HSC). In some embodiments, the constituent element of the targeting moiety of the conjugate of the present disclosure targets an HSC receptor, including but not limited to CD90 or CD117. In other embodiments, the constituent element of the targeting moiety of the conjugate binds to CD8, TCR alpha, TCR beta, CD10, CD33, CD34, CD68, CD19, CCR7, CD62L, CD25, CXCR3, CCR2, CCR3, CCR4, CCR5, CCR, or CCR7.

[0155] In certain embodiments, the targeting moiety binds to CD4+ or CD8+ T cells. In other embodiments, the targeting moiety binds to natural killer (NK) cells. In other embodiments, the targeting moiety binds to hematopoietic stem cells. In other embodiments, the targeting moiety binds to lymphoid progenitor cells. In other embodiments, the targeting moiety binds to myeloid cells. In other embodiments, the targeting moiety binds to macrophages.

[0156] In some embodiments, the LNP comprises a targeting moiety that targets a receptor on the surface of HSCs selected from CD33, CD34, CD38, CD43, CD46, CD49d, CD50, CD59, CD71, CD105, CD117, CD123, CD164, CD184, and CD338. In some embodiments, the targeting moiety on the LNP binds CD33. In some embodiments, the targeting moiety on the LNP binds CD34. In some embodiments, the targeting moiety on the LNP binds CD38. In some embodiments, the targeting moiety on the LNP binds CD43. In some embodiments, the targeting moiety on the LNP binds CD46. In some embodiments, the targeting moiety on the LNP binds CD49d. In some embodiments, the targeting moiety on the LNP binds CD50. In some embodiments, the targeting moiety on the LNP binds CD59. In some embodiments, the targeting moiety on the LNP binds CD71. In some embodiments, the targeting moiety on the LNP binds CD105. In some embodiments, the targeting moiety on the LNP binds CD117. In some embodiments, the targeting moiety on the LNP binds CD123. In some embodiments, the targeting moiety on the LNP binds CD184. In some embodiments, the targeting moiety on the LNP binds CD164. In some embodiments, the targeting moiety on the LNP binds CD338.

[0157] In some embodiments, as described herein, lipid nanoparticles (LNPs) for delivering a therapeutic agent to HSCs are an ionizable lipid and a helper lipid, wherein the ionizable lipid is an ionizable lipid of Formula (I), or a salt thereof (e.g., Lipid 154, Lipid 155, Lipid 209, Lipid 232, Lipid 262, or Lipid 263), and the helper lipid, Multiple target-direction portions conjugated to an LNP, wherein each of the multiple target-direction portions is conjugated to at least one of CD33, CD34, CD38, CD43, CD59, CD105, CD123, CD164, CD338, CD71, CD117, CD50, CD49d, CD46, or CD184 (CXCR4), It includes a therapeutic agent encapsulated within the LNP.

[0158] In some embodiments, a double binder can be added to the surface of the LNP by the method described herein. For example, in some embodiments, each of the target-directed moieties is conjugated to a lipid nanoparticle via a linker, and each linker contains a click product formed from a click reaction between a first click handle of the target-directed moiety and a second click handle of the LNP. In some such embodiments, the target-directed moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directed moiety is an ScFv. In some embodiments, the target-directed moiety is a Fab fragment.

[0159] In some embodiments, multiple target-directing portions are coupled to two or more of the following: CD33, CD34, CD38, CD43, CD59, CD105, CD123, CD164, CD338, CD71, CD117, CD50, CD49d, CD46, or CD184 (CXCR4). In some embodiments, multiple target-directing portions are coupled to CD117 and CD34. In some embodiments, multiple target-directing portions are coupled to CD117 and CD71. In some embodiments, multiple target-directing portions are coupled to CD34 and CD71. In some embodiments, multiple target-directing portions are coupled to CD117 and CD50. In some embodiments, multiple target-directing portions are coupled to CD34 and CD50.

[0160] In some embodiments, two different target-directing moieties can bind to the same receptor on the surface of the HSC. For example, in some embodiments, both target-directing moieties can bind to CD117. In other embodiments, both target-directing moieties can bind to CD34.

[0161] In some embodiments, as described herein, lipid nanoparticles (LNPs) for delivering a therapeutic agent to HSCs are, Multiple target-direction portions conjugated to an LNP, wherein the multiple target-direction portions are coupled to CD33, CD34, CD38, CD43, CD59, CD105, CD123, CD164, CD338, CD71, CD117, CD50, CD49d, CD46, or CD184 (CXCR4), It includes a therapeutic agent encapsulated within the LNP.

[0162] In some aspects, the present disclosure provides targeted lipid nanoparticles (LNPs) for in vivo delivery of therapeutic agents to HSCs (e.g., LT-HSCs), where the LNPs are i. An ionizable lipid of formula (I), or a salt thereof (e.g., lipid 154), ii. Helper lipids and, iii. Two different target-directed portions conjugated to an LNP, each of which is conjugated to a target on the surface of an HSC (e.g., an LT-HSC), iv. A system comprising one or more nucleic acids (e.g., two or more nucleic acids) that encode components of a system for modifying or altering genomic DNA (e.g., a gene modification system), wherein one or more nucleic acids (e.g., two or more nucleic acids) are RNA molecules.

[0163] Method for preparing targeted LNPs (conjugates) Different approaches can be used to introduce target-directed moieties to the surface of LNPs. For example, one approach relies on the functionalization of pre-formed LNPs having target-directed moieties. LNPs generally contain lipids having polyethylene glycol (PEG) spacers functionalized with reactive moieties such as thiols, amines, maleimides, or carboxylic acid groups. The functionalized lipid of the LNP reacts with complementary groups covalently bonded to the target-directed moiety, thus forming a conjugate between the LNP and the target-directed moiety.

[0164] In some embodiments, the target-directed moiety is conjugated to lipid nanoparticles via a linker, the linker comprising a click product formed from a click reaction between a first click handle of the target-directed moiety and a second click handle of the LNP. In some such embodiments, the target-directed moiety is an antibody or its antigen-binding fragment. In other such embodiments, the target-directed moiety is an ScFv. In some embodiments, the target-directed moiety is a Fab fragment.

[0165] In one embodiment, the click product can be formed using a copper-catalyzed click reaction. One such copper-catalyzed click reaction is the hysgene 1,3-dipolar cycloaddition (CuAAC) between an azide and an alkyne. In some embodiments, the first or second click handle includes a cyclic derivative of the alkynyl group. In some embodiments, the cyclic derivative of the alkynyl group is selected from dibenzocyclooctin, cyclooctin, and difluorinated cyclooctin. In some embodiments, the click chemistry involves strain-promoted cycloaddition of the azide. In some embodiments, the click chemistry is based on the reaction of a strained alkene.

[0166] In another embodiment, the click product can be formed using copper-free click chemistry. For example, the click product can be formed between an azide and dibenzocyclooctene (DBCO). Alternatively, the click product can be formed using a Staudinger reaction between an azide and a phosphine, thus producing an aza-ylide.

[0167] In some embodiments, the click product can be formed from an inverse electron-demanded Diels-Alder reaction between a trans-cyclooctene (TCO) moiety on a first or second click handle and a tetrazine ring on a first or second click handle. In some embodiments, the first click handle comprises a tetrazine (Tz) ring, and the second click handle comprises a TCO moiety. In some embodiments, the tetrazine ring is unsubstituted. In some such embodiments, the tetrazine ring is methyltetrazine. In some embodiments, the tetrazine ring is 6-methylsubstituted tetrazine.

[0168] In another embodiment, the target-directing moiety (e.g., antibody, Fab fragment, or ScFv) is first selectively modified with an enzyme recognition sequence. An enzyme recognizing the enzyme recognition sequence can site-specifically introduce a first click handle to the target-directing moiety via covalent bonding. The first click handle can then react with a second click handle on the LNP to generate a targeted LNP. Thus, in one embodiment, an antibody, Fab fragment, or single-stranded variable fragment (scFv) covalently bonded to a first click handle via a linker containing the enzyme recognition sequence is reacted with an LNP containing a second click handle, thereby forming a click reaction product that conjugates the antibody, Fab fragment, or ScFv to the LNP. In some embodiments, the antibody, Fab fragment, or ScFv is directly bound to the enzyme recognition sequence. In some embodiments, the target-directing moiety (e.g., antibody, Fab fragment, or scFv) is bound to the enzyme recognition sequence via one or more amino acid residues. Specific amino acid residues that can be covalently bonded to the C-terminus of a target-directing moiety (e.g., antibody, Fab fragment, or scFv) include, but are not limited to, (GGGGS)v (SEQ ID NO: 1), (G) v , (EAAAK)v(Sequence ID 2) 、 (PAPAP)v(SEQ ID NO: 3), (AP) v Examples include A(EAAAK)u ALEA(EAAAK)vA (sequence number 4), where u is 1-10 and v is 1-10.

[0169] In some embodiments, the enzyme recognition sequence is a saltase recognition motif or a LplA acceptor peptide. In some embodiments in which the LNP is conjugated to an antibody, one or more C-terminuses of the heavy or light chain of the antibody are covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide) directly or via a linker comprising one or more amino acid residues as shown herein. In some embodiments in which the LNP is conjugated to a Fab fragment, the C-terminuses of the heavy or light chain of the Fab fragment are covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide). In some embodiments in which the LNP is conjugated to an scFv, the C-terminus of the scFv is covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide). In some of the embodiments described above, the first click handle comprises a tetrazine ring or TCO moiety, and the second click handle comprises a tetrazine ring or TCO moiety. In some such embodiments, the first click handle comprises a tetrazine ring, and the second click handle comprises a TCO moiety. In some embodiments, the tetrazine ring is methyltetrazine. In some embodiments, the conjugation efficiency achieved by the method of the present disclosure is greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In some embodiments, the conjugation efficiency achieved by the method of the present disclosure is about 60% to about 95%. In some embodiments, the conjugation efficiency achieved by the disclosed method is about 70% to about 85%.

[0170] In some embodiments, the linker further includes a spacer between the target-directing moiety and the click product. The spacer may include additional functional groups that indirectly link the target-directing moiety to the Tz group. The spacer may also include additional amino acid residues that indirectly link the target-directing moiety to the Tz group.

[0171] In some embodiments, the first or second click handle is a tetrazine derivative having one of the following structures,

Chemical Formula

Chemical Formula

[0172] In some embodiments, the first or second click handle is a TCO derivative having one of the following structures.

Chemical Formula

[0173] In some embodiments, the spacer linking the target-directing moiety to the Tz ring is an enzyme recognition sequence. Accordingly, the Disclosure provides a method for conjugating an LNP to a target-directing moiety modified with an enzyme recognition sequence, the conjugation being achieved by a click reaction between the Tz ring covalently bonded to the target-directing moiety and the TCO moiety bonded to the LNP. For example, the Disclosure provides a method for conjugating an LNP to an antibody, Fab fragment, or single-stranded variable fragment (ScFv), wherein the antibody, Fab fragment, or ScFv is covalently bonded to a first click handle (Tz ring) via a linker containing an enzyme recognition sequence, and the LNP is covalently bonded to a second click handle (TCO moiety), the method comprising contacting the LNP with the antibody, Fab fragment, or ScFv such that the first click handle reacts with the second click handle to form a click reaction product (dihydropyridazine) that conjugates the antibody, Fab fragment, or ScFv to the LNP. In some embodiments, the antibody, Fab fragment, or ScFv is directly bound to the enzyme recognition sequence. In some embodiments, the antibody, Fab fragment, or ScFv is bound to the enzyme recognition sequence via one or more amino acid residues. Specific amino acid residues that can be covalently bound to the C-terminus of the antibody, Fab fragment, or ScFv include, but are not limited to, (GGGGS)v (SEQ ID NO: 1), (G) v , (EAAAK)v(Sequence ID 2) 、 (PAPAP)v(SEQ ID NO: 3), (AP) v Examples include A(EAAAK)u ALEA(EAAAK)vA (sequence number 4), where u is 1-10 and v is 1-10.

[0174] In some embodiments, the enzyme recognition sequence is a saltase recognition motif or a LplA acceptor peptide. In some embodiments where the LNP is conjugated to an antibody, one or more C-terminuses of the antibody's heavy or light chain are covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide) directly or via a linker comprising one or more amino acid residues as shown herein. In some embodiments where the LNP is conjugated to a Fab fragment, the C-terminuses of the heavy or light chain of the Fab fragment are covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide). In some embodiments where the LNP is conjugated to an ScFv, the C-terminus of the ScFv is covalently bound to the enzyme recognition sequence (e.g., a saltase recognition motif or a LplA acceptor peptide). In some embodiments, the conjugation efficiency achieved by the methods of this disclosure is greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In some embodiments, the conjugation efficiency achieved by the method disclosed is approximately 60% to approximately 95%. In some embodiments, the conjugation efficiency achieved by the disclosed method is approximately 70% to approximately 85%.

[0175] In one embodiment, lipid nanoparticles conjugated to an antibody, Fab fragment, or ScFv in a site-specific manner are as follows: (i) The step of covalently attaching a peptide having a saltase recognition site to one or more C-terminuses of an antibody or Fab fragment, or to the C-terminus of an ScFv, (ii) In the presence of a saltase enzyme, under conditions suitable for the saltase enzyme to ligate the antibody, Fab fragment, or ScFv to a first click handle, the product of step (i) is brought into contact with a first click handle containing a Tz ring covalently bonded to three or more glycine residues, (iii) A step of contacting the product of step (ii) with lipid nanoparticles (LNPs), wherein one or more lipids comprising LNPs comprises a second click handle that can react with a first click handle, and the second click handle comprises a TCO moiety, thereby producing a click product.

[0176] In some embodiments, step (i) includes covalent bonding of a linker to one or more C-terminuses of an antibody or Fab fragment, or to the C-terminus of an ScFv, of a peptide having a saltase recognition site. In some embodiments, the linker comprises one or more amino acid residues. Specific amino acid residues that can be covalently bonded to the C-terminus of an antibody, Fab fragment, or ScFv include, but are not limited to, (GGGGS)v (SEQ ID NO: 1), (G) v , (EAAAK)v(Sequence ID 2) 、 (PAPAP)v(SEQ ID NO: 3), (AP) v Examples include A(EAAAK)u ALEA(EAAAK)vA (sequence number 4), where u is 1-10 and v is 1-10.

[0177] In some embodiments, the antibody, Fab fragment, or the saltase recognition motif attached to the C-terminus of ScFv is bound to one or more amino acid residues. For example, in some embodiments, the glycine (G) of the LPXTG (SEQ ID NO: 5) motif can be bound to one or more (e.g., 1 to 10) histidine (H) residues (see Figure 1). The glycine and histidine residues are removed during the transpeptidation reaction.

[0178] In some embodiments, step (ii) (i.e., the saltase-catalyzed reaction) is carried out in the presence of saltase A5. Saltase A5 is a modified variant of wild-type saltase from Staphylococcus aureus that is significantly more active than wild-type saltase. See U.S. Patent No. 9,267,227. In such embodiments, the saltase recognition site binding to the antibody, Fab fragment, or ScFv in step (i) has the sequence LPXTG (SEQ ID NO: 5), where X is any amino acid residue. In step (ii), saltase A catalyzes the transpeptidation reaction between the LPXTG (SEQ ID NO: 5) recognition motif and the glycine residue bound to the first click handle by cleaving the saltase recognition site between the threonine and glycine residues.

[0179] In other embodiments, step (ii) is carried out in the presence of the saltase enzyme Streptococcus pyogenes saltase A (SpSrtA WT). In such embodiments, the saltase recognition site binding to the antibody, Fab fragment, or ScFv in step (i) has the sequence LPXTA (SEQ ID NO: 6), where X is any amino acid residue. In step (ii), SpSrtA catalyzes the transpeptidation reaction between the LPXTA (SEQ ID NO: 6) recognition motif and the glycine residue bound to the first click handle by cleaving the saltase recognition site between the threonine and alanine residues.

[0180] Figure 1 illustrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via saltase-mediated ligation followed by a click reaction. In the schematic diagram, the C-terminus of the Fab fragment is first covalently modified with a saltase recognition motif covalently bonded to six histidine (H) residues. The saltase-modified Fab fragment is then reacted with a first click handle (click handle 1) covalently bonded to a glycine (G) residue. The resulting Fab fragment modified with the first click handle is then reacted with an LNP containing at least one lipid covalently bonded to a second click handle (click handle 2), thereby obtaining an LNP site-specifically conjugated to the Fab fragment.

[0181] In one embodiment, the conjugate comprises the aforementioned protein targeting moiety (e.g., antibody, Fab fragment, or ScFv) and lipid nanoparticles (LNP), where the C-terminus of the targeting moiety is conjugated to the lipid nanoparticles via a linker, and the linker comprises a saltase recognition motif and a click product formed from a click reaction between a first click handle of the targeting moiety and a second click handle of the LNP. In some embodiments, one or more C-terminuses of the heavy or light chain of an antibody, the C-terminus of the heavy or light chain of a Fab fragment, or the C-terminus of an ScFv are conjugated to lipid nanoparticles via a linker, and the linker comprises a saltase recognition motif and a click product formed from a click reaction between a first click handle of the antibody, Fab fragment, or ScFv and a second click handle of the LNP. In certain embodiments, the saltase recognition motif comprises an LPXT motif, where X is any amino acid residue. In some such embodiments, the saltase recognition motif comprises an LPET motif. In some embodiments, the linker contains three or more glycine residues between the saltase recognition motif and the click product. In some embodiments, the linker contains 3 to 50 glycine residues. In some embodiments, the linker contains 3 to 10 glycine residues. In some such embodiments, the linker contains 3, 4, 5, or 6 glycine residues.

[0182] In some embodiments, the conjugate is antibody-LPXT(G) n - Click product - LNP, Fab fragment - LPXT(G) n - Click product - LNP, or ScFv-LPXT(G) n The click product has the structure of an LNP, where X is any amino acid residue and n is 1 to 20 (e.g., 3 to 10 or 3 to 6). In these embodiments, the leucine (L) residue of the saltase recognition motif is bound to at least one C-terminus of the antibody or Fab fragment, or to the C-terminus of the ScFv. In some such embodiments, X is E. In some embodiments, the linker between the antibody (or Fab fragment or ScFv) and the click includes the following amino acid residues: LPETGGG (SEQ ID NO: 7), LPETGGGG (SEQ ID NO: 8), LPETGGGGG (SEQ ID NO: 9), LPETAGGG (SEQ ID NO: 10), or LPETGGGGGG (SEQ ID NO: 11).

[0183] In some embodiments, the linker includes additional amino acid residues between the antibody, Fab fragment, or ScFv and the saltase recognition motif. In such embodiments, the C-terminus of the antibody, Fab fragment, or ScFv can be covalently modified with one or more amino acid residues before covalently bonding the saltase recognition motif. For example, in certain embodiments, the conjugate is antibody-Z-LPXT(G) n - Click product - LNP, Fab fragment - Z-LPXT(G) n - Click product - LNP, or ScFv-Z-LPXT(G) n The click product has the structure of an LNP, where Z is a linker between the antibody (or Fab fragment or ScFv) and the leucine of the saltase recognition motif. In some embodiments, Z comprises one or more amino acid residues. In some embodiments, Z is (GGGGS)v (SEQ ID NO: 1), (G) v , (EAAAK)v(Sequence ID 2) 、 (PAPAP)v(SEQ ID NO: 3), (AP) v, and A(EAAAK)u ALEA(EAAAK)vA(SEQ ID NO: 4), where u is 1 to 10 and v is 1 to 10. In some embodiments, Z is GG, GGG, GGGG (SEQ ID NO: 12), GGGGG (SEQ ID NO: 13), GGGGGG (SEQ ID NO: 14), and GGGGGGG (SEQ ID NO: 15) or GGGGGS (SEQ ID NO: 16).

[0184] In some embodiments, the conjugate is antibody-LPXT(G) n -Dihydropyridazine-LNP, Fab fragment-LPXT(G) n -Dihydropyridazine-LNP, or ScFv-LPXT(G) n -Dihydropyridazine-LNP, antibody-Z-LPXT(G) n -Dihydropyridazine-LNP, Fab fragment-Z-LPXT(G) n -Dihydropyridazine-LNP, or ScFv-Z-LPXT(G) n The structure is -dihydropyridazine-LNP, where the variables n and Z are defined as above. In certain embodiments, the dihydropyridazine moiety is 1,4-dihydropyridazine.

[0185] In another embodiment, LNP lipids are (i) Covalently attaching the LplA acceptor peptide site to an antibody, Fab fragment, or ScFv, (ii) Contacting the product of step (i) with a carboxylic acid compound containing a first click handle containing a Tz ring in the presence of lipoic acid ligase under conditions suitable for the lipoic acid ligase to ligate the antibody, Fab fragment, or ScFv to the first click handle, (iii) Contacting the product of step (ii) with lipid nanoparticles (LNPs), wherein one or more lipids comprising the LNPs are conjugated to an antibody, Fab fragment, or ScFv in a site-specific manner, comprising contacting a second click handle that can react with a first click handle, the second click handle comprising a TCO moiety, thereby generating a click product.

[0186] In some embodiments of step (i), the Lp1A acceptor peptide is covalently bound to one or more C-terminuses of the antibody or Fab fragment. In other embodiments of step i), the Lp1A acceptor peptide is covalently bound to the C-terminus of the ScFv.

[0187] In some embodiments, step (i) involves covalently bonding the Lp1A acceptor peptide to a linker covalently bonded to one or more C-terminuses of the antibody or Fab fragment, or to the C-terminus of ScFv. In some embodiments, the linker comprises one or more amino acid residues. Specific amino acid residues that can be covalently bonded to the C-terminus of the antibody, Fab fragment, or ScFv include, but are not limited to, (GGGGS)v (SEQ ID NO: 1), (G)v, (EAAAK)v (SEQ ID NO: 2), (PAPAP)v (SEQ ID NO: 3), (AP)v, and A(EAAAK)u ALEA(EAAAK)vA (SEQ ID NO: 4), where u is 1 to 10 and v is 1 to 10.

[0188] In some embodiments, step (ii) (i.e., lipoic acid ligase-catalyzed reaction) is carried out in the presence of a mutated lipoic acid ligase, where tryptophan is mutated and located at the lipoic acid ligase site (W). Specific W37 variants are described in Cohen et al., 2012, ChemBioChem, 13, 888-894. In some embodiments, the mutant lipoic acid ligase is selected from W37V, W37I, W37T, W37L, W37C, W37A, and W37G.

[0189] In some embodiments, the carboxylic acid in step (ii) (i.e., lipoic acid ligase-catalyzed reaction) is a C3-C20 carboxylic acid. In some embodiments, the carboxylic acid in step (ii) is a fatty acid, for example, a C7-C19 fatty acid. In some such embodiments, the fatty acid is selected from decanoic acid, palmitic acid, lauric acid, or octanoic acid.

[0190] In other embodiments, the carboxylic acid of step (ii) has the formula COOH-R-click handle, where R comprises two lipid tails. In some such embodiments, the carboxylic acids shown below are n=1 to 120. [ka] [ka] [ka]

[0191] Figure 2 illustrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via LplA ligation followed by a click reaction. In the schematic diagram, the C-terminus of the Fab fragment is first covalently modified with an LplA acceptor peptide. Specifically, a first click handle (click handle 1) containing a Tz ring is introduced by first chemically reacting a carboxylic acid with a lysine residue of the LplA acceptor peptide. The resulting Fab fragment modified with the first click handle is then reacted with an LNP containing at least one lipid covalently attached to a second click handle (click handle 2) containing a TCO moiety, thereby obtaining an LNP site-specifically conjugated to the Fab fragment.

[0192] In some embodiments, the conjugate produced by the method disclosed herein comprises the above-mentioned protein targeting moiety (e.g., antibody, Fab fragment, or ScFv) conjugated to a lipid nanoparticle via a linker, the linker comprising a lipoic acid ligase (LplA) acceptor peptide and a click product formed from a click reaction between a first click handle of the targeting moiety and a second click handle of the LNP. In some embodiments, the linker further comprises one or more additional amino acid residues between the protein targeting moiety (e.g., antibody, Fab fragment, or ScFv) and the LplA acceptor peptide. In some embodiments, the LplA acceptor peptide has the sequence GFEDKVWYDLDA (SEQ ID NO: 17). In some embodiments, the conjugate comprises an antibody, and one or more C-terminuses of the heavy or light chain of the antibody are bound to the linker. In some embodiments, the conjugate comprises a Fab fragment, and the C-terminuses of the heavy or light chain of the Fab fragment are bound to the linker. In some embodiments, the conjugate includes an ScFv, the C-terminus of which is coupled to a linker.

[0193] In some embodiments, the linker includes additional amino acid residues between the target-directed moiety (e.g., antibody, Fab fragment, or ScFv) and the LplA acceptor peptide. In such embodiments, the C-terminus of the target-directed moiety (e.g., antibody, Fab fragment, or ScFv) can be covalently modified with one or more amino acid residues before covalently bonding the LplA acceptor peptide. For example, in certain embodiments, the conjugate has the structure target-directed moiety-Z-LplA acceptor peptide-click product-LNP (e.g., antibody-Z-LplA acceptor peptide-click product-LNP, Fab fragment-Z-LplA acceptor peptide-click product-LNP, or ScFv-Z-LplA acceptor peptide-click product-LNP), where Z is a linker between the antibody (or Fab fragment or ScFv) and a glycine residue of the LplA acceptor peptide. In some embodiments, Z includes one or more amino acid residues. In some embodiments, Z is (GGGGS)v (sequence number 1), (G)v, (EAAAK)v (sequence number 2), (PAPAP)v (sequence number 3), (AP)v, and A(EAAAK)u ALEA(EAAAK)vA (sequence number 4), where u is 1 to 10 and v is 1 to 10. In some embodiments, Z is GG, GGG, GGGG (sequence number 12), GGGGG (sequence number 13), GGGGGG (sequence number 14), and GGGGGGG (sequence number 15) or GGGGGS (sequence number 16).

[0194] In the embodiments described above, it will be understood that the lysine (K) residue of the LplA acceptor peptide is covalently bonded to the click product which is covalently bonded to the LNP. Specifically, to generate a conjugate, the side-chain lysine group reacts with a carboxylic acid compound containing a first click handle. The resulting modified target-directed moiety (antibody, Fab fragment, or ScFv) is reacted with the LNP modified with a second click handle, as disclosed herein, thereby generating a click product. The surface of the LNP modified with a Fab fragment is shown below, where R is a lipid group (e.g., a C2-C30 alkyl group). [ka]

[0195] In other embodiments, the enzyme recognition sequence is a transglutaminase enzyme recognition sequence (LLQG(SEQ ID NO: 19)). The transglutaminase enzyme recognition sequence (LLQG(SEQ ID NO: 19)) is also referred to as the Q tag. The Q tag may be located at one or more positions of the target-directing moiety (e.g., antibody, Fab fragment, or ScFv), for example, at the C-terminus, or can be inserted. The transglutaminase enzyme catalyzes the reaction between the side-chain amide group on the Q tag and the alkyl-primary amine on the component of the LNP (e.g., lipid), thereby linking the antibody to the LNP via an amide bond.

[0196] In other embodiments, the enzyme recognition sequence is a sequence recognized by formylglycinase, specifically CXPXR, where each X is any amino acid. In such embodiments, the CXPXR sequence can be inserted into one or more positions of a target-directing moiety (e.g., an antibody, Fab fragment, or ScFv), for example, at the C-terminus. The formylglycinase can convert the cysteinethiol of CXPXR to an aldehyde group, which can then react with an aminooxy or hydrazine group covalently bonded to a component of the LNP.

[0197] In another embodiment, lipid nanoparticles are conjugated to a target-directed moiety, such as an antibody, Fab fragment, or ScFv, in a site-specific manner via a sugar moiety on a glycosylated antibody. Figure 3 shows one specific embodiment of introducing a Tz click handle via a sugar moiety on an antibody. In step 1, an azide moiety is site-directly introduced to the sugar moiety of a target antibody catalyzed by the enzymes galactosidase and transferase. The azide functional group then reacts with dibenzocyclooctene (DBCO)-MeTz via a click reaction. Using the click reaction, the Tz ring, in this case MeTz, can be introduced into the antibody and then reacted with the TCO moiety on an LNP (not shown) in a second click reaction, thus obtaining a conjugate.

[0198] In another embodiment, the LNP is conjugated to a site-specific target moiety (e.g., antibody, Fab fragment, or ScFv) via a photo-induced crosslinking reaction. Figure 4 shows one particular embodiment using oYo-linked Tz. In Figure 4, a Tz ring (e.g., MeTz) is covalently bound to a site-specific antibody label (oYo linkage) that specifically reacts with a residue on the heavy chain of the antibody. The oYo-linked tetrazine covalently bound to the antibody reacts with TCO (not shown) bound to the LNP, thus generating a surface-modified LNP.

[0199] In another embodiment, lipid nanoparticles are conjugated to a target-directed moiety (e.g., an antibody, Fab fragment, or ScFv) in a site-specific manner by mutating amino acid residues on the target-directed moiety and then reacting the mutated target-directed moiety with a compound containing a Tz ring. Figure 5 shows a specific embodiment in which an azide functional group is introduced during the production of an antibody or Fab fragment. The azide group then undergoes a click reaction with a DBCO group linked to a tetrazine ring. The tetrazine ring bound to the antibody reacts with a TCO (not shown) bound to the LNP, thus producing a surface-modified LNP.

[0200] In another embodiment, lipid nanoparticles are conjugated to a target-directed moiety (e.g., antibody, Fab fragment, or ScFv) in a site-specific manner by introducing a first click handle to the target-directed moiety (antibody, Fab fragment, or ScFv) using a cysteine-maleimide reaction. Figure 6 shows one particular embodiment of introducing a first click handle (e.g., Tz) to a Fab fragment. In Figure 6, a hinge with free cysteine ​​is initially introduced at the C-terminus of the Fab fragment. In some such embodiments, an engineered interchain disulfide, bound away from the C-terminus and embedded at the CL-CH1 interface, is introduced for improved stability (Figure 7). The resulting modified Fab fragment is reacted with a first click handle (click handle 1) covalently bonded to the maleimide nitrogen. The first click handle is then reacted with a second click handle (click handle 2) on the LNP, thus generating a surface-modified targeted LNP. In some embodiments, click handle 1 is the TZ portion, and click handle 2 is the TCO portion.

[0201] In some embodiments, the click product can be formed using any suitable photo-induced click reaction. In some embodiments, the click product can be formed using a photo-induced 1,3-dipolar ring addition reaction between a tetrazole and an alkene (see, for example, Song et al., Angew. Chem., Int. Ed. 2008, 47(15), 2832-2835).

[0202] In some embodiments, the click product can be formed using oxime and hydrazone ligation. In some embodiments, the ketone or aldehyde can react with α-effect amines such as hydroxylamines, hydrazines, and hydrazides (see, for example, Agten et al., ChemBioChem 2013, 14(18), 2431-2434 and Dirksen et al., J.Am.Chem.Soc. 2006, 128(49), 15602-15603).

[0203] The following are exemplary lipid and cholesterol molecules that can be attached to click handles and used to produce targeted LNPs. [ka] [ka] [ka]

[0204] Conjugates prepared by site-specific methods (e.g., Figures 1-6) have a high density of target-directed moieties on the surface of the LNP. For example, a conjugate may contain two or more target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, a conjugate may contain more than 10 target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, a conjugate may contain more than 20 target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, a conjugate may contain more than 30 target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, a conjugate may contain more than 50 target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, a conjugate may contain more than 75 target-directed moieties per LNP (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, the conjugate may contain more than 100 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv). In some embodiments, the conjugate may contain about 50 to about 200 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 100 to about 200 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 100 to about 230 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 10 to about 150 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 10 to about 30 target-directed moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP.

[0205] In some embodiments, the weight ratio between the targeting moiety on the surface of the LNP and the payload (e.g., RNA) encapsulated in the LNP can be 1:20, 1:15, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1.

[0206] Interchain C L -C H 1. Disulfide reduction, followed by conjugation An IgG antibody consists of four polypeptide chains linked by disulfide bonds. The two low-molecular-weight polypeptide chains are referred to as light chains (L). A light chain consists of a variable light chain domain (VL) and a constant light chain domain (CL). A heavy chain consists of a variable heavy chain domain (VH) and three constant heavy chain domains (CH1, CH2, and CH3). The Fab region of an antibody includes the VL, CL, VH, and CH1 domains. The Fc region includes the constant heavy chain domains CH2 and CH3. The hinge region of an IgG antibody covalently bonds the CH1 domain to the CH2 domain. The two heavy chains of an IgG antibody are connected within the hinge region by a variable number of disulfide bonds depending on the IgG subclass. Different subclasses of IgG antibodies have varying numbers of interchain disulfide bonds. In addition, the light chain is covalently bonded to the heavy chain via a disulfide bond between the light chain and the heavy chain. Using standard IgG nomenclature, this natural interchain disulfide bond is also referred to as the CL-CH1 disulfide bond to distinguish it from the disulfide bonds present in the hinge region. A therapeutic antibody of the IgG1 type has an interchain disulfide bond between Cys233 (Kabat numbering) in the heavy domain and Cys214 (Kabat numbering) in the light domain. A therapeutic antibody of the IgG4 type has an interchain disulfide bond between Cys127 (Kabat numbering) in the heavy domain and Cys214 (Kabat numbering) in the light domain. A therapeutic antibody of the IgG2 type has an interchain disulfide bond between Cys135 (Kabat numbering) in the heavy domain and Cys214 (Kabat numbering) in the light domain.

[0207] Proteolytic cleavage of an IgG antibody results in the formation of a Fab fragment known as the F(ab')2 fragment. The F(ab')2 fragment does not contain a CH2 or CH3 domain. However, the hinge region of the antibody is retained in the F(ab')2 fragment. The F(ab')2 fragment contains a disulfide bond covalently connecting two Fab fragments. Reduction of the disulfide bond in F(ab')2 produces two F(ab') fragments. The sulfhydryl (thiol) group of F(ab') can potentially react with thiol-reactive groups on the surface of the LNP, thus generating a conjugate. However, site-specific conjugation is difficult due to the presence of multiple sulfhydryl groups in the hinge region of the F(ab') fragment. Furthermore, reduction of F(ab')2 to the F(ab') fragment can disrupt the native interchain disulfide bond between the CL and CH1 regions of the Fab fragment, thus further impairing site-specific conjugation.

[0208] As described herein, Fab fragments can be site-selectively conjugated onto the surface of precursor lipid nanoparticles (LNPs) via the natural interchain disulfide bond (i.e., CL-CH1 disulfide bond) between the heavy and light chains of the Fab fragment to create targeted LNPs (conjugates).

[0209] The terms “precursor LNP” or “basic LNP” refer to LNPs that have been functionalized with a reactive moiety (e.g., a thiol-reactive group or polyglycine) before reacting with a Fab fragment. As disclosed herein, the process for conjugating a target-directing moiety involves reducing the innate interchain disulfide bond between the CL domain and CH1 domain of the Fab fragment, and reacting the reduced Fab fragment with a thiol-reactive group (e.g., a maleimide or DBM group) covalently bonded to the surface of the precursor LNP, thereby forming a conjugate. Alternatively, the reduced Fab fragment can be reacted with a lipid chemically modified (functionalized) with a thiol-reactive group (e.g., a maleimide or DBM group). The resulting lipid can then be inserted into an existing LNP to produce a conjugate. As described herein, despite the removal of the innate interchain disulfide bond linking the heavy and light chains of the Fab fragment, the resulting conjugate can effectively target specific cell types depending on the properties of the Fab target-directing moiety. For example, specific Fab fragments for targeting immune cells or hematopoietic stem cells (HSCs) are disclosed herein. A schematic diagram of LNPs site-specifically conjugated to a Fab fragment is shown in Figure 25.

[0210] In one embodiment, the Fab fragment used for conjugation may be used by a recombinant method. In a particular embodiment, the recombinantly generated Fab fragment is designed so as not to contain a hinge region at the C-terminus. Thus, the recombinantly generated Fab fragment contains only one disulfide bond between CL-CH1 and the domain. As shown herein, CL-CH1 can then be reduced, and the resulting free thiol group can be used as an anchor to conjugate the Fab fragment to the surface of the LNP.

[0211] In some embodiments, the Fab fragment is of the IgG class, IgM class, or IgA class. In some embodiments, the Fab fragment is of the IgG class and has an IgGl, IgG2, IgG3, or IgG4 isotype. In some embodiments, the Fab fragment is a native protein. In some embodiments, the Fab fragment is an engineered protein.

[0212] In one aspect, the present disclosure provides a method for producing a targeted LNP, the method being (i) Contacting a composition containing a Fab fragment with a reducing reagent, wherein the Fab fragment comprises a heavy chain and a light chain, as well as a constant light chain domain (C L ) and constant heavy chain domain 1 (C H 1) contains interchain disulfide bonds that connect the two components, thereby allowing the reducing agent to reduce the interchain disulfide bonds of the Fab fragment, generating two free cysteine ​​residues, by contact. (ii) Contacting the product of step (i) with a precursor LNP containing multiple thiol-reactive groups covalently bonded to one or more lipids of the precursor LNP, thereby forming a targeted LNP.

[0213] In some aspects, this disclosure is, (i) Contacting a composition containing a Fab fragment with a reducing reagent, wherein the Fab fragment comprises a heavy chain and a light chain, as well as a constant light chain domain (C L ) and constant heavy chain domain 1 (C H 1) contains interchain disulfide bonds that connect the two components, thereby allowing the reducing agent to reduce the interchain disulfide bonds of the Fab fragment, generating two free cysteine ​​residues, by contact. (ii) Contacting the product of step (i) with a precursor LNP containing multiple thiol-reactive groups covalently bonded to one or more lipids of the precursor LNP, thereby forming a targeted LNP, provides a conjugate produced by a method comprising the above.

[0214] In some embodiments, a thiol-reactive group (e.g., maleimide, pyridyl disulfide, 2,3-dibromomaleimide, or haloacetyl) is chemically reacted with a lipid molecule to produce a modified lipid, and the thiol-reactive group can be covalently bonded to the lipid if it can react with at least one free cysteine ​​residue (either from the heavy or light chain of the Fab fragment) of the reduced Fab fragment. The reaction between the thiol-reactive group and at least one free cysteine ​​residue can be completed before or after the formation of the LNP with the modified lipid. For example, as shown in Figure 26A, various components (e.g., lipids) including the LNP and therapeutic payload can be mixed with a lipid molecule containing one or more lipids containing a thiol-reactive group, thus generating an LNP containing multiple thiol-reactive groups (each thiol-reactive group is schematically shown as a “functional group” in Figure 26A). The thiol-reactive group can then be reacted with at least one free cysteine ​​residue of the Fab fragment, thus generating a conjugate. Alternatively, lipids modified with thiol-reactive groups can be directly reacted with at least one free cysteine ​​residue of the Fab fragment. As shown in Figure 26B, the resulting modified lipid, bound to the Fab fragment, can then be inserted into a pre-formed LNP that has not yet been surface-modified. This procedure allows the reaction to take place on individual lipid molecules rather than on the surface of the LNP.

[0215] The interchain disulfide bonds of the Fab fragment can be reduced using any suitable reducing agent. Examples of reducing agents, but not limited to, include 2-mercaptoethanol, 2-mercaptoethylamine, dithiothreitol (DTT), dithioerythritol (DTE), and tris(carboxyethyl)phosphine (TCEP), as well as combinations thereof. In some embodiments, the reducing agent is a mild reducing agent. Examples of mild reducing agents include, for example, DTT, TCEP, and DTE. In some embodiments, the reducing agent is TCEP. Any suitable reaction conditions can be used for the reduction of the interchain disulfide bonds in step (i). In some embodiments, the reduction reaction can occur in water, aqueous buffer, or cell culture medium. In some embodiments, the reduction reaction is carried out at physiological pH (e.g., about 7.4). In some embodiments, the reduction reaction is carried out at physiological temperature (e.g., about 37°C). In some embodiments, the reduction reaction takes place at 0°C to 40°C, for example, 10°C to 35°C, 15°C to 30°C, 20°C to 30°C, or 20°C to 25°C. In some embodiments, the reduction reaction takes place at ambient temperature (e.g., about 23°C to about 25°C). In some embodiments, the reduction reaction takes place at about 0°C to about 4°C.

[0216] In some embodiments, excess reducing agent is removed after step (i) before conjugation to the precursor LNP. In some embodiments, excess reducing agent is not removed after step (i) before conjugation to the precursor LNP.

[0217] In some embodiments of the method or process, the thiol-reactive group on the LNP (or the lipid subsequently inserted into the LNP) may include, but are not limited to, any preferred reactive group, including maleimide, pyridyl disulfide, 2,3-dibromomaleimide, or haloacetyl.

[0218] In some embodiments, the thiol-reactive group is maleimide. In some embodiments, maleimide reacts with one of two free cysteine ​​residues of the Fab fragment (either on the heavy or light chain) to form a thiosuccinimide moiety. In some embodiments, maleimide reacts with a free cysteine ​​residue on the heavy chain of the Fab fragment. In some embodiments, maleimide reacts with a free cysteine ​​residue on the light chain of the Fab fragment. In some embodiments, each of the two maleimide groups reacts with the Fab fragment, with one maleimide reacting with a free cysteine ​​residue on the light chain and the other maleimide reacting with a free cysteine ​​residue on the heavy chain.

[0219] Any preferred conditions can be used for the reaction between the thiol-reactive group and at least one of the two free cysteine ​​residues of the Fab fragment in step (ii). In some embodiments, the reaction may occur in water, aqueous buffer, or cell culture medium. In some embodiments, the reaction may be carried out at physiological pH (e.g., about 7.4). In some embodiments, the reaction may be carried out at physiological temperature (e.g., about 37°C). In some embodiments, the reduction reaction may be carried out at 0°C to 40°C, e.g., 10°C to 35°C, 15°C to 30°C, 20°C to 30°C, or 20°C to 25°C. In some embodiments, the reaction may be carried out at ambient temperature (e.g., about 23°C to about 25°C). In some embodiments, the reaction may be carried out at about 0°C to about 4°C.

[0220] A schematic diagram illustrating the reduction of interchain disulfide bonds in the Fab fragment is shown in Figure 27. In some embodiments, the Fab fragment shown in Figure 27 can be recombinantly produced without a hinge region at the C-terminus. Therefore, in such embodiments, the Fab fragment is produced with respect to the C of the Fab fragment. L -C HIt contains only a single interchain disulfide bond located at the interface. As shown in Figure 27, the interchain disulfide bond is located between the heavy and light chains of the Fab fragment. The reduction reaction breaks the covalent bond forming the disulfide bond, thereby generating two free cysteine ​​residues that can react with the thiol-reactive group in subsequent steps.

[0221] Figure 28 shows an exemplary schematic diagram of conjugate formation as described herein. In Figure 28, a Fab fragment containing an interchain disulfide bond between the heavy and light chains is brought into contact with a reducing agent, thereby reducing the interchain disulfide to produce two free cysteine ​​residues (step (i)). In step (ii), the reduced Fab fragment is reacted with an LNP containing multiple thiol-reactive groups (e.g., maleimide or DBM) conjugated on the surface of the LNP, thereby the thiol-reactive groups react with the free cysteine ​​residues of the reduced Fab fragment. The Fab fragment is site-specifically conjugated to the surface of the LNP via binding by at least one of the free cysteine ​​residues of the Fab fragment.

[0222] After the reduced Fab fragment is reacted with the thiol-reactive groups of the LNP, the heavy chain, light chain, or both of the heavy and light chains of the Fab fragment are conjugated to the surface of the LNP. Various orientations are shown in Figure 29. In some embodiments, the conjugates formed by the method disclosed herein include at least one, at least two, or all three orientations shown in Figure 29. The concentration of the thiol-reactive group (e.g., maleimide) is likely to determine which orientation is dominant. In some embodiments, increasing the number of thiol-reactive groups on the LNP increases the number of Fab fragments conjugated to two thiol-reactive groups. In some embodiments, decreasing the number of thiol-reactive groups on the LNP decreases the number of Fab fragments conjugated to two thiol-reactive groups. Regardless of orientation, the heavy and light chains remain intact on the surface of the LNP and thus form a functional Fab fragment that can engage with receptors on targeted cells.

[0223] In some embodiments, the thiol-reactive group is maleimide, as shown in Figure 29. In some embodiments, the maleimide reacts with one of the two free cysteine residues of the antibody or antigen-binding fragment thereof. In some embodiments, the maleimide reacts with one of the two free cysteine residues of the Fab fragment to form a thiosuccinimide moiety. In some embodiments, the maleimide reacts with the free cysteine residue on the heavy chain of the Fab fragment. In some embodiments, the maleimide reacts with the free cysteine residue on the light chain of the Fab fragment. In some embodiments, each of the two maleimide groups on the LNP reacts with a Fab fragment, one maleimide reacts with the free cysteine residue on the light chain, and the other maleimide reacts with the free cysteine residue on the heavy chain.

[0224] In some embodiments, the thiol-reactive group is 2,3-dibromomaleimide (DBM), as shown in Figure 30. After reduction of the disulfide bond, the reduced Fab fragment is added to the DBM covalently bound to the lipid (represented by the wavy line in Figure 30). As indicated above, the lipid may be part of the LNP, or may be subsequently inserted into the LNP after reaction with the Fab fragment. Both of the free cysteine residues displace the two bromine groups of DBM, thus generating a dithiomaleimide. The dithiomaleimide can be converted to the corresponding maleamic acid via hydrolysis. DBM reacts with the free cysteine residue on the heavy chain and the free cysteine residue on the light chain of the Fab fragment to form a crosslink between the cysteine residues. Thus, the heavy chain and light chain of the Fab fragment are effectively crosslinked together after reaction with DBM.

[0225] In all the embodiments discussed above, the thiol-reactive group can be introduced into any of the lipids comprising the LNP. In some embodiments, the conjugate can comprise one or more pegylated lipid molecules. In some embodiments, the thiol-reactive group is covalently bound to at least one of the pegylated lipid molecules, and thus lipid-PEG x- A thiol-reactive group structure is formed, where x is 2 to 120 ethylene glycol units. In such embodiments, at least one free cysteine ​​residue of the Fab fragment reacts with a thiol-reactive group bound to one or more pegylated lipids containing LNPs. In some embodiments, the LNPs comprise about 0.05 mol% to about 2 mol% of the pegylated lipids bound to the thiol-reactive group. In some embodiments, the PEG spacer between the lipid and the thiol-reactive group comprises at least about 5, 10, 20, 30, 50, 50, 60, 70, 80, 90, 200, or 110 ethylene glycol units. In some embodiments, the PEG spacer comprises about 10 to 120 ethylene glycol units. In some embodiments, the molecular weight of the pegylated lipids bound to the thiol-reactive group is about 500 (i.e., PEG500) to about 5,000 (i.e., PEG5000). In some embodiments, the molecular weight of the pegylated lipid bound to the thiol-reactive group is approximately 1,000 (i.e., PEG1000) to approximately 3,000 (i.e., PEG5300). In some embodiments, the thiol-reactive group is bound to at least one of the non-pegylated phospholipids containing LNPs. In some embodiments, the thiol-reactive group is bound to at least one of the ionizable lipids containing LNPs. In some embodiments, the thiol-reactive group is bound to at least one of the sterol molecules containing LNPs. In some embodiments, the lipid portion of the pegylated lipid bound to the thiol-reactive group is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, and stearic acid. Figure 32 shows some examples of pegylated lipids bound to a thiol-reactive group, in this case the maleimide portion.

[0226] In some embodiments, the thiol-reactive group is bound to at least one of the non-pegylated phospholipids (helper lipids) containing the LNP. Figure 33 shows some examples of non-pegylated lipids bound to the maleimide moiety.

[0227] In some embodiments, the thiol-reactive group is bound to at least one of the ionizable lipids containing the LNP. Figure 34 shows some examples of ionizable lipids bound to the maleimide moiety.

[0228] In some embodiments, the thiol-reactive group is bound to at least one of the sterol molecules containing the LNP. Figure 35 shows some examples of sterols bound to the maleimide moiety.

[0229] The methods of this disclosure provide a stable conjugate exhibiting excellent ability to transduce specifically targeted cells. In some embodiments, the disclosure provides a conjugate comprising an LNP and a Fab fragment, wherein the LNP is covalently bonded to either or both a first cysteine ​​residue in the constant region of the heavy chain of the Fab fragment and a second cysteine ​​residue in the constant region of the light chain of the Fab fragment. In some embodiments, the Fab fragment does not contain a disulfide bond linking the constant region of the heavy chain of the Fab fragment to the constant region of the light chain of the Fab fragment. In some embodiments, both the constant region of the heavy chain constant region of the heavy chain and the constant region of the light chain of the Fab fragment are covalently bonded to the LNP. In some embodiments, only the constant region of the heavy chain of the Fab fragment is covalently bonded to the LNP. In some such embodiments, the light chain remains associated with the covalently bonded heavy chain on the surface of the LNP. In some embodiments, only the constant region of the light chain of the Fab fragment is covalently bonded to the LNP. In some such embodiments, the heavy chain remains associated with the covalently bonded light chain on the surface of the LNP. In some of the embodiments described above, the Fab fragment is linked to the LNP via a thiosuccinimide moiety. In other embodiments of the embodiments described above, the Fab fragment is linked to the LNP via a dithiomalemide moiety (see Figure 30). In yet another embodiment of the embodiments described above, the Fab fragment is linked to the LNP via a maleamic acid moiety (see Figure 30).

[0230] In some embodiments, the Fab fragment conjugated to the LNP is an IgG1 Fab fragment. In some such embodiments, the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG1 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 233 (Kabat numbering) of the heavy chain of the IgG1 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 233 (Kabat numbering) of the heavy chain of the IgG1 Fab fragment and the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG1 Fab fragment are covalently bonded to the LNP.

[0231] In some embodiments, the Fab fragment conjugated to the LNP is an IgG2 Fab fragment. In some such embodiments, the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG2 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 127 (Kabat numbering) of the heavy chain of the IgG2 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 127 (Kabat numbering) of the heavy chain of the IgG2 Fab fragment and the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG2 Fab fragment are covalently bonded to the LNP.

[0232] In some embodiments, the Fab fragment conjugated to the LNP is an IgG4 Fab fragment. In some such embodiments, the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG4 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 127 (Kabat numbering) of the heavy chain of the IgG4 Fab fragment is covalently bonded to the LNP. In other such embodiments, the cysteine ​​at position 127 (Kabat numbering) of the heavy chain of the IgG4 Fab fragment and the cysteine ​​at position 214 (Kabat numbering) of the light chain of the IgG4 Fab fragment are covalently bonded to the LNP.

[0233] The processes described herein also enable the ability to conjugate two or more different Fab fragments onto the surface of an LNP. An embodiment demonstrating the conjugation of two different Fab fragments (which may bind to the same or different antigens) onto the surface of an LNP is shown in Figure 31. In Figure 31, two Fab fragments (Fab1 and Fab2) are reduced (step (i)) and reacted with a precursor LNP containing a thiol-reactive group (e.g., maleimide or DBM) (step (ii)). After the reaction in step (ii), both Fab1 and Fab2 are conjugated onto the surface of the LNP. Despite the reduction of the disulfide bonds in Fab1 and Fab2, the heavy and light chains in Fab1, and in Fab2, remain together on the surface of the LNP. In other words, the heavy or light chain of Fab1 does not associate with the heavy or light chain of Fab2 on the surface of the LNP.

[0234] In some embodiments, the first and second Fab fragments can be reduced in the same reaction (e.g., the first and second Fab fragments are mixed in a reaction vessel and brought into contact with the same reducing agent). In some embodiments, the first and second Fab fragments are reduced separately (e.g., the first and second Fab fragments are each brought into contact with a reducing agent in separate reaction vessels). In some embodiments, the first Fab fragment is brought into contact with the reducing agent before step (ii) (the reduced first Fab fragment is conjugated to the LNP surface). In some embodiments, the second Fab fragment is brought into contact with the reducing agent after step (ii) (the reduced second Fab fragment is conjugated to the LNP surface). In some embodiments, the reduced first and reduced second Fab fragments are brought into contact with the LNP simultaneously. In some embodiments, the reduced first Fab fragment and the reduced second Fab fragment are contacted with the LNP sequentially (in any order). It is conceivable that any number of Fab fragments can be implemented in the method or process (e.g., third, fourth, fifth, etc. Fab fragments). In some embodiments, a total of three different Fab fragments can be conjugated onto the surface of the LNP. In some embodiments, a total of four different Fab fragments can be conjugated onto the surface of the LNP.

[0235] In some embodiments, the reaction between at least one of the two free cysteine ​​residues of the Fab fragment and the thiol-reactive group of the LNP forms at least one covalent bond. In some embodiments, the formation of at least one covalent bond between at least one of the two free cysteine ​​residues of the Fab fragment and the thiol-reactive group of the LNP is reversible. In some embodiments, the formation of at least one covalent bond between at least one of the two free cysteine ​​residues of the Fab fragment and the thiol-reactive group of the LNP is irreversible. In some embodiments, the reaction efficiency between at least one of the two free cysteine ​​residues of the Fab fragment and the thiol-reactive group of the LNP is greater than 5%, greater than 10%, greater than 25%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In some embodiments, the reaction efficiency between at least one of the two free cysteine ​​residues of the Fab fragment and the thiol-reactive group of the LNP is about 5% to about 30%, about 10% to about 20%, about 25% to about 50%, about 30% to about 40%, about 50% to about 80%, about 60% to about 70%, about 70% to about 95%, or about 80% to about 90%. In some embodiments, the conjugate product of the method of the present disclosure can be purified from the remaining intermediate product using any preferred technique such as ultrafiltration and diafiltration, but is not limited to these.

[0236] In some embodiments, the conjugate prepared by the methods or processes disclosed herein has a high density of Fab fragments on the surface of the LNP. For example, the conjugate may contain a plurality of Fab fragments conjugated on the surface of the LNP. In some embodiments, the conjugate may contain more than 10 Fab fragments per LNP. In some embodiments, the conjugate may contain more than 20 Fab fragments per LNP. In some embodiments, the conjugate may contain more than 30 Fab fragments. In some embodiments, the conjugate may contain more than 50 Fab fragments per LNP. In some embodiments, the conjugate may contain more than 75 Fab fragments per LNP. In some embodiments, the conjugate may contain more than 100 Fab fragments. In some embodiments, the conjugate may contain about 50 to about 200 Fab fragments per LNP. In some embodiments, the conjugate may contain about 100 to about 230 Fab fragments per LNP. In some embodiments, the conjugate may contain approximately 10 to 150 Fab fragments per LNP. In some embodiments, the conjugate may contain approximately 10 to 30 Fab fragments per LNP.

[0237] IV. payload The LNPs and conjugates (targeted LNPs) of this disclosure can be used to deliver payloads to cells, such as T cells, HSCs, HSC precursors, or liver cells. In some embodiments, LNPs can be used to deliver payloads to long-term HSC (LT-HSC) subpopulations. In some embodiments, the targeted LNPs described herein can be used to deliver payloads to cells expressing cell surface receptors that are targeted by the target-directed portion of the targeted LNP (conjugate), such as antibodies, Fab fragments, scFv, or nanobody components.

[0238] The LNPs and conjugates disclosed herein can be used to deliver therapeutic agents of interest to cells. For example, in some embodiments, the conjugates disclosed herein can be used to deliver nucleic acids encoding vaccines (e.g., mRNA). In other embodiments, the conjugates disclosed herein can be used to deliver nucleic acids encoding enzymes (e.g., mRNA). In yet another embodiment, the LNPs and conjugates disclosed herein can be used to deliver nucleic acids encoding chimeric antigen receptors (CARs) to T cells.

[0239] In some embodiments, the payload is one or more nucleic acids. In some embodiments, the payload is one or more RNA molecules. In some embodiments, the payload is mRNA (e.g., mRNA encoding an enzyme). In some embodiments, the RNA molecule is non-coding RNA (ncRNA). In some embodiments, the payload is an RNA template (e.g., an RNA template for reverse transcription, e.g., targeted primed reverse transcription (TPRT)). In other embodiments, the payload is siRNA or miRNA (miRNA). In other embodiments, the payload is guide RNA. In other embodiments, the payload is tRNA. In other embodiments, the payload is antisense oligonucleotide (ASO). In other embodiments, the payload is a DNA molecule, e.g., a DNA plasmid, closed-end DNA (ceDNA), or small circular DNA (e.g., a minicircle or nanoplasmid). The nucleic acid payload can be linear, circular, covalently closed, single-stranded, double-stranded, or hybrid RNA / DNA molecule, and the payload is a small molecule. In some embodiments, the payload is a peptide or protein. In some embodiments, the conjugates disclosed herein may include two or more payloads selected from, for example, mRNA, ncRNA, guide RNA, siRNA, miRNA, ASO, DNA vectors, small molecules, peptides, or proteins.

[0240] LNPs described herein, such as targeted LNPs, can be used to deliver a therapeutic agent of interest to cells, such as HSCs, HSC precursors, or liver cells. In some embodiments, the LNPs, such as targeted LNPs, contain a payload that is a therapeutic agent. In some embodiments, the therapeutic agent may be a therapeutic peptide or protein, a nucleic acid containing the therapeutic agent, or a nucleic acid encoding the therapeutic agent. In some embodiments, the therapeutic agent may be a gene drug (e.g., for gene therapy or gene editing) that can modify, alter, or influence changes in the genomic DNA of cells (e.g., HSCs (e.g., LT-HSCs), HSC precursors, or liver cells in a target). In some embodiments, the therapeutic agent is a gene therapy agent or a gene editing agent. In some embodiments, the therapeutic agent is a gene modification polypeptide as described herein. In some embodiments, the therapeutic agent is a gene modification system as described herein.

[0241] In some embodiments, the therapeutic agent may be a peptide or protein such as an enzyme, or a nucleic acid (e.g., mRNA or DNA) encoding a peptide or protein (e.g., an enzyme). In some embodiments, the enzyme may be a nuclease, recombinase, integrase, transposase, retrotransposase, helicase, transcriptase, polymerase, reverse transcriptase, deaminase, methylase, demethylase, or ligase, or may have a combination of these enzymatic activities. In some embodiments, the therapeutic agent may be a peptide or protein, or a nucleic acid encoding a peptide or protein, for use as a replacement gene therapy. In some embodiments, the therapeutic agent may be a peptide or protein, or a nucleic acid encoding a peptide or protein, for use in modifying or altering the genome or epigenome of cells, e.g., T cells, HSCs, HSC precursors, or liver cells of interest. In some embodiments, the therapeutic agent may include one or more components of a system for modifying or altering the genome or epigenome of cells, e.g., T cells, HSCs, HSC precursors, or liver cells of interest. In some embodiments, the system for modifying or altering the genome or epigenome of a target cell comprises one or more proteins, one or more nucleic acids (e.g., RNA and / or DNA), or a combination thereof.

[0242] In some embodiments, the therapeutic agent may be one or more components of a ribonucleoprotein (RNP) complex for modifying or altering the genome or epigenome of cells, such as T cells, HSCs, HSC precursors, or liver cells. For example, in some cases, the therapeutic agent may be a protein, or a nucleic acid encoding a protein (e.g., mRNA), and / or an RNA molecule (e.g., gRNA) for guiding the protein to a specific location within the genome or epigenome, and the protein may modify or alter the genome or epigenome as a nuclease, recombinase, integrase, transposase, helicase, reverse transcriptase, deaminase, methylase, demethylase, or ligase, or a combination thereof. In certain embodiments, the therapeutic agent is a nuclease. In some embodiments, the nuclease cleaves DNA (e.g., both strands of DNA), thereby introducing insertion and / or deletion (indel) mutations into DNA, such as genomic DNA. In certain embodiments, the nuclease is a nickase (i.e., it cleaves a single strand of DNA). In certain embodiments, the nuclease is mutated to be inactive or to contain reduced nuclease activity. In certain embodiments, the therapeutic agent can be used to induce substitutions in DNA, e.g., genomic DNA, via base editing. In certain embodiments, the therapeutic agent can be used for epigenome editing. In certain embodiments, the therapeutic agent can be used to induce indels or substitutions in DNA, e.g., genomic DNA, by inducing targeted primed reverse transcription (TPRT). In certain embodiments, the therapeutic agent delivered by LNP, e.g., targeted LNP (i.e., payload) can be a gene-modified protein, a nucleic acid encoding a gene-modified protein, or a gene-modification system, as described herein. In some embodiments, LNP, e.g., targeted LNP, can be used to deliver a gene-modified protein, a nucleic acid encoding a gene-modified protein, or a gene-modification system, as described herein, to HSPCs, HSCs (e.g., LT-HSCs), or hepatocytes.In certain embodiments, the therapeutic agent may be a small molecule. In certain embodiments, the therapeutic agent may be siRNA or miRNA. In some embodiments, LNPs of the Disclosure, e.g., targeted LNPs, can be used to deliver gene editing components to T cells, HSCs, HSC precursors, or liver cells. In some embodiments, LNPs, e.g., targeted LNPs, can be used to deliver CRISPR-Cas systems to T cells or HSCs. In some embodiments, LNPs, e.g., targeted LNPs, can be used to deliver Class 1 (Type I, Type III, or Type IV) CRISPR systems to T cells or HSCs. In some embodiments, LNPs, e.g., targeted LNPs, can be used to deliver Class 2 (Type II, Type V, or Type VI) CRISPR systems to T cells or HSCs. In some embodiments, LNPs, e.g., targeted LNPs, can be used to deliver CRISPR-Cas9 systems, or nucleic acids encoding one or more components of CRISPR-Cas9 systems, to T cells or HSCs (e.g., LT-HSCs). In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the CRISPR-Cas12 system (e.g., the Cas12a system) or nucleic acids encoding one or more components of the CRISPR-Cas12 system to T cells or HSCs (e.g., LT-HSCs). In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the CRISPR-Cas system to liver cells. In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the Class 1 (Type I, Type III, or Type IV) CRISPR system to liver cells. In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the Class 2 (Type II, Type V, or Type VI) CRISPR system to liver cells. In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the CRISPR-Cas9 system or nucleic acids encoding one or more components of the CRISPR-Cas9 system to liver cells.In some embodiments, LNPs, such as targeted LNPs, can be used to deliver the CRISPR-Cas12 system (e.g., the Cas12a system) or nucleic acids encoding one or more components of the CRISPR-Cas12 system to liver cells. In some such embodiments, the LNP, such as targeted LNPs, may include two RNA molecules, such as RNA containing a guide RNA (gRNA) and mRNA encoding the Cas protein. In some embodiments, Cas is Cas9 or Cas12a. In some embodiments, Cas is Cas12a. In some embodiments, gRNA is a single guide RNA (sgRNA). In some embodiments, the LNP, such as targeted LNPs, consists of Cas9 or mRNA encoding Cas9, or includes a payload containing the same. In some embodiments, the LNP, such as targeted LNPs, consists of Cas12 (e.g., Cas12a) or mRNA encoding Cas12 (e.g., Cas12a), or includes a payload containing the same. In some embodiments, the payload consists of or includes gRNA.

[0243] In some embodiments, the mRNA component of the gene modification system includes recombinant nucleases, or nucleic acids encoding nucleases, such as restriction endonucleases, meganucleases, homing endonucleases, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs).

[0244] In certain embodiments, the therapeutic agent delivered by the LNP, for example, a targeted LNP (i.e., payload), may be a gene modification system, or one or more nucleic acids (e.g., RNA molecules) comprising a gene modification system (e.g., a gene-modified polypeptide and mRNA encoding a template RNA), as described herein.

[0245] Gene modification system In some embodiments, the gene modification system described herein comprises (A) a gene modification polypeptide or a nucleic acid encoding a gene modification polypeptide, wherein the gene modification polypeptide comprises (i) a reverse transcriptase domain and an endonuclease domain having DNA-binding functionality, and (B) a template RNA. In some embodiments, the gene modification polypeptide functions as a substantially autonomous protein machine capable of incorporating a template nucleic acid sequence into a target DNA molecule (e.g., within a mammalian host cell, such as a genomic DNA molecule in a host cell) substantially independently of host mechanisms. For example, the gene modification protein may comprise a DNA-binding domain, a reverse transcriptase domain, and an endonuclease domain. In some embodiments, the DNA-binding functionality may comprise an RNA component that directs the protein to a DNA sequence, e.g., a gRNA spacer. In some embodiments, the gene modification polypeptide may comprise a reverse transcriptase domain and an endonuclease domain. The RNA template element of the gene modification system is typically heterogeneous to the gene modification polypeptide element and provides an object sequence to be inserted (reverse transcribed) into the host genome. In some embodiments, the gene modification polypeptide is capable of targeted primed reverse transcription.

[0246] In some embodiments, the genetically modified polypeptide comprises one or more domains that comprehensively facilitate 1) binding of a template nucleic acid, 2) binding of a target DNA molecule, and 3) incorporation of at least a portion of the template nucleic acid into the target DNA. In some embodiments, the genetically modified polypeptide is an engineered polypeptide comprising one or more amino acid substitutions to the corresponding naturally occurring sequence. In some embodiments, the genetically modified polypeptide comprises two or more domains that are heterogeneous to one another, for example, through heterogeneous fusion (or other conjugates) of other wild-type domains, and, for example, through fusion of modified domains via substitution or fusion of heterogeneous subdomains or other substitution domains. For example, in some embodiments, one or more of the following are the case: the RT domain is heterogeneous to the DBD, the DBD is heterogeneous to the endonuclease domain, or the RT domain is heterogeneous to the endonuclease domain.

[0247] Polypeptide components of gene modification systems In some embodiments, the gene-modified polypeptide has the functions of DNA target site binding, template nucleic acid (e.g., RNA) binding, DNA target site cleavage, and template nucleic acid (e.g., RNA) writing, e.g., reverse transcription. In some embodiments, each function is contained within a different domain. In some embodiments, the function may be attributed to two or more domains (e.g., two or more domains that work together to exhibit functionality). In some embodiments, two or more domains may have the same or similar functions (e.g., two or more domains each independently having DNA binding function, e.g., for two different DNA sequences). In other embodiments, one or more domains may enable one or more functions, e.g., a Cas9 domain that enables both DNA binding and target site cleavage. In some embodiments, all domains are located within a single polypeptide. In some embodiments, the gene-modified polypeptide described herein (for example, the system described herein includes a gene-modified polypeptide comprising) 1) a Cas domain (e.g., a Cas nickas domain, e.g., a Cas9 nickas domain), 2) a reverse transcriptase (RT) domain (the RT domain being the C-terminus of the Cas domain), and a linker positioned between the RT domain and the Cas domain. In some embodiments, the endonuclease domain is N-terminus relative to the RT domain. In some embodiments, the endonuclease domain is C-terminus relative to the RT domain.

[0248] In some embodiments, the gene-modified polypeptide includes a GG amino acid sequence between the Cas domain and the linker, an AG amino acid sequence between the RT domain and the second NLS, and / or a GG amino acid sequence between the linker and the RT domain. In some embodiments, the gene-modified polypeptide includes the sequence of SEQ ID NO: 21, which includes the first NLS and the Cas domain, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, the gene-modified polypeptide includes the sequence of SEQ ID NO: 22, which includes the second NLS, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. Exemplary N-terminal NLS-Cas9 domain Exemplary C-terminal sequence including NLS AGKRTADGSEFEKRTADGSEFESPKKKAKVE (Sequence ID 22)

[0249] In some embodiments, the genetically modified polypeptide includes a template nucleic acid binding domain (e.g., an RNA binding domain) contained within a target DNA binding domain. For example, in some embodiments, the DNA binding domain is a CRISPR-related protein that recognizes the structure of a template nucleic acid (e.g., template RNA) containing gRNA. In some embodiments, the genetically modified polypeptide includes a DNA binding domain containing a CRISPR-related protein that associates with a gRNA scaffold, enabling the DNA binding domain to bind to a target genomic DNA sequence. In some embodiments, the gRNA scaffold and gRNA spacer are contained within the template nucleic acid (e.g., template RNA), and therefore the DNA binding domain is also the template nucleic acid binding domain. In some embodiments, the polypeptide has RNA binding function in multiple domains, for example, a gRNA structure can be bound in the CRISPR-related DNA binding domain, and additional sequences or structures can be bound in the reverse transcriptase domain.

[0250] Writing domain (RT domain) In certain embodiments of the present invention, the writing domain of the gene modification system has reverse transcriptase activity and is also referred to as the reverse transcriptase domain (RT domain). In some embodiments, the RT domain includes an RT catalytic moiety and an RNA-binding region (e.g., a region that binds to template RNA).

[0251] In some embodiments, the RT domain forms a dimer (e.g., a heterodimer or a homodimer). In some embodiments, the RT domain is a monomer.

[0252] In certain embodiments, the gene-modified polypeptide comprises an amino acid sequence of an RT domain sequence from a family selected from AVIRE, BAEVM, FFV, FLV, FOAMV, GALV, KORV, MLVAV, MLVBM, MLVCB, MLVFF, MLVMS, PERV, SFV1, SFV3L, WMSV, XMRV6, BLVAU, BLVJ, HTL1A, HTL1C, HTL1L, HTL32, HTL3P, ​​HTLV2, JSRV, MLVF5, MLVRD, MMTVB, MPMV, SSFVCP, SMRVH, SRV1, SRV2, and WDSV.

[0253] In some embodiments, the gene-modified polypeptides described herein include an RT domain having an amino acid sequence according to Table 6 of International Application WO / 2023 / 039440 (the table thereof is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the nucleic acids described herein encode an RT domain having an amino acid sequence according to Table 6 of International Application WO / 2023 / 039440, or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0254] In some embodiments, the RT domain (e.g., listed in Table 6 of International Application WO / 2023 / 039440) comprises one or more mutations listed in Table 2A of International Application WO / 2023 / 039440, the table of which is incorporated herein by reference in its entirety. In some embodiments, the RT domain listed in Table 6 of International Application WO / 2023 / 039440 comprises one, two, three, four, five, or six mutations listed in the corresponding rows of Table 2A of International Application WO / 2023 / 039440.

[0255] In some embodiments, the gene-modified polypeptide comprises (i) a linker comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to a linker sequence listed in the row of Table T1, or (ii) an RT domain comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to an RT domain sequence listed in the same row of Table 2. In some embodiments, the gene-modified polypeptide comprises an amino acid sequence according to Table 3, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to an amino acid sequence. [Table 2-1] [Table 2-2] [Table 2-3] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]

[0256] Endonuclease domain and DNA-binding domain In some embodiments, the genetically modified polypeptide has the function of cleaving a target DNA site via an endonuclease domain. In some embodiments, the genetically modified polypeptide includes, for example, a DNA-binding domain for binding to a target nucleic acid. In some embodiments, the domain of the genetically modified polypeptide (e.g., the Cas domain) includes two or more smaller domains, e.g., a DNA-binding domain and an endonuclease domain. When it is said that the DNA-binding domain (e.g., the Cas domain) binds to a target nucleic acid sequence, in some embodiments, it is understood that the binding is mediated by gRNA.

[0257] In some embodiments, the domain has two functions. For example, in some embodiments, the endonuclease domain is also a DNA-binding domain. In some embodiments, the endonuclease domain is also a template nucleic acid (e.g., template RNA)-binding domain. For example, in some embodiments, the polypeptide includes a CRISPR-associated endonuclease domain that binds to a template RNA containing gRNA, binds to a target DNA sequence (e.g., complementary to a portion of the gRNA), and cleaves the target DNA sequence. In some embodiments, an endonuclease domain or endonuclease / DNA-binding domain from a heterologous source may be used or modified in the gene modification system described herein (e.g., by insertion, deletion, or substitution of one or more residues).

[0258] In some embodiments, the gene-modified polypeptide comprises a Cas domain, which comprises an endonuclease domain and a DNA-binding domain. In some embodiments, the Cas domain comprises Cas9 or a variant or variant thereof (e.g., as described herein). In embodiments, the Cas domain is associated with a guide RNA (gRNA), for example, as described herein. In embodiments, the Cas domain is directed by the gRNA to a target nucleic acid (e.g., DNA) sequence of interest.

[0259] In some embodiments, the endonuclease domain has nickase activity and cleaves one strand of target DNA. In some embodiments, the nickase activity reduces the formation of double-strand breaks at the target site compared to an endonuclease domain with double-strand break activity. In certain embodiments, the heterologous endonuclease is derived from a CRISPR-related protein, e.g., Cas9. In certain embodiments, the heterologous endonuclease is engineered to have only nickase activity, e.g., Cas9 nickase, e.g., SpCas9 with D10A, H840A, or N863A mutations. In some embodiments, the endonuclease domain has nickase activity but does not form double-strand breaks. In some embodiments, the endonuclease domain forms single-strand breaks more frequently than double-strand breaks, for example, at least 90%, 95%, 96%, 97%, 98%, or 99% of the breaks are single-strand breaks, or 10%, 5%, 4%, 3%, 2%, or less than 1% of the breaks are double-strand breaks. In some embodiments, the endonuclease does not form substantially any double-strand breaks. In some embodiments, the endonuclease does not form detectable levels of double-strand breaks.

[0260] In some embodiments, the endonuclease domain has nickase activity to nick a target site DNA on the first strand; for example, in some embodiments, the endonuclease domain cleaves genomic DNA at a target site near the site of modification on the strand extended by the write domain. In some embodiments, the endonuclease domain has nickase activity to nick a target site DNA on the first strand but not on the target site DNA on the second strand. For example, if the polypeptide contains a CRISPR-related endonuclease domain having nickase activity, in some embodiments, the CRISPR-related endonuclease domain nicks a target site DNA strand containing a PAM site (for example, does not nick a target site DNA strand that does not contain a PAM site). As a further example, if the polypeptide contains a CRISPR-related endonuclease domain having nickase activity, in some embodiments, the CRISPR-related endonuclease domain nicks a target site DNA strand that does not contain a PAM site (for example, does not nick a target site DNA strand that contains a PAM site).

[0261] In some embodiments, the gene-modified polypeptides described herein include a Cas domain. In some embodiments, the Cas domain can orient the gene-modified polypeptide to a target site designated by a gRNA spacer, thereby modifying the target nucleic acid sequence in "cis". In some embodiments, the reverse transcriptase domain of the gene-modified polypeptide is fused to the Cas domain. The CRISPR system is an adaptive defense system originally discovered in bacteria and archaea. The CRISPR system uses RNA guide nucleases called CRISPR-associated or "Cas" endonucleases (e.g., Cas9 or Cpf1) to cleave foreign DNA. For example, in a typical CRISPR-Cas system, the endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome to be sequence-edited) by a sequence-specific non-coding "guide RNA" that targets a single-stranded or double-stranded DNA sequence. Three classes (I-III) of CRISPR systems have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). A class II CRISPR system includes a type II Cas endonuclease such as Cas9, CRISPR RNA ("crRNA"), and transactivating crRNA ("tracrRNA"). The crRNA contains a "spacer" sequence, typically an RNA sequence of about 20 nucleotides corresponding to the target DNA sequence ("protospacer"). In the wild-type system, and in some engineered systems, the crRNA also contains a region that binds to the tracrRNA and forms a partially double-stranded structure that is cleaved by RNase III, resulting in a crRNA / tracrRNA hybrid molecule. The crRNA / tracrRNA hybrid then instructs the Cas endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence is generally specific to a given Cas endonuclease and is adjacent to a "protospacer-adjacent motif" ("PAM"), which is required for cleavage activity at the target site corresponding to the crRNA spacer.CRISPR endonucleases identified from various prokaryotic species possess characteristic PAM sequence requirements. Examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), and 5'-NNNGATT (Neisseria meningiditis). Some endonucleases, such as Cas9 endonuclease, associate with a G-rich PAM site, e.g., 5'-NGG, and perform blunt-end cleavage of target DNA at a 3-nucleotide position upstream of the PAM site (5' from the PAM site). Another class II CRISPR system includes smaller V-type endonucleases Cpf1, such as AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). Cpf1-associated CRISPR arrays are processed with mature crRNA without the need for tracrRNA; in other words, the Cpf1 system, in some embodiments, comprises only the Cpf1 nuclease and crRNA to cleave the target DNA sequence. The Cpf1 endonuclease typically associates with T-rich PAM sites, e.g., 5'-TTN. Cpf1 can also recognize 5'-CTA PAM motifs. Cpf1 typically cleaves target DNA by introducing offset or staggered double-strand breaks with a 4 or 5-nucleotide 5' overhang, for example, cleaving target DNA with a 5-nucleotide offset or staggered break located 18 nucleotides downstream (3' from the PAM site) from the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complementary strand. The 5-nucleotide overhang resulting from such offset breaks allows for more precise genome editing by homologous recombination DNA insertion than insertion with blunt-end cut DNA. For example, see Zetsche et al. (2015) Cell, 163:759-771.

[0262] In the techniques provided by this disclosure, various CRISPR-related (Cas) genes or proteins can be used, and the selection of the Cas protein depends on the specific conditions of the method. Specific examples of Cas proteins include the Class II system, which includes Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cpf1, C2C1, or C2C3. In some embodiments, the Cas protein, e.g., the Cas9 protein, may originate from any of various prokaryotic species. In some embodiments, a specific Cas protein, e.g., a specific Cas9 protein, is selected to recognize a specific protospacer-adjacent motif (PAM) sequence. In some embodiments, the DNA-binding domain or endonuclease domain includes a sequence that targets a polypeptide such as the Cas protein, e.g., Cas9. In certain embodiments, the Cas protein, e.g., the Cas9 protein, may be obtained from bacteria or archaea or synthesized using known methods. In certain embodiments, the Cas protein may originate from Gram-positive or Gram-negative bacteria. In certain embodiments, the Cas protein may be from Streptococcus (e.g., S. pyogenes or S. thermophilus), Francisella (e.g., F. novicida), Staphylococcus (e.g., S. aureus), Acidaminococcus (e.g., Acidaminococcus sp. BV3L6), Neisseria (e.g., N. meningitidis), Cryptococcus, Corynebacterium, Haemophilus, Eubacterium, Pasteurella, Prevotella, Veillonella, or Marinobacter.

[0263] In some embodiments, the genetically modified polypeptide may include Cas domains or functional fragments thereof listed in Table 7 or 8 of International Application WO / 2023 / 039440 (their tables are incorporated herein by reference in their entirety), or sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0264] In some embodiments, the gene-modified polypeptide includes a Cas domain according to SEQ ID NO: 33, or a functional fragment thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0265]

[0266] In some embodiments, the Cas protein requires a protospacer facilitation motif (PAM) present in or adjacent to a target DNA sequence for the Cas protein to bind and / or function. In some embodiments, the PAM is NGG, YG, NNGRRT, NNNRRT, NGA, TYCV, TATV, NTTN, or NNNGATT from 5' to 3', or comprises them, where N represents any nucleotide, Y represents C or T, R represents A or G, and V represents A or C or G. In some embodiments, the Cas protein is a protein listed in Table 7 or 8 of International Application WO / 2023 / 039440. In some embodiments, the Cas protein includes one or more mutations that modify its PAM. Exemplary advances in the manipulation of Cas enzymes that recognize modified PAM sequences are outlined in Collias et al Nature Communications 12:555 (2021), which is incorporated herein by reference in its entirety.

[0267] In some embodiments, the Cas protein is modified to inactivate or partially inactivate a nuclease, such as nuclease-deficient Cas9. While wild-type Cas9 produces double-strand breaks (DSBs) at specific DNA sequences targeted by gRNA, several CRISPR endonucleases with modified function are available; for example, a “nickase” version of Cas9 that is partially inactivated produces only single-strand breaks, and catalytically inactive Cas9 ("dCas9") does not cleave target DNA. In some embodiments, the DNA-binding domain includes catalytically inactive Cas9, e.g., dCas9. Many catalytically inactive Cas9 proteins are known in the art. In some embodiments, dCas9 includes mutations in each endonuclease domain of the Cas protein, e.g., D10A and H840A or N863A mutations. In some embodiments, a catalytically inactive or partially inactive CRISPR / Cas domain comprises a Cas protein containing one or more mutations, for example, one or more of the mutations listed in Table 7 of International Application WO / 2023 / 039440. In some embodiments, a Cas protein listed in a given row of Table 7 of International Application WO / 2023 / 039440 comprises one, two, three, or all of the mutations listed in the same row of Table 7 of International Application WO / 2023 / 039440. In some embodiments, for example, a Cas protein not listed in Table 7 of International Application WO / 2023 / 039440 comprises one, two, three, or all of the mutations listed in the row of Table 7 of International Application WO / 2023 / 039440, or a corresponding mutation at the corresponding site of that Cas protein.

[0268] In some embodiments, the endonuclease domain or DNA-binding domain comprises Streptococcus pyogenes Cas9 (SpCas9 or SpyCas9) or a functional fragment or variant thereof. In some embodiments, the endonuclease domain or DNA-binding domain comprises modified SpCas9. In embodiments, the modified SpCas9 comprises modifications that alter protospacer-adjacent motif (PAM) specificity. In embodiments, the PAM is specific to the nucleic acid sequence 5'-NGT-3'. In some embodiments, the endonuclease domain or DNA-binding domain comprises a Cas domain, e.g., a Cas9 domain. In embodiments, the endonuclease domain or DNA-binding domain comprises a nuclease-active Cas domain, a Cas niccas (nCas) domain, or a nuclease-inactive Cas (dCas) domain. In some embodiments, the endonuclease domain or DNA-binding domain includes a nuclease-active Cas9 domain, a Cas9 nickase (nCas9) domain, or a nuclease-inactive Cas9 (dCas9) domain. In some embodiments, the endonuclease domain or DNA-binding domain includes Cas9 domains of Cas9 (e.g., dCas9 and nCas9), Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the endonuclease domain or DNA-binding domain includes Cas9 (e.g., dCas9 and nCas9), Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the endonuclease domain or DNA-binding domain includes S. pyogenes or S. thermophilus Cas9, or a functional fragment thereof.In some embodiments, the endonuclease domain or DNA-binding domain includes, for example, a Cas9 sequence as described in Chylinski, Rhun, and Charpentier (2013) RNA Biology 10:5, 726-737, which is incorporated herein by reference.

[0269] In some embodiments, the endonuclease domain or DNA-binding domain includes spCas9, SpCas9-SpRY, spCas9-VRQR, spCas9-VRER, xCas9(sp), saCas9, saCas9-KKH, spCas9-MQKSER, spCas9-LRKIQK, or spCas9-LRVSQL.

[0270] Additional components of exemplary gene-modified polypeptides In addition to the write / RT domain and the endonuclease and DNA-binding domains, exemplary gene-modified polypeptides for use in gene modification systems may include additional components described herein.

[0271] Linker In some embodiments, the genetically modified polypeptide may include a linker, e.g., a peptide linker, e.g., one of the linkers listed in Table 10 of International Application WO / 2023 / 039440 (the table of which is incorporated herein by reference in its entirety). In some embodiments, the genetically modified polypeptide includes, from the N-terminus to the C-terminus, a Cas domain (e.g., the Cas domain in Table 8 of International Application WO / 2023 / 039440), a linker in Table 10 of International Application WO / 2023 / 039440 (or a sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto), and an RT domain (e.g., the RT domain in Table 6 of International Application WO / 2023 / 039440). In some embodiments, the gene-modified polypeptide includes a flexible linker between the endonuclease and the RT domain, for example, a linker containing the amino acid sequence AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 34), or a sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain of the gene-modified polypeptide may be located at the C-terminus of the endonuclease domain. In some embodiments, the RT domain of the gene-modified polypeptide may be located at the N-terminus of the endonuclease domain.

[0272] In some embodiments, the gene-modified polypeptide comprises (i) a Cas domain comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to a Cas sequence listed in the row of Table 4 of International Application WO / 2023 / 039440 (the table of which is incorporated herein by reference in its entirety); (ii) a linker comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to a linker sequence listed in the same row of Table 4; and (iii) an RT domain comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to an RT domain sequence listed in the same row of Table 4.

[0273] localization array In certain embodiments, the genetically modified RNA further comprises an intracellular localization sequence, such as a nuclear localization sequence (NLS). In some embodiments, the genetically modified polypeptide or the nucleic acid (e.g., RNA) encoding the genetically modified polypeptide comprises an NLS.

[0274] In some embodiments, the polypeptide described herein comprises one or more (e.g., two, three, four, or five) nuclear target sequences, such as nuclear localization sequences (NLS). In some embodiments, the NLS is a binocular NLS. In some embodiments, the NLS facilitates the importation of the protein containing the NLS into the cell nucleus. In some embodiments, the NLS is fused to the N-terminus of the genetically modified polypeptide described herein. In some embodiments, the NLS is fused to the C-terminus of the genetically modified polypeptide. In some embodiments, the NLS is fused to the N-terminus or C-terminus of the Cas domain. In some embodiments, a linker sequence is positioned between the NLS and the adjacent domain of the genetically modified polypeptide.

[0275] In some embodiments, the NLS comprises an amino acid sequence disclosed in Table 11 of International Application WO / 2023 / 039440 (the table thereof is incorporated herein by reference in its entirety), or a sequence having at least 80%, 85%, 90%, or 95% identity thereto. To improve intracellular localization to the nucleus, the NLS may be used in conjunction with one, two, three, or more copies of the NLS within the polypeptide at one or more positions within the polypeptide, e.g., within the N-terminal domain, between peptide domains, within the C-terminal domain, or in a combination of positions. Multiple unique sequences may be used within a single polypeptide. The sequences may be native monosegmental or bisegmental sequences, for example, having one or two extensions of basic amino acids, or may be used as chimeric bisegmental sequences.

[0276] In some embodiments, the NLS is a binocular NLS. A binocular NLS typically contains two basic amino acid clusters separated by a spacer sequence (which may be, for example, about 10 amino acids long). A mononocular NLS typically lacks a spacer.

[0277] In some embodiments, the gene-modified polypeptide comprises, in order from the N-terminus to the C-terminus, one or more of the following (e.g., 1, 2, 3, 4, 5, or all 6): an N-terminal methionine residue, a first nuclear localization signal (NLS), a DNA-binding domain, a linker, an RT domain, and / or a second NLS. In some embodiments, the gene-modified polypeptide comprises, in order from the N-terminus to the C-terminus, a first NLS, a DNA-binding domain, a linker, an RT domain, and a second NLS.

[0278] In some embodiments, the gene-modified polypeptide includes (i) an N-terminal NLS comprising the NLS sequence of PAAKRVKLDGG (SEQ ID NO: 35) or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto), (ii) a Cas domain comprising the Cas sequence of Table 7 or 8 of International Application WO / 2023 / 039440, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto, and (iii) a relic of AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 34) (iv) a linker comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; an RT domain comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (v) a C-terminal NLS of KRTADGSEFEKRTADGSEFESPKKKAKVE (SEQ ID NO: 36) or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto). In some embodiments, the gene-modified polypeptide comprises the amino acid sequence of SEQ ID NO: 23, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0279] In some embodiments, the gene-modified polypeptide includes an N-terminal methionine residue.

[0280] In certain embodiments, the gene-modified polypeptide further includes a spacer sequence between the first NLS and the DNA-binding domain. In certain embodiments, the spacer sequence between the first NLS and the DNA-binding domain includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the first NLS and the DNA-binding domain includes the amino acid sequence GG.

[0281] In certain embodiments, the gene-modified polypeptide further includes a spacer sequence between the DNA-binding domain and the linker. In certain embodiments, the spacer sequence between the DNA-binding domain and the linker includes one, two, three, four, five, six, seven, eight, nine, or ten amino acids. In certain embodiments, the spacer sequence between the DNA-binding domain and the linker includes the amino acid sequence GG.

[0282] In certain embodiments, the gene-modified polypeptide further includes a spacer sequence between the linker and the RT domain. In certain embodiments, the spacer sequence between the linker and the RT domain includes one, two, three, four, five, six, seven, eight, nine, or ten amino acids. In certain embodiments, the spacer sequence between the linker and the RT domain includes the amino acid sequence GG.

[0283] In certain embodiments, the gene-modified polypeptide further includes a spacer sequence between the RT domain and the second NLS. In certain embodiments, the spacer sequence between the RT domain and the second NLS includes one, two, three, four, five, six, seven, eight, nine, or ten amino acids. In certain embodiments, the spacer sequence between the RT domain and the second NLS includes the amino acid sequence AG.

[0284] nucleic acids that encode gene-modified polypeptides Nucleic acids encoding gene-modifying polypeptides for use in the gene modification systems disclosed herein are provided herein. In some embodiments, the nucleic acid is mRNA.

[0285] In some embodiments, the nucleic acid encoding the genetically modified polypeptide (e.g., mRNA) is flanked by an untranslated region (UTR) that modifies the protein expression level. Various 5' and 3' UTRs may be used. In some embodiments, the nucleic acid encoding the genetically modified polypeptide (e.g., RNA) further comprises a poly(A) tail for enhancing polypeptide expression.

[0286] template nucleic acid The gene modification systems described herein can modify host target DNA sites using template nucleic acid sequences. In some embodiments, the gene modification systems described herein transcribe an RNA sequence template to a host target DNA site by targeted primed reverse transcription (TPRT). By directly modifying a DNA sequence(s) in the host genome via reverse transcription of an RNA sequence template, the gene modification systems can insert an object sequence into the target genome without requiring an exogenous DNA sequence to be introduced into the host cell (unlike, for example, the CRISPR system), and furthermore, eliminate the exogenous DNA insertion step. The gene modification systems can also delete sequences from the target genome or introduce substitutions using object sequences. Thus, the gene modification systems provide a platform for the use of customized RNA sequence templates, including object sequences, e.g., sequences containing heterologous genetic codes and / or functional information.

[0287] In some embodiments, the template nucleic acid includes one or more sequences (e.g., two sequences) that bind to a gene-modified polypeptide.

[0288] In some embodiments, the system or method described herein includes a single template nucleic acid (e.g., template RNA). In some embodiments, the system or method described herein includes multiple template nucleic acids (e.g., template RNA).

[0289] In some embodiments, the template RNA may include a gRNA sequence, for example, to orient a gene-modified polypeptide to a target site of interest. In some embodiments, the template RNA includes (i) a gRNA spacer that binds to a target site (e.g., the second strand of a site in the target genome) (e.g., from 5' to 3'), (ii) a gRNA scaffold that binds to a polypeptide described herein (e.g., a gene-modified polypeptide, e.g., the Cas domain of the gene-modified polypeptide), (iii) a heterologous object sequence containing a variant region (optionally, the heterologous object sequence includes a first homology region, a variant region, and a second homology region from 5' to 3'), and (iv) a primer-binding site (PBS) sequence containing a 3' target homology domain.

[0290] In some embodiments, the template RNA molecule for use in the system includes (1) a gRNA spacer, (2) a gRNA scaffold, (3) a heterologous object sequence, and (4) a primer-binding site (PBS) sequence from 5' to 3'. In some embodiments, (1) It is a gRNA spacer of about 18-22 nt, for example, 20 nt (2) A gRNA scaffold comprising one or more hairpin loops, e.g., one or two of three loops, for associating the template with a Cas domain, e.g., a nickase Cas9 domain. In some embodiments, the gRNA scaffold comprises the sequence GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCC (SEQ ID NO: 37) from 5' to 3'. (3) In some embodiments, the heterogeneous object array is, for example, 7 to 74, for example, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, or 70 to 80 nt in length, or 80 to 90 nt in length. (4) In some embodiments, the PBS sequence that binds to the target priming sequence after nicking occurs is, for example, 3-20 nt, for example, 7-15 nt, for example, 12-14 nt. In some embodiments, the PBS sequence has a GC content of 40-60%.

[0291] The template nucleic acid (e.g., template RNA) component of the genome editing systems described herein can typically be bound to the gene-modifying polypeptide of the system. In some embodiments, the template nucleic acid (e.g., template RNA) may be associated with a gRNA scaffold related to the DNA-binding domain of the polypeptide, e.g., a DNA-binding domain derived from Cas9. In some embodiments, the binding region may also provide a gRNA that recognizes a DNA target, e.g., hybridizes to a target DNA sequence and binds to a polypeptide, e.g., a Cas9 domain.

[0292] In some embodiments, the template RNA has a poly(A) tail at its 3' end. In some embodiments, the template RNA does not have a poly(A) tail at its 3' end.

[0293] In some embodiments, the template RNA includes one or more chemically modified nucleotides. In some embodiments, the template RNA includes skeletal modifications, such as modifications to sugar or phosphate groups in the skeleton. In some embodiments, the template RNA includes nucleic acid base modifications.

[0294] In some embodiments, the system described herein comprises two nucleic acids that together contain the sequence of the template RNA described herein. In some embodiments, the two nucleic acids are associated with each other non-covalently, for example, directly (e.g., via base pairing), or indirectly as part of a complex that includes one or more additional molecules.

[0295] In this specification, when an RNA sequence (e.g., a template RNA sequence or an RNA sequence encoding a genetically modified polypeptide) is said to contain a particular sequence containing thymine (T), it is understood that the RNA sequence may (and frequently) contain uracil (U) instead of T. For example, an RNA sequence may contain U at all positions indicated as T in the sequence. More specifically, this disclosure provides RNA sequences that conform to all nucleic acid sequences herein that contain T, and the RNA sequences have U instead of each T. In addition, it is understood that terminal Us and Ts may be optionally added to or removed from the tracrRNA sequence, and may be modified or unmodified when provided as RNA.

[0296] The template RNA described herein may include, from 5' to 3', (1) a gRNA spacer, (2) a gRNA scaffold, (3) a heterologous object sequence, and (4) a primer-binding site (PBS) sequence. Each of these components is described in more detail here.

[0297] gRNA spacer and gRNA scaffold The template RNA described herein may include a gRNA spacer that directs the gene modification system to the target nucleic acid and a gRNA scaffold that facilitates the association of the template RNA with the Cas domain of the gene modification polypeptide. The system described herein may also include gRNA that is not part of the template nucleic acid. For example, a gRNA including a gRNA spacer and a gRNA scaffold but not containing a heterogeneous object sequence or PBS sequence can be used, for example, to induce second strand nicking, as described in the section of this specification titled "Second Strand Nicking".

[0298] In some embodiments, the gRNA is a short synthetic RNA consisting of a scaffold sequence involved in CRISPR-related protein binding and a user-defined target sequence of approximately 20 nucleotides for genomic targeting.

[0299] In some embodiments, the template nucleic acid (e.g., template RNA) has at least 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 bases with at least 80%, 85%, 90%, 95%, 99%, or 100% homology to the target site, for example, including a gRNA spacer sequence of appropriate length to the Cas9 domain of the gene-modified polypeptide at its 5' end.

[0300] Table 12 of International Application WO / 2023 / 039440 (the table thereof is incorporated herein by reference in its entirety) provides parameters for defining components for designing gRNA and / or template RNA to apply Cas variants listed in Table 8 of International Application WO / 2023 / 039440 for gene modification. A given enzyme gRNA can be assembled by ligating crRNA, tetraloop, and tracrRNA sequences and further adding a 5' spacer of minimum and maximum length within the spacer to match the protospacer at the target site. In some embodiments, the gRNA scaffold described herein includes a nucleic acid sequence comprising, in the 5' to 3' direction, a crRNA, a tetraloop, and a tracrRNA, or sequences having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto, as shown in Table 12 of International Application WO2023 / 039440. In some embodiments, the gRNA or template RNA comprising the scaffold further comprises gRNA spacers having lengths within the spacer (minimum) and spacer (maximum) shown in the same row of Table 12. In some embodiments, the gRNA or template RNA having a sequence according to Table 12 of International Application WO2023 / 039440 is comprised of a system further comprising a genetically modified polypeptide, the genetically modified polypeptide comprising a Cas domain as shown in the same row of Table 12.

[0301] Array of heterogeneous objects The template RNA described herein may include a heterologous object sequence that a gene-modified polypeptide can use as a template for reverse transcription to write a desired sequence into a target nucleic acid. In some embodiments, the heterologous object sequence includes a post-edited homology region, a mutation region, and a pre-edited homology region from 5' to 3'. Although not intended to be constrained by theory, the reverse transcription (RT) performing reverse transcription on the template RNA first reverse transcribes the pre-edited homology region, then the mutation region, and then the post-edited homology region, thereby creating a DNA strand containing the desired mutation with homology regions on both sides.

[0302] In some embodiments, the heterogeneous object sequence is 10-100, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-30, or 10-20 nucleotides long, for example, 10-80, 10-50, or 10-20 nucleotides long, for example, about 10-20 nucleotides long. In some embodiments, the heterogeneous object sequence is 8-30, 9-25, 10-20, 11-16, or 12-15 nucleotides long, for example, 11-16 nucleotides long.

[0303] Heterogeneous object sequences can be designed to cause insertions, substitutions, or deletions at target DNA loci.

[0304] In some embodiments, the pre-editing homology domain includes a nucleic acid sequence having 100% sequence identity with the nucleic acid sequence contained in the target nucleic acid molecule. In some embodiments, the post-editing homology domain includes a nucleic acid sequence having 100% sequence identity with the nucleic acid sequence contained in the target nucleic acid molecule.

[0305] PBS sequence In some embodiments, the template nucleic acid (e.g., template RNA) comprises a PBS sequence. In some embodiments, the PBS sequence is positioned at 3' of the heterologous object sequence and is complementary to a sequence adjacent to the site modified by the system described herein, or contains 1, 2, 3, 4, or 5 or fewer mismatches with a sequence complementary to a sequence adjacent to the site modified by the system / gene modification polypeptide. In some embodiments, the PBS sequence is bound within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of a nick site in the target nucleic acid molecule. In some embodiments, binding of the PBS sequence to the target nucleic acid molecule enables the initiation of targeted primed reverse transcription (TPRT), for example, by the 3' homology domain acting as a primer for TPRT. In some embodiments, the PBS sequence is 5–20, 8–16, 8–14, 8–13, 9–13, 9–12, or 10–12 nucleotides long, for example, 9–12 nucleotides long.

[0306] Exemplary template RNA sequence - liver cells In some embodiments of the systems and methods described herein, the template RNA includes a gRNA spacer comprising the gRNA spacer sequence shown in Table 5 or 6.

[0307] Table 5 provides gRNA spacer sequences for correcting the pathogenic R408W mutation in the PAH gene, for example, to treat PKU. Table 6 provides gRNA spacer sequences for correcting the pathogenic E342K mutation in the SERPINA1 gene, for example, to treat AATD. A list of spacers, PAMs, and Cas variants for generating nicks at appropriate locations is provided herein to enable the installation of desired genome editing using gene modification systems. The spacers in these tables are designed to be used with gene modification polypeptides containing nickase variants of the Cas species shown in the tables. In some embodiments, the payloads described herein include template RNA containing the spacers in Table 5, or sequences having 1, 2, or 3 or fewer sequence differences thereto. In some embodiments, the payloads described herein include template RNA containing the spacers in Table 6, or sequences having 1, 2, or 3 or fewer sequence differences thereto. [Table 4] [Table 5]

[0308] In some embodiments, the template RNA described herein includes a gRNA scaffold that binds to SpyCas9. In some embodiments, the gRNA scaffold that binds to SpyCas9 includes a sequence that conforms to GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 40), or a sequence or fragment thereof that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0309] In some embodiments, the template RNA described herein includes a gRNA scaffold that binds to St1Cas9. In some embodiments, the gRNA scaffold that binds to St1Cas9 includes a sequence that follows GUCUUUGUACUCUGGUACCAGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACCCUGUCAUUUUAUGGCAGGGUGUUUU (Sequence ID 41), or a sequence or fragment thereof that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0310] For example, in some embodiments of the systems and methods herein for modifying PAHs, for example, for correcting the R408W mutation, the heterogeneous object sequence includes the RT template sequence in Table 7. The RT and PBS sequences in Table 7 are compatible with spacers, for example, those listed in the first column of Table 7. In some embodiments, the primer-binding site (PBS) sequence has a sequence that includes the PBS sequence from the same row in Table 7 as the RT template sequence. In some embodiments, the payload described herein includes a template RNA containing one or both of the RT and PBS sequences in Table 7, or a sequence having one, two, or three or fewer sequence differences thereto.

[0311] For example, in some embodiments of the systems and methods herein for modifying SERPINA1, for example, for correcting the E342K mutation, the heterogeneous object sequence includes the RT template sequence in Table 8. The RT and PBS sequences in Table 8 are compatible with the spacers listed in the first column of Table 8. In some embodiments, the primer binding site (PBS) sequence has a sequence that includes the PBS sequence from the same row in Table 8 as the RT template sequence. In some embodiments, the payload described herein includes a template RNA containing one or both of the RT and PBS sequences in Table 8, or a sequence having one, two, or three or fewer sequence differences thereto. [Table 6] [Table 7]

[0312] In some embodiments of the systems and methods herein, the system further comprises a second-strand targeting gRNA that directs a nick to the second strand of the human SERPINA1 gene or the human PAH gene. In some embodiments, for example, for modifying PAH, for example, for correcting the R408W mutation, the systems and methods provided herein may include template sequences listed in Table 9. Table 9 shows the full-length sequences of the template RNAs described herein, for example, including the spacers in Table 5, for example, the heterologous object sequences and / or PBS sequences in Table 7. In some embodiments, the template RNA includes sequences according to Table 9, or sequences having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the template RNA according to Table 9 herein includes one or more chemical modifications.

[0313] In some embodiments, the systems and methods provided herein for modifying, for example, SERPINA1, for example, for correcting the E342K mutation, may include template sequences listed in Table 10. Table 10 shows full-length sequences of various template RNAs described herein, including, for example, spacers in Table 6, heterogeneous object sequences and / or PBS sequences in Table 8. In some embodiments, the template RNA includes sequences according to Table 10, or sequences having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the template RNA according to Table 10 herein includes one or more chemical modifications. [Table 8] [Table 9]

[0314] In this specification, for example, certain heterologous object sequences and PBS sequences provided in Table 7 may be designed to correct the PAH mutation by replacing a "T" nucleotide with a "C" nucleotide at the mutation site via gene editing in order to reverse the R408W mutation in the corresponding protein. In this specification, for example, certain heterologous object sequences and PBS sequences provided in Table 8 may be designed to correct the AATD mutation by replacing an "A" nucleotide with a "G" nucleotide at the mutation site via gene editing in order to reverse the E342K mutation in the corresponding protein.

[0315] In some embodiments, the template RNA of this section for modifying the PAH is used together with a gene-modified polypeptide having the sequence of SEQ ID NO: 32, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, the gene-modified polypeptide is provided as a nucleic acid (e.g., mRNA) encoding the amino acid sequence of SEQ ID NO: 32, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0316] In some embodiments, the template RNA of this section for modifying SERPINA1 is used together with a gene-modified polypeptide having the sequence of SEQ ID NO: 31, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, the gene-modified polypeptide is provided as a nucleic acid (e.g., mRNA) encoding the amino acid sequence of SEQ ID NO: 31, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0317] The template RNA sequences described herein can be customized depending on various factors. For example, in some embodiments, it is desirable to inactivate the PAM sequence during editing (e.g., using a "PAM kill" modification) to reduce the possibility of further gene editing after the initial editing (e.g., by Cas retargeting). Therefore, certain template RNAs described herein are designed to write mutations (e.g., substitutions) to the PAM at the target site, so that during editing, the PAM site is mutated to a sequence that is no longer recognized by the gene-modified polypeptide. Thus, the mutated region within the heterologous object sequence of the template RNA may include a PAM kill sequence. Although we do not wish to be constrained by theory, in some embodiments, the PAM kill sequence prevents or reduces recombination of the gene-modified polypeptide at the completion of gene modification. In some embodiments, the PAM kill sequence does not alter the amino acid sequence encoded by the gene; for example, the PAM kill sequence results in a silent mutation. In other embodiments, it is desirable to leave the PAM sequence intact (no PAM kill).

[0318] Similarly, in some embodiments, it may be desirable to modify the first three nucleotides of the RT template sequence via a “seedkill” motif to reduce the possibility of further gene editing after initial editing (e.g., by Cas retargeting). Therefore, certain template RNAs described herein are designed to write mutations (e.g., substitutions) to a portion of the target site corresponding to the first three nucleotides of the RT template sequence, so that, upon editing, the target site is mutated to a sequence with less homology to the RT template sequence. Thus, the mutated region within the heterologous object sequence of the template RNA may contain a seedkill sequence. While not intended to be theoretically constrained, in some embodiments, the seedkill sequence prevents or reduces recombination of the modified polypeptide at the completion of gene modification compared to other similar template RNAs lacking a seedkill sequence. In some embodiments, the seedkill sequence does not alter the amino acid sequence encoded by the gene; for example, the seedkill sequence results in a silent mutation. In other embodiments, it is desirable to leave the seed region intact, and no seedkill sequence is used.

[0319] In further embodiments, it may be desirable to circumvent the target cell's mismatch repair or nucleotide repair pathway, or to bias the target cell's repair pathway toward preservation of the edited strand, in order to optimize or improve gene editing efficiency. In some embodiments, multiple silent mutations (e.g., silent substitutions) may be introduced into the RT template sequence to circumvent the target cell's mismatch repair or nucleotide repair pathway, or to bias the target cell's repair pathway toward preservation of the edited strand.

[0320] Exemplary template RNA sequence - HSC In some embodiments, the template RNA described herein may contain single nucleotide polymorphisms (SNPs) relative to the reference sequence. In some embodiments, the cell line used for screening may contain one or more additional SNPs at the HBB locus compared to a patient or reference sequence, e.g., the hg38 human genome reference sequence, and the landing pad containing the target mutation may optionally be designed to carry one or more non-pathogenic SNPs to match the endogenous cell line HBB locus, e.g., to carry mutations that reproduce SNPs present at the endogenous HBB locus in HEK293T cells. While not intended to limit us by the examples, it should be understood that a template RNA sequence found to successfully edit the target mutation at a site containing additional SNPs compared to the reference sequence is different from a therapeutic template RNA in any region overlapping with the additional SNPs. For example, a successful template RNA in a HEK293T-based screening assay, in which the genome landing pad includes a target mutation (corresponding to an endogenous E6V mutation caused by DNA substitution NC_000011.10:g.5227002T>A) and an additional substitution compared to hg38 in the protospacer (corresponding to an NC_000011.10:g.5227013T>C mutation at the endogenous HBB locus in HEK293T cells), may provide a candidate composition in which the corresponding therapeutic template RNA has an intraspace substitution (C>T) in the spacer region relative to the corresponding spacer region of the screening RNA, in order to enable therapeutic correction of the E6V mutation at a target site that lacks the additional substitution, e.g., a pathogenic E6V mutation, but otherwise matches the hg38 reference sequence. In this example, a screening cell line including a target site landing pad containing a pathogenic mutation with an additional T>C substitution in the protospacer region is the spacer sequence [ka] The screening template RNA may be modified using (SEQ ID NO: 50), but the corresponding therapeutic template RNA may have a spacer sequence. [ka] (SEQ ID NO: 51) may be included, where the underlined nucleotide indicates a position to be modified to match either the screening cell target sequence or the hg38 target sequence. In some embodiments, spacers, PBS, and / or RT template regions may need to be thus adjusted to account for any discrepancies between the screening and reference target sequences. A given patient or patient population may have one or more SNPs for hg38 at the target locus in addition to the pathogenic E6V mutation, and it is therefore further intended that patient or patient population-specific template RNA sequences can be generated using similar adaptations of candidate template RNA molecules.

[0321] In some embodiments, gene modification systems used to correct the pathogenic E6V mutation in HBB are described in their entirety in WO2023 / 039440, which is incorporated herein by reference.

[0322] Table 11 provides several gRNAs for correcting pathogenic EV6 mutations in HBB. It lists spacers, PAMs, and Cas variants for generating nicks at appropriate locations to enable the installation of desired genome editing using the gene modification system. The spacers in this table are designed to be used with gene modification polypeptides containing nickase variants of the Cas species shown in the table. In some embodiments, the payloads described herein include template RNA containing the spacers in Table 11, or sequences having 1, 2, or 3 or fewer sequence differences thereto. [Table 10]

[0323] In some embodiments, the template RNA described herein includes a gRNA scaffold that binds to SpyCas9. In some embodiments, the gRNA scaffold that binds to SpyCas9 includes a sequence that conforms to GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 53), or a sequence or fragment thereof that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0324] In some embodiments of the systems and methods described herein, the heterogeneous object sequence includes an RT template sequence from Table 12. The RT sequences in Table 12 are compatible, for example, with spacer HBB5 having a SNP or HBB5 without a SNP. In some embodiments, the payload described herein includes a template RNA containing an RT from Table 12, or a sequence having one, two, or three or fewer sequence differences thereto. [Table 11]

[0325] In some embodiments of the systems and methods described herein, PBS comprises a PBS template sequence from Table 13. The RT sequences in Table 13 are compatible, for example, with spacer HBB5 having a SNP or HBB5 without a SNP. In some embodiments, the payload described herein comprises a template RNA containing PBS from Table 13, or a sequence having one, two, or three or fewer sequence differences thereto. [Table 12]

[0326] In some embodiments of the systems and methods described herein, the heterogeneous object sequence includes an RT template sequence from Table 14. The RT and PBS sequences in Table 14 are compatible with the spacers listed in the first column of Table 14. In some embodiments, the primer binding site (PBS) sequence has a sequence that includes a PBS sequence from the same row in Table 14 as the RT template sequence.

[0327] Table 14 provides exemplary PBS sequences and heterologous object sequences (reverse transcription template regions) of template RNA for correcting pathogenic EV6 mutations in HBBs. gRNA spacers were selected, for example, by development within 15 nt of the desired edit site and by the use of Tier 1 Cas enzymes. The PBS sequences and heterologous object sequences (reverse transcription template regions) were designed for nick sites directed by congeneral gRNAs, as described in this application. For illustrative purposes, these regions were designed to extend 8–17 nt (priming) and 1–50 nt beyond the edit (RT) site. While not intended to be limited by example, given length variability is provided using the maximum length parameter and including all templates of shorter lengths within the given parameter. Sequences are indicated by uppercase letters indicating the core sequence and lowercase letters indicating adjacent sequences that can be cleaved within the stated length parameter. [Table 13]

[0328] In some embodiments of the systems and methods described herein, the system further comprises a second strand targeting gRNA that directs a nick to the second strand of the human HBB gene. In some embodiments, the second strand targeting gRNA comprises a gRNA spacer sequence, a gRNA scaffold sequence, or both from Table 15. Table 15 provides exemplary second nick gRNA species for optional use in correcting pathogenic E6V mutations in HBB. [Table 14-1] [Table 14-2] [Table 14-3]

[0329] In some embodiments, the systems and methods provided herein for modifying HBBs, for example, for correcting E6V mutations, may include template sequences listed in Table 16. Table 16 shows the full-length sequences of various template RNAs described herein, including, for example, the spacers in Table 11. In some embodiments, the template RNA includes sequences listed in Table 16, or sequences having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the template RNAs listed in Table 16 herein include one or more chemical modifications, for example, chemical modifications, as listed in Table 14 of International Application WO / 2023 / 039440 (whose table is incorporated herein by reference in its entirety). [Table 15-1] [Table 15-2]

[0330] Heterogeneous object sequences and PBS sequences may be designed to correct SCD mutations by replacing "T" nucleotides with "A" nucleotides (wild type) or by replacing the mutation site with "C" (Makassar install) using the gene modification systems described herein.

[0331] The template RNA sequences described herein can be customized depending on various factors. For example, in some embodiments, it is desirable to inactivate the PAM sequence during editing (e.g., using a "PAM kill" modification) to reduce the possibility of further gene editing after the initial editing (e.g., by Cas retargeting). Therefore, certain template RNAs described herein are designed to write mutations (e.g., substitutions) to the PAM at the target site, so that during editing, the PAM site is mutated to a sequence that is no longer recognized by the gene-modified polypeptide. Thus, the mutated region within the heterologous object sequence of the template RNA may include a PAM kill sequence. Although we do not wish to be constrained by theory, in some embodiments, the PAM kill sequence prevents or reduces recombination of the gene-modified polypeptide at the completion of gene modification. In some embodiments, the PAM kill sequence does not alter the amino acid sequence encoded by the gene; for example, the PAM kill sequence results in a silent mutation. In other embodiments, it is desirable to leave the PAM sequence intact (no PAM kill).

[0332] In some embodiments, it is desirable to inactivate the PAM sequence during editing ("PAM kill"), while in other embodiments, it is preferable to leave the PAM sequence intact (no PAM kill). The RT template can be designed as either a "PAM kill" or "no PAM kill" version, for example, as shown below. HBB5 spacer (without SNP): CATGGTGCATCTGACTCCTG (Sequence ID 51) HBB5 PBS (no SNP): GAGTCAGAtgcaccatg (SEQ ID NO: 138) HBB5 RT template (no PAM kills): aacggcagactTCTCG T CAG (Sequence ID 139) HBB8 RT template (no SNP): tggtgcatctgACTCCTG A G (Sequence ID 140)

[0333] Similarly, in some embodiments, it may be desirable to modify the first three nucleotides of the RT template sequence via a “seedkill” motif to reduce the possibility of further gene editing after initial editing (e.g., by Cas retargeting). Therefore, certain template RNAs described herein are designed to write mutations (e.g., substitutions) to a portion of the target site corresponding to the first three nucleotides of the RT template sequence, so that, upon editing, the target site is mutated to a sequence with less homology to the RT template sequence. Thus, the mutated region within the heterologous object sequence of the template RNA may contain a seedkill sequence. While not intended to be theoretically constrained, in some embodiments, the seedkill sequence prevents or reduces recombination of the modified polypeptide at the completion of gene modification compared to other similar template RNAs lacking a seedkill sequence. In some embodiments, the seedkill sequence does not alter the amino acid sequence encoded by the gene; for example, the seedkill sequence results in a silent mutation. In other embodiments, it is desirable to leave the seed region intact, and no seedkill sequence is used.

[0334] In further embodiments, it may be desirable to circumvent the target cell's mismatch repair or nucleotide repair pathway, or to bias the target cell's repair pathway toward preservation of the edited strand, in order to optimize or improve gene editing efficiency. In some embodiments, multiple silent mutations (e.g., silent substitutions) may be introduced into the RT template sequence to circumvent the target cell's mismatch repair or nucleotide repair pathway, or to bias the target cell's repair pathway toward preservation of the edited strand.

[0335] Table 7A of International Application WO / 2023 / 039440 (whose table is incorporated herein by reference in its entirety) provides exemplary silent mutations for various locations within the HBB gene. These silent mutations may be incorporated into the template RNA described herein.

[0336] Second chain nicking In some embodiments, the gene modification systems described herein include nickase activity (e.g., in a gene-modified polypeptide) for nicking a first strand and nickase activity (e.g., in the same gene-modified polypeptide or a polypeptide isolated from a gene-modified polypeptide) for nicking a second strand of target DNA. As considered herein, although we do not wish to be constrained by theory, it is thought that nicking the first strand of target site DNA provides a 3'OH that can be used by the RT domain to reverse transcribe the template RNA sequence, e.g., a heterologous object sequence. Although we do not wish to be constrained by theory, it is thought that introducing an additional nick to the second strand may bias the cellular DNA repair mechanism to adopt heterologous object sequence-based sequences more frequently than the original genomic sequence. In some embodiments, the additional nick to the second strand is made by the same endonuclease domain (e.g., a nickase domain) as the nick to the first strand. In some embodiments, the same gene-modified polypeptide performs both the nick to the first strand and the nick to the second strand. In some embodiments, the gene-modified polypeptide comprises a CRISPR / Cas domain, and the additional nick to the second strand is directed by an additional nucleic acid, for example, a second gRNA that directs the CRISPR / Cas domain to introduce the nick to the second strand. In other embodiments, the additional second strand nick is made by a different endonuclease domain (e.g., a nickase domain) than the nick to the first strand. In some embodiments, this different endonuclease domain is located in an additional polypeptide (e.g., the system of the present invention further comprises an additional polypeptide) separate from the gene-modified polypeptide. In some embodiments, the additional polypeptide comprises an endonuclease domain (e.g., a nickase domain) as described herein. In some embodiments, the additional polypeptide comprises, for example, a DNA-binding domain as described herein.

[0337] In this specification, the location of a second strand nick relative to a first strand nick is intended to influence one or more of the following: the degree to which a desired gene modification DNA modification is obtained, the degree to which an undesirable double-strand break (DSB) occurs, the degree to which an undesirable insertion occurs, or the degree to which an undesirable deletion occurs. Although we do not wish to be constrained by theory, second strand nicks can occur in two general directions: inward nicks and outward nicks. The directions of inward and outward nicks are described in detail in International Application WO / 2023 / 039440.

[0338] Examples of gRNAs suitable for introducing a second strand nick are provided, for example, in Table 13 of this specification.

[0339] Adjustment Edit In some embodiments, regulatory editing can be introduced using a gene modification system. In some embodiments, the regulatory editing is introduced into a regulatory sequence of a gene, such as a gene promoter, gene enhancer, gene repressor, or sequence that regulates gene splicing. In some embodiments, the regulatory editing increases or decreases the expression level of a target gene. In some embodiments, the target gene is the same as the gene containing the disease-causing mutation. In some embodiments, the target gene is different from the gene containing the disease-causing mutation. For example, using the system or method provided herein, the expression of fetal hemoglobin can be upregulated by introducing regulatory editing into the promoter of bcl11a, thereby treating sickle cell anemia.

[0340] In some embodiments, multiple components of a gene modification system may be prepared as a single LNP formulation, for example, the LNP formulation comprising a gene-modified polypeptide and mRNA encoding an RNA template. The ratio of nucleic acid components may be varied to maximize the therapeutic properties. In some embodiments, the ratio of RNA template to mRNA encoding a gene-modified polypeptide is about 1:1 to 100:1 in molar ratio, for example, about 1:1 to 20:1, about 20:1 to 40:1, about 40:1 to 60:1, about 60:1 to 80:1, or about 80:1 to 100:1. In other embodiments, a system of multiple nucleic acids may be prepared by separate formulations, for example, one LNP formulation containing template RNA and a second LNP formulation containing mRNA encoding a gene-modified polypeptide. In some embodiments, the system may contain more than two nucleic acid components formulated into LNPs. In some embodiments, the system may contain a protein, for example, a gene-modified polypeptide and template RNA formulated into at least one LNP formulation.

[0341] In some embodiments, regulatory editing can be introduced using a gene modification system. In some embodiments, the regulatory editing is introduced into a regulatory sequence of a gene, such as a gene promoter, gene enhancer, gene repressor, or sequence that regulates gene splicing. In some embodiments, the regulatory editing increases or decreases the expression level of a target gene. In some embodiments, the target gene is the same as the gene containing the disease-causing mutation. In some embodiments, the target gene is different from the gene containing the disease-causing mutation. For example, using the system or method provided herein, the expression of fetal hemoglobin can be upregulated by introducing regulatory editing into the promoter of bcl11a, thereby treating sickle cell anemia.

[0342] Table 17 provides exemplary indications (column 1), genes (column 2), and regulatory edits (column 3) that can be introduced using the systems or methods described herein. [Table 16-1] Table 16-2 Table 16-3

[0343] T cell editing The conjugates described herein may be used to target and modify immune cells. In some embodiments, the conjugates may be used to modify T cells. In some embodiments, the T cells may include any subpopulation of T cells, e.g., CD4+, CD8+, gamma-delta, naive T cells, stem cell memory T cells, central memory T cells, or a mixture of subpopulations. In some embodiments, the conjugates may be used to deliver or modify T cell receptors (TCRs) in T cells. In some embodiments, the conjugates may be used to deliver at least one chimeric antigen receptor (CAR) to T cells. For example, in certain embodiments, the conjugates may be used to deliver mRNA encoding a CAR to T cells. In some embodiments, the conjugates may be used to deliver at least one CAR to natural killer (NK) cells. In some embodiments, the conjugates may be used to deliver at least one CAR to natural killer (NKT) cells. In some embodiments, the conjugate may be used to deliver at least one CAR to progenitor cells, e.g., T cells, NK cells, or NKT cell progenitors. In some embodiments, cells modified with at least one CAR (e.g., CAR-T cells, CAR-NK cells, CAR-NKT cells), or a combination of cells modified with at least one CAR (e.g., a mixture of CAR-NK / T cells), MacKay, et al. Nat Biotechnol 38,233-244 (2020) (the entire text of which is incorporated herein by reference) are used to treat conditions identified in the targetable landscape of CAR therapy. In some embodiments, immune cells are used to treat tumors or conditions identified by AChR (fetal acetylcholine receptor), ADGRE2, AFP (alpha-fetoprotein), BAFF-R, BCMA, CAIX (carbonic anhydrase IX), CCR1, CCR4, CEA (carcinoembryonic antigen), CD3, CD5, CD8, CD7, CD10, CD13, CD14, CD15, CD19, CD20, CD22, CD30, CD33, CLLI, CD34, CD38, CD41, CD44, CD49f, CD56, CD61, CD64, CD68, CD70,CD74, CD99, CD117, CD123, CD133, CD138, CD44v6, CD267, CD269, CDS, CLEC12A, CS1, EGP-2 (epithelial glycoprotein-2), EGP-40 (epithelial sugar protein-40), EGFR (HER1), EGFR-VIII, EpCAM (epithelial cell adhesion molecule), EphA2, ERBB2 (HER2, human epidermal growth factor receptor 2), ERBB3, ERBB4, FBP (folate binding Proteins), Flt3 receptor, folate receptor-a, GD2 (ganglioside G2), GD3 (ganglioside G3), GPC3 (glypican-3), GPI00, hTERT (human telomerase reverse transcriptase), ICAM-1, integrin B7, interleukin-6 receptor, IL13Ra2 (interleukin-13 receptor 30 subunit alpha-2), kappa light chain, KDR (kinase insertion domain receptor), LeY (Lewis Y), L1CAM (LI cell adhesion molecule), LILRB2 (leukocyte immunoglobulin-like receptor B2), MARTI, MAGE-A1 (melanoma-associated antigen Al), MAGE-A3, MSLN (mesothelin), MUC16 (mucin 16), MUCI (mucin I), KG2D ligand, NY-ESO-1 (cancer r-testis antigen), PRI (proteinase 3), TRBCI, TRBC2, TFM-3, TACI, tyrosine, hTERT, tumor fetal antigen (h5T4), p53, P It contains CARs specific to pathogen antigens selected from the group consisting of SCA (prostate stem cell antigen), PSMA (prostate-specific membrane antigen), hRORl, TAG-72 (tumor-associated glycoprotein 72), VEGF-R2 (vascular endothelial growth factor R2), WT-1 (Wilms tumor protein), and antigens of HIV (human immunodeficiency virus), hepatitis B, hepatitis C, CMV (cytomegalovirus), EBV (Epstein-Barr virus), and HPV (human papillomavirus).

[0344] In some embodiments, immune cells, such as T cells, NK cells, NKT cells, or progenitor cells, are modified ex vivo and then delivered to the patient. In some embodiments, nucleic acids (e.g., mRNA) are delivered by one of the methods referred to herein, and immune cells, such as T cells, NK cells, NKT cells, or progenitor cells, are modified in vivo in the patient.

[0345] In certain embodiments, the target-directed portion is an antibody, Fab fragment, or ScFv that binds to a T cell antigen selected from the group consisting of T cell target-directed portions such as CD2, CD3, CD4, CD5, CD7, CD8, CD28, CD137, CD45, T cell receptor (TCR)β, TCR-α, TCR-α / β, TCR-γ / δ, PD1, CTLA4, TIM3, LAG3, CD18, IL-2 receptor, CD11a, TLR2, TLR4, TLR5, IL-7 receptor, or IL-15 receptor.

[0346] V. Treatment method In some embodiments, LNPs or conjugates (targeted LNPs) described herein are used to treat diseases, disorders, or conditions. In some embodiments, LNPs or conjugates, or components or parts thereof, described herein are used to treat diseases, disorders, or conditions listed in any of Tables 18 to 23. In some embodiments, LNPs or conjugates described herein are used to treat, for example, hematopoietic stem cell (HSC) diseases, disorders, or conditions listed in Table 18. In some embodiments, LNPs or conjugates described herein are used to treat, for example, kidney diseases, disorders, or conditions listed in Table 19. In some embodiments, LNPs or conjugates described herein are used to treat, for example, liver diseases, disorders, or conditions listed in Table 20. In some embodiments, LNPs or conjugates described herein are used to treat, for example, lung diseases, disorders, or conditions listed in Table 21. In some embodiments, LNPs or conjugates described herein are used to treat, for example, skeletal muscle diseases, disorders, or conditions listed in Table 22. In some embodiments, the LNPs or conjugates described herein are used to treat, for example, skin diseases, disorders, or conditions listed in Table 23. [Table 17] [Table 18] [Table 19-1] [Table 19-2] [Table 20] [Table 21] [Table 22]

[0347] In some embodiments, the LNPs or conjugates described herein are delivered to tissues or cells from the cerebrum, cerebellum, adrenal glands, ovaries, pancreas, parathyroid glands, pituitary gland, testes, thyroid gland, breast, spleen, tonsils, thymus, lymph nodes, bone marrow, lungs, myocardium, esophagus, stomach, small intestine, colon, liver, salivary glands, kidneys, prostate, blood, or other cell or tissue types. In some embodiments, the LNPs or conjugates described herein are used to treat diseases such as cancer, inflammatory diseases, infections, gene defects, or other disorders. Cancer can be cancer of the cerebrum, cerebellum, adrenal glands, ovaries, pancreas, parathyroid glands, pituitary gland, testes, thyroid gland, breast, spleen, tonsils, thymus, lymph nodes, bone marrow, lungs, myocardium, esophagus, stomach, small intestine, colon, liver, salivary glands, kidneys, prostate, blood, or other cell or tissue types, and may include multiple cancers.

[0348] In some embodiments, the LNPs or conjugates disclosed herein are delivered ex vivo to isolated cells (e.g., T cells or HSCs) of a subject (e.g., a human patient) that requires them. In some such embodiments, the T cells or HSCs are first collected from the bone marrow of the subject. After isolation of the desired cell population, the LNPs of this disclosure can be mixed with the cells, thereby resulting in effective transduction of the payload (e.g., a gene modification system) into the T cells or HSCs. The modified T cells or HSCs can then be administered to the patient.

[0349] In some embodiments, where the cells are T cells, the cells can be activated prior to ex vivo delivery of the LNP or conjugate. In other embodiments, the T cells are not activated prior to ex vivo delivery of the LNP or conjugate to the T cells.

[0350] In other embodiments, LNPs such as those disclosed herein, e.g., targeted LNPs, can be introduced into cells, tissues, and / or multicellular organisms. In other embodiments, LNPs, e.g., targeted LNPs, are delivered to cells by mechanical or physical means.

[0351] Therapeutic protein drug formulations are described in Meyer (Ed.), Therapeutic Protein Drug Products: Practical Approaches to Formulation in the Laboratory, Manufacturing, and the Clinic, Woodhead Publishing Series (2012).

[0352] In some embodiments, the LNPs or conjugates described herein are administered in vivo to patients in need. High levels of transduction and protein expression after in vivo administration allow for sufficient levels of transduction and expression of the protein (e.g., a genetically modified protein), and thus can be used to treat a variety of diseases, including, but not limited to, those listed in Tables 18-23.

[0353] In some embodiments, the LNPs or conjugates described herein are delivered from or within the bone marrow to tissues or cells. In some such embodiments, the LNPs, e.g., targeted LNPs, are administered by parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intradermal, epidural, intracerebral, intraventricular, percutaneous, nasal, intra-arterial, intra-articular, intracavernosal, intraocular, intramedullary, intraperitoneal, intrathecal, intrauterine, vaginal, intravesical, perivascular, or transmucosal administration).

[0354] In some embodiments, the LNPs or conjugates described herein deliver the above-mentioned therapeutic agents to the patient's T cells, HSCs (e.g., LT-HSCs), or liver cells after in vivo administration. In some embodiments, the LNPs of the Disclosure, e.g., targeted LNPs, deliver gene-modified polypeptides or nucleic acids encoding gene-modified polypeptides to the patient's T cells, HSCs (e.g., LT-HSCs), or liver cells after in vivo administration. In some embodiments, the LNPs of the Disclosure, e.g., targeted LNPs, deliver gene-modification systems to the patient's T cells, HSCs (e.g., LT-HSCs), or liver cells after in vivo administration. In some embodiments, the LNPs of the Disclosure, e.g., targeted LNPs, deliver gene-editing components to the patient's T cells, HSCs (e.g., LT-HSCs), or liver cells after in vivo administration. Exemplary gene-editing systems are described above. After in vivo administration, nucleic acids encoding components of a system for modifying or altering the genome can be expressed, resulting in in vivo gene editing of T cells, HSCs (e.g., LT-HSCs), or liver cells.

[0355] Surprisingly, it has been found that certain combinations of target-directed moieties (e.g., antibodies, Fab fragments, or scFv) and ionizable lipids in certain LNP formulations (e.g., containing a specific amount of helper lipids) can deliver the therapeutic agent to more HSCs (e.g., LT-HSCs) and / or deliver a larger amount of the therapeutic agent to T cells or HSCs (e.g., LT-HSCs) after in vivo administration to a subject. In some cases, the LNPs described herein result in an enhanced level of modification or alteration of the genomic DNA of T cells or HSCs, e.g., an enhanced level of gene editing in T cells or HSCs. In some embodiments, the percentage of T cells or HSCs exhibiting modified or altered (e.g., edited) genomic DNA in a subject after administration of the LNP, e.g., targeted LNP, is at least 20%. In some cases, the LNPs described herein result in an enhanced level of modification or alteration of the genomic DNA of T cells or HSCs, e.g., an enhanced level of gene editing in T cells or HSCs. In some embodiments, the percentage of T cells or HSCs having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNP, e.g., targeted LNP, is at least 30%. In some embodiments, the percentage of T cells or HSCs having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNP, e.g., targeted LNP, is at least 40%. In some embodiments, the percentage of T cells or HSCs having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNP, e.g., targeted LNP, is at least 50%. In some embodiments, the percentage of T cells or HSCs having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNP, e.g., targeted LNP, is at least 60%. In some embodiments, the percentage of T cells or HSCs having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNP, e.g., targeted LNP, is at least 70%.In some embodiments, the percentage of T cells or HSCs (e.g., LT-HSCs) having modified or altered (e.g., edited) genomic DNA in a subject after administration of an LNP, e.g., a targeted LNP, is about 20% to about 50%, about 20% to about 40%, or about 20% to about 30%. In some embodiments, an additional 10% of T cells or HSCs have modified or altered (e.g., edited) genomic DNA in a subject after administration of an LNP, e.g., a targeted LNP, comprising the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or gene-modifying system), compared to a baseline LNP (e.g., an LNP comprising V003) comprising the same therapeutic agent. In some embodiments, 15% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 20% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 25% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., a targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., an LNP containing V003).In some embodiments, 30% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 35% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 40% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 45% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 50% of additional T cells or HSCs have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., the targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., the LNP containing V003).In some embodiments, the number of T cells or HSCs containing modified or altered (e.g., edited) genomic DNA can be determined by DNA sequencing.

[0356] Surprisingly, it has been discovered that certain combinations of a target-directing moiety (e.g., antibody, Fab fragment, or scFv) and an ionizable lipid in certain LNP formulations (e.g., containing a specific amount of helper lipids) can deliver the therapeutic agent to more hepatocytes and / or deliver a larger amount of the therapeutic agent to hepatocytes after in vivo administration to a subject. In some cases, the LNPs described herein result in an enhanced level of modification or alteration of genomic DNA in hepatocytes, e.g., an enhanced level of gene editing in hepatocytes. In some embodiments, the percentage of hepatocytes exhibiting modified or altered (e.g., edited) genomic DNA in a subject after administration of an LNP, e.g., a targeted LNP, is at least 20%. In some cases, the LNPs described herein result in an enhanced level of modification or alteration of genomic DNA in hepatocytes, e.g., an enhanced level of gene editing in hepatocytes. In some embodiments, the percentage of hepatocytes having modified or altered (e.g., edited) genomic DNA in a subject after administration of an LNP, e.g., a targeted LNP, is at least 30%. In some embodiments, the percentage of liver cells having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNPs, e.g., targeted LNPs, is at least 40%. In some embodiments, the percentage of liver cells having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNPs, e.g., targeted LNPs, is at least 50%. In some embodiments, the percentage of liver cells having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNPs, e.g., targeted LNPs, is at least 60%. In some embodiments, the percentage of liver cells having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNPs, e.g., targeted LNPs, is at least 70%. In some embodiments, the percentage of liver cells having modified or altered (e.g., edited) genomic DNA in a subject after administration of LNPs, e.g., targeted LNPs, is about 20% to about 50%, about 20% to about 40%, or about 20% to about 30%.In some embodiments, 10% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 15% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 20% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 25% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 30% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., a targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene modification polypeptide or gene modification system), compared with a baseline LNP containing the same therapeutic agent (e.g., an LNP containing V003).In some embodiments, 35% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 40% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., targeted LNP, which contains the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., LNP containing V003). In some embodiments, 45% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., a targeted LNP, containing the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., an LNP containing V003). In some embodiments, 50% of additional liver cells have modified or altered (e.g., edited) genomic DNA in the subject after administration of the LNP described herein, e.g., a targeted LNP, containing the therapeutic agent (e.g., one or more nucleic acids encoding a gene-modifying polypeptide or a gene-modifying system), compared with a baseline LNP containing the same therapeutic agent (e.g., an LNP containing V003). In some embodiments, the number of liver cells containing modified or altered (e.g., edited) genomic DNA can be determined by DNA sequencing.

[0357] In some embodiments, the LNPs described herein, when administered in vivo to a subject, can deliver a larger amount of payload, e.g., a therapeutic agent or reporter, to T cells or HSCs (e.g., LT-HSCs) compared with a baseline LNP (e.g., V003). In some embodiments, the targeted LNPs described herein, when administered in vivo to a subject, can deliver a larger amount of payload, e.g., a therapeutic agent or reporter, to T cells or HSCs (e.g., LT-HSCs) compared with a baseline LNP (e.g., an LNP containing V003) containing the same target-directing moiety as the targeted LNP. In some embodiments, the LNPs described herein, e.g., targeted LNPs, when administered in vivo to a subject, can deliver a larger amount of nucleic acid, e.g., nucleic acid encoding a gene-modified polypeptide (e.g., mRNA), or one or more nucleic acids including a gene-modification system, to T cells or HSCs (e.g., LT-HSCs) compared with a baseline LNP (e.g., an LNP containing V003). In some cases, nucleic acid payloads (e.g., therapeutic agents such as nucleic acids encoding gene-modified polypeptides (e.g., mRNA) or one or more nucleic acids encoding gene-modification systems) delivered in vivo to T cells or HSCs (e.g., LT-HSCs) using LNPs described herein (e.g., targeted LNPs) are expressed at higher levels compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 10% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 15% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003).In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 20% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 25% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 30% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 35% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 40% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 45% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit up to 50% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003).In some embodiments, nucleic acid payloads (e.g., mRNA) delivered in vivo to T cells or HSCs using LNPs described herein (e.g., targeted LNPs) exhibit 10%–50%, 20%–40%, 10%–30%, or 30%–50% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, the expression level of the payload can be determined by measuring protein levels, for example, by flow cytometry. In some cases, for example, if the payload contains a gene-modified polypeptide or gene-modification system, the expression level of the payload can be measured by determining the level of modification or alteration of the genomic DNA of the T cells or HSCs, for example, by DNA sequencing.

[0358] In some embodiments, the LNPs described herein can deliver a larger payload, e.g., a therapeutic agent or reporter, to liver cells when administered in vivo to a subject compared with a baseline LNP (e.g., V003). In some embodiments, the targeted LNPs described herein can deliver a larger payload, e.g., a therapeutic agent or reporter, to liver cells when administered in vivo to a subject compared with a baseline LNP (e.g., an LNP containing V003) that contains the same target-directing moiety as the targeted LNP. In some embodiments, the LNPs described herein, e.g., targeted LNPs, can deliver a larger amount of nucleic acid, e.g., nucleic acid encoding a gene-modified polypeptide (e.g., mRNA), or one or more nucleic acids including a gene-modification system, to liver cells when administered in vivo to a subject compared with a baseline LNP (e.g., an LNP containing V003). In some cases, nucleic acid payloads (e.g., therapeutic agents such as nucleic acids encoding gene-modifying polypeptides (e.g., mRNA) or one or more nucleic acids encoding gene-modifying systems) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) are expressed at higher levels compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) exhibit 10% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) exhibit 15% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003).In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) exhibit 20% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) exhibit 25% higher expression compared to the same payload delivered using baseline LNPs (e.g., LNPs containing V003). In some cases, nucleic acid payloads (e.g., mRNA) delivered in vivo to liver cells using LNPs described herein (e.g., targeted LNPs) exhibit 30% higher expression compared to the same payload delivered using baseline LN...

Claims

1. Compound of formula (I), 【Chemistry 1】 or a pharmaceutically acceptable salt thereof, in the formula, X is -O- or -CH 2 - and m is 0, 1, 2, or 3, R 1 However, C 1-4 It is alkyl, R 2 However, C 1-4 It is alkyl, n is 1, 2, 3, or 4, R 3 However, C 4-10 It is alkyl, R 4 is C 4-10 alkyl, p is 2, 3, 4, 5, or 6, R 5 However, C 4-10 It is alkyl, R 6 However, C 4-10 A compound of formula (I) that is alkyl, or a pharmaceutically acceptable salt thereof.

2. Compounds having the structure shown in Table 1.

3. Compounds having the following structure, 【Chemistry 2】 or a pharmaceutically acceptable salt thereof.

4. Compounds having the following structure, 【Transformation 3】 or a pharmaceutically acceptable salt thereof.

5. Compounds having the following structure, 【Chemistry 4】 or a pharmaceutically acceptable salt thereof.

6. Compounds having the following structure, 【Transformation 5】 or a pharmaceutically acceptable salt thereof.

7. Compounds having the following structure, 【Transformation 6】 or a pharmaceutically acceptable salt thereof.

8. Lipid nanoparticles (LNPs) comprising the compound described in any one of claims 1 to 7.

9. Lipid nanoparticles according to claim 8, further comprising a target-directing portion.

10. The lipid nanoparticle according to claim 9, wherein the target-directing portion targets hematopoietic stem cells (HSCs).

11. The lipid nanoparticle according to claim 9, wherein the target-directing portion targets immune cells.

12. The lipid nanoparticles according to claim 11, wherein the immune cells are T cells.

13. The lipid nanoparticle according to claim 9, wherein the target-directing portion targets liver cells.

14. Lipid nanoparticles (LNPs) for delivering therapeutic agents to cells in vivo, Ionizable lipids and helper lipids, wherein the ionizable lipids are selected from the lipids in Table 1, and the ionizable lipids and helper lipids are Lipid nanoparticles (LNPs) comprising a therapeutic agent encapsulated within the LNPs.

15. The LNP according to claim 14, wherein the ionizable lipid has the following structure. 【Transformation 7】

16. The LNP according to claim 14, wherein the ionizable lipid has the following structure. 【Transformation 8】

17. The LNP according to claim 14, wherein the ionizable lipid has the following structure. 【Chemistry 9】

18. The LNP according to claim 14, wherein the ionizable lipid has the following structure. 【Chemistry 10】

19. The LNP according to claim 14, wherein the ionizable lipid has the following structure. 【Chemistry 11】

20. The LNP according to any one of claims 14 to 19, wherein the cell is an immune cell.

21. The LNP according to claim 20, wherein the immune cell is a T cell.

22. The LNP according to any one of claims 14 to 19, wherein the cells are hematopoietic stem cells (HSCs).

23. The LNP according to any one of claims 14 to 19, wherein the cells are liver cells.

24. The LNP according to any one of claims 14 to 23, wherein the therapeutic agent comprises at least one nucleic acid molecule.

25. The LNP according to Embodiment 24, wherein the nucleic acid molecule is an mRNA molecule or a DNA molecule.

26. The LNP according to claim 24, wherein the nucleic acid molecule is an mRNA molecule.

27. The LNP according to claim 24, wherein the nucleic acid molecule is an siRNA or miRNA molecule.

28. The LNP according to claim 24, wherein the therapeutic agent comprises two nucleic acid molecules.

29. The LNP according to claim 28, wherein the two nucleic acid molecules are RNA molecules.

30. The LNP according to claim 29, wherein one nucleic acid molecule comprises an mRNA molecule (e.g., mRNA encoding a gene-modified polypeptide), and one nucleic acid molecule comprises an RNA molecule (e.g., gRNA or template RNA).

31. The LNP according to claim 30, wherein one nucleic acid molecule contains an mRNA molecule, and one nucleic acid molecule contains a guide RNA.

32. The LNP according to claim 31, wherein one nucleic acid molecule is an mRNA molecule and one nucleic acid molecule is a DNA molecule.

33. The LNP according to any one of claims 28 to 32, wherein at least one of the nucleic acid molecules encodes at least one component for modifying a genome.

34. The LNP according to claim 33, wherein the at least one component comprises mRNA encoding a CRISPR-related nuclease (Cas) and a guide RNA.

35. The LNP according to claim 34, wherein the Cas is Cas9 (e.g., spCas9) or Cas12 (e.g., Cas12a).

36. The LNP according to any one of claims 28 to 35, wherein the mol% of ionizable lipids in the LNP is in the range of about 35% to about 60%.

37. The LNP according to claim 36, wherein the mol% of ionizable lipids in the LNP is in the range of about 40% to about 50%.

38. The LNP according to claim 37, wherein the mol% of ionizable lipids in the LNP is in the range of about 45% to about 50%.

39. The helper lipids are distearoyl-sn-glycerol-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), 1,2-Dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (e.g., 16-O-monomethylPE), dimethyl-phosphatidylethanolamine (e.g., 16-O-dimethylPE), l8-l-transPE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybeans Phosphatidylcholine, Egg Phosphatidylcholine (EPC), Dioleoyl Phosphatidylserine (DOPS), Sphingomyelin (SM), Dimyristoyl Phosphatidylcholine (DMPC), Dimyristoyl Phosphatidylglycerol (DMPG), Distearoyl Phosphatidylglycerol (DSPG), Diylcoyl Phosphatidylcholine (DEPC), Palmitoyloleoyl Phosphatidylglycerol (POPG), Diyloyl Phosphatidyl Ethanol LNP according to any one of claims 28 to 38, selected from the group consisting of mine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof.

40. The LNP according to claim 39, wherein the helper lipid is DSPC.

41. The LNP according to claim 39, wherein the helper lipid is sphingomyelin.

42. The LNP according to claim 41, wherein the sphingomyelin has a head group selected from phosphocholine, phosphoethanolamine, and ceramide.

43. The LNP according to claim 42, wherein the sphingomyelin is egg sphingomyelin.

44. The LNP according to any one of claims 14 to 43, wherein the mol% of the helper lipid is about 18% to about 32%.

45. The LNP according to claim 44, wherein the mol% of the helper lipid is about 20% to about 25%.

46. The LNP according to claim 44, wherein the mol% of the helper lipid is about 22% to about 28%.

47. A method for treating a disease in a subject and / or delaying its progression, comprising administering to the subject a therapeutically effective amount of LNP according to any one of claims 14 to 44.

48. The method according to claim 47, wherein the disease is selected from any one of the diseases in Tables 18 to 23.

49. A conjugate for targeting and delivering therapeutic agents to cells in vivo, Lipid nanoparticles (LNPs) comprising ionizable lipids and helper lipids, wherein the ionizable lipids are selected from the lipids listed in Table 1, and the lipid nanoparticles (LNPs) A plurality of target-directing portions conjugated to the LNP, wherein the plurality of target-directing portions are configured to target cells, The conjugate comprises a therapeutic agent encapsulated within the LNP.

50. The conjugate according to claim 49, wherein the ionizable lipid has the following structure. 【Chemistry 12】

51. The conjugate according to claim 49, wherein the ionizable lipid has the following structure. 【Chemistry 13】

52. The conjugate according to claim 49, wherein the ionizable lipid has the following structure. 【Chemistry 14】

53. The conjugate according to claim 49, wherein the ionizable lipid has the following structure. 【Chemistry 15】

54. The conjugate according to claim 49, wherein the ionizable lipid has the following structure. 【Chemistry 16】

55. The conjugate according to any one of claims 47 to 52, wherein the plurality of target-directing portions are configured to target receptors on the surface of HSCs.

56. The conjugate according to claim 55, wherein the plurality of target-directing portions are configured to target receptors on the surface of HSCs selected from the group consisting of CD33, CD34, CD38, CD43, CD59, CD105, CD123, CD164, CD338, CD71, CD117, CD50, CD49d, CD46, and CD184.

57. The conjugate according to claim 56, wherein the plurality of target-directing portions are configured to target the CD 117.

58. The conjugate according to claim 56, wherein the plurality of target-directing portions are configured to target the CD71.

59. The conjugate according to claim 56, wherein the plurality of target-directing portions are configured to target the CD 34.

60. The conjugate according to any one of claims 49 to 54, wherein the plurality of target-directing portions are configured to target receptors on the surface of immune cells.

61. The conjugate according to claim 60, wherein the immune cell is a T cell.

62. The conjugate according to any one of claims 49 to 54, wherein the plurality of target-directing portions are configured to target receptors on the surface of liver cells.

63. The conjugate according to any one of claims 49 to 62, wherein the plurality of target-directing portions include an antibody or a fragment thereof.

64. The conjugate according to any one of claims 49 to 62, wherein the plurality of target-directing portions include a Fab fragment.

65. The conjugate according to any one of claims 49 to 62, wherein the plurality of target-directing portions include a single-stranded variable fragment (scFv).

66. The conjugate according to any one of claims 49 to 65, wherein the therapeutic agent comprises at least one nucleic acid molecule.

67. The conjugate according to claim 66, wherein the nucleic acid molecule is an mRNA molecule or a DNA molecule.

68. The conjugate according to claim 66, wherein the nucleic acid molecule is an mRNA molecule.

69. The conjugate according to claim 66, wherein the nucleic acid molecule is a siRNA or miRNA molecule.

70. The conjugate according to claim 66, wherein the therapeutic agent comprises two nucleic acid molecules.

71. The conjugate according to claim 70, wherein the two nucleic acid molecules are RNA molecules.

72. The conjugate according to claim 71, wherein one nucleic acid molecule comprises an mRNA molecule (e.g., mRNA encoding a gene-modified polypeptide), and one nucleic acid molecule comprises an RNA molecule (e.g., guide RNA or template RNA).

73. The conjugate according to claim 71, wherein one nucleic acid molecule contains an mRNA molecule, and one nucleic acid molecule contains a guide RNA.

74. The conjugate according to claim 71, wherein one nucleic acid molecule is an mRNA molecule and one nucleic acid molecule is a DNA molecule.

75. The conjugate according to any one of claims 68 to 74, wherein at least one of the nucleic acid molecules encodes at least one component for modifying a genome, for example, a gene-modifying polypeptide.

76. The conjugate according to claim 75, wherein the at least one component comprises an mRNA encoding a CRISPR-related nuclease (Cas) and a guide RNA.

77. The conjugate according to claim 76, wherein the Cas is Cas9 (e.g., spCas9) or Cas12 (e.g., Cas12a).

78. The conjugate according to claim 76, wherein the guide RNA is a single guide RNA.

79. The conjugate according to any one of claims 49 to 76, wherein the mol% of ionizable lipids in the LNP is in the range of about 35% to about 60%.

80. The conjugate according to claim 79, wherein the mol% of ionizable lipids in the LNP is in the range of about 40% to about 50%.

81. The conjugate according to claim 79, wherein the mol% of ionizable lipids in the LNP is in the range of about 45% to about 50%.

82. The helper lipids are distearoyl-sn-glycerol-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (e.g., 16-O-monomethylPE), dimethyl-phosphatidylethanolamine (e.g., 16-O-dimethylPE), l8-l-transPE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylethanolamine Phatidylcholine, egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), dielicyl phosphatidylcholine (DEPC), palmitoyl oleoyl phosphatidylglycerol (POPG), dielicyl phosphatidylethanolamine ( A conjugate according to any one of claims 49 to 81, selected from the group consisting of DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof.

83. The conjugate according to claim 82, wherein the helper lipid is DSPC.

84. The conjugate according to claim 83, wherein the helper lipid is sphingomyelin.

85. The conjugate according to claim 84, wherein the sphingomyelin has a head group selected from phosphocholine, phosphoethanolamine, and ceramide.

86. The conjugate according to claim 85, wherein the sphingomyelin is egg sphingomyelin.

87. The conjugate according to any one of claims 49 to 86, wherein the mol% of the helper lipid in the conjugate is about 18% to about 32%.

88. The conjugate according to claim 87, wherein the mol% of the helper lipid in the conjugate is about 20% to about 25%.

89. The conjugate according to claim 88, wherein the mol% of the helper lipid in the conjugate is about 21% to about 23%.

90. The conjugate according to claim 88, wherein the mol% of the helper lipid in the conjugate is about 22% to about 28%.

91. The conjugate according to any one of claims 49 to 90, wherein the LNP further comprises one or more PEGylated lipids.

92. The conjugate according to claim 91, wherein the target-directing portion is conjugated to the LNP via the PEG-modified lipid.

93. The conjugate according to claim 91 or claim 92, wherein each of the PEG-modified lipids comprises a lipid component, and the lipid component of the PEG-modified lipid is selected from the group consisting of DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, stearic acid, and any combination thereof.

94. The conjugate according to claim 93, wherein the lipid component of the PEG-converted lipid is DSPE.

95. The conjugate according to any one of claims 91 to 94, wherein the mol% of the PEGylated lipid in the LNP is in the range of about 0.05% to about 2%.

96. A conjugate according to any one of claims 49 to 95, wherein multiple lipid molecules contain one or more cholesterol molecules.

97. The conjugate according to claim 96, wherein the cholesterol molecule is selected from beta-sitoesterol, hydroxycholesterol, stigmamanol, and any combination thereof.

98. The conjugate according to claim 96 or claim 97, wherein the mol% of cholesterol molecules in the LNP is in the range of about 35% to about 55%.

99. The conjugate according to any one of claims 49 to 98, wherein the plurality of target-directing portions include more than 10 target-directing portions.

100. The conjugate according to claim 99, wherein the plurality of target-directing portions include more than 20 target-directing portions.

101. The conjugate according to claim 99, wherein the plurality of target-directing portions include more than 50 target-directing portions.

102. The conjugate according to claim 99, wherein the plurality of target-directing portions include more than 100 target-directing portions.

103. The conjugate according to any one of claims 47 to 102, wherein the conjugate is formed via a click reaction between a first click handle on the target-directing portion and a second click handle on the LNP, thereby generating a click product.

104. The conjugate according to claim 103, wherein the second click handle is covalently bonded to a pegylated lipid on the LNP.

105. The conjugate according to claim 103 or claim 104, wherein the LNP is specifically conjugated to the target-directed portion.

106. The conjugate according to any one of claims 103 to 105, wherein the click reaction is an inverse electron-demanded Diels-Alder reaction between a trans-cyclooctene (TCO) moiety on the first or second click handle and a tetrazine ring on the first or second click handle.

107. The conjugate according to claim 106, wherein the first click handle includes a tetrazine ring and the second click handle includes a TCO portion.

108. The conjugate according to claim 106 or claim 107, wherein the tetrazine ring is unsubstituted.

109. The conjugate according to claim 107 or claim 108, wherein the tetrazine ring is methyltetrazine.

110. The conjugate according to claim 109, wherein the tetrazine ring is 6-methyltetrazine.

111. The conjugate according to claim 110, wherein the tetrazine ring has one of the following structures. 【Chemistry 17】

112. The conjugate according to any one of claims 106 to 111, wherein the first click handle is conjugated to the target-directing portion via saltase-mediated ligation between the saltase recognition motif of the target-directing portion and a plurality of glycine residues conjugated to the first click handle.

113. A method for treating a disease in a subject and / or delaying its progression, comprising administering to the subject a therapeutically effective amount of a conjugate according to any one of claims 49 to 112.

114. The method according to claim 113, wherein the disease is selected from any one of the diseases in Tables 18 to 23.

115. A pharmaceutical composition comprising an LNP according to any one of claims 8 to 46 or a conjugate according to any one of claims 49 to 112.

116. A pharmaceutical composition comprising the LNP described in claim 29 or the conjugate described in claim 71.

117. The pharmaceutical composition according to claim 116, wherein one RNA molecule contains template RNA.

118. The pharmaceutical composition according to claim 117, wherein the template RNA includes the spacers shown in Table 5, Table 6, or Table 11.

119. The pharmaceutical composition according to claim 117, wherein the template RNA comprises a heterogeneous object sequence from Table 7, Table 8, or Table 12.

120. The pharmaceutical composition according to claim 117, wherein the template RNA comprises the PBS sequence shown in Table 13.

121. The pharmaceutical composition according to claim 117, wherein the template RNA comprises heterogeneous object sequences and PBS sequences from Table 7, Table 8, or Table 14.

122. The pharmaceutical composition according to claim 117, wherein the template RNA comprises the sequence shown in Table 9, Table 10, or Table 16.

Images